International Nuclear Information System (INIS)
Hasham, Muneer G.; Tsygankov, Alexander Y.
2004-01-01
Saimiriine herpesvirus-2 (Herpesvirus saimiri) transforms T lymphocytes, including human, to continuous growth in vitro. H. saimiri-induced transformation is becoming an important tool of T-cell biology, including studies of HIV replication. Two proteins of H. saimiri subgroup C, Tip and StpC, are essential for T-cell transformation. In spite of the important role of these proteins, their biological functions and the molecular mechanisms of their action remain insufficiently understood. To further elucidate the effects of Tip on T cells, we transduced T lymphocytes, using an efficient lentiviral gene transfer system, to express Tip in the absence of other H. saimiri proteins. Our results indicate that Tip specifically inhibits IL-2 production by human T lymphocytes. Furthermore, Tip promotes T-cell apoptosis, which appears to be the reason for the observed decrease in IL-2 production. Finally, the apoptotic effect of Tip in T cells is mediated by Fas and requires the presence of active Lck in the cell
Directory of Open Access Journals (Sweden)
Jean-Paul Vernot
2015-01-01
Full Text Available The Lck interacting protein Tip of Herpesvirus saimiri is responsible for T-cell transformation both in vitro and in vivo. Here we designed the chimeric peptide hTip-CSKH, comprising the Lck specific interacting motif CSKH of Tip and its hydrophobic transmembrane sequence (hTip, the latter as a vector targeting lipid rafts. We found that hTip-CSKH can induce a fivefold increase in proliferation of human and Aotus sp. T-cells. Costimulation with PMA did not enhance this proliferation rate, suggesting that hTip-CSKH is sufficient and independent of further PKC stimulation. We also found that human Lck phosphorylation was increased earlier after stimulation when T-cells were incubated previously with hTip-CSKH, supporting a strong signalling and proliferative effect of the chimeric peptide. Additionally, Lck downstream signalling was evident with hTip-CSKH but not with control peptides. Importantly, hTip-CSKH could be identified in heavy lipid rafts membrane fractions, a compartment where important T-cell signalling molecules (LAT, Ras, and Lck are present during T-cell activation. Interestingly, hTip-CSKH was inhibitory to Jurkat cells, in total agreement with the different signalling pathways and activation requirements of this leukemic cell line. These results provide the basis for the development of new compounds capable of modulating therapeutic targets present in lipid rafts.
Vernot, Jean-Paul; Perdomo-Arciniegas, Ana María; Pérez-Quintero, Luis Alberto; Martínez, Diego Fernando
2015-01-01
The Lck interacting protein Tip of Herpesvirus saimiri is responsible for T-cell transformation both in vitro and in vivo. Here we designed the chimeric peptide hTip-CSKH, comprising the Lck specific interacting motif CSKH of Tip and its hydrophobic transmembrane sequence (hTip), the latter as a vector targeting lipid rafts. We found that hTip-CSKH can induce a fivefold increase in proliferation of human and Aotus sp. T-cells. Costimulation with PMA did not enhance this proliferation rate, suggesting that hTip-CSKH is sufficient and independent of further PKC stimulation. We also found that human Lck phosphorylation was increased earlier after stimulation when T-cells were incubated previously with hTip-CSKH, supporting a strong signalling and proliferative effect of the chimeric peptide. Additionally, Lck downstream signalling was evident with hTip-CSKH but not with control peptides. Importantly, hTip-CSKH could be identified in heavy lipid rafts membrane fractions, a compartment where important T-cell signalling molecules (LAT, Ras, and Lck) are present during T-cell activation. Interestingly, hTip-CSKH was inhibitory to Jurkat cells, in total agreement with the different signalling pathways and activation requirements of this leukemic cell line. These results provide the basis for the development of new compounds capable of modulating therapeutic targets present in lipid rafts.
The genome of herpesvirus saimiri C488 which is capable of transforming human T cells
International Nuclear Information System (INIS)
Ensser, Armin; Thurau, Mathias; Wittmann, Sabine; Fickenscher, Helmut
2003-01-01
Herpesvirus saimiri (HVS), the rhadinovirus prototype, is apathogenic in the persistently infected natural host, the squirrel monkey, but causes acute T cell leukemia in other New World primate species. In contrast to subgroups A and B, only strains of HVS subgroup C such as C488 are capable of transforming primary human T cells to stable antigen-independent growth in culture. Here, we report the complete 155-kb genome sequence of the transformation-competent HVS strain C488. The A+T-rich unique L-DNA of 113,027 bp encodes at least 77 open reading frames and 5 URNAs. In addition to the viral oncogenes stp and tip, only a few genes including the transactivator orf50 and the glycoprotein orf51 are highly divergent. In a series of new primary HVS isolates, the subgroup-specific divergence of the orf50/orf51 alleles was studied. In these new isolates, the orf50/orf51 alleles of the respective subgroup segregate with the stp and/or tip oncogene alleles, which are essential for transformation
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
International Nuclear Information System (INIS)
Hendrickson, A.E.; Wilson, J.R.
1979-01-01
Since the apparent absence of ocular dominance columns (ODC) in some New World primates could be caused by deficiencies of the transsynaptic autoradiographic technique, such as spillage of label in the poorly laminated dorsal lateral geniculate nucleus, the authors have examined this question using a functional autoradiographic tracing technique based on the uptake of [ 14 C]2-deoxyglucose ([ 14 C]dG) by active neurons. When only one eye is stimulated, this innovative method graphically demonstrates a repetitive pattern in Macaca monkey striate cortex which has been interpreted to be the ODC driven by the open eye. They now report on the results of a comparative study of Old World Macaca and New World Saimiri monkeys using [ 14 C]dG autoradiography in which evidence is found for repetitive patterns of [ 14 C]dG in Saimiri for layers above, but not in, layer IV. (Auth.)
Lifescience Database Archive (English)
Full Text Available AAAAACTAGTAATTTAAAAAAAAA AAAAACCAAAAAAAAAAXXXXXXXXXXATGATGTCGAATGTCCANATTTCCATANA...seq. 137 3' end seq. ID SFE484Z 3' end seq. >SFE484Z.Seq ----------ATGATGTCGAATGTCCANATTTCCATANATGTGTTTAAANA...AACTAGTAATTTAAAAAAAAA AAAAACCAAAAAAAAAA----------ATGATGTCGAATGTCCANATTTCCATANATGTG TTTAAANACGTGGNGGNATCTTAAG
Directory of Open Access Journals (Sweden)
Dorothee A Vogt
Full Text Available The nonstructural protein NS5A has emerged as a new drug target in antiviral therapies for Hepatitis C Virus (HCV infection. NS5A is critically involved in viral RNA replication that takes place at newly formed membranes within the endoplasmic reticulum (membranous web and assists viral assembly in the close vicinity of lipid droplets (LDs. To identify host proteins that interact with NS5A, we performed a yeast two-hybrid screen with the N-terminus of NS5A (amino acids 1-31, a well-studied α-helical domain important for the membrane tethering of NS5A. Our studies identified the LD-associated host protein, Tail-Interacting Protein 47 (TIP47 as a novel NS5A interaction partner. Coimmunoprecipitation experiments in Huh7 hepatoma cells confirmed the interaction of TIP47 with full-length NS5A. shRNA-mediated knockdown of TIP47 caused a more than 10-fold decrease in the propagation of full-length infectious HCV in Huh7.5 hepatoma cells. A similar reduction was observed when TIP47 was knocked down in cells harboring an autonomously replicating HCV RNA (subgenomic replicon, indicating that TIP47 is required for efficient HCV RNA replication. A single point mutation (W9A in NS5A that disrupts the interaction with TIP47 but preserves proper subcellular localization severely decreased HCV RNA replication. In biochemical membrane flotation assays, TIP47 cofractionated with HCV NS3, NS5A, NS5B proteins, and viral RNA, and together with nonstructural viral proteins was uniquely distributed to lower-density LD-rich membrane fractions in cells actively replicating HCV RNA. Collectively, our data support a model where TIP47--via its interaction with NS5A--serves as a novel cofactor for HCV infection possibly by integrating LD membranes into the membranous web.
de Souza, Hugo Amorim dos Santos; Costa-Correa, Edmar Henrique; Bianco-Junior, Cesare; Andrade, Márcia Cristina Ribeiro; Lima-Junior, Josué da Costa; Pratt-Riccio, Lilian Rose; Daniel-Ribeiro, Cláudio Tadeu; Totino, Paulo Renato Rivas
2017-01-01
Non-human primates (NHP) are suitable models for studying different aspects of the human system, including pathogenesis and protective immunity to many diseases. However, the lack of specific immunological reagents for neo-tropical monkeys, such as Saimiri sciureus, is still a major factor limiting studies in these models. An alternative strategy to circumvent this obstacle has been the selection of immunological reagents directed to humans, which present cross-reactivity with NHP molecules. In this context and considering the key role of inhibitory immunoreceptors—such as the signal regulatory protein α (SIRPα)—in the regulation of immune responses, in the present study, we attempted to evaluate the ability of anti-human SIRPα monoclonal antibodies to recognize SIRPα in antigen-presenting S. sciureus peripheral blood mononuclear cells (PBMC). As shown by flow cytometry analysis, the profile of anti-SIRPα staining as well as the levels of SIRPα-positive cells in PBMC from S. sciureus were similar to those observed in human PBMC. Furthermore, using anti-SIRPα monoclonal antibody, it was possible to detect a decrease of the SIRPα levels on surface of S. sciureus cells after in vitro stimulation with lipopolysaccharides. Finally, using computed-based analysis, we observed a high degree of conservation of SIRPα across six species of primates and the presence of shared epitopes in the extracellular domain between humans and Saimiri genus that could be targeted by antibodies. In conclusion, we have identified a commercially available anti-human monoclonal antibody that is able to detect SIRPα of S. sciureus monkeys and that, therefore, can facilitate the study of the immunomodulatory role of SIRPα when S. sciureus is used as a model. PMID:29312325
Directory of Open Access Journals (Sweden)
Hugo Amorim dos Santos de Souza
2017-12-01
Full Text Available Non-human primates (NHP are suitable models for studying different aspects of the human system, including pathogenesis and protective immunity to many diseases. However, the lack of specific immunological reagents for neo-tropical monkeys, such as Saimiri sciureus, is still a major factor limiting studies in these models. An alternative strategy to circumvent this obstacle has been the selection of immunological reagents directed to humans, which present cross-reactivity with NHP molecules. In this context and considering the key role of inhibitory immunoreceptors—such as the signal regulatory protein α (SIRPα—in the regulation of immune responses, in the present study, we attempted to evaluate the ability of anti-human SIRPα monoclonal antibodies to recognize SIRPα in antigen-presenting S. sciureus peripheral blood mononuclear cells (PBMC. As shown by flow cytometry analysis, the profile of anti-SIRPα staining as well as the levels of SIRPα-positive cells in PBMC from S. sciureus were similar to those observed in human PBMC. Furthermore, using anti-SIRPα monoclonal antibody, it was possible to detect a decrease of the SIRPα levels on surface of S. sciureus cells after in vitro stimulation with lipopolysaccharides. Finally, using computed-based analysis, we observed a high degree of conservation of SIRPα across six species of primates and the presence of shared epitopes in the extracellular domain between humans and Saimiri genus that could be targeted by antibodies. In conclusion, we have identified a commercially available anti-human monoclonal antibody that is able to detect SIRPα of S. sciureus monkeys and that, therefore, can facilitate the study of the immunomodulatory role of SIRPα when S. sciureus is used as a model.
With Protein Foods, Variety Is Key: 10 Tips for Choosing Protein
... Dietary Guidelines Communicator’s Guide 10 Tips: Vary Your Protein Routine You are here Home 10 Tips: Vary ... Protein Routine Print Share 10 Tips: Vary Your Protein Routine Protein foods include both animal (meat, poultry, ...
Lynch Alfaro, Jessica W; Boubli, Jean P; Paim, Fernanda P; Ribas, Camila C; Silva, Maria Nazareth F da; Messias, Mariluce R; Röhe, Fabio; Mercês, Michelle P; Silva Júnior, José S; Silva, Claudia R; Pinho, Gabriela M; Koshkarian, Gohar; Nguyen, Mai T T; Harada, Maria L; Rabelo, Rafael M; Queiroz, Helder L; Alfaro, Michael E; Farias, Izeni P
2015-01-01
The squirrel monkey, Saimiri, is a pan-Amazonian Pleistocene radiation. We use statistical phylogeographic methods to create a mitochondrial DNA-based timetree for 118 squirrel monkey samples across 68 localities spanning all Amazonian centers of endemism, with the aim of better understanding (1) the effects of rivers as barriers to dispersal and distribution; (2) the area of origin for modern Saimiri; (3) whether ancestral Saimiri was a lowland lake-affiliated or an upland forest taxa; and (4) the effects of Pleistocene climate fluctuation on speciation. We also use our topology to help resolve current controversies in Saimiri taxonomy and species relationships. The Rondônia and Inambari centers in the southern Amazon were recovered as the most likely areas of origin for Saimiri. The Amazon River proved a strong barrier to dispersal, and squirrel monkey expansion and diversification was rapid, with all speciation events estimated to occur between 1.4 and 0.6Ma, predating the last three glacial maxima and eliminating climate extremes as the main driver of squirrel monkey speciation. Saimiri expansion was concentrated first in central and western Amazonia, which according to the "Young Amazon" hypothesis was just becoming available as floodplain habitat with the draining of the Amazon Lake. Squirrel monkeys also expanded and diversified east, both north and south of the Amazon, coincident with the formation of new rivers. This evolutionary history is most consistent with a Young Amazon Flooded Forest Taxa model, suggesting Saimiri has always maintained a lowland wetlands niche and was able to greatly expand its range with the transition from a lacustrine to a riverine system in Amazonia. Saimiri vanzolinii was recovered as the sister group to one clade of Saimiri ustus, discordant with the traditional Gothic vs. Roman morphological division of squirrel monkeys. We also found paraphyly within each of the currently recognized species: S. sciureus, S. ustus, and S
Molecular data highlight hybridization in squirrel monkeys (Saimiri, Cebidae
Directory of Open Access Journals (Sweden)
Jeferson Carneiro
Full Text Available Abstract Hybridization has been reported increasingly frequently in recent years, fueling the debate on its role in the evolutionary history of species. Some studies have shown that hybridization is very common in captive New World primates, and hybrid offspring have phenotypes and physiological responses distinct from those of the "pure" parents, due to gene introgression. Here we used the TA15 Alu insertion to investigate hybridization in the genus Saimiri. Our results indicate the hybridization of Saimiri boliviensis peruviensis with S. sciureus macrodon, and S. b. boliviensis with S. ustus. Unexpectedly, some hybrids of both S. boliviensis peruviensis and S. b. boliviensis were homozygous for the absence of the insertion, which indicates that the hybrids were fertile.
Directory of Open Access Journals (Sweden)
T. Fandeur
1986-06-01
Full Text Available The in vitro growth and multiplication of the erythrocytic stages of Plasmodium falciparum within Saimiri sciureus (squirrel monkey red blood cells have been studied. Various parameters, such as the origin of the red blood cells and serum supplement, nature of the buffer, influence of the final pH of the medium, role of proteose peptone and glucose addition, were investigated. The selection of the best culture conditions led to the obtention of a reproducible in vitro growth of two parasite cycles in Saimiri erythrocytes, which is an useful achievement for in vitro studies. Our failure to establish a continuous culture line for longer than 19 days, could be explained by a dramatic increasing of osmotic fragility of the Saimiri red blood cells related to their small size.O crescimento e a multiplicação dos estágios eritrocíticos do Plasmodium falciparum in vitro foi estudado em cultivos com hemácias do Saimiri sciureus (macaco de cheiro. Foram investigados vários parâmetros tais como, origem das hemácias e suplementação de soro, tipo de tampão, influência do pH final do meio, papel da proteose-peptona e da glicose adicionados. A seleção das condições ideais de cultivo permitiram, de maneira reprodutível, a obtenção de crescimento do parasita durante dois ciclos nas hemácias do Saimiri. Nosso fracasso em estabelecer uma linhagem contínua de cultivo por mais de 19 dias poderia ser explicado pelo aumento dramático da fragilidade osmótica das hemácias do Saimiri relacionado com seu pequeno tamanho.
Directory of Open Access Journals (Sweden)
Warren W Wakarchuk
Full Text Available The bacteria in the genus Cellulomonas are known for their ability to degrade plant cell wall biomass. Cellulomonas fimi ATCC 484 and C. flavigena ATCC 482 have been the subject of much research into secreted cellulases and hemicellulases. Recently the genome sequences of both C. fimi ATCC 484 and C. flavigena ATCC 482 were published, and a genome comparison has revealed their full spectrum of possible carbohydrate-active enzymes (CAZymes. Using mass spectrometry, we have compared the proteins secreted by C. fimi and C. flavigena during growth on the soluble cellulose substrate, carboxymethylcellulose (CMC, as well as a soluble xylan fraction. Many known C. fimi CAZymes were detected, which validated our analysis, as were a number of new CAZymes and other proteins that, though identified in the genome, have not previously been observed in the secretome of either organism. Our data also shows that many of these are co-expressed on growth of either CMC or xylan. This analysis provides a new perspective on Cellulomonas enzymes and provides many new CAZyme targets for characterization.
Nedvetsky, Pavel I; Zhao, Xiaocheng; Mathivet, Thomas; Aspalter, Irene M; Stanchi, Fabio; Metzger, Ross J; Mostov, Keith E; Gerhardt, Holger
2016-10-01
cAMP-dependent protein kinase A (PKA) is a ubiquitously expressed serine/threonine kinase that regulates a variety of cellular functions. Here, we demonstrate that endothelial PKA activity is essential for vascular development, specifically regulating the transition from sprouting to stabilization of nascent vessels. Inhibition of endothelial PKA by endothelial cell-specific expression of dominant-negative PKA in mice led to perturbed vascular development, hemorrhage and embryonic lethality at mid-gestation. During perinatal retinal angiogenesis, inhibition of PKA resulted in hypersprouting as a result of increased numbers of tip cells. In zebrafish, cell autonomous PKA inhibition also increased and sustained endothelial cell motility, driving cells to become tip cells. Although these effects of PKA inhibition were highly reminiscent of Notch inhibition effects, our data demonstrate that PKA and Notch independently regulate tip and stalk cell formation and behavior. © 2016. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Chan-Ki Min
2008-11-01
Full Text Available Lipid rafts are membrane microdomains that function as platforms for signal transduction and membrane trafficking. Tyrosine kinase interacting protein (Tip of T lymphotropic Herpesvirus saimiri (HVS is targeted to lipid rafts in T cells and downregulates TCR and CD4 surface expression. Here, we report that the membrane-proximal amphipathic helix preceding Tip's transmembrane (TM domain mediates lipid raft localization and membrane deformation. In turn, this motif directs Tip's lysosomal trafficking and selective TCR downregulation. The amphipathic helix binds to the negatively charged lipids and induces liposome tubulation, the TM domain mediates oligomerization, and cooperation of the membrane-proximal helix with the TM domain is sufficient for localization to lipid rafts and lysosomal compartments, especially the mutivesicular bodies. These findings suggest that the membrane-proximal amphipathic helix and TM domain provide HVS Tip with the unique ability to deform the cellular membranes in lipid rafts and to downregulate TCRs potentially through MVB formation.
Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana
Directory of Open Access Journals (Sweden)
Ming Li
2016-01-01
Full Text Available Background. Water channel proteins, also called aquaporins, are integral membrane proteins from major intrinsic protein (MIP family and involved in several pathways including not only water transport but also cell signaling, reproduction, and photosynthesis. The full cDNA and protein sequences of aquaporin in Chorispora bungeana Fisch. & C.A. Mey (C. bungeana are still unknown. Results. In this study, PCR and rapid amplification of cDNA ends approaches were used to clone the full cDNA of LRB7 (GenBank accession number: EU636988 of C. bungeana. Sequence analysis indicated that it was 1235 bp, which had two introns and encoded a protein of 250 amino acids. Structure analysis revealed that the protein had two conserved NPA motifs, one of which is MIP signature sequence (SGxHxNPAVT, six membrane helix regions, and additional membrane-embedded domains. Phylogenetic analysis suggested that the protein was from TIP2 subgroup. Surprisingly, semiquantitative RT-PCR experiment and western blot analysis showed that LRB7 and TIP2 were only detectable in roots, unlike Arabidopsis and Raphanus. Connecting with our previous studies, LRB7 was supported to associate with chilling-tolerance in C. bungeana. Conclusion. This is the first time to characterize the full sequences of LRB7 gene and water channel protein in C. bungeana. Our findings contribute to understanding the water transports in plants under low temperatures.
DEFF Research Database (Denmark)
Nordentoft, Iver Kristiansen; Jeppesen, Per Bendix; Nielsen, Anders Lade
2007-01-01
In the present study we investigate the expression levels of cytosolic phospholipase A2 alpha (cPLA2alpha) interacting histone acetyl transferase proteins TIP60alpha and TIP60beta in non-diabetic C57BL wild-type mice and obese type 2 diabetic KKAy model mice. The aim was to test our hypothesis...
Mercês, Michelle P; Lynch Alfaro, Jessica W; Ferreira, Wallax A S; Harada, Maria L; Silva Júnior, José S
2015-01-01
Saimiri has a complicated taxonomic history, and there is continuing disagreement about the number of valid taxa. Despite these controversies, one point of consensus among morphologists has been that the eastern Amazonian populations of squirrel monkeys form a single terminal taxon, Saimiri sciureus sciureus (Linnaeus, 1758). This group is distributed to both the north and south of the middle to lower Amazon River and in the Marajó Archipelago. However, a recent molecular study by Lavergne and colleagues suggested that the Saimiri sciureus complex (comprised of S. s. sciureus sensu lato, S. s. albigena, S. s. macrodon, and S. s. cassiquiarensis) was paraphyletic. The discordance between morphological and molecular studies prompted us to conduct a new multidisciplinary analysis, employing a combination of morphological, morphometric, and molecular markers. Our results suggest the currently recognized taxon S. s. sciureus contains two distinct species, recognized by the Phylogenetic Species Concept: Saimiri sciureus (Linnaeus, 1758) and Saimiri collinsi Osgood, 1916. East Amazonian squirrel monkeys north of the Amazon have a gray crown (S. sciureus), and south of the Amazon, the crown is yellow (S. collinsi). Morphometric measurements also clearly distinguish between the two species, with the most important contributing factors including width across upper canines for both sexes. For males, the mean zygomatic breadth was significantly wider in S. sciureus compared to S. collinsi, and for females, the width across the upper molars was wider in S. sciureus compared to S. collinsi. Mitochondrial phylogenetic analyses support this separation of the eastern Amazonian squirrel monkeys into two distinct taxa, recovering one clade (S. sciureus) distributed to the north of the Amazon River, from the Negro River and Branco River to the Guiana coast and the Brazilian state of Amapá, and another clade (S. collinsi) south of the Amazon River, from the region of the Tapaj
Replicación de los cromosomas sexuales de Saimiri sciureus
María Paulina Cabarcas M.; Marta Lucía Bueno
2004-01-01
El comportamiento de replicación tardía de los cromosomas sexuales de 19 individuos de la especie Saimiri sciureus fue estudiado utilizando cultivos de linfocitos sometidos a un pulso terminal de BrdU. Las metafases obtenidas fueron procesadas con el método de FPG para
diferenciar las regiones tempranas y bromosustituídas en los cromosomas. No se encontró variación en los autosomas controles, en el cromosoma X isocíclico ni en el cromosoma Y, estos cromosomas mostraron un comportam...
Directory of Open Access Journals (Sweden)
Luane L. Pinheiro
2012-12-01
Full Text Available The aim of this work is to study the morphological characteristics of the trachea of Saimiri sciureus through quantification and measurement of the cartilaginous rings, providing information to facilitate the election of more appropriate endotracheal tube, laryngeal mask or tracheostomy tube for anesthetic and emergency procedures, as it is a species of Neotropical primates most commonly used as biological models, and little is known about their morphology. Nine animals were investigated, being 4 adults and 5 young acquired from the Centro Nacional de Primatas (National Primate Center - CENP - Ananindeua - PA, which died from natural causes and then fixed in aqueous buffered formalin 10%. Saimiri sciureus trachea comprises an average of 32.8 incomplete rings and an average length of 3.74 cm in young animals, while in adults it demonstrated an average of 30.25 rings and average length of 3.67 cm. The shape of the light and its proportion varied along the trachea. Endotracheal tube with a diameter the 2.0 - 2.5mm, laryngeal mask number 1.0 or tracheostomy tube neonatal Shiley number 3.0, can be placed in animals weighing 600g - 1.2 Kg. Given the great importance of the species studied, which is widely used as a biological model, the detailing on the morphology and morphometry of tracheal animal studies provides new approaches needed in respiratory emergency, as well as, facilitates the development of future anesthetic protocols.Estudou-se as características morfológicas da traqueia do Saimiri sciureus através da quantificação e mensuração dos anéis cartilaginosos, a fim de fornecer informações que facilitem a eleição mais adequada de sonda endotraqueal, máscara laríngea ou cânula de trasqueostomia para procedimentos anestésicos e de emergência, visto que é uma das espécies de primatas neotropicais mais comumente utilizadas como modelos biológicos e pouco se sabe sobre sua morfologia. Foram utilizados nove animais, sendo quatro
DEFF Research Database (Denmark)
Rosenkilde, Mette M; McLean, Katherine A; Holst, Peter J
2004-01-01
Open reading frame 74 (ORF74) of many gamma(2)-herpesviruses encodes a CXC chemokine receptor. The molecular pharmacological profile of ORF74 from herpesvirus saimiri, ECRF3, is characterized here and compared with that of the well known ORF74 from human herpesvirus 8 (HHV8). The ECRF3 receptor...... ligand selectivity of ECRF3 among ORF74 receptors could reflect differences in the cellular tropism of the gamma(2)-herpesviruses....
Calcium-regulated in vivo protein phosphorylation in Zea mays L. root tips
Raghothama, K. G.; Reddy, A. S.; Friedmann, M.; Poovaiah, B. W.
1987-01-01
Calcium dependent protein phosphorylation was studied in corn (Zea mays L.) root tips. Prior to in vivo protein phosphorylation experiments, the effect of calcium, ethyleneglycol-bis-(beta-aminoethyl ether)-N-N' -tetraacetic acid (EGTA) and calcium ionophore (A-23187) on phosphorus uptake was studied. Calcium increased phosphorus uptake, whereas EGTA and A-23187 decreased it. Consequently, phosphorus concentration in the media was adjusted so as to attain similar uptake in different treatments. Phosphoproteins were analyzed by two-dimensional gel electrophoresis. Distinct changes in phosphorylation were observed following altered calcium levels. Calcium depletion in root tips with EGTA and A-23187 decreased protein phosphorylation. However, replenishment of calcium following EGTA and ionophore pretreatment enhanced phosphorylation of proteins. Preloading of the root tips with 32P in the presence of EGTA and A-23187 followed by a ten minute calcium treatment, resulted in increased phosphorylation indicating the involvement of calcium, calcium and calmodulin-dependent kinases. Calmodulin antagonist W-7 was effective in inhibiting calcium-promoted phosphorylation. These studies suggest a physiological role for calcium-dependent phosphorylation in calcium-mediated processes in plants.
42 CFR 441.484 - Financial management services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Financial management services. 441.484 Section 441... Optional Self-Directed Personal Assistance Services Program § 441.484 Financial management services. (a) States may choose to provide financial management services to participants, or their representatives, as...
Directory of Open Access Journals (Sweden)
Saemee Song
Full Text Available To survive in the presence of a wide range of toxic compounds, gram-negative bacteria expel such compounds via tripartite efflux pumps that span both the inner and outer membranes. The Salmonella-specific MdsAB pump consists of MdsB, a resistance-nodulation-division (RND-type inner membrane transporter (IMT that requires the membrane fusion protein (MFP MdsA, and an outer membrane protein (OMP; MdsC or TolC to form a tripartite efflux complex. In this study, we investigated the role of the putative tip regions of MdsA and its OMPs, MdsC and TolC, in the formation of a functional MdsAB-mediated efflux pump. Comparative analysis indicated that although sequence homologies of MdsA and MdsC with other MFPs and OMPs, respectively, are extremely low, key residues in the putative tip regions of these proteins are well conserved. Mutagenesis studies on these conserved sites demonstrated their importance for the physical and functional interactions required to form an MdsAB-mediated pump. Our studies suggest that, despite differences in the primary amino acid sequences and functions of various OMPs and MFPs, interactions mediated by the conserved tip regions of OMP and MFP are required for the formation of functional tripartite efflux pumps in gram-negative bacteria.
Delpeut, Sébastien; Sawatsky, Bevan; Wong, Xiao-Xiang; Frenzke, Marie; Cattaneo, Roberto; von Messling, Veronika
2017-06-01
In addition to humans, only certain nonhuman primates are naturally susceptible to measles virus (MeV) infection. Disease severity is species dependent, ranging from mild to moderate for macaques to severe and even lethal for certain New World monkey species. To investigate if squirrel monkeys ( Saimiri sciureus ), which are reported to develop a course of disease similar to humans, may be better suited than macaques for the identification of virulence determinants or the evaluation of therapeutics, we infected them with a green fluorescent protein-expressing MeV. Compared to cynomolgus macaques ( Macaca fascicularis ) infected with the same virus, the squirrel monkeys developed more-severe immunosuppression, higher viral load, and a broader range of clinical signs typical for measles. In contrast, infection with an MeV unable to interact with the epithelial receptor nectin-4, while causing immunosuppression, resulted in only a mild and transient rash and a short-lived elevation of the body temperature. Similar titers of the wild-type and nectin-4-blind MeV were detected in peripheral blood mononuclear cells and lymph node homogenates, but only the wild-type virus was found in tracheal lavage fluids and urine. Thus, our study demonstrates the importance of MeV interactions with nectin-4 for clinical disease in the new and better-performing S. sciureus model of measles pathogenesis. IMPORTANCE The characterization of mechanisms underlying measles virus clinical disease has been hampered by the lack of an animal model that reproduces the course of disease seen in human patients. Here, we report that infection of squirrel monkeys ( Saimiri sciureus ) fulfills these requirements. Comparative infection with wild-type and epithelial cell receptor-blind viruses demonstrated the importance of epithelial cell infection for clinical disease, highlighting the spread to epithelia as an attractive target for therapeutic strategies. Copyright © 2017 American Society for
Nanosecond field emitted and photo-field emitted current pulses from ZrC tips
International Nuclear Information System (INIS)
Ganter, R.; Bakker, R.J.; Gough, C.; Paraliev, M.; Pedrozzi, M.; Le Pimpec, F.; Rivkin, L.; Wrulich, A.
2006-01-01
In order to find electron sources with low thermal emittance, cathodes based on single tip field emitter are investigated. Maximum peak current, measured from single tip in ZrC with a typical apex radius around 1 μm, are presented. Voltage pulses of 2 ns duration and up to 50 kV amplitude lead to field emission current up to 470 mA from one ZrC tip. Combination of high applied electric field with laser illumination gives the possibility to modulate the emission with laser pulses. Nanoseconds current pulses have been emitted with laser pulses at 1064 nm illuminating a ZrC tip under high-DC electric field. The dependence of photo-field emitted current with the applied voltage can be explained by the Schottky effect
Nanosecond field emitted and photo-field emitted current pulses from ZrC tips
Energy Technology Data Exchange (ETDEWEB)
Ganter, R. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland)]. E-mail: romain.ganter@psi.ch; Bakker, R.J. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Gough, C. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Paraliev, M. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Pedrozzi, M. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Le Pimpec, F. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Rivkin, L. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland); Wrulich, A. [Paul Scherrer Institut, Villigen, CH 5232 (Switzerland)
2006-09-15
In order to find electron sources with low thermal emittance, cathodes based on single tip field emitter are investigated. Maximum peak current, measured from single tip in ZrC with a typical apex radius around 1 {mu}m, are presented. Voltage pulses of 2 ns duration and up to 50 kV amplitude lead to field emission current up to 470 mA from one ZrC tip. Combination of high applied electric field with laser illumination gives the possibility to modulate the emission with laser pulses. Nanoseconds current pulses have been emitted with laser pulses at 1064 nm illuminating a ZrC tip under high-DC electric field. The dependence of photo-field emitted current with the applied voltage can be explained by the Schottky effect.
Qin, Rong; Zhang, Huaning; Li, Shaoshan; Jiang, Wusheng; Liu, Donghua
2014-09-01
Results from our previous investigation indicated that Al could affect the nucleolus and induce extrusion of silver-staining nucleolar particles containing argyrophilic proteins from the nucleolus into the cytoplasm in root tip cells of Vicia faba L. So far, the nucleolar proteins involved have not been identified. It is well known that nucleophosmin (B23), nucleolin (C23), and fibrillarin are three major and multifunctional nucleolar proteins. Therefore, effects of Al on B23, C23, and fibrillarin in root tip cells of V. faba exposed to 100 μM Al for 48 h were observed and analyzed using indirect immunofluorescence microscopy and Western blotting. The results from this work demonstrated that after 100 μM of Al treatment for 48 h, B23 and C23 migrated from the nucleolus to the cytoplasm and fibrillarin from the nucleolus to the nucleoplasm. In some cells, fibrillarin was present only in the cytoplasm. Western blotting data revealed higher expression of the three major nucleolar proteins in Al-treated roots compared with the control and that the B23 content increased markedly. These findings confirmed our previous observations.
The TIP30 protein complex, arachidonic acid and coenzyme A are required for vesicle membrane fusion.
Directory of Open Access Journals (Sweden)
Chengliang Zhang
Full Text Available Efficient membrane fusion has been successfully mimicked in vitro using artificial membranes and a number of cellular proteins that are currently known to participate in membrane fusion. However, these proteins are not sufficient to promote efficient fusion between biological membranes, indicating that critical fusogenic factors remain unidentified. We have recently identified a TIP30 protein complex containing TIP30, acyl-CoA synthetase long-chain family member 4 (ACSL4 and Endophilin B1 (Endo B1 that promotes the fusion of endocytic vesicles with Rab5a vesicles, which transport endosomal acidification enzymes vacuolar (H⁺-ATPases (V-ATPases to the early endosomes in vivo. Here, we demonstrate that the TIP30 protein complex facilitates the fusion of endocytic vesicles with Rab5a vesicles in vitro. Fusion of the two vesicles also depends on arachidonic acid, coenzyme A and the synthesis of arachidonyl-CoA by ACSL4. Moreover, the TIP30 complex is able to transfer arachidonyl groups onto phosphatidic acid (PA, producing a new lipid species that is capable of inducing close contact between membranes. Together, our data suggest that the TIP30 complex facilitates biological membrane fusion through modification of PA on membranes.
2010-10-01
... AND CERTIFICATION HOME HEALTH SERVICES Prospective Payment System for Home Health Agencies § 484.202... resource intensity among different groups in the clinical model. Discipline means one of the six home...
Directory of Open Access Journals (Sweden)
Hiromi eSato
2011-07-01
Full Text Available Pseudomonas aeruginosa possesses a type III secretion system (T3SS to intoxicate host cells and evade innate immunity. This virulence-related machinery consists of a molecular syringe and needle assembled on the bacterial surface, which allows delivery of T3 effector proteins into infected cells. To accomplish a one-step effector translocation, a tip protein is required at the top end of the T3 needle structure. Strains lacking expression of the functional tip protein fail to intoxicate host cells.P. aeruginosa encodes a T3S that is highly homologous to the proteins encoded by Yersinia species. The needle tip proteins of Yersinia, LcrV, and P. aeruginosa, PcrV, share 37% identity and 65% similarity. Other known tip proteins are AcrV (Aeromonas, IpaD (Shigella, SipD (Salmonella, BipD (Burkholderia, EspA (EPEC, EHEC, Bsp22 (Bordetella, with additional proteins identified from various Gram negative species, such as Vibrio and Bordetella. The tip proteins can serve as a protective antigen or may be critical for sensing host cells and evading innate immune responses. Recognition of the host microenvironment transcriptionally activates synthesis of T3SS components. The machinery appears to be mechanically controlled by the assemblage of specific junctions within the apparatus. These junctions include the tip and base of the T3 apparatus, the needle proteins and components within the bacterial cytoplasm. The tip proteins likely have chaperone functions for translocon proteins, allowing the proper assembly of translocation channels in the host membrane and completing vectorial delivery of effector proteins into the host cytoplasm. Multifunctional features of the needle-tip proteins appear to be intricately controlled. In this review, we highlight the functional aspects and complex controls of T3 needle-tip proteins with particular emphasis on PcrV and LcrV.
A brain MRI atlas of the common squirrel monkey, Saimiri sciureus
Gao, Yurui; Schilling, Kurt G.; Khare, Shweta P.; Panda, Swetasudha; Choe, Ann S.; Stepniewska, Iwona; Li, Xia; Ding, Zhoahua; Anderson, Adam; Landman, Bennett A.
2014-03-01
The common squirrel monkey, Saimiri sciureus, is a New World monkey with functional and microstructural organization of central nervous system similar to that of humans. It is one of the most commonly used South American primates in biomedical research. Unlike its Old World macaque cousins, no digital atlases have described the organization of the squirrel monkey brain. Here, we present a multi-modal magnetic resonance imaging (MRI) atlas constructed from the brain of an adult female squirrel monkey. In vivo MRI acquisitions include high resolution T2 structural imaging and low resolution diffusion tensor imaging. Ex vivo MRI acquisitions include high resolution T2 structural imaging and high resolution diffusion tensor imaging. Cortical regions were manually annotated on the co-registered volumes based on published histological sections.
Object permanence in orangutans (Pongo pygmaeus) and squirrel monkeys (Saimiri sciureus).
de Blois, S T; Novak, M A; Bond, M
1998-06-01
The authors tested orangutans (Pongo pygmaeus) and squirrel monkeys (Saimiri sciureus) on object permanence tasks. In Experiment 1, orangutans solved all visible displacements and most invisible displacements except those involving movements into 2 boxes successively. In Experiment 2, performance of orangutans on double invisible displacements and control displacements (assessing simple strategies) was compared. Orangutans did not use the simple strategy of selecting the box visited last by the experimenter. Instead, poorer performance on double invisible displacements may have been related to increased memory requirements. In Experiment 3, squirrel monkeys were tested using the procedure of Experiment 1. Squirrel monkeys solved visible but did not comprehend invisible displacements. Results suggest that orangutans but not squirrel monkeys possess Stage 6 object permanence capabilities.
Theoretical modelling of tip effects in the pushing manipulation of C60 on the Si(001) surface
International Nuclear Information System (INIS)
Martsinovich, N; Kantorovich, L
2008-01-01
We present the results of our theoretical studies on the repulsive (pushing) manipulation of a C 60 molecule on the Si(001) surface with several scanning tunnelling microscopy tips. We show that, for silicon tips, tip-C 60 bonds are formed even with tips that do not initially have dangling bonds, and this tip-C 60 interaction drives the manipulation of the molecule. The details of the atomic structure of the tip and its position relative to the molecule do not have a significant effect on the mechanism and the sequence of adsorption configurations during the pushing manipulation of C 60 along the trough, where the trough itself provides a guiding effect. The pushing manipulation is thus a very robust process that occurs largely independently of the tip structure. On the other hand, the pushing manipulation across an Si-Si dimer row into the neighbouring trough proceeds in a more complex way, with tip deformation and detachment more likely to occur. We demonstrate the role of tip deformation and tip-molecule bond rearrangement in the continuous manipulation of the molecule. Finally, we calculate and analyse the forces acting on the tip during manipulation and identify characteristic patterns
42 CFR 484.4 - Personnel qualifications.
2010-10-01
... (CONTINUED) STANDARDS AND CERTIFICATION HOME HEALTH SERVICES General Provisions § 484.4 Personnel... baccalaureate degree in social work, psychology, sociology, or other field related to social work, and has had...
Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann
2015-02-01
A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.
2010-10-01
...-function health agency, such as the home care department of a hospital or the nursing division of a health... AND CERTIFICATION HOME HEALTH SERVICES General Provisions § 484.2 Definitions. As used in this part... governing the agency's operation. Branch office means a location or site from which a home health agency...
Precise Orientation of a Single C60 Molecule on the Tip of a Scanning Probe Microscope
Chiutu, C.; Sweetman, A. M.; Lakin, A. J.; Stannard, A.; Jarvis, S.; Kantorovich, L.; Dunn, J. L.; Moriarty, P.
2012-06-01
We show that the precise orientation of a C60 molecule which terminates the tip of a scanning probe microscope can be determined with atomic precision from submolecular contrast images of the fullerene cage. A comparison of experimental scanning tunneling microscopy data with images simulated using computationally inexpensive Hückel theory provides a robust method of identifying molecular rotation and tilt at the end of the probe microscope tip. Noncontact atomic force microscopy resolves the atoms of the C60 cage closest to the surface for a range of molecular orientations at tip-sample separations where the molecule-substrate interaction potential is weakly attractive. Measurements of the C60C60 pair potential acquired using a fullerene-terminated tip are in excellent agreement with theoretical predictions based on a pairwise summation of the van der Waals interactions between C atoms in each cage, i.e., the Girifalco potential [L. Girifalco, J. Phys. Chem. 95, 5370 (1991)JPCHAX0022-365410.1021/j100167a002].
Dickenson, Nicholas E; Arizmendi, Olivia; Patil, Mrinalini K; Toth, Ronald T; Middaugh, C Russell; Picking, William D; Picking, Wendy L
2013-12-10
The type III secretion system (T3SS) is an essential virulence factor for Shigella flexneri , providing a conduit through which host-altering effectors are injected directly into a host cell to promote uptake. The type III secretion apparatus (T3SA) is composed of a basal body, external needle, and regulatory tip complex. The nascent needle is a polymer of MxiH capped by a pentamer of invasion plasmid antigen D (IpaD). Exposure to bile salts (e.g., deoxycholate) causes a conformational change in IpaD and promotes recruitment of IpaB to the needle tip. It has been proposed that IpaB senses contact with host cell membranes, recruiting IpaC and inducing full secretion of T3SS effectors. Although the steps of T3SA maturation and their external triggers have been identified, details of specific protein interactions and mechanisms have remained difficult to study because of the hydrophobic nature of the IpaB and IpaC translocator proteins. Here, we explored the ability for a series of soluble N-terminal IpaB peptides to interact with IpaD. We found that DOC is required for the interaction and that a region of IpaB between residues 11-27 is required for maximum binding, which was confirmed in vivo. Furthermore, intramolecular FRET measurements indicated that movement of the IpaD distal domain away from the protein core accompanied the binding of IpaB11-226. Together, these new findings provide important new insight into the interactions and potential mechanisms that define the maturation of the Shigella T3SA needle tip complex and provide a foundation for further studies probing T3SS activation.
Structure of the Yersinia pestis tip protein LcrV refined to 1.65 Å resolution
International Nuclear Information System (INIS)
Chaudhury, Sukanya; Battaile, Kevin P.; Lovell, Scott; Plano, Gregory V.; De Guzman, Roberto N.
2013-01-01
Here, the crystal structure of Yersinia pestis tip protein LcrV is reported at a resolution of 1.65 Å. The human pathogen Yersinia pestis requires the assembly of the type III secretion system (T3SS) for virulence. The structural component of the T3SS contains an external needle and a tip complex, which is formed by LcrV in Y. pestis. The structure of an LcrV triple mutant (K40A/D41A/K42A) in a C273S background has previously been reported to 2.2 Å resolution. Here, the crystal structure of LcrV without the triple mutation in a C273S background is reported at a higher resolution of 1.65 Å. Overall the two structures are similar, but there are also notable differences, particularly near the site of the triple mutation. The refined structure revealed a slight shift in the backbone positions of residues Gly28–Asn43 and displayed electron density in the loop region consisting of residues Ile46–Val63, which was disordered in the original structure. In addition, the helical turn region spanning residues Tyr77–Gln95 adopts a different orientation
MTB-3, a microtubule plus-end tracking protein (+TIP of Neurospora crassa.
Directory of Open Access Journals (Sweden)
Rosa R Mouriño-Pérez
Full Text Available The microtubule (MT "plus end" constitutes the platform for the accumulation of a structurally and functionally diverse group of proteins, collectively called "MT plus-end tracking proteins" (+TIPs. +TIPs control MT dynamics and link MTs to diverse sub-cellular structures. Neurospora crassaMicroTubule Binding protein-3 (MTB-3 is the homolog of yeast EB1, a highly conserved +TIP. To address the function of MTB-3, we examined strains with mtb-3 deletions, and we tagged MTB-3 with GFP to assess its dynamic behavior. MTB-3-GFP was present as comet-like structures distributed more or less homogeneously within the hyphal cytoplasm, and moving mainly towards the apex at speeds up to 4× faster than the normal hyphal elongation rates. MTB-3-GFP comets were present in all developmental stages, but were most abundant in mature hyphae. MTB-3-GFP comets were observed moving in anterograde and retrograde direction along the hypha. Retrograde movement was also observed as originating from the apical dome. The integrity of the microtubular cytoskeleton affects the presence and dynamics of MTB-3-GFP comets, while actin does not seem to play a role. The size of MTB-3-GFP comets is affected by the absence of dynactin and conventional kinesin. We detected no obvious morphological phenotypes in Δmtb-3 mutants but there were fewer MTs in Δmtb-3, MTs were less bundled and less organized. Compared to WT, both MT polymerization and depolymerization rates were significantly decreased in Δmtb-3. In summary, the lack of MTB-3 affects overall growth and morphological phenotypes of N. crassa only slightly, but deletion of mtb-3 has strong effect on MT dynamics.
Xu, Yongbin; Song, Saemee; Moeller, Arne; Kim, Nahee; Piao, Shunfu; Sim, Se-Hoon; Kang, Mooseok; Yu, Wookyung; Cho, Hyun-Soo; Chang, Iksoo; Lee, Kangseok; Ha, Nam-Chul
2011-01-01
Macrolide-specific efflux pump MacAB-TolC has been identified in diverse Gram-negative bacteria including Escherichia coli. The inner membrane transporter MacB requires the outer membrane factor TolC and the periplasmic adaptor protein MacA to form a functional tripartite complex. In this study, we used a chimeric protein containing the tip region of the TolC α-barrel to investigate the role of the TolC α-barrel tip region with regard to its interaction with MacA. The chimeric protein formed a stable complex with MacA, and the complex formation was abolished by substitution at the functionally essential residues located at the MacA α-helical tip region. Electron microscopic study delineated that this complex was made by tip-to-tip interaction between the tip regions of the α-barrels of TolC and MacA, which correlated well with the TolC and MacA complex calculated by molecular dynamics. Taken together, our results demonstrate that the MacA hexamer interacts with TolC in a tip-to-tip manner, and implies the manner by which MacA induces opening of the TolC channel. PMID:21325274
Xu, Yongbin; Song, Saemee; Moeller, Arne; Kim, Nahee; Piao, Shunfu; Sim, Se-Hoon; Kang, Mooseok; Yu, Wookyung; Cho, Hyun-Soo; Chang, Iksoo; Lee, Kangseok; Ha, Nam-Chul
2011-04-15
Macrolide-specific efflux pump MacAB-TolC has been identified in diverse gram-negative bacteria including Escherichia coli. The inner membrane transporter MacB requires the outer membrane factor TolC and the periplasmic adaptor protein MacA to form a functional tripartite complex. In this study, we used a chimeric protein containing the tip region of the TolC α-barrel to investigate the role of the TolC α-barrel tip region with regard to its interaction with MacA. The chimeric protein formed a stable complex with MacA, and the complex formation was abolished by substitution at the functionally essential residues located at the MacA α-helical tip region. Electron microscopic study delineated that this complex was made by tip-to-tip interaction between the tip regions of the α-barrels of TolC and MacA, which correlated well with the TolC and MacA complex calculated by molecular dynamics. Taken together, our results demonstrate that the MacA hexamer interacts with TolC in a tip-to-tip manner, and implies the manner by which MacA induces opening of the TolC channel.
Energy Technology Data Exchange (ETDEWEB)
Garman, R H; Weiss, B; Evans, H L
1975-01-01
Histopathologic and autoradiographic studies were performed on monkeys of the genera Saimiri and Macaca after acute and chronic oral exposure to several dosage regimens of methylmercuric chloride (MeHg). Neuropathologic changes were primarily cortical, although subcortical lesions also were observed. Autoradiographic localization of /sup 203/Hg was greatest within glial cells (particularly Nissl-plump astrocytes, subependymal glia and Bergmann's glia) and mast cells. High levels of label within normal appearing large neurons (particularly those within Gasserian and dorsal root ganglia) indicate a lower susceptibility of these neurons to the toxic effects of MeHg. Blood and brain levels of mercury correlated well with the degree of neuropathologic change, but individual variations in susceptibility to intoxication also existed. (auth)
Dickenson, Nicholas E.; Arizmendi, Olivia; Patil, Mrinalini K.; Toth, Ronald T.; Middaugh, C. Russell; Picking, William D.; Picking, Wendy L.
2014-01-01
The type III secretion system (T3SS) is an essential virulence factor for Shigella flexneri, providing a conduit through which host-altering effectors are injected directly into a host cell to promote uptake. The type III secretion apparatus (T3SA) is comprised of a basal body, external needle, and regulatory tip complex. The nascent needle is a polymer of MxiH capped by a pentamer of invasion plasmid antigen D (IpaD). Exposure to bile salts (e.g. deoxycholate) causes a conformational change in IpaD and promotes recruitment of IpaB to the needle tip. It has been proposed that IpaB senses contact with host cell membranes, recruiting IpaC and inducing full secretion of T3SS effectors. While the steps of T3SA maturation and their external triggers have been identified, details of specific protein interactions and mechanisms have remained difficult to study due to the hydrophobic nature of the IpaB and IpaC translocator proteins. Here we explored the ability for a series of soluble N-terminal IpaB peptides to interact with IpaD. We found that DOC is required for the interaction and that a region of IpaB between residues 11–27 is required for maximum binding, which was confirmed in vivo. Furthermore, intramolecular FRET measurements indicated that movement of the IpaD distal domain away from the protein core accompanied the binding of IpaB11-226. Together these new findings provide important new insight into the interactions and potential mechanisms that define the maturation of the Shigella T3SA needle tip complex and provide a foundation for further studies probing T3SS activation. PMID:24236510
MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361.
Directory of Open Access Journals (Sweden)
Kun Wang
2014-07-01
Full Text Available Long noncoding RNAs (lncRNAs are emerging as new players in gene regulation, but whether lncRNAs operate in the processing of miRNA primary transcript is unclear. Also, whether lncRNAs are involved in the regulation of the mitochondrial network remains to be elucidated. Here, we report that a long noncoding RNA, named mitochondrial dynamic related lncRNA (MDRL, affects the processing of miR-484 primary transcript in nucleus and regulates the mitochondrial network by targeting miR-361 and miR-484. The results showed that miR-361 that predominantly located in nucleus can directly bind to primary transcript of miR-484 (pri-miR-484 and prevent its processing by Drosha into pre-miR-484. miR-361 is able to regulate mitochondrial fission and apoptosis by regulating miR-484 levels. In exploring the underlying molecular mechanism by which miR-361 is regulated, we identified MDRL and demonstrated that it could directly bind to miR-361 and downregulate its expression levels, which promotes the processing of pri-miR-484. MDRL inhibits mitochondrial fission and apoptosis by downregulating miR-361, which in turn relieves inhibition of miR-484 processing by miR-361. Our present study reveals a novel regulating model of mitochondrial fission program which is composed of MDRL, miR-361 and miR-484. Our work not only expands the function of the lncRNA pathway in gene regulation but also establishes a new mechanism for controlling miRNA expression.
EXO70C2 is a key regulatory factor for optimal tip growth of pollen
Synek, Lukas
2017-03-30
The exocyst, an eukaryotic tethering complex, co-regulates targeted exocytosis as an effector of small GTPases in polarized cell growth. In land plants, several exocyst subunits are encoded by double or triple paralogs, culminating in tens of EXO70 paralogs. Out of 23 Arabidopsis EXO70 isoforms, we analyzed seven isoforms expressed in pollen. Genetic and microscopic analyses of single mutants in EXO70A2, C1, C2, F1, H3, H5, and H6 genes revealed that only a loss-of-function EXO70C2 allele resulted in a significant male-specific transmission defect (segregation 40%:51%:9%) due to aberrant pollen tube growth. Mutant pollen tubes grown in vitro exhibited enhanced growth rate and a decreased thickness of the tip cell wall, causing tip bursts. However, exo70C2 pollen tubes could frequently recover and restart their speedy elongation, resulting in a repetitive stop-and-go growth dynamics. A pollen-specific depletion of the closest paralog, EXO70C1, using ami-RNA in the exo70C2 mutant background resulted in a complete pollen-specific transmission defect, suggesting redundant functions of EXO70C1 and EXO70C2. Both EXO70C1 and EXO70C2, GFP-tagged and expressed under their native promoters, localized in the cytoplasm of pollen grains, pollen tubes, and also root trichoblast cells. Expression of EXO70C2-GFP complemented aberrant growth of exo70C2 pollen tubes. The absent EXO70C2 interactions with core exocyst subunits in the yeast two-hybrid assay, cytoplasmic localization, and genetic effect suggest an unconventional EXO70 function possibly as a regulator of exocytosis outside the exocyst complex. In conclusion, EXO70C2 is a novel factor contributing to the regulation of optimal tip growth of Arabidopsis pollen tubes.
Pinheiro, Tatyana; Ferrari, Stephen F; Lopes, Maria Aparecida
2013-07-01
Squirrel monkeys (Saimiri spp.) are widely distributed in the Amazon basin. This study describes the ecological and behavioral patterns of two social groups of S. sciureus in forests adjacent to the Tucuruí hydroelectric reservoir in eastern Amazonia, including range size, activity budgets, and composition of the diet. The groups were monitored at Base 4 (group B4) and Germoplasma Island (group GI). Quantitative behavioral data were collected using instantaneous scan sampling to record behavior, substrate use, and height. Home ranges were delimited using a GPS to determine group position after each 50 m of movement. Home ranges were 75.0 ha for group B4 (39 members) and 77.5 ha for group GI (32 members). The use of vertical strata was well defined, with a marked preference for the middle and lower levels of the canopy. The activity budgets of both groups were typical of those of other squirrel monkeys and were dominated by foraging (B4 = 48.7 %; GI = 49.6 %), moving (both groups 28.9 %), and feeding (B4 = 14.6 %; GI = 12.4 %). Resting was rare (B4 = 3.5 %; GI = 2.6 %) and less common than social behavior (B4 = 4.3 %; GI = 6.4 %). The diet of both groups was dominated by plant material (B4 = 70.7 % of feeding records; GI = 71.4 %), which is in contrast with the more insectivorous diets recorded for Saimiri at other sites. Group GI spent more time foraging during the dry season, whereas group B4 spent more time in the rainy season when the consumption of fruit increased (significantly, in the case of group GI). The less insectivorous diet of these groups may be due to a number of factors, including the unique habitat configuration at the site and reduced hydrological stress due to the proximity of the reservoir.
Directory of Open Access Journals (Sweden)
Erika Branco
2010-03-01
Full Text Available The gross anatomy of the genital organs of four specimens of young female of Saimiri sciureus was investigated. The animals were bred in captivity at the Centro Nacional de Primatas and had died from natural causes. The vulva was limited by the labium minus and presented a well-developed clitoris which seemed to represent a rudimentary penis. The vaginal vestibule was the first cavity and was very short, presenting a thick muscular wall which extended from the vulva comissure to the vaginal ostium. The vagina was constituted by an elongated and dorsally flattened muscular tube with a thin wall between the vaginal vestibule and cervix. The cervix was short with well-developed musculature. The uterus was simple, presenting a global fundus located in the caudal portion of the abdominal cavity. The uterine tubes were elongated and rectilinear, connected to the ovaries which were large, ellipsoid in shape, and presented a smooth surface.
Modeling shoot-tip temperature in the greenhouse environment
International Nuclear Information System (INIS)
Faust, J.E.; Heins, R.D.
1998-01-01
An energy-balance model is described that predicts vinca (Catharanthus roseus L.) shoot-tip temperature using four environmental measurements: solar radiation and dry bulb, wet bulb, and glazing material temperature. The time and magnitude of the differences between shoot-tip and air temperature were determined in greenhouses maintained at air temperatures of 15, 20, 25, 30, or 35 °C. At night, shoot-tip temperature was always below air temperature. Shoot-tip temperature decreased from 0.5 to 5 °C below air temperature as greenhouse glass temperature decreased from 2 to 15 °C below air temperature. During the photoperiod under low vapor-pressure deficit (VPD) and low air temperature, shoot-tip temperature increased ≈4 °C as solar radiation increased from 0 to 600 W·m -2 . Under high VPD and high air temperature, shoot-tip temperature initially decreased 1 to 2 °C at sunrise, then increased later in the morning as solar radiation increased. The model predicted shoot-tip temperatures within ±1 °C of 81% of the observed 1-hour average shoot-tip temperatures. The model was used to simulate shoot-tip temperatures under different VPD, solar radiation, and air temperatures. Since the rate of leaf and flower development are influenced by the temperature of the meristematic tissues, a model of shoot-tip temperature will be a valuable tool to predict plant development in greenhouses and to control the greenhouse environment based on a plant temperature setpoint. (author)
Oracle database 12c release 2 in-memory tips and techniques for maximum performance
Banerjee, Joyjeet
2017-01-01
This Oracle Press guide shows, step-by-step, how to optimize database performance and cut transaction processing time using Oracle Database 12c Release 2 In-Memory. Oracle Database 12c Release 2 In-Memory: Tips and Techniques for Maximum Performance features hands-on instructions, best practices, and expert tips from an Oracle enterprise architect. You will learn how to deploy the software, use In-Memory Advisor, build queries, and interoperate with Oracle RAC and Multitenant. A complete chapter of case studies illustrates real-world applications. • Configure Oracle Database 12c and construct In-Memory enabled databases • Edit and control In-Memory options from the graphical interface • Implement In-Memory with Oracle Real Application Clusters • Use the In-Memory Advisor to determine what objects to keep In-Memory • Optimize In-Memory queries using groups, expressions, and aggregations • Maximize performance using Oracle Exadata Database Machine and In-Memory option • Use Swingbench to create d...
Proteomic and metabolomic analyses of soybean root tips under flooding stress.
Komatsu, Setsuko; Nakamura, Takuji; Sugimoto, Yurie; Sakamoto, Kazunori
2014-01-01
Flooding is one of the serious problems for soybean plants because it inhibits growth. Proteomic and metabolomic techniques were used to determine whether proteins and metabolites are altered in the root tips of soybeans under flooding stress. Two-day-old soybean plants were flooded for 2 days, and proteins and metabolites were extracted from root tips. Flooding-responsive proteins were identified using two-dimensional- or SDS-polyacrylamide gel electrophoresis- based proteomics techniques. Using both techniques, 172 proteins increased and 105 proteins decreased in abundance in the root tips of flood-stressed soybean. The abundance of methionine synthase, heat shock cognate protein, urease, and phosphoenol pyruvate carboxylase was significantly increased by flooding stress. Furthermore, 73 flooding-responsive metabolites were identified using capillary electrophoresis-mass spectrometry. The levels of gamma-aminobutyric acid, glycine, NADH2, and phosphoenol pyruvate were increased by flooding stress. Taken together, these results suggest that synthesis of phosphoenol pyruvate by way of oxaloacetate produced in the tricarboxylic acid cycle is activated in soybean root tips in response to flooding stress, and that flooding stress also leads to modulation of the urea cycle in the root tips.
Sugar-starvation-induced changes of carbon metabolism in excised maize root tips
International Nuclear Information System (INIS)
Dieuaide-Noubhani, M.; Canioni, P.; Raymond, P.
1997-01-01
Excised maize (Zea mays L.) root tips were used to study the early metabolic effects of glucose (Glc) starvation. Root tips were prelabeled with [1-13C]Glc so that carbohydrates and metabolic intermediates were close to steady-state labeling, but lipids and proteins were scarcely labeled. They were then incubated in a sugar-deprived medium for carbon starvation. Changes in the level of soluble sugars, the respiratory quotient, and the 13C enrichment of intermediates, as measured by 13C and 1H nuclear magnetic resonance, were studied to detect changes in carbon fluxes through glycolysis and the tricarboxylic acid cycle. Labeling of glutamate carbons revealed two major changes in carbon input into the tricarboxylic acid cycle: (a) the phosphoenolpyruvate carboxylase flux stopped early after the start of Glc starvation, and (b) the contribution of glycolysis as the source of acetyl-coenzyme A for respiration decreased progressively, indicating an increasing contribution of the catabolism of protein amino acids, fatty acids, or both. The enrichment of glutamate carbons gave no evidence for proteolysis in the early steps of starvation, indicating that the catabolism of proteins was delayed compared with that of fatty acids. Labeling of carbohydrates showed that sucrose turnover continues during sugar starvation, but gave no indication for any significant flux through gluconeogenesis
42 CFR 484.230 - Methodology used for the calculation of the low-utilization payment adjustment.
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Methodology used for the calculation of the low... Prospective Payment System for Home Health Agencies § 484.230 Methodology used for the calculation of the low... amount is determined by using cost data set forth in § 484.210(a) and adjusting by the appropriate wage...
Directory of Open Access Journals (Sweden)
Minho Lee
Full Text Available The Hly translocator complex of Escherichia coli catalyzes type I secretion of the toxin hemolysin A (HlyA. In this complex, HlyB is an inner membrane ABC (ATP Binding Cassette-type transporter, TolC is an outer membrane channel protein, and HlyD is a periplasmic adaptor anchored in the inner membrane that bridges HlyB to TolC. This tripartite organization is reminiscent of that of drug efflux systems such as AcrA-AcrB-TolC and MacA-MacB-TolC of E. coli. We have previously shown the crucial role of conserved residues located at the hairpin tip region of AcrA and MacA adaptors during assembly of their cognate systems. In this study, we investigated the role of the putative tip region of HlyD using HlyD mutants with single amino acid substitutions at the conserved positions. In vivo and in vitro data show that all mutations abolished HlyD binding to TolC and resulted in the absence of HlyA secretion. Together, our results suggest that, similarly to AcrA and MacA, HlyD interacts with TolC in a tip-to-tip manner. A general model in which these conserved interactions induce opening of TolC during drug efflux and type I secretion is discussed.
Bradshaw, Nicholas J; Ukkola-Vuoti, Liisa; Pankakoski, Maiju; Zheutlin, Amanda B; Ortega-Alonso, Alfredo; Torniainen-Holm, Minna; Sinha, Vishal; Therman, Sebastian; Paunio, Tiina; Suvisaari, Jaana; Lönnqvist, Jouko; Cannon, Tyrone D; Haukka, Jari; Hennah, William
2017-11-01
Genetic studies of familial schizophrenia in Finland have observed significant associations with a group of biologically related genes, DISC1 , NDE1 , NDEL1 , PDE4B and PDE4D , the 'DISC1 network'. Here, we use gene expression and psychoactive medication use data to study their biological consequences and potential treatment implications. Gene expression levels were determined in 64 individuals from 18 families, while prescription medication information has been collected over a 10-year period for 931 affected individuals. We demonstrate that the NDE1 SNP rs2242549 associates with significant changes in gene expression for 2908 probes (2542 genes), of which 794 probes (719 genes) were replicable. A significant number of the genes altered were predicted targets of microRNA-484 ( p = 3.0 × 10 -8 ), located on a non-coding exon of NDE1 Variants within the NDE1 locus also displayed significant genotype by gender interaction to early cessation of psychoactive medications metabolized by CYP2C19. Furthermore, we demonstrate that miR-484 can affect the expression of CYP2C19 in a cell culture system. Thus, variation at the NDE1 locus may alter risk of mental illness, in part through modification of miR-484, and such modification alters treatment response to specific psychoactive medications, leading to the potential for use of this locus in targeting treatment. © 2017 The Authors.
2010-10-01
... outpatient physical therapy or speech pathology services. 484.38 Section 484.38 Public Health CENTERS FOR... furnish outpatient physical therapy or speech pathology services. An HHA that wishes to furnish outpatient physical therapy or speech pathology services must meet all the pertinent conditions of this part and also...
Tip off the HAT- Epigenetic control of learning and memory by Drosophila Tip60.
Xu, Songjun; Elefant, Felice
2015-01-01
Disruption of epigenetic gene control mechanisms involving histone acetylation in the brain causes cognitive impairment, a debilitating hallmark of most neurodegenerative disorders. Histone acetylation regulates cognitive gene expression via chromatin packaging control in neurons. Unfortunately, the histone acetyltransferases (HATs) that generate such neural epigenetic signatures and their mechanisms of action remain unclear. Our recent findings provide insight into this question by demonstrating that Tip60 HAT action is critical for morphology and function of the mushroom body (MB), the learning and memory center in the Drosophila brain. We show that Tip60 is robustly produced in MB Kenyon cells and extending axonal lobes and that targeted MB Tip60 HAT loss results in axonal outgrowth disruption. Functional consequences of loss and gain of Tip60 HAT levels in the MB are evidenced by defects in memory. Tip60 ChIP-Seq analysis reveals enrichment for genes that function in cognitive processes and accordingly, key genes representing these pathways are misregulated in the Tip60 HAT mutant fly brain. Remarkably, increasing levels of Tip60 in the MB rescues learning and memory deficits resulting from Alzheimer's disease associated amyloid precursor protein (APP) induced neurodegeneration. Our studies highlight the potential of HAT activators as a therapeutic option for cognitive disorders.
TIPsy tour guides: How microtubule plus-end tracking proteins (+TIPs facilitate axon guidance
Directory of Open Access Journals (Sweden)
Elizabeth A Bearce
2015-06-01
Full Text Available The growth cone is a dynamic cytoskeletal vehicle, which drives the end of a developing axon. It serves to interpret and navigate through the complex landscape and guidance cues of the early nervous system. The growth cone’s distinctive cytoskeletal organization offers a fascinating platform to study how extracellular cues can be translated into mechanical outgrowth and turning behaviors. While many studies of cell motility highlight the importance of actin networks in signaling, adhesion, and propulsion, both seminal and emerging works in the field have highlighted a unique and necessary role for microtubules in growth cone navigation. Here, we focus on the role of singular pioneer microtubules, which extend into the growth cone periphery and are regulated by a diverse family of microtubule plus-end tracking proteins (+TIPs. These +TIPs accumulate at the dynamic ends of microtubules, where they are well-positioned to encounter and respond to key signaling events downstream of guidance receptors, catalyzing immediate changes in microtubule stability and actin cross-talk, that facilitate both axonal outgrowth and turning events.
Regulation of Histone Acetyltransferase TIP60 Function by Histone Deacetylase 3
Yi, Jingjie; Huang, Xiangyang; Yang, Yuxia; Zhu, Wei-Guo; Gu, Wei; Luo, Jianyuan
2014-01-01
The key member of the MOZ (monocyticleukaemia zinc finger protein), Ybf2/Sas3, Sas2, and TIP60 acetyltransferases family, Tat-interactive protein, 60 kD (TIP60), tightly modulates a wide array of cellular processes, including chromatin remodeling, gene transcription, apoptosis, DNA repair, and cell cycle arrest. The function of TIP60 can be regulated by SIRT1 through deacetylation. Here we found that TIP60 can also be functionally regulated by HDAC3. We identified six lysine residues as its autoacetylation sites. Mutagenesis of these lysines to arginines completely abolishes the autoacetylation of TIP60. Overexpression of HDAC3 increases TIP60 ubiquitination levels. However, unlike SIRT1, HDAC3 increased the half-life of TIP60. Further study found that HDAC3 colocalized with TIP60 both in the nucleus and the cytoplasm, which could be the reason why HDAC3 can stabilize TIP60. The deacetylation of TIP60 by both SIRT1 and HDAC3 reduces apoptosis induced by DNA damage. Knockdown of HDAC3 in cells increased TIP60 acetylation levels and increased apoptosis after DNA damage. Together, our findings provide a better understanding of TIP60 regulation mechanisms, which is a significant basis for further studies of its cellular functions. PMID:25301942
Riccio, Evelyn K P; Pratt-Riccio, Lilian R; Bianco-Júnior, Cesare; Sanchez, Violette; Totino, Paulo R R; Carvalho, Leonardo J M; Daniel-Ribeiro, Cláudio Tadeu
2015-04-18
The neotropical, non-human primates (NHP) of the genus Saimiri and Aotus are recommended by the World Health Organization as experimental models for the study of human malaria because these animals can be infected with the same Plasmodium that cause malaria in humans. However, one limitation is the lack of immunological tools to assess the immune response in these models. The present study focuses on the development and comparative use of molecular and immunological methods to evaluate the cellular immune response in Saimiri sciureus. Blood samples were obtained from nineteen uninfected Saimiri. Peripheral blood mononuclear cells (PBMC) from these animals and splenocytes from one splenectomized animal were cultured for 6, 12, 18, 24, 48, 72 and 96 hrs in the presence of phorbol-12-myristate-13-acetate and ionomycin. The cytokine levels in the supernatant were detected using human and NHP cytometric bead array Th1/Th2 cytokine kits, the Bio-Plex Pro Human Cytokine Th1/Th2 Assay, enzyme-linked immunosorbent assay, enzyme-linked immunospot assays and intracellular cytokine secretion assays. Cytokine gene expression was examined through TaqMan® Gene Expression Real-Time PCR using predesigned human gene-specific primers and probes or primers and probes designed based on published S. sciureus cytokine sequences. The use of five assays based on monoclonal antibodies specific for human cytokines facilitated the detection of IL-2, IL-4 and/or IFN-γ. TaqMan array plates facilitated the detection of 12 of the 28 cytokines assayed. However, only seven cytokines (IL-1A, IL-2, IL-10, IL-12B, IL-17, IFN-β, and TNF) presented relative expression levels of at least 70% of the gene expression observed in human PBMC. The use of primers and probes specific for S. sciureus cytokines facilitated the detection of transcripts that showed relative expression below the threshold of 70%. The most efficient evaluation of cytokine gene expression, in PBMC and splenocytes, was observed
Ghereg, Dumitru; Gornitzka, Heinz; Escudié, Jean; Ladeira, Sonia
2010-11-15
Phosphagermaallene Tip(t-Bu)Ge=C=PMes* (1; Mes* = 2,4,6-tri-tert-butylphenyl, Tip = 2,4,6-triisopropylphenyl) gives, with N-benzylidenemethylamine and pivalonitrile, [2+2] cycloadditions between the Ge=C double bond and the C=N and C≡N unsaturations, leading to the formation of the corresponding four-membered heterocycles 2 and 9. With N-tert-butyl-α-phenylnitrone and benzonitrile oxide, [2+3] cycloadditions occur to form the five-membered ring derivatives 6 and 7. By treatment of 1 with derivatives which possess weak acidic hydrogens in α of the C=N or C≡N multiple bond, two types of reactions were observed: an ene reaction with methyl(benzylideneamino)acetate and a 1,2 addition with acetonitrile to afford azadienyl(germyl)ether (4) and 3-germa-1-phosphapropene (8), respectively. In the case of benzonitrile, phosphagermaallene 1 behaves as a 1,3-dipole, to give, via a cyclic phosphagermacarbene intermediate, the tricyclic derivative 10.
Effect of Mach number on thermoelectric performance of SiC ceramics nose-tip for supersonic vehicles
International Nuclear Information System (INIS)
Han, Xiao-Yi; Wang, Jun
2014-01-01
This paper focus on the effects of Mach number on thermoelectric energy conversion for the limitation of aero-heating and the feasibility of energy harvesting on supersonic vehicles. A model of nose-tip structure constructed with SiC ceramics is developed to numerically study the thermoelectric performance in a supersonic flow field by employing the computational fluid dynamics and the thermal conduction theory. Results are given in the cases of different Mach numbers. Moreover, the thermoelectric performance in each case is predicted with and without Thomson heat, respectively. Due to the increase of Mach number, both the temperature difference and the conductive heat flux between the hot side and the cold side of nose tip are increased. This results in the growth of the thermoelectric power generated and the energy conversion efficiency. With respect to the Thomson effect, over 50% of total power generated converts to Thomson heat, which greatly reduces the thermoelectric power and efficiency. However, whether the Thomson effect is considered or not, with the Mach number increasing from 2.5 to 4.5, the thermoelectric performance can be effectively improved. -- Highlights: • Thermoelectric SiC nose-tip structure for aerodynamic heat harvesting of high-speed vehicles is studied. • Thermoelectric performance is predicted based on numerical methods and experimental thermoelectric parameters. • The effects of Mach number on thermoelectric performance are studied in the present paper. • Results with respect to the Thomson effect are also explored. • Output power and energy efficiency of the thermoelectric nose-tip are increased with the increase of Mach number
International Nuclear Information System (INIS)
Larsen, M.R.
2001-01-01
In the early 90'ies mass spectrometry (MS) was introduced as a tool for identifying proteins in protein sequence databases. Since then it has become an integrated tool in protein characterization and is today routinely used to identify proteins separated by gel electrophoresis. A two-tiered mass spectrometric protein identification strategy has recently been proposed. In the first strategy peptide mass maps obtained from the protein of interest are compared with theoretically derived peptide mass maps from proteins in protein sequence databases. If the protein cannot be identified by this strategy, tandem mass spectrometric sequencing is used to generate enough sequence data to identify the protein in protein sequence databases or expressed sequence tag (EST) databases. However, the above strategies primarily identify a protein relatively to the DNA sequence, in which no information about e.g. post-translational modifications (PTMs) is stored. PTMs are known to modify the function, location, solubility and activity of proteins in the cell, and they are therefore very important for understanding living cells. More than 200 different PTMs are known, of which glycosylation, phosphorylation and proteolytic processing are the most common ones. Mass spectrometric analysis of PTMs on gel-separated proteins requires a higher amount of protein than for identification only. In addition, higher sequence coverage from the peptide mass maps or pre-purification of the modified peptides prior to MS analysis, is necessary for detection of putative modified peptides. In this study a multi-tiered strategy, in which GELoader tip micro-columns packed with increasingly more hydrophobic chromatographic material are used in combination with mass spectrometry, is described. The ultimate aim was to gain increased sequence coverage from peptide mixtures derived from gel-separated proteins, in order to locate modified peptides. Graphite powder is described as an alternative to traditional
Characterization of metal-coated fiber tip for NSOM lithography by tip-to-tip scan
International Nuclear Information System (INIS)
Kubicova, I.; Pudis, D.; Suslik, L.; Skriniarova, J.
2011-01-01
For the optical field characterization, a tip-to-tip scan of two metal-coated fiber tips with circular aperture at the apex was performed. The optical field irradiated from the fiber probe in illumination mode was analyzed by NSOM represented by fiber probe in collection mode. The near-field intensity profile of the source fiber tip in the plane perpendicular to the axis of the tip was taken. Experimental stage requires high resolution 3D motion system controlled by computer (Fig. 1). The source and the detector fiber tip were placed on the moving and static part of the 3D nanoposition system, respectively. As a light source, a modulated 473 nm DPSS laser was used. After the source fiber tip characterization, the NSOM lithography was performed. In the experimental setup from Fig. 1, the detector fiber tip was replaced by a sample fixed in a vacuum holder. As a sample, a 600 nm positive photoresist AZ 5214E was spin-coated on a GaAs substrate. Exposure was carried out by irradiation of the sample at desired positions through the fiber tip aperture. The sample was developed in AZ 400K developer for 30 s and rinsed in DI water. A promising tip-to-tip scanning technique for characterization of metal-coated fiber tips with aperture at the apex was presented. Nearly-circular aperture shapes were documented from NSOM measurements with diameter estimated to be less than 460 nm. By knowing the source-detector distance and the FWHM of the near-field intensity profile, the tip-to-tip scan proves an easy and fast method to analyze the fiber tip aperture properties. The fiber tip resolution was confirmed by preparation of 2D planar structures in thin photoresist layer, where the NSOM lithography uses the metal-coated fiber tip characterized in previous section. (authors)
Yin, Xiaojian; Sakata, Katsumi; Nanjo, Yohei; Komatsu, Setsuko
2014-06-25
Flooding has a severe negative effect on soybean cultivation in the early stages of growth. To obtain a better understanding of the response mechanisms of soybean to flooding stress, initial changes in root tip proteins under flooding were analyzed using two proteomic techniques. Two-day-old soybeans were treated with flooding for 3, 6, 12, and 24h. The weight of soybeans increased during the first 3h of flooding, but root elongation was not observed. Using gel-based and gel-free proteomic techniques, 115 proteins were identified in root tips, of which 9 proteins were commonly detected by both methods. The 71 proteins identified by the gel-free proteomics were analyzed by a hierarchical clustering method based on induction levels during the flooding, and the proteins were divided into 5 clusters. Additional interaction analysis of the proteins revealed that ten proteins belonging to cluster I formed the center of a protein interaction network. mRNA expression analysis of these ten proteins showed that citrate lyase and heat shock protein 70 were down-regulated, whereas calreticulin was up-regulated in initial phase of flooding. These results suggest that flooding stress to soybean induces calcium-related signal transduction, which might play important roles in the early responses to flooding. Flooding has a severe negative effect on soybean cultivation, particularly in the early stages of growth. To better understand the response mechanisms of soybean to the early stages of flooding stress, two proteomic techniques were used. Two-day-old soybeans were treated without or with flooding for 3, 6, 12, and 24h. The fresh weight of soybeans increased during the first 3h of flooding stress, but the growth then slowed and no root elongation was observed. Using gel-based and gel-free proteomic techniques, 115 proteins were identified in root tips, of which 9 proteins were commonly detected by both methods. The 71 proteins identified by the gel-free proteomics were analyzed
International Nuclear Information System (INIS)
Lee, Sang Woo; Cheon, Joo Hong; Zhang, Qiang
2014-01-01
Highlights: • The effect of full coverage (FC) winglets on tip leakage aerodynamics is tested. • A qualitative tip gap flow model for the FC winglet is suggested. • The FC winglet of w/p = 10.55% is considered an optimal one for the plane tip. -- Abstract: The effect of full coverage (FC) winglets on tip leakage aerodynamics over the plane tip in a turbine cascade has been investigated with the variation of winglet width (w) up to w/p = 15.83% for a tip gap-to-span (chord) ratio of h/s = 1.36% (h/c = 2.0%). A qualitative tip gap flow model for the FC winglet is suggested on the bases of the near-tip surface flow visualizations. As w/p increases, the passage vortex tends to be weakened meanwhile the tip leakage vortex becomes stronger and wall-jet-like. With an increment of w/p, the mass-averaged aerodynamic loss all over the measurement plane decreases steeply up to w/p = 10.55% and then becomes almost unchanged. Thus, the FC winglet of w/p = 10.55% is considered an optimal one for the plane tip. With respect to the baseline plane tip without winglet, the maximum mass-averaged loss reduction by installing the FC winglet on the plane tip is still somewhat smaller than that by employing the cavity squealer rim on the plane tip surface
Venom Protein C activators as diagnostic agents for defects of protein C System.
Ramzan, Faiqah; Asmat, Andleeb
2018-06-18
Background Protein C is a vitamin K dependent plasma zymogen. It prevents clotting by inhibiting clotting by inactivating factor V and factor VIII. Protein C activation pathway involves three steps: (i) Activation of protein C; (ii) Inhibition of coagulation through inactivating factor V and VIII by activated protein C and (iii) Inhibition of activated protein C by plasma protease inhibitors specific for this enzyme. Proteinases converts the zymogen Protein C (PC) of vertebrates into activated PC, which has been detected in several snake venoms. Most PC activators have been purified from venom of snake species belonging to the genera of the Agkistrodon complex. Unlike the physiological thrombin-catalyzed PC activation reaction which requires thrombomodulin as a cofactor, most snake venom activators directly convert the zymogen PC into the catalytically active form which can easily be determined by means of coagulation or chromogenic substrate techniques. Conclusion The fast-acting PC activator Protac® from Agkistrodon contortrix (southern copperhead snake) venom has been found to have broad application in diagnostic practice for the determination of disorders in the PC pathway. Recently, screening assays for the PC pathway have been introduced, based on the observation that the PC pathway is probably the most important physiological barrier against thrombosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Foraging density for squirrel monkey Saimiri sciureus in two forests in Puerto Lopez - Colombia
Directory of Open Access Journals (Sweden)
Jorge Astwood R.
2014-06-01
Full Text Available Objective. Forest remnants were analyzed to determine the density of squirrel monkeys (Saimiri sciureus and the degree of alteration of the forest, by selecting areas for the conservation and maintenance of the species in natural environments. Materials and methods. Linear transects were conducted on two wooden fragments, “La Reforma” and “Campo Hermoso” farms (Puerto Lopez, Meta, Colombia, recording sightings of squirrel monkeys and identifying the tree species used by the primates. Results. The fragments studied correspond to trails at the edge of water bodies with low connectivity. Highest density values were observed on the second transect of La Reforma, a possible consequence of an overcrowding phenomenon due to the high degree of isolation of the fragment. The species preferentially used as refuge and food source were: Bellucia grossularioides, Eugenia jambos, Inga alba, Mauritia flexuosa, Pseudolmedia laevis and Rollinia edulis. Conclusions. The phenology of the plant species allows for a dynamic food supply, considering the constant availability of food for the primates. Therefore, despite the evident ecological problem of these forests, it is possible to use active restoration programs to strengthen the existing dynamics and balance the biogeochemical dynamics of the ecosystem, so that socioeconomic human activities are not in conflict with conservation efforts and vice versa.
Measurement of np elastic scattering spin-spin correlation parameters at 484, 634, and 788 MeV
International Nuclear Information System (INIS)
Garnett, R.W.
1989-03-01
The spin-spin correlation parameters C/sub LL/ and C/sub SL/ were measured for np elastic scattering at the incident neutron kinetic energy of 634 MeV. Good agreement was obtained with previously measured data. Additionally, the first measurement of the correlation parameter C/sub SS/ was made at the three energies, 484, 634, and 788 MeV. It was found that the new values, in general, do not agree well with phase shift predictions. A study was carried out to determine which of the isospin-0 partial waves will be affected by this new data. It was found that the 1 P 1 partial wave will be affected significantly at all three measurement energies. At 634 and 788 MeV, the 3 S 1 phase shifts will also change. 29 refs., 21 figs., 16 tabs
2010-10-01
... address changes to the case-mix that are a result of changes in the coding or classification of different...-day episode payment rate for case-mix and area wage levels. 484.220 Section 484.220 Public Health... Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and area wage levels...
Oostra, R. J.; van Galen, M. J.; Bolhuis, P. A.; Bleeker-Wagemakers, E. M.; van den Bogert, C.
1995-01-01
The electron transfer activity of Complex I of the respiratory chain and Complex I-linked ATP synthesis were investigated in leukocytes of four males affected by Leber hereditary optic neuropathy and a mutation in the ND6 gene at nucleotide position 14,484 of mtDNA. The electron transfer activity in
Chen, Zhongying; Noir, Sandra; Kwaaitaal, Mark; Hartmann, H. Andreas; Wu, Ming-Jing; Mudgil, Yashwanti; Sukumar, Poornima; Muday, Gloria; Panstruga, Ralph; Jones, Alan M.
2009-01-01
Directional root expansion is governed by nutrient gradients, positive gravitropism and hydrotropism, negative phototropism and thigmotropism, as well as endogenous oscillations in the growth trajectory (circumnutation). Null mutations in phylogenetically related Arabidopsis thaliana genes MILDEW RESISTANCE LOCUS O 4 (MLO4) and MLO11, encoding heptahelical, plasma membrane–localized proteins predominantly expressed in the root tip, result in aberrant root thigmomorphogenesis. mlo4 and mlo11 mutant plants show anisotropic, chiral root expansion manifesting as tightly curled root patterns upon contact with solid surfaces. The defect in mlo4 and mlo11 mutants is nonadditive and dependent on light and nutrients. Genetic epistasis experiments demonstrate that the mutant phenotype is independently modulated by the Gβ subunit of the heterotrimeric G-protein complex. Analysis of expressed chimeric MLO4/MLO2 proteins revealed that the C-terminal domain of MLO4 is necessary but not sufficient for MLO4 action in root thigmomorphogenesis. The expression of the auxin efflux carrier fusion, PIN1-green fluorescent protein, the pattern of auxin-induced gene expression, and acropetal as well as basipetal auxin transport are altered at the root tip of mlo4 mutant seedlings. Moreover, addition of auxin transport inhibitors or the loss of EIR1/AGR1/PIN2 function abolishes root curling of mlo4, mlo11, and wild-type seedlings. These results demonstrate that the exaggerated root curling phenotypes of the mlo4 and mlo11 mutants depend on auxin gradients and suggest that MLO4 and MLO11 cofunction as modulators of touch-induced root tropism. PMID:19602625
Bernard, Abram R; Jessop, T Carson; Kumar, Prashant; Dickenson, Nicholas E
2017-12-12
Type three secretion systems (T3SS) are specialized nanomachines that support infection by injecting bacterial proteins directly into host cells. The Shigella T3SS has uniquely evolved to sense environmental levels of the bile salt deoxycholate (DOC) and upregulate virulence in response to DOC. In this study, we describe a rare i + 5 hydrogen bonding secondary structure element (π-helix) within the type three secretion system tip protein IpaD that plays a critical role in DOC-enhanced virulence. Specifically, engineered mutations within the π-helix altered the pathogen's response to DOC, with one mutant construct in particular exhibiting an unprecedented reduction in virulence following DOC exposure. Fluorescence polarization binding assays showed that these altered DOC responses are not the result of differences in affinity between IpaD and DOC, but rather differences in the DOC-dependent T3SS tip maturation resulting from binding of IpaD to translocator/effector protein IpaB. Together, these findings begin to uncover the complex mechanism of DOC-enhanced Shigella virulence while identifying an uncommon structural element that may provide a much needed target for non-antibiotic treatment of Shigella infection.
Wang, Xin; Oh, MyeongWon; Sakata, Katsumi; Komatsu, Setsuko
2016-01-01
Growth in the early stage of soybean is markedly inhibited under flooding and drought stresses. To explore the responsive mechanisms of soybean, temporal protein profiles of root tip under flooding and drought stresses were analyzed using gel-free/label-free proteomic technique. Root tip was analyzed because it was the most sensitive organ against flooding, and it was beneficial to root penetration under drought. UDP glucose: glycoprotein glucosyltransferase was decreased and increased in soybean root under flooding and drought, respectively. Temporal protein profiles indicated that fermentation and protein synthesis/degradation were essential in root tip under flooding and drought, respectively. In silico protein-protein interaction analysis revealed that the inductive and suppressive interactions between S-adenosylmethionine synthetase family protein and B-S glucosidase 44 under flooding and drought, respectively, which are related to carbohydrate metabolism. Furthermore, biotin/lipoyl attachment domain containing protein and Class II aminoacyl tRNA/biotin synthetases superfamily protein were repressed in the root tip during time-course stresses. These results suggest that biotin and biotinylation might be involved in energy management to cope with flooding and drought in early stage of soybean-root tip. Copyright © 2015 Elsevier B.V. All rights reserved.
Henkens, C. M. A.; van der Meer, J.; Hillege, J. L.; Bom, V. J. J.; Halie, M. R.; van der Schaaf, W.
We investigated 103 first-degree relatives of 13 unrelated protein C or protein S deficient patients to assess the role of additional thrombotic risk factors and of protein C and protein S levels in the clinical expression of hereditary protein C and protein S deficiency. Fifty-seven relatives were
Tip studies using CFD and comparison with tip loss models
DEFF Research Database (Denmark)
Hansen, Martin Otto Laver; Johansen, J.
2004-01-01
The flow past a rotating LM8.2 blade equipped with two different tips are computed using CFD. The different tip flows are analysed and a comparison with two different tip loss models is made. Keywords: tip flow, aerodynamics, CFD......The flow past a rotating LM8.2 blade equipped with two different tips are computed using CFD. The different tip flows are analysed and a comparison with two different tip loss models is made. Keywords: tip flow, aerodynamics, CFD...
DEFF Research Database (Denmark)
van Beekum, Olivier; Brenkman, Arjan B; Grøntved, Lars
2008-01-01
The transcription factor peroxisome proliferator-activated receptor gamma (PPARgamma) plays a key role in the regulation of lipid and glucose metabolism in adipocytes, by regulating their differentiation, maintenance, and function. The transcriptional activity of PPARgamma is dictated by the set...... in cells, and through use of chimeric proteins, we established that coactivation by Tip60 critically depends on the N-terminal activation function 1 of PPARgamma, a domain involved in isotype-specific gene expression and adipogenesis. Chromatin immunoprecipitation experiments showed that the endogenous Tip...... of proteins with which this nuclear receptor interacts under specific conditions. Here we identify the HIV-1 Tat-interacting protein 60 (Tip60) as a novel positive regulator of PPARgamma transcriptional activity. Using tandem mass spectrometry, we found that PPARgamma and the acetyltransferase Tip60 interact...
Robustness of tungsten single atom tips to thermal treatment and air exposure
Energy Technology Data Exchange (ETDEWEB)
Vesa, Cristian; Urban, Radovan [Department of Physics, University of Alberta, Edmonton, Alberta, Canada T6G 2G7 (Canada); National Institute for Nanotechnology, National Research Council of Canada, Edmonton, Alberta, Canada T6G 2M9 (Canada); Pitters, Jason L., E-mail: jason.pitters@nrc-cnrc.gc.ca [National Institute for Nanotechnology, National Research Council of Canada, Edmonton, Alberta, Canada T6G 2M9 (Canada); Wolkow, Robert A. [Department of Physics, University of Alberta, Edmonton, Alberta, Canada T6G 2G7 (Canada); National Institute for Nanotechnology, National Research Council of Canada, Edmonton, Alberta, Canada T6G 2M9 (Canada)
2014-05-01
Highlights: • W(1 1 1) single atom tips (SATs) were exposed to air. • SATs could be regenerated by field assisted chemical etching after exposure. • Warming procedures to minimize tip contamination were developed. • Degassing temperatures for air exposed tips were established. • Tip faceting occurred when SATs and unetched tips were annealed above 1200 °C. - Abstract: Experiments aimed at assessing the robustness of nitrogen-etched, single-atom tips (SATs) prepared using W(1 1 1) single crystal wire were performed. Our experiments showed that single-atoms tips sustain minimal damage when exposed to atmospheric conditions and can be readily and quickly nitrogen-etched to single-atom tips thereafter. The SATs can be annealed at temperatures up to 1100 °C with minimal shape changes. Moreover, annealing temperatures in excess of 1200 °C resulted in an apex faceting which may prove important in further single-atom tip creation. Procedures for warming of the SATs from operating temperatures of 80 K were also evaluated to determine conditions that limit tip contamination. These results show that SATS could be fabricated in a dedicated vacuum system and subsequently transferred to other instruments where they would undergo a brief conditioning procedure to recover the single-atom apex configuration prior to being subjected to operating conditions.
Relocalization of human chromatin remodeling cofactor TIP48 in mitosis
International Nuclear Information System (INIS)
Sigala, Barbara; Edwards, Mina; Puri, Teena; Tsaneva, Irina R.
2005-01-01
TIP48 is a highly conserved eukaryotic AAA + protein which is an essential cofactor for several complexes involved in chromatin acetylation and remodeling, transcriptional and developmental regulation and nucleolar organization and trafficking. We show that TIP48 abundance in HeLa cells did not change during the cell cycle, nor did its distribution in various biochemical fractions. However, we observed distinct changes in the subcellular localization of TIP48 during M phase using immunofluorescence microscopy. Our studies demonstrate that in interphase cells TIP48 was found mainly in the nucleus and exhibited a distinct localization in the nuclear periphery. As the cells entered mitosis, TIP48 was excluded from the condensing chromosomes but showed association with the mitotic apparatus. During anaphase, some TIP48 was detected in the centrosome colocalizing with tubulin but the strongest staining appeared in the mitotic equator associated with the midzone central spindle. Accumulation of TIP48 in the midzone and the midbody was observed in late telophase and cytokinesis. This redeployment of TIP48 during anaphase and cytokinesis was independent of microtubule assembly. The relocation of endogenous TIP48 to the midzone/midbody under physiological conditions suggests a novel and distinct function for TIP48 in mitosis and possible involvement in the exit of mitosis
Song, Xiaoli; Liu, Xiaoyun; Cai, Lei; Wu, Jianwei; Wang, Jihua
2015-12-01
In order to construct and express human cardiac troponin C-linker-troponin I(P) [ cTnC-linker-TnI(P)] fusion protein, detect its activity and prepare lyophilized protein, we searched the CDs of human cTnC and cTnI from GenBank, synthesized cTnC and cTnI(30-110aa) into cloning vector by a short DNA sequence coding for 15 neutral amino acid residues. pCold I-cTnC-linker-TnI(P) was constructed and transformed into E. coli BL21(DE3). Then, cTnC-linker-TnI(P) fusion protein was induced by isopropyl-β-D-thiogalactopyranoside (IPTG). Soluable expression of cTnC-linker-TnI(P) in prokaryotic system was successfully obtained. The fusion protein was purified by Ni²⁺ Sepharose 6 Fast Flow affinity chromatography with over 95% purity and prepared into lyophilized protein. The activity of purified cTnC-linker-TnI(P) and its lyophilized protein were detected by Wondfo Finecare™ cTnI Test. Lyophilized protein of cTnC-linker-TnI(P) was stable for 10 or more days at 37 °C and 4 or more months at 25 °C and 4 °C. The expression system established in this research is feasible and efficient. Lyophilized protein is stable enough to be provided as biological raw materials for further research.
Preparation of C-terminally modified chemokines by expressed protein ligation.
Baumann, Lars; Steinhagen, Max; Beck-Sickinger, Annette G
2013-01-01
In order to link structural features on a molecular level to the function of chemokines, site-specific modification strategies are strongly required. These can be used to incorporate fluorescent dyes and/or physical probes to allow investigations in a wide range of biological and physical techniques, e.g., nuclear magnetic resonance (NMR) spectroscopy, fluorescence microscopy, fluorescence resonance energy transfer (FRET), or fluorescence correlation spectroscopy (FCS). Only a limited number of functional groups within the 20 canonical amino acids allow ligation strategies that can be helpful to introduce novel functionalities, which in turn expand the scope of chemoselective and orthogonal reactivity of (semi)synthetic chemokines. In the present chapter we mainly focus on the fabulous history of native chemical ligation (NCL) and provide a general protocol for the preparation of C-terminally modified SDF-1α including tips and tricks for practical work. We believe that this protocol can be easily adapted to other chemokines and many proteins in general.
Membrane insertion and assembly of epitope-tagged gp9 at the tip of the M13 phage
Directory of Open Access Journals (Sweden)
Kuhn Andreas
2011-09-01
Full Text Available Abstract Background Filamentous M13 phage extrude from infected Escherichia coli with a tip structure composed of gp7 and gp9. This tip structure is extended by the assembly of the filament composed of the major coat protein gp8. Finally, gp3 and gp6 terminate the phage structure at the proximal end. Up to now, gp3 has been the primary tool for phage display technology. However, gp7, gp8 and gp9 could also be used for phage display and these phage particles should bind to two different or more surfaces when the modified coat proteins are combined. Therefore, we tested here if the amino-terminal end of gp9 can be modified and whether the modified portion is exposed and detectable on the M13 phage particles. Results The amino-terminal region of gp9 was modified by inserting short sequences that encode antigenic epitopes. We show here that the modified gp9 proteins correctly integrate into the membrane using the membrane insertase YidC exposing the modified epitope into the periplasm. The proteins are then efficiently assembled onto the phage particles. Also extensions up to 36 amino acid residues at the amino-terminal end of gp9 did not interfere with membrane integration and phage assembly. The exposure of the antigenic tags on the phage was visualised with immunogold labelling by electron microscopy and verified by dot blotting with antibodies to the tags. Conclusions Our results suggest that gp9 at the phage tip is suitable for the phage display technology. The modified gp9 can be supplied in trans from a plasmid and fully complements M13 phage with an amber mutation in gene 9. The modified phage tip is very well accessible to antibodies.
The functional significance of the autolysis loop in protein C and activated protein C.
Yang, Likui; Manithody, Chandrashekhara; Rezaie, Alireza R
2005-07-01
The autolysis loop of activated protein C (APC) is five residues longer than the autolysis loop of other vitamin K-dependent coagulation proteases. To investigate the role of this loop in the zymogenic and anticoagulant properties of the molecule, a protein C mutant was constructed in which the autolysis loop of the protein was replaced with the corresponding loop of factor X. The protein C mutant was activated by thrombin with approximately 5-fold higher rate in the presence of Ca2+. Both kinetics and direct binding studies revealed that the Ca2+ affinity of the mutant has been impaired approximately 3-fold. The result of a factor Va degradation assay revealed that the anticoagulant function of the mutant has been improved 4-5-fold in the absence but not in the presence of protein S. The improvement was due to a better recognition of both the P1-Arg506 and P1-Arg306 cleavage sites by the mutant protease. However, the plasma half-life of the mutant was markedly shortened due to faster inactivation by plasma serpins. These results suggest that the autolysis loop of protein C is critical for the Ca(2+)-dependence of activation by thrombin. Moreover, a longer autolysis loop in APC is not optimal for interaction with factor Va in the absence of protein S, but it contributes to the lack of serpin reactivity and longer half-life of the protease in plasma.
DNA-binding activity of TNF-α inducing protein from Helicobacter pylori
International Nuclear Information System (INIS)
Kuzuhara, T.; Suganuma, M.; Oka, K.; Fujiki, H.
2007-01-01
Tumor necrosis factor-α (TNF-α) inducing protein (Tipα) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-α and chemokine genes and activation of nuclear factor-κB. Since Tipα enters gastric cancer cells, the Tipα binding molecules in the cells should be investigated. The direct DNA-binding activity of Tipα was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tipα and DNA, revealed that the affinity of Tipα for (dGdC)10 is 2400 times stronger than that of del-Tipα, an inactive Tipα. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tipα. And the DNA-binding activity of Tipα was first demonstrated with a molecule secreted from H. pylori
Gupta, A; Jha, S; Engel, D A; Ornelles, D A; Dutta, A
2013-10-17
Adenoviruses are linear double-stranded DNA viruses that infect human and rodent cell lines, occasionally transform them and cause tumors in animal models. The host cell challenges the virus in multifaceted ways to restrain viral gene expression and DNA replication, and sometimes even eliminates the infected cells by programmed cell death. To combat these challenges, adenoviruses abrogate the cellular DNA damage response pathway. Tip60 is a lysine acetyltransferase that acetylates histones and other proteins to regulate gene expression, DNA damage response, apoptosis and cell cycle regulation. Tip60 is a bona fide tumor suppressor as mice that are haploid for Tip60 are predisposed to tumors. We have discovered that Tip60 is degraded by adenovirus oncoproteins EIB55K and E4orf6 by a proteasome-mediated pathway. Tip60 binds to the immediate early adenovirus promoter and suppresses adenovirus EIA gene expression, which is a master regulator of adenovirus transcription, at least partly through retention of the virally encoded repressor pVII on this promoter. Thus, degradation of Tip60 by the adenoviral early proteins is important for efficient viral early gene transcription and for changes in expression of cellular genes.
Yeast Interacting Proteins Database: YNL258C, YKR022C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available YNL258C DSL1 Peripheral membrane protein required for Golgi-to-ER retrograde traffi...equired for Golgi-to-ER retrograde traffic; component of the ER target site that interacts with coatomer, th...it ORF YNL258C Bait gene name DSL1 Bait description Peripheral membrane protein r
Adipophilin protein expression in muscle - a possible protective role against insulin resistance
Wilde, de J.; Smit, E.; Snepvangers, F.J.M.; Wit, de N.J.W.; Mohren, R.; Hulshof, M.F.M.; Mariman, E.C.M.
2010-01-01
Adipophilin is a 50 kDa protein that belongs to the PAT family (perilipin, adipophilin, TIP47, S3-12 and OXPAT), which comprises proteins involved in the coating of lipid droplets. Little is known about the functional role of adipophilin in muscle. Using the C2C12 cell line as a model, we
Regulation of cardiac C-protein phosphorylation
International Nuclear Information System (INIS)
Titus, F.L.
1985-01-01
Molecular mechanisms of cardiac sympathetic and parasympathetic responses were addressed by studying subcellular changes in protein phosphorylation, cAMP-dependent protein kinase activity and protein phosphatase activity in frog hearts. B-adrenergic agonists increased and muscarinic cholinergic agonists decreased [ 32 P]phosphate incorporation into C-protein, a thick filament component. Regulation of protein phosphatase activity by Iso and methacholine (MCh) was assayed using extracts of drug treated frog hearts and [ 32 P]phospho-C-protein as substrate. Total phosphatase activity decreased 21% in extracts from hearts perfused with 0.1 μM Iso and 17% in hearts exposed to Iso plus 1 μM methacholine. This decrease reflected decreased phosphatase-2A activity. No changes in total phosphatase activity were measurable in broken cells treated with Iso or MCh. The results suggest adrenergic stimulation changes contractile activity in frog hearts by activating cAMP-dependent protein kinase associated with particulate cellular elements and inactivating soluble protein phosphatase-2A. This is the first demonstration of coordinated regulation of these enzymes by B-adrenergic agonists favoring phosphorylation of effector proteins. Coordinated regulation by methacholine in the presence of Iso was not observed
Tip Effect of the Tapping Mode of Atomic Force Microscope in Viscous Fluid Environments.
Shih, Hua-Ju; Shih, Po-Jen
2015-07-28
Atomic force microscope with applicable types of operation in a liquid environment is widely used to scan the contours of biological specimens. The contact mode of operation allows a tip to touch a specimen directly but sometimes it damages the specimen; thus, a tapping mode of operation may replace the contact mode. The tapping mode triggers the cantilever of the microscope approximately at resonance frequencies, and so the tip periodically knocks the specimen. It is well known that the cantilever induces extra liquid pressure that leads to drift in the resonance frequency. Studies have noted that the heights of protein surfaces measured via the tapping mode of an atomic force microscope are ~25% smaller than those measured by other methods. This discrepancy may be attributable to the induced superficial hydrodynamic pressure, which is worth investigating. In this paper, we introduce a semi-analytical method to analyze the pressure distribution of various tip geometries. According to our analysis, the maximum hydrodynamic pressure on the specimen caused by a cone-shaped tip is ~0.5 Pa, which can, for example, pre-deform a cell by several nanometers in compression before the tip taps it. Moreover, the pressure calculated on the surface of the specimen is 20 times larger than the pressure without considering the tip effect; these results have not been motioned in other papers. Dominating factors, such as surface heights of protein surface, mechanical stiffness of protein increasing with loading velocity, and radius of tip affecting the local pressure of specimen, are also addressed in this study.
Control of the Water Transport Activity of Barley HvTIP3;1 Specifically Expressed in Seeds.
Utsugi, Shigeko; Shibasaka, Mineo; Maekawa, Masahiko; Katsuhara, Maki
2015-09-01
Tonoplast intrinsic proteins (TIPs) are involved in the transport and storage of water, and control intracellular osmotic pressure by transporting material related to the water potential of cells. In the present study, we focused on HvTIP3;1 during the periods of seed development and desiccation in barley. HvTIP3;1 was specifically expressed in seeds. An immunochemical analysis showed that HvTIP3;1 strongly accumulated in the aleurone layers and outer layers of barley seeds. The water transport activities of HvTIP3;1 and HvTIP1;2, which also accumulated in seeds, were measured in the heterologous expression system of Xenopus oocytes. When they were expressed individually, HvTIP1;2 transported water, whereas HvTIP3;1 did not. However, HvTIP3;1 exhibited water transport activity when co-expressed with HvTIP1;2 in oocytes, and this activity was higher than when HvTIP1;2 was expressed alone. This is the first report to demonstrate that the water permeability of a TIP aquaporin was activated when co-expressed with another TIP. The split-yellow fluorescent protein (YFP) system in onion cells revealed that HvTIP3;1 interacted with HvTIP1;2 to form a heterotetramer in plants. These results suggest that HvTIP3;1 functions as an active water channel to regulate water movement through tissues during the periods of seed development and desiccation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Single amino acid substitutions on the needle tip protein IpaD increased Shigella virulence.
Meghraoui, Alaeddine; Schiavolin, Lionel; Allaoui, Abdelmounaaïm
2014-07-01
Infection of colonic epithelial cells by Shigella is associated with the type III secretion system, which serves as a molecular syringe to inject effectors into host cells. This system includes an extracellular needle used as a conduit for secreted proteins. Two of these proteins, IpaB and IpaD, dock at the needle tip to control secretion and are also involved in the insertion of a translocation pore into host cell membrane allowing effector delivery. To better understand the function of IpaD, we substituted thirteen residues conserved among homologous proteins in other bacterial species. Generated variants were tested for their ability to surface expose IpaB and IpaD, to control secretion, to insert the translocation pore, and to invade host cells. In addition to a first group of seven ipaD variants that behaved similarly to the wild-type strain, we identified a second group with mutations V314D and I319D that deregulated secretion of all effectors, but remained fully invasive. Moreover, we identified a third group with mutations Y153A, T161D, Q165L and Y276A, that exhibited increased levels of translocators secretion, pore formation, and cell entry. Altogether, our results offer a better understanding of the role of IpaD in the control of Shigella virulence. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Factor VII and protein C are phosphatidic acid-binding proteins.
Tavoosi, Narjes; Smith, Stephanie A; Davis-Harrison, Rebecca L; Morrissey, James H
2013-08-20
Seven proteins in the human blood clotting cascade bind, via their GLA (γ-carboxyglutamate-rich) domains, to membranes containing exposed phosphatidylserine (PS), although with membrane binding affinities that vary by 3 orders of magnitude. Here we employed nanodiscs of defined phospholipid composition to quantify the phospholipid binding specificities of these seven clotting proteins. All bound preferentially to nanobilayers in which PS headgroups contained l-serine versus d-serine. Surprisingly, however, nanobilayers containing phosphatidic acid (PA) bound substantially more of two of these proteins, factor VIIa and activated protein C, than did equivalent bilayers containing PS. Consistent with this finding, liposomes containing PA supported higher proteolytic activity by factor VIIa and activated protein C toward their natural substrates (factors X and Va, respectively) than did PS-containing liposomes. Moreover, treating activated human platelets with phospholipase D enhanced the rates of factor X activation by factor VIIa in the presence of soluble tissue factor. We hypothesize that factor VII and protein C bind preferentially to the monoester phosphate of PA because of its accessibility and higher negative charge compared with the diester phosphates of most other phospholipids. We further found that phosphatidylinositol 4-phosphate, which contains a monoester phosphate attached to its myo-inositol headgroup, also supported enhanced enzymatic activity of factor VIIa and activated protein C. We conclude that factor VII and protein C bind preferentially to monoester phosphates, which may have implications for the function of these proteases in vivo.
Directory of Open Access Journals (Sweden)
Álvarez-Fernández Ana
2010-06-01
deficiency and resupply in root tips of sugar beet plants. Flavin synthesis could be involved in Fe uptake, whereas RFO sugars could be involved in the alleviation of oxidative stress, C trafficking or cell signalling. Our data also confirm the increase in proteins and metabolites related to carbohydrate metabolism and TCA cycle pathways.
Molecular dynamics of surfactant protein C
DEFF Research Database (Denmark)
Ramírez, Eunice; Santana, Alberto; Cruz, Anthony
2006-01-01
Surfactant protein C (SP-C) is a membrane-associated protein essential for normal respiration. It has been found that the alpha-helix form of SP-C can undergo, under certain conditions, a transformation from an alpha-helix to a beta-strand conformation that closely resembles amyloid fibrils, which...... are possible contributors to the pathogenesis of pulmonary alveolar proteinosis. Molecular dynamics simulations using the NAMD2 package were performed for systems containing from one to seven SP-C molecules to study their behavior in water. The results of our simulations show that unfolding of the protein...
Dephosphorylation of chicken cardiac myofibril C-protein by protein phosphatases 1 and 2A
International Nuclear Information System (INIS)
Thysseril, T.J.; Hegazy, M.G.; Schlender, K.K.
1987-01-01
C-Protein, which is a regulatory component of cardiac muscle myofibrils, is phosphorylated in response to β-adrenergic agonists by a cAMP-dependent mechanism and dephosphorylated in response to cholinergic agonists. It is believed that the cAMP-dependent phosphorylation is due to cAMP-dependent protein kinase. The protein phosphatase(s) involved in the dephosphorylation of C-protein has not been determined. In this study, chicken cardiac C-protein was phosphorylated with the cAMP-dependent protein kinase to about 3 mol phosphate/mol C-protein. Incubation of [ 32 P]C-protein with the catalytic subunit of protein phosphatase 1 or 2A rapidly removed 30-40% of 32 [P]. Phosphopeptide maps and phosphoamino acid analysis revealed that the major site(s) dephosphorylated by either phosphatase was a phosphothreonine residue(s) located on the same tryptic peptide and on the same CNBr fragment. Increasing the incubation period or the phosphatase concentration did not result in any further dephosphorylation of C-protein by phosphatase 1, but phosphatase 2A completely dephosphorylated C-protein. Preliminary studies showed that the major protein phosphatase associated with the myofibril was phosphatase 2A. These results indicate the phosphatase 2A may be important in the regulation of the phosphorylation state of C-protein
In situ scanning tunneling microscope tip treatment device for spin polarization imaging
Li, An-Ping [Oak Ridge, TN; Jianxing, Ma [Oak Ridge, TN; Shen, Jian [Knoxville, TN
2008-04-22
A tip treatment device for use in an ultrahigh vacuum in situ scanning tunneling microscope (STM). The device provides spin polarization functionality to new or existing variable temperature STM systems. The tip treatment device readily converts a conventional STM to a spin-polarized tip, and thereby converts a standard STM system into a spin-polarized STM system. The tip treatment device also has functions of tip cleaning and tip flashing a STM tip to high temperature (>2000.degree. C.) in an extremely localized fashion. Tip coating functions can also be carried out, providing the tip sharp end with monolayers of coating materials including magnetic films. The device is also fully compatible with ultrahigh vacuum sample transfer setups.
Transcaval TIPS in patients with failed revision of occluded previous TIPS
Energy Technology Data Exchange (ETDEWEB)
Seong, Chang Kyu; Kim, Yong Joo; Shin, Tae Beom; Park, Hyo Yong; Kim, Tae Hun; Kang, Duk Sik [Kyungpook National University School of Medicine, Daegu (Korea, Republic of)
2001-12-01
To determine the feasibility of transcaval transjugular intrahepatic portosystemic shunt (TIPS) in patients with occluded previous TIPS. Between February 1996 and December 2000 we performed five transcaval TIPS procedures in four patients with recurrent gastric cardiac variceal bleeding. All four had occluded TIPS, which was between the hepatic and portal vein. The interval between initial TIPS placement and revisional procedures with transcaval TIPS varied between three and 31 months; one patient underwent transcaval TIPS twice, with a 31-month interval. After revision of the occluded shunt failed, direct cavoportal puncture at the retrohepatic segment of the IVC was attempted. Transcaval TIPS placement was technically successful in all cases. In three, tractography revealed slight leakage of contrast materials into hepatic subcapsular or subdiaphragmatic pericaval space. There was no evidence of propagation of extravasated contrast materials through the retroperitoneal space or spillage into the peritoneal space. After the tract was dilated by a bare stent, no patient experienced trans-stent bleeding and no serious procedure-related complications occurred. After successful shunt creation, variceal bleeding ceased in all patients. Transcaval TIPS placement is an effective and safe alternative treatment in patients with occluded previous TIPS and no hepatic veins suitable for new TIPS.
DEFF Research Database (Denmark)
Reid, K B M; Bentley, D R; Campbell, R D
1986-01-01
Recent cDNA sequencing data has allowed the prediction of the entire amino acid sequences of complement components factor B and C2, the complement control proteins factor H and C4b-binding protein and a partial sequence for the Cab/C4b receptor CR1. These proteins all contain internal repeating u...
Full Text Available ... en español Blog About OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by ... danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe ...
International Nuclear Information System (INIS)
Bechel Nevada
2004-01-01
This Streamlined Approach for Environmental Restoration plan details the activities necessary to close Corrective Action Unit (CAU) 484: Surface Debris, Waste Sites, and Burn Area (Tonopah Test Range). CAU 484 consists of sites located at the Tonopah Test Range, Nevada, and is currently listed in Appendix III of the Federal Facility Agreement and Consent Order. CAU 484 consists of the following six Corrective Action Sites: (1) CAS RG-52-007-TAML, Davis Gun Penetrator Test; (2) CAS TA-52-001-TANL, NEDS Detonation Area; (3) CAS TA-52-004-TAAL, Metal Particle Dispersion Test; (4) CAS TA-52-005-TAAL, Joint Test Assembly DU Sites; (5) CAS TA-52-006-TAPL, Depleted Uranium Site; and (6) CAS TA-54-001-TANL, Containment Tank and Steel Structure
Thermoelectric voltage at a nanometer-scale heated tip point contact
Fletcher, Patrick C.; Lee, Byeonghee; King, William P.
2012-01-01
We report thermoelectric voltage measurements between the platinum-coated tip of a heated atomic force microscope (AFM) cantilever and a gold-coated substrate. The cantilevers have an integrated heater-thermometer element made from doped single crystal silicon, and a platinum tip. The voltage can be measured at the tip, independent from the cantilever heating. We used the thermocouple junction between the platinum tip and the gold substrate to measure thermoelectric voltage during heating. Experiments used either sample-side or tip-side heating, over the temperature range 25-275 °C. The tip-substrate contact is ˜4 nm in diameter and its average measured Seebeck coefficient is 3.4 μV K-1. The thermoelectric voltage is used to determine tip-substrate interface temperature when the substrate is either glass or quartz. When the non-dimensional cantilever heater temperature is 1, the tip-substrate interface temperature is 0.593 on glass and 0.125 on quartz. Thermal contact resistance between the tip and the substrate heavily influences the tip-substrate interface temperature. Measurements agree well with modeling when the tip-substrate interface contact resistance is 108 K W-1.
A tonoplast intrinsic protein in Gardenia jasminoides
Gao, Lan; Li, Hao-Ming
2017-08-01
Physiological and molecular studies proved that plasma membrane intrinsic proteins (PIPs) and tonoplast intrinsic proteins (TIPs) subfamily of aquaporins play key functions in plant water homeostasis. Five specialized subgroups (TIP1-5) of TIPs have been found in higher plants, in which the TIP1 and TIP2 isoforms are the largest arbitrary groups. TIPs have high water-transport activity than PIPs, some TIPs can transport other small molecule such as urea, ammonia, hydrogen peroxide, and carbon dioxide. In this work, the structure of the putative tonoplast aquaporin from Gardenia jasminoides (GjTIP) was analyzed. Its transcript level has increased during fruit maturation. A phylogenetic analysis indicates that the protein belongs to TIP1 subfamily. A three-dimensional model structure of GjTIP was built based on crystal structure of an ammonia-permeable AtTIP2-1 from Arabidopsis thaliana. The model structure displayed as a homo-tetramer, each monomer has six trans-membrane and two half-membrane-spanning α helices. The data suggests that the GjTIP has tendency to be a mixed function aquaporin, might involve in water, urea and hydrogen peroxide transport, and the gating machanism founded in some AQPs involving pH and phosphorylation response have not been proved in GjTIP.
Dissecting the mechanisms of squirrel monkey (Saimiri boliviensis) social learning.
Hopper, Lm; Holmes, An; Williams, LE; Brosnan, Sf
2013-01-01
Although the social learning abilities of monkeys have been well documented, this research has only focused on a few species. Furthermore, of those that also incorporated dissections of social learning mechanisms, the majority studied either capuchins (Cebus apella) or marmosets (Callithrix jacchus). To gain a broader understanding of how monkeys gain new skills, we tested squirrel monkeys (Saimiri boliviensis) which have never been studied in tests of social learning mechanisms. To determine whether S. boliviensis can socially learn, we ran "open diffusion" tests with monkeys housed in two social groups (N = 23). Over the course of 10 20-min sessions, the monkeys in each group observed a trained group member retrieving a mealworm from a bidirectional task (the "Slide-box"). Two thirds (67%) of these monkeys both learned how to operate the Slide-box and they also moved the door significantly more times in the direction modeled by the trained demonstrator than the alternative direction. To tease apart the underlying social learning mechanisms we ran a series of three control conditions with 35 squirrel monkeys that had no previous experience with the Slide-box. The first replicated the experimental open diffusion sessions but without the inclusion of a trained model, the second was a no-information control with dyads of monkeys, and the third was a 'ghost' display shown to individual monkeys. The first two controls tested for the importance of social support (mere presence effect) and the ghost display showed the affordances of the task to the monkeys. The monkeys showed a certain level of success in the group control (54% of subjects solved the task on one or more occasions) and paired controls (28% were successful) but none were successful in the ghost control. We propose that the squirrel monkeys' learning, observed in the experimental open diffusion tests, can be best described by a combination of social learning mechanisms in concert; in this case, those
Towards easy and reliable AFM tip shape determination using blind tip reconstruction
International Nuclear Information System (INIS)
Flater, Erin E.; Zacharakis-Jutz, George E.; Dumba, Braulio G.; White, Isaac A.; Clifford, Charles A.
2014-01-01
Quantitative determination of the geometry of an atomic force microscope (AFM) probe tip is critical for robust measurements of the nanoscale properties of surfaces, including accurate measurement of sample features and quantification of tribological characteristics. Blind tip reconstruction, which determines tip shape from an AFM image scan without knowledge of tip or sample shape, was established most notably by Villarrubia [J. Res. Natl. Inst. Stand. Tech. 102 (1997)] and has been further developed since that time. Nevertheless, the implementation of blind tip reconstruction for the general user to produce reliable and consistent estimates of tip shape has been hindered due to ambiguity about how to choose the key input parameters, such as tip matrix size and threshold value, which strongly impact the results of the tip reconstruction. These key parameters are investigated here via Villarrubia's blind tip reconstruction algorithms in which we have added the capability for users to systematically vary the key tip reconstruction parameters, evaluate the set of possible tip reconstructions, and determine the optimal tip reconstruction for a given sample. We demonstrate the capabilities of these algorithms through analysis of a set of simulated AFM images and provide practical guidelines for users of the blind tip reconstruction method. We present a reliable method to choose the threshold parameter corresponding to an optimal reconstructed tip shape for a given image. Specifically, we show that the trend in how the reconstructed tip shape varies with threshold number is so regular that the optimal, or Goldilocks, threshold value corresponds with the peak in the derivative of the RMS difference with respect to the zero threshold curve vs. threshold number. - Highlights: • Blind tip reconstruction algorithms have been implemented and augmented to determine the optimal input parameters. • We demonstrate the capabilities of the algorithms using a simulated AFM
Young, Jesse W; Russo, Gabrielle A; Fellmann, Connie D; Thatikunta, Meena A; Chadwell, Brad A
2015-10-01
The need to maintain stability on narrow branches is often presented as a major selective force shaping primate morphology, with adaptations to facilitate grasping receiving particular attention. The functional importance of a long and mobile tail for maintaining arboreal stability has been comparatively understudied. Tails can facilitate arboreal balance by acting as either static counterbalances or dynamic inertial appendages able to modulate whole-body angular momentum. We investigate associations between tail use and inferred grasping ability in two closely related cebid platyrrhines-cotton-top tamarins (Saguinus oedipus) and black-capped squirrel monkeys (Saimiri boliviensis). Using high-speed videography of captive monkeys moving on 3.2 cm diameter poles, we specifically test the hypothesis that squirrel monkeys (characterized by grasping extremities with long digits) will be less dependent on the tail for balance than tamarins (characterized by claw-like nails, short digits, and a reduced hallux). Tamarins have relatively longer tails than squirrel monkeys, move their tails through greater angular amplitudes, at higher angular velocities, and with greater angular accelerations, suggesting dynamic use of tail to regulate whole-body angular momentum. By contrast, squirrel monkeys generally hold their tails in a comparatively stationary posture and at more depressed angles, suggesting a static counterbalancing mechanism. This study, the first empirical test of functional tradeoffs between grasping ability and tail use in arboreal primates, suggests a critical role for the tail in maintaining stability during arboreal quadrupedalism. Our findings have the potential to inform our functional understanding of tail loss during primate evolution. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Zelenina, M.N.; Solenov, E.I.; Ivanova, L.N.
1985-01-01
The activity of cAMP-dependent protein kinases, the binding of cAMP, and the spectrum of cAMP-binding proteins in the cytosol of the renal papilla was studied in intact rats and in rats after 24 h on a water-deprived diet. It was found that the activation of protein kinases by 10 -6 M cAMP is significantly higher in the experimental animals than in the intact animals. In chromatography on DEAE-cellulose, the positions of the peaks of specific reception of cAMP corresponded to the peaks of the regulatory subunits of cAMP-dependent protein kinases of types I and II. In this case, in intact animals more than 80% of the binding activity was detected in peaks II, whereas in rats subjected to water deprivation, more than 60% of the binding was observed in peak I. The general regulatory activity of the cytosol was unchanged in the experimental animals in comparison with intact animals. It is suggested that during dehydration there is an induction of the synthesis of the regulatory subunit of type I cAMP-dependent protein kinase in the renal papilla
Pulver, Rebecca; Heisel, Timothy; Gonia, Sara; Robins, Robert; Norton, Jennifer; Haynes, Paula
2013-01-01
The extremely elongated morphology of fungal hyphae is dependent on the cell's ability to assemble and maintain polarized growth machinery over multiple cell cycles. The different morphologies of the fungus Candida albicans make it an excellent model organism in which to study the spatiotemporal requirements for constitutive polarized growth and the generation of different cell shapes. In C. albicans, deletion of the landmark protein Rsr1 causes defects in morphogenesis that are not predicted from study of the orthologous protein in the related yeast Saccharomyces cerevisiae, thus suggesting that Rsr1 has expanded functions during polarized growth in C. albicans. Here, we show that Rsr1 activity localizes to hyphal tips by the differential localization of the Rsr1 GTPase-activating protein (GAP), Bud2, and guanine nucleotide exchange factor (GEF), Bud5. In addition, we find that Rsr1 is needed to maintain the focused localization of hyphal polarity structures and proteins, including Bem1, a marker of the active GTP-bound form of the Rho GTPase, Cdc42. Further, our results indicate that tip-localized Cdc42 clusters are associated with the cell's ability to express a hyphal transcriptional program and that the ability to generate a focused Cdc42 cluster in early hyphae (germ tubes) is needed to maintain hyphal morphogenesis over time. We propose that in C. albicans, Rsr1 “fine-tunes” the distribution of Cdc42 activity and that self-organizing (Rsr1-independent) mechanisms of polarized growth are not sufficient to generate narrow cell shapes or to provide feedback to the transcriptional program during hyphal morphogenesis. PMID:23223038
Directory of Open Access Journals (Sweden)
William D. Picking
2012-11-01
Full Text Available Förster resonance energy transfer (FRET provides a powerful tool for monitoring intermolecular interactions and a sensitive technique for studying Å-level protein conformational changes. One system that has particularly benefited from the sensitivity and diversity of FRET measurements is the maturation of the Shigella type III secretion apparatus (T3SA needle tip complex. The Shigella T3SA delivers effector proteins into intestinal cells to promote bacterial invasion and spread. The T3SA is comprised of a basal body that spans the bacterial envelope and a needle with an exposed tip complex that matures in response to environmental stimuli. FRET measurements demonstrated bile salt binding by the nascent needle tip protein IpaD and also mapped resulting structural changes which led to the recruitment of the translocator IpaB. At the needle tip IpaB acts as a sensor for host cell contact but prior to secretion, it is stored as a heterodimeric complex with the chaperone IpgC. FRET analyses showed that chaperone binding to IpaB’s N-terminal domain causes a conformational change in the latter. These FRET analyses, with other biophysical methods, have been central to understanding T3SA maturation and will be highlighted, focusing on the details of the FRET measurements and the relevance to this particular system.
Biomimicry of surfactant protein C.
Brown, Nathan J; Johansson, Jan; Barron, Annelise E
2008-10-01
Since the widespread use of exogenous lung surfactant to treat neonatal respiratory distress syndrome, premature infant survival and respiratory morbidity have dramatically improved. Despite the effectiveness of the animal-derived surfactant preparations, there still remain some concerns and difficulties associated with their use. This has prompted investigation into the creation of synthetic surfactant preparations. However, to date, no clinically used synthetic formulation is as effective as the natural material. This is largely because the previous synthetic formulations lacked analogues of the hydrophobic proteins of the lung surfactant system, SP-B and SP-C, which are critical functional constituents. As a result, recent investigation has turned toward the development of a new generation of synthetic, biomimetic surfactants that contain synthetic phospholipids along with a mimic of the hydrophobic protein portion of lung surfactant. In this Account, we detail our efforts in creating accurate mimics of SP-C for use in a synthetic surfactant replacement therapy. Despite SP-C's seemingly simple structure, the predominantly helical protein is extraordinarily challenging to work with given its extreme hydrophobicity and structural instability, which greatly complicates the creation of an effective SP-C analogue. Drawing inspiration from Nature, two promising biomimetic approaches have led to the creation of rationally designed biopolymers that recapitulate many of SP-C's molecular features. The first approach utilizes detailed SP-C structure-activity relationships and amino acid folding propensities to create a peptide-based analogue, SP-C33. In SP-C33, the problematic and metastable polyvaline helix is replaced with a structurally stable polyleucine helix and includes a well-placed positive charge to prevent aggregation. SP-C33 is structurally stable and eliminates the association propensity of the native protein. The second approach follows the same design
Elisen, M. G.; von dem Borne, P. A.; Bouma, B. N.; Meijers, J. C.
1998-01-01
Protein C inhibitor (PCI), which was originally identified as an inhibitor of activated protein C, also efficiently inhibits coagulation factors such as factor Xa and thrombin. Recently it was found, using purified proteins, that the anticoagulant thrombin-thrombomodulin complex was also inhibited
DEFF Research Database (Denmark)
Hansen, Gry Aune Westergaard; Ludvigsen, Maja; Jacobsen, Christian
2015-01-01
Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify...... the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted...
Influence of the tip mass on the tip-sample interactions in TM-AFM
Energy Technology Data Exchange (ETDEWEB)
Pishkenari, Hossein Nejat, E-mail: nejat@mech.sharif.edu [Nano-Robotics Laboratory, Center of Excellence in Design, Robotics and Automation, School of Mechanical Engineering, Sharif University of Technology, Tehran, P.O. Box 11365-9465 (Iran, Islamic Republic of); Meghdari, Ali [Nano-Robotics Laboratory, Center of Excellence in Design, Robotics and Automation, School of Mechanical Engineering, Sharif University of Technology, Tehran, P.O. Box 11365-9465 (Iran, Islamic Republic of)
2011-07-15
This paper focuses on the influences of the tip mass ratio (the ratio of the tip mass to the cantilever mass), on the excitation of higher oscillation eigenmodes and also on the tip-sample interaction forces in tapping mode atomic force microscopy (TM-AFM). A precise model for the cantilever dynamics capable of accurate simulations is essential for the investigation of the tip mass effects on the interaction forces. In the present work, the finite element method (FEM) is used for modeling the AFM cantilever to consider the oscillations of higher eigenmodes oscillations. In addition, molecular dynamics (MD) is used to calculate precise data for the tip-sample force as a function of tip vertical position with respect to the sample. The results demonstrate that in the presence of nonlinear tip-sample interaction forces, the tip mass ratio plays a significant role in the excitations of higher eigenmodes and also in the normal force applied on the surface. Furthermore, it has been shown that the difference between responses of the FEM and point-mass models in different system operational conditions is highly affected by the tip mass ratio. -- Highlights: {yields} A strong correlation exists between the tip mass ratio and the 18th harmonic amplitude. {yields} Near the critical tip mass ratio a small change in the tip mass may lead to a significant force change. {yields} Inaccuracy of the lumped model depends significantly on the tip mass ratio.
High-Temperature Sensor Based on Fabry-Perot Interferometer in Microfiber Tip
Directory of Open Access Journals (Sweden)
Zhenshi Chen
2018-01-01
Full Text Available A miniaturized tip Fabry-Perot interferometer (tip-FPI is proposed for high-temperature sensing. It is simply fabricated for the first time by splicing a short length of microfiber (MF to the cleaved end of a standard single mode fiber (SMF with precise control of the relative cross section position. Such a MF acts as a Fabry-Perot (FP cavity and serves as a tip sensor. A change in temperature modifies the length and refractive index of the FP cavity, and then a corresponding change in the reflected interference spectrum can be observed. High temperatures of up to 1000 °C are measured in the experiments, and a high sensitivity of 13.6 pm/°C is achieved. This compact sensor, with tip diameter and length both of tens of microns, is suitable for localized detection, especially in harsh environments.
The superfamily of C3b/C4b-binding proteins
DEFF Research Database (Denmark)
Kristensen, Torsten; D'Eustachio, P; Ogata, R T
1987-01-01
The determination of primary structures by amino acid and nucleotide sequencing for the C3b-and/or C4b-binding proteins H, C4BP, CR1, B, and C2 has revealed the presence of a common structural element. This element is approximately 60 amino acids long and is repeated in a tandem fashion, commencing...... at the amino-terminal end of each molecule. Two other complement components, C1r and C1s, have two of these repeating units in the carboxy-terminal region of their noncatalytic A chains. Three noncomplement proteins, beta 2-glycoprotein I (beta 2I), the interleukin 2 receptor (IL 2 receptor), and the b chain...... of factor XIII, have 4, 2 and 10 of these repeating units, respectively. These proteins obviously belong to the above family, although there is no evidence that they interact with C3b and/or C4b. Human haptoglobin and rat leukocyte common antigen also contain two and three repeating units, respectively...
Directory of Open Access Journals (Sweden)
Joseph B Fisher
Full Text Available Tat-interactive protein 60 (Tip60, encoded by the Kat5 gene, is a member of the MYST family of acetyltransferases. Cancer biology studies have shown that Tip60 induces the DNA damage response, apoptosis, and cell-cycle inhibition. Although Tip60 is expressed in the myocardium, its role in cardiomyocytes (CMs is unclear. Earlier studies here showed that application of cardiac stress to globally targeted Kat5+/-haploinsufficient mice resulted in inhibition of apoptosis and activation of the CM cell-cycle, despite only modest reduction of Tip60 protein levels. It was therefore of interest to ascertain the effects of specifically and substantially depleting Tip60 from CMs using Kat5LoxP/-;Myh6-Cre mice in the absence of stress. We report initial findings using this model, in which the effects of specifically depleting Tip60 protein from ventricular CMs, beginning at early neonatal stages, were assessed in 2-12 week-old mice. Although 5'-bromodeoxyuridine immunostaining indicated that CM proliferation was not altered at any of these stages, CM density was increased in 2 week-old ventricles, which persisted in 4 week-old hearts when TUNEL staining revealed inhibition of apoptosis. By week 4, levels of connexin-43 were depleted, and its patterning was dysmorphic, concomitant with an increase in cardiac hypertrophy marker expression and interstitial fibrosis. This was followed by systolic dysfunction at 8 weeks, after which extensive apoptosis and CM fallout occurred, followed by lethality as mice approached 12 weeks of age. In summary, chronic depletion of Tip60 from the ventricular myocardium beginning at early stages of neonatal heart development causes CM death after 8 weeks; hence, Tip60 protein has a crucial function in the heart.
Balk, P A; de Boer, A D
1999-09-01
Many bulbous plants need a low-temperature treatment for flowering. Cold, for example, affects the elongation of the stalk, thereby influencing the quality of the cut flower. How the elongation of the stalk is promoted by cold and which physiological and biochemical mechanisms are involved have remained obscure. As invertase has been shown to be involved in the cold-induced elongation of the flower stalks of tulips (Lambrechts et al., 1994, Plant Physiol 104: 515-520), we further characterized this enzyme by cloning the cDNA and analysing its expression in various tissues of the tulip (Tulipa gesneriana L. cv. Apeldoorn) stalk. In addition, the role of sucrose synthase was investigated. Since turgor pressure is an important force driving cell elongation, the role of a water-channel protein (gammaTIP) was studied in relation to these two enzymes. The mRNA level of the invertase found was substantially up-regulated as a result of cold treatment. Analysis of the amino acid sequence of this invertase revealed the presence of a vacuolar targeting signal. Two different forms of sucrose synthase were found, the expression of one of them appeared to be restricted to the vascular tissue while the other form was present in the surrounding tissue. Both sucrose synthases were present in the stalk during the entire period of bulb storage and after planting, but their activities declined during stalk elongation. The expression of the gammaTIP gene was restricted mainly to the vascular tissue and its expression profile was identical to that of invertase. Simultaneous expression of invertase and gammaTIP possibly leads to an increase in osmotic potential and vacuolar water uptake, thus providing a driving force for stretching the stalk cells.
TIP maker and TIP marker; EB1 as a master controller of microtubule plus ends.
Vaughan, Kevin T
2005-10-24
The EB1 protein is a member of the exciting and enigmatic family of microtubule (MT) tip-tracking proteins. EB1 acts as an exquisite marker of dynamic MT plus ends in some cases, whereas in others EB1 is thought to directly dictate the behavior of the plus ends. How EB1 differentiates between these two roles remains unclear; however, a growing list of interactions between EB1 and other MT binding proteins suggests there may be a single mechanism. Adding another layer of complexity to these interactions, two studies published in this issue implicate EB1 in cross-talk between mitotic MTs and between MTs and actin filaments (Goshima et al., p. 229; Wu et al., p. 201). These results raise the possibility that EB1 is a central player in MT-based transport, and that the activity of MT-binding proteins depends on their ability or inability to interact with EB1.
Paiva, Joana S; Jorge, Pedro A S; Rosa, Carla C; Cunha, João P S
2018-05-01
The tip of an optical fiber has been considered an attractive platform in Biology. The simple cleaved end of an optical fiber can be machined, patterned and/or functionalized, acquiring unique properties enabling the exploitation of novel optical phenomena. Prompted by the constant need to measure and manipulate nanoparticles, the invention of the Scanning Near-field Optical Microscopy (SNOM) triggered the optimization and development of novel fiber tip microfabrication methods. In fact, the fiber tip was soon considered a key element in SNOM by confining light to sufficiently small extensions, challenging the diffraction limit. As result and in consequence of the newly proposed "Lab On Tip" concept, several geometries of fiber tips were applied in three main fields: imaging (in Microscopy/Spectroscopy), biosensors and micromanipulation (Optical Fiber Tweezers, OFTs). These are able to exert forces on microparticles, trap and manipulate them for relevant applications, as biomolecules mechanical study or protein aggregates unfolding. This review presents an overview of the main achievements, most impactful studies and limitations of fiber tip-based configurations within the above three fields, along the past 10 years. OFTs could be in future a valuable tool for studying several cellular phenomena such as neurodegeneration caused by abnormal protein fibrils or manipulating organelles within cells. This could contribute to understand the mechanisms of some diseases or biophenomena, as the axonal growth in neurons. To the best of our knowledge, no other review article has so far provided such a broad view. Despite of the limitations, fiber tips have key roles in Biology/Medicine. Copyright © 2018 Elsevier B.V. All rights reserved.
Protein C activity and antigen levels in childhood
van Teunenbroek, A.; Peters, M.; Sturk, A.; Borm, J. J.; Breederveld, C.
1990-01-01
Hereditary protein C deficiency is an important risk factor for thrombosis. To enable its diagnosis shortly after birth, we determined reference values of protein C antigen and activity levels for the first 3 months of life. To establish an age-related range of protein C levels we also determined
Directory of Open Access Journals (Sweden)
Natália Salazar
Full Text Available Infections caused by Staphylococcus aureus--particularly nosocomial infections--represent a great concern. Usually, the early stage of pathogenesis consists on asymptomatic nasopharynx colonization, which could result in dissemination to other mucosal niches or invasion of sterile sites, such as blood. This pathogenic route depends on scavenging of nutrients as well as binding to and disrupting extracellular matrix (ECM. Manganese transport protein C (MntC, a conserved manganese-binding protein, takes part in this infectious scenario as an ion-scavenging factor and surprisingly as an ECM and coagulation cascade binding protein, as revealed in this work. This study showed a marked ability of MntC to bind to several ECM and coagulation cascade components, including laminin, collagen type IV, cellular and plasma fibronectin, plasminogen and fibrinogen by ELISA. The MntC binding to plasminogen appears to be related to the presence of surface-exposed lysines, since previous incubation with an analogue of lysine residue, ε-aminocaproic acid, or increasing ionic strength affected the interaction between MntC and plasminogen. MntC-bound plasminogen was converted to active plasmin in the presence of urokinase plasminogen activator (uPA. The newly released plasmin, in turn, acted in the cleavage of the α and β chains of fibrinogen. In conclusion, we describe a novel function for MntC that may help staphylococcal mucosal colonization and establishment of invasive disease, through the interaction with ECM and coagulation cascade host proteins. These data suggest that this potential virulence factor could be an adequate candidate to compose an anti-staphylococcal human vaccine formulation.
Mmu-miR-615-3p regulates lipoapoptosis by inhibiting C/EBP homologous protein.
Directory of Open Access Journals (Sweden)
Yasuhiro Miyamoto
Full Text Available Lipoapoptosis occurring due to an excess of saturated free fatty acids such as palmitate is a key pathogenic event in the initiation of nonalcoholic fatty liver disease. Palmitate loading of cells activates the endoplasmic reticulum stress response, including induction of the proapoptotic transcription factor C/EBP homologous protein (CHOP. Furthermore, the loss of microRNAs is implicated in regulating apoptosis under conditions of endoplasmic reticulum (ER stress. The aim of this study was to identify specific microRNAs regulating CHOP expression during palmitate-induced ER stress. Five microRNAs were repressed under palmitate-induced endoplasmic reticulum stress conditions in hepatocyte cell lines (miR-92b-3p, miR-328-3p, miR-484, miR-574-5p, and miR-615-3p. We identified miR-615-3p as a candidate microRNA which was repressed by palmitate treatment and regulated CHOP protein expression, by RNA sequencing and in silico analyses, respectively. There is a single miR-615-3p binding site in the 3'untranslated region (UTR of the Chop transcript. We characterized this as a functional binding site using a reporter gene-based assay. Augmentation of miR-615-3p levels, using a precursor molecule, repressed CHOP expression; and under these conditions palmitate- or tunicamycin-induced cell death were significantly reduced. Our results suggest that palmitate-induced apoptosis requires maximal expression of CHOP which is achieved via the downregulation of its repressive microRNA, miR-615-3p. We speculate that enhancement of miR-615-3p levels may be of therapeutic benefit by inhibiting palmitate-induced hepatocyte lipoapoptosis.
Swayne, Theresa C; Zhou, Chun; Boldogh, Istvan R; Charalel, Joseph K; McFaline-Figueroa, José Ricardo; Thoms, Sven; Yang, Christine; Leung, Galen; McInnes, Joseph; Erdmann, Ralf; Pon, Liza A
2011-12-06
Mitochondria accumulate at neuronal and immunological synapses and yeast bud tips and associate with the ER during phospholipid biosynthesis, calcium homeostasis, and mitochondrial fission. Here we show that mitochondria are associated with cortical ER (cER) sheets underlying the plasma membrane in the bud tip and confirm that a deletion in YPT11, which inhibits cER accumulation in the bud tip, also inhibits bud tip anchorage of mitochondria. Time-lapse imaging reveals that mitochondria are anchored at specific sites in the bud tip. Mmr1p, a member of the DSL1 family of tethering proteins, localizes to punctate structures on opposing surfaces of mitochondria and cER sheets underlying the bud tip and is recovered with isolated mitochondria and ER. Deletion of MMR1 impairs bud tip anchorage of mitochondria without affecting mitochondrial velocity or cER distribution. Deletion of the phosphatase PTC1 results in increased Mmr1p phosphorylation, mislocalization of Mmr1p, defects in association of Mmr1p with mitochondria and ER, and defects in bud tip anchorage of mitochondria. These findings indicate that Mmr1p contributes to mitochondrial inheritance as a mediator of anchorage of mitochondria to cER sheets in the yeast bud tip and that Ptc1p regulates Mmr1p phosphorylation, localization, and function. Copyright © 2011 Elsevier Ltd. All rights reserved.
Full Text Available ... death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ... tv tip-overs. The force of a large television falling from tipping furniture can be staggering. A ...
Full Text Available ... and furniture, appliance and tv tip-overs. The force of a large television falling from tipping furniture ... 50 lb. TV falls with about the same force as child falling from the third story of ...
Full Text Available ... Tipping Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture ... about horrible accidents involving young children and furniture, appliance and tv tip-overs. The force of a ...
The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease
King, Oliver D.; Gitler, Aaron D.; Shorter, James
2012-01-01
Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the
Cuijpers, C.F.
2015-01-01
The transjugular intrahepatic portosystemic shunt (TIPS) procedure is one of the most technically challenging procedures in interventional radiology. During the procedure, interventional radiologists (IRs) insert very thin and long instruments through a little incision in the patient’s neck. They
... now Try it free Find out why Close CPAP Tips from FDA USFoodandDrugAdmin Loading... Unsubscribe from USFoodandDrugAdmin? ... apnea and use a continuous positive airway pressure (CPAP) device when sleeping? Here are some tips from ...
Full Text Available ... OnSafety CPSC Stands for Safety The Tipping Point Home > 60 Seconds of Safety (Videos) > The Tipping Point ... 24 hours a day. For young children whose home is a playground, it’s the best way to ...
Full Text Available ... now Try it free Find out why Close CPAP Tips from FDA USFoodandDrugAdmin Loading... Unsubscribe from USFoodandDrugAdmin? ... apnea and use a continuous positive airway pressure (CPAP) device when sleeping? Here are some tips from ...
Directory of Open Access Journals (Sweden)
Chunhui Xu
Full Text Available Aquaporins are channel proteins which transport water across cell membranes. We show that the bread wheat aquaporin gene TaTIP2;2 maps to the long arm of chromosome 7b and that its product localizes to the endomembrane system. The gene is expressed constitutively in both the root and the leaf, and is down-regulated by salinity and drought stress. Salinity stress induced an increased level of C-methylation within the CNG trinucleotides in the TaTIP2;2 promoter region. The heterologous expression of TaTIP2;2 in Arabidopsis thaliana compromised its drought and salinity tolerance, suggesting that TaTIP2;2 may be a negative regulator of abiotic stress. The proline content of transgenic A. thaliana plants fell, consistent with the down-regulation of P5CS1, while the expression of SOS1, SOS2, SOS3, CBF3 and DREB2A, which are all stress tolerance-related genes acting in an ABA-independent fashion, was also down-regulated. The supply of exogenous ABA had little effect either on TaTIP2;2 expression in wheat or on the phenotype of transgenic A. thaliana. The expression level of the ABA signalling genes ABI1, ABI2 and ABF3 remained unaltered in the transgenic A. thaliana plants. Thus TaTIP2;2 probably regulates the response to stress via an ABA-independent pathway(s.
Full Text Available ... 60 Seconds of Safety (Videos) > The Tipping Point The Tipping Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash ...
Arachchillage, D R J; Efthymiou, M; Mackie, I J; Lawrie, A S; Machin, S J; Cohen, H
2014-11-01
Antiphospholipid antibodies may interfere with the anticoagulant activity of activated protein C (APC) to induce acquired APC resistance (APCr). To investigate the frequency and characteristics of APCr by using recombinant human APC (rhAPC) and endogenous protein C activation in antiphospholipid syndrome (APS). APCr was assessed in APS and non-APS venous thromboembolism (VTE) patients on warfarin and normal controls with rhAPC or Protac by thrombin generation. IgG anti-protein C and anti-protein S antibodies and avidity were assessed by ELISA. APS patients showed greater resistance to both rhAPC and Protac than non-APS patients and normal controls (median normalized endogenous thrombin potential inhibition): APS patients with rhAPC, 81.3% (95% confidence interval [CI] 75.2-88.3%; non-APS patients with rhAPC, 97.7% (95% CI 93.6-101.8%; APS patients with Protac, 66.0% (95% CI 59.5-72.6%); and non-APS patients with Protac, 80.7 (95% CI 74.2-87.2%). APS patients also had a higher frequency and higher levels of anti-protein C antibodies, with 60% (15/25) high-avidity antibodies. High-avidity anti-protein C antibodies were associated with greater APCr and with a severe thrombotic phenotype (defined as the development of recurrent VTE while patients were receiving therapeutic anticoagulation or both venous and arterial thrombosis). Twelve of 15 (80%) patients with high-avidity anti-protein C antibodies were classified as APS category I. Thrombotic APS patients showed greater APCr to both rhAPC and activation of endogenous protein C by Protac. High-avidity anti-protein C antibodies, associated with greater APCr, may provide a marker for a severe thrombotic phenotype in APS. However, in patients with category I APS, it remains to be established whether anti-protein C or anti-β2 -glycoprotein I antibodies are responsible for APCr. © 2014 International Society on Thrombosis and Haemostasis.
Anti-thrombin III, Protein C, and Protein S deficiency in acute coronary syndrome
Directory of Open Access Journals (Sweden)
Dasnan Ismail
2002-06-01
Full Text Available The final most common pathway for the majority of coronary artery disease is occlusion of a coronary vessel. Under normal conditions, antithrombin III (AT III, protein C, and protein S as an active protein C cofactor, are natural anticoagulants (hemostatic control that balances procoagulant activity (thrombin antithrombin complex balance to prevent thrombosis. If the condition becomes unbalanced, natural anticoagulants and the procoagulants can lead to thrombosis. Thirty subjects with acute coronary syndrome (ACS were studied for the incidence of antithrombin III (AT III, protein C, and protein S deficiencies, and the result were compare to the control group. Among patients with ACS, the frequency of distribution of AT-III with activity < 75% were 23,3% (7 of 30, and only 6,7% ( 2 of 30 in control subject. No one of the 30 control subject have protein C activity deficient, in ACS with activity < 70% were 13,3% (4 of 30. Fifteen out of the 30 (50% control subjects had protein S activity deficiency, while protein S deficiency activity < 70% was found 73.3.% (22 out of 30. On linear regression, the deterministic coefficient of AT-III activity deficiency to the development ACS was 13,25 %, and the deterministic coefficient of protein C activity deficient to the development of ACS was 9,06 %. The cut-off point for AT-III without protein S deficiency expected to contribute to the development of vessel disease was 45%. On discriminant analysis, protein C activity deficiency posed a risk for ACS of 4,5 greater than non deficient subjects, and AT-III activity deficiency posed a risk for ACS of 3,5 times greater than non deficient subjects. On binary logistic regression, protein S activity acted only as a reinforcing factor of AT-III activity deficiency in the development of ACS. Protein C and AT III deficiency can trigger ACS, with determinant coefficients of 9,06% and 13,25% respectively. Low levels of protein C posed a greater risk of
Nanobits - exchangable and customisable scanning probe tips
DEFF Research Database (Denmark)
Yildiz, Izzet
dimensions: tips suitable for imaging high-aspect ratio structures and sidewall profiles were designed. Tip diameters in the order of 30 nm were reproducibly obtained with the FIB milling and the smallest tip diameter achieved was ... process by providing direct picking up of the NanoBits by the AFM probe was investigated. Two different bending mechanisms were studied for out-of-plane bending studies: FIB irradiation- and the residual stress-driven bending in bimorph structures. With FIB irradiation studies, NanoBits were demonstrated...... of the structure which may be starting at 170°C. The fabricated NanoBits were assembled and their performance as AFM probes were tested at OFFIS. The NanoBits were successfully picked up by a microgripper, collected in a cartridge and mounted to an AFM probe. Performances of the assembled high-aspect-ratio Nano...
Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael
2015-05-26
The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kager, Liesbeth M.; Roelofs, Joris J. T. H.; de Vos, Alex F.; Wieland, Catharina W.; Schouten, Marcel; Meijers, Joost C. M.; Isermann, Berend; van't Veer, Cornelis; Esmon, Charles T.; van der Poll, Tom
2013-01-01
The protein C (PC) system is an important regulator of both coagulation and inflammation. Activated PC (APC), together with its receptor the endothelial protein C receptor (EPCR), has anticoagulant and anti-inflammatory properties. During tuberculosis (TB), a devastating chronic pulmonary disease
Directory of Open Access Journals (Sweden)
Gerson CARREIRO
2001-01-01
Full Text Available Diversas alternativas terapêuticas têm sido usadas, atualmente, na tentativa de reduzir a mortalidade de pacientes com hipertensão portal que desenvolvem varizes esofagianas. Abordagem de uma dessas alternativas que ainda é de exceção e pouco utilizada em nosso meio - o "shunt" (desvio portossistêmico intra-hepático transjugular - TIPS ("transjugular intrahepatic portasystemic shunt". O TIPS possibilita redução significativa do gradiente de pressão portohepático, uma vez que funciona como um "shunt" portocava látero-lateral, promovendo, dessa forma, descompressão eficiente do sistema portal, reduzindo significativamente o risco de sangramentos. A técnica consiste na inserção percutânea, através da veia jugular interna, de malha metálica através do parênquima hepático, sob controle angiográfico, criando verdadeira comunicação portocava. Bons resultados na utilização do TIPS têm sido atestados em diversos estudos, muito embora bem poucos deles tenham sido controlados e randomizados de modo a concluir que esse procedimento é seguro, eficaz e com boa relação custo-benefício. Dessa forma, buscou-se, nesta revisão, uma análise do estado atual da utilização do TIPS, sua técnica, principais indicações e complicações. O TIPS vem sendo utilizado nos casos de hemorragia digestiva refratária ao tratamento farmacológico e/ou endoscópico, principalmente em pacientes Child-Pugh B e C ou ainda como opção de controle do quadro, servindo como "ponte" para um futuro transplante hepático. Pode-se considerar ainda o tratamento da ascite refratária, da síndrome hepatorrenal e do hidrotórax hepático como promissoras indicações definitivas para a colocação do TIPS. As complicações dessa técnica estão relacionadas, sobretudo, a sua colocação, às conseqüências hemodinâmicas imediatas, como a encefalopatia hepática, e às complicações tardias envolvendo principalmente a oclusão do "stent" (prótese auto
The tipping point: A mathematical model for the profit-driven abandonment of restaurant tipping
Clifton, Sara M.; Herbers, Eileen; Chen, Jack; Abrams, Daniel M.
2018-02-01
The custom of voluntarily tipping for services rendered has gone in and out of fashion in America since its introduction in the 19th century. Restaurant owners that ban tipping in their establishments often claim that social justice drives their decisions, but we show that rational profit-maximization may also justify the decisions. Here, we propose a conceptual model of restaurant competition for staff and customers, and we show that there exists a critical conventional tip rate at which restaurant owners should eliminate tipping to maximize profits. Because the conventional tip rate has been increasing steadily for the last several decades, our model suggests that restaurant owners may abandon tipping en masse when that critical tip rate is reached.
Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein
Koppelman, S.J.
1995-01-01
The complement protein C4b-binding protein plays an important role in the regulation of the protein C anticoagulant pathway. C4b-binding protein can bind to protein S, thereby inhibiting the cofactor activity of protein S for activated protein C. In this report, we describe a new role for
Advanced ceramic material for high temperature turbine tip seals
Solomon, N. G.; Vogan, J. W.
1978-01-01
Ceramic material systems are being considered for potential use as turbine blade tip gas path seals at temperatures up to 1370 1/4 C. Silicon carbide and silicon nitride structures were selected for study since an initial analysis of the problem gave these materials the greatest potential for development into a successful materials system. Segments of silicon nitride and silicon carbide materials over a range of densities, processed by various methods, a honeycomb structure of silicon nitride and ceramic blade tip inserts fabricated from both materials by hot pressing were tested singly and in combination. The evaluations included wear under simulated engine blade tip rub conditions, thermal stability, impact resistance, machinability, hot gas erosion and feasibility of fabrication into engine components. The silicon nitride honeycomb and low-density silicon carbide using a selected grain size distribution gave the most promising results as rub-tolerant shroud liners. Ceramic blade tip inserts made from hot-pressed silicon nitride gave excellent test results. Their behavior closely simulated metal tips. Wear was similar to that of metals but reduced by a factor of six.
Terrell, D F; Thomas, R K
1990-09-01
In Experiment 1, with the number of sides or angles of irregular polygons as cues, programmed training, and a 90% correct criterion (36 of 40), 2 squirrel monkeys' (Saimiri sciureus sciureus and S. boliviensus boliviensus) best performances were to discriminate heptagons from octagons, a 3rd's best was hexagons from heptagons, and a 4th's best was pentagons from heptagons. In Experiment 2, on most trials 2 polygons on one or both discriminanda had to be summed to determine which discrimination had the total fewer sides. Only 1 monkey met criterion (27 of 30) on the 2 tasks, 6 vs. 8 and 7 vs. 8 sides, but the other 3 performed better than chance on the 6 vs. 8 task. We conclude that previous studies of animals' discrimination of polygons in terms of complexity were minimally relevant to this work, and counting and subitizing were rejected in favor of a prototype-matching process to explain our monkeys' performances.
Integrating histology and MRI in the first digital brain of common squirrel monkey, Saimiri sciureus
Sun, Peizhen; Parvathaneni, Prasanna; Schilling, Kurt G.; Gao, Yurui; Janve, Vaibhav; Anderson, Adam; Landman, Bennett A.
2015-03-01
This effort is a continuation of development of a digital brain atlas of the common squirrel monkey, Saimiri sciureus, a New World monkey with functional and microstructural organization of central nervous system similar to that of humans. Here, we present the integration of histology with multi-modal magnetic resonance imaging (MRI) atlas constructed from the brain of an adult female squirrel monkey. The central concept of this work is to use block face photography to establish an intermediate common space in coordinate system which preserves the high resolution in-plane resolution of histology while enabling 3-D correspondence with MRI. In vivo MRI acquisitions include high resolution T2 structural imaging (300 μm isotropic) and low resolution diffusion tensor imaging (600 um isotropic). Ex vivo MRI acquisitions include high resolution T2 structural imaging and high resolution diffusion tensor imaging (both 300 μm isotropic). Cortical regions were manually annotated on the co-registered volumes based on published histological sections in-plane. We describe mapping of histology and MRI based data of the common squirrel monkey and construction of a viewing tool that enable online viewing of these datasets. The previously descried atlas MRI is used for its deformation to provide accurate conformation to the MRI, thus adding information at the histological level to the MRI volume. This paper presents the mapping of single 2D image slice in block face as a proof of concept and this can be extended to map the atlas space in 3D coordinate system as part of the future work and can be loaded to an XNAT system for further use.
Polgár, Zita; Wood, Lara; Haskell, Marie J
2017-05-01
Understanding individual differences in captive squirrel monkeys is a topic of importance both for improving welfare by catering to individual needs, and for better understanding the results and implications of behavioral research. In this study, 23 squirrel monkeys (Saimiri sciureus), housed in an environment that is both a zoo enclosure and research facility, were assessed for (i) the time they spent by an observation window under three visitor conditions: no visitors, small groups, and large groups; (ii) their likelihood of participating in voluntary research; and (iii) zookeepers, ratings of personality. A Friedman's ANOVA and Wilcoxon post-hoc tests comparing mean times found that the monkeys spent more time by the window when there were large groups present than when there were small groups or no visitors. Thus, visitors do not seem to have a negative effect and may be enriching for certain individuals. Through GLMM and correlational analyses, it was found that high scores on the personality trait of playfulness and low scores on cautiousness, depression, and solitude were significant predictors of increased window approach behavior when visitors were present. The GLMM and correlational analyses assessing the links between personality traits and research participation found that low scores of cautiousness and high scores of playfulness, gentleness, affection, and friendliness, were significant predictors. The implications of these results are discussed in relation to selection bias and its potential confounding effect on cognitive studies with voluntary participation. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Agnieszka Kordek
2014-12-01
Full Text Available Aim: This study was intended to assess the clinical usefulness of blood procalcitonin (PCT concentrations for the diagnosis and therapeutic monitoring of nosocomial neonatal sepsis.Material/Methods: The enrolment criterion was sepsis clinically manifesting after three days of life. PCT concentrations were measured in venous blood from 52 infected and 88 uninfected neonates. The results were interpreted against C-reactive protein (CRP concentrations and white blood cell counts (WBC.Results: Differences between the two groups in PCT and CRP concentrations were highly significant. No significant differences between the groups were noted for WBC. The threshold value on the receiver operator characteristic curve was 2.06 ng/mL for PCT (SE 75%; SP 80.68%; PPV 62.22%; NPV 88.75%; AUC 0.805, 5.0 mg/L for CRP (SE 67.44%; SP 73.68%; PPV 42.02%; NPV 88.89%; AUC 0.801, and 11.9 x109/L for WBC (SE 51.16%; SP 50.68%; PPV 23.16%; NPV 78.13%; AUC 0.484. Procalcitonin concentrations decreased 24 hours after initiation of antibiotic therapy and reverted to the control level after 5-7 days. C-reactive protein concentrations began to decline after two days of antibiotic therapy but were still higher than in the control group after 5-7 days of treatment. No significant changes in WBC during the treatment were observed.Conclusions: Procalcitonin concentrations in blood appear to be of use for the diagnosis and therapeutic monitoring of nosocomial infections in neonates as this parameter demonstrates greater sensitivity and specificity than C-reactive protein. White blood cell counts appear to be of little diagnostic value in the early phase of infection or for therapeutic monitoring.
Pre-Liver Transplant: Tips Versus Distal Splenorenal Shunt
Directory of Open Access Journals (Sweden)
Thomas W. Faust
1997-01-01
Full Text Available Recurrent variceal bleeding in liver transplant candidates with end-stage liver disease can complicate or even prohibit a subsequent transplant procedure (OLT. Endoscopic sclero-therapy and medical therapy are considered as first-line management with surgical shunts reserved for refractory situations. Surgical shunts can be associated with a high mortality in this population and may complicate subsequent OLT. The transjugular intrahepatic portosystemic shunt (TIPS has been recommended in these patients as a bridge to OLT. This is a new modality that has not been compared with previously established therapies such as the distal splenorenal shunt (DSRS. In this study we report our experience with 35 liver transplant recipients who had a previous TIPS (18 patients or DSRS (17 patients for variceal bleeding. The TIPS group had a significantly larger proportion of critically ill and Child-Pugh C patients. Mean operating time was more prolonged in the DSRS group (P=0.014 but transfusion requirements were similar. Intraoperative portal vein blood flow measurements averaged 2132±725 ml/min in the TIPS group compared with 1120±351ml/min in the DSRS group (P<0.001. Arterial flows were similar. Mean ICU and hospital stays were similar. There were 3 hospital mortalities in the DSRS group and none in the TIPS group (P=0.1. We conclude that TIPS is a valuable tool in the management of recurrent variceal bleeding prior to liver transplantation. Intra0Perative hemodynamic measurements suggest a theoretical advantage with TIPS. In a group of patients with advanced liver disease we report an outcome that is similar to patients treated with DSRS prior to liver transplantation. The role of TIPS in the treatment of nontransplant candidates remains to be clarified.
Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip
Directory of Open Access Journals (Sweden)
Yanling Xia
2018-04-01
Full Text Available Objective Molecular cloning and bioinformatics analysis of annexin A2 (ANXA2 gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. Methods The reverse transcriptase polymerase chain reaction (RT-PCR was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer (Cervus Nippon hortulorum and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR. Results The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period. Conclusion ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.
Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23
International Nuclear Information System (INIS)
Ghaffari, S.H.; Olson, M.O.J.
1986-01-01
Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved
Mathematics Teacher, 2004
2004-01-01
Some inexpensive or free ways that enable to capture and use images in work are mentioned. The first tip demonstrates the methods of using some of the built-in capabilities of the Macintosh and Windows-based PC operating systems, and the second tip describes methods to capture and create images using SnagIt.
Microfabricated microneedle with porous tip for drug delivery
Ji, Jing; Tay, Francis E. H.; Miao, Jianmin; Iliescu, Ciprian
2006-05-01
This paper presents a novel approach to fabrication of a silicon microneedle array with porous tips. Dry etching technology with SF6/O2 gas by STS's inductively coupled plasma (ICP) etch tool was used to achieve the pyramidal needle structure. A thin silicon nitride layer was deposited after a thick photoresist layer was coated and reflowed at 120 °C. The silicon nitride layer and residual photoresist on the tips of the pyramidal structures were removed using reactive ion etching (RIE). Electrochemical etching in MeCN/HF was carried out to generate porous silicon on the tips of the microneedles. The fabricated microneedle array has potential applications in drug delivery, since the porous tips can be loaded with a high molecular weight drug. Analytic solutions to the critical loadings of the fabricated microneedle structure are also presented. The variations of the square cross-section were expressed as a function of the axial coordinate to analyze the bending normal stress and critical buckling loading. This analytic method can also be used for other microneedle structures with different cross-sections.
Phosphorylation of the Yeast Choline Kinase by Protein Kinase C
Choi, Mal-Gi; Kurnov, Vladlen; Kersting, Michael C.; Sreenivas, Avula; Carman, George M.
2005-01-01
The Saccharomyces cerevisiae CKI1-encoded choline kinase catalyzes the committed step in phosphatidylcholine synthesis via the Kennedy pathway. The enzyme is phosphorylated on multiple serine residues, and some of this phosphorylation is mediated by protein kinase A. In this work, we examined the hypothesis that choline kinase is also phosphorylated by protein kinase C. Using choline kinase as a substrate, protein kinase C activity was dose- and time-dependent, and dependent on the concentrations of choline kinase (Km = 27 μg/ml) and ATP (Km = 15 μM). This phosphorylation, which occurred on a serine residue, was accompanied by a 1.6-fold stimulation of choline kinase activity. The synthetic peptide SRSSS25QRRHS (Vmax/Km = 17.5 mM-1 μmol min-1 mg-1) that contains the protein kinase C motif for Ser25 was a substrate for protein kinase C. A Ser25 to Ala (S25A) mutation in choline kinase resulted in a 60% decrease in protein kinase C phosphorylation of the enzyme. Phosphopeptide mapping analysis of the S25A mutant enzyme confirmed that Ser25 was a protein kinase C target site. In vivo, the S25A mutation correlated with a decrease (55%) in phosphatidylcholine synthesis via the Kennedy pathway whereas an S25D phosphorylation site mimic correlated with an increase (44%) in phosphatidylcholine synthesis. Whereas the S25A (protein kinase C site) mutation did not affect the phosphorylation of choline kinase by protein kinase A, the S30A (protein kinase A site) mutation caused a 46% reduction in enzyme phosphorylation by protein kinase C. A choline kinase synthetic peptide (SQRRHS30LTRQ) containing Ser30 was a substrate (Vmax/Km = 3.0 mM−1 μmol min−1 mg−1) for protein kinase C. Comparison of phosphopeptide maps of the wild type and S30A mutant choline kinase enzymes phosphorylated by protein kinase C confirmed that Ser30 was also a target site for protein kinase C. PMID:15919656
Thermoelectric voltage at a nanometer-scale heated tip point contact
International Nuclear Information System (INIS)
Fletcher, Patrick C; Lee, Byeonghee; King, William P
2012-01-01
We report thermoelectric voltage measurements between the platinum-coated tip of a heated atomic force microscope (AFM) cantilever and a gold-coated substrate. The cantilevers have an integrated heater–thermometer element made from doped single crystal silicon, and a platinum tip. The voltage can be measured at the tip, independent from the cantilever heating. We used the thermocouple junction between the platinum tip and the gold substrate to measure thermoelectric voltage during heating. Experiments used either sample-side or tip-side heating, over the temperature range 25–275 °C. The tip–substrate contact is ∼4 nm in diameter and its average measured Seebeck coefficient is 3.4 μV K −1 . The thermoelectric voltage is used to determine tip–substrate interface temperature when the substrate is either glass or quartz. When the non-dimensional cantilever heater temperature is 1, the tip–substrate interface temperature is 0.593 on glass and 0.125 on quartz. Thermal contact resistance between the tip and the substrate heavily influences the tip–substrate interface temperature. Measurements agree well with modeling when the tip–substrate interface contact resistance is 10 8 K W −1 . (paper)
DEFF Research Database (Denmark)
Andreasen, Martin Møller; Christensen, Jens H.E.; Simon Riddell, Simon
We introduce an arbitrage-free term structure model of nominal and real yields that accounts for liquidity risk in Treasury inflation-protected securities (TIPS). The novel feature of our model is to identify liquidity risk from individual TIPS prices by accounting for the tendency that TIPS, lik...
Abscisic Acid Regulates Auxin Homeostasis in Rice Root Tips to Promote Root Hair Elongation
Directory of Open Access Journals (Sweden)
Tao Wang
2017-06-01
Full Text Available Abscisic acid (ABA plays an essential role in root hair elongation in plants, but the regulatory mechanism remains to be elucidated. In this study, we found that exogenous ABA can promote rice root hair elongation. Transgenic rice overexpressing SAPK10 (Stress/ABA-activated protein kinase 10 had longer root hairs; rice plants overexpressing OsABIL2 (OsABI-Like 2 had attenuated ABA signaling and shorter root hairs, suggesting that the effect of ABA on root hair elongation depends on the conserved PYR/PP2C/SnRK2 ABA signaling module. Treatment of the DR5-GUS and OsPIN-GUS lines with ABA and an auxin efflux inhibitor showed that ABA-induced root hair elongation depends on polar auxin transport. To examine the transcriptional response to ABA, we divided rice root tips into three regions: short root hair, long root hair and root tip zones; and conducted RNA-seq analysis with or without ABA treatment. Examination of genes involved in auxin transport, biosynthesis and metabolism indicated that ABA promotes auxin biosynthesis and polar auxin transport in the root tip, which may lead to auxin accumulation in the long root hair zone. Our findings shed light on how ABA regulates root hair elongation through crosstalk with auxin biosynthesis and transport to orchestrate plant development.
Directory of Open Access Journals (Sweden)
Gry Aune Westergaard Hansen
Full Text Available Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted with both proteins with an estimated dissociation constant at 1 μM for reticulocalbin and 150 nM for calumenin. The interaction, at least for calumenin, was dependent upon the presence of Ca2+ with strong interaction at 3.5 mM while no detectable interaction could be found at 0.1 mM. Grp75 binds with an affinity of approximately 3-7 nM with reticulocalbin as well as with calumenin. These interactions suggest functional participation of the CREC proteins in chaperone activity, cell proliferation and transformation, cellular aging, haemostasis and thrombosis as well as modulation of the complement system in fighting bacterial infection.
HCVpro: Hepatitis C virus protein interaction database
Kwofie, Samuel K.
2011-12-01
It is essential to catalog characterized hepatitis C virus (HCV) protein-protein interaction (PPI) data and the associated plethora of vital functional information to augment the search for therapies, vaccines and diagnostic biomarkers. In furtherance of these goals, we have developed the hepatitis C virus protein interaction database (HCVpro) by integrating manually verified hepatitis C virus-virus and virus-human protein interactions curated from literature and databases. HCVpro is a comprehensive and integrated HCV-specific knowledgebase housing consolidated information on PPIs, functional genomics and molecular data obtained from a variety of virus databases (VirHostNet, VirusMint, HCVdb and euHCVdb), and from BIND and other relevant biology repositories. HCVpro is further populated with information on hepatocellular carcinoma (HCC) related genes that are mapped onto their encoded cellular proteins. Incorporated proteins have been mapped onto Gene Ontologies, canonical pathways, Online Mendelian Inheritance in Man (OMIM) and extensively cross-referenced to other essential annotations. The database is enriched with exhaustive reviews on structure and functions of HCV proteins, current state of drug and vaccine development and links to recommended journal articles. Users can query the database using specific protein identifiers (IDs), chromosomal locations of a gene, interaction detection methods, indexed PubMed sources as well as HCVpro, BIND and VirusMint IDs. The use of HCVpro is free and the resource can be accessed via http://apps.sanbi.ac.za/hcvpro/ or http://cbrc.kaust.edu.sa/hcvpro/. © 2011 Elsevier B.V.
Fe65 is required for Tip60-directed histone H4 acetylation at DNA strand breaks
Stante, Maria; Minopoli, Giuseppina; Passaro, Fabiana; Raia, Maddalena; Vecchio, Luigi Del; Russo, Tommaso
2009-01-01
Fe65 is a binding partner of the Alzheimer's β-amyloid precursor protein APP. The possible involvement of this protein in the cellular response to DNA damage was suggested by the observation that Fe65 null mice are more sensitive to genotoxic stress than WT counterpart. Fe65 associated with chromatin under basal conditions and its involvement in DNA damage repair requires this association. A known partner of Fe65 is the histone acetyltransferase Tip60. Considering the crucial role of Tip60 in DNA repair, we explored the hypothesis that the phenotype of Fe65 null cells depended on its interaction with Tip60. We demonstrated that Fe65 knockdown impaired recruitment of Tip60-TRRAP complex to DNA double strand breaks and decreased histone H4 acetylation. Accordingly, the efficiency of DNA repair was decreased upon Fe65 suppression. To explore whether APP has a role in this mechanism, we analyzed a Fe65 mutant unable to bind to APP. This mutant failed to rescue the phenotypes of Fe65 null cells; furthermore, APP/APLP2 suppression results in the impairment of recruitment of Tip60-TRRAP complex to DNA double strand breaks, decreased histone H4 acetylation and repair efficiency. On these bases, we propose that Fe65 and its interaction with APP play an important role in the response to DNA damage by assisting the recruitment of Tip60-TRRAP to DNA damage sites. PMID:19282473
International Nuclear Information System (INIS)
Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.
1987-01-01
The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the α subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single β subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the α subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub sα/ relative to G/sub ichemical bond/ and G/sub ochemical bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with [ 125 I]protein. Immunohistochemical studies using an antiserum against the β subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the α subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C occurred also in cilia isolated from respiratory epithelium
Evaluation of pro-c global for identification of defects in protein c/s anticoagulant pathway
International Nuclear Information System (INIS)
Hanif, T.B.; Anwar, J.; Idrees, M.
2011-01-01
Background: Detection of protein C and S deficiency forms a major investigation in the laboratory evaluation of thrombophilia screening. It has key role in the diagnosis of protein C and S deficiency. The objective of this study is to determine the utility of ProC Global as a screening test for identifying the defects of protein C and S anticoagulant pathways. Methods: Two Hundred patients with venous thromboembolism were studied at the Department of Haematology, Armed Forces Institute of Pathology, Rawalpindi, from October 2004 to March 2006. ProC Global test (Dade Behring Diagnostics) was performed and was followed up by protein C and S assays. ProC Global is an activated partial thromboplastin time based assay in which Protac (snake venom from Aghistroden contortrix) is used for activation of the endogenous protein C of the plasma sample. The protein C activation time in the presence of the activator was set in relation to a parallel determination of PCAT/O with addition of a buffer instead of activator reagent. The ratio PCAT: PCAT/O was transformed in normalized ratio by relating them to a calibrator. Control plasma for normal range and ProC control plasma for pathological range (Dade Behring Diagnostics) were assayed in each run for quality control. Results: A total of 200 patients, 132 (66%) males and 68 (34%) females with age ranging from 1 to 68 years were studied. ProC Global was positive in 29/200 (14.5%) patients. ProC Global was found to be 86% sensitive, 94% specific and its overall efficiency turned out to be 94%. Conclusion: Pro-C Global can be used effectively as a screening test to detect abnormalities in protein C and S anticoagulant pathways. (author)
Hepatitis C virus infection protein network.
de Chassey, B; Navratil, V; Tafforeau, L; Hiet, M S; Aublin-Gex, A; Agaugué, S; Meiffren, G; Pradezynski, F; Faria, B F; Chantier, T; Le Breton, M; Pellet, J; Davoust, N; Mangeot, P E; Chaboud, A; Penin, F; Jacob, Y; Vidalain, P O; Vidal, M; André, P; Rabourdin-Combe, C; Lotteau, V
2008-01-01
A proteome-wide mapping of interactions between hepatitis C virus (HCV) and human proteins was performed to provide a comprehensive view of the cellular infection. A total of 314 protein-protein interactions between HCV and human proteins was identified by yeast two-hybrid and 170 by literature mining. Integration of this data set into a reconstructed human interactome showed that cellular proteins interacting with HCV are enriched in highly central and interconnected proteins. A global analysis on the basis of functional annotation highlighted the enrichment of cellular pathways targeted by HCV. A network of proteins associated with frequent clinical disorders of chronically infected patients was constructed by connecting the insulin, Jak/STAT and TGFbeta pathways with cellular proteins targeted by HCV. CORE protein appeared as a major perturbator of this network. Focal adhesion was identified as a new function affected by HCV, mainly by NS3 and NS5A proteins.
AERODYNAMICS OF WING TIP SAILS
Directory of Open Access Journals (Sweden)
MUSHTAK AL-ATABI
2006-06-01
Full Text Available Observers have always been fascinated by soaring birds. An interesting feature of these birds is the existence of few feathers extending from the tip of the wing. In this paper, small lifting surfaces were fitted to the tip of a NACA0012 wing in a fashion similar to that of wing tip feathers. Experimental measurements of induced drag, longitudinal static stability and trailing vortex structure were obtained.The tests showed that adding wing tip surfaces (sails decreased the induced drag factor and increased the longitudinal static stability. Results identified two discrete appositely rotated tip vortices and showed the ability of wing tip surfaces to break them down and to diffuse them.
Human serum protein and C-reactive protein levels among HIV ...
African Journals Online (AJOL)
Human serum protein and C-reactive protein levels were determined among HIV patients visiting St Camillus Hospital, Uromi, Edo State, Nigeria, between January to March, 2013. Fifty (50) HIV patients (20 males; 30 females) and 50 control subjects (24 males; 26 females) were enrolled for this study. The clinical status of ...
Ahmed, Zubair M; Goodyear, Richard; Riazuddin, Saima; Lagziel, Ayala; Legan, P Kevin; Behra, Martine; Burgess, Shawn M; Lilley, Kathryn S; Wilcox, Edward R; Riazuddin, Sheikh; Griffith, Andrew J; Frolenkov, Gregory I; Belyantseva, Inna A; Richardson, Guy P; Friedman, Thomas B
2006-06-28
Sound and acceleration are detected by hair bundles, mechanosensory structures located at the apical pole of hair cells in the inner ear. The different elements of the hair bundle, the stereocilia and a kinocilium, are interconnected by a variety of link types. One of these links, the tip link, connects the top of a shorter stereocilium with the lateral membrane of an adjacent taller stereocilium and may gate the mechanotransducer channel of the hair cell. Mass spectrometric and Western blot analyses identify the tip-link antigen, a hitherto unidentified antigen specifically associated with the tip and kinocilial links of sensory hair bundles in the inner ear and the ciliary calyx of photoreceptors in the eye, as an avian ortholog of human protocadherin-15, a product of the gene for the deaf/blindness Usher syndrome type 1F/DFNB23 locus. Multiple protocadherin-15 transcripts are shown to be expressed in the mouse inner ear, and these define four major isoform classes, two with entirely novel, previously unidentified cytoplasmic domains. Antibodies to the three cytoplasmic domain-containing isoform classes reveal that each has a different spatiotemporal expression pattern in the developing and mature inner ear. Two isoforms are distributed in a manner compatible for association with the tip-link complex. An isoform located at the tips of stereocilia is sensitive to calcium chelation and proteolysis with subtilisin and reappears at the tips of stereocilia as transduction recovers after the removal of calcium chelators. Protocadherin-15 is therefore associated with the tip-link complex and may be an integral component of this structure and/or required for its formation.
Scholten, A.
2006-01-01
The primary focus of this thesis is the two kinases PKA and PKG, cAMP and cGMP dependent protein kinase respectively. PKA and PKG are studied both at structure/function level as well as at the level of interaction with other proteins in tissue. Our primary methods are all based on mass spectrometry.
Oral protein kinase c β inhibition using ruboxistaurin
DEFF Research Database (Denmark)
Aiello, Lloyd Paul; Vignati, Louis; Sheetz, Matthew J
2011-01-01
To evaluate efficacy, safety, and causes of vision loss among 813 patients (1,392 eyes) with moderately severe to very severe nonproliferative diabetic retinopathy from the Protein Kinase C β Inhibitor-Diabetic Retinopathy Study and Protein Kinase C β Inhibitor-Diabetic Retinopathy Study 2 ruboxi...
LENUS (Irish Health Repository)
Preston, Roger J S
2012-02-01
We report a kindred with heritable protein C (PC) deficiency in which two siblings with severe thrombosis showed a composite type I and IIb PC deficiency phenotype, identified using commercial PC assays (proband: PC antigen 42 u\\/dl, amidolytic activity 40 u\\/dl, anticoagulant activity 9 u\\/dl). The independent PROC nucleotide variations c.669C>A (predictive of Ser181Arg) and c.131C>T (predictive of Asn2Ile) segregated with the type I and type IIb PC deficiency phenotypes respectively, but co-segregated in the siblings with severe thrombosis. Soluble thrombomodulin (sTM)-mediated inhibition of plasma thrombin generation from an individual with PC-Asn2Ile was lower (endogenous thrombin potential (ETP) 56 +\\/- 1% that of ETP determined without sTM) than control plasma (ETP 15 +\\/- 2%) indicating reduced PC anticoagulant activity. Recombinant APC-Asn2Ile exhibited normal amidolytic activity but impaired anticoagulant activity. Protein S (PS)-dependent anticoagulant activity of recombinant APC-Asn2Ile and binding of recombinant APC-Asn2Ile to endothelial protein C receptor (EPCR) were reduced compared to recombinant wild-type APC. Asn2 lies within the omega-loop of the PC\\/APC Gla domain and this region is critical for calcium-induced folding and subsequent interactions with anionic phospholipids, EPCR and PS. The disruption of these interactions in this naturally-occurring PC variant highlights their collective importance in mediating APC anticoagulant activity in vivo.
Production and characterisation of recombinant forms of human pulmonary surfactant protein C (SP-C)
DEFF Research Database (Denmark)
Lukovic, Dunja; Plasencia, Inés; Taberner, Francisco J
2006-01-01
Surfactant protein C (SP-C) is an essential component for the surface tension-lowering activity of the pulmonary surfactant system. It contains a valine-rich alpha helix that spans the lipid bilayer, and is one of the most hydrophobic proteins known so far. SP-C is also an essential component of ...
C-reactive (CRP) protein in transfusion dependent thalassaemic patients
International Nuclear Information System (INIS)
Jokhio, R.; Mughal, Z.U.N.
2009-01-01
In thalassaemic patients iron overload, secondary to blood transfusion, results toxic effects by producing reactive radicals. Iron overload can be studied using serum ferritin level which has a direct correlation with the body's iron status. While oxidative damage can be studied using biomarker of inflammation like hsC-reactive proteins. Blood samples of 55 thalassaemic patients (39 males, 16 females) were collected from Fatmid Foundation (Hyderabad). The samples were analyzed for CBC, serum ferritin level and hsC-reactive proteins. High mean serum ferritin levels was found in all the patients regardless of the frequency of blood transfusion (4774.2135+-3143.3040 mu g/L), indicating the iron overload. High mean hsC-reactive protein was found (2.5151+-1.3712) with a positive correlation with ferritin (r= 0.8371198, p= 0.0000) and platelets (r= 0.43293443, p=0.000962175). C-reactive proteins serve as biomarker of various inflammatory conditions, progression of cardiovascular diseases and as indicator of morbidity and mortality. High C-reactive proteins in these patients indicate ongoing iron overload toxicity related damage in these patients. The estimation of hsC-reactive proteins and other biomarkers of inflammation and oxidation may help in better management of these patients. (author)
HCVpro: Hepatitis C virus protein interaction database
Kwofie, Samuel K.; Schaefer, Ulf; Sundararajan, Vijayaraghava Seshadri; Bajic, Vladimir B.; Christoffels, Alan G.
2011-01-01
It is essential to catalog characterized hepatitis C virus (HCV) protein-protein interaction (PPI) data and the associated plethora of vital functional information to augment the search for therapies, vaccines and diagnostic biomarkers
Nanosized f.c.c. thallium inclusions in aluminium
International Nuclear Information System (INIS)
Johnson, E.; Johansen, A.; Thoft, N.B.; Andersen, H.H.; Sarholt-Kristensen, L.
1993-01-01
Ion implantation of pure aluminium with thallium induces the formation of nanosized crystalline inclusions of thallium with a f.c.c. structure. The size of the inclusions depends on the implantation conditions and subsequent annealing treatments and is typically in the range from 1 to 10 nm. The inclusions are aligned topotactically with the aluminium matrix with a cube-cube orientation relationship and they have a truncated octahedral shape bounded by {111} and {001} planes. The lattice parameter of the f.c.c. thallium inclusions is 0.484 ± 0.002 nm, which is slightly but significantly larger than in the high-pressure f.c.c. thallium phase known to be stable above 3.8 GPa. (Author)
Leiterer, Christian; Deckert-Gaudig, Tanja; Singh, Prabha; Wirth, Janina; Deckert, Volker; Fritzsche, Wolfgang
2015-05-01
Tip-enhanced Raman spectroscopy, a combination of Raman spectroscopy and scanning probe microscopy, is a powerful technique to detect the vibrational fingerprint of molecules at the nanometer scale. A metal nanoparticle at the apex of an atomic force microscope tip leads to a large enhancement of the electromagnetic field when illuminated with an appropriate wavelength, resulting in an increased Raman signal. A controlled positioning of individual nanoparticles at the tip would improve the reproducibility of the probes and is quite demanding due to usually serial and labor-intensive approaches. In contrast to commonly used submicron manipulation techniques, dielectrophoresis allows a parallel and scalable production, and provides a novel approach toward reproducible and at the same time affordable tip-enhanced Raman spectroscopy tips. We demonstrate the successful positioning of an individual plasmonic nanoparticle on a commercial atomic force microscope tip by dielectrophoresis followed by experimental proof of the Raman signal enhancing capabilities of such tips. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yinghao, Cui; He, Xue; Lingyan, Zhao
2017-12-01
It’s important to obtain accurate stress corrosion crack(SCC) growth rate for quantitative life prediction of components in nuclear power plants. However, the engineering practice shows that the crack tip constraint effect has a great influence on the mechanical properties and crack growth rate of SCC at crack tip. To study the influence of the specimen thickness on the crack tip mechanical properties of SCC, the stress, strain and C integral at creep crack tip are analyzed under different specimens thickness. Results show that the cracked specimen is less likely to crack due to effect of crack tip constraint. When the thickness ratio B/W is larger than 0.1, the crack tip constraint is almost ineffective. Value of C integral is the largest when B/W is 0.25. Then specimen thickness has little effect on the value of C integral. The effect of specimen thickness on the value of C integral is less significant at higher thickness ratio.
Park, Sungjin; Szumlanski, Amy L; Gu, Fangwei; Guo, Feng; Nielsen, Erik
2011-07-17
In plants, cell shape is defined by the cell wall, and changes in cell shape and size are dictated by modification of existing cell walls and deposition of newly synthesized cell-wall material. In root hairs, expansion occurs by a process called tip growth, which is shared by root hairs, pollen tubes and fungal hyphae. We show that cellulose-like polysaccharides are present in root-hair tips, and de novo synthesis of these polysaccharides is required for tip growth. We also find that eYFP-CSLD3 proteins, but not CESA cellulose synthases, localize to a polarized plasma-membrane domain in root hairs. Using biochemical methods and genetic complementation of a csld3 mutant with a chimaeric CSLD3 protein containing a CESA6 catalytic domain, we provide evidence that CSLD3 represents a distinct (1→4)-β-glucan synthase activity in apical plasma membranes during tip growth in root-hair cells.
Epigenetic control of learning and memory in Drosophila by Tip60 HAT action.
Xu, Songjun; Wilf, Rona; Menon, Trisha; Panikker, Priyalakshmi; Sarthi, Jessica; Elefant, Felice
2014-12-01
Disruption of epigenetic gene control mechanisms in the brain causes significant cognitive impairment that is a debilitating hallmark of most neurodegenerative disorders, including Alzheimer's disease (AD). Histone acetylation is one of the best characterized of these epigenetic mechanisms that is critical for regulating learning- and memory- associated gene expression profiles, yet the specific histone acetyltransferases (HATs) that mediate these effects have yet to be fully characterized. Here, we investigate an epigenetic role for the HAT Tip60 in learning and memory formation using the Drosophila CNS mushroom body (MB) as a well-characterized cognition model. We show that Tip60 is endogenously expressed in the Kenyon cells, the intrinsic neurons of the MB, and in the MB axonal lobes. Targeted loss of Tip60 HAT activity in the MB causes thinner and shorter axonal lobes while increasing Tip60 HAT levels cause no morphological defects. Functional consequences of both loss and gain of Tip60 HAT levels in the MB are evidenced by defects in immediate-recall memory. Our ChIP-Seq analysis reveals that Tip60 target genes are enriched for functions in cognitive processes, and, accordingly, key genes representing these pathways are misregulated in the Tip60 HAT mutant fly brain. Remarkably, we find that both learning and immediate-recall memory deficits that occur under AD-associated, amyloid precursor protein (APP)-induced neurodegenerative conditions can be effectively rescued by increasing Tip60 HAT levels specifically in the MB. Together, our findings uncover an epigenetic transcriptional regulatory role for Tip60 in cognitive function and highlight the potential of HAT activators as a therapeutic option for neurodegenerative disorders. Copyright © 2014 by the Genetics Society of America.
Safety Tips: Basketball (For Parents)
... Staying Safe Videos for Educators Search English Español Safety Tips: Basketball KidsHealth / For Parents / Safety Tips: Basketball ... make sure they follow these tips. Why Basketball Safety Is Important Fortunately, very few basketball injuries are ...
[Expression of c-jun protein after experimental rat brain concussion].
Wang, Feng; Li, Yong-hong
2010-02-01
To observe e-jun protein expression after rat brain concussion and explore the forensic pathologic markers following brain concussion. Fifty-five rats were randomly divided into brain concussion group and control group. The expression of c-jun protein was observed by immunohistochemistry. There were weak positive expression of c-jun protein in control group. In brain concussion group, however, some neutrons showed positive expression of c-jun protein at 15 min after brain concussion, and reach to the peak at 3 h after brain concussion. The research results suggest that detection of c-jun protein could be a marker to determine brain concussion and estimate injury time after brain concussion.
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... the liver). Portal hypertension can also occur in children, although children are much less likely to require a TIPS. ... intentionally to solve the problem. Although extremely rare, children may also require a TIPS procedure. TIPS in ...
Sub-10-micrometer toughening and crack tip toughness of dental enamel.
Ang, Siang Fung; Schulz, Anja; Pacher Fernandes, Rodrigo; Schneider, Gerold A
2011-04-01
In previous studies, enamel showed indications to occlude small cracks in-vivo and exhibited R-curve behaviors for bigger cracks ex-vivo. This study quantifies the crack tip's toughness (K(I0),K(III0)), the crack's closure stress and the cohesive zone size at the crack tip of enamel and investigates the toughening mechanisms near the crack tip down to the length scale of a single enamel crystallite. The crack-opening-displacement (COD) profile of cracks induced by Vickers indents on mature bovine enamel was studied using atomic force microscopy (AFM). The mode I crack tip toughness K(I0) of cracks along enamel rod boundaries and across enamel rods exhibit a similar range of values: K(I0,Ir)=0.5-1.6MPa m(0.5) (based on Irwin's 'near-field' solution) and K(I0,cz)=0.8-1.5MPa m(0.5) (based on the cohesive zone solution of the Dugdale-Muskhelishvili (DM) crack model). The mode III crack tip toughness K(III0,Ir) was computed as 0.02-0.15MPa m(0.5). The crack-closure stress at the crack tip was computed as 163-770 MPa with a cohesive zone length and width 1.6-10.1μm and 24-44 nm utilizing the cohesive zone solution. Toughening elements were observed under AFM and SEM: crack bridging due to protein ligament and hydroxyapatite fibres (micro- and nanometer scale) as well as microcracks were identified. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.
C-reactive protein, fibrinogen, and cardiovascular disease prediction
DEFF Research Database (Denmark)
Kaptoge, Stephen; Di Angelantonio, Emanuele; Pennells, Lisa
2012-01-01
There is debate about the value of assessing levels of C-reactive protein (CRP) and other biomarkers of inflammation for the prediction of first cardiovascular events.......There is debate about the value of assessing levels of C-reactive protein (CRP) and other biomarkers of inflammation for the prediction of first cardiovascular events....
Presenilin dependence of phospholipase C and protein kinase C signaling
DEFF Research Database (Denmark)
Dehvari, Nodi; Cedazo-Minguez, Angel; Isacsson, Ola
2007-01-01
-stimulated phospholipase C (PLC) activity which was gamma-secretase dependent. To further evaluate the dependence of PLC on PSs we measured PLC activity and the activation of variant protein kinase C (PKC) isoforms in mouse embryonic fibroblasts (MEFs) lacking either PS1, PS2, or both. PLC activity and PKCalpha...
Corder, Lloyd E.; And Others
This manual of telephone behavior tips for business and sales professionals offers ways to handle the disgruntled caller and makes suggestions on topics relevant to the telephone. The manual is divided into the following sections and subsections: (1) Common Courtesy (staff tips, answering the telephone, screening calls, transferring calls, taking…
Control of droplet morphology for inkjet-printed TIPS-pentacene transistors
Lee, Myung Won; Ryu, Gi Seong; Lee, Young Uk; Pearson, Christopher; Petty, Michael C.; Song, Chung Kun
2012-01-01
We report on methods to control the morphology of droplets of 6,13-bis(triisopropyl-silylethynyl) pentacene (TIPS-PEN), which are then used in the fabrication of organic thin film transistors (OTFTs). The grain size and distribution of the TIPS-PEN were found to depend on the temperature of the droplets during drying. The performance of the OTFTs could be improved by heating the substrate and also by changing the relative positions of the inkjet-printed droplets. In our experiments, the optimum substrate temperature was 46 °C in air. Transistors with the TIPS-PEN grain boundaries parallel to the current flow between the source and drain electrodes exhibited charge carrier mobilities of 0.44 ± 0.08 cm2/V s.
Pang, Yongqi; Li, Lijuan; Ren, Fei; Lu, Pingli; Wei, Pengcheng; Cai, Jinghui; Xin, Lingguo; Zhang, Juan; Chen, Jia; Wang, Xuechen
2010-06-01
Boron (B) toxicity to plants is responsible for low crop productivity in many regions of the world. Here we report a novel and effective means to alleviate the B toxicity to plants under high B circumstance. Functional characterization of AtTIP5;1, an aquaporin gene, revealed that overexpression of AtTIP5;1 (OxAtTIP5;1) in Arabidopsis significantly increased its tolerance to high B toxicity. Compared to wild-type plants, OxAtTIP5;1 plants exhibited longer hypocotyls, accelerated development, increased silique production under high B treatments. GUS staining and quantitative RT-PCR (qRT-PCR) results demonstrated that the expression of AtTIP5;1 was induced by high B concentration treatment. Subcellular localization analysis revealed that the AtTIP5;1-GFP fusion protein was localized on the tonoplast membrane, which was consistent with the prediction based on bioinformatics. Taken together, our results suggest that AtTIP5;1 is involved in B transport pathway possibly via vacuolar compartmentation for B, and that overexpression of AtTIP5;1 in plants may provide an effective way to overcome the problem resulting from high B concentration toxicity. Copyright 2010 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hongyun Nie
2016-01-01
Full Text Available Protocadherin 15 (PCDH15 is a core component of hair cell tip-links and crucial for proper function of inner ear hair cells. Mutations of PCDH15 gene cause syndromic and nonsyndromic hearing loss. At present, the regulatory mechanisms responsible for the intracellular transportation of PCDH15 largely remain unknown. Here we show that PIST, a Golgi-associated, PDZ domain-containing protein, interacts with PCDH15. The interaction is mediated by the PDZ domain of PIST and the C-terminal PDZ domain-binding interface (PBI of PCDH15. Through this interaction, PIST retains PCDH15 in the trans-Golgi network (TGN and reduces the membrane expression of PCDH15. We have previously showed that PIST regulates the membrane expression of another tip-link component, cadherin 23 (CDH23. Taken together, our finding suggests that PIST regulates the intracellular trafficking and membrane targeting of the tip-link proteins CDH23 and PCDH15.
Identification of the protein kinase C phosphorylation site in neuromodulin
International Nuclear Information System (INIS)
Apel, E.D.; Byford, M.F.; Au, D.; Walsh, K.A.; Storm, D.R.
1990-01-01
Neuromodulin (P-57, GAP-43, B-50, F-1) is a neurospecific calmodulin binding protein that is phosphorylated by protein kinase C. Phosphorylation by protein kinase C has been shown to abolish the affinity of neuromodulin for calmodulin and the authors have proposed that the concentration of free CaM in neurons may be regulated by phosphorylation and dephosphorylation of neuromodulin. The purpose of this study was to identify the protein kinase C phosphorylation site(s) in neuromodulin using recombinant neuromodulin as a substrate. Toward this end, it was demonstrated that recombinant neuromodulin purified from Escherichia coli and bovine neuromodulin were phosphorylated with similar K m values and stoichiometries and that protein kinase C mediated phosphorylation of both proteins abolished binding to calmodulin-Sepharose. Recombinant neuromodulin was phosphorylated by using protein kinase C and [γ- 32 P]ATP and digested with trypsin, and the resulting peptides were separated by HPLC. Only one 32 P-labeled tryptic peptide was generated from phosphorylated neuromodulin. They conclude that serine-41 is the protein kinase C phosphorylation site of neuromodulin and that phosphorylation of this amino acid residue blocks binding of calmoculin to neuromodulin. The proximity of serine-41 to the calmodulin binding domain in neuromodulin very likely explains the effect of phosphorylation on the affinity of neuromodulin for calmodulin
Compressive strength of dental composites photo-activated with different light tips
International Nuclear Information System (INIS)
Galvão, M R; Campos, E A; Rastelli, A N S; Andrade, M F; Caldas, S G F R; Calabrez-Filho, S; Bagnato, V S
2013-01-01
The aim of this study was to evaluate the compressive strength of microhybrid (Filtek™ Z250) and nanofilled (Filtek™ Supreme XT) composite resins photo-activated with two different light guide tips, fiber optic and polymer, coupled with one LED. The power density was 653 mW cm −2 when using the fiber optic light tip and 596 mW cm −2 with the polymer. After storage in distilled water at 37 ± 2 °C for seven days, the samples were subjected to mechanical testing of compressive strength in an EMIC universal mechanical testing machine with a load cell of 5 kN and speed of 0.5 mm min −1 . The statistical analysis was performed using ANOVA with a confidence interval of 95% and Tamhane’s test. The results showed that the mean values of compressive strength were not influenced by the different light tips (p > 0.05). However, a statistical difference was observed (p < 0.001) between the microhybrid composite resin photo-activated with the fiber optic light tip and the nanofilled composite resin. Based on these results, it can be concluded that microhybrid composite resin photo-activated with the fiber optic light tip showed better results than nanofilled, regardless of the tip used, and the type of the light tip did not influence the compressive strength of either composite. Thus, the presented results suggest that both the fiber optic and polymer light guide tips provide adequate compressive strength to be used to make restorations. However, the fiber optic light tip associated with microhybrid composite resin may be an interesting option for restorations mainly in posterior teeth. (paper)
Dissociation of activated protein C functions by elimination of protein S cofactor enhancement.
LENUS (Irish Health Repository)
Harmon, Shona
2008-11-07
Activated protein C (APC) plays a critical anticoagulant role in vivo by inactivating procoagulant factor Va and factor VIIIa and thus down-regulating thrombin generation. In addition, APC bound to the endothelial cell protein C receptor can initiate protease-activated receptor-1 (PAR-1)-mediated cytoprotective signaling. Protein S constitutes a critical cofactor for the anticoagulant function of APC but is not known to be involved in regulating APC-mediated protective PAR-1 signaling. In this study we utilized a site-directed mutagenesis strategy to characterize a putative protein S binding region within the APC Gla domain. Three single amino acid substitutions within the APC Gla domain (D35T, D36A, and A39V) were found to mildly impair protein S-dependent anticoagulant activity (<2-fold) but retained entirely normal cytoprotective activity. However, a single amino acid substitution (L38D) ablated the ability of protein S to function as a cofactor for this APC variant. Consequently, in assays of protein S-dependent factor Va proteolysis using purified proteins or in the plasma milieu, APC-L38D variant exhibited minimal residual anticoagulant activity compared with wild type APC. Despite the location of Leu-38 in the Gla domain, APC-L38D interacted normally with endothelial cell protein C receptor and retained its ability to trigger PAR-1 mediated cytoprotective signaling in a manner indistinguishable from that of wild type APC. Consequently, elimination of protein S cofactor enhancement of APC anticoagulant function represents a novel and effective strategy by which to separate the anticoagulant and cytoprotective functions of APC for potential therapeutic gain.
Function and regulation of plant major intrinsic proteins
DEFF Research Database (Denmark)
Popovic, Milan
;1 in Arabidopsis. That led to the discovery that tip4;1 is gametophytic lethal- gene essential for normal seed set. ICP-MS analyses of the elemental composition of tip4;1 heterozygous T-DNA insert mutant plants and 35S::TIP4;1 over-expression plants indicate that AtTIP4;1 has a role in arsenic distribution...... inorganic forms of arsenic in the environment, can be taken up by plants and thus enter the food chain. Once inside the root cells, As(V) is reduced to As(III) which is then extruded to the soil solution or bound to phytochelatins (PCs) and transported to the vacuole in an effort to accomplish...... detoxification. Plant Noduline 26-like Intrinsic Proteins (NIPs) can channel As(III) and consequently influence the detoxification process. The role of the Tonoplast Intrinsic Proteins (TIPs) in As(III) detoxification remains to be clarified, yet TIPs could have an impact on As(III) accumulation in plant cell...
Protein C Inhibitor-A Novel Antimicrobial Agent
Malmström, E.; Mörgelin, M.; Malmsten, M.; Johansson, L.; Norrby-Teglund, A.; Shannon, O.; Schmidtchen, A.; Meijers, J.C.M.; Herwald, H.
2009-01-01
Protein C inhibitor (PCI) is a heparin-binding serine proteinase inhibitor belonging to the family of serpin proteins. Here we describe that PCI exerts broad antimicrobial activity against bacterial pathogens. This ability is mediated by the interaction of PCI with lipid membranes, which
An F-actin-depleted zone is present at the hyphal tip of invasive hyphae of Neurospora crassa.
Suei, S; Garrill, A
2008-01-01
The distribution of filamentous actin (F-actin) in invasive and noninvasive hyphae of the ascomycete Neurospora crassa was investigated. Eighty six percent of noninvasive hyphae had F-actin in the tip region compared to only 9% of invasive hyphae. The remaining 91% of the invasive hyphae had no obvious tip high concentration of F-actin staining; instead they had an F-actin-depleted zone in this region, although some F-actin, possibly associated with the Spitzenkörper, remained at the tip. The size of the F-actin-depleted zone in invasive hyphae increased with an increase in agar concentration. The membrane stain FM 4-64 reveals a slightly larger accumulation of vesicles at the tips of invasive hyphae relative to noninvasive hyphae, although this difference is unlikely to be sufficient to account for the exclusion of F-actin from the depleted zone. Antibodies raised against the actin filament-severing protein cofilin from both yeast and human cells localize to the tips of invasive hyphae. The human cofilin antibody shows a more random distribution in noninvasive hyphae locating primarily at the hyphal periphery but with some diffuse cytoplasmic staining. This antibody also identifies a single band at 21 kDa in immunoblots of whole hyphal fractions. These data suggest that a protein with epitopic similarity to cofilin may function in F-actin dynamics that underlie invasive growth. The F-actin-depleted zone may play a role in the regulation of tip yielding to turgor pressure, thus increasing the protrusive force necessary for invasive growth.
Short Linear Sequence Motif LxxPTPh Targets Diverse Proteins to Growing Microtubule Ends
Kumar, Anil; Manatschal, Cristina; Rai, Ankit; Grigoriev, Ilya; Degen, Miriam Steiner; Jaussi, Rolf; Kretzschmar, Ines; Prota, Andrea E; Volkmer, Rudolf; Kammerer, Richard A.; Akhmanova, Anna; Steinmetz, Michel O.
2017-01-01
Microtubule plus-end tracking proteins (+TIPs) are involved in virtually all microtubule-based processes. End-binding (EB) proteins are considered master regulators of +TIP interaction networks, since they autonomously track growing microtubule ends and recruit a plethora of proteins to this
DEFF Research Database (Denmark)
Shin, K. W.; Andersen, Poul
2015-01-01
The blade tip loading is often reduced as an effort to restrain sheet and tip vortex cavitation in the design of marine propellers. This CFD analysis demonstrates that an excessive reduction of the tip loading can cause cloud cavitation responsible for much of noise and surface erosion. Detached...
High frequency plant regeneration from shoot tip explants of ...
African Journals Online (AJOL)
USER
2010-08-02
Aug 2, 2010 ... 16/8-h (light/dark) photoperiod provided by cool white fluorescent light. Multiple .... formation from shoot tip explant of C. colocynthis on MS-medium. S. No. .... micropropagation of Musa sapientum L. (Cavendish Dwarf). Afr. J.
... Test Pain, Discomfort and Anxiety Tips to Help Children through Their Medical Tests Tips to Help the Elderly through Their Medical Tests Find Us On Social Media: Facebook Twitter Google Plus Footer Menu Home About ...
Energy Technology Data Exchange (ETDEWEB)
Dong, Wenjie, E-mail: dongwenjie200581@126.com [Department of Internal Medicine-Oncology, The First Affiliated Hospital, Zhengzhou University (China); Shen, Ruizhe; Cheng, Shidan [Department of Gastroenterology, Rui-jin Hospital, Shanghai Jiao Tong University, Shanghai (China)
2014-10-31
Highlights: • TIP30 expression is frequently suppressed in ESCC. • TIP30 was hypermethylated in ESCC. • Reduction of TIP30 was significantly correlated with LN metastasis. • miR-10b is a direct regulator of TIP30. - Abstract: TIP30 is a putative tumor suppressor that can promote apoptosis and inhibit angiogenesis. However, the role of TIP30 in esophageal squamous cell carcinoma (ESCC) biology has not been investigated. Immunohistochemistry was used to investigate the expression of TIP30 in 70 ESCC. Hypermethylation of TIP30 was evaluated by the methylation specific PCR (MSP) method in ESCC (tumor and paired adjacent non-tumor tissues). Lost expression of TIP30 was observed in 50 of 70 (71.4%) ESCC. 61.4% (43 of 70) of primary tumors analyzed displayed TIP30 hypermethylation, indicating that this aberrant characteristic is common in ESCC. Moreover, a statistically significant inverse association was found between TIP30 methylation status and expression of the TIP30 protein in tumor tissues (p = 0.001). We also found that microRNA-10b (miR-10b) targets a homologous DNA region in the 3′untranslated region of the TIP30 gene and represses its expression at the transcriptional level. Reporter assay with 3′UTR of TIP30 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-10b, providing strong evidence that miR-10b is a direct regulator of TIP30. These results suggest that TIP30 expression is regulated by promoter methylation and miR-10b in ESCC.
International Nuclear Information System (INIS)
Anik, E; Abdulrahim, A; Ostovan, Y; Mercan, B; Uzol, O
2014-01-01
This study is part of an on-going experimental research campaign that focuses on the active control of the tip leakage/vortex characteristics of a model horizontal axis wind turbine rotor using tip injection. This paper presents both baseline (no-injection) data as well as data with tip injection, concentrating on the effects of tip injection on power and thrust variations with the Tip Speed Ratio (TSR). The experiments are conducted by placing a specially designed 3-bladed model wind turbine rotor at the exit of a 1.7 m diameter open-jet wind tunnel. The rotor blades are non-linearly twisted and tapered with NREL S826 airfoil profile all along the span. The nacelle, hub and the blades are specifically designed to allow pressurized air to pass through and get injected from the blade tips while the rotor is rotating. Baseline results show that the general trends are as expected for a small wind turbine and the maximum power coefficient is reached at around TSR=4.5. Results with injection show that the tip injection has significant effect on the power and thrust coefficients in comparison to the baseline data, especially at TSR values higher than the max C P TSR value. Both coefficients seem to be significantly increased due to tip injection and the max C P TSR value also gets shifted to a slightly higher TSR value. Tip injection seems to have no significant effect for TSR values less than 3.5
Chemically etched fiber tips for near-field optical microscopy: a process for smoother tips.
Lambelet, P; Sayah, A; Pfeffer, M; Philipona, C; Marquis-Weible, F
1998-11-01
An improved method for producing fiber tips for scanning near-field optical microscopy is presented. The improvement consists of chemically etching quartz optical fibers through their acrylate jacket. This new method is compared with the previous one in which bare fibers were etched. With the new process the meniscus formed by the acid along the fiber does not move during etching, leading to a much smoother surface of the tip cone. Subsequent metallization is thus improved, resulting in better coverage of the tip with an aluminum opaque layer. Our results show that leakage can be avoided along the cone, and light transmission through the tip is spatially limited to an optical aperture of a 100-nm dimension.
Lifescience Database Archive (English)
Full Text Available CCAAG sequence update 2001. 3.22 Translated Amino Acid sequence nxnrnkkikkxnk*ixyqiyi*xnx*inkmsx...kinlqknplppqkmknnnnfyfiqkk*nkikkrs*kke*nkktk Translated Amino Acid sequence (All Frames) Frame A: nxnrnkkikkxnk*ixyqiyi*xnx*inkmsx
... Staying Safe Videos for Educators Search English Español ADHD: Tips to Try KidsHealth / For Teens / ADHD: Tips to Try Print en español TDAH: Consejos que puedes probar ADHD , short for attention deficit hyperactivity disorder , is a ...
Directory of Open Access Journals (Sweden)
Katherine Mills-Lujan
Full Text Available Even though plant cells are highly plastic, plants only develop hyperplasia under very specific abiotic and biotic stresses, such as when exposed to pathogens like Beet curly top virus (BCTV. The C4 protein of BCTV is sufficient to induce hyperplasia and alter Arabidopsis development. It was previously shown that C4 interacts with two Arabidopsis Shaggy-like protein kinases, AtSK21 and 23, which are negative regulators of brassinosteroid (BR hormone signaling. Here we show that the C4 protein interacts with five additional AtSK family members. Bikinin, a competitive inhibitor of the seven AtSK family members that interact with C4, induced hyperplasia similar to that induced by the C4 protein. The Ser49 residue of C4 was found to be critical for C4 function, since: 1 mutagenesis of Ser49 to Ala abolished the C4-induced phenotype, abolished C4/AtSK interactions, and resulted in a mutant protein that failed to induce changes in the BR signaling pathway; 2 Ser49 is phosphorylated in planta; and 3 plant-encoded AtSKs must be catalytically active to interact with C4. A C4 N-myristoylation site mutant that does not localize to the plasma membrane and does not induce a phenotype, retained the ability to bind AtSKs. Taken together, these results suggest that plasma membrane associated C4 interacts with and co-opts multiple AtSKs to promote its own phosphorylation and activation to subsequently compromise cell cycle control.
C2 Domains as Protein-Protein Interaction Modules in the Ciliary Transition Zone
Directory of Open Access Journals (Sweden)
Kim Remans
2014-07-01
Full Text Available RPGR-interacting protein 1 (RPGRIP1 is mutated in the eye disease Leber congenital amaurosis (LCA and its structural homolog, RPGRIP1-like (RPGRIP1L, is mutated in many different ciliopathies. Both are multidomain proteins that are predicted to interact with retinitis pigmentosa G-protein regulator (RPGR. RPGR is mutated in X-linked retinitis pigmentosa and is located in photoreceptors and primary cilia. We solved the crystal structure of the complex between the RPGR-interacting domain (RID of RPGRIP1 and RPGR and demonstrate that RPGRIP1L binds to RPGR similarly. RPGRIP1 binding to RPGR affects the interaction with PDEδ, the cargo shuttling factor for prenylated ciliary proteins. RPGRIP1-RID is a C2 domain with a canonical β sandwich structure that does not bind Ca2+ and/or phospholipids and thus constitutes a unique type of protein-protein interaction module. Judging from the large number of C2 domains in most of the ciliary transition zone proteins identified thus far, the structure presented here seems to constitute a cilia-specific module that is present in multiprotein transition zone complexes.
International Nuclear Information System (INIS)
Cooper, R.H.; Johanson, R.A.; Wiliamson, J.R.
1986-01-01
Receptor-mediated breakdown of inositol lipids produces two intracellular signals, diacylglycerol, which activates protein kinase C, and inositol trisphosphate, which causes release of intracellular vesicular Ca 2+ . This study examined the effects of Ca 2+ -ionophores, vasopressin, phenylephrine, and phorbol ester (PMA) on hepatocyte protein phosphorylations. [ 32 P] Phosphoproteins from hepatocytes prelabeled with 32 P were resolved by 2-dimensional SDS-PAGE and corresponding autoradiographs were quantitated by densitometric analysis. The phosphorylation of five proteins, a plasma membrane bound 16 kDa protein with pI 6.4, a cytosolic 16 kDa protein with pI 5.8, and proteins with Mr's of 36 kDa, 52 kDa, and 68 kDa, could be attributed to phosphorylation by protein kinase C since the phosphorylation was stimulated by PMA. When the vasopressin concentration was varied, low vasopressin stimulated the phosphorylation of only the membrane bound 16 kDa protein of the above set of proteins, while higher vasopressin concentrations were required to stimulate the phosphorylation of all five proteins. Phenylephrine, even at supramaximal concentrations, stimulated the phosphorylation of only the membrane bound 16 kDa protein. These results suggest that phenylephrine is a less potent activator of protein kinase C than vasopressin by virtue of limited or localized diacylglycerol production
Relationship between C-Reactive Protein and Body Mass Index in ...
African Journals Online (AJOL)
Background. C-reactive protein is an acute-phase protein synthesized in the liver and its release is stimulated by cytokines (interleukin 6 and tumour necrosis factor alpha). Baseline levels of C-reactive protein in apparently healthy men and women predict long-term risk of a first myocardial infarction. In older men and ...
Thorn, Craig E.; Chasman, Chellis; Baltz, Anthony J.
1984-04-24
An improved magnet which more easily provides a radially increasing magnetic field, as well as reduced fringe field and requires less power for a given field intensity. The subject invention comprises a pair of spaced, opposed magnetic poles which further comprise a pair of pole roots, each having a pole tip attached to its center. The pole tips define the gap between the magnetic poles and at least a portion of each pole tip is separated from its associated pole root. The separation begins at a predetermined distance from the center of the pole root and increases with increasing radial distance while being constant with azimuth within that portion. Magnets in accordance with the subject invention have been found to be particularly advantageous for use in large isochronous cyclotrons.
Energy Technology Data Exchange (ETDEWEB)
Xiang, Zhonghua; Qiao, Ling; Zhou, Yan [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada); Babiuk, Lorne A. [University of Alberta, Edmonton, Alberta (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada)
2010-11-19
Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.
International Nuclear Information System (INIS)
Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang
2010-01-01
Research highlights: → A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. → HCV-3a NS5A increases mature SREBP-1c protein level. → HCV-3a NS5A activates SREBP-1c transcription. → Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. → Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.
Numerical investigation of J-characterization of growing crack tips
International Nuclear Information System (INIS)
Nilsson, F.
1992-01-01
Two different geometries, a centrally cracked panel and a three-point bend bar, are modelled with aid of the finite element program ABAQUS. Elastic-plastic behaviour with a realistic linear hardening modulus is assumed. By simulation of the growth with the aid of nodal relaxation, the J-value for a remote path around the growing tip is obtained for some different local-crack growth histories. The J F -value is compared to the J D -value that results if the crack tip is assumed to be stationary at the current length. It is found that the J C - and J F -values agree well for crack growth histories satisfying the criteria for J-characterization. However, after examination of the crack surface displacements it was found that the results for the bend geometry and the tension geometry, respectively, did not coincide for corresponding J-values, except at low load levels. This raises doubt about the abilities of J to characterize the state at a growing tip. (orig.)
Association of protein C23 with rapidly labeled nucleolar RNA
International Nuclear Information System (INIS)
Herrera, A.H.; Olson, M.O.
1986-01-01
The association of nucleolar phosphoprotein C23 with preribosomal ribonucleoprotein (RNP) particles was examined in Novikoff hepatoma nucleoli. RNA was labeled with [ 3 H]uridine for various times in cell suspensions, and RNP particles were extracted from isolated nucleoli and fractionated by sucrose gradient ultracentrifugation. The majority of protein C23 cosedimented with fractions containing rapidly labeled RNA (RL fraction). To determine whether there was a direct association of RNA with protein C23, the RL fraction was exposed to ultraviolet (UV) light (254 nm) for short periods of time. After 2 min of exposure there was a 50% decrease in C23 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analyses, with no significant further decrease at longer times. When UV-treated fractions were subjected to phenol/chloroform extractions, as much as 30% of the labeled RNA was found in the phenol (protein) layer, indicating that RNA became cross-linked to protein. Similarly, there was an increase in protein C23 extracted into the water layer after irradiation. By SDS-PAGE analyses the cross-linked species migrated more slowly than protein C23, appearing as a smear detected either by [ 3 H]uridine radioactivity or by anti-C23 antibody. With anti-C23 antibodies, up to 25% of the labeled RNA was precipitated from the RL fraction. Dot-blot hybridizations, using cloned rDNA fragments as probes, indicated that the RNA in the RL fraction and the immunoprecipitated RNA contained sequences from 18S and 28S ribosomal RNA
C reactive protein and chronic obstructive pulmonary disease
DEFF Research Database (Denmark)
Dahl, Morten; Vestbo, Jørgen; Zacho, Jeppe
2011-01-01
It is unclear whether elevated plasma C reactive protein (CRP) is causally related to chronic obstructive pulmonary disease (COPD). The authors tested the hypothesis that genetically elevated plasma CRP causes COPD using a Mendelian randomisation design.......It is unclear whether elevated plasma C reactive protein (CRP) is causally related to chronic obstructive pulmonary disease (COPD). The authors tested the hypothesis that genetically elevated plasma CRP causes COPD using a Mendelian randomisation design....
Numerical investigation of three wind turbine blade tips
Energy Technology Data Exchange (ETDEWEB)
Johansen, J.; Soerensen, N.N.
2002-08-01
The complex three-dimensional flow around three different tip shapes on a rotating wind turbine blade is investigated and analyzed using Computational Fluid Dynamics. Differences in production, flap wise bending moments and forces are discussed. A method for determining the local inflow angle of attack is presented and further analysis is performed on lift and drag coefficients. It is shown that the original Standard tip results in a more concentrated tip vortex leading to a steeper gradient on both tangential and normal forces when approaching the tip, whereas the two tapered tips show a more flat behavior. This again leads to lower flap wise bending moments and lower production for the Standard tip compared to the two tapered tips. At 12 m/s, though, the Swept tip shows a separation pattern on the surface. This separation causes a decrease in normal force and an increase in tangential force. The Taper tip keeps the higher loading causing the flap wise bending moment to be higher as seen in measurements. To determine the radial variation of lift and drag coefficients the local inflow angle of attack is determined. It is shown that the Standard tip experiences a slightly larger angle of attack at the tip compared to the two tapered tips. The lift coefficients are kept at a more constant level for the two tapered tips due to the decrease in chord, while the drag coefficients actually decrease for the two tapered tips, especially for the Swept tip. For the Swept tip at 12 m/s both lift and drag coefficients changed considerably due to the separation. Differences in aerodynamic damping of the three tips were investigated using HAWCDAMP. The Standard tip seems to be slightly less damped with respect to the edgewise vibrations. (au)
Activated Protein C Drives the Hyperfibrinolysis of Acute Traumatic Coagulopathy.
Davenport, Ross A; Guerreiro, Maria; Frith, Daniel; Rourke, Claire; Platton, Sean; Cohen, Mitchell; Pearse, Rupert; Thiemermann, Chris; Brohi, Karim
2017-01-01
Major trauma is a leading cause of morbidity and mortality worldwide with hemorrhage accounting for 40% of deaths. Acute traumatic coagulopathy exacerbates bleeding, but controversy remains over the degree to which inhibition of procoagulant pathways (anticoagulation), fibrinogen loss, and fibrinolysis drive the pathologic process. Through a combination of experimental study in a murine model of trauma hemorrhage and human observation, the authors' objective was to determine the predominant pathophysiology of acute traumatic coagulopathy. First, a prospective cohort study of 300 trauma patients admitted to a single level 1 trauma center with blood samples collected on arrival was performed. Second, a murine model of acute traumatic coagulopathy with suppressed protein C activation via genetic mutation of thrombomodulin was used. In both studies, analysis for coagulation screen, activated protein C levels, and rotational thromboelastometry (ROTEM) was performed. In patients with acute traumatic coagulopathy, the authors have demonstrated elevated activated protein C levels with profound fibrinolytic activity and early depletion of fibrinogen. Procoagulant pathways were only minimally inhibited with preservation of capacity to generate thrombin. Compared to factors V and VIII, proteases that do not undergo activated protein C-mediated cleavage were reduced but maintained within normal levels. In transgenic mice with reduced capacity to activate protein C, both fibrinolysis and fibrinogen depletion were significantly attenuated. Other recognized drivers of coagulopathy were associated with less significant perturbations of coagulation. Activated protein C-associated fibrinolysis and fibrinogenolysis, rather than inhibition of procoagulant pathways, predominate in acute traumatic coagulopathy. In combination, these findings suggest a central role for the protein C pathway in acute traumatic coagulopathy and provide new translational opportunities for management of
Yeast Interacting Proteins Database: YFR049W, YOR047C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available protein kinase Snf1p, glucose sensors Snf3p and Rgt2p, and TATA-binding protein Spt15p; acts as a regulator... (0) YOR047C STD1 Protein involved in control of glucose-regulated gene expression; interacts with protein kinase Snf1p, glucose sens...ors Snf3p and Rgt2p, and TATA-binding protein Spt15p; ac
Lightning Safety Tips and Resources
... Services Careers Contact Us Glossary Safety National Program Lightning Safety Tips and Resources Weather.gov > Safety > Lightning Safety Tips and Resources Lightning Resources Lightning strikes ...
Serum lipids modify periodontal infection - C-reactive protein association.
Haro, Anniina; Saxlin, Tuomas; Suominen, Anna-Liisa; Ylöstalo, Pekka; Leiviskä, Jaana; Tervonen, Tellervo; Knuuttila, Matti
2012-09-01
To investigate whether low-grade inflammation-related factors such as serum low-density (LDL-C) and high-density lipoprotein cholesterol (HDL-C) modify the association between periodontal infection and C-reactive protein. This study was based on a subpopulation of the Health 2000 Survey, which consisted of dentate, non-diabetic, non-rheumatic subjects who were 30-49 years old (n = 2710). The extent of periodontal infection was measured by means of the number of teeth with periodontal pocket ≥4 mm and teeth with periodontal pocket ≥6 mm and systemic inflammation using high sensitive C-reactive protein. The extent of periodontal infection was associated with elevated levels of C-reactive protein among those subjects whose HDL-C value was below the median value of 1.3 mmol/l or LDL-C above the median value of 3.4 mmol/l. Among those with HDL-C ≥ 1.3 mmol/l or LDL-C ≤ 3.4 mmol/l, the association between periodontal infection and serum concentrations of C-reactive protein was practically non-existent. This study suggests that the relation of periodontal infection to the systemic inflammatory condition is more complicated than previously presumed. The findings of this study suggest that the possible systemic effect of periodontal infection is dependent on serum lipid composition. © 2012 John Wiley & Sons A/S.
M.G. Dallinga (Marchien); S.E.M. Boas (Sonja); I. Klaassen (Ingeborg); R.M.H. Merks (Roeland); C.J.F. van Noorden; R.O. Schlingemann (Reinier)
2015-01-01
htmlabstractIn angiogenesis, the process in which blood vessel sprouts grow out from a pre-existing vascular network, the so-called endothelial tip cells play an essential role. Tip cells are the leading cells of the sprouts; they guide following endothelial cells and sense their environment for
International Nuclear Information System (INIS)
Goennenwein, F.; Boersig, B.
1991-01-01
Cold fission is defined to be the limiting case of nuclear fission where virtually all of the available energy is converted into the total kinetic energy of the fragments. The fragments have, therefore, to be born in or at least close to their respective ground states. Starting from the viewpoint that cold fission corresponds to most compact scission configurations, energy constraints have been exploited to calculate minimum tip distances between the two nascent fragments in binary fission. Crucial input parameters to this tip model of cold fission are the ground-state deformations of fragment nuclei. It is shown that the minimum tip distances being compatible with energy conservation vary strongly with both the mass and charge fragmentation of the fission prone nucleus. The tip distances refer to nuclei with equivalent sharp surfaces. In keeping with the size of the surface width of leptodermous nuclei, only configurations where the tip distances are smaller than a few fm may be considered as valid scission configurations. From a comparison with experimental data on cold fission this critical tip distance appears to be 3.0 fm for the model parameters chosen. Whenever the model calculation yields tip distances being smaller than the critical value, a necessary condition for attaining cold fission is considered to be fulfilled. It is shown that this criterion allows to understand in fair agreement with experiment which mass fragmentations are susceptible to lead to cold fission and which fragment-charge divisions are the most favored in each isobaric mass chain. Being based merely on energy arguments, the model cannot aim at predicting fragment yields in cold fission. However, the tip model proposed appears well suited to delineate the phase space where cold fission phenomena may come into sight. (orig.)
Walia, J S; Chronister, C L
2001-10-01
Tonometer tips are used by optometrists to measure intraocular pressures. The recommended procedure of soaking in bleach solution kills bacteria and certain viruses, such as human immunodeficiency virus, herpes simplex virus-1 and herpes simplex virus-2, adenovirus 8, and hepatitis B, from the tip. Conversely, recommendations made in literature to sterilize equipment that may have come in contact with virus-contaminated tissue from patients with Creutzfeldt-Jakob disease have a somewhat tougher requirement. Autoclaving for 1 hour at a temperature of at least 120 degrees C (15 psi), or a 1-hour exposure to 0.5% sodium hypochlorite (a 10-fold dilution of household bleach) should provide excellent disinfection. One-hour exposure to 1 N Sodium hydroxide has also been mentioned in the literature. Studies have shown that corneas of guinea pigs with Cruetzfeldt-Jakob disease (C-J disease) are infectious. Infected corneas have been shown to cause transmission via corneal transplants, and via experimental placement of infected guinea pig's cornea into the anterior chamber of uninfected guinea pigs. Many researchers have strongly suggested that C-J disease can be iatrogenically transmitted via applanation tonometer tips. An epidemiologic case-controlled study found statistically significant odds ratio for intraocular pressure testing in the medical history of patients with C-J disease. Even though there have not been any proven studies confirming iatrogenic transmission through tonometer tips, optometrists should be cautious if a patient has C-J disease, or manifests symptoms of C-J disease and use alternatives to Goldmann applanation tonometry.
C-reactive protein and later preeclampsia
DEFF Research Database (Denmark)
Rebelo, Fernanda; Schlüssel, Michael M; Vaz, Juliana S
2013-01-01
This study aims to determine whether high C-reactive protein (CRP) concentration during pregnancy is associated with later preeclampsia and whether weight status (BMI) is a potential modifier of the relation between CRP and preeclampsia....
Kanamori, Mutsumi; Sandy, Peter; Marzinotto, Stefania; Benetti, Roberta; Kai, Chikatoshi; Hayashizaki, Yoshihide; Schneider, Claudio; Suzuki, Harukazu
2003-10-03
Wnt signaling is essential during development while deregulation of this pathway frequently leads to the formation of various tumors including colorectal carcinomas. A key component of the pathway is beta-catenin that, in association with TCF-4, directly regulates the expression of Wnt-responsive genes. To identify novel binding partners of beta-catenin that may control its transcriptional activity, we performed a mammalian two-hybrid screen and isolated the Tax-interacting protein (TIP-1). The in vivo complex formation between beta-catenin and TIP-1 was verified by coimmunoprecipitation, and a direct physical association was revealed by glutathione S-transferase pull-down experiments in vitro. By using a panel of deletion mutants of both proteins, we demonstrate that the interaction is mediated by the PDZ (PSD-95/DLG/ZO-1 homology) domain of TIP-1 and requires primarily the last four amino acids of beta-catenin. TIP-1 overexpression resulted in a dose-dependent decrease in the transcriptional activity of beta-catenin when tested on the TOP/FOPFLASH reporter system. Conversely, siRNA-mediated knock-down of endogenous TIP-1 slightly increased endogenous beta-catenin transactivation function. Moreover, we show that overexpression of TIP-1 reduced the proliferation and anchorage-independent growth of colorectal cancer cells. These data suggest that TIP-1 may represent a novel regulatory element in the Wnt/beta-catenin signaling pathway.
Early warning of climate tipping points
Lenton, Timothy M.
2011-07-01
A climate 'tipping point' occurs when a small change in forcing triggers a strongly nonlinear response in the internal dynamics of part of the climate system, qualitatively changing its future state. Human-induced climate change could push several large-scale 'tipping elements' past a tipping point. Candidates include irreversible melt of the Greenland ice sheet, dieback of the Amazon rainforest and shift of the West African monsoon. Recent assessments give an increased probability of future tipping events, and the corresponding impacts are estimated to be large, making them significant risks. Recent work shows that early warning of an approaching climate tipping point is possible in principle, and could have considerable value in reducing the risk that they pose.
AFM tip-sample convolution effects for cylinder protrusions
Shen, Jian; Zhang, Dan; Zhang, Fei-Hu; Gan, Yang
2017-11-01
A thorough understanding about the AFM tip geometry dependent artifacts and tip-sample convolution effect is essential for reliable AFM topographic characterization and dimensional metrology. Using rigid sapphire cylinder protrusions (diameter: 2.25 μm, height: 575 nm) as the model system, a systematic and quantitative study about the imaging artifacts of four types of tips-two different pyramidal tips, one tetrahedral tip and one super sharp whisker tip-is carried out through comparing tip geometry dependent variations in AFM topography of cylinders and constructing the rigid tip-cylinder convolution models. We found that the imaging artifacts and the tip-sample convolution effect are critically related to the actual inclination of the working cantilever, the tip geometry, and the obstructive contacts between the working tip's planes/edges and the cylinder. Artifact-free images can only be obtained provided that all planes and edges of the working tip are steeper than the cylinder sidewalls. The findings reported here will contribute to reliable AFM characterization of surface features of micron or hundreds of nanometers in height that are frequently met in semiconductor, biology and materials fields.
Energy Technology Data Exchange (ETDEWEB)
Gogolek, P. [Natural Resources Canada, Ottawa, ON (Canada). CANMET Energy Technology Centre
2004-07-01
This paper discusses the testing procedures and development of an improved flare tip design. Design objectives included performance equal to or better than utility flares at low wind speed; conversion efficiency; fuel slip; smoking; significant improvement at high wind speed; and no increase in trace emissions. A description of the testing facility of the flare tip was provided, with reference to the fact that the facility allowed for realistic near full scale gas flares in a single-pass flare test facility. Other details of the facility included: an adjustable ceiling; high capacity variable speed fan; sampling ports along working section in stack; windows along working section; and air cooled walls, floor, and ceiling. The fuels used in the flare tip included natural gas, propane, gasoline and inert gases. Details of wind speed, appurtenances and turbulence generating grids were presented, with reference to continuous gas emission measurements. A list of design constraints was provided. Flare performance included wind speed, turbulence and fuel composition. A chart of conversion inefficiencies with a correlation of wind speed and turbulence, fuel flow and pipe size was also presented. Several new tip designs were fabricated for testing, with screening tests for comparison to basic pipe and ranking designs. Significant improvements were found in one of the new designs, including results with 30 per cent propane in fuel. Emissions reduction from 10 to 35 per cent were noted. It was concluded that future work should focus on evaluating improved tip for stability at low wind speeds. Fuel slips are the primary source of emissions, and it was recommended that further research is necessary to improve existing flare tips. tabs, figs.
Tips and traps in the 14C bio-AMS preparation laboratory
International Nuclear Information System (INIS)
Buchholz, Bruce A.; Freeman, Stewart P.H.T.; Haack, Kurt W.; Vogel, John S.
2000-01-01
Maintaining a contamination free sample preparation lab for biological 14 C AMS requires the same or more diligence as a radiocarbon dating prep lab. Isotope ratios of materials routinely range over 4-8 orders of magnitude in a single experiment, dosing solutions contain thousands of DPM and gels used to separate proteins possess 14 C ratios of 1 amol 14 C/mg C. Radiocarbon contamination is a legacy of earlier tracer work in most biological laboratories, even if they were never hot labs. Removable surface contamination can be found and monitored using swipes. Contamination can be found on any surface routinely touched: door knobs, light switches, drawer handles, water faucets. In general, all surfaces routinely touched need to be covered with paper, foil or plastic that can be changed frequently. Shared air supplies can also present problems by distributing hot aerosols throughout a building. Aerosols can be monitored for 14 C content using graphitized coal or fullerene soot mixed with metal powder as an absorber. The monitors can be set out in work spaces for 1-2 weeks and measured by AMS with regular samples. Frequent air changes help minimize aerosol contamination in many cases. Cross-contamination of samples can be minimized by using disposable plastic or glassware in the prep lab, isolating samples from the air when possible and using positive displacement pipettors
Evolution and structural organization of the C proteins of paramyxovirinae.
Directory of Open Access Journals (Sweden)
Michael K Lo
Full Text Available The phosphoprotein (P gene of most Paramyxovirinae encodes several proteins in overlapping frames: P and V, which share a common N-terminus (PNT, and C, which overlaps PNT. Overlapping genes are of particular interest because they encode proteins originated de novo, some of which have unknown structural folds, challenging the notion that nature utilizes only a limited, well-mapped area of fold space. The C proteins cluster in three groups, comprising measles, Nipah, and Sendai virus. We predicted that all C proteins have a similar organization: a variable, disordered N-terminus and a conserved, α-helical C-terminus. We confirmed this predicted organization by biophysically characterizing recombinant C proteins from Tupaia paramyxovirus (measles group and human parainfluenza virus 1 (Sendai group. We also found that the C of the measles and Nipah groups have statistically significant sequence similarity, indicating a common origin. Although the C of the Sendai group lack sequence similarity with them, we speculate that they also have a common origin, given their similar genomic location and structural organization. Since C is dispensable for viral replication, unlike PNT, we hypothesize that C may have originated de novo by overprinting PNT in the ancestor of Paramyxovirinae. Intriguingly, in measles virus and Nipah virus, PNT encodes STAT1-binding sites that overlap different regions of the C-terminus of C, indicating they have probably originated independently. This arrangement, in which the same genetic region encodes simultaneously a crucial functional motif (a STAT1-binding site and a highly constrained region (the C-terminus of C, seems paradoxical, since it should severely reduce the ability of the virus to adapt. The fact that it originated twice suggests that it must be balanced by an evolutionary advantage, perhaps from reducing the size of the genetic region vulnerable to mutations.
Zhao, Peng; Wang, Ji-Gang; Gao, Peng; Li, Xia; Brewer, Rubell
2016-01-01
The aim of this study is to identify and subclassify sudden natural death (sudden death from natural diseases) cases in Seychelles. A total of 484 sudden natural death cases with autopsy at the Clinical Pathology Laboratory, Victoria Hospital, Seychelles between 1997 through 2012 were retrospectively reviewed. Among them, 363 cases (75%) were male and 121 (25%) were female. The most frequent sudden deaths were attributed to cardiovascular diseases (78.5%), and then followed by infectious diseases (9.9%), and gastrointestinal diseases (9.1%). This is the largest population-based study on sudden natural deaths in Seychelles. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Willemsen, O.H.; Kuipers, L.; van der Werf, Kees; de Grooth, B.G.; Greve, Jan
2000-01-01
The thermal movement of an atomic force microscope (AFM) tip is used to reconstruct the tip-surface interaction potential. If a tip is brought into the vicinity of a surface, its movement is governed by the sum of the harmonic cantilever potential and the tip-surface interaction potential. By
Activation of protein kinase C inhibits synthesis and release of decidual prolactin
International Nuclear Information System (INIS)
Harman, I.; Costello, A.; Ganong, B.; Bell, R.M.; Handwerger, S.
1986-01-01
Activation of calcium-activated, phospholipid-dependent protein kinase C by diacylglycerol and phorbol esters has been shown to mediate release of hormones in many systems. To determine whether protein kinase C activation is also involved in the regulation of prolactin release from human decidual, the authors have examined the effects of various acylglycerols and phorbol esters on the synthesis and release of prolactin from cultured human decidual cells. sn-1,2-Dioctanolyglycerol (diC 8 ), which is known to stimulate protein kinase C in other systems, inhibited prolactin release in a dose-dependent manner with maximal inhibition of 53.1% at 100 μM. Diolein (100 μM), which also stimulates protein kinase C activity in some systems, inhibited prolactin release by 21.3%. Phorbol 12-myristate 13-acetate (PMA), phorbol 12,13-didecanoate, and 4β-phorbol 12,13-dibutyrate, which activate protein kinase C in other systems, also inhibited the release of prolactin, which the protein kinase C inactivate 4α-phorbol-12,13-didecanoate was without effect. The inhibition of prolactin release was secondary to a decrease in prolactin synthesis. Although diC 8 and PMA inhibited the synthesis and release of prolactin, these agents had no effect on the synthesis or release of trichloroacetic acid-precipitable [ 35 S]methionine-labeled decidual proteins and did not cause the release of the cytosolic enzymes lactic dehydrogenase and alkaline phosphatase. DiC 8 and PMA stimulates the specific activity of protein kinase C in decidual tissue by 14.6 and 14.0-fold, respectively. The inhibition of the synthesis and release of prolactin by diC 8 and phorbol esters strongly implicates protein kinase C in the regulation of the production and release of prolactin from the decidua
Protein crystals as scanned probes for recognition atomic force microscopy.
Wickremasinghe, Nissanka S; Hafner, Jason H
2005-12-01
Lysozyme crystal growth has been localized at the tip of a conventional silicon nitride cantilever through seeded nucleation. After cross-linking with glutaraldehyde, lysozyme protein crystal tips image gold nanoparticles and grating standards with a resolution comparable to that of conventional tips. Force spectra between the lysozyme crystal tips and surfaces covered with antilysozyme reveal an adhesion force that drops significantly upon blocking with free lysozyme, thus confirming that lysozyme crystal tips can detect molecular recognition interactions.
New tips for structure prediction by comparative modeling
Rayan, Anwar
2009-01-01
Comparative modelling is utilized to predict the 3-dimensional conformation of a given protein (target) based on its sequence alignment to experimentally determined protein structure (template). The use of such technique is already rewarding and increasingly widespread in biological research and drug development. The accuracy of the predictions as commonly accepted depends on the score of sequence identity of the target protein to the template. To assess the relationship between sequence identity and model quality, we carried out an analysis of a set of 4753 sequence and structure alignments. Throughout this research, the model accuracy was measured by root mean square deviations of Cα atoms of the target-template structures. Surprisingly, the results show that sequence identity of the target protein to the template is not a good descriptor to predict the accuracy of the 3-D structure model. However, in a large number of cases, comparative modelling with lower sequence identity of target to template proteins led to more accurate 3-D structure model. As a consequence of this study, we suggest new tips for improving the quality of omparative models, particularly for models whose target-template sequence identity is below 50%. PMID:19255646
Zheng, Lijun; Yang, Dachi; Chang, Rong; Wang, Chengwen; Zhang, Gaixia; Sun, Shuhui
2017-07-06
We have developed "crack-tips" and "superlattice" enriched Pt-Cu nanoflakes (NFs), benefiting from the synergetic effects of "crack-tips" and "superlattice crystals"; the Pt-Cu NFs exhibit 4 times higher mass activity, 6 times higher specific activity and 6 times higher stability than those of the commercial Pt/C catalyst, respectively. Meanwhile, the Pt-Cu NFs show more enhanced CO tolerance than the commercial Pt/C catalyst.
Dalton, George D; Dewey, William L
2006-02-01
Signal transduction cascades involving cAMP-dependent protein kinase are highly conserved among a wide variety of organisms. Given the universal nature of this enzyme it is not surprising that cAMP-dependent protein kinase plays a critical role in numerous cellular processes. This is particularly evident in the nervous system where cAMP-dependent protein kinase is involved in neurotransmitter release, gene transcription, and synaptic plasticity. Protein kinase inhibitor peptide (PKI) is an endogenous thermostable peptide that modulates cAMP-dependent protein kinase function. PKI contains two distinct functional domains within its amino acid sequence that allow it to: (1) potently and specifically inhibit the activity of the free catalytic subunit of cAMP-dependent protein kinase and (2) export the free catalytic subunit of cAMP-dependent protein kinase from the nucleus. Three distinct PKI isoforms (PKIalpha, PKIbeta, PKIgamma) have been identified and each isoform is expressed in the brain. PKI modulates neuronal synaptic activity, while PKI also is involved in morphogenesis and symmetrical left-right axis formation. In addition, PKI also plays a role in regulating gene expression induced by cAMP-dependent protein kinase. Future studies should identify novel physiological functions for endogenous PKI both in the nervous system and throughout the body. Most interesting will be the determination whether functional differences exist between individual PKI isoforms which is an intriguing possibility since these isoforms exhibit: (1) cell-type specific tissue expression patterns, (2) different potencies for the inhibition of cAMP-dependent protein kinase activity, and (3) expression patterns that are hormonally, developmentally and cell-cycle regulated. Finally, synthetic peptide analogs of endogenous PKI will continue to be invaluable tools that are used to elucidate the role of cAMP-dependent protein kinase in a variety of cellular processes throughout the nervous
Yeast Interacting Proteins Database: YNL258C, YGL145W [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available YNL258C DSL1 Peripheral membrane protein required for Golgi-to-ER retrograde traffi...t description Peripheral membrane protein required for Golgi-to-ER retrograde traffic; component of the ER t
An Optical Fiber Bundle Sensor for Tip Clearance and Tip Timing Measurements in a Turbine Rig
Directory of Open Access Journals (Sweden)
María Asunción Illarramendi
2013-06-01
Full Text Available When it comes to measuring blade-tip clearance or blade-tip timing in turbines, reflective intensity-modulated optical fiber sensors overcome several traditional limitations of capacitive, inductive or discharging probe sensors. This paper presents the signals and results corresponding to the third stage of a multistage turbine rig, obtained from a transonic wind-tunnel test. The probe is based on a trifurcated bundle of optical fibers that is mounted on the turbine casing. To eliminate the influence of light source intensity variations and blade surface reflectivity, the sensing principle is based on the quotient of the voltages obtained from the two receiving bundle legs. A discrepancy lower than 3% with respect to a commercial sensor was observed in tip clearance measurements. Regarding tip timing measurements, the travel wave spectrum was obtained, which provides the average vibration amplitude for all blades at a particular nodal diameter. With this approach, both blade-tip timing and tip clearance measurements can be carried out simultaneously. The results obtained on the test turbine rig demonstrate the suitability and reliability of the type of sensor used, and suggest the possibility of performing these measurements in real turbines under real working conditions.
Tips for Living with Scleroderma
... Patients Tips for Living Tips for Living with Scleroderma Ways to help manage your symptoms The Scleroderma ... help find improved therapies and a cure for scleroderma! Your gift today will be matched to have ...
DEFF Research Database (Denmark)
Ngo, HT; Pham, Long; Kim, JW
2013-01-01
Hepatitis C virus (HCV) is highly dependent on cellular proteins for its own propagation. In order to identify the cellular factors involved in HCV propagation, we performed protein microarray assays using the HCV core protein as a probe. Of ~9,000 host proteins immobilized in a microarray...... inducers. Binding of HCV core to MAPKAPK3 was confirmed by in vitro pulldown assay and further verified by coimmunoprecipitation assay. HCV core protein interacted with MAPKAPK3 through amino acid residues 41 to 75 of core and the N-terminal half of kinase domain of MAPKAPK3. In addition, both RNA...... increased HCV IRES-mediated translation and MAPKAPK3-dependent HCV IRES activity was further increased by core protein. These data suggest that HCV core may modulate MAPKAPK3 to facilitate its own propagation....
Yeast Interacting Proteins Database: YNL216W, YLR453C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available YNL216W RAP1 DNA-binding protein involved in either activation or repression of transcription, depending...NA-binding protein involved in either activation or repression of transcription, depending on binding site c
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... or bypass, without the risks that accompany open surgery. TIPS is a minimally invasive procedure that typically has a shorter recovery time than surgery. Your TIPS should have less of an effect ...
Ion Binding Energies Determining Functional Transport of ClC Proteins
Yu, Tao; Guo, Xu; Zou, Xian-Wu; Sang, Jian-Ping
2014-06-01
The ClC-type proteins, a large family of chloride transport proteins ubiquitously expressed in biological organisms, have been extensively studied for decades. Biological function of ClC proteins can be reflected by analyzing the binding situation of Cl- ions. We investigate ion binding properties of ClC-ec1 protein with the atomic molecular dynamics simulation approach. The calculated electrostatic binding energy results indicate that Cl- at the central binding site Scen has more binding stability than the internal binding site Sint. Quantitative comparison between the latest experimental heat release data isothermal titration calorimetry (ITC) and our calculated results demonstrates that chloride ions prefer to bind at Scen than Sint in the wild-type ClC-ec1 structure and prefer to bind at Sext and Scen than Sint in mutant E148A/E148Q structures. Even though the chloride ions make less contribution to heat release when binding to Sint and are relatively unstable in the Cl- pathway, they are still part contributors for the Cl- functional transport. This work provides a guide rule to estimate the importance of Cl- at the binding sites and how chloride ions have influences on the function of ClC proteins.
International Nuclear Information System (INIS)
Harrach, Michael F.; Drossel, Barbara
2014-01-01
We perform molecular dynamics simulations to observe the structure and dynamics of water using different water models (TIP3P, TIP4P, TIP5P) at ambient conditions, constrained by planar walls, which are either modeled by smooth potentials or regular atomic lattices, imitating the honeycomb-structure of graphene. We implement walls of different hydroaffinity, different lattice constant, and different types of interaction with the water molecules. We find that in the hydrophobic regime the smooth wall generally represents a good abstraction of the atomically rough walls, while in the hydrophilic regime there are noticeable differences in structure and dynamics between all stages of wall roughness. For a small lattice constant however the smooth and the atomically rough wall still share a number of structural and dynamical similarities. Out of the three water models, TIP5P water shows the largest degree of tetrahedral ordering and is often the one that is least perturbed by the presence of the wall
Mechanochemistry Induced Using Force Exerted by a Functionalized Microscope Tip
DEFF Research Database (Denmark)
Zhang, Yajie; Wang, Yongfeng; Lü, Jing-Tao
2017-01-01
Atomic-scale mechanochemistry is realized from force exerted by a C60 -functionalized scanning tunneling microscope tip. Two conformers of tin phthalocyanine can be prepared on coinage-metal surfaces. A transition between these conformers is induced on Cu(111) and Ag(100). Density...
RANS computations of tip vortex cavitation
Decaix, Jean; Balarac, Guillaume; Dreyer, Matthieu; Farhat, Mohamed; Münch, Cécile
2015-12-01
The present study is related to the development of the tip vortex cavitation in Kaplan turbines. The investigation is carried out on a simplified test case consisting of a NACA0009 blade with a gap between the blade tip and the side wall. Computations with and without cavitation are performed using a R ANS modelling and a transport equation for the liquid volume fraction. Compared with experimental data, the R ANS computations turn out to be able to capture accurately the development of the tip vortex. The simulations have also highlighted the influence of cavitation on the tip vortex trajectory.
International Nuclear Information System (INIS)
Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin
2005-01-01
Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... pressure. top of page How does the procedure work? A TIPS reroutes blood flow in the liver ... filtered out by the liver. The TIPS may cause too much of these substances to bypass the ...
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... then placed in this tunnel to keep the pathway open. Patients who typically need a TIPS have ... and stomach. A TIPS procedure involves creating a pathway through the liver that connects the portal vein ( ...
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... and/or hydrothorax (in the chest). Budd-Chiari syndrome , a blockage in one or more veins that ... intentionally to solve the problem. Although extremely rare, children may also require a TIPS procedure. TIPS in ...
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... the esophagus and stomach. A TIPS procedure involves creating a pathway through the liver that connects the ... diseases. This can result in significant challenges in creating the TIPS. top of page Additional Information and ...
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... TIPS. top of page What are some common uses of the procedure? A TIPS is used to ... community, you can search the ACR-accredited facilities database . This website does not provide cost information. The ...
Transjugular Intrahepatic Portosystemic Shunt (TIPS)
Full Text Available ... pressure. top of page How does the procedure work? A TIPS reroutes blood flow in the liver ... recovery time than surgery. Your TIPS should have less of an effect than open surgical bypass on ...
Directory of Open Access Journals (Sweden)
Ying Liu
2010-08-01
Full Text Available In spite of decades-long studies, the mechanism of morphogenesis of plus-stranded RNA viruses belonging to the genus Enterovirus of Picornaviridae, including poliovirus (PV, is not understood. Numerous attempts to identify an RNA encapsidation signal have failed. Genetic studies, however, have implicated a role of the non-structural protein 2C(ATPase in the formation of poliovirus particles. Here we report a novel mechanism in which protein-protein interaction is sufficient to explain the specificity in PV encapsidation. Making use of a novel "reporter virus", we show that a quasi-infectious chimera consisting of the capsid precursor of C-cluster coxsackie virus 20 (C-CAV20 and the nonstructural proteins of the closely related PV translated and replicated its genome with wild type kinetics, whereas encapsidation was blocked. On blind passages, encapsidation of the chimera was rescued by a single mutation either in capsid protein VP3 of CAV20 or in 2C(ATPase of PV. Whereas each of the single-mutation variants expressed severe proliferation phenotypes, engineering both mutations into the chimera yielded a virus encapsidating with wild type kinetics. Biochemical analyses provided strong evidence for a direct interaction between 2C(ATPase and VP3 of PV and CAV20. Chimeras of other C-CAVs (CAV20/CAV21 or CAV18/CAV20 were blocked in encapsidation (no virus after blind passages but could be rescued if the capsid and 2C(ATPase coding regions originated from the same virus. Our novel mechanism explains the specificity of encapsidation without apparent involvement of an RNA signal by considering that (i genome replication is known to be stringently linked to translation, (ii morphogenesis is known to be stringently linked to genome replication, (iii newly synthesized 2C(ATPase is an essential component of the replication complex, and (iv 2C(ATPase has specific affinity to capsid protein(s. These conditions lead to morphogenesis at the site where newly
Deformation localization at the tips of shear fractures: An analytical approach
Misra, Santanu
2011-04-01
Mechanical heterogeneities are important features in rocks which trigger deformation localization in brittle, ductile or brittle-ductile modes during deformation. In a recent study Misra et al. (2009) have investigated these different processes of deformation localization at the tips of pre-existing planar shear fractures. The authors identified four mechanisms of deformation, ranging from brittle to ductile, operating at the crack tips. Mechanism A: brittle deformation is the dominant process that forms a pair of long tensile fractures at the two crack tips. Mechanism B: nature of deformation is mixed where the tensile fractures grow to a finite length with incipient plastic deformation at the tips. Mechanism C: mixed mode deformation characterized by dominating macro-scale shear bands, and short, opened-out tensile fissures. Mechanism D: localization of plastic bands in the form of a pair of shear bands at each tip without any discernible brittle fracturing. The transition of the mechanisms is a function of orientation ( α) of the crack with respect to the bulk compression direction and the finite length ( l) of the crack. The aim of this study is to present a theoretical analysis to account for the variability of deformation localization in the vicinity of pre-existing shear cracks considering an elastic-plastic rheological model. The analysis calculates the principal tensile stress ( σ1) and the second stress invariant ( I2) of the stress field at the fracture tip to explain the transition from Mechanism A (tensile fracturing) to Mechanism D (ductile strain). The results show that σ1 at the fracture tip increases non-linearly with increasing α and Ar (aspect ratio of the shear crack), and assumes a large value when α > 50 o, promoting tensile fractures. On the other hand, I2 is a maximum at α < 45°, resulting in nucleation of ductile shear bands.
Modular organization of proteins containing C1q-like globular domain.
Kishore, U; Reid, K B
1999-05-01
The first step in the activation of the classical pathway of complement cascade by immune complexes involves the binding of the six globular heads of C1q to the Fc regions of immunoglobulin G (IgG) or immunoglobulin M (IgM). The globular heads of C1q are located C-terminal to the six triple-helical stalks present in the molecule, each head is considered to be composed of the C-terminal halves (3 x 135 residues) of one A-, one B- and one C-chain. It is not known if the C-terminal globular regions, present in each of the three types of chains, are independently folded modules (with each chain having distinct binding properties towards immunoglobulins) or whether the different binding functions of C1q are dependent upon a globular structure which relies on contributions from all three chains. Recent reports of recombinant production and characterisation of soluble globular head regions of all the three chains indicate that the globular regions of C1q may adopt a modular organization, i.e., each globular head of C1q may be composed of three, structurally and functionally, independent domains, thus retaining multivalency in the form of a heterotrimer. Modules of the same type as the C1q C-terminal module are also found in a variety of noncomplement proteins that include the C-terminal regions of the human type VIII and type X collagens, precerebellin, the chipmunk hibernation proteins, the human endothelial cell protein, multimerin, the serum protein, Acrp-30 which is secreted from mouse adipocytes, and the sunfish inner-ear specific structural protein. The C1q molecule is the only one of these proteins for which, to date, a function has been ascribed to the module. The existence of a shared structural region between C1q and certain collagens may suggest an evolutionarily common ancestral precursor. Various structural and biochemical data suggest that these modules may be responsible for multimerisation through patches of aromatic residues within them.
Energy Technology Data Exchange (ETDEWEB)
Gucciardi, P G [CNR-Istituto per i Processi Chimico-Fisici, sezione Messina, Salita Sperone, Contrada Papardo, I-98158 Faro Superiore, Messina (Italy); Lopes, M; Deturche, R; Julien, C; Barchiesi, D; Chapelle, M Lamy de la [Institut Charles Delaunay-CNRS FRE 2848, Laboratoire de Nanotechnologie et d' Instrumentation Optique, Universite de Technologie de Troyes, 12 rue Marie Curie, BP2060, 10010 Troyes (France)
2008-05-28
We have investigated the depolarization effects of light scattered by sharp tips used for apertureless near-field optical microscopy. Dielectric and metal coated tips have been investigated and depolarization factors between 5 and 30% have been measured, changing as a function of the incident light polarization and of the tip shape. The experimental results are in good agreement with theoretical calculations performed by the finite element method, giving a near-field depolarization factor close to 10%. The effect of depolarization has been investigated in polarized tip-enhanced Raman spectroscopy (TERS) experiments; the depolarization gives rise to forbidden Raman modes in Si crystals.
The C protein of measles virus inhibits the type I interferon response
International Nuclear Information System (INIS)
Shaffer, Jessica A.; Bellini, William J.; Rota, Paul A.
2003-01-01
Type I interferons (IFNα/β) are an important part of innate immunity to viral infections because they induce an antiviral response and limit viral replication until the adaptive response clears the infection. Since the nonstructural proteins of several paramyxoviruses inhibit the IFNα/β response, we chose to explore the role of the C protein of measles virus (MV) in such inhibition. Previous studies have suggested that the MV C protein may serve as a virulence factor, but its role in the pathogenesis of MV remains undefined. In the present study, a recombinant MV strain that does not express the C protein (MV C-) and its parental strain (Ed Tag) were used. Growth of MV C- was restricted in human peripheral blood mononuclear cells and HeLa cells, but in the presence of neutralizing antibodies to IFNα/β, MV C- produced titers that were equivalent to those of Ed Tag. In addition, expression of the MV C protein from plasmid DNA inhibited the production of an IFNα/β responsive reporter gene and, to a lesser extent, inhibited an IFNγ responsive reporter gene. The ability of the MV C protein to suppress the IFNα/β response was confirmed using a biologic assay. After IFNβ stimulation, HeLa cells infected with Ed Tag produced five-fold less IFNα/β than cells infected with MV C-. While the mechanism of inhibition remains unclear, these data suggest that the MV C protein plays an important role in the pathogenesis of MV by inhibiting IFNα/β signaling
The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.
Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter
2018-06-01
Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of
Superconducting phase transition in STM tips
Energy Technology Data Exchange (ETDEWEB)
Eltschka, Matthias; Jaeck, Berthold; Assig, Maximilian; Etzkorn, Markus; Ast, Christian R. [Max Planck Institute for Solid State Research, Stuttgart (Germany); Kern, Klaus [Max Planck Institute for Solid State Research, Stuttgart (Germany); Ecole Polytechnique Federale de Lausanne (Switzerland)
2015-07-01
The superconducting properties of systems with dimensions comparable to the London penetration depth considerably differ from macroscopic systems. We have studied the superconducting phase transition of vanadium STM tips in external magnetic fields. Employing Maki's theory we extract the superconducting parameters such as the gap or the Zeeman splitting from differential conductance spectra. While the Zeeman splitting follows the theoretical description of a system with s=1/2 and g=2, the superconducting gaps as well as the critical fields depend on the specific tip. For a better understanding of the experimental results, we solve a one dimensional Usadel equation modeling the superconducting tip as a cone with the opening angle α in an external magnetic field. We find that only a small region at the apex of the tip is superconducting in high magnetic fields and that the order of the phase transition is directly determined by α. Further, the spectral broadening increases with α indicating an intrinsic broadening mechanism due to the conical shape of the tip. Comparing these calculations to our experimental results reveals the order of the superconducting phase transition of the STM tips.
Directory of Open Access Journals (Sweden)
Byeong jun Ahn
2015-11-01
Full Text Available Background We hypothesized that the direction of the J-tip of the guidewire during insertion into the internal jugular vein (IJV might determine its ultimate location. Methods In this study, 300 patients between the ages of 18 and 99 years who required central venous catheterization via IJV in the emergency department enrolled for randomization. IVJ catheterization was successful in 285 of 300 patients. An independent operator randomly prefixed the direction of the J-tip of the guidewire to one of three directions. Based on the direction of the J-tip, patients were allocated into three groups: the J-tip medial-directed group (Group A, the lateral-directed group (Group B, or the downward-directed group (Group C. Postoperative chest radiography was performed on all patients in order to visualize the location of the catheter tip. A catheter is considered malpositioned if it is not located in the superior vena cava or right atrium. Results Of the total malpositioned catheter tips (8 of 285; 2.8%, the majority (5 of 8; 62.5% entered the contralateral subclavian vein, 2 (25.0% were complicated by looping, and 1 (12.5% entered the ipsilateral subclavian vein. According to the direction of the J-tip of the guidewire, the incidence of malpositioning of the catheter tip was 4 of 92 in Group A (4.3%, 4 of 96 in Group B (4.2%, and there were no malpositions in Group C. There were no significant differences among the three groups (p = 0.114. Conclusions The direction of the J-tip of the guidewire had no statistically significant effect on incidence of malpositioned tips.
Radiofrequency Wire Recanalization of Chronically Thrombosed TIPS
Energy Technology Data Exchange (ETDEWEB)
Majdalany, Bill S., E-mail: bmajdala@med.umich.edu [University of Michigan Health System, Division of Interventional Radiology, Department of Radiology (United States); Elliott, Eric D., E-mail: eric.elliott@osumc.edu [The Ohio State University Wexner Medical Center, Division of Interventional Radiology, Department of Radiology (United States); Michaels, Anthony J., E-mail: Anthony.michaels@osumc.edu; Hanje, A. James, E-mail: James.Hanje@osumc.edu [The Ohio State University Wexner Medical Center, Division of Gastroenterology and Hepatology, Department of Medicine (United States); Saad, Wael E. A., E-mail: wsaad@med.umich.edu [University of Michigan Health System, Division of Interventional Radiology, Department of Radiology (United States)
2016-07-15
Radiofrequency (RF) guide wires have been applied to cardiac interventions, recanalization of central venous thromboses, and to cross biliary occlusions. Herein, the use of a RF wire technique to revise chronically occluded transjugular intrahepatic portosystemic shunts (TIPS) is described. In both cases, conventional TIPS revision techniques failed to revise the chronically thrombosed TIPS. RF wire recanalization was successfully performed through each of the chronically thrombosed TIPS, demonstrating initial safety and feasibility in this application.
Ner protein of phage Mu: Assignments using {sup 13}C/{sup 15}N-labeled protein
Energy Technology Data Exchange (ETDEWEB)
Strzelecka, T.; Gronenborn, A.M.; Clore, G.M. [National Institutes of Health, Bethesda, MD (United States)
1994-12-01
The Ner protein is a small (74-amino acid) DNA-binding protein that regulates a switch between the lysogenic and lytic stages of phage Mu. It inhibits expression of the C repressor gene and down-regulates its own expression. Two-dimensional NMR experiments on uniformly {sup 15}N-labeled protein provided most of the backbone and some of the sidechain proton assignments. The secondary structure determination using two-dimensional NOESY experiments showed that Ner consists of five {alpha}-helices. However, because most of the sidechain protons could not be assigned, the full structure was not determined. Using uniformly {sup 13}C/{sup 15}N-labeled Ner and a set of three-dimensional experiments, we were able to assign all of the backbone and 98% of the sidechain protons. In particular, the CBCANH and CBCA(CO)NH experiments were used to sequentially assign the C{alpha} and C{beta} resonances; the HCCH-CTOCSY and HCCH-COSY were used to assign sidechain carbon and proton resonances.
Directory of Open Access Journals (Sweden)
Mary E Blair
Full Text Available Landscape genetic studies offer a fine-scale understanding of how habitat heterogeneity influences population genetic structure. We examined population genetic structure and conducted a landscape genetic analysis for the endangered Central American Squirrel Monkey (Saimiri oerstedii that lives in the fragmented, human-modified habitats of the Central Pacific region of Costa Rica. We analyzed non-invasively collected fecal samples from 244 individuals from 14 groups for 16 microsatellite markers. We found two geographically separate genetic clusters in the Central Pacific region with evidence of recent gene flow among them. We also found significant differentiation among groups of S. o. citrinellus using pairwise F(ST comparisons. These groups are in fragments of secondary forest separated by unsuitable "matrix" habitats such as cattle pasture, commercial African oil palm plantations, and human residential areas. We used an individual-based landscape genetic approach to measure spatial patterns of genetic variance while taking into account landscape heterogeneity. We found that large, commercial oil palm plantations represent moderate barriers to gene flow between populations, but cattle pastures, rivers, and residential areas do not. However, the influence of oil palm plantations on genetic variance was diminished when we restricted analyses to within population pairs, suggesting that their effect is scale-dependent and manifests during longer dispersal events among populations. We show that when landscape genetic methods are applied rigorously and at the right scale, they are sensitive enough to track population processes even in species with long, overlapping generations such as primates. Thus landscape genetic approaches are extremely valuable for the conservation management of a diverse array of endangered species in heterogeneous, human-modified habitats. Our results also stress the importance of explicitly considering the heterogeneity of
Roehrich, A Dorothea; Guillossou, Enora; Blocker, Ariel J; Martinez-Argudo, Isabel
2013-02-01
Type III secretion systems (T3SSs) are protein injection devices essential for the interaction of many Gram-negative bacteria with eukaryotic cells. While Shigella assembles its T3SS when the environmental conditions are appropriate for invasion, secretion is only activated after physical contact with a host cell. First, the translocators are secreted to form a pore in the host cell membrane, followed by effectors which manipulate the host cell. Secretion activation is tightly controlled by conserved T3SS components: the needle tip proteins IpaD and IpaB, the needle itself and the intracellular gatekeeper protein MxiC. To further characterize the role of IpaD during activation, we combined random mutagenesis with a genetic screen to identify ipaD mutant strains unable to respond to host cell contact. Class II mutants have an overall defect in secretion induction. They map to IpaD's C-terminal helix and likely affect activation signal generation or transmission. The Class I mutant secretes translocators prematurely and is specifically defective in IpaD secretion upon activation. A phenotypically equivalent mutant was found in mxiC. We show that IpaD and MxiC act in the same intracellular pathway. In summary, we demonstrate that IpaD has a dual role and acts at two distinct locations during secretion activation. © 2013 Blackwell Publishing Ltd.
Tip Clearance Control Using Plasma Actuators
2007-03-01
Clearance Control Using Plasma Actuators 4 posed by Denton (1993). A number of investigators have used partial shrouds, or " winglet " designs to...SDBD actuator Plasma enhanced aerodynamics has been demonstrated in a range of applications involving sepa- ration control, lift enhancement, drag... aerodynamic benefits of a squealer tip geometry. Specifically, the squealer tip is known to reduce the discharge coefficient of the tip gap, thereby
International Nuclear Information System (INIS)
Salomon, M.; Zacherl, M.; Rüdiger, W.
1997-01-01
Blue light induces the phosphorylation of a 116 kDa oat protein found in plasma membrane preparations from coleoptile tips. We developed a very sensitive in vitro method that allowed us to determine the tissue distribution of protein phosphorylation after applying unilateral and bilateral blue light pulses in vivo. We found that following unilateral in vivo irradiation the degree in phosphorylation of the 116 kDa protein is significantly higher at the irradiated than at the shaded side of the coleoptile tip. This asymmetry can be considered as previously missing criterion that protein phosphorylation represents an early event within the transduction chain for phototropism. (author)
Depletion of WRN protein causes RACK1 to activate several protein kinase C isoforms
DEFF Research Database (Denmark)
Massip, L; Garand, C; Labbé, A
2010-01-01
show that a knock down of the WRN protein in normal human fibroblasts induces phosphorylation and activation of several protein kinase C (PKC) enzymes. Using a tandem affinity purification strategy, we found that WRN physically and functionally interacts with receptor for activated C-kinase 1 (RACK1......), a highly conserved anchoring protein involved in various biological processes, such as cell growth and proliferation. RACK1 binds strongly to the RQC domain of WRN and weakly to its acidic repeat region. Purified RACK1 has no impact on the helicase activity of WRN, but selectively inhibits WRN exonuclease...... activity in vitro. Interestingly, knocking down RACK1 increased the cellular frequency of DNA breaks. Depletion of the WRN protein in return caused a fraction of nuclear RACK1 to translocate out of the nucleus to bind and activate PKCdelta and PKCbetaII in the membrane fraction of cells. In contrast...
van Wijnen, M.; van 't Veer, C.; Meijers, J. C.; Bertina, R. M.; Bouma, B. N.
1998-01-01
To study the physiological importance of the activated protein C (APC)-independent anticoagulant activity of protein S, we developed an assay specific for this activity. The ability of protein S to prolong the clotting time in an APC-independent way was expressed as the ratio of the clotting time in
Tips for Good Electronic Presentations.
Strasser, Dennis
1996-01-01
Describes library uses of presentation graphics software and offers tips for creating electronic presentations. Tips include: audience retention; visual aid options; software package options; presentation planning; presentation showing; and use of text, colors, and graphics. Sidebars note common presentation errors and popular presentation…
Environmental tipping points significantly affect the cost−benefit assessment of climate policies
Cai, Yongyang; Judd, Kenneth L.; Lenton, Timothy M.; Lontzek, Thomas S.; Narita, Daiju
2015-01-01
Most current cost−benefit analyses of climate change policies suggest an optimal global climate policy that is significantly less stringent than the level required to meet the internationally agreed 2 °C target. This is partly because the sum of estimated economic damage of climate change across various sectors, such as energy use and changes in agricultural production, results in only a small economic loss or even a small economic gain in the gross world product under predicted levels of climate change. However, those cost−benefit analyses rarely take account of environmental tipping points leading to abrupt and irreversible impacts on market and nonmarket goods and services, including those provided by the climate and by ecosystems. Here we show that including environmental tipping point impacts in a stochastic dynamic integrated assessment model profoundly alters cost−benefit assessment of global climate policy. The risk of a tipping point, even if it only has nonmarket impacts, could substantially increase the present optimal carbon tax. For example, a risk of only 5% loss in nonmarket goods that occurs with a 5% annual probability at 4 °C increase of the global surface temperature causes an immediate two-thirds increase in optimal carbon tax. If the tipping point also has a 5% impact on market goods, the optimal carbon tax increases by more than a factor of 3. Hence existing cost−benefit assessments of global climate policy may be significantly underestimating the needs for controlling climate change. PMID:25825719
Environmental tipping points significantly affect the cost-benefit assessment of climate policies.
Cai, Yongyang; Judd, Kenneth L; Lenton, Timothy M; Lontzek, Thomas S; Narita, Daiju
2015-04-14
Most current cost-benefit analyses of climate change policies suggest an optimal global climate policy that is significantly less stringent than the level required to meet the internationally agreed 2 °C target. This is partly because the sum of estimated economic damage of climate change across various sectors, such as energy use and changes in agricultural production, results in only a small economic loss or even a small economic gain in the gross world product under predicted levels of climate change. However, those cost-benefit analyses rarely take account of environmental tipping points leading to abrupt and irreversible impacts on market and nonmarket goods and services, including those provided by the climate and by ecosystems. Here we show that including environmental tipping point impacts in a stochastic dynamic integrated assessment model profoundly alters cost-benefit assessment of global climate policy. The risk of a tipping point, even if it only has nonmarket impacts, could substantially increase the present optimal carbon tax. For example, a risk of only 5% loss in nonmarket goods that occurs with a 5% annual probability at 4 °C increase of the global surface temperature causes an immediate two-thirds increase in optimal carbon tax. If the tipping point also has a 5% impact on market goods, the optimal carbon tax increases by more than a factor of 3. Hence existing cost-benefit assessments of global climate policy may be significantly underestimating the needs for controlling climate change.
Verzijl, D.; Fitzsimons, C.P.; Van Dijk, M.; Stewart, J.P.; Timmerman, H.; Smit, M.J.; Leurs, R.
2004-01-01
Infection of mice with murine gammaherpesvirus 68 (MHV-68) is a well-characterized small animal model for the study of gammaherpesvirus infection. MHV-68 belongs to the same herpesvirus family as herpesvirus saimiri (HVS) of New World squirrel monkeys and human herpesvirus 8 (HHV-8) (also referred
Inhibition of epithelial Na+ transport by atriopeptin, protein kinase c, and pertussis toxin
International Nuclear Information System (INIS)
Mohrmann, M.; Cantiello, H.F.; Ausiello, D.A.
1987-01-01
The authors have recently shown the selective inhibition of an amiloride-sensitive, conductive pathway for Na + by atrial natriuretic peptide and 8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) in the renal epithelial cell line, LLC-PK i . Using 22 Na + fluxes, they further investigated the modulation of Na + transport by atrial natriuretic peptide and by agents that increase cGMP production, activate protein kinase c, or modulate guanine nucleotide regulatory protein function. Sodium nitroprusside increases intracellular cGMP concentrations without affecting cAMP concentrations and completely inhibits amiloride-sensitive Na + uptake in a time- and concentration-dependent manner. Oleoyl 2-acetylglycerol and phorbol 12-myristate 13-acetate, activators of protein kinase c, inhibit Na + uptake by 93 ± 13 and 51 ± 10%, respectively. Prolonged incubation with phorbol ester results in the downregulation of protein kinase c activity and reduces the inhibitory effect of atrial natriuretic peptide, suggesting that the action of this peptide involves stimulation of protein kinase c. Pertussis toxin, which induces the ADP-ribosylation of a 41-kDa guanine nucleotide regulatory protein in LLC-PK i cells, inhibits 22 Na + influx to the same extent as amiloride. Thus, increasing cGMP, activating protein kinase c, and ADP-ribosylating a guanine nucleotide regulatory protein all inhibit Na + uptake. These events may be sequentially involved in the action of atrial natriuretic peptide
The structurally-related members of the PAT family of proteins, which are so name based on similarity amongst perilipin, adipophilin/adipocyte differentiation-related protein (ADRP), and tail-interacting protein of 47 kilodaltons (TIP47), are cytoplasmic lipid droplet (LD)-associated proteins charac...
International Nuclear Information System (INIS)
Chung Hongjing; Song Jing; Vancso, G. Julius
2009-01-01
Poly(ferrocenylsilanes) (PFS) belong to the class of redox responsive organometallic polymers. Atomic force microscopy (AFM)-based single molecule force spectroscopy (SMFS) was used earlier to study single chain PFS response and redox energy driven single chain PFS molecular motors. Here we present further AFM investigations of force interactions between tip and a grafted PFS surface under potential control in electrochemical redox cycles. Typical tip-Au interaction is considered as reference in the force measurements. First the electrostatic component in the diffused double layer (DL) in NaClO 4 electrolyte environment was considered for a 'grafted to' PFS, which dominated the interplay between the tip and sample surface. The DL forces can also hinder the physisorption of PFS chain onto the tip when the voltage was applied at -0.1 V. On the other hand, if the tip contacted the PFS surface prior to the electrochemical process, physisorption of PFS chains governed the overall interaction regardless of subsequently applied surface potential. In addition, prolonged contact time, t c , may also contribute to the stability of tip-PFS bridging and detection of electrostatic forces between the tip-PFS interface. The results showed that tip-substrate interaction forces without PFS grafts have negligibly small force contributions under similar, electrochemically controlled, conditions used in single PFS chain based molecular motors.
Directory of Open Access Journals (Sweden)
Reid A. Berdanier
2015-01-01
Full Text Available An analysis of compressor rotor tip clearance measurements using capacitance probe instrumentation is discussed for a three-stage axial compressor. Thermal variations and centrifugal effects related to rotational speed changes affect clearance heights relative to the assembled configuration. These two primary contributions to measured changes are discussed both independently and in combination. Emphasis is given to tip clearance changes due to changing loading condition and at several compressor operating speeds. Measurements show a tip clearance change approaching 0.1 mm (0.2% rotor span when comparing a near-choke operating condition to a near-stall operating condition for the third stage. Additional consideration is given to environmental contributions such as ambient temperature, for which changes in tip clearance height on the order of 0.05 mm (0.1% rotor span were noted for temperature variations of 15°C. Experimental compressor operating clearances are presented for several temperatures, operating speeds, and loading conditions, and comparisons are drawn between these measured variations and predicted changes under the same conditions.
Identification of human hnRNP C1/C2 as a dengue virus NS1-interacting protein
International Nuclear Information System (INIS)
Noisakran, Sansanee; Sengsai, Suchada; Thongboonkerd, Visith; Kanlaya, Rattiyaporn; Sinchaikul, Supachok; Chen, Shui-Tein; Puttikhunt, Chunya
2008-01-01
Dengue virus nonstructural protein 1 (NS1) is a key glycoprotein involved in the production of infectious virus and the pathogenesis of dengue diseases. Very little is known how NS1 interacts with host cellular proteins and functions in dengue virus-infected cells. This study aimed at identifying NS1-interacting host cellular proteins in dengue virus-infected cells by employing co-immunoprecipitation, two-dimensional gel electrophoresis, and mass spectrometry. Using lysates of dengue virus-infected human embryonic kidney cells (HEK 293T), immunoprecipitation with an anti-NS1 monoclonal antibody revealed eight isoforms of dengue virus NS1 and a 40-kDa protein, which was subsequently identified by quadrupole time-of-flight tandem mass spectrometry (Q-TOF MS/MS) as human heterogeneous nuclear ribonucleoprotein (hnRNP) C1/C2. Further investigation by co-immunoprecipitation and co-localization confirmed the association of hnRNP C1/C2 and dengue virus NS1 proteins in dengue virus-infected cells. Their interaction may have implications in virus replication and/or cellular responses favorable to survival of the virus in host cells
Contraction-associated translocation of protein kinase C in rat skeletal muscle
DEFF Research Database (Denmark)
Richter, Erik; Cleland, P J; Rattigan, S
1987-01-01
Electrical stimulation of the sciatic nerve of the anaesthetized rat in vivo led to a time-dependent translocation of protein kinase C from the muscle cytosol to the particulate fraction. Maximum activity of protein kinase C in the particulate fraction occurred after 2 min of intermittent short...... tetanic contractions of the gastrocnemius-plantaris-soleus muscle group and coincided with the loss of activity from the cytosol. Translocation of protein kinase C may imply a role for this kinase in contraction-initiated changes in muscle metabolism....
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
International Nuclear Information System (INIS)
Sundara Baalaji, N.; Acharya, K. Ravi; Singh, T. P.; Krishnaswamy, S.
2005-01-01
Crystals of the complex formed between the bacterial membrane protein OmpC and the antibacterial protein lactoferrin suitable for high-resolution structure determination have been obtained. The crystals belong to the hexagonal space group P6, with unit-cell parameters a = b = 116.3, c = 152.4 Å. Crystals of the complex formed between the outer membrane protein OmpC from Escherichia coli and the eukaryotic antibacterial protein lactoferrin from Camelus dromedarius (camel) have been obtained using a detergent environment. Initial data processing suggests that the crystals belong to the hexagonal space group P6, with unit-cell parameters a = b = 116.3, c = 152.4 Å, α = β = 90, γ = 120°. This indicated a Matthews coefficient (V M ) of 3.3 Å 3 Da −1 , corresponding to a possible molecular complex involving four molecules of lactoferrin and two porin trimers in the unit cell (4832 amino acids; 533.8 kDa) with 63% solvent content. A complete set of diffraction data was collected to 3 Å resolution at 100 K. Structure determination by molecular replacement is in progress. Structural study of this first surface-exposed membrane-protein complex with an antibacterial protein will provide insights into the mechanism of action of OmpC as well as lactoferrin
Tsaousis, Konstantinos T; Werner, Liliana; Perez, Jesus Paulo; Li, He J; Reiter, Nicholas; Guan, Jia J; Mamalis, Nick
2016-09-01
To evaluate the elemental composition of phacoemulsification tips and their surface roughness in the microscale. John A. Moran Eye Center and Utah Nanofab, College of Engineering, University of Utah, Salt Lake City, Utah, USA. Experimental study. Seven types of phacoemulsification tips were studied. The phaco tips were examined through energy-dispersive x-ray spectroscopy (EDS) and x-ray photoelectron spectroscopy (XPS) for elemental composition. In addition, the roughness of the opening in all tips was assessed through 3-dimensional white-light interferometry. Elemental analysis showed considerable differences in the surface layers between manufacturers. Alcon tips had a thinner oxidized titanium (Ti) layer in their surface. Through XPS, vanadium was not detected in the superficial layers of any tip, but only in deeper levels. The microroughness surface analysis showed comparable results regarding their root-mean-square (RMS) metric. Maximum peak valley distance values varied and appeared to be dependent on the quality of material process rather than the material itself. Phacoemulsification tips are made of Ti alloys and showed differences between models, especially regarding their composition in the superficial layers. Their opening end roughness showed an overall appropriate RMS value of less than 1.0 μm in all cases. The existence of small defected areas highlights the importance of adequate quality control of these critical surgical instruments. None of the authors has a financial or proprietary interest in any material or method mentioned. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Sound source location in cavitating tip vortices
International Nuclear Information System (INIS)
Higuchi, H.; Taghavi, R.; Arndt, R.E.A.
1985-01-01
Utilizing an array of three hydrophones, individual cavitation bursts in a tip vortex could be located. Theoretically, four hydrophones are necessary. Hence the data from three hydrophones are supplemented with photographic observation of the cavitating tip vortex. The cavitation sound sources are found to be localized to within one base chord length from the hydrofoil tip. This appears to correspond to the region of initial tip vortex roll-up. A more extensive study with a four sensor array is now in progress
Francis, Sharron H; Blount, Mitsi A; Zoraghi, Roya; Corbin, Jackie D
2005-09-01
Cyclic GMP is a critical second messenger signaling molecule in many mammalian cell types. It is synthesized by a family of guanylyl cyclases that is activated in response to stimuli from hormones such as natriuretic peptides, members of the guanylin family, and chemical stimuli including nitric oxide and carbon monoxide. The resulting elevation of cGMP modulates myriad physiological processes. Three major groups of cellular proteins bind cGMP specifically at allosteric sites; interaction of cGMP with these sites modulates the activities and functions of other domains within these protein groups to bring about physiological effects. These proteins include the cyclic nucleotide (cN)-dependent protein kinases, cN-gated cation channels, and cGMP-binding phosphodiesterases (PDE). Cyclic GMP also interacts with the catalytic sites of many cN PDEs and with some members of the multi-drug anion transporter family (MRPs) which can extrude nucleotides from cells. The allosteric cN-binding sites in the kinases and the cN-gated channels are evolutionarily and biochemically related, whereas the allosteric cGMP-binding sites in PDEs (also known as GAF domains), the catalytic sites of PDEs , and the ligand-binding sites in the MRPs are evolutionarily and biochemically distinct from each other and from those in the kinase and channel families. The sites that interact with cGMP within each of these groups of proteins have unique properties that provide for cGMP binding. Within a given cell, cGMP can potentially interact with members of all these groups of proteins if they are present. The relative abundance and affinities of these various cGMP-binding sites in conjunction with their subcellular compartmentation, proximity to cyclases and PDEs, and post-translational modification contribute importantly in determining the impact of these respective proteins to cGMP signaling within a particular cell.
Computerized automatic tip scanning operation
International Nuclear Information System (INIS)
Nishikawa, K.; Fukushima, T.; Nakai, H.; Yanagisawa, A.
1984-01-01
In BWR nuclear power stations the Traversing Incore Probe (TIP) system is one of the most important components in reactor monitoring and control. In previous TIP systems, however, operators have suffered from the complexity of operation and long operation time required. The system presented in this paper realizes the automatic operation of the TIP system by monitoring and driving it with a process computer. This system significantly reduces the burden on customer operators and improves plant efficiency by simplifying the operating procedure, augmenting the accuracy of the measured data, and shortening operating time. The process computer is one of the PODIA (Plant Operation by Displayed Information Automation) systems. This computer transfers control signals to the TIP control panel, which in turn drives equipment by microprocessor control. The process computer contains such components as the CRT/KB unit, the printer plotter, the hard copier, and the message typers required for efficient man-machine communications. Its operation and interface properties are described
Study of tip loss corrections using CFD rotor computations
DEFF Research Database (Denmark)
Shen, Wen Zhong; Zhu, Wei Jun; Sørensen, Jens Nørkær
2014-01-01
Tip loss correction is known to play an important role for engineering prediction of wind turbine performance. There are two different types of tip loss corrections: tip corrections on momentum theory and tip corrections on airfoil data. In this paper, we study the latter using detailed CFD...... computations for wind turbines with sharp tip. Using the technique of determination of angle of attack and the CFD results for a NordTank 500 kW rotor, airfoil data are extracted and a new tip loss function on airfoil data is derived. To validate, BEM computations with the new tip loss function are carried out...... and compared with CFD results for the NordTank 500 kW turbine and the NREL 5 MW turbine. Comparisons show that BEM with the new tip loss function can predict correctly the loading near the blade tip....
Brazzini, Augusto; Carrillo, Alvaro; Cantella, Raúl
1998-01-01
Esophageal hemorrage due to variceal bleeding in cirrhotic patients represents a serious problem for the physician in charge, especially in this country where liver transplants are inexistent; and also, it is a drama for the patient and its familly. We propose here the Transjugular Intrahepatic Portosystemic Shunt (TIPS). Twenty one patients were part of a study where 23 TIPS were placed, observing an immediate improval in 18 of them, a rebleeding in 2, within the first 24 and 48 hours. An embolization of the coronary veins was performed in the procedure in 15 patients, and a second intervention due to rebleeding in 2 of them. In the latter patients, the embolization of the coronary veins was rutinary.The survival of the patients has been outstanding.We conclude that this interventional procedure is a worldwide reality in the treatment of esophageal hemorrage by variceal bleeding due to portal hipertension, and it does not cut down the probability of liver transplant, unfortunately inexistent in our country. This procedure results in a low morbimortality with an adequate quality of life.
Film cooling effects on the tip flow characteristics of a gas turbine blade
Directory of Open Access Journals (Sweden)
Jin Wang
2015-03-01
Full Text Available An experimental investigation of the tip flow characteristics between a gas turbine blade tip and the shroud was conducted by a pressure-test system and a particle image velocimetry (PIV system. A three-times scaled profile of the GE-E3 blade with five film cooling holes was used as specimen. The effects on flow characteristics by the rim width and the groove depth of the squealer tip were revealed. The rim widths were (a 0.9%, (b 2.1%, and (c 3.0% of the axial chord, and the groove depths were (a 2.8%, (b 4.8%, and (c 10% of the blade span. Several pressure taps on the top plate above the blades were connected to pressure gauges. By a CCD camera the PIV system recorded the velocity field around the leading edge zone including the five cooling holes. The flow distributions both in the tip clearance and in the passage were revealed, and the influence of the inlet velocity was determined. In this work, the tip flow characteristics with and without film cooling were investigated. The effects of different global blowing ratios of M=0.5, 1.0, 1.3 and 2.5 were established. It was found that decreasing the rim width resulted in a lower mass flow rate of the leakage flow, and the pressure distributions from the leading edge to the trailing edge showed a linearly increasing trend. It was also found that if the inlet velocity was less than 1.5 m/s, the flow field in the passage far away from the suction side appeared as a stagnation zone.
Full Text Available ... opinion count. Sign in ... and use a continuous positive airway pressure (CPAP) device when sleeping? Here are some tips from the U.S. Food and Drug Administration (FDA) on how to safely ...
Caine, Jennifer A; Lin, Yi-Pin; Kessler, Julie R; Sato, Hiromi; Leong, John M; Coburn, Jenifer
2017-12-01
Borrelia burgdorferi (Bb) is the causative agent of Lyme disease in the United States, a disease that can result in carditis, and chronic and debilitating arthritis and/or neurologic symptoms if left untreated. Bb survives in the midgut of the Ixodes scapularis tick, or within tissues of immunocompetent hosts. In the early stages of infection, the bacteria are present in the bloodstream where they must resist clearance by the innate immune system of the host. We have found a novel role for outer surface protein C (OspC) from B. burgdorferi and B. garinii in interactions with the complement component C4b and bloodstream survival in vivo. Our data show that OspC inhibits the classical and lectin complement pathways and competes with complement protein C2 for C4b binding. Resistance to complement is important for maintenance of the lifecycle of Bb, enabling survival of the pathogen within the host as well as in the midgut of a feeding tick when ospC expression is induced. © 2017 John Wiley & Sons Ltd.
Rodrigues, Marcela I; Bravo, Juliana P; Sassaki, Flávio T; Severino, Fábio E; Maia, Ivan G
2013-12-01
Aquaporins have important roles in various physiological processes in plants, including growth, development and adaptation to stress. In this study, a gene encoding a root-specific tonoplast intrinsic aquaporin (TIP) from Eucalyptus grandis (named EgTIP2) was investigated. The root-specific expression of EgTIP2 was validated over a panel of five eucalyptus organ/tissues. In eucalyptus roots, EgTIP2 expression was significantly induced by osmotic stress imposed by PEG treatment. Histochemical analysis of transgenic tobacco lines (Nicotiana tabacum SR1) harboring an EgTIP2 promoter:GUS reporter cassette revealed major GUS staining in the vasculature and in root tips. Consistent with its osmotic-stress inducible expression in eucalyptus, EgTIP2 promoter activity was up-regulated by mannitol treatment, but was down-regulated by abscisic acid. Taken together, these results suggest that EgTIP2 might be involved in eucalyptus response to drought. Additional searches in the eucalyptus genome revealed the presence of four additional putative TIP coding genes, which could be individually assigned to the classical TIP1-5 groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Yang, Ying; Zhang, Lujia; Guo, Mingrong; Sun, Jiaqi; Matsukawa, Shingo; Xie, Jingli; Wei, Dongzhi
2015-04-15
In the process of gene mining for novel α-L-arabinofuranosidases (AFs), the gene Celf_3321 from Cellulomonas fimi ATCC 484 encodes an AF, termed as AbfCelf, with potent activity, 19.4 U/mg under the optimum condition, pH 6.0 and 40 °C. AbfCelf can hydrolyze α-1,5-linked oligosaccharides, sugar beet arabinan, linear 1,5-α-arabinan, and wheat flour arabinoxylan, which is partly different from some previously well-characterized GH 51 AFs. The traditional substrate-specificity analysis for AFs is labor-consuming and money costing, because the substrates include over 30 kinds of various 4-nitrophenol (PNP)-glycosides, oligosaccharides, and polysaccharides. Hence, a preliminary structure and mechanism based method was applied for substrate-specificity analysis. The binding energy (ΔG, kcal/mol) obtained by docking suggested the reaction possibility and coincided with the experimental results. AbfA crystal 1QW9 was used to test the rationality of docking method in simulating the interaction between enzyme and substrate, as well the credibility of the substrate-specificity analysis method in silico.
Tip Induced Motion of Adatoms on Metal Surfaces
International Nuclear Information System (INIS)
Kuerpick, U.; Rahman, T.S.
1999-01-01
From total energy calculations we show that for certain tip-adatom separations the activation barrier for the adatom to move towards the tip disappears and the adatom experiences an attractive force in the direction of the tip. For a Cu adatom at a (100) microfaceted step on Cu(111) this happens at a lateral separation of about one lattice constant, in agreement with recent experimental findings. Simultaneously, the activation barrier in the direction away from the tip increases significantly. The details of the changes in the potential energy surface induced by the tip are found to depend on the characteristics of the tip apex and its height above the adatom. copyright 1999 The American Physical Society
A lifting line model to investigate the influence of tip feathers on wing performance
International Nuclear Information System (INIS)
Fluck, M; Crawford, C
2014-01-01
Bird wings have been studied as prototypes for wing design since the beginning of aviation. Although wing tip slots, i.e. wings with distinct gaps between the tip feathers (primaries), are very common in many birds, only a few studies have been conducted on the benefits of tip feathers on the wing's performance, and the aerodynamics behind tip feathers remains to be understood. Consequently most aircraft do not yet copy this feature. To close this knowledge gap an extended lifting line model was created to calculate the lift distribution and drag of wings with tip feathers. With this model, is was easily possible to combine several lifting surfaces into various different birdwing-like configurations. By including viscous drag effects, good agreement with an experimental tip slotted reference case was achieved. Implemented in C++ this model resulted in computation times of less than one minute per wing configuration on a standard notebook computer. Thus it was possible to analyse the performance of over 100 different wing configurations with and without tip feathers. While generally an increase in wing efficiency was obtained by splitting a wing tip into distinct, feather-like winglets, the best performance was generally found when spreading more feathers over a larger dihedral angle out of the wing plane. However, as the results were very sensitive to the precise geometry of the feather fan (especially feather twist) a careless set-up could just as easily degrade performance. Hence a detailed optimization is recommended to realize the full benefits by simultaneously optimizing feather sweep, twist and dihedral angles. (paper)
Ma, Nan; Abel, Ted; Hernandez, Pepe J.
2009-01-01
It is well established that cAMP signaling within neurons plays a major role in the formation of long-term memories--signaling thought to proceed through protein kinase A (PKA). However, here we show that exchange protein activated by cAMP (Epac) is able to enhance the formation of long-term memory in the hippocampus and appears to do so…
Aerodynamic performance of winglets covering the tip gap inlet in a turbine cascade
International Nuclear Information System (INIS)
Lee, Sang Woo; Kim, Seon Ung; Kim, Kyoung Hoon
2012-01-01
Highlights: ► We test aerodynamics of PS and LEPS winglets for three winglet widths. ► PS winglet reduces tip leakage loss but increases loss in the passage vortex region. ► Mass-averaged loss reductions by PS and LEPS winglets are marginal. ► The loss reductions are much smaller than that by a cavity squealer tip. - Abstract: The aerodynamic performance of two different kinds of winglets covering the tip gap inlet of a plane tip, a “pressure-side” (PS) winglet and a “leading-edge and pressure-side” (LEPS) winglet, has been investigated in a turbine cascade. For a tip gap height-to-chord ratio of h/c = 2.0%, their width-to-pitch ratio is changed to be w/p = 2.64, 5.28, and 10.55%. The PS winglet reduces aerodynamic loss in the tip leakage vortex region as well as in an area downstream of the winglet-pressure surface corner, whereas it increases aerodynamic loss in the central area of the passage vortex region. The additional leading-edge winglet portion of the LEPS winglet reduces aerodynamic loss considerably on the casing wall side of the passage vortex region but delivers a noticeable aerodynamic loss increase on its mid-span side. These local trends are deepened with increasing w/p. However, the mass-averaged aerodynamic loss reductions by installing the PS and LEPS winglets in comparison with the baseline no winglet data are only marginal even for w/p = 10.55% and found much smaller than that by employing a cavity squealer tip.
Gori Savellini, Gianni; Gandolfo, Claudia; Cusi, Maria Grazia
2015-12-01
Toscana Virus (TOSV) is a Phlebovirus responsible for central nervous system (CNS) injury in humans. The TOSV non-structural protein (NSs), which interacting with RIG-I leads to its degradation, was analysed in the C terminus fragment in order to identify its functional domains. To this aim, two C-terminal truncated NSs proteins, Δ1C-NSs (aa 1-284) and Δ2C-NSs (aa 1-287) were tested. Only Δ1C-NSs did not present any inhibitory effect on RIG-I and it showed a greater stability than the whole NSs protein. Moreover, the deletion of the TLQ aa sequence interposed between the two ΔC constructs caused a greater accumulation of the protein with a weak inhibitory effect on RIG-I, indicating some involvement of these amino acids in the NSs activity. Nevertheless, all the truncated proteins were still able to interact with RIG-I, suggesting that the domains responsible for RIG-I signaling and RIG-I interaction are mapped on different regions of the protein. Copyright © 2015 Elsevier Inc. All rights reserved.
Twerdochlib, Adriana L; Chubatsu, Leda S; Souza, Emanuel M; Pedrosa, Fábio O; Steffens, M Berenice R; Yates, M Geoffrey; Rigo, Liu U
2003-07-01
NtrC is a bacterial enhancer-binding protein (EBP) that activates transcription by the sigma54 RNA polymerase holoenzyme. NtrC has a three domain structure typical of EBP family. In Herbaspirillum seropedicae, an endophytic diazotroph, NtrC regulates several operons involved in nitrogen assimilation, including glnAntrBC. In order to over-express and purify the NtrC protein, DNA fragments containing the complete structural gene for the whole protein, and for the N-terminal+Central and Central+C-terminal domains were cloned into expression vectors. The NtrC and NtrC(N-terminal+Central) proteins were over-expressed as His-tag fusion proteins upon IPTG addition, solubilized using N-lauryl-sarcosyl and purified by metal affinity chromatography. The over-expressed His-tag-NtrC(Central+C-terminal) fusion protein was partially soluble and was also purified by affinity chromatography. DNA band-shift assays showed that the NtrC protein and the Central+C-terminal domains bound specifically to the H. seropedicae glnA promoter region. The C-terminal domain is presumably necessary for DNA-protein interaction and DNA-binding does not require a phosphorylated protein.
Arctic tipping points in an Earth system perspective.
Wassmann, Paul; Lenton, Timothy M
2012-02-01
We provide an introduction to the volume The Arctic in the Earth System perspective: the role of tipping points. The terms tipping point and tipping element are described and their role in current science, general debates, and the Arctic are elucidated. From a wider perspective, the volume focuses upon the role of humans in the Arctic component of the Earth system and in particular the envelope for human existence, the Arctic ecosystems. The Arctic climate tipping elements, the tipping elements in Arctic ecosystems and societies, and the challenges of governance and anticipation are illuminated through short summaries of eight publications that derive from the Arctic Frontiers conference in 2011 and the EU FP7 project Arctic Tipping Points. Then some ideas based upon resilience thinking are developed to show how wise system management could ease pressures on Arctic systems in order to keep them away from tipping points.
Compressor airfoil tip clearance optimization system
Little, David A.; Pu, Zhengxiang
2015-08-18
A compressor airfoil tip clearance optimization system for reducing a gap between a tip of a compressor airfoil and a radially adjacent component of a turbine engine is disclosed. The turbine engine may include ID and OD flowpath boundaries configured to minimize compressor airfoil tip clearances during turbine engine operation in cooperation with one or more clearance reduction systems that are configured to move the rotor assembly axially to reduce tip clearance. The configurations of the ID and OD flowpath boundaries enhance the effectiveness of the axial movement of the rotor assembly, which includes movement of the ID flowpath boundary. During operation of the turbine engine, the rotor assembly may be moved axially to increase the efficiency of the turbine engine.
Effects of bromine on mitosis in root-tips of Allium cepa
Energy Technology Data Exchange (ETDEWEB)
Chury, J; Slouka, V
1949-01-01
The root-tips of Allium cepa, 1.5-2 cm. long, were exposed to pure bromine vapor for five minutes. The root-tips were then washed for ten minutes in water, and kept in fresh-water at a temperature of 20-24/sup 0/C. Squash preparations were made and stained according to the method of Darlington and La Cour. Bromine acting for five minutes on the root-tips of Allium has a specific effect on the cell nucleus in the resting stage. The effects induced are shown thirty-six hours after treatment by spindle abnormalities in metaphase and anaphase, and result in polyploidy in a large number of cells. Bromine produces chromosome and chromatid fragmentation; the latter may be followed by reunion. The effect of the bromine is cumulative and depends on the time which elapses between treatment and fixation. The cytological effects induced by bromine strongly suggest that it is another specific mutafacient chemical.
DEFF Research Database (Denmark)
Kraynack, Bryan A; Chan, Angela; Rosenthal, Eva Helga
2005-01-01
The "Dsl1p complex" in Saccharomyces cerevisiae, consisting of Dsl1p and Tip20p, is involved in Golgi-ER retrograde transport and it is functionally conserved from yeast to mammalian cells. To further characterize this complex, we analyzed the function of Dsl3p, a protein that interacts with Dsl1p...... in yeast two hybrids screens. DSL3, recently identified in a genome wide analysis of essential genes as SEC39, encodes a cytosolic protein of 82 kDa that is peripherally associated with membranes derived from the ER. There is strong genetic interaction between DSL3 and other factors required for Golgi...
Comparative study of C-Reactive Protein and other biochemical ...
African Journals Online (AJOL)
Serum levels of C-reactive proteins (CRP), Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), total protein, albumin and globulins were investigated using high sensitivity Immunoturbidometric and colorimetric techniques in individuals with hepatitis (n=50), Malaria (n=50) and 40 control subjects in age ...
Tips for Postpartum Dads and Partners
... Blues: Partners Interview with Wade Bowen Coping with Suicide & Loss Tips for Postpartum Dads and Partners Pregnancy and postpartum mood and anxiety disorders affect the whole family. Here are some tips ...
Full Text Available ... fall furniture head injury product safety television tipover tv Watch the video in Adobe Flash format. Almost ... accidents involving young children and furniture, appliance and tv tip-overs. The force of a large television ...
Full Text Available ... sleeping? Here are some tips from the U.S. Food and Drug Administration (FDA) on how to safely and effectively use your CPAP device. Category Education License Standard YouTube License Show more Show ...
Full Text Available ... Point by CPSC Blogger September 22, 2009 appliance child Childproofing CPSC danger death electrical fall furniture head ... see news reports about horrible accidents involving young children and furniture, appliance and tv tip-overs. The ...
Full Text Available ... of a large television falling from tipping furniture can be staggering. A 50 lb. TV falls with ... story of a building. That kind of impact can kill a child or cause severe injuries. About ...
Directory of Open Access Journals (Sweden)
Néstor Hugo Kisilevzky
2006-12-01
Full Text Available OBJETIVO: Avaliar a eficácia do TIPS (transjugular intrahepatic portosystemic shunt para tratar as complicações clínicas em pacientes com hipertensão portal. MATERIAIS E MÉTODOS: Quarenta e quatro pacientes, sendo 30 do sexo masculino e 14 do feminino e com idade média de 52 anos foram analisados. A indicação para realização de TIPS foi hemorragia gastrintestinal em 28 e ascite refratária em 16. Houve 7 pacientes Child-Pugh A, 24 Child-Pugh B e 11 Child-Pugh C. RESULTADOS: O TIPS foi realizado com sucesso em todos os pacientes (100%, verificando-se queda do gradiente pressórico porto-sistêmico médio de 49,69% (de 18,98 mmHg para 9,55 mmHg. Comprovou-se melhora clínica em 35 pacientes (79,55%. A mortalidade pós-operatóriaia foi de 13,64%, sendo mais incidente nos pacientes Child-Pugh C (45,45%. Os fatores mais relevantes de mau prognóstico foram o aumento da bilirrubina e do nível de creatinina. A sobrevida média de pacientes Child-Pugh A foi de 11,5 meses, nos Child-Pugh B foi de 10,97 meses e nos Child-Pugh C foi de apenas 5,9 meses. Foram observadas complicações em nove casos (20,44%. CONCLUSÃO: O TIPS é eficiente para reduzir a pressão portal. As complicações e a morbi-mortalidade relacionadas com o procedimento podem ser consideradas aceitáveis. A mortalidade foi influenciada por alguns fatores clínicos, tais como classe Child-Pugh C e elevação dos níveis séricos de bilirrubina e creatinina.OBJECTIVE: To evaluate the efficacy of TIPS (transjugular intrahepatic portosystemic shunt for resolving clinical complications in patients with portal hypertension. MATERIALS AND METHODS: Forty-four caucasian patients, 30 men and 14 women, with a mean age of 52 years have been evaluated. Indication for TIPS has been gastrointestinal hemorrhage in 28 patients, and refractory ascites in 16. There has been 7 Child-Pugh A patients, 24 Child-Pugh B, and 11 Child-Pugh C. RESULTS: TIPS was successfully performed in all the
Excised radicle tips as a source of genomic DNA for PCR-based ...
Indian Academy of Sciences (India)
2012-12-13
Dec 13, 2012 ... Cotton; cry1Ac; genomic DNA isolation; high-resolution melting curve analysis; radicle tip; seed purity testing .... cooled to 40°C. Fluorescence data for melting curves were ... greatly increased by introducing automation.
Nanomechanical properties of SiC films grown from C{sub 60} precursors using atomic force microscopy
Energy Technology Data Exchange (ETDEWEB)
Morse, K. [Colorado School of Mines, Golden, CO (United States); Balooch, M.; Hamza, A.V.; Belak, J. [Lawrence Livermore National Lab., CA (United States)
1994-12-01
The mechanical properties of SiC films grown via C{sub 60} precursors were determined using atomic force microscopy (AFM). Conventional silicon nitride and modified diamond cantilever AFM tips were employed to determine the film hardness, friction coefficient, and elastic modulus. The hardness is found to be between 26 and 40 GPa by nanoindentation of the film with the diamond tip. The friction coefficient for the silicon nitride tip on the SiC film is about one third that for silicon nitride sliding on a silicon substrate. By combining nanoindentation and AFM measurements an elastic modulus of {approximately}300 GPa is estimated for these SiC films. In order to better understand the atomic scale mechanisms that determine the hardness and friction of SiC, we simulated the molecular dynamics of a diamond indenting a crystalline SiC substrate.
Directory of Open Access Journals (Sweden)
Shengdi Fan
2013-09-01
Full Text Available Staphylococcus aureus AgrC is an important component of the agr quorum-sensing system. AgrC is a membrane-embedded histidine kinase that is thought to act as a sensor for the recognition of environmental signals and the transduction of signals into the cytoplasm. However, the difficulty of expressing and purifying functional membrane proteins has drastically hindered in-depth understanding of the molecular structures and physiological functions of these proteins. Here, we describe the high-yield expression and purification of AgrC, and analyze its kinase activity. A C-terminal green fluorescent protein (GFP fusion to AgrC served as a reporter for monitoring protein expression levels in real time. Protein expression levels were analyzed by the microscopic assessment of the whole-cell fluorescence. The expressed AgrC-GFP protein with a C-terminal His-tagged was purified using immobilized metal affinity chromatography (IMAC and size exclusion chromatography (SEC at yields of ≥10 mg/L, following optimization. We also assessed the effects of different detergents on membrane solubilization and AgrC kinase activity, and polyoxyethylene-(23-lauryl-ether (Brij-35 was identified as the most suitable detergent. Furthermore, the secondary structural stability of purified AgrC was analyzed using circular dichroism (CD spectroscopy. This study may serve as a general guide for improving the yields of other membrane protein preparations and selecting the appropriate detergent to stabilize membrane proteins for biophysical and biochemical analyses.
Full Text Available ... sleeping? Here are some tips from the U.S. Food and Drug Administration (FDA) on how to safely and effectively use your CPAP device. Category ... Ambulance Service 21,588 views 4:34 Obstructive Sleep Apnea ...
Full Text Available ... third story of a building. That kind of impact can kill a child or cause severe injuries. ... to prevent a tip-over tragedy. Share Post Facebook Twitter Google Plus Reddit Connect with Me: Visit ...
Continuum damage mechanics analysis of crack tip zone
International Nuclear Information System (INIS)
Yinchu, L.; Jianping, Z.
1989-01-01
The crack tip field and its intensity factor play an important role in fracture mechanics. Generally, the damage such as microcracks, microvoids etc. will initiate and grow in materials as the cracked body is subjected to external loadings, especially in the crack tip zone. The damage evolution will load to the crack tip damage field and the change of the stress, strain and displacement fields of cracks tip zone. In this paper, on the basis of continuum damage mechanics, the authors have derived the equations which the crack tip field and its intensity factor must satisfy in a loading process, calculated the angle distribution curves of stress, strain and displacement fields in a crack tip zone and have compared them with the corresponding curves of HRR field and linear elastic field in undamaged materials. The equations of crack tip field intensity factors have been solved and its solutions give the variation of the field intensity factors with the loading parameter
Recurrent tongue tip constriction in a captive giant anteater (Myrmecophaga tridactyla).
Steinmetz, Hanspeter W; Clauss, Marcus; Feige, Karsten; Thio, Tanja; Isenbügel, Ewald; Hatt, Jean-Michel
2007-03-01
A male giant anteater (Myrmecophage tridactyla) was treated twice for tongue tip constrictions. Clinical signs were partial anorexia, soft stool, bleeding from the mouth, and intermittent lingual discomfort. In the first presentation, wood fibers constricting the distal part of the tongue were detected by endoscopy and were removed. In the second presentation, bands of collagenous fibers were identified and resected. Dietary elements were responsible for both cases: elongated wood fibers were present in peat, which was included as a supplement to improve stool consistency, and collagenous fibers originated from fascias of lean meat, which served as a protein source in this diet. Preventive measures included sieving of the peat to eliminate long fibers and grinding of the meat, respectively, prior to diet presentation. A homogenous diet, utilizing cellulose rather than peat and dry cat food rather than meat, will avoid tongue tip constriction as described in these cases.
Translocation of an 89-kDa periplasmic protein is associated with Holospora infection
International Nuclear Information System (INIS)
Iwatani, Koichi; Dohra, Hideo; Lang, B. Franz; Burger, Gertraud; Hori, Manabu; Fujishima, Masahiro
2005-01-01
The symbiotic bacterium Holospora obtusa infects the macronucleus of the ciliate Paramecium caudatum. After ingestion by its host, an infectious form of Holospora with an electron-translucent tip passes through the host digestive vacuole and penetrates the macronuclear envelope with this tip. To investigate the underlying molecular mechanism of this process, we raised a monoclonal antibody against the tip-specific 89-kDa protein, sequenced this partially, and identified the corresponding complete gene. The deduced protein sequence carries two actin-binding motifs. Indirect immunofluorescence microscopy shows that during escape from the host digestive vacuole, the 89-kDa proteins translocates from the inside to the outside of the tip. When the bacterium invades the macronucleus, the 89-kDa protein is left behind at the entry point of the nuclear envelope. Transmission electron microscopy shows the formation of fine fibrous structures that co-localize with the antibody-labeled regions of the bacterium. Our findings suggest that the 89-kDa protein plays a role in Holospora's escape from the host digestive vacuole, the migration through the host cytoplasm, and the invasion into the macronucleus
Kawata, Satoshi
2007-01-01
This book discusses the recent advances in the area of near-field Raman scattering, mainly focusing on tip-enhanced and surface-enhanced Raman scattering. Some of the key features covered here are the optical structuring and manipulations, single molecule sensitivity, analysis of single-walled carbon nanotubes, and analytic applications in chemistry, biology and material sciences. This book also discusses the plasmonic materials for better enhancement, and optical antennas. Further, near-field microscopy based on second harmonic generation is also discussed. Chapters have been written by some of the leading scientists in this field, who present some of their recent work in this field.·Near-field Raman scattering·Tip-enhanced Raman spectroscopy·Surface-enhanced Raman spectroscopy·Nano-photonics·Nanoanalysis of Physical, chemical and biological materials beyond the diffraction limits·Single molecule detection
Numerical investigation of tip leakage vortex
Fredriksen, Vegard
2017-01-01
The Kaplan turbine has a small clearance gap between the blade tip and casing to allow the blades to rotate freely. This clearance gap is the cause of an undesirable Tip Leakage Vortex (TLV). A TLV might reduce the turbine efficiency, erode the turbine blades or cause instabilities for the power output. A literature study indicated that the tip clearance gap was a critical parameter affecting the behavior of the TLV. A research gap was observed for an operating Kaplan turbine where the ...
Principe, Maria; Micco, Alberto; Crescitelli, Alessio; Castaldi, Giuseppe; Consales, Marco; Esposito, Emanuela; La Ferrara, Vera; Galdi, Vincenzo; Cusano, Andrea
2016-04-01
We report on the first example of a "meta-tip" configuration that integrates a metasurface on the tip of an optical fiber. Our proposed design is based on an inverted-Babinet plasmonic metasurface obtained by patterning (via focused ion beam) a thin gold film deposited on the tip of an optical fiber, so as to realize an array of rectangular aperture nanoantennas with spatially modulated sizes. By properly tuning the resonances of the aperture nanoantennas, abrupt variations can be impressed in the field wavefront and polarization. We fabricated and characterized several proof-of-principle prototypes operating an near-infrared wavelengths, and implementing the beam-steering (with various angles) of the cross-polarized component, as well as the excitation of surface waves. Our results pave the way to the integration of the exceptional field-manipulation capabilities enabled by metasurfaces with the versatility and ubiquity of fiber-optics technological platforms.
Full Text Available ... Get YouTube Red. Working... Not now Try it free Find out why Close CPAP Tips from FDA ... safely and effectively use your CPAP device. Category Education License Standard YouTube License Show more Show less ...
Full Text Available ... sleeping? Here are some tips from the U.S. Food and Drug Administration (FDA) on how to safely ... Developers +YouTube Terms Privacy Policy & Safety Send feedback Test new features Loading... Working... Sign in to add ...
International Nuclear Information System (INIS)
Masushige, Shoichi; Tadokoro, Tadahiro; Suzuki, Takao; Nakajima, Hisao.
1983-01-01
The effect of dietary protein level on the metabolic fate of intraperitoneally administered (exogeneous) 8- 14 C-inosine in chicks was studied. Three different protein level diets (low, standard and high) were prepared. Chicks were fed on these diets for 10 days, respectively and the following results were found: (1) RNA content of liver, small intestine and muscle in chicks fed on a low protein diet was decreased as compared to other diet groups, but no difference was observed in kidney or pancreas. (2) 14 C uptake by organs from exogeneous 8- 14 C-inosine was determined. The uptake of 14 C in kidney, pancreas and small intestine was higher than that in liver and muscle. Moreover, the uptake by tissues in the low protein groups was significantly higher than that in either the standard or high protein groups, but no difference was observed between these latter two groups. (3) The rate of incorporation of 14 C labelled purine by acid soluble materials and RNA was higher in kidney, pancreas and small intestine than in liver and muscle, and also higher in chicks fed on a low protein diet than in either the standard or high protein groups. (4) It was revealed that the 14 C-labelled purine rings from 8- 14 C-inosine were incorporated into AMP and GMP as constituents of RNA. (author)
Note: Microelectrode-shielding tip for scanning probe electron energy spectroscopy
Huang, Wei; Li, Zhean; Xu, Chunkai; Liu, Jian; Xu, Chunye; Chen, Xiangjun
2018-04-01
We report a novel microelectrode-shielding tip (ME tip) for scanning probe electron energy spectroscopy (SPEES). The shielding effect of this tip is studied through comparing the detection efficiency with the normal tip by both experiment and simulation. The results show that the backscattering count rate detected by the SPEES instrument using the normal tip begins to decrease as the tip approaches to the sample surface within 21 μm, while that using the ME tip only starts to drop off within 1 μm. This indicates that the electron energy spectra can be measured with the ME tip at a much closer tip-sample distance. Furthermore, it is also demonstrated that the ME tip can be used to obtain topography of the sample surface in situ simultaneously.
Injector tip for an internal combustion engine
Shyu, Tsu Pin; Ye, Wen
2003-05-20
This invention relates to a the tip structure of a fuel injector as used in a internal combustion engine. Internal combustion engines using Homogeneous Charge Compression Ignition (HCCI) technology require a tip structure that directs fuel spray in a downward direction. This requirement necessitates a tip design that is capable of withstanding mechanical stresses associated with the design.
van Wijnen, M.; Stam, J. G.; van't Veer, C.; Meijers, J. C.; Reitsma, P. H.; Bertina, R. M.; Bouma, B. N.
1996-01-01
Protein S is a vitamin-K dependent glycoprotein involved in the regulation of the anticoagulant activity of activated protein C (APC). Recent data showed a direct anticoagulant role of protein S independent of APC, as demonstrated by the inhibition of prothrombinase and tenase activity both in
Modification of AFM Tips for Facilitating Picking-up of Nanoparticles
International Nuclear Information System (INIS)
Peng, Wang; Hai-Jun, Yang; Hua-Bin, Wang; Hai, Li; Xin-Yan, Wang; Ying, Wang; Jun-Hong, Lü; Bin, Li; Yi, Zhang; Jun, Hu
2008-01-01
The radius of atomic force microscope (AFM) tip is a key factor that influences nonspecific interactions between AFM tip and nanoparticles. Generally, a tip with larger radius contributes to a higher efficiency of picking up nanoparticles. We provide two methods for modifying the AFM tip: one is to wear a tip apex on a solid substrate and the other is to coat a tip with poly (dimethylsiloxane) (PDMS). Both the approaches can enhance the adhesion force between the tip and nanoparticles by increasing tip radius. The experimental results show that a modified tip, compared to an unmodified one, achieves six-fold efficiency improvement in the capture of targeted colloidal gold nanoparticles. (general)
Dynamic of cold-atom tips in anharmonic potentials
Menold, Tobias; Federsel, Peter; Rogulj, Carola; Hölscher, Hendrik; Fortágh, József
2016-01-01
Background: Understanding the dynamics of ultracold quantum gases in an anharmonic potential is essential for applications in the new field of cold-atom scanning probe microscopy. Therein, cold atomic ensembles are used as sensitive probe tips to investigate nanostructured surfaces and surface-near potentials, which typically cause anharmonic tip motion. Results: Besides a theoretical description of this anharmonic tip motion, we introduce a novel method for detecting the cold-atom tip dynamics in situ and real time. In agreement with theory, the first measurements show that particle interactions and anharmonic motion have a significant impact on the tip dynamics. Conclusion: Our findings will be crucial for the realization of high-sensitivity force spectroscopy with cold-atom tips and could possibly allow for the development of advanced spectroscopic techniques such as Q-control. PMID:28144505
Inhibition of protein kinase C induces differentiation in Neuro-2a cells
International Nuclear Information System (INIS)
Minana, M.D.; Felipo, V.; Grisolia, S.
1990-01-01
1-(5-Isoquinolinylsulfonyl)-2-methylpiperazine (H7), a potent inhibitor of protein kinase C, induced neuritogenesis in Neuro-2a cells, whereas N-(2-guanidinoethyl)-5-isoquinolinesulfonamide (HA 1004), which inhibits more efficiently cAMP- and cGMP-dependent protein kinases, did not. The effect, noticeable after 3 hr, was maximum (13-fold increase at 500 μM H7) between 1 and 3 days and was maintained over 2 months. In controls, 90% of the cells were undifferentiated, whereas after 3 hr with 500 μM H7 only 25% of the cells remained undifferentiated. DNA synthesis decreased as the number of differentiated cells increased. Differentiation is also functional since acetylcholinesterase activity increased ∼7-fold after 48 hr with 500 μM H7. Phorbol 12-myristate 13-acetate, a specific activator of protein kinase C, prevented or reversed the induction of neuritogenesis and the inhibition of DNA synthesis by H7. There is a good correlation between the level of protein kinase C and the percentage of differentiated cells. The results indicate that protein kinase C may play a key role in the control of differentiation of neural cells. Some possible clinical implications are briefly discussed
Full Text Available ... starting stop Loading... Watch Queue Queue __count__/__total__ It’s YouTube. Uninterrupted. Loading... Want music and videos with ... ads? Get YouTube Red. Working... Not now Try it free Find out why Close CPAP Tips from ...
Direct calculation of wind turbine tip loss
DEFF Research Database (Denmark)
Wood, D.H.; Okulov, Valery; Bhattacharjee, D.
2016-01-01
. We develop three methods for the direct calculation of the tip loss. The first is the computationally expensive calculation of the velocities induced by the helicoidal wake which requires the evaluation of infinite sums of products of Bessel functions. The second uses the asymptotic evaluation......The usual method to account for a finite number of blades in blade element calculations of wind turbine performance is through a tip loss factor. Most analyses use the tip loss approximation due to Prandtl which is easily and cheaply calculated but is known to be inaccurate at low tip speed ratio...
Einfinger, Katrin; Badrnya, Sigrun; Furtmüller, Margareta; Handschuh, Daniela; Lindner, Herbert; Geiger, Margarethe
2015-01-01
Protein C inhibitor is a secreted, non-specific serine protease inhibitor with broad protease reactivity. It binds glycosaminoglycans and anionic phospholipids, which can modulate its activity. Anionic phospholipids, such as phosphatidylserine are normally localized to the inner leaflet of the plasma membrane, but are exposed on activated and apoptotic cells and on plasma membrane-derived microparticles. In this report we show by flow cytometry that microparticles derived from cultured cells and activated platelets incorporated protein C inhibitor during membrane blebbing. Moreover, protein C inhibitor is present in/on microparticles circulating in normal human plasma as judged from Western blots, ELISAs, flow cytometry, and mass spectrometry. These plasma microparticles are mainly derived from megakaryocytes. They seem to be saturated with protein C inhibitor, since they do not bind added fluorescence-labeled protein C inhibitor. Heparin partially removed microparticle-bound protein C inhibitor, supporting our assumption that protein C inhibitor is bound via phospholipids. To assess the biological role of microparticle-bound protein C inhibitor we performed protease inhibition assays and co-precipitated putative binding partners on microparticles with anti-protein C inhibitor IgG. As judged from amidolytic assays microparticle-bound protein C inhibitor did not inhibit activated protein C or thrombin, nor did microparticles modulate the activity of exogenous protein C inhibitor. Among the proteins co-precipitating with protein C inhibitor, complement factors, especially complement factor 3, were most striking. Taken together, our data do not support a major role of microparticle-associated protein C inhibitor in coagulation, but rather suggest an interaction with proteins of the complement system present on these phospholipid vesicles. PMID:26580551
International Nuclear Information System (INIS)
Rodriguez-Medina, Caren; Boissinot, Sylvaine; Chapuis, Sophie; Gereige, Dalya; Rastegar, Maryam; Erdinger, Monique; Revers, Frédéric; Ziegler-Graff, Véronique; Brault, Véronique
2015-01-01
Turnip yellows virus (TuYV), a phloem-limited virus, encodes a 74 kDa protein known as the readthrough protein (RT) involved in virus movement. We show here that a TuYV mutant deleted of the C-terminal part of the RT protein (TuYV-∆RT_C_t_e_r) was affected in long-distance trafficking in a host-specific manner. By using the C-terminal domain of the RT protein as a bait in a yeast two-hybrid screen of a phloem cDNA library from Arabidopsis thaliana we identified the calcineurin B-like protein-interacting protein kinase-7 (AtCIPK7). Transient expression of a GFP:CIPK7 fusion protein in virus-inoculated Nicotiana benthamiana leaves led to local increase of wild-type TuYV accumulation, but not that of TuYV-∆RT_C_t_e_r. Surprisingly, elevated virus titer in inoculated leaves did not result in higher TuYV accumulation in systemic leaves, which indicates that virus long-distance movement was not affected. Since GFP:CIPK7 was localized in or near plasmodesmata, CIPK7 could negatively regulate TuYV export from infected cells. - Highlights: • The C-terminal domain of TuYV-RT is required for long-distance movement. • CIPK7 from Arabidopsis interacts with RT_C_t_e_r in yeast and in plants. • CIPK7 overexpression increases virus titer locally but not virus systemic movement. • CIPK7 localizes to plasmodesmata. • CIPK7 could be a defense protein regulating virus export.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Platelet factor 4 impairs the anticoagulant activity of activated protein C.
LENUS (Irish Health Repository)
Preston, Roger J S
2012-02-01
Platelet factor 4 (PF4) is an abundant platelet alpha-granule chemokine released following platelet activation. PF4 interacts with thrombomodulin and the gamma-carboxyglutamic acid (Gla) domain of protein C, thereby enhancing activated protein C (APC) generation by the thrombin-thrombomodulin complex. However, the protein C Gla domain not only mediates protein C activation in vivo, but also plays a critical role in modulating the diverse functional properties of APC once generated. In this study we demonstrate that PF4 significantly inhibits APC anti-coagulant activity. PF4 inhibited both protein S-dependent APC anticoagulant function in plasma and protein S-dependent factor Va (FVa) proteolysis 3- to 5-fold, demonstrating that PF4 impairs protein S cofactor enhancement of APC anticoagulant function. Using recombinant factor Va variants FVa-R506Q\\/R679Q and FVa-R306Q\\/R679Q, PF4 was shown to impair APC proteolysis of FVa at position Arg(306) by 3-fold both in the presence and absence of protein S. These data suggest that PF4 contributes to the poorly understood APC resistance phenotype associated with activated platelets. Finally, despite PF4 binding to the APC Gla domain, we show that APC in the presence of PF4 retains its ability to initiate PAR-1-mediated cytoprotective signaling. In summary, we propose that PF4 acts as a critical regulator of APC generation, but also differentially targets APC toward cytoprotective, rather than anticoagulant function at sites of vascular injury with concurrent platelet activation.
Platelet factor 4 impairs the anticoagulant activity of activated protein C.
LENUS (Irish Health Repository)
Preston, Roger J S
2009-02-27
Platelet factor 4 (PF4) is an abundant platelet alpha-granule chemokine released following platelet activation. PF4 interacts with thrombomodulin and the gamma-carboxyglutamic acid (Gla) domain of protein C, thereby enhancing activated protein C (APC) generation by the thrombin-thrombomodulin complex. However, the protein C Gla domain not only mediates protein C activation in vivo, but also plays a critical role in modulating the diverse functional properties of APC once generated. In this study we demonstrate that PF4 significantly inhibits APC anti-coagulant activity. PF4 inhibited both protein S-dependent APC anticoagulant function in plasma and protein S-dependent factor Va (FVa) proteolysis 3- to 5-fold, demonstrating that PF4 impairs protein S cofactor enhancement of APC anticoagulant function. Using recombinant factor Va variants FVa-R506Q\\/R679Q and FVa-R306Q\\/R679Q, PF4 was shown to impair APC proteolysis of FVa at position Arg(306) by 3-fold both in the presence and absence of protein S. These data suggest that PF4 contributes to the poorly understood APC resistance phenotype associated with activated platelets. Finally, despite PF4 binding to the APC Gla domain, we show that APC in the presence of PF4 retains its ability to initiate PAR-1-mediated cytoprotective signaling. In summary, we propose that PF4 acts as a critical regulator of APC generation, but also differentially targets APC toward cytoprotective, rather than anticoagulant function at sites of vascular injury with concurrent platelet activation.
Quantitative Proteomics Analysis of the cAMP/Protein Kinase A Signaling Pathway
2012-01-01
To define the proteins whose expression is regulated by cAMP and protein kinase A (PKA), we used a quantitative proteomics approach in studies of wild-type (WT) and kin- (PKA-null) S49 murine T lymphoma cells. We also compared the impact of endogenous increases in the level of cAMP [by forskolin (Fsk) and the phosphodiesterase inhibitor isobutylmethylxanthine (IBMX)] or by a cAMP analogue (8-CPT-cAMP). We identified 1056 proteins in WT and kin- S49 cells and found that 8-CPT-cAMP and Fsk with IBMX produced differences in protein expression. WT S49 cells had a correlation coefficient of 0.41 between DNA microarray data and the proteomics analysis in cells incubated with 8-CPT-cAMP for 24 h and a correlation coefficient of 0.42 between the DNA microarray data obtained at 6 h and the changes in protein expression after incubation with 8-CPT-cAMP for 24 h. Glutathione reductase (Gsr) had a higher level of basal expression in kin- S49 cells than in WT cells. Consistent with this finding, kin- cells are less sensitive to cell killing and generation of malondialdehyde than are WT cells incubated with H2O2. Cyclic AMP acting via PKA thus has a broad impact on protein expression in mammalian cells, including in the regulation of Gsr and oxidative stress. PMID:23110364
Pharmacokinetics of activated protein C in guinea pigs
International Nuclear Information System (INIS)
Berger, H. Jr.; Kirstein, C.G.; Orthner, C.L.
1991-01-01
Protein C is a vitamin K-dependent zymogen of the serine protease, activated protein C (APC), an important regulatory enzyme in hemostasis. In view of the potential of human APC as an anticoagulant and profibrinolytic agent, the pharmacokinetics and tissue distribution of APC were studied in guinea pigs. The plasma elimination of a trace dose of 125 I-APC was biphasic following an initial rapid elimination of approximately 15% of the injected dose within 1 to 2 minutes. This rapid removal of 125 I-APC from the circulation was found to be a result of an association with the liver regardless of the route of injection. Essentially identical results were obtained with active site-blocked forms of APC generated with either diisopropylfluorophosphate or D-phenylalanyl-L-prolyl-L-arginine chloromethyl ketone, which indicates that the active site was not essential for the liver association. Accumulation of all three forms of APC in the liver peaked at 30 minutes and then declined as increasing amounts of degraded radiolabeled material appeared in the gastrointestinal tract and urine. Removal of the gamma-carboxyglutamic acid (gla) domain of diisopropylphosphoryl-APC resulted in a 50% reduction in the association with liver and an accumulation in the kidneys. Protein C and protein S were cleared from the circulation at rates approximately one-half and one-fourth, respectively, that of APC. Both in vitro and in vivo, APC was found to form complexes with protease inhibitors present in guinea pig plasma. Complex formation resulted in a more rapid disappearance of the enzymatic activity of APC than elimination of the protein moiety. These findings indicate two distinct mechanisms for the elimination of APC. One mechanism involves reaction with plasma protease inhibitors and subsequent elimination by specific hepatic receptors. (Abstract Truncated)
Saad, Wael E; Lippert, Allison; Schwaner, Sandra; Al-Osaimi, Abdullah; Sabri, Saher; Saad, Nael
2014-01-01
Endoscopic experience in the management of duodenal varices (DVs) is limited and challenging given the anatomic constraints and limited experience. The endovascular management of DVs is not yet established and the controversy of whether to manage them by decompression with a transjugular intrahepatic portosystemic shunt (TIPS) or by transvenous obliteration is unresolved. In the literature, the 6-12 month rebleeding rate of DVs after TIPS is 21-37% and after transvenous obliteration is 13%. The purpose of the study is to evaluate the clinical outcome of combined TIPS decompression and transvenous obliteration/sclerosis. This is a retrospective study (case series) of two institutions, evaluating patients who underwent TIPS and/or transvenous obliteration/sclerosis for bleeding DVs (from January 2009 to June 2013). TIPS was performed according to a standard procedure using covered stents. Transvenous obliteration (variceal sclerosis) from the systemic and/or portal venous circulation was performed utilizing 3% sodium tetradecyl sulfate foam. Transvenous obliteration was commonly augmented with coils and/or vascular plugs. Technical (technical success of establishing TIPS and completely obliterating the DVs) and clinical outcomes (rebleeding rate and survival) were evaluated. Five patients with liver cirrhosis presenting with bleeding DVs were included in the study with all eventually (and coincidentally) receiving TIPS and transvenous obliteration. Two of the five patients underwent concomitant TIPS and transvenous obliteration in the same procedural setting. However, three patients underwent transvenous obliteration due to bleeding despite a patent TIPS that had been previously placed. The average time from TIPS placement to transvenous obliteration was 125 days (range: 3-324 days). After having both procedures, there was no rebleeding in the patients during a mean follow-up period of 22 months (6-50 months). Coils and/or metallic vascular plugs were used to augment
Improved labeling strategy for 13C relaxation measurements of methyl groups in proteins
International Nuclear Information System (INIS)
Lee, Andrew L.; Urbauer, Jeffrey L.; Wand, A. Joshua
1997-01-01
Selective incorporation of 13 C into the methyl groups of protein side chains is described as a means for simplifying the measurement and interpretation of 13 C relaxation parameters.High incorporation (>90%) is accomplished by using pyruvate(3- 13 C, 99%) as the sole carbon source in the growth media for protein overexpression in E. coli. This improved labeling scheme increases the sensitivity of the relaxation experiments by approximately fivefold when compared to randomly fractionally 13 C-labeled protein, allowing high-quality measurements on relatively dilute (<1 mM)protein samples at a relatively low cost
Directory of Open Access Journals (Sweden)
Namgyu Kim
2016-10-01
Full Text Available Tomato yellow leaf curl virus (TYLCV, a member of the genus Begomovirus, is one of the most important viruses of cultivated tomatoes worldwide, mainly causing yellowing and curling of leaves with stunting in plants. TYLCV causes severe problems in sub-tropical and tropical countries, as well as in Korea. However, the mechanism of TYLCV infection remains unclear, although the function of each viral component has been identified. TYLCV C4 codes for a small protein involved in various cellular functions, including symptom determination, gene silencing, viral movement, and induction of the plant defense response. In this study, through yeast-two hybrid screenings, we identified TYLCV C4-interacting host proteins from both healthy and symptom-exhibiting tomato tissues, to determine the role of TYLCV C4 proteins in the infection processes. Comparative analyses of 28 proteins from healthy tissues and 36 from infected tissues showing interactions with TYLCV C4 indicated that TYLCV C4 mainly interacts with host proteins involved in translation, ubiquitination, and plant defense, and most interacting proteins differed between the two tissues but belong to similar molecular functional categories. Four proteins—two ribosomal proteins, S-adenosyl-L-homocysteine hydrolase, and 14-3-3 family protein—were detected in both tissues. Furthermore, the identified proteins in symptom-exhibiting tissues showed greater involvement in plant defenses. Some are key regulators, such as receptor-like kinases and pathogenesis-related proteins, of plant defenses. Thus, TYLCV C4 may contribute to the suppression of host defense during TYLCV infection and be involved in ubiquitination for viral infection.
Potential allergenicity research of Cry1C protein from genetically modified rice.
Cao, Sishuo; He, Xiaoyun; Xu, Wentao; Luo, Yunbo; Ran, Wenjun; Liang, Lixing; Dai, Yunqing; Huang, Kunlun
2012-07-01
With the development of genetically modified crops, there has been a growing interest in available approaches to assess the potential allergenicity of novel gene products. We were not sure whether Cry1C could induce allergy. We examined the protein with three other proteins to determine the potential allergenicity of Cry1C protein from genetically modified rice. Female Brown Norway (BN) rats received 0.1 mg peanut agglutinin (PNA), 1mg potato acid phosphatase (PAP), 1mg ovalbumin (OVA) or 5 mg purified Cry1C protein dissolved in 1 mL water by daily gavage for 42 days to test potential allergenicity. Ten days after the last gavage, rats were orally challenged with antigens, and physiologic and immunologic responses were studied. In contrast to sensitization with PNA, PAP and OVA Cry1C protein did not induce antigen-specific IgG2a in BN rats. Cytokine expression, serum IgE and histamine levels and the number of eosinophils and mast cells in the blood of Cry1C group rats were comparable to the control group rats, which were treated with water alone. As Cry1C did not show any allergenicity, we make the following conclusion that the protein could be safety used in rice or other plants. Copyright © 2012 Elsevier Inc. All rights reserved.
Cai, Yitian; Teo, Boon Heng Dennis; Yeo, Joo Guan; Lu, Jinhua
2015-09-11
In infection, complement C1q recognizes pathogen-congregated antibodies and elicits complement activation. Among endogenous ligands, C1q binds to DNA and apoptotic cells, but whether C1q binds to nuclear DNA in apoptotic cells remains to be investigated. With UV irradiation-induced apoptosis, C1q initially bound to peripheral cellular regions in early apoptotic cells. By 6 h, binding concentrated in the nuclei to the nucleolus but not the chromatins. When nucleoli were isolated from non-apoptotic cells, C1q also bound to these structures. In vivo, C1q exists as the C1 complex (C1qC1r2C1s2), and C1q binding to ligands activates the C1r/C1s proteases. Incubation of nucleoli with C1 caused degradation of the nucleolar proteins nucleolin and nucleophosmin 1. This was inhibited by the C1 inhibitor. The nucleoli are abundant with autoantigens. C1q binding and C1r/C1s degradation of nucleolar antigens during cell apoptosis potentially reduces autoimmunity. These findings help us to understand why genetic C1q and C1r/C1s deficiencies cause systemic lupus erythematosus. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Aerodynamic performance of winglets covering the tip gap inlet in a turbine cascade
Energy Technology Data Exchange (ETDEWEB)
Lee, Sang Woo, E-mail: swlee@kumoh.ac.kr [Department of Mechanical Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Kim, Seon Ung; Kim, Kyoung Hoon [Department of Mechanical Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of)
2012-04-15
Highlights: Black-Right-Pointing-Pointer We test aerodynamics of PS and LEPS winglets for three winglet widths. Black-Right-Pointing-Pointer PS winglet reduces tip leakage loss but increases loss in the passage vortex region. Black-Right-Pointing-Pointer Mass-averaged loss reductions by PS and LEPS winglets are marginal. Black-Right-Pointing-Pointer The loss reductions are much smaller than that by a cavity squealer tip. - Abstract: The aerodynamic performance of two different kinds of winglets covering the tip gap inlet of a plane tip, a 'pressure-side' (PS) winglet and a 'leading-edge and pressure-side' (LEPS) winglet, has been investigated in a turbine cascade. For a tip gap height-to-chord ratio of h/c = 2.0%, their width-to-pitch ratio is changed to be w/p = 2.64, 5.28, and 10.55%. The PS winglet reduces aerodynamic loss in the tip leakage vortex region as well as in an area downstream of the winglet-pressure surface corner, whereas it increases aerodynamic loss in the central area of the passage vortex region. The additional leading-edge winglet portion of the LEPS winglet reduces aerodynamic loss considerably on the casing wall side of the passage vortex region but delivers a noticeable aerodynamic loss increase on its mid-span side. These local trends are deepened with increasing w/p. However, the mass-averaged aerodynamic loss reductions by installing the PS and LEPS winglets in comparison with the baseline no winglet data are only marginal even for w/p = 10.55% and found much smaller than that by employing a cavity squealer tip.
DO SLOVENIAN DEALERS USE TECHNIQUES FOR INCREASING THEIR TIPS?
Directory of Open Access Journals (Sweden)
Andrej Raspor
2016-05-01
Full Text Available In 1996 Michael Lynn introduced the idea that restaurant managers could increase tips for their waiters and thus increase turnover by training the waiters to engage tip-enhancing behaviours. Since then, the list of tip-enhancing behaviours has expanded. Therefore the potential to increase tips is more accessible. The purpose of this paper was to examine how Slovenian dealers use strategies to increase their tips. We tested fourteen techniques to increase tips. The study was carried out among 473 gaming employees, 279 of which are dealers, in the Slovenian gaming industry, in order to find out how they use these techniques and which of them can bring about an increase in their tips. The study showed that Slovenian dealers mostly do not use these techniques, and that the dealers who do use them tend to receive tips more often. The findings imply that managers and employees should be informed of these techniques in order to increase tips and their overall income. Practical implications are that we suggest that management considers these ideas for increasing flexibility and reducing the cost of work: (1 informing dealers on ways of increasing tips, (2 including the acquisition of this specific knowledge in their career plans, (3 carrying out a reform of the reward system which would include tips. Social implications will be shown in a higher gaming revenue. It is very likely – as shown in our research – that employees will receive higher wages as these will be topped up by tips. The state, in turn, will collect more taxes.
Hard-tip, soft-spring lithography.
Shim, Wooyoung; Braunschweig, Adam B; Liao, Xing; Chai, Jinan; Lim, Jong Kuk; Zheng, Gengfeng; Mirkin, Chad A
2011-01-27
Nanofabrication strategies are becoming increasingly expensive and equipment-intensive, and consequently less accessible to researchers. As an alternative, scanning probe lithography has become a popular means of preparing nanoscale structures, in part owing to its relatively low cost and high resolution, and a registration accuracy that exceeds most existing technologies. However, increasing the throughput of cantilever-based scanning probe systems while maintaining their resolution and registration advantages has from the outset been a significant challenge. Even with impressive recent advances in cantilever array design, such arrays tend to be highly specialized for a given application, expensive, and often difficult to implement. It is therefore difficult to imagine commercially viable production methods based on scanning probe systems that rely on conventional cantilevers. Here we describe a low-cost and scalable cantilever-free tip-based nanopatterning method that uses an array of hard silicon tips mounted onto an elastomeric backing. This method-which we term hard-tip, soft-spring lithography-overcomes the throughput problems of cantilever-based scanning probe systems and the resolution limits imposed by the use of elastomeric stamps and tips: it is capable of delivering materials or energy to a surface to create arbitrary patterns of features with sub-50-nm resolution over centimetre-scale areas. We argue that hard-tip, soft-spring lithography is a versatile nanolithography strategy that should be widely adopted by academic and industrial researchers for rapid prototyping applications.
14C Analysis of protein extracts from Bacillus spores.
Cappuccio, Jenny A; Falso, Miranda J Sarachine; Kashgarian, Michaele; Buchholz, Bruce A
2014-07-01
Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F(14)C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F(14)C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F(14)C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F(14)C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their (14)C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate (14)C bomb-pulse dating. Since media is contemporary, (14)C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Rosuvastatin to prevent vascular events in men and women with elevated C-reactive protein
Ridker, Paul M.; Danielson, Eleanor; Fonseca, Francisco A. H.; Genest, Jacques; Gotto, Antonio M.; Kastelein, John J. P.; Koenig, Wolfgang; Libby, Peter; Lorenzatti, Alberto J.; Macfadyen, Jean G.; Nordestgaard, Børge G.; Shepherd, James; Willerson, James T.; Glynn, Robert J.; Ridker, P. M.; Fonseca, F. A. H.; Genest, J.; Gotto, A. M.; Koenig, W.; Libby, P.; Lorenzatti, A. J.; Nordestgaard, B. G.; Shepherd, J.; Willerson, J. T.; Danielson, E.; Glynn, R. J.; MacFadyen, J. G.; Mora, S.; Collins, R.; Bailey, K.; Gersh, B.; Lamas, G.; Smith, S.; Vaughan, D.; Mahaffey, K.; Brown, P.; Montgomery, D.; Wilson, M.; Wood, F.; Altamirano, J.; Boskis, P.; Colombo, H.; Cuneo, C.; Diaz, M.; Esper, R.; Trip, M.; Hoekstra, J.; Koch, S.; Lucas, M.; van de Beek, M.
2008-01-01
BACKGROUND: Increased levels of the inflammatory biomarker high-sensitivity C-reactive protein predict cardiovascular events. Since statins lower levels of high-sensitivity C-reactive protein as well as cholesterol, we hypothesized that people with elevated high-sensitivity C-reactive protein levels
Numerical Simulation of LVAD Inflow Cannulas with Different Tip
Directory of Open Access Journals (Sweden)
Guang-Mao Liu
2012-01-01
Full Text Available The tip structure of LVAD inflow cannula is one of major factors to lead adverse events such as thrombosis and suction leading to obstruction. In this research, four kinds of tips that had been used in inflow cannulas were selected and designed. The flow field of the four inflow cannulas inserted into the apex of left ventricle (LV was numerically computed by computational fluid dynamics. The flow behavior was analyzed in order to compare the blood compatibility and suction in left ventricle and cannulas after the inflow cannulas with different tips were inserted to the apex of LV. The results showed that the cannula tip structure affected the LVAD performance. Among these four cannulas, the trumpet-tipped inflow cannula owned the best performance in smooth flow velocity distribution without backflow or low-velocity flow so that it was the best in blood compatibility. Nevertheless, the caged tipped cannula was the worst in blood compatibility. And the blunt-tipped and beveled tipped inflow cannulas may obstruct more easily than trumpet and caged tipped inflow cannulas because of their shape. The study indicated that the trumpet tip was the most preferable for the inflow cannula of long-term LVAD.
cAMP signalling in the vasculature: the role of Epac (exchange protein directly activated by cAMP).
Roberts, Owain Llŷr; Dart, Caroline
2014-02-01
The second messenger cAMP plays a central role in mediating vascular smooth muscle relaxation in response to vasoactive transmitters and in strengthening endothelial cell-cell junctions that regulate the movement of solutes, cells and macromolecules between the blood and the surrounding tissue. The vasculature expresses three cAMP effector proteins: PKA (protein kinase A), CNG (cyclic-nucleotide-gated) ion channels, and the most recently discovered Epacs (exchange proteins directly activated by cAMP). Epacs are a family of GEFs (guanine-nucleotide-exchange factors) for the small Ras-related GTPases Rap1 and Rap2, and are being increasingly implicated as important mediators of cAMP signalling, both in their own right and in parallel with the prototypical cAMP target PKA. In the present paper, we review what is currently known about the role of Epac within blood vessels, particularly with regard to the regulation of vascular tone, endothelial barrier function and inflammation.
Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J
2005-03-01
Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.
De March, Matteo; Demitri, Nicola; De Zorzi, Rita; Casini, Angela; Gabbiani, Chiara; Guerri, Annalisa; Messori, Luigi; Geremia, Silvano
2014-06-01
The electrostatic surface of cytochrome c and its changes with the iron oxidation state are involved in the docking and undocking processes of this protein to its biological partners in the mitochondrial respiratory pathway. To investigate the subtle mechanisms of formation of productive macromolecular complexes and of their breakage following the electron transfer process, the X-ray structures of horse heart ferri-cytochrome c (trigonal form) and ferro-cytochrome c (monoclinic form) were obtained using nitrate ions both as a crystallizing agent and an anionic probe for mapping the electrostatic surface changes. Both crystal forms contain three protein molecules in the asymmetric unit. In addition, a total of 21.5 and 18 crystallographically independent nitrate ions were identified for the trigonal and monoclinic forms, respectively. By matching all the six crystallographically independent protein molecules, 26 different anion-protein interaction sites were identified on the surfaces of cytochrome c, 10 of which were found in both forms, 8 present only in the oxidized and 8 only in the reduced form. The structural analysis of the electron transfer complexes, based on this new information, suggests a specific exit strategy for cytochrome c after formation of productive protein-protein complexes: a directional sliding mechanism for the electron shuttle on the surface of the redox partner is proposed to take place after the electron transfer process has occurred. Copyright © 2014 Elsevier Inc. All rights reserved.
Activated protein C attenuates acute ischaemia reperfusion injury in skeletal muscle.
LENUS (Irish Health Repository)
Dillon, J P
2012-02-03
Activated protein C (APC) is an endogenous anti-coagulant with anti-inflammatory properties. The purpose of the present study was to evaluate the effects of activated protein C in the setting of skeletal muscle ischaemia reperfusion injury (IRI). IRI was induced in rats by applying rubber bands above the levels of the greater trochanters bilaterally for a period of 2h followed by 12h reperfusion. Treatment groups received either equal volumes of normal saline or activated protein C prior to tourniquet release. Following 12h reperfusion, muscle function was assessed electrophysiologically by electrical field stimulation. The animals were then sacrificed and skeletal muscle harvested for evaluation. Activated protein C significantly attenuated skeletal muscle reperfusion injury as shown by reduced myeloperoxidase content, wet to dry ratio and electrical properties of skeletal muscle. Further in vitro work was carried out on neutrophils isolated from healthy volunteers to determine the direct effect of APC on neutrophil function. The effects of APC on TNF-alpha stimulated neutrophils were examined by measuring CD18 expression as well as reactive oxygen species generation. The in vitro work demonstrated a reduction in CD18 expression and reactive oxygen species generation. We conclude that activated protein C may have a protective role in the setting of skeletal muscle ischaemia reperfusion injury and that this is in part mediated by a direct inhibitory effect on neutrophil activation.
Youssoufian, H; Kruyt, FAE; Li, XT
1999-01-01
Current methods for direct gene transfer into hematopoietic cells are inefficient. Here we show that functional complementation of Fanconi anemia (FA) group C cells by protein replacement can be as efficacious as by transfection with wild-type FAC cDNA, We expressed a chimeric protein (called
Tumor promoter induced membrane-bound protein kinase C - its influence on hematogenous metastasis
International Nuclear Information System (INIS)
Gopalakrishna, R.; Barsky, S.H.
1987-01-01
A correlation between the amount of membrane-bound detergent-extractable protein kinase C activity in various B16 melanoma sublines (F10, F1, BL6) and their lung metastasizing abilities following intravenous injection was found. The F10 subline which exhibits higher metastasizing ability was found to have higher membrane-bound protein kinase C compared to the lower metastasizing subline, F1. Treatment of F1 cells with 100 nM 12-0 tetradecanoylphorbol-13-acetate (TPA) for 1h resulted in 90% decrease in protein kinase C activity in the cytosol with a concommitent increase in membrane-bound activity. These TPA-treated cells when injected intravenously in C57BL/6 mice produced 6-fold increase in pulmonary metastases compared to untreated F1 cells. However, biologically inactive analogues 4 α-phorbol 12,13-didecanoate and phorbol 13-acetate had no effect on either membrane-bound protein kinase C activity or pulmonary metastases. Treating F1 cells with the second-stage tumor promoter, mezerin, resulted in increase in both membrane association of protein kinase C and also lung metastases. Thus, these results strongly suggests that membrane associated protein kinase C activity influences hematogenous metastasis of these melanoma cells
Productivity tips for developers
CERN. Geneva
2018-01-01
I like to read about productivity tools and techniques, but the problem is - most of them are completely overrated, the tips are not that useful or they are too difficult to implement. But, sometimes I can find some stuff that really makes me think "damn, how could I live without this before?!". Today, I would like to share some of them and hopefully hear about the tips and tricks that you use. Maybe we can find a way to share them somehow (github repo/forum)?
Temperature-controlled irrigated tip radiofrequency catheter ablation
DEFF Research Database (Denmark)
Petersen, H H; Chen, X; Pietersen, Adrian
1998-01-01
INTRODUCTION: In patients with ventricular tachycardias due to structural heart disease, catheter ablation cures radiofrequency ablation. Irrigated tip radiofrequency ablation using power control and high infusion rates enlarges lesion......: We conclude that temperature-controlled radiofrequency ablation with irrigated tip catheters using low target temperature and low infusion rate enlarges lesion size without increasing the incidence of cratering and reduces coagulum formation of the tip....
Full Text Available ... to prevent a tip-over tragedy. Share Post Facebook Twitter Google Plus Reddit Connect with Me: Visit other Web Sites Maintained by CPSC: cpsc.gov| poolsafely.gov| recalls.gov| saferproducts.gov Privacy, Security, and Legal Notice | Accessibility Policy | Open Government @ ...
Myotonin protein-kinase [AGC]n trinucleotide repeat in seven nonhuman primates
Energy Technology Data Exchange (ETDEWEB)
Novelli, G.; Sineo, L.; Pontieri, E. [Catholic Univ. of Rome (Italy)]|[Univ. of Milan (Italy)]|[Univ. Florence (Italy)] [and others
1994-09-01
Myotonic dystrophy (DM) is due to a genomic instability of a trinucleotide [AGC]n motif, located at the 3{prime} UTR region of a protein-kinase gene (myotonin protein kinase, MT-PK). The [AGC] repeat is meiotically and mitotically unstable, and it is directly related to the manifestations of the disorder. Although a gene dosage effect of the MT-PK has been demonstrated n DM muscle, the mechanism(s) by which the intragenic repeat expansion leads to disease is largely unknown. This non-standard mutational event could reflect an evolutionary mechanism widespread among animal genomes. We have isolated and sequenced the complete 3{prime}UTR region of the MT-PK gene in seven primates (macaque, orangutan, gorilla, chimpanzee, gibbon, owl monkey, saimiri), and examined by comparative sequence nucleotide analysis the [AGC]n intragenic repeat and the surrounding nucleotides. The genomic organization, including the [AGC]n repeat structure, was conserved in all examined species, excluding the gibbon (Hylobates agilis), in which the [AGC]n upstream sequence (GGAA) is replaced by a GA dinucleotide. The number of [AGC]n in the examined species ranged between 7 (gorilla) and 13 repeats (owl monkeys), with a polymorphism informative content (PIC) similar to that observed in humans. These results indicate that the 3{prime}UTR [AGC] repeat within the MT-PK gene is evolutionarily conserved, supporting that this region has important regulatory functions.
DEFF Research Database (Denmark)
Sørensen, Inge Juul; Nielsen, EH; Andersen, Ove
1996-01-01
Serum amyloid P component (SAP), a member of the conserved pentraxin family of plasma proteins, binds calcium dependently to its ligands. The authors investigated SAPs interaction with the complement proteins C4b binding protein (C4bp) and C1q by ELISA, immunoelectrophoresis and electron microscopy....... Binding of these proteins to SAP was demonstrated when SAP was immobilized using F(ab')2 anti-SAP, but not when SAP reacted with these proteins in liquid phase; thus the binding to human SAP was markedly phase state dependent. Presaturation of solid phase SAP with heparin, which binds SAP with high...... affinity, did not interfere with the subsequent binding of C4bp or C1q to SAP. In contrast, collagen I and IV showed partial competition with the binding of C1q to SAP. Using fresh serum, immobilized native SAP bound C4bp whereas binding of C1q/C1 could not be demonstrated. Altogether the results indicate...
Determinants of RNA binding and translational repression by the Bicaudal-C regulatory protein.
Zhang, Yan; Park, Sookhee; Blaser, Susanne; Sheets, Michael D
2014-03-14
Bicaudal-C (Bic-C) RNA binding proteins function as important translational repressors in multiple biological contexts within metazoans. However, their RNA binding sites are unknown. We recently demonstrated that Bic-C functions in spatially regulated translational repression of the xCR1 mRNA during Xenopus development. This repression contributes to normal development by confining the xCR1 protein, a regulator of key signaling pathways, to specific cells of the embryo. In this report, we combined biochemical approaches with in vivo mRNA reporter assays to define the minimal Bic-C target site within the xCR1 mRNA. This 32-nucleotide Bic-C target site is predicted to fold into a stem-loop secondary structure. Mutational analyses provided evidence that this stem-loop structure is important for Bic-C binding. The Bic-C target site was sufficient for Bic-C mediated repression in vivo. Thus, we describe the first RNA binding site for a Bic-C protein. This identification provides an important step toward understanding the mechanisms by which evolutionarily conserved Bic-C proteins control cellular function in metazoans.
Depressive symptoms and C-reactive protein in a Brazilian urban community
Directory of Open Access Journals (Sweden)
W.W. Dressler
2006-08-01
Full Text Available Psychological depression is an independent risk factor for coronary artery disease. C-reactive protein has been implicated as a mediator of the effect of psychological depression. Several studies have found that individuals, especially men, who report higher levels of psychological depression also have higher levels of C-reactive protein. The current study was undertaken to replicate these results in a Brazilian population, in which there is a much wider range of variation in both background characteristics (such as socioeconomic status and coronary artery disease risk factors. A sample of 271 individuals was interviewed using the Center for Epidemiological Studies Depression Scale. Fasting blood samples were obtained and evaluated for C-reactive protein (assessed by a turbidimetric immunoassay using a Dade Behring kit analysis in a subsample (N = 258 of individuals. The mean ± SD C-reactive protein for the entire sample was 0.43 ± 0.44, with 0.42 ± 0.48 for men and 0.43 ± 0.42 mg/L for women. Data were analyzed using multiple regression analysis, controlling for age, sex, body mass index, socioeconomic status, tobacco use, and both total cholesterol and low-density lipoprotein cholesterol. Higher reported depressive symptoms were correlated with higher C-reactive protein for men (partial r = 0.298, P = 0.004 and with lower C-reactive protein for women (partial r = -0.154, P = 0.059. The differences in the associations for men and women could be a result of differential effects of sex hormones on stress reactivity and immune response. On the other hand, this difference in the associations may be related to gender differences in the disclosure of emotion and the effect that self-disclosure has on physical health and immune response.
DEFF Research Database (Denmark)
Petersen, J; Nielsen, O; Egel, R
1998-01-01
of the late G2 cells in a vegetatively growing population. Expression of both FH3-GFP fusions also affected cytokinesis. Overexpression of the spindle pole body component Sad1 altered the distribution of both Sad1 and the FH3-GFP domain. Together these data suggest that proteins at multiple sites can interact...... is required for conjugation, and is localized to the projection tip in cells of mating pairs. We replaced genomic fus1+ with green fluorescent protein (GFP)- tagged versions that lacked either the FH1, FH2, or FH3 domain. Deletion of any FH domain essentially abolished mating. FH3, but neither FH1 nor FH2......, was required for Fus1 localization. An FH3 domain-GFP fusion protein localized to the projection tips of mating pairs. Thus, the FH3 domain alone can direct protein localization. The FH3 domains of both Fus1 and the S. pombe cytokinesis formin Cdc12 were able to localize GFP to the spindle pole body in half...
DEFF Research Database (Denmark)
Russkamp, Dennis; Van Vaerenbergh, Matthias; Etzold, Stefanie
2018-01-01
-like protein (C1q) and PDGF/VEGF-like factor 1 (PVF1). C1q and PVF1 were produced as recombinant proteins in insect cells. Their allergenic properties were examined by determining the level of specific IgE antibodies in the sera of HBV-allergic patients (n = 26) as well as by their capacity to activate...... frugiperda insect cells exhibited specific IgE reactivity with approximately 38.5% of sera of HBV-allergic patients. Interestingly, both proteins were unable to activate basophils of the patients, questioning their role in the context of clinically relevant sensitization. Recombinant C1q and PVF1 can build...
TIPS Evaluation Project Retrospective Study: Wave 1 and 2.
Hubbard, Susan M.; Mulvey, Kevin P.
2003-01-01
Measured substance abuse treatment professionals' knowledge, attitudes, and practices regarding the Treatment Improvement Protocol (TIP) series and the 28 TIPs. Results for 3,267 respondents in wave 1 and 1,028 in wave 2 indicate that almost half of all professionals were aware of the TIPs. Attitudes toward TIPs were positive, but professionals…
Directory of Open Access Journals (Sweden)
Wael E Saad
2014-01-01
Full Text Available Objectives: Endoscopic experience in the management of duodenal varices (DVs is limited and challenging given the anatomic constraints and limited experience. The endovascular management of DVs is not yet established and the controversy of whether to manage them by decompression with a transjugular intrahepatic portosystemic shunt (TIPS or by transvenous obliteration is unresolved. In the literature, the 6-12 month rebleeding rate of DVs after TIPS is 21-37% and after transvenous obliteration is 13%. The purpose of the study is to evaluate the clinical outcome of combined TIPS decompression and transvenous obliteration/sclerosis. Materials and Methods: This is a retrospective study (case series of two institutions, evaluating patients who underwent TIPS and/or transvenous obliteration/sclerosis for bleeding DVs (from January 2009 to June 2013. TIPS was performed according to a standard procedure using covered stents. Transvenous obliteration (variceal sclerosis from the systemic and/or portal venous circulation was performed utilizing 3% sodium tetradecyl sulfate foam. Transvenous obliteration was commonly augmented with coils and/or vascular plugs. Technical (technical success of establishing TIPS and completely obliterating the DVs and clinical outcomes (rebleeding rate and survival were evaluated. Results: Five patients with liver cirrhosis presenting with bleeding DVs were included in the study with all eventually (and coincidentally receiving TIPS and transvenous obliteration. Two of the five patients underwent concomitant TIPS and transvenous obliteration in the same procedural setting. However, three patients underwent transvenous obliteration due to bleeding despite a patent TIPS that had been previously placed. The average time from TIPS placement to transvenous obliteration was 125 days (range: 3-324 days. After having both procedures, there was no rebleeding in the patients during a mean follow-up period of 22 months (6-50 months
Magnetic elements for switching magnetization magnetic force microscopy tips
International Nuclear Information System (INIS)
Cambel, V.; Elias, P.; Gregusova, D.; Martaus, J.; Fedor, J.; Karapetrov, G.; Novosad, V.
2010-01-01
Using combination of micromagnetic calculations and magnetic force microscopy (MFM) imaging we find optimal parameters for novel magnetic tips suitable for switching magnetization MFM. Switching magnetization MFM is based on two-pass scanning atomic force microscopy with reversed tip magnetization between the scans. Within the technique the sum of the scanned data with reversed tip magnetization depicts local atomic forces, while their difference maps the local magnetic forces. Here we propose the design and calculate the magnetic properties of tips suitable for this scanning probe technique. We find that for best performance the spin-polarized tips must exhibit low magnetic moment, low switching fields, and single-domain state at remanence. The switching field of such tips is calculated and optimum shape of the Permalloy elements for the tips is found. We show excellent correspondence between calculated and experimental results for Py elements.
Hateboer, G.; Timmers, H.T.M.; Rustgi, A.K.; Billaud, Marc; Veer, L.J. Van 't; Bernards, R.A.
1993-01-01
Using a protein binding assay, we show that the amino-teminal 204 amino acids of the c-Myc protein interact di y with a key component of the basal p tdon factor TFID, the TATA box-binding protein (TBP). Essentialy the same region of the c-Myc protein alo binds the product of the retinoblatoma
Directory of Open Access Journals (Sweden)
G. González Rey
2007-09-01
Full Text Available Mediante un modelo matemático son dadas las principales relaciones entre los parámetros geométricos básicos requeridosen la evaluación del diámetro de cresta exterior de un engranaje ortogonal de ruedas cónicas con dientes rectos y suma decorrecciones radiales iguales a cero. Adicionalmente, serán brindados algunos resultados que asocian la correspondenciaentre una geometría racional y la capacidad de carga de un engranaje cónico con restricciones del diámetro de crestaexterior. Para la determinación de los procedimientos de cálculo, los problemas planteados sobre los modelos matemáticoshan sido serán representados por medio de grafos bicromáticos.Palabras claves: Engranajes cónicos, diseño racional, modelo matemático._______________________________________________________________________________Abstract:By means of a mathematical model, the main relations for the evaluation of the outer tip diameter on straight bevelgear with sum of the profile shift coefficients equal to zero are given. Additionally, some results associated with arational geometry and high load capacities of straight bevel gear with restrictions in the outer tip diameter arepresented. For the determination of the calculation procedures based on mathematical models was used thetechnique of representation by means of graphs.Key words: Straight bevel gear, rational design, mathematical models, graphs technique.
Development of diacyltetrol lipids as activators for the C1 domain of protein kinase C.
Mamidi, Narsimha; Gorai, Sukhamoy; Mukherjee, Rakesh; Manna, Debasis
2012-04-01
The protein kinase C (PKC) family of serine/threonine kinases is an attractive drug target for the treatment of cancer and other diseases. Diacylglycerol (DAG), phorbol esters and others act as ligands for the C1 domain of PKC isoforms. Inspection of the crystal structure of the PKCδ C1b subdomain in complex with phorbol-13-O-acetate shows that one carbonyl group and two hydroxyl groups play pivotal roles in recognition of the C1 domain. To understand the importance of two hydroxyl groups of phorbol esters in PKC binding and to develop effective PKC activators, we synthesized DAG like diacyltetrols (DATs) and studied binding affinities with C1b subdomains of PKCδ and PKCθ. DATs, with the stereochemistry of natural DAGs at the sn-2 position, were synthesized from (+)-diethyl L-tartrate in four to seven steps as single isomers. The calculated EC(50) values for the short and long chain DATs varied in the range of 3-6 μM. Furthermore, the fluorescence anisotropy values of the proteins were increased in the presence of DATs in a similar manner to that of DAGs. Molecular docking of DATs (1b-4b) with PKCδ C1b showed that the DATs form hydrogen bonds with the polar residues and backbone of the protein, at the same binding site, as that of DAG and phorbol esters. Our findings reveal that DATs represent an attractive group of C1 domain ligands that can be used as research tools or further structurally modified for potential drug development.
Interaction between cardiac myosin-binding protein C and formin Fhod3.
Matsuyama, Sho; Kage, Yohko; Fujimoto, Noriko; Ushijima, Tomoki; Tsuruda, Toshihiro; Kitamura, Kazuo; Shiose, Akira; Asada, Yujiro; Sumimoto, Hideki; Takeya, Ryu
2018-05-08
Mutations in cardiac myosin-binding protein C (cMyBP-C) are a major cause of familial hypertrophic cardiomyopathy. Although cMyBP-C has been considered to regulate the cardiac function via cross-bridge arrangement at the C-zone of the myosin-containing A-band, the mechanism by which cMyBP-C functions remains unclear. We identified formin Fhod3, an actin organizer essential for the formation and maintenance of cardiac sarcomeres, as a cMyBP-C-binding protein. The cardiac-specific N-terminal Ig-like domain of cMyBP-C directly interacts with the cardiac-specific N-terminal region of Fhod3. The interaction seems to direct the localization of Fhod3 to the C-zone, since a noncardiac Fhod3 variant lacking the cMyBP-C-binding region failed to localize to the C-zone. Conversely, the cardiac variant of Fhod3 failed to localize to the C-zone in the cMyBP-C-null mice, which display a phenotype of hypertrophic cardiomyopathy. The cardiomyopathic phenotype of cMyBP-C-null mice was further exacerbated by Fhod3 overexpression with a defect of sarcomere integrity, whereas that was partially ameliorated by a reduction in the Fhod3 protein levels, suggesting that Fhod3 has a deleterious effect on cardiac function under cMyBP-C-null conditions where Fhod3 is aberrantly mislocalized. Together, these findings suggest the possibility that Fhod3 contributes to the pathogenesis of cMyBP-C-related cardiomyopathy and that Fhod3 is critically involved in cMyBP-C-mediated regulation of cardiac function via direct interaction.
LENUS (Irish Health Repository)
Marshall, C
2012-02-03
Cardiopulmonary bypass has evolved over the last 30 years. It is an important tool for the cardiac surgeon today and also has applications in non-cardiac operations such as surgery to extract tumours. Such patients undergoing surgery for cancer may be at an increased risk of a thromboembolic event post surgery, due to disturbances in the normal clotting pathway leading to hypercoagulability. One such disturbance is malignancy-induced Protein C deficiency. A deficiency of Protein C can cause hypercoagulabitity. Recent studies have examined cardiopulmonary bypass and inherited Protein C deficiency. However, surgery for cancer patients with a malignancy-induced Protein C deficiency involving cardiopulmonary bypass has not been reported. Surgery using CPB in these patients may result in increased morbidity and mortality. The objective of this article is to review the literature in order to discuss the occurrence, the aetiology and possible management of cancer patients with malignancy-induced Protein C deficiencies that require cardiopulmonary bypass for their surgery.
Effects of plastic anisotropy on crack-tip behaviour
DEFF Research Database (Denmark)
Legarth, Brian Nyvang; Tvergaard, Viggo; Kuroda, Mitsutoshi
2002-01-01
For a crack in a homogeneous material the effect of plastic anisotropy on crack-tip blunting and on the near-tip stress and strain fields is analyzed numerically. The full finite strain analyses are carried out for plane strain under small scale yielding conditions, with purely symmetric mode I...... loading remote from the crack-tip. In cases where the principal axes of the anisotropy are inclined to the plane of the crack it is found that the plastic zones as well as the stress and strain fields just around the blunted tip of the crack become non-symmetric. In these cases the peak strain...... on the blunted tip occurs off the center line of the crack, thus indicating that the crack may want to grow in a different direction. When the anisotropic axes are parallel to the crack symmetry is retained, but the plastic zones and the near-tip fields still differ from those predicted by standard isotropic...
Embolization with the Amplatzer Vascular Plug in TIPS Patients
International Nuclear Information System (INIS)
Pattynama, Peter M. T.; Wils, Alexandra; Linden, Edwin van der; Dijk, Lukas C. van
2007-01-01
Vessel embolization can be a valuable adjunct procedure in transjugular intrahepatic portosystemic shunt (TIPS). During the creation of a TIPS, embolization of portal vein collaterals supplying esophageal varices may lower the risk of secondary rebleeding. And after creation of a TIPS, closure of the TIPS itself may be indicated if the resulting hepatic encephalopathy severely impairs mental functioning. The Amplatzer Vascular Plug (AVP; AGA Medical, Golden Valley, MN) is well suited for embolization of large-diameter vessels and has been employed in a variety of vascular lesions including congenital arteriovenous shunts. Here we describe the use of the AVP in the context of TIPS to embolize portal vein collaterals (n = 8) or to occlude the TIPS (n = 2)
Predictive value of C-reactive protein in critically ill patients after abdominal surgery
Directory of Open Access Journals (Sweden)
Frédéric Sapin
Full Text Available OBJECTIVES: The development of sepsis after abdominal surgery is associated with high morbidity and mortality. Due to inflammation, it may be difficult to diagnose infection when it occurs, but measurement of C-reactive protein could facilitate this diagnosis. In the present study, we evaluated the predictive value and time course of C-reactive protein in relation to outcome in patients admitted to the intensive care unit (ICU after abdominal surgery. METHODS: We included patients admitted to the ICU after abdominal surgery over a period of two years. The patients were divided into two groups according to their outcome: favorable (F; left the ICU alive, without modification of the antibiotic regimen and unfavorable (D; death in the ICU, surgical revision with or without modification of the antibiotic regimen or just modification of the regimen. We then compared the highest C-reactive protein level on the first day of admission between the two groups. RESULTS: A total of 308 patients were included: 86 patients had an unfavorable outcome (group D and 222 had a favorable outcome (group F. The groups were similar in terms of leukocytosis, neutrophilia, and platelet count. C-reactive protein was significantly higher at admission in group D and was the best predictor of an unfavorable outcome, with a sensitivity of 74% and a specificity of 72% for a threshold of 41 mg/L. No changes in C-reactive protein, as assessed based on the delta C-reactive protein, especially at days 4 and 5, were associated with a poor prognosis. CONCLUSIONS: A C-reactive protein cut-off of 41 mg/L during the first day of ICU admission after abdominal surgery was a predictor of an adverse outcome. However, no changes in the C-reactive protein concentration, especially by day 4 or 5, could identify patients at risk of death.
Purification and characterization of cGMP binding protein-phosphodiesterase from rat lung
International Nuclear Information System (INIS)
Francis, S.H.; Walseth, T.F.; Corbin, J.D.
1986-01-01
The cGMP binding protein-phosphodiesterase (cG-BPP) with a phosphodiesterase specific activity of 7 μM/min/mg has been purified from rat lung by sequential chromatography on DEAE-cellulose, Blue-Sepharose, zinc chelate affinity adsorbent and HPLC-DEAE. Migration of the major band on SDS-PAGE corresponds to a MW of ∼93,000. Both cGMP phosphodiesterase activity and cGMP binding from the HPLC-DEAE profile correlate with this band. Since the authors previous work has determined the native MW to be ∼177,000, this suggests a dimeric structure comprised of two 93,000 MW subunits for the rat lung cG-BPP. At low cGMP concentrations, cGMP binding is stimulated ∼20-fold by histone and ∼5-fold by 3-isobutyl-1-methylxanthine(IBMX). The purified protein has one component of cGMP dissociation with a rate constant of 0.045/min. Photolysis of the purified protein in the presence of 32 P-cGMP labels the 93,000 MW band and this labeling is increased by IBMX, indicating that the 93,000 MW band is a subunit of the cGMP-BPP. This implies that the enzyme preparation is nearly homogeneous, a conclusion also supported by a minimum [ 3 H]-cGMP binding stoichiometry of 0.5 mol per 93,000 subunit. An additional protein band with a MW of ∼90,000 also occurs in these preparations which exhibits behavior similar to the 93,000 MW protein. N 2 -Hexyl-cGMP inhibits phosphodiesterase activity by competing with cGMP for hydrolysis at the catalytic site but not at the binding site. N 2 -Hexyl cGMP actually increases cGMP binding. This provides the first evidence that cGMP binding is increased by compounds hydrolyzed at the catalytic site. This interaction between the binding and phosphodiesterase sites could be important in the regulation of the functions of these sites in vivo
International Nuclear Information System (INIS)
Yokota, Shin-ichi; Okabayashi, Tamaki; Fujii, Nobuhiro
2011-01-01
Measles virus (MeV) produces two accessory proteins, V and C, from the P gene. These accessory proteins have been reported to contribute to efficient virus proliferation through the modulation of host cell events. Our previous paper described that Vero cell-adapted strains of MeV led host cells to growth arrest through the upregulation of interferon regulatory factor 1 (IRF-1), and wild strains did not. In the present study, we found that C protein expression levels varied among MeV strains in infected SiHa cells. C protein levels were inversely correlated with IRF-1 expression levels and with cell growth arrest. Forced expression of C protein released cells from growth arrest. C-deficient recombinant virus efficiently upregulated IRF-1 and caused growth arrest more efficiently than the wild-type virus. C protein preferentially bound to phosphorylated STAT1 and suppressed STAT1 dimer formation. We conclude that MeV C protein suppresses IFN-γ signaling pathway via inhibition of phosphorylated STAT1 dimerization.
International Nuclear Information System (INIS)
Zullo, J.; Stiles, C.D.; Garcea, R.L.
1987-01-01
The levels of c-myc, c-fos, and JE mRNAs accumulate in a biphasic pattern following infection of quiescent BALB/c 3T3 mouse cells with polyomavirus. Maximal levels of c-myc and c-fos mRNAs were seen within 1 hr and were nearly undetectable at 6 hr after infection. At 12 hr after infection mRNA levels were again maximal and remained elevated thereafter. Empty virions (capsids) and recombinant VP 1 protein, purified from Escherichia coli, induced the early but not the late phase of mRNA accumulation. Virions, capsids, and recombinant VP 1 protein stimulated [ 3 H]thymidine nuclear labeling and c-myc mRNA accumulation in a dose-responsive manner paralleling their affinity for the cell receptor for polyoma. The second phase of mRNA accumulation is regulated by the viral early gene products, as shown by polyomavirus early gene mutants and by a transfected cell line (336a) expressing middle tumor antigen upon glucocorticoid addition. These results suggest that polyomavirus interacts with the cell membrane at the onset of infection to increase the levels of mRNA for the cellular genes associated with cell competence for DNA replication, and subsequently these levels are maintained by the action of the early viral proteins
Energy Technology Data Exchange (ETDEWEB)
Hansen, Alexandar L.; Bouvignies, Guillaume; Kay, Lewis E., E-mail: kay@pound.med.utoronto.ca [University of Toronto, Departments of Molecular Genetics, Biochemistry and Chemistry (Canada)
2013-03-15
A {sup 13}C{sup {alpha}} chemical exchange saturation transfer based experiment is presented for the study of protein systems undergoing slow interconversion between an 'observable' ground state and one or more 'invisible' excited states. Here a labeling strategy whereby [2-{sup 13}C]-glucose is the sole carbon source is exploited, producing proteins with {sup 13}C at the C{sup {alpha}} position, while the majority of residues remain unlabeled at CO or C{sup {beta}}. The new experiment is demonstrated with an application to the folding reaction of the Im7 protein that involves an on-pathway excited state. The obtained excited state {sup 13}C{sup {alpha}} chemical shifts are cross validated by comparison to values extracted from analysis of CPMG relaxation dispersion profiles, establishing the utility of the methodology.
Bilateral leukocoria in a patient with homozygous protein C deficiency
International Nuclear Information System (INIS)
Khan, Nasrat M.; Al-Dohayan, Noura D.; Al-Batiniji, Fatima S.
2007-01-01
We describe a bilateral leukocoria and neonatal purpura fulminans in a male infant, born at full term after an unremarkable pregnancy to a healthy consanguineous married couple. Multiple hemorrhagic skin bullae were found at birth on various parts of the body with bilateral leukocoria, organized vitreous hemorrhage, retinal detachment, and intracranial hemorrhage with undetectable levels of protein C activity. We report a clinical case of homozygous protein-C deficiency with severe purpura fulminans and bilateral leukocoria. (author)
Increased Prevalence of Activated Protein C Resistance During ...
African Journals Online (AJOL)
Background: Acquired resistance to protein C in pregnancy has been established as one of the factors associated with ..... diabetes, sickle cell disease, smoking, anti-phospholipid syndrome inherited thrombophilia, and previous history of.
Modulation of TIP60 by Human Papilloma Virus in Breast Cancer
2013-04-01
1 AG________ Award Number: W81XWH-11-1-0687 Title Modulation of TIP60 by Human Papilloma Virus in Breast Cancer... Human Papilloma Virus in Breast Cancer 5b. GRANT NUMBER 1 H 11 1 06 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Betty Diamond 5d. PROJECT...virus (EBV), Hepatitis B Virus (HBV), Hepatitis C virus (HCV), Human Papilloma virus (HPV), Human T-cell lymphotropic virus (HTLV-1) and Kaposi’s
Microneedles array with biodegradable tips for transdermal drug delivery
Iliescu, Ciprian; Chen, Bangtao; Wei, Jiashen; Tay, Francis E. H.
2008-12-01
The paper presented an enhancement solution for transdermal drug delivery using microneedles array with biodegradable tips. The microneedles array was fabricated by using deep reactive ion etching (DRIE) and the biodegradable tips were made to be porous by electrochemical etching process. The porous silicon microneedle tips can greatly enhance the transdermal drug delivery in a minimum invasion, painless, and convenient manner, at the same time; they are breakable and biodegradable. Basically, the main problem of the silicon microneedles consists of broken microneedles tips during the insertion. The solution proposed is to fabricate the microneedle tip from a biodegradable material - porous silicon. The silicon microneedles are fabricated using DRIE notching effect of reflected charges on mask. The process overcomes the difficulty in the undercut control of the tips during the classical isotropic silicon etching process. When the silicon tips were formed, the porous tips were then generated using a classical electrochemical anodization process in MeCN/HF/H2O solution. The paper presents the experimental results of in vitro release of calcein and BSA with animal skins using a microneedle array with biodegradable tips. Compared to the transdermal drug delivery without any enhancer, the microneedle array had presented significant enhancement of drug release.
International Nuclear Information System (INIS)
Francois, D.
1975-01-01
The study of potential energy variations in a loaded elastic solid containing a crack leads to determination of the crack driving force G. Generalization of this concept to cases other than linear elasticity leads to definition of the integral J. In a linear solid, the crack tip stress field is characterized by a single parameter: the stress-intensity factor K. When the crack tip plastic zone size is confined to the elastic singularity J=G, it is possible to establish relationship between these parameters and plastic strain (and in particular the crack tip opening displacement delta). The stress increases because of the triaxiality effect. This overload rises with increasing strain hardening. When the plastic zone size expands, using certain hypotheses, delta can be calculated. The plastic strain intensity is exclusively dependent on parameter J [fr
Hasegawa, Chika; Kumazawa, Takeshi; Uchigasaki, Seisaku; Lee, Xiao-Pen; Sato, Keizo; Terada, Masaru; Kurosaki, Kunihiko
2011-10-01
Dextromethorphan was extracted from human plasma samples (100 μL) using MonoTip C(18) tips, which are packed with C(18)-bonded monolithic silica gel that is attached to the inside of the tip. The samples, which contained dextromethorphan and trimeprazine as an internal standard (IS), were mixed with 200 μL of distilled water and 50 μL of 1 mol/L glycine-sodium hydroxide buffer (pH 10). The mixture was extracted to the C(18) phase of the tip by 20 sequential aspirating/dispensing cycles using a manual micropipettor. The analytes retained on the C(18) phase were then eluted with methanol by five sequential aspirating/dispensing cycles. The eluate was injected directly into a gas chromatograph and detected by a mass spectrometer with selected ion monitoring in positive electron ionization mode. An Equity-5 fused silica capillary column (30 m × 0.32 mm i.d., film thickness 0.5 μm) gave adequate separation of the dextromethorphan, IS, and impurities. The recoveries of dextromethorphan and the IS spiked into plasma were >87.4%. The regression equation for dextromethorphan showed excellent linearity from 2.5 to 320 ng/mL of plasma, and the limit of detection was 1.25 ng/mL of plasma. The intraday and interday coefficients of variation were less than 10.5% and 14.7%, respectively. The accuracy ranged from 91.9% to 107%. The validated method was successfully used to quantify the plasma concentration of dextromethorphan in a human subject after oral administration of the drug. © Springer-Verlag 2011
Protein kinase C, focal adhesions and the regulation of cell migration
DEFF Research Database (Denmark)
Fogh, Betina S; Multhaupt, Hinke A B; Couchman, John Robert
2014-01-01
in their intracellular compartment. Among these are tyrosine kinases, which have received a great deal of attention, whereas the serine/threonine kinase protein kinase C has received much less. Here the status of protein kinase C in focal adhesions and cell migration is reviewed, together with discussion of its roles...... and adhesion turnover. Focal adhesions, or focal contacts, are widespread organelles at the cell-matrix interface. They arise as a result of receptor interactions with matrix ligands, together with clustering. Recent analysis shows that focal adhesions contain a very large number of protein components...
Complete cDNA sequence coding for human docking protein
Energy Technology Data Exchange (ETDEWEB)
Hortsch, M; Labeit, S; Meyer, D I
1988-01-11
Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.
Minimizing fouling at hydrogenated conical-tip carbon electrodes during dopamine detection in vivo.
Chandra, Shaneel; Miller, Anthony D; Bendavid, Avi; Martin, Philip J; Wong, Danny K Y
2014-03-04
In this paper, physically small conical-tip carbon electrodes (∼2-5 μm diameter and ∼4 μm axial length) were hydrogenated to develop a probe capable of withstanding fouling during dopamine detection in vivo. Upon hydrogenation, the resultant hydrophobic sp(3) carbon surface deters adsorption of amphiphilic lipids, proteins, and peptides present in extracellular fluid and hence minimizes electrode fouling. These hydrogenated carbon electrodes showed a 35% decrease in sensitivity but little change in the limit of detection for dopamine over a 7-day incubation in a synthetic laboratory solution containing 1.0% (v/v) caproic acid (a lipid), 0.1% (w/v) bovine serum albumin and 0.01% (w/v) cytochrome C (both are proteins), and 0.002% (w/v) human fibrinopeptide B (a peptide). Subsequently, during dopamine detection in vivo, over 70% of the dopamine oxidation current remained after the first 30 min of a 60-min experiment, and at least 50% remained over the next half-period at the hydrogenated carbon electrodes. On the basis of these results, an initial average electrode surface fouling rate of 1.2% min(-1) was estimated, which gradually declined to 0.7% min(-1). These results support minimal fouling at hydrogenated carbon electrodes applied to dopamine detection in vivo.
Directory of Open Access Journals (Sweden)
Kajal Gupta
2010-11-01
Full Text Available C-di-GMP, a bacterial second messenger plays a key role in survival and adaptation of bacteria under different environmental conditions. The level of c-di-GMP is regulated by two opposing activities, namely diguanylate cyclase (DGC and phosphodiesterase (PDE-A exhibited by GGDEF and EAL domain, respectively in the same protein. Previously, we reported a bifunctional GGDEF-EAL domain protein, MSDGC-1 from Mycobacterium smegmatis showing both these activities (Kumar and Chatterji, 2008. In this current report, we have identified and characterized the homologous protein from Mycobacterium tuberculosis (Rv 1354c named as MtbDGC. MtbDGC is also a bifunctional protein, which can synthesize and degrade c-di-GMP in vitro. Further we expressed Mtbdgc in M. smegmatis and it was able to complement the MSDGC-1 knock out strain by restoring the long term survival of M. smegmatis. Another protein Rv 1357c, named as MtbPDE, is an EAL domain protein and degrades c-di-GMP to pGpG in vitro. Rv1354c and 1357c have seven cysteine amino acids in their sequence, distributed along the full length of the protein. Disulfide bonds play an important role in stabilizing protein structure and regulating protein function. By proteolytic digestion and mass spectrometric analysis of MtbDGC, connectivity between cysteine pairs Cys94-Cys584, Cys2-Cys479 and Cys429-Cys614 was determined, whereas the third cysteine (Cys406 from N terminal was found to be free in MtbDGC protein, which was further confirmed by alkylation with iodoacetamide labeling. Bioinformatics modeling investigations also supported the pattern of disulfide connectivity obtained by Mass spectrometric analysis. Cys406 was mutated to serine by site directed mutagenesis and the mutant MtbC406S was not found to be active and was not able to synthesize or degrade c-di-GMP. The disulfide connectivity established here would help further in understanding the structure - function relationship in MtbDGC.
[Identification of C(2)M interacting proteins by yeast two-hybrid screening].
Yue, Shan-shan; Xia, Lai-xin
2015-11-01
The synaptonemal complex (SC) is a huge structure which assembles between the homologous chromosomes during meiotic prophase I. Drosophila germ cell-specific nucleoprotein C(2)M clustering at chromosomes can induce SC formation. To further study the molecular function and mechanism of C(2)M in meiosis, we constructed a bait vector for C(2)M and used the yeast two-hybrid system to identify C(2)M interacting proteins. Forty interacting proteins were obtained, including many DNA and histone binding proteins, ATP synthases and transcription factors. Gene silencing assays in Drosophila showed that two genes, wech and Psf1, may delay the disappearance of SC. These results indicate that Wech and Psf1 may form a complex with C(2)M to participate in the formation or stabilization of the SC complex.
Research progress in TIPS shunt dysfunction and recanalization
Directory of Open Access Journals (Sweden)
WANG Tingting
2015-11-01
Full Text Available Transjugular intrahepatic portosystemic shunt (TIPS is widely used in the treatment of cirrhotic portal hypertension and its associated complications. However, postoperative shunt dysfunction has been an important factor restricting the clinical application of TIPS. This article summarizes the use of shunt, the incidence of shunt dysfunction after TIPS, preventive measures and diagnostic methods for shunt dysfunction, and indications and techniques of shunt recanalization, in order to enhance our knowledge of shunt dysfunction and recanalization, which could further improve the efficacy of TIPS for cirrhotic portal hypertension.
Hepatitis C virus core protein induces hepatic steatosis via Sirt1-dependent pathway.
Zhang, Chuanhai; Wang, Jingjing; Zhang, Hanlin; Liu, Shunai; Lee, Hyuek Jong; Jin, Wanzhu; Cheng, Jun
2018-05-01
Hepatic steatosis is a common feature of patients with chronic hepatitis C. Previous reports have shown that the overexpression of hepatitis C virus core-encoding sequences (hepatitis C virus genotypes 3a and 1b) significantly induces intracellular triglyceride accumulation. However, the underlying mechanism has not yet been revealed. To investigate whether Sirt1 is involved in hepatitis C virus-mediated hepatic steatosis, the overexpression of hepatitis C virus core 1b protein and Sirt1 and the knockdown of Sirt1 in HepG2 cells were performed. To confirm the results of the cellular experiment liver-specific Sirt1 KO mice with lentivirus-mediated hepatitis C virus core 1b overexpression were studied. Our results show that hepatitis C virus core 1b protein overexpression led to the accumulation of triglycerides in HepG2 cells. Notably the expression of PPARγ2 was dramatically increased at both the mRNA and protein levels by hepatitis C virus core 1b overexpression. The protein expression of Sirt1 is an upstream regulator of PPARγ2 and was also significantly increased after core 1b overexpression. In addition, the overexpression or knockdown of Sirt1 expression alone was sufficient to modulate p300-mediated PPARγ2 deacetylation. In vivo studies showed that hepatitis C virus core protein 1b-induced hepatic steatosis was attenuated in liver-specific Sirt1 KO mice by downregulation of PPARγ2 expression. Sirt1 mediates hepatitis C virus core protein 1b-induced hepatic steatosis by regulation of PPARγ2 expression. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Twelve Tips for Effective Electronic Presentation.
Crosby, Joy
1994-01-01
Offers 12 tips for effective electronic presentation. This article is intended for readers who may be considering using electronic presentation for the first time. Offers reasons for its popularity and occasions when it may be used. The tips offer assistance in the design and presentation of electronic material. (LZ)
Directory of Open Access Journals (Sweden)
Carlo Travaglini-Allocatelli
2013-01-01
Full Text Available Cytochromes c (Cyt c are ubiquitous heme-containing proteins, mainly involved in electron transfer processes, whose structure and functions have been and still are intensely studied. Surprisingly, our understanding of the molecular mechanism whereby the heme group is covalently attached to the apoprotein (apoCyt in the cell is still largely unknown. This posttranslational process, known as Cyt c biogenesis or Cyt c maturation, ensures the stereospecific formation of the thioether bonds between the heme vinyl groups and the cysteine thiols of the apoCyt heme binding motif. To accomplish this task, prokaryotic and eukaryotic cells have evolved distinctive protein machineries composed of different proteins. In this review, the structural and functional properties of the main maturation apparatuses found in gram-negative and gram-positive bacteria and in the mitochondria of eukaryotic cells will be presented, dissecting the Cyt c maturation process into three functional steps: (i heme translocation and delivery, (ii apoCyt thioreductive pathway, and (iii apoCyt chaperoning and heme ligation. Moreover, current hypotheses and open questions about the molecular mechanisms of each of the three steps will be discussed, with special attention to System I, the maturation apparatus found in gram-negative bacteria.
A Nanoscale Plasma Etching Process for Pole Tip Recession of Perpendicular Recording Magnetic Head
LIU, Shoubin; HE, Dayao
2017-01-01
The pole tip of perpendicular recording head is constructed in a stacked structure with materials of NiCoFe, NiFe, Al2O3 and AlTiC. The surfaces of different materials are set at different heights below the air-bearing surface of slider. This paper presented a plasma dry etching process for Pole Tip Recession (PTR) based on an ion beam etching system. Ar and O2 mixed plasma at small incident angles have a high removal rate to the nonmagnetic material. It was utilised to etch the reference sur...
Directory of Open Access Journals (Sweden)
Simon G. Kimuda
2017-01-01
Full Text Available Latent tuberculosis infection (LTBI is evidence of immunological control of tuberculosis. Dormancy survival regulator (DosR regulon-encoded proteins may have a role in the maintenance of LTBI. T cell responses to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were found to be most frequent among household contacts of TB cases from Uganda compared to other DosR proteins, but antibody responses were not described. We characterized antibody responses to these proteins in individuals from Uganda. Antibodies to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were measured in 68 uninfected individuals, 62 with LTBI, and 107 with active pulmonary tuberculosis (APTB cases. There were no differences in the concentrations of antibodies to Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins between individuals with LTBI and APTB and those who were uninfected. LTBI was associated with higher concentrations of antibodies to Rv1733c in female participants [adjusted geometric mean ratio: 1.812, 95% confidence interval (CI: 1.105 2.973, and p=0.019] but not in males (p value for interaction = 0.060. Antibodies to the four DosR regulon-encoded proteins investigated may not serve as good biomarkers of LTBI in the general population. More of the M.tb proteome needs to be screened to identify proteins that induce strong antibody responses in LTBI.
... this page: https://medlineplus.gov/lowvision.html MedlinePlus: Low Vision Tips We are sorry. MedlinePlus no longer maintains the For Low Vision Users page. You will still find health resources ...
International Nuclear Information System (INIS)
Sheikh, A.
2001-01-01
Objective: To evaluate the efficacy of serum and CSF C-reactive protein (C-rp) in differentiating bacterial from viral meningitis. Design: An observational, respective hospital-based study. Place and duration of study: It was conducted at the Department of Medicine and Department of Pediatrics, Shaikh Zayed Postgraduate Medical Institute Lahore, Over a Period of one year between march, 1999 and March, 2000. Subject and Methods: A randomized group of thirty patients, who presented with clinical features, suggestive of meningitis, were included in the study. C-reactive protein determinations were performed by latex agglutination method on the serum and cerebrospinal fluid (CSF) of these patients. Results: In the present study, c-reactive protein was found to be a more sensitive test for differentiating bacterial from non-bacterial meningitis on initial examination than the usual conventional methods used to diagnose bacterial meningitis. CSF C-reactive protein had a greater sensitivity (92% as compared to serum C-reactive protein (71%). Conclusion: C-reactive protein determination in CSF was found to be a useful indicator of bacterial meningitis that can be used to distinguish it from viral meningitis. (author)
Nanoscale dynamic wetting and spreading of molten Ti alloy on 6H-SiC
International Nuclear Information System (INIS)
Tanaka, Shun-Ichiro; Iwamoto, Chihiro
2008-01-01
We have investigated nanoscale features at the reactive wetting front of the molten Ag-27.4 wt.% Cu-4.9 wt.% Ti on 6H-SiC using video movies recorded in situ on a high-temperature stage of a high-resolution transmission electron microscope and also proposed a model of a chemical reaction at each tip. One of the features of reactive wetting and spreading at 1073 K in 4 x 10 -5 Pa was the discontinuous motion of the tip, and the halting time depended on the thickness of an amorphous Si-O layer on SiC, which can be explained by the time needed for the decomposition of the layer by Ti atoms to form TiC nanoparticles since Ti atoms in the molten alloy sufficiently rapidly diffuse to the tip on the SiC surface. Molten Ti and TiC nanolayers preceded the Ti 5 Si 3 nanolayer at the tip. The reaction required to form the TiC nanolayer is also the rate-determining step for spreading. The contact angle of the tip increased up to 60-80 deg. when the tip halted, whereas the tip decreased down to 10 deg. on the nonbasal plane and 20 deg. on the basal plane of SiC when it traveled rapidly. The high traveling angle of the molten tip on the basal polar plane of SiC indicates a high interfacial energy between Ti and SiC(0 0 0 1)
International Nuclear Information System (INIS)
Smallwood, Sherin; Moyer, Sue A.
2004-01-01
We recently showed that the L protein of Sendai virus is present as an oligomer in the active P-L polymerase complex [Smallwood et al., Virology 304 (2002) 235]. We now demonstrate using two different epitope tags that the L protein of a second respirovirus, human parainfluenza type 3 virus (PIV3), also forms an L-L complex. L oligomerization requires the coexpression of the differentially epitope tagged L proteins. By exploiting a series of C-terminal truncations the L-L binding site maps to the N-terminal half of L. There is some complex formation between the heterologous PIV3 and Sendai L and P proteins; however, the heterologous L protein does not function in transcription of either the PIV3 or Sendai template. The PIV3 C protein binds PIV3 L and inhibits RNA synthesis in vitro and in vivo. Significant homology exists between the C proteins of PIV3 and Sendai and complex formation occurs between the PIV3 and Sendai heterologous C and L proteins. In addition, the heterologous C proteins can inhibit transcription at ∼50% of the level of the homologous protein. These data suggest that while the C proteins may be functionally somewhat interchangeable, the L and P proteins are specific for each virus
Bent versus straight tips in micropulsed longitudinal phacoemulsification.
Stagg, Brian C; Gupta, Isha; Cahoon, Judd; Ronquillo, Cecinio; Shi, Dallas; Zaugg, Brian; Gardiner, Gareth; Barlow, William R; Pettey, Jeff H; Aabid Farukhi, M; Jensen, Jason; Olson, Randall J
2015-10-01
The aim of this study was to evaluate bent and straight phacoemulsification tips to determine which tip is more efficient in removal of lens fragments, using micropulsed longitudinal ultrasound in phacoemulsification. In vitro laboratory study. The John A. Moran Eye Center Laboratories, University of Utah, Salt Lake City, Utah, was the study setting. Pig lenses hardened in a manner comparable with dense human cataracts were cut into 2-mm cubes and removed with micropulsed longitudinal ultrasound using settings previously shown to be optimally efficient (6 milliseconds on and 6 milliseconds off for a bent tip). To verify this time as most efficient for a straight tip, we also tested times of 5, 6, and 7 milliseconds time on and off. The tips were either straight or with a 20-degree bend. Twenty cubes were used for each comparative run. For the straight tip, 6 milliseconds on (1.56 ± 0.815 seconds) was significantly more efficient than 7 milliseconds on (2.45 ± 1.56 seconds, p = 0.001) and not significantly more efficient than 5 milliseconds on (1.69 ± 0.86 seconds, p = 0.43). Five milliseconds off time (1.45 ± 0.76s) was more efficient than 6 milliseconds (2.06 ± 1.37 seconds, p = 0.004) and 7 milliseconds off (2.18 ± 1.24s, p = 0.001). The straight tip was more efficient than the bent tip (1.38 ± 0.83 versus 2.93 ± 2.14 seconds, p = 0.006). Results are contrary to accepted common belief. Micropulsed longitudinal phacoemulsification is more efficient with a straight rather than a bent tip. Copyright © 2015 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.
Activated protein C inhibits neutrophil migration in allergic asthma: a randomised trial
de Boer, J. Daan; Berger, Marieke; Majoor, Christof J.; Kager, Liesbeth M.; Meijers, Joost C. M.; Terpstra, Sanne; Nieuwland, Rienk; Boing, Anita N.; Lutter, René; Wouters, Diana; van Mierlo, Gerard J.; Zeerleder, Sacha S.; Bel, Elisabeth H.; van't Veer, Cornelis; de Vos, Alex F.; van der Zee, Jaring S.; van der Poll, Tom
2015-01-01
Asthma patients show evidence of a procoagulant state in their airways, accompanied by an impaired function of the anticoagulant protein C system. We aimed to study the effect of recombinant human activated protein C (rhAPC) in allergic asthma patients.We conducted a randomised, double-blind,
Tips for Reducing Pesticide Impacts on Wildlife
This Web page provides tips for pesticide users in residential and agricultural settings, as well as tips for certified pesticide applicators for ways to protect wildlife from potentially harmful effects of pesticides.
International Nuclear Information System (INIS)
Kamolrat, Torkamol; Gray, Stuart R.
2013-01-01
Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using 3 H-labelled phenylalanine. Protein breakdown was measured using 3 H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion
Energy Technology Data Exchange (ETDEWEB)
Kamolrat, Torkamol [Musculoskeletal Research Programme, Institute of Medical Sciences, University of Aberdeen, AB25 2ZD (United Kingdom); Gray, Stuart R., E-mail: s.r.gray@abdn.ac.uk [Musculoskeletal Research Programme, Institute of Medical Sciences, University of Aberdeen, AB25 2ZD (United Kingdom)
2013-03-22
Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.
DEFF Research Database (Denmark)
Donsmark, Morten; Langfort, Jozef; Holm, Cecilia
2003-01-01
and contractions. Adrenaline acts via cAMP-dependent protein kinase (PKA). The signalling mediating the effect of contractions is unknown and was explored in this study. Incubated soleus muscles from 70 g male rats were electrically stimulated to perform repeated tetanic contractions for 5 min. The contraction......Intramuscular triacylglycerol is an important energy store and is also related to insulin resistance. The mobilization of fatty acids from this pool is probably regulated by hormone-sensitive lipase (HSL), which has recently been shown to exist in muscle and to be activated by both adrenaline......-induced activation of HSL was abolished by the protein kinase C (PKC) inhibitors bisindolylmaleimide I and calphostin C and reduced 50% by the mitogen-activated protein kinase kinase (MEK) inhibitor U0126, which also completely blocked extracellular signal-regulated kinase (ERK) 1 and 2 phosphorylation. None...
International Nuclear Information System (INIS)
Yamamoto, Shigeru; Wakabayashi, Kazuo; Niiyama, Yoshiaki; Inoue, Goro
1974-01-01
The effects of protein and/or energy deficiency on 14 C incorporation into body constituents and 14 C output in expired air and urine were investigated in adult rats using 14 C-Chlorella protein hydrolysate. Rats were given a protein-free diet (PFD) for 2 weeks and conrol rats were fed ad libitum or pari-fed with the PFD group on a 12% lactalbumin diet (LA and Pair-fed, respectively). On the 15th day, animals received 14 C-Chlorella protein hydolysate with 5 g of their respective diet. One group of PFD animals was given tracer by stomach tube without food (PFD-fast). Normal control rats ate about twice as much diet as the PFD group. The respiratory 14 C output in the PFD group was identical with those in the LA and Pair-fed groups and was less than that in the PFD-fast group. The rate of protein synthesis, provisionally expressed as relative specific radioactivity, was more in the PFD group than in the normal group in the liver and less than the latter in the muscle. The LA group retained less total radioactivity in the body than the Pair-fed or PFD group, indicating high capability to hold the body protein in protein deficiency. In addition, decreased conversion of amino acids to lipids and glycogen was observed in the PFD group. All these differences are interpreted as adaptations to protein shortage. On prolonged fasting (PFD-fast group), gluconeogenesis in the liver increased to provide energy, despite the protein deficiency. The relative importances of protein and energy for tissue protein synthesis are briefly discussed. (author)
Villarino Romero, Rodrigo; Bibova, Ilona; Cerny, Ondrej; Vecerek, Branislav; Wald, Tomas; Benada, Oldrich; Zavadilova, Jana; Sebo, Peter
2013-01-01
The type III secretion system (T3SS) of pathogenic bordetellae employs a self-associating tip complex protein Bsp22. This protein is immunogenic during infections by Bordetella bronchiseptica and could be used as a protective antigen to immunize mice against B. bronchiseptica challenge. Since low-passage clinical isolates of the human pathogen Bordetella pertussis produce a highly homologous Bsp22 protein (97% homology), we examined its vaccine and diagnostic potential. No Bsp22-specific antibodies were, however, detected in serum samples from 36 patients with clinically and serologically confirmed whooping cough disease (pertussis syndrome). Moreover, although the induction of Bsp22 secretion by the laboratory-adapted 18323 strain in the course of mice lung infection was observed, the B. pertussis 18323-infected mice did not mount any detectable serum antibody response against Bsp22. Furthermore, immunization with recombinant Bsp22 protein yielded induction of high Bsp22-specific serum antibody titers but did not protect mice against an intranasal challenge with B. pertussis 18323. Unlike for B. bronchiseptica, hence, the Bsp22 protein is nonimmunogenic, and/or the serum antibody response to it is suppressed, during B. pertussis infections of humans and mice. PMID:23690400
Short communication: QTL mapping for ear tip-barrenness in maize
Energy Technology Data Exchange (ETDEWEB)
Ding, J.; Ma, J.; Chen, J.; Ai, T.; Li, Z.; Tian, Z.; Wu, S.; Chen, W.; Wu, J.
2016-11-01
Barren tip on corn ear is an important agronomic trait in maize, which is highly associated with grain yield. Understanding the genetic basis of tip-barrenness may help to reduce the ear tip-barrenness in breeding programs. In this study, ear tip-barrenness was evaluated in two environments in a F2:3 population, and it showed significant genotypic variation for ear tip-barrenness in both environments. Using mixed-model composite interval mapping method, three additive effects quantitative trait loci (QTL) for ear tip-barrenness were mapped on chromosomes 2, 3 and 6, respectively. They explained 16.6% of the phenotypic variation, and no significant QTL × Environment interactions and digenic interactions were detected. The results indicated that additive effect was the main genetic basis for ear tip-barrenness in maize. This is the first report of QTL mapped for ear tip-barrenness in maize. (Author)
Wilts, I T; Hutten, B A; Meijers, J C M; Spek, C A; Büller, H R; Kamphuisen, P W
2017-06-01
Procoagulant factors promote cancer progression and metastasis. Protein C is involved in hemostasis, inflammation and signal transduction, and has a protective effect on the endothelial barrier. In mice, administration of activated protein C reduced experimental metastasis. We assessed the association between protein C and mortality in patients with three types of cancer. The study population consisted of patients with advanced prostate, non-small cell lung or pancreatic cancer, who participated in the INPACT trial (NCT00312013). The trial evaluated the addition of nadroparin to chemotherapy in patients with advanced malignancy. Patients were divided into tertiles based on protein C at baseline. The association between protein C levels and mortality was evaluated with Cox proportional hazard models. We analysed 477 patients (protein C tertiles: C level was 107% (IQR 92-129). In the lowest tertile, 75 patients per 100 patient-years died, as compared to 60 and 54 in the middle and high tertile, respectively. Lower levels of protein C were associated with increased mortality (in tertiles: HR for trend 1.18, 95%CI 1.02-1.36, adjusted for age, sex and nadroparin use; as a continuous variable: HR 1.004, 95%CI 1.00-1.008, p=0.07). Protein C seems inversely associated with mortality in patients with advanced prostate, lung and pancreatic cancer. Further research should validate protein C as a biomarker for mortality, and explore the effects of protein C on progression of cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yuan, C. C.; Zhang, D.; Gan, Y.
2017-03-01
Engineering atomic force microscopy tips for reliable tip enhanced Raman spectroscopy (TERS) and colloidal probe technique are becoming routine practices in many labs. In this 10 year update review, various new tip modification methods developed over the past decade are briefly reviewed to help researchers select the appropriate method. The perspective is put in a large context to discuss the opportunities and challenges in this area, including novel combinations of seemingly different methods, potential applications of some methods which were not originally intended for TERS tip fabrication, and the problems of high cost and poor reproducibility of tip fabrication.
Dependence of electric field on STM tip preparation
DEFF Research Database (Denmark)
Huang, D.H.; Grey, Francois; Aono, M.
1998-01-01
Voltage pulses applied between an STM tip and a surface can modify the surface on the nanometer scale due to electric-field-induced evaporation. However, at present, different groups have achieved surface modification with quite different bias conditions, and it is still difficult to obtain high...... reproducibility in such experiments. In this paper, we measure the tip displacement during a pulse at constant tunnelling current, and deduce that the electric field produced by the pulse depends in a systematic way on tip preparation, The results show how differences in tip preparation can be a major source...
Sadjadi, Seyed-Ali; Jaipaul, Navin
2010-09-07
Quantification of proteinuria is usually predicated upon 24-hour urine collection. Multiple factors influence urine collection and the rate of protein and creatinine excretion. Urine collection is often incomplete, and therefore creatinine and protein excretion rates are underestimated. A random urine protein-creatinine (P-C) ratio has been shown over the years to be a reliable alternative to the 24-hour collection for detection and follow up of proteinuria. However, urine protein excretion may be influenced by physical activity. We studied 48 patients with proteinuria and varying levels of physical activity to determine the correlation between the measures of urine protein excretion. The correlation coefficient (r) between 24-hour urine total protein and random urine P-C ratio was 0.75 (P r = 0.99 (P r = 0.95 (P bedridden patients; r = 0.44 (P = not significant [NS]) and r = 0.54 (P = NS) in semiactive patients; and r = 0.44 (P = NS) and r = 0.58 (P 3500 mg/day) and non-nephrotic (r = 0.84; P r = 0.99 (P r = 0.92 (P bedridden patients; r = 0.61 (P = NS) and r = 0.54 (P = NS) in semiactive patients; and r = 0.64 (P r = 0.52 (P < 0.05) in active patients with nephrotic and non-nephrotic range proteinuria, respectively. We conclude that the random urine P-C ratio is a reliable and practical way of estimating and following proteinuria, but its precision and accuracy may be affected by the level of patient physical activity.
Angle-tip Fiber Probe as Humidity Sensor
Directory of Open Access Journals (Sweden)
Pabitra NATH
2010-05-01
Full Text Available In this paper, I present a simple fiber optic relative humidity sensor (FORHS using an angled-tip multimode optical fiber. The sensing region is fabricated by coating moisture sensitive Cobalt Chloride (CoCl2 doped polyvinyl alcohol (PVA film on the surface of fiber optic tip. Light signal introducing from flat-end of the fiber is back-reflected at the fiber tip-air interface by the effect of total internal refection. The change of relative humidity (RH in the outstanding medium affects of evanescent field absorption at the fiber tip-sensing film interface thus, modulates the back-reflected signal. With the present sensing investigation, RH ranging from 5 % to 95 % can be measured with high degree of repeatability and has a fast response time of about 2 seconds.
The Ultrachopper tip: a wound temperature study.
Barlow, William R; Pettey, Jeff; Olson, Randall J
2013-12-01
To determine the thermal characteristics of the Ultrachopper and its thermal properties in varied viscosurgical substances. Experimental study. Not applicable. The Ultrachopper (Alcon, Inc) tip with the Infiniti (Alcon, Inc) handpiece was attached to a thermistor and placed in a test chamber filled with either an ophthalmic viscosurgical device (OVD) or balanced salt solution (BSS). The thermistor allowed for continuous monitoring of temperature from baseline and the change that occurred over 60 seconds of continuous run time. Mean maximum temperature in each OVD exceeded 50°C over the first 25 seconds of continuous run time. The mean maximum temperature was statistically significantly higher with all OVDs (p < 0.0001) when compared with BSS. A small but statistically significant difference in mean maximum temperature was shown between Healon 5 (AMO, Inc) and Viscoat (Alcon, Inc) (p < 0.05). The linear increase in temperature was statistically significantly different with all OVDs compared with BSS (p < 0.0001). The thermal properties of the Ultrachopper tip demonstrate a heat-generating capacity that achieves published thresholds for risk for wound burn. Copyright © 2013 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.
Nuclear localization of phosphorylated c-Myc protein in human tumor cells.
Directory of Open Access Journals (Sweden)
C. Soldani
2010-05-01
Full Text Available Using immunocytochemical techniques at light and electron microscopy, we analysed the distribution of phosphorylated c-Myc in actively proliferating human HeLa cells. The distribution pattern of c-Myc was also compared with those of other ribonucleoprotein (RNP-containing components (PANA, hnRNP-core proteins, fibrillarin or RNP-associated nuclear proteins (SC-35 splicing factor. Our results provide the first evidence that phosphorylated c-Myc accumulates in the nucleus of tumor cells, where it colocalizes with fibrillarin, both in the nucleolus and in extranucleolar structures.
Chourabi, Kalthoum; Campoy, Susana; Rodriguez, Jesus A; Kloula, Salma; Landoulsi, Ahmed; Chatti, Abdelwaheb
2017-11-01
Water UV disinfection remains extremely important, particularly in developing countries where drinking and reclaimed crop irrigation water may spread devastating infectious diseases. Enteric bacterial pathogens, among which Shigella, are possible contaminants of drinking and bathing water and foods. To study the effect of UV light on Shigella, four strains were exposed to different doses in a laboratory-made irradiation device, given that the ultraviolet radiation degree of inactivation is directly related to the UV dose applied to water. Our results showed that the UV-C rays are effective against all the tested Shigella strains. However, UV-C doses appeared as determinant factors for Shigella eradication. On the other hand, Shigella-survived strains changed their outer membrane protein profiles, secreted proteins, and lipopolysaccharides. Also, as shown by electron microscopy transmission, morphological alterations were manifested by an internal cytoplasm disorganized and membrane envelope breaks. Taken together, the focus of interest of our study is to know the adaptive mechanism of UV-C resistance of Shigella strains.
Gonzales, Melissa; Bowden, G Tim
2002-06-26
The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.
Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8
Energy Technology Data Exchange (ETDEWEB)
Wang, Chengliang [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Zhang, Qiongdi [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Hang, Tianrong [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China); Tao, Yue [Shanghai Children’s Medical Center, 1678 Dongfang Road, Pudong, Shanghai 200120, People’s Republic of (China); Ma, Xukai [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Wu, Minhao; Zhang, Xuan, E-mail: xuanzbin@ustc.edu.cn; Zang, Jianye, E-mail: xuanzbin@ustc.edu.cn [University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026, People’s Republic of (China); Chinese Academy of Sciences, Hefei, Anhui 230026, People’s Republic of (China)
2015-08-28
The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.
Tomassini, R.; Rossi, G.; Brouckaert, J.-F.
2016-10-01
A simultaneous blade tip timing (BTT) and blade tip clearance (BTC) measurement system enables the determination of turbomachinery blade vibrations and ensures the monitoring of the existing running gaps between the blade tip and the casing. This contactless instrumentation presents several advantages compared to the well-known telemetry system with strain gauges, at the cost of a more complex data processing procedure. The probes used can be optical, capacitive, eddy current as well as microwaves, everyone with its dedicated electronics and many existing different signal processing algorithms. Every company working in this field has developed its own processing method and sensor technology. Hence, repeating the same test with different instrumentations, the answer is often different. Moreover, rarely it is possible to achieve reliability for in-service measurements. Developments are focused on innovative instrumentations and a common standard. This paper focuses on the results achieved using a novel magnetoresistive sensor for simultaneous tip timing and tip clearance measurements. The sensor measurement principle is described. The sensitivity to gap variation is investigated. In terms of measurement of vibrations, experimental investigations were performed at the Air Force Institute of Technology (ITWL, Warsaw, Poland) in a real aeroengine and in the von Karman Institute (VKI) R2 compressor rig. The advantages and limitations of the magnetoresistive probe for turbomachinery testing are highlighted.
Mineral, vitamin C and crude protein contents in kale (Brassica ...
African Journals Online (AJOL)
ajl yemi
2011-10-27
Oct 27, 2011 ... Key words: Kale (Brassica oleracea var. acephala), harvesting stage, vitamin C, crude protein, mineral content. .... L-ascorbic acid (or vitamin C) in plant tissues. .... Cooking methods of Brassica rapa affect the preservation of.
Eijlander, Robyn T.; Kolbusz, Magdalena A.; Berendsen, Erwin M.; Kuipers, Oscar P.
Protein translocation via the Tat machinery in thylakoids and bacteria occurs through a cooperation between the TatA, TatB and TatC subunits, of which the TatC protein forms the initial Tat substrate-binding site. The Bacillus subtilis Tat machinery lacks TatB and comprises two separate TatAC
KNOW-BLADE, task-3.2 report, tip shape study
Energy Technology Data Exchange (ETDEWEB)
Soerensen, N.N.; Johansen, J.; Conway, S.; Voutsinas, S.; Hansen, M.O.L.; Stuermer, A.
2005-01-01
For modern rotor blades with their very large aspect ratio, the blade tip is a very limited part of the overall rotor, and as such of limited importance for the overall aerodynamics of the rotor. Even though they may not be very important for the overall power production, the tip noise can be very important for the acoustics of the rotor [15], and the blade tips can as well be important for the aerodynamic damping properties of the rotor blades [13]. Unfortunately, not many options exists for predicting the aerodynamic behavior of blade tips using computational methods. Experimentally it is dicult to perform detailed measurements in the form of pressure and velocity measurements in natural wind conditions on modern large scale turbines due to the inherent unsteadiness in the natural wind. The present study describes the application of four different Navier-Stokes solvers to tip shape studies, and shows that these codes are well suited to study the flow around different tip shape geometries, and can predict the pressure distributions at the blade tip quite accurately. (au)
F1F0 ATP synthase subunit c is a substrate of the novel YidC pathway for membrane protein biogenesis
van der Laan, M; Bechtluft, P; Kol, S; Nouwen, N; Driessen, AJM
2004-01-01
The Escherichia coli YidC protein belongs to the Oxa1 family of membrane proteins that have been suggested to facilitate the insertion and assembly of membrane proteins either in cooperation with the Sec translocase or as a separate entity. Recently, we have shown that depletion of YidC causes a
SAS-1 Is a C2 Domain Protein Critical for Centriole Integrity in C. elegans
Delattre, Marie; Balestra, Fernando R.; Blanchoud, Simon; Finger, Susanne; Knott, Graham; Müller-Reichert, Thomas; Gönczy, Pierre
2014-01-01
Centrioles are microtubule-based organelles important for the formation of cilia, flagella and centrosomes. Despite progress in understanding the underlying assembly mechanisms, how centriole integrity is ensured is incompletely understood, including in sperm cells, where such integrity is particularly critical. We identified C. elegans sas-1 in a genetic screen as a locus required for bipolar spindle assembly in the early embryo. Our analysis reveals that sperm-derived sas-1 mutant centrioles lose their integrity shortly after fertilization, and that a related defect occurs when maternal sas-1 function is lacking. We establish that sas-1 encodes a C2 domain containing protein that localizes to centrioles in C. elegans, and which can bind and stabilize microtubules when expressed in human cells. Moreover, we uncover that SAS-1 is related to C2CD3, a protein required for complete centriole formation in human cells and affected in a type of oral-facial-digital (OFD) syndrome. PMID:25412110
SAS-1 is a C2 domain protein critical for centriole integrity in C. elegans.
Directory of Open Access Journals (Sweden)
Lukas von Tobel
2014-11-01
Full Text Available Centrioles are microtubule-based organelles important for the formation of cilia, flagella and centrosomes. Despite progress in understanding the underlying assembly mechanisms, how centriole integrity is ensured is incompletely understood, including in sperm cells, where such integrity is particularly critical. We identified C. elegans sas-1 in a genetic screen as a locus required for bipolar spindle assembly in the early embryo. Our analysis reveals that sperm-derived sas-1 mutant centrioles lose their integrity shortly after fertilization, and that a related defect occurs when maternal sas-1 function is lacking. We establish that sas-1 encodes a C2 domain containing protein that localizes to centrioles in C. elegans, and which can bind and stabilize microtubules when expressed in human cells. Moreover, we uncover that SAS-1 is related to C2CD3, a protein required for complete centriole formation in human cells and affected in a type of oral-facial-digital (OFD syndrome.
Zhan, Jinghui; Felder, Barbara; Ellison, Aaron R; Winters, Aaron; Salimi-Moosavi, Hossein; Scully, Sheila; Turk, James R; Wei, Ping
2013-06-01
Thrombopoietin and its cognate receptor, c-Mpl, are the primary molecular regulators of megakaryocytopoiesis and platelet production. To date the pattern of c-Mpl expression in human solid tumors and the distribution and biochemical properties of c-Mpl proteins in hematopoietic tissues are largely unknown. We have recently developed highly specific mouse monoclonal antibodies (MAb) against human c-Mpl. In this study we used these antibodies to demonstrate the presence of full-length and truncated human c-Mpl proteins in various megakaryocytic cell types, and their absence in over 100 solid tumor cell lines and in the 12 most common primary human tumor types. Quantitative assays showed a cell context-dependent distribution of full-length and truncated c-Mpl proteins. All forms of human c-Mpl protein were found to be modified with extensive N-linked glycosylation but different degrees of sialylation and O-linked glycosylation. Of note, different variants of full-length c-Mpl protein exhibiting differential glycosylation were expressed in erythromegakaryocytic leukemic cell lines and in platelets from healthy human donors. This work provides a comprehensive analysis of human c-Mpl mRNA and protein expression on normal and malignant hematopoietic and non-hematopoietic cells and demonstrates the multiple applications of several novel anti-c-Mpl antibodies.
Hackeng, T. M.; Hessing, M.; van 't Veer, C.; Meijer-Huizinga, F.; Meijers, J. C.; de Groot, P. G.; van Mourik, J. A.; Bouma, B. N.
1993-01-01
An important feedback mechanism in blood coagulation is supplied by the protein C/protein S anticoagulant pathway. In this study we demonstrate that the binding of human protein S to cultured human umbilical vein endothelial cells (HUVECs) is required for the expression of cofactor activity of
The Tipping Points of Technology Development
Directory of Open Access Journals (Sweden)
Tauno Kekäle
2014-07-01
Full Text Available The tipping point, the decisive point in time in the competition between old and new, is an interesting phenomenon in physics of today. This aspect in technology acceptance is connected to many business decisions such as technology investments, product releases, resource allocation, sales forecasts and, ultimately, affects the profitability and even survival of a company. The tipping point itself is based on many stochastic and dynamic variables, and the process may at least partly be described as path-dependent. This paper analyses the tipping point from three aspects: (1 product performance, (2 features of the market and infrastructure (including related technologies and human network externalities, and (3 actions of the incumbents (including customer lock-in, systems lock-in, and sustaining innovation. The paper is based on the Bass s-curve idea and the technology trajectory concept proposed by Dosi. Three illustrative cases are presented to make the point of the multiple factors affecting technology acceptance and, thus, the tipping point. The paper also suggests outlines for further research in field of computer simulation.
Final Technical Report: Electrohydrodynamic Tip Streaming
Energy Technology Data Exchange (ETDEWEB)
Basaran, Osman [Purdue Univ., West Lafayette, IN (United States)
2016-01-06
When subjected to strong electric fields, liquid drops and films form conical tips and emit thin jets from their tips. Such electrodydrodynamic (EDH) tip streaming or cone-jetting phenomena, which are sometimes referred to as electrospraying, occur widely in nature, e.g., in ejection of streams of small charged drops from pointed tips of raindrops in thunderclouds, and technology, e.g., in electrospray mass spectrometry or electric field-driven solvent extraction. More recently, EHD cone-jetting has emerged as a powerful technique for direct printing of solar cells, micro- and nano- particle production, and microencapsulation for controlled release. In many of the aforementioned situations, of equal importance to the processes by which one drop disintegrates to form several drops are those by which (a) two drops come together and coalesce and (b) two drops are coupled to form a double droplet system (DDS) or a capillary switch (CS). the main objective of this research program is to advance through simulation, theory, and experiment the breakup, coalescence, and oscillatory dynamics of single and pairs of charged as well as uncharged drops.
Diabetes: Dental Tips For more copies contact: National Institute of Dental and Craniofacial Research National Oral Health Information Clearinghouse ... damage the gum and bone that hold your teeth in place and may lead to painful chewing ...
TEM observations of crack tip: cavity interactions
International Nuclear Information System (INIS)
Horton, J.A.; Ohr, S.M.; Jesser, W.A.
1981-01-01
Crack tip-cavity interactions have been studied by performing room temperature deformation experiments in a transmission electron microscope on ion-irradiated type 316 stainless steel with small helium containing cavities. Slip dislocations emitted from a crack tip cut, sheared, and thereby elongated cavities without a volume enlargement. As the crack tip approached, a cavity volume enlargement occurred. Instead of the cavities continuing to enlarge until they touch, the walls between the cavities fractured. Fracture surface dimples do not correlate in size or density with these enlarged cavities
Association between C-reactive protein and features of the metabolic syndrome
DEFF Research Database (Denmark)
Fröhlich, M; Imhof, A; Berg, Gabriele
2000-01-01
OBJECTIVE: To assess the association of circulating levels of C-reactive protein, a sensitive systemic marker of inflammation, with different components of the metabolic syndrome. RESEARCH DESIGN AND METHODS: Total cholesterol (TC), HDL cholesterol, triglycerides, uric acid, BMI , and prevalence...... C-reactive protein and TC (R = 0.19), TG (R = 0.29), BMI (R = 0.32), glucose (R = 0.11), and uric acid (R = 0.14) (all P
Directory of Open Access Journals (Sweden)
N Parmar
2015-07-01
Full Text Available Cell therapy is an emerging option for regenerating skeletal muscle. Improved delivery methods for anchorage-dependent myoblasts are likely to improve integration and function of transplanted muscle cells. Highly porous microspheres, produced using thermally induced phase separation (TIPS, have features ideally suited for minimally invasive cell delivery. The purpose of this study was to investigate, for the first time, the use of TIPS microspheres as highly porous microcarriers for manipulation of human skeletal muscle myoblasts (HSMM under defined culture conditions. HSMM cells readily attached to the surface of poly (DL-lactide-co-glycolide (PLGA TIPS microcarriers, where they were induced to continue proliferating or to be driven towards differentiation whilst under static-dynamic culture conditions for 7 days. Switching from proliferation medium to differentiation medium for 7 days, resulted in increased protein expression of skeletal muscle cell contractile apparatus components, MyoD and skeletal muscle myosin heavy chain, compared with cells cultured on conventional culture plasticware for the same duration (p < 0.001. Growth of myoblasts on the surface of the microcarriers and their migration following simulated delivery, caused no change to the proliferative capacity of cells over 7 days. Results from this study demonstrate that TIPS microspheres provide an ideal vehicle for the expansion and delivery of myoblasts for therapeutic applications. Transplantation of myoblasts anchored to a substrate, rather than in suspension, will reduce the amount of ex vivo manipulation required during preparation of the product and allows cells to be delivered in a more natural state. This will improve the ability to control cell dosage and increase the likelihood of efficacy.
Curlango-Rivera, Gilberto
2011-01-01
Root elongation occurs by the generation of new cells from meristematic tissue within the apical 1–2 mm region of root tips. Therefore penetration of the soil environment is carried out by newly synthesized plant tissue, whose cells are inherently vulnerable to invasion by pathogens. This conundrum, on its face, would seem to reflect an intolerable risk to the successful establishment of root systems needed for plant life. Yet root tip regions housing the meristematic tissues repeatedly have been found to be free of microbial infection and colonization. Even when spore germination, chemotaxis, and/or growth of pathogens are stimulated by signals from the root tip, the underlying root tissue can escape invasion. Recent insights into the functions of root border cells, and the regulation of their production by transient exposure to external signals, may shed light on long-standing observations. PMID:21455030
DEFF Research Database (Denmark)
Lausten-Thomsen, Ulrik; Gamborg, Michael; Bøjsøe, Christine
2015-01-01
BACKGROUND: Childhood obesity is associated with several complications, including cardiovascular comorbidity. Several biomarkers, such as high-sensitive C-reactive protein (hs-CRP), proform of eosinophil major basic protein (Pro-MBP) and pregnancy associated plasma protein-A (PAPP-A), have equally...
International Nuclear Information System (INIS)
Sung, Woo Yong; Ok, Jong Girl; Kim, Wal Jun; Lee, Seung Min; Yeon, Soon Chang; Lee, Ho Young; Kim, Yong Hyup
2007-01-01
Carbon nanocoils (CNCs) were synthesized via thermal chemical vapour deposition (CVD) with C 2 H 2 and NH 3 gases at 600 deg. C. A Ni catalyst was placed upon the copper micro-tip structures that were fabricated on a silicon substrate. Our CNCs had a long rope shape with a length not exceeding 100 μm and a nanoscale diameter. The copper micro-tips were formed through high current pulse electroplating, which played a significant role in characterizing our CNCs. The CNCs grown on the copper micro-tips showed outstanding field emission performance and long-term stability. Their turn-on field, defined as that at a current density of 10 μA cm -2 , was 1.30 V μm -1 and the maximum current density reached 11.17 mA cm -2 at an electric field of 2.39 V μm -1
Experimental study of soft X-ray intensity with different anode tips in ...
Indian Academy of Sciences (India)
2016-06-15
Jun 15, 2016 ... c Indian Academy of Sciences. DOI 10.1007/s12043-016-1224-8. Experimental study of soft X-ray intensity with different anode tips in Amirkabir plasma focus device. MORTEZA HABIBI. ∗ and MAHSA MAHTAB. Energy Engineering and Physics Department, Amirkabir University of Technology, Tehran, Iran.
Inhibitory action of certain cyclophosphate derivatives of cAMP on cAMP-dependent protein kinases
Wit, René J.W. de; Hekstra, Doeke; Jastorff, Bernd; Stec, Wojciech J.; Baraniak, Janina; Driel, Roel van; Haastert, Peter J.M. van
1984-01-01
A series cAMP derivatives with modifications in the adenine, ribose and cyclophosphate moiety were screened for their binding affinity for the two types of cAMP-binding sites in mammalian protein kinase type I. In addition, the activation of the kinase by these analogs was monitored. The binding
cDNA cloning and mRNA expression of heat shock protein 70 gene ...
African Journals Online (AJOL)
In this study, the full-length heat shock protein 70 of Tegillarca granosa was cloned from cDNA library by rapid amplification of cDNA end (RACE). The open reading frame (ORF) of heat shock protein 70 was 1968 bp, and it encoded a protein of 655 amino acids with a predicted molecular weight of 71.48 kDa and an ...
Directory of Open Access Journals (Sweden)
Mohamadkhani Ashraf
2011-10-01
Full Text Available Abstract Background Even though many functions of protein-x from the Hepatitis B virus (HBV have been revealed, the nature of protein-x is yet unknown. This protein is well-known for its transactivation activity through interaction with several cellular transcription factors, it is also known as an oncogene. In this work, we have presented computational approaches to design a model to show the structure of protein-x and its respective binding sites associated with the CCAAT/enhancer-binding protein α (C/EBPα. C/EBPα belongs to the bZip family of transcription factors, which activates transcription of several genes through its binding sites in liver and fat cells. The C/EBPα has been shown to bind and modulate enhancer I and the enhancer II/core promoter of HBV. In this study using the bioinformatics tools we tried to present a reliable model for the protein-x interaction with C/EBPα. Results The amino acid sequence of protein-x was extracted from UniProt [UniProt:Q80IU5] and the x-ray crystal structure of the partial CCAAT-enhancer α [PDB:1NWQ] was retrieved from the Protein Data Bank (PDB. Similarity search for protein-x was carried out by psi-blast and bl2seq using NCBI [GenBank: BAC65106.1] and Local Meta-Threading-Server (LOMETS was used as a threading server for determining the maximum tertiary structure similarities. Advanced MODELLER was implemented to design a comparative model, however, due to the lack of a suitable template, Quark was used for ab initio tertiary structure prediction. The PDB-blast search indicated a maximum of 23% sequence identity and 33% similarity with crystal structure of the porcine reproductive and respiratory syndrome virus leader protease Nsp1α [PDB:3IFU]. This meant that protein-x does not have a suitable template to predict its tertiary structure using comparative modeling tools, therefore we used QUARK as an ab initio 3D prediction approach. Docking results from the ab initio tertiary structure of
Turbine-blade tip clearance and tip timing measurements using an optical fiber bundle sensor
Garcia, Iker; Beloki, Josu; Zubia, Joseba; Durana, Gaizka; Aldabaldetreku, Gotzon
2013-04-01
Traditional limitations of capacitive, inductive or discharging probe sensor for tip timing and tip clearance measurements are overcome by reflective intensity modulated optical fiber sensors. This paper presents the signals and results corresponding to a one stage turbine rig which rotor has 146 blades, obtained from a transonic wind-tunnel test. The probe is based on a trifurcated bundle of optical fibers that is mounted on turbine casing. It is composed of a central illuminating fiber that guides the light from a laser to the turbine blade, and two concentric rings of receiving fibers that collect the reflected light. Two photodetectors turn this reflected light signal from the receiving rings into voltage. The electrical signals are acquired and saved by a high-sample-rate oscilloscope. In tip clearance calculations the ratio of the signals provided by each ring of receiving fibers is evaluated and translated into distance. In the case of tip timing measurements, only one of the signals is considered to get the arrival time of the blade. The differences between the real and theoretical arrival times of the blades are used to obtain the deflections amplitude. The system provides the travelling wave spectrum, which presents the average vibration amplitude of the blades at a certain nodal diameter. The reliability of the results in the turbine rig testing facilities suggests the possibility of performing these measurements in real turbines under real working conditions.
Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein
Directory of Open Access Journals (Sweden)
Ekman-Joelsson Britt-Marie
2008-10-01
Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.
Energy Technology Data Exchange (ETDEWEB)
Rodriguez-Medina, Caren; Boissinot, Sylvaine [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France); Chapuis, Sophie [Institut de Biologie Moléculaire des Plantes, Laboratoire propre du CNRS conventionné avec l’Université de Strasbourg, 12 rue du Général Zimmer, 67084 Strasbourg (France); Gereige, Dalya; Rastegar, Maryam; Erdinger, Monique [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France); Revers, Frédéric [INRA, Université de Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, 33882 Villenave d’Ornon (France); Ziegler-Graff, Véronique [Institut de Biologie Moléculaire des Plantes, Laboratoire propre du CNRS conventionné avec l’Université de Strasbourg, 12 rue du Général Zimmer, 67084 Strasbourg (France); Brault, Véronique, E-mail: veronique.brault@colmar.inra.fr [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France)
2015-12-15
Turnip yellows virus (TuYV), a phloem-limited virus, encodes a 74 kDa protein known as the readthrough protein (RT) involved in virus movement. We show here that a TuYV mutant deleted of the C-terminal part of the RT protein (TuYV-∆RT{sub Cter}) was affected in long-distance trafficking in a host-specific manner. By using the C-terminal domain of the RT protein as a bait in a yeast two-hybrid screen of a phloem cDNA library from Arabidopsis thaliana we identified the calcineurin B-like protein-interacting protein kinase-7 (AtCIPK7). Transient expression of a GFP:CIPK7 fusion protein in virus-inoculated Nicotiana benthamiana leaves led to local increase of wild-type TuYV accumulation, but not that of TuYV-∆RT{sub Cter}. Surprisingly, elevated virus titer in inoculated leaves did not result in higher TuYV accumulation in systemic leaves, which indicates that virus long-distance movement was not affected. Since GFP:CIPK7 was localized in or near plasmodesmata, CIPK7 could negatively regulate TuYV export from infected cells. - Highlights: • The C-terminal domain of TuYV-RT is required for long-distance movement. • CIPK7 from Arabidopsis interacts with RT{sub Cter} in yeast and in plants. • CIPK7 overexpression increases virus titer locally but not virus systemic movement. • CIPK7 localizes to plasmodesmata. • CIPK7 could be a defense protein regulating virus export.
Neighborhood Walkable Urban Form and C-Reactive Protein
Background: Walkable urban form predicts physical activity and lower body mass index, which lower C-reactive protein (CRP). However, urban form is also related to pollution, noise, social and health behavior, crowding, and other stressors, which may complement or contravene walka...
Protein kinase C alpha controls erythropoietin receptor signaling.
M.M. von Lindern (Marieke); M. Parren-Van Amelsvoort (Martine); T.B. van Dijk (Thamar); E. Deiner; B. Löwenberg (Bob); E. van den Akker (Emile); S. van Emst-de Vries (Sjenet); P.J. Willems (Patrick); H. Beug (Hartmut)
2000-01-01
textabstractProtein kinase C (PKC) is implied in the activation of multiple targets of erythropoietin (Epo) signaling, but its exact role in Epo receptor (EpoR) signal transduction and in the regulation of erythroid proliferation and differentiation remained elusive. We
Numerical analysis of turbine blade tip treatments
Gopalaswamy, Nath S.; Whitaker, Kevin W.
1992-01-01
Three-dimensional solutions of the Navier-Stokes equations for a turbine blade with a turning angle of 180 degrees have been computed, including blade tip treatments involving cavities. The geometry approximates a preliminary design for the GGOT (Generic Gas Oxidizer Turbine). The data presented here will be compared with experimental data to be obtained from a linear cascade using original GGOT blades. Results have been computed for a blade with 1 percent clearance, based on chord, and three different cavity sizes. All tests were conducted at a Reynolds number of 4 x 10 exp 7. The grid contains 39,440 points with 10 spanwise planes in the tip clearance region of 5.008E-04 m. Streamline plots and velocity vectors together with velocity divergence plots reveal the general flow behavior in the clearance region. Blade tip temperature calculations suggest placement of a cavity close to the upstream side of the blade tip for reduction of overall blade tip temperature. The solutions do not account for the relative motion between the endwall and the turbine blade. The solutions obtained are generally consistent with previous work done in this area,
Dueñas-Carrera, S; Viña, A; Garay, H E; Reyes, O; Alvarez-Lajonchere, L; Guerra, I; González, L J; Morales, J
2001-09-01
Two variants of the hepatitis C virus (HCV) E2 envelope protein, lacking the C-terminal domain and comprising amino acids 458-650 (E2A) and 382-605 (E2C), respectively, were efficiently produced in BL21 (DE3) Escherichia coli cells. E2A and E2C were used to immunize mice. The E2C variant induced the maximal mean antibody titer. Anti-E2C mouse sera reacted mainly with E2 synthetic peptides covering the 70 amino acid N-terminal region of the E2 protein. Moreover, a panel of anti-HCV positive human sera recognized only the E2C protein (28.2%) and the synthetic peptide covering the HVR-1 of the E2 protein (23.1%). These data indicate the existence of an immunologically relevant region in the HVR-1 of the HCV E2 protein.
Ultrathin MoS2 and WS2 layers on silver nano-tips as electron emitters
Loh, Tamie A. J.; Tanemura, Masaki; Chua, Daniel H. C.
2016-09-01
2-dimensional (2D) inorganic analogues of graphene such as MoS2 and WS2 present interesting opportunities for field emission technology due to their high aspect ratio and good electrical conductivity. However, research on 2D MoS2 and WS2 as potential field emitters remains largely undeveloped compared to graphene. Herein, we present an approach to directly fabricate ultrathin MoS2 and WS2 onto Ag nano-tips using pulsed laser deposition at low temperatures of 450-500 °C. In addition to providing a layer of chemical and mechanical protection for the Ag nano-tips, the growth of ultrathin MoS2 and WS2 layers on Ag led to enhanced emission properties over that of pristine nano-tips due to a reduction of the effective barrier height arising from charge injection from Ag to the overlying MoS2 or WS2. For WS2 on Ag nano-tips, the phasic mixture was also an important factor influencing the field emission performance. The presence of 1T-WS2 at the metal-WS2 interface in a hybrid film of 2H/1T-WS2 leads to improvement in the field emission capabilities as compared to pure 2H-WS2 on Ag nano-tips.
[14C]mechlorethamine binding to proteins of the human keratinocyte
International Nuclear Information System (INIS)
Deaton, M.A.; Jones, G.P.; Bowman, P.D.
1990-01-01
Much mustard agent research has focused on mustard/DNA interactions. Mustard also interacts with proteins, however, and to reach the DNA any agent must first pass through the cytoplasm. We hypothesized that the cell's proteins would covalently bind mustard, and thereby limit its access to the DNA. Keratinocyte proteins were radiolabeled with [ 14 C]mechlorethamine and separated by electrophoresis. The banding patterns that resulted were made visible on x-ray films, then compared with control patterns. A correspondence of almost one-to-one was observed, which supports the hypothesis that many cellular proteins are susceptible to mustard alkylation. It follows that some mustard symptoms probably result from effects on existing proteins
Directory of Open Access Journals (Sweden)
Sugimoto Naotoshi
2016-01-01
Full Text Available Cyclic adenosine monophosphate (cAMP controls differentiation in several types of cells during brain development. However, the molecular mechanism of cAMP-controlled differentiation is not fully understood. We investigated the role of protein kinase A (PKA and exchange protein directly activated by cAMP (Epac on cAMP-induced glial fibrillary acidic protein (GFAP, an astrocyte marker, in cultured glial cells. B92 glial cells were treated with cAMP-elevating drugs, an activator of adenylate cyclase, phosphodiesterase inhibitor and a ß adrenal receptor agonist. These cAMP-elevating agents induced dramatic morphological changes and expression of GFAP. A cAMP analog, 8-Br-cAMP, which activates Epac as well as PKA, induced GFAP expression and morphological changes, while another cAMP analog, 8-CPT-cAMP, which activates Epac with greater efficacy when compared to PKA, induced GFAP expression but very weak morphological changes. Most importantly, the treatment with a PKA inhibitor partially reduced cAMP-induced GFAP expression. Taken together, these results indicate that cAMP-elevating drugs lead to the induction of GFAP via PKA and/or Epac activation in B92 glial cells.
The structurally-related members of the PAT family of proteins, which are so name based on similarity amongst perilipin, adipophilin/adipocyte differentiation-related protein (ADRP), and tail-interacting protein of 47 kilodaltons (TIP47), are cytoplasmic lipid droplet (LD)-associated proteins charac...
AFM tip characterization by using FFT filtered images of step structures
Energy Technology Data Exchange (ETDEWEB)
Yan, Yongda, E-mail: yanyongda@hit.edu.cn [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center For Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Xue, Bo [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center For Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Hu, Zhenjiang; Zhao, Xuesen [Center For Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China)
2016-01-15
The measurement resolution of an atomic force microscope (AFM) is largely dependent on the radius of the tip. Meanwhile, when using AFM to study nanoscale surface properties, the value of the tip radius is needed in calculations. As such, estimation of the tip radius is important for analyzing results taken using an AFM. In this study, a geometrical model created by scanning a step structure with an AFM tip was developed. The tip was assumed to have a hemispherical cone shape. Profiles simulated by tips with different scanning radii were calculated by fast Fourier transform (FFT). By analyzing the influence of tip radius variation on the spectra of simulated profiles, it was found that low-frequency harmonics were more susceptible, and that the relationship between the tip radius and the low-frequency harmonic amplitude of the step structure varied monotonically. Based on this regularity, we developed a new method to characterize the radius of the hemispherical tip. The tip radii estimated with this approach were comparable to the results obtained using scanning electron microscope imaging and blind reconstruction methods. - Highlights: • The AFM tips with different radii were simulated to scan a nano-step structure. • The spectra of the simulation scans under different radii were analyzed. • The functions of tip radius and harmonic amplitude were used for evaluating tip. • The proposed method has been validated by SEM imaging and blind reconstruction.
Energy Technology Data Exchange (ETDEWEB)
Krasnoslobodtsev, Alexey V., E-mail: akrasnos@unomaha.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Department of Physics, University of Nebraska Omaha, Omaha, NE 68182 (United States); Deckert-Gaudig, Tanja [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Zhang, Yuliang [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Deckert, Volker [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Institute for Physical Chemistry and Abbe Center of Photonics, University of Jena, Helmholtzweg 4, D-07743 Jena (Germany); Lyubchenko, Yuri L., E-mail: ylyubchenko@unmc.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States)
2016-06-15
Aggregation of prion proteins is the cause of various prion related diseases. The infectious form of prions, amyloid aggregates, exist as multiple strains. The strains are thought to represent structurally different prion protein molecules packed into amyloid aggregates, but the knowledge on the structure of different types of aggregates is limited. Here we report on the use of AFM (Atomic Force Microscopy) and TERS (Tip-Enhanced Raman Scattering) to study morphological heterogeneity and access underlying conformational features of individual amyloid aggregates. Using AFM we identified the morphology of amyloid fibrils formed by the peptide (CGNNQQNY) from the yeast prion protein Sup35 that is critically involved in the aggregation of the full protein. TERS results demonstrate that morphologically different amyloid fibrils are composed of a distinct set of conformations. Fibrils formed at pH 5.6 are composed of a mixture of peptide conformations (β-sheets, random coil and α-helix) while fibrils formed in pH~2 solution primarily have β-sheets. Additionally, peak positions in the amide III region of the TERS spectra suggested that peptides have parallel arrangement of β-sheets for pH~2 fibrils and antiparallel arrangement for fibrils formed at pH 5.6. We also developed a methodology for detailed analysis of the peptide secondary structure by correlating intensity changes of Raman bands in different regions of TERS spectra. Such correlation established that structural composition of peptides is highly localized with large contribution of unordered secondary structures on a fibrillar surface. - Highlights: • Amyloid polymorphs were characterized by AFM and TERS. • A mixture of peptide secondary structures in fibrils were identified using TERS. • TERS recognizes packing arrangement (parallel versus antiparallel) of peptides. • TERS is a powerful tool for high resolution structural analysis of fibrils.
A Comparative Study of Conventional and Tip-Fin Propeller Performance
DEFF Research Database (Denmark)
Andersen, Poul
1997-01-01
During more than a decade several attempts have been made to obtain higher propeller efficiencies by radically modifying the geometry in the tip region of the blade. In the tip-fin propeller a tip fin or winglet is attached to the blade tip and integrated into the blade in such a way that the bla...
Yeast Interacting Proteins Database: YER081W, YDR105C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available YDR105C TMS1 Vacuolar membrane protein of unknown function that is conserved in mammals; predicted to contai...tion that is conserved in mammals; predicted to contain eleven transmembrane heli
Structural characterization of the photoswitchable fluorescent protein Dronpa-C62S
International Nuclear Information System (INIS)
Nam, Ki-Hyun; Kwon, Oh Yeun; Sugiyama, Kanako; Lee, Won-Ho; Kim, Young Kwan; Song, Hyun Kyu; Kim, Eunice Eunkyung; Park, Sam-Yong; Jeon, Hyesung; Hwang, Kwang Yeon
2007-01-01
The photoswitching behavior of green fluorescent proteins (GFPs) or GFP-like proteins is increasingly recognized as a new technique for optical marking. Recently, Ando and his colleagues developed a new green fluorescent protein Dronpa, which possesses the unique photochromic property of being photoswitchable in a non-destructive manner. To better understand this mechanism, we determined the crystal structures of a new GFP Dronpa and its mutant C62S, at 1.9 A and 1.8 A, respectively. Determination of the structures demonstrates that a unique hydrogen-bonding network and the sulfur atom of the chromophore are critical to the photoswitching property of Dronpa. Reversible photoswitching was lost in cells expressing the Dronpa-C62S upon repetitive irradiation compared to the native protein. Structural and mutational analyses reveal the chemical basis for the functional properties of photoswitchable fluorescent proteins and provide the basis for subsequent coherent engineering of this subfamily of Dronpa homolog's
A pathological study on overexpression of c-fos and Rb proteins in human radiation skin ulcer
International Nuclear Information System (INIS)
Du Yuejiao; Wang Dewen; Gao Yabing
1996-01-01
We performed an immunohistochemical study on human radiation skin ulcer by using antibodies against c-fos and Rb proteins and antigen-repairing method with a microwave oven. We found that the positive rates of overexpression of c-fos and Rb proteins were 84.0% and 100%, respectively. The overexpression of c-fos protein was mainly observed in cell nuclei of squamous epithelial cells, fibroblasts, endothelial cells, and leiomyocytes in media and fibrocytes in adventitia of arterioles. The location of the Rb protein overexpression was mostly similar to that of c-fos protein. The overexpression of c-fos and Rb proteins may be related to cancer transformation and poor healing of radiation-induced skin ulcers
Structure and stability of semiconductor tip apexes for atomic force microscopy
International Nuclear Information System (INIS)
Pou, P; Perez, R; Ghasemi, S A; Goedecker, S; Jelinek, P; Lenosky, T
2009-01-01
The short range force between the tip and the surface atoms, that is responsible for atomic-scale contrast in atomic force microscopy (AFM), is mainly controlled by the tip apex. Thus, the ability to image, manipulate and chemically identify single atoms in semiconductor surfaces is ultimately determined by the apex structure and its composition. Here we present a detailed and systematic study of the most common structures that can be expected at the apex of the Si tips used in experiments. We tackle the determination of the structure and stability of Si tips with three different approaches: (i) first principles simulations of small tip apexes; (ii) simulated annealing of a Si cluster; and (iii) a minima hopping study of large Si tips. We have probed the tip apexes by making atomic contacts between the tips and then compared force-distance curves with the experimental short range forces obtained with dynamic force spectroscopy. The main conclusion is that although there are multiple stable solutions for the atomically sharp tip apexes, they can be grouped into a few types with characteristic atomic structures and properties. We also show that the structure of the last atomic layers in a tip apex can be both crystalline and amorphous. We corroborate that the atomically sharp tips are thermodynamically stable and that the tip-surface interaction helps to produce the atomic protrusion needed to get atomic resolution.
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Energy Technology Data Exchange (ETDEWEB)
Han, D.; Zhang, C. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China); Fan, W.J. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China); The Second Affiliated Hospital, University of South China, Hengyang City, Hunan Province (China); Pan, W.J.; Feng, D.M.; Qu, S.L.; Jiang, Z.S. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China)
2014-10-31
Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C{sub 2}H{sub 2} motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.
Rodriguez-Medina, Caren; Boissinot, Sylvaine; Chapuis, Sophie; Gereige, Dalya; Rastegar, Maryam; Erdinger, Monique; Revers, Frédéric; Ziegler-Graff, Véronique; Brault, Véronique
2015-12-01
Turnip yellows virus (TuYV), a phloem-limited virus, encodes a 74kDa protein known as the readthrough protein (RT) involved in virus movement. We show here that a TuYV mutant deleted of the C-terminal part of the RT protein (TuYV-∆RTCter) was affected in long-distance trafficking in a host-specific manner. By using the C-terminal domain of the RT protein as a bait in a yeast two-hybrid screen of a phloem cDNA library from Arabidopsis thaliana we identified the calcineurin B-like protein-interacting protein kinase-7 (AtCIPK7). Transient expression of a GFP:CIPK7 fusion protein in virus-inoculated Nicotiana benthamiana leaves led to local increase of wild-type TuYV accumulation, but not that of TuYV-∆RTCter. Surprisingly, elevated virus titer in inoculated leaves did not result in higher TuYV accumulation in systemic leaves, which indicates that virus long-distance movement was not affected. Since GFP:CIPK7 was localized in or near plasmodesmata, CIPK7 could negatively regulate TuYV export from infected cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Level of C - reactive protein as an indicator for prognosis of premature uterine contractions.
Najat Nakishbandy, Bayar M; Barawi, Sabat A M
2014-01-01
high concentrations of maternal C-reactive protein have been associated with adverse pregnancy outcome, and premature uterine contraction may be predicted by elevated levels of C-reactive protein. This may ultimately be simple and cost-effective enough to introduce as a low-risk screening program. an observational case control study was performed from May 1st, 2010 to December 1st, 2010 at Maternity Teaching Hospital-Erbil/ Kurdistan Region/ Iraq. The sample size was (200) cases. Hundred of them were presented with premature uterine contractions at 24(+0)-36(+6) weeks. The other hundred were control group at same gestational ages. The level of C-reactive protein was determined in both groups and both groups were followed till delivery. (93) out of (100) women with premature uterine contractions had elevated level of C-Reactive protein and 91% delivered prematurely while in the control group only (9) out of (100) women had elevated level of C-reactive protein and only 8% of them delivered preterm. Differences were statistically highly significant. C-reactive protein can be used as a biomarker in prediction of premature delivery when it is associated with premature uterine contractions. As well it can be used as a screening test to detect cases that are at risk of premature delivery.
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, S; Wakabayashi, K; Niiyama, Y; Inoue, G [Tokushima Univ. (Japan). School of Medicine
1974-12-01
The effects of protein and/or energy deficiency on /sup 14/C incorporation into body constituents and /sup 14/C output in expired air and urine were investigated in adult rats using /sup 14/C-Chlorella protein hydrolysate. Rats were given a protein-free diet (PFD) for 2 weeks and conrol rats were fed ad libitum or pari-fed with the PFD group on a 12% lactalbumin diet (LA and Pair-fed, respectively). On the 15th day, animals received /sup 14/C-Chlorella protein hydolysate with 5 g of their respective diet. One group of PFD animals was given tracer by stomach tube without food (PFD-fast). Normal control rats ate about twice as much diet as the PFD group. The respiratory /sup 14/C output in the PFD group was identical with those in the LA and Pair-fed groups and was less than that in the PFD-fast group. The rate of protein synthesis, provisionally expressed as relative specific radioactivity, was more in the PFD group than in the normal group in the liver and less than the latter in the muscle. The LA group retained less total radioactivity in the body than the Pair-fed or PFD group, indicating high capability to hold the body protein in protein deficiency. In addition, decreased conversion of amino acids to lipids and glycogen was observed in the PFD group. All these differences are interpreted as adaptations to protein shortage. On prolonged fasting (PFD-fast group), gluconeogenesis in the liver increased to provide energy, despite the protein deficiency. The relative importances of protein and energy for tissue protein synthesis are briefly discussed.
GTSE1 is a microtubule plus-end tracking protein that regulates EB1-dependent cell migration.
Directory of Open Access Journals (Sweden)
Massimilano Scolz
Full Text Available The regulation of cell migration is a highly complex process that is often compromised when cancer cells become metastatic. The microtubule cytoskeleton is necessary for cell migration, but how microtubules and microtubule-associated proteins regulate multiple pathways promoting cell migration remains unclear. Microtubule plus-end binding proteins (+TIPs are emerging as important players in many cellular functions, including cell migration. Here we identify a +TIP, GTSE1, that promotes cell migration. GTSE1 accumulates at growing microtubule plus ends through interaction with the EB1+TIP. The EB1-dependent +TIP activity of GTSE1 is required for cell migration, as well as for microtubule-dependent disassembly of focal adhesions. GTSE1 protein levels determine the migratory capacity of both nontransformed and breast cancer cell lines. In breast cancers, increased GTSE1 expression correlates with invasive potential, tumor stage, and time to distant metastasis, suggesting that misregulation of GTSE1 expression could be associated with increased invasive potential.
Protein kinase C alpha controls erythropoietin receptor signaling
von Lindern, M.; Parren-van Amelsvoort, M.; van Dijk, T.; Deiner, E.; van den Akker, E.; van Emst-de Vries, S.; Willems, P.; Beug, H.; Löwenberg, B.
2000-01-01
Protein kinase C (PKC) is implied in the activation of multiple targets of erythropoietin (Epo) signaling, but its exact role in Epo receptor (EpoR) signal transduction and in the regulation of erythroid proliferation and differentiation remained elusive. We analyzed the effect of PKC inhibitors
C-Reactive Protein, Fibrinogen, and Cardiovascular Disease Prediction
Kaptoge, Stephen; Di Angelantonio, Emanuele; Pennells, Lisa; Wood, Angela M.; White, Ian R.; Gao, Pei; Walker, Matthew; Thompson, Alexander; Sarwar, Nadeem; Caslake, Muriel; Butterworth, Adam S.; Amouyel, Philippe; Assmann, Gerd; Bakker, Stephan J. L.; Barr, Elizabeth L. M.; Barrett-Connor, Elizabeth; Benjamin, Emelia J.; Bjorkelund, Cecilia; Brenner, Hermann; Brunner, Eric; Clarke, Robert; Cooper, Jackie A.; Cremer, Peter; Cushman, Mary; Dagenais, Gilles R.; D'Agostino, Ralph B.; Dankner, Rachel; Davey-Smith, George; Deeg, Dorly; Dekker, Jacqueline M.; Engstrom, Gunnar; Folsom, Aaron R.; Fowkes, F. Gerry R.; Gallacher, John; Gaziano, J. Michael; Giampaoli, Simona; Gillum, Richard F.; Hofman, Albert; Howard, Barbara V.; Ingelsson, Erik; Iso, Hiroyasu; Jorgensen, Torben; Kiechl, Stefan; Kitamura, Akihiko; Kiyohara, Yutaka; Koenig, Wolfgang; Kromhout, Daan; Kuller, Lewis H.; Lawlor, Debbie A.; Meade, Tom W.
2012-01-01
Background There is debate about the value of assessing levels of C-reactive protein (CRP) and other biomarkers of inflammation for the prediction of first cardiovascular events. Methods We analyzed data from 52 prospective studies that included 246,669 participants without a history of
International Nuclear Information System (INIS)
Stambo, Glenn W.; Berlet, Matthew H.
2012-01-01
Portal hypertension and variceal bleeding are complications due to cirrhosis. Transjugular Intraphepatic Portosystemic shunt (TIPS) procedure is a well-established treatment for recurrent ascites and variceal bleeding related to portal hypertension. After a TIPS has been placed, the potential of TIPS occlusion or stenosis is high. A TIPS re-do procedure has been used in treatment of progressive clinical symptoms. The standard approach is via the jugular route to recannulate the TIPS shunt. Rarely, it cannot be performed from the jugular approach. Therefore, a fluoroscopically -guided transhepatic approach has been devised for these difficult situations. This case describes the use of the transhepatic route through an indwelling Viatorr covered stent utilizing an En-Snare device to help complete the TIPS re-do procedure. With this newer approach to TIPS re-do procedures, endovascular specialists can achieve TIPS patency despite difficult venous anatomical challenges and the various types of available TIPS stents presently on the market.
International Nuclear Information System (INIS)
Gebhart, Dana; Williams, Steven R.; Scholl, Dean
2017-01-01
SP6 is a salmonella phage closely related to coliphage K1-5. K1-5 is notable in that it encodes two polysaccharide-degrading tailspike proteins, an endosialidase that allows it to infect E. coli K1, and a lyase that enables it to infect K5 strains. SP6 is similar to K1-5 except that it encodes a P22-like endorhamnosidase tailspike, gp46, allowing it to infect group B Salmonella. We show here that SP6 can also infect Salmonella serogroups C 2 and C 3 and that a mutation in a putative second tailspike, gp47, eliminates this specificity. Gene 47 was fused to the coding region of the N-terminal portion of the Pseudomonas aeruginosa R2 pyocin tail fiber and expressed in trans such that the fusion protein becomes incorporated into pyocin particles. These pyocins, termed AvR2-SP47, killed serogroups C 2 and C 3 Salmonella. We conclude that SP6 encodes two tail proteins providing it a broad host range among Salmonella enterica. - Highlights: • SP6 is a “dual specificity” bacteriophage that encodes two different receptor binding proteins giving it a broad host range. • These receptor binding proteins can be used to re-target the spectrum of R-type bacteriocins to Salmonella enterica. • Both SP6 and the engineered R-type bacteriocins can kill the Salmonella serovars most associated with human disease making them attractive for development as antimicrobial agents.
ATM Mediates pRB Function To Control DNMT1 Protein Stability and DNA Methylation
Suzuki, Misa; Hayashi, Naoyuki; Kobayashi, Masahiko; Sasaki, Nobunari; Nishiuchi, Takumi; Doki, Yuichiro; Okamoto, Takahiro; Kohno, Susumu; Muranaka, Hayato; Kitajima, Shunsuke; Yamamoto, Ken-ichi
2013-01-01
The retinoblastoma tumor suppressor gene (RB) product has been implicated in epigenetic control of gene expression owing to its ability to physically bind to many chromatin modifiers. However, the biological and clinical significance of this activity was not well elucidated. To address this, we performed genetic and epigenetic analyses in an Rb-deficient mouse thyroid C cell tumor model. Here we report that the genetic interaction of Rb and ATM regulates DNMT1 protein stability and hence controls the DNA methylation status in the promoters of at least the Ink4a, Shc2, FoxO6, and Noggin genes. Furthermore, we demonstrate that inactivation of pRB promotes Tip60 (acetyltransferase)-dependent ATM activation; allows activated ATM to physically bind to DNMT1, forming a complex with Tip60 and UHRF1 (E3 ligase); and consequently accelerates DNMT1 ubiquitination driven by Tip60-dependent acetylation. Our results indicate that inactivation of the pRB pathway in coordination with aberration in the DNA damage response deregulates DNMT1 stability, leading to an abnormal DNA methylation pattern and malignant progression. PMID:23754744
Interaction of C-terminal truncated human alphaA-crystallins with target proteins.
Directory of Open Access Journals (Sweden)
Anbarasu Kumarasamy
2008-09-01
Full Text Available Significant portion of alphaA-crystallin in human lenses exists as C-terminal residues cleaved at residues 172, 168, and 162. Chaperone activity, determined with alcohol dehydrogenase (ADH and betaL-crystallin as target proteins, was increased in alphaA(1-172 and decreased in alphaA(1-168 and alphaA(1-162. The purpose of this study was to show whether the absence of the C-terminal residues influences protein-protein interactions with target proteins.Our hypothesis is that the chaperone-target protein binding kinetics, otherwise termed subunit exchange rates, are expected to reflect the changes in chaperone activity. To study this, we have relied on fluorescence resonance energy transfer (FRET utilizing amine specific and cysteine specific fluorescent probes. The subunit exchange rate (k for ADH and alphaA(1-172 was nearly the same as that of ADH and alphaA-wt, alphaA(1-168 had lower and alphaA(1-162 had the lowest k values. When betaL-crystallin was used as the target protein, alphaA(1-172 had slightly higher k value than alphaA-wt and alphaA(1-168 and alphaA(1-162 had lower k values. As expected from earlier studies, the chaperone activity of alphaA(1-172 was slightly better than that of alphaA-wt, the chaperone activity of alphaA(1-168 was similar to that of alphaA-wt and alphaA(1-162 had substantially decreased chaperone activity.Cleavage of eleven C-terminal residues including Arg-163 and the C-terminal flexible arm significantly affects the interaction with target proteins. The predominantly hydrophilic flexible arm appears to be needed to keep the chaperone-target protein complex soluble.
Yen, Li-Chen; Liao, Jia-Teh; Lee, Hwei-Jen; Chou, Wei-Yuan; Chen, Chun-Wei; Lin, Yi-Ling; Liao, Ching-Len
2016-02-01
NS1 is the only nonstructural protein that enters the lumen of the endoplasmic reticulum (ER), where NS1 is glycosylated, forms a dimer, and is subsequently secreted during flavivirus replication as dimers or hexamers, which appear to be highly immunogenic to the infected host, as protective immunity can be elicited against homologous flavivirus infections. Here, by using a trans-complementation assay, we identified the C-terminal end of NS1 derived from Japanese encephalitis virus (JEV), which was more flexible than other regions in terms of housing foreign epitopes without a significant impact on virus replication. This mapped flexible region is located in the conserved tip of the core β-ladder domain of the multimeric NS1 structure and is also known to contain certain linear epitopes, readily triggering specific antibody responses from the host. Despite becoming attenuated, recombinant JEV with insertion of a neutralizing epitope derived from enterovirus 71 (EV71) into the C-terminal end of NS1 not only could be normally released from infected cells, but also induced dual protective immunity for the host to counteract lethal challenge with either JEV or EV71 in neonatal mice. These results indicated that the secreted multimeric NS1 of flaviviruses may serve as a natural protein carrier to render epitopes of interest more immunogenic in the C terminus of the core β-ladder domain. The positive-sense RNA genomes of mosquito-borne flaviviruses appear to be flexible in terms of accommodating extra insertions of short heterologous antigens into their virus genes. Here, we illustrate that the newly identified C terminus of the core β-ladder domain in NS1 could be readily inserted into entities such as EV71 epitopes, and the resulting NS1-epitope fusion proteins appeared to maintain normal virus replication, secretion ability, and multimeric formation from infected cells. Nonetheless, such an insertion attenuated the recombinant JEV in mice, despite having retained
Crack Tip Mechanics in Distortion Gradient Plasticity
DEFF Research Database (Denmark)
Fuentes-Alonso, Sandra; Martínez Pañeda, Emilio
2017-01-01
Gradient Plasticity (DGP), the influence on crack tip mechanics of DGP's distinguishing features that entail superior modelling capabilities has not been investigated yet. In this work crack tip fields are thoroughly examined by implementing the higher order theory of DGP in an implicit finite element...
International Nuclear Information System (INIS)
Feng, Ming-Jing; Fu, Tian-Min; Liu, Xiang; Li, Lan-Fen
2010-01-01
SMU.1108c, a putative uncharacterized protein from S. mutans, was crystallized and X-ray diffraction data were collected to a resolution of 2.2 Å. Streptococcus mutans SMU.1108c (KEGG database) encodes a functionally uncharacterized protein consisting of 270 amino-acid residues. This protein is predicted to have a haloacid dehalogenase hydrolase-like domain and is a homologue of haloacid dehalogenase phosphatases that catalyze phosphoryl-transfer reactions. In this work, SMU.1108c was cloned into the pET28a vector and overexpressed in Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity and crystallized using the sitting-drop vapour-diffusion method. The best crystal diffracted to 2.0 Å resolution and belonged to space group C2, with unit-cell parameters a = 77.1, b = 80.2, c = 47.9 Å, β = 99.5°
Centrifugal compressor tip clearance and impeller flow
Energy Technology Data Exchange (ETDEWEB)
Jaatinen-Varri, Ahti; Tiainen, Jonna; Turunen-Saaresti, Teemu; Gronman, Aki; Ameli, Alireza; Backman, Jari [Laboratory of Fluid Dynamics, LUT School of Energy Systems, Lappeenranta University of Technology, Lappeenranta (Finland); Engeda, Abraham [Turbomachinery Laboratory, Dept. of Mechanical Engineering, Michigan State University, East Lansing (United States)
2016-11-15
Compressors consume a considerable portion of the electricity used in the industrial sector. Hence, improvements in compressor efficiency lead to energy savings and reduce environmental impacts. The efficiency of an unshrouded centrifugal compressor suffers from leakage flow over the blade tips. The effect of tip leakage flow on the passage flow differs between the full and splitter blade passages. In this study, the differences in the flow fields between the full and splitter blade passages were studied numerically in detail. An industrial high-speed compressor with a design pressure ratio of 1.78 was modelled. Numerical studies were conducted with six different tip clearances and three different diffuser widths. The results show that increasing tip clearance considerably increases the reversed flow into the impeller with an unpinched diffuser. The reversed flow then partly mixes into the flow in the same blade passage it entered the impeller and the rest migrates over the blade, mixing with the tip clearance flow. Furthermore, as the reversed and clearance flow mix into the wake, the wake is weakened. As pinch reduces both the reversed flow and clearance flow, the passage wakes are stronger with pinches. However, the pinch is beneficial as the losses at the impeller outlet decrease.
Centrifugal compressor tip clearance and impeller flow
International Nuclear Information System (INIS)
Jaatinen-Varri, Ahti; Tiainen, Jonna; Turunen-Saaresti, Teemu; Gronman, Aki; Ameli, Alireza; Backman, Jari; Engeda, Abraham
2016-01-01
Compressors consume a considerable portion of the electricity used in the industrial sector. Hence, improvements in compressor efficiency lead to energy savings and reduce environmental impacts. The efficiency of an unshrouded centrifugal compressor suffers from leakage flow over the blade tips. The effect of tip leakage flow on the passage flow differs between the full and splitter blade passages. In this study, the differences in the flow fields between the full and splitter blade passages were studied numerically in detail. An industrial high-speed compressor with a design pressure ratio of 1.78 was modelled. Numerical studies were conducted with six different tip clearances and three different diffuser widths. The results show that increasing tip clearance considerably increases the reversed flow into the impeller with an unpinched diffuser. The reversed flow then partly mixes into the flow in the same blade passage it entered the impeller and the rest migrates over the blade, mixing with the tip clearance flow. Furthermore, as the reversed and clearance flow mix into the wake, the wake is weakened. As pinch reduces both the reversed flow and clearance flow, the passage wakes are stronger with pinches. However, the pinch is beneficial as the losses at the impeller outlet decrease
C-E1 fusion protein synthesized by rubella virus DI RNAs maintained during serial passage
International Nuclear Information System (INIS)
Tzeng, W.-P.; Frey, Teryl K.
2006-01-01
Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, it was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles
Energy Technology Data Exchange (ETDEWEB)
Krishnan, Vengadesan [UNESCO Regional Centre for Biotechnology (RCB), Gurgaon 122 016, Haryana (India); Dwivedi, Prabhat [University of Texas Health Science Center, Houston, TX 77030 (United States); Kim, Brandon J. [San Diego State University, 5500 Campanile Drive, San Diego, CA 92182 (United States); Samal, Alexandra; Macon, Kevin [University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Ma, Xin; Mishra, Arunima [University of Texas Health Science Center, Houston, TX 77030 (United States); Doran, Kelly S. [San Diego State University, 5500 Campanile Drive, San Diego, CA 92182 (United States); Ton-That, Hung [University of Texas Health Science Center, Houston, TX 77030 (United States); Narayana, Sthanam V. L., E-mail: narayana@uab.edu [University of Alabama at Birmingham, Birmingham, AL 35294 (United States); UNESCO Regional Centre for Biotechnology (RCB), Gurgaon 122 016, Haryana (India)
2013-06-01
The crystal structure of a 75 kDa central fragment of GBS104, a tip pilin from the 2063V/R strain of Streptococcus agalactiae (group B streptococcus; GBS), is reported. The crystal structure of a 75 kDa central fragment of GBS104, a tip pilin from the 2063V/R strain of Streptococcus agalactiae (group B streptococcus; GBS), is reported. In addition, a homology model of the remaining two domains of GBS104 was built and a model of full-length GBS104 was generated by combining the homology model (the N1 and N4 domains) and the crystal structure of the 75 kDa fragment (the N2 and N3 domains). This rod-shaped GBS104 model is constructed of three IgG-like domains (the N1, N2 and N4 domains) and one vWFA-like domain (the N3 domain). The N1 and N2 domains of GBS104 are assembled with distinct and remote segments contributed by the N- and C-termini. The metal-binding site in the N3 domain of GBS104 is in the closed/low-affinity conformation. Interestingly, this domain hosts two long arms that project away from the metal-binding site. Using site-directed mutagenesis, two cysteine residues that lock the N3 domain of GBS104 into the open/high-affinity conformation were introduced. Both wild-type and disulfide-locked recombinant proteins were tested for binding to extracellular matrix proteins such as collagen, fibronectin, fibrinogen and laminin, and an increase in fibronectin binding affinity was identified for the disulfide-locked N3 domain, suggesting that induced conformational changes may play a possible role in receptor binding.
International Nuclear Information System (INIS)
Krishnan, Vengadesan; Dwivedi, Prabhat; Kim, Brandon J.; Samal, Alexandra; Macon, Kevin; Ma, Xin; Mishra, Arunima; Doran, Kelly S.; Ton-That, Hung; Narayana, Sthanam V. L.
2013-01-01
The crystal structure of a 75 kDa central fragment of GBS104, a tip pilin from the 2063V/R strain of Streptococcus agalactiae (group B streptococcus; GBS), is reported. The crystal structure of a 75 kDa central fragment of GBS104, a tip pilin from the 2063V/R strain of Streptococcus agalactiae (group B streptococcus; GBS), is reported. In addition, a homology model of the remaining two domains of GBS104 was built and a model of full-length GBS104 was generated by combining the homology model (the N1 and N4 domains) and the crystal structure of the 75 kDa fragment (the N2 and N3 domains). This rod-shaped GBS104 model is constructed of three IgG-like domains (the N1, N2 and N4 domains) and one vWFA-like domain (the N3 domain). The N1 and N2 domains of GBS104 are assembled with distinct and remote segments contributed by the N- and C-termini. The metal-binding site in the N3 domain of GBS104 is in the closed/low-affinity conformation. Interestingly, this domain hosts two long arms that project away from the metal-binding site. Using site-directed mutagenesis, two cysteine residues that lock the N3 domain of GBS104 into the open/high-affinity conformation were introduced. Both wild-type and disulfide-locked recombinant proteins were tested for binding to extracellular matrix proteins such as collagen, fibronectin, fibrinogen and laminin, and an increase in fibronectin binding affinity was identified for the disulfide-locked N3 domain, suggesting that induced conformational changes may play a possible role in receptor binding
Bacterial flagellar capping proteins adopt diverse oligomeric states
Energy Technology Data Exchange (ETDEWEB)
Postel, Sandra; Deredge, Daniel; Bonsor, Daniel A.; Yu, Xiong; Diederichs, Kay; Helmsing, Saskia; Vromen, Aviv; Friedler, Assaf; Hust, Michael; Egelman, Edward H.; Beckett, Dorothy; Wintrode, Patrick L.; Sundberg, Eric J. (UV); (Braunschweig); (Maryland-MED); (Konstanz); (Maryland); (Hebrew)
2016-09-24
Flagella are crucial for bacterial motility and pathogenesis. The flagellar capping protein (FliD) regulates filament assembly by chaperoning and sorting flagellin (FliC) proteins after they traverse the hollow filament and exit the growing flagellum tip. In the absence of FliD, flagella are not formed, resulting in impaired motility and infectivity. Here, we report the 2.2 Å resolution X-ray crystal structure of FliD from
Identification and functional analysis of endothelial tip cell-enriched genes.
del Toro, Raquel; Prahst, Claudia; Mathivet, Thomas; Siegfried, Geraldine; Kaminker, Joshua S; Larrivee, Bruno; Breant, Christiane; Duarte, Antonio; Takakura, Nobuyuki; Fukamizu, Akiyoshi; Penninger, Josef; Eichmann, Anne
2010-11-11
Sprouting of developing blood vessels is mediated by specialized motile endothelial cells localized at the tips of growing capillaries. Following behind the tip cells, endothelial stalk cells form the capillary lumen and proliferate. Expression of the Notch ligand Delta-like-4 (Dll4) in tip cells suppresses tip cell fate in neighboring stalk cells via Notch signaling. In DLL4(+/-) mouse mutants, most retinal endothelial cells display morphologic features of tip cells. We hypothesized that these mouse mutants could be used to isolate tip cells and so to determine their genetic repertoire. Using transcriptome analysis of retinal endothelial cells isolated from DLL4(+/-) and wild-type mice, we identified 3 clusters of tip cell-enriched genes, encoding extracellular matrix degrading enzymes, basement membrane components, and secreted molecules. Secreted molecules endothelial-specific molecule 1, angiopoietin 2, and apelin bind to cognate receptors on endothelial stalk cells. Knockout mice and zebrafish morpholino knockdown of apelin showed delayed angiogenesis and reduced proliferation of stalk cells expressing the apelin receptor APJ. Thus, tip cells may regulate angiogenesis via matrix remodeling, production of basement membrane, and release of secreted molecules, some of which regulate stalk cell behavior.
Redundant role of protein kinase C delta and epsilon during mouse embryonic development.
Directory of Open Access Journals (Sweden)
Sergio Carracedo
Full Text Available Protein Kinase C delta and epsilon are mediators of important cellular events, such as cell proliferation, migration or apoptosis. The formation of blood vessels, i.e., vasculo- and angiogenesis, is a process where these isoforms have also been shown to participate. However, mice deficient in either Protein Kinase C delta or epsilon are viable and therefore their individual contribution to the formation of the vasculature appeared so far dispensable. In this study, we show that double null mutation of Protein Kinase C delta and epsilon causes embryonic lethality at approximately E9.5. At this stage, whole mount staining of the endothelial marker CD31 in double null embryos revealed defective blood vessel formation. Moreover, culture of double deficient mouse allantois showed impaired endothelial cell organization, and analyses of double deficient embryo sections showed dilated vessels, decreased endothelial-specific adherent junctions, and decreased contact of endothelial cells with mural cells. Protein kinase C delta and epsilon also appeared essential for vascular smooth muscle cell differentiation, since α-smooth muscle actin, a classical marker for vascular smooth muscle cells, was almost undetectable in double deficient embryonic aorta at E9.5. Subsequent qPCR analyses showed decreased VE-cadherin, Vegfr2, Cd31, Cdh2, Ets1, and Fli-1, among other angiogenesis related transcripts in double deficient embryos. Taken together, these data suggest for the first time an in vivo redundant role between members of the novel Protein Kinase C subfamily that allows for mutual compensation during mouse embryonic development, with vasculogenesis/angiogenesis as an obvious common function of these two Protein Kinase Cs. Protein Kinase C delta and epsilon might therefore be useful targets for inhibiting vasculo- and/or angiogenesis.
Modular design of AFM probe with sputtered silicon tip
DEFF Research Database (Denmark)
Rasmussen, Peter; Thaysen, Jacob; Bouwstra, Siebe
2001-01-01
of the thin films constituting the cantilever. The AFM probe has an integrated tip made of a thick sputtered silicon layer, which is deposited after the probe has been defined and just before the cantilevers are released. The tips are so-called rocket tips made by reactive ion etching. We present probes...
21 CFR 880.6025 - Absorbent tipped applicator.
2010-04-01
... stick. The device is used to apply medications to, or to take specimens from, a patient. (b...) MEDICAL DEVICES GENERAL HOSPITAL AND PERSONAL USE DEVICES General Hospital and Personal Use Miscellaneous Devices § 880.6025 Absorbent tipped applicator. (a) Identification. An absorbent tipped applicator is a...
Radioassays for quantitation of intact complement proteins C2 and B in human serum
Energy Technology Data Exchange (ETDEWEB)
Oglesby, T J; Ueda, A; Volanakis, J E
1988-05-25
Availability of polyclonal and monoclonal antibodies recognizing determinants on the major cleavage fragments of complement proteins C2 and B enabled development of sensitive radioassays which can be used to quantitate the intact proteins in human sera. Changes in C2 and B concentrations indicative of classical or alternative pathway activation, or both, were seen in normal serum after incubation with complement activators. The authors determined the normal range of C2 concentration to be 11-35 ..mu..g/ml in 32 healthy individuals, and that of protein B to be 74-286 ..mu..g/ml. Sera from patients with systemic lupus erythematosus (SLE), septic shock, infections, and following orthopedic surgery were then assayed. Mean protein B concentration was significantly higher in SLE sera and in the infected and post-operative sera, and the mean C2 concentration in the septic shock group was significantly lower than the mean of healthy individuals. Intact C2 was not detected in known C2-deficient individuals. These assays allow parallel quantitation of the structurally and functionally homologous proteins of the classical (C2) and alternative (B) pathways, which is of interest in patients with genetic and acquired hypocomplementemia. 22 refs.; 3 figs.
C- Reactive Protein in Tuberculosis and Human Immunodeficiency ...
African Journals Online (AJOL)
This study was conducted to evaluate C-reactive protein (CRP) levels in Mycobacterium tuberculosis and human immunodeficiency virus (HIV) infections and the follow-up therapeutic response to tuberculosis (TB) among patients aged 19-68 years attending out-patient clinics of two hospitals in Abeokuta, Southwestern ...
Some observations of tip-vortex cavitation
Arndt, R. E. A.; Arakeri, V. H.; Higuchi, H.
1991-08-01
Cavitation has been observed in the trailing vortex system of an elliptic platform hydrofoil. A complex dependence on Reynolds number and gas content is noted at inception. Some of the observations can be related to tension effects associated with the lack of sufficiently large-sized nuclei. Inception measurements are compared with estimates of pressure in the vortex obtained from LDV measurements of velocity within the vortex. It is concluded that a complete correlation is not possible without knowledge of the fluctuating levels of pressure in tip-vortex flows. When cavitation is fully developed, the observed tip-vortex trajectory flows. When cavitation is fully developed, the observed tip-vortex trajectory shows a surprising lack of dependence on any of the physical parameters varied, such as angle of attack, Reynolds number, cavitation number, and dissolved gas content.
Directory of Open Access Journals (Sweden)
Vesa Kirjavainen
Full Text Available Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS O-antigen (O-ag and outer core (OC do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp, an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.
Variable-temperature independently driven four-tip scanning tunneling microscope
International Nuclear Information System (INIS)
Hobara, Rei; Nagamura, Naoka; Hasegawa, Shuji; Matsuda, Iwao; Yamamoto, Yuko; Miyatake, Yutaka; Nagamura, Toshihiko
2007-01-01
The authors have developed an ultrahigh vacuum (UHV) variable-temperature four-tip scanning tunneling microscope (STM), operating from room temperature down to 7 K, combined with a scanning electron microscope (SEM). Four STM tips are mechanically and electrically independent and capable of positioning in arbitrary configurations in nanometer precision. An integrated controller system for both of the multitip STM and SEM with a single computer has also been developed, which enables the four tips to operate either for STM imaging independently and for four-point probe (4PP) conductivity measurements cooperatively. Atomic-resolution STM images of graphite were obtained simultaneously by the four tips. Conductivity measurements by 4PP method were also performed at various temperatures with the four tips in square arrangement with direct contact to the sample surface
C-Terminal Fluorescent Labeling Impairs Functionality of DNA Mismatch Repair Proteins
Brieger, Angela; Plotz, Guido; Hinrichsen, Inga; Passmann, Sandra; Adam, Ronja; Zeuzem, Stefan
2012-01-01
The human DNA mismatch repair (MMR) process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2). Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency. PMID:22348133
C-terminal fluorescent labeling impairs functionality of DNA mismatch repair proteins.
Directory of Open Access Journals (Sweden)
Angela Brieger
Full Text Available The human DNA mismatch repair (MMR process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2. Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency.
Site-selective 13C labeling of proteins using erythrose
International Nuclear Information System (INIS)
Weininger, Ulrich
2017-01-01
NMR-spectroscopy enables unique experimental studies on protein dynamics at atomic resolution. In order to obtain a full atom view on protein dynamics, and to study specific local processes like ring-flips, proton-transfer, or tautomerization, one has to perform studies on amino-acid side chains. A key requirement for these studies is site-selective labeling with 13 C and/or 1 H, which is achieved in the most general way by using site-selectively 13 C-enriched glucose (1- and 2- 13 C) as the carbon source in bacterial expression systems. Using this strategy, multiple sites in side chains, including aromatics, become site-selectively labeled and suitable for relaxation studies. Here we systematically investigate the use of site-selectively 13 C-enriched erythrose (1-, 2-, 3- and 4- 13 C) as a suitable precursor for 13 C labeled aromatic side chains. We quantify 13 C incorporation in nearly all sites in all 20 amino acids and compare the results to glucose based labeling. In general the erythrose approach results in more selective labeling. While there is only a minor gain for phenylalanine and tyrosine side-chains, the 13 C incorporation level for tryptophan is at least doubled. Additionally, the Phe ζ and Trp η2 positions become labeled. In the aliphatic side chains, labeling using erythrose yields isolated 13 C labels for certain positions, like Ile β and His β, making these sites suitable for dynamics studies. Using erythrose instead of glucose as a source for site-selective 13 C labeling enables unique or superior labeling for certain positions and is thereby expanding the toolbox for customized isotope labeling of amino-acid side-chains.
The incorporation of 2-[14C]glycine into porcine lens protein
International Nuclear Information System (INIS)
Lee, Y.B.; Kauffman, R.G.; DeVenecia, G.
1977-01-01
A series of experiments was conducted to estimate the apparent turnover rate of lens soluble protein, the incorporation rate of 2-[ 14 C]glycine into various soluble protein components and the effect of nutritional stress on the disappearance of radioactivity with time. Evidence is presented that there are two fractions of soluble lens protein with different turnover rates: one is a fast turnover fraction with a half-life of 20.8 hr and the other is a metabolically inert fraction with an infinitely long half-life. It is postulated that the fast turnover fraction is present in the newly-formed younger fibers in the periphery, whereas the inert fraction is in the old lens fibers of the cortex and nucleus. Sephadex G-200 column chromatography was used to separate the soluble lens protein into four components: A, B, C and D in the order of elution. The changes in specific activities of the four components with the time course after injection were followed. Prolonged starvation did not affect the disappearance of carbon incorporated into lens protein with the time course after injection, suggesting normal synthesis and degradation of lens protein without regard to dietary stress. (author)
Effect of tip geometry on photo-electron-emission from nanostructures.
Teki, Ranganath; Lu, Toh-Ming; Koratkar, Nikhil
2009-03-01
We show in this paper the strong effect of tip geometry on the photo-electron-emission behavior of nanostructured surfaces. To study the effect of tip geometry we compared the photo-emissivity of Ru and Pt nanorods with pyramidal shaped tips to that of carbon nanorods that display flat top (planar) tips. Flat top architectures gave no significant increase in the emission current, while nanostructures with pyramidal shaped tips showed 3-4 fold increase in photo-emission compared to a thin film of the same material. Pyramidal tip geometries increase the effective surface area that is exposed to the incident photon-flux thereby enhancing the photon-collection probability of the system. Such nano-structured surfaces show promise in a variety of device applications such as photo-detectors, photon counters and photo-multiplier tubes.
Hu, W H; Liu, S F; Liaw, S I
2015-01-01
The purpose of this study was to develop an efficient cryopreservation protocol for pineapple (Ananas comosus Merr.) shoot tips. The optimal state of pineapple plantlets was investigated by using sucrose preconditioning to enhance survival after cryostorage. To achieve a suitable state of plantlets before cryopreservation, 0.2 M to 0.4 M sucrose concentrations combined with short- (0-7 days), medium- (15-30 days), and long-term (75-150 days) preconditioning periods were compared. The highest survival (100 %) was achieved using the following procedure: intact plantlets underwent long-term preconditioning with 0.2 M sucrose for 135 days, dissected shoot tips were treated with a loading solution containing 2.0 M glycerol + 0.4 M sucrose for 60 min at 25 degree and the shoot tips were dehydrated in PVS2 for 2h at 0 degree C before being plunged in liquid nitrogen. Rewarming was conducted in a water-bath for 30 s at 40 degree C and PVS2 was replaced with a 1.2 M sucrose solution for 30 min at 25 degree C. The shoot tips were transferred on semisolid medium and left in the dark for 1 week, then in dim light for 3 weeks.
Plasma levels of C-Reactive Protein and Fibrinogen in Pulmonary ...
African Journals Online (AJOL)
In this study, we determined the changes in plasma C- reactive protein (C-RP) and Fibrinogen levels in Drug sensitive Tuberculosis (DSTB) patients at diagnosis, Multi drug resistant tuberculosis (MDRTB) patients at diagnosis and during chemotherapy. Twenty-four (24) patients MDRTB patients and 24 newly diagnosed ...
Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.
2012-01-01
Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA...
100 Consejos para los Padres (100 Tips for Parents).
Department of Education, Washington, DC.
Noting that involved parents can improve their children's chances of succeeding in school, this packet of Spanish-language cards offers 100 tips created to help parents become more involved in their child's education. Following a card of general tips on becoming involved, tips are offered in the following topic areas: keeping a child alcohol,…
Adam, Philip R.; Patil, Mrinalini K.; Dickenson, Nicholas E.; Choudhari, Shyamal; Barta, Michael; Geisbrecht, Brian V.; Picking, Wendy L.; Picking, William D.
2012-01-01
Shigella flexneri uses its type III secretion system (T3SS) to promote invasion of human intestinal epithelial cells as the first step in causing shigellosis, a life threatening form of dysentery. The Shigella type III secretion apparatus (T3SA) consists of a basal body that spans the bacterial envelope and an exposed needle that injects effector proteins into target cells. The nascent Shigella T3SA needle is topped with a pentamer of the needle tip protein invasion plasmid antigen D (IpaD). Bile salts trigger recruitment of the first hydrophobic translocator protein, IpaB, to the tip complex where it senses contact with a host membrane. In the bacterial cytoplasm, IpaB exists in a complex with its chaperone IpgC. Several structures of IpgC have been solved and we recently reported the 2.1-Å crystal structure of the N-terminal domain (IpaB74.224) of IpaB. Like IpgC, the IpaB N-terminal domain exists as a homodimer in solution. We now report that when the two are mixed, these homodimers dissociate and form heterodimers having a nanomolar dissociation constant. This is consistent with the equivalent complexes co-purified after being co-expressed in E. coli. Fluorescence data presented here also indicate that the N-terminal domain of IpaB possesses two regions that appear to contribute additively to chaperone binding. It is also likely that the IpaB N terminus adopts an alternative conformation as a result of chaperone binding. The importance of these findings within the functional context of these proteins is discussed. PMID:22497344
H. Lans (Hannes)
2005-01-01
textabstractAmong the key molecules involved in sensory perception are G proteins, which act in every cell to activate a cascade of signaling molecules in response to certain environmental cues. In this thesis, several studies on the role of G proteins in the sensory system of C. elegans are
International Nuclear Information System (INIS)
Zakhartchouk, Alexander; Connors, Wayne; Van Kessel, Andrew; Tikoo, Suresh Kumar
2004-01-01
Earlier, we detected pIX of BAdV-3 as a 14-kDa protein in purified virions. Analysis of BAdV-3 pIX using different region antibodies revealed that the N-terminus and central domain of the pIX contain immunogenic sites and are not exposed on the surface of BAdV-3 virion. This suggested that the C-terminus of BAdV-3 pIX (125 amino acid) may be exposed on the virion and may be used as a site for incorporation of heterologous peptides or proteins. We constructed recombinant BAV950 containing a small peptide (21 amino acid), including the RGD motif or recombinant BAV951 containing enhanced yellow-green fluorescent protein (EYFP) fused to the C-terminus of pIX. Western blot analysis demonstrated that the chimeric pIX-RGD was incorporated into virion capsids. Incorporation of the RGD motif into the pIX resulted in significant augmentation of BAdV-3 fiber knob-independent infection of the integrin-positive cells, suggesting that RGD motifs are displayed on the surface of virion capsids and are accessible for binding to integrins. Analysis of BAV951 revealed that the chimeric pIX is incorporated into virion capsids and EYFP containing the C-terminus of pIX is exposed on the surface of the virion. Moreover, insertion of chimeric pIXs was maintained without change through successive rounds of viral replication. These results suggested that in contrast to major capsid proteins (hexon, penton, fiber), the minor capsid protein IX can be use for the incorporation of targeting ligands based on either small peptides or longer polypeptides
Leite, Anne Carolina Eleutério; Carneiro, Valéria Martins de Araújo; Guimarães, Maria do Carmo Machado
2014-01-01
To investigate the effects of nonsurgical periodontal therapy on levels of high-sensitivity C-reactive protein in the sera and its association with body mass index and high density lipoprotein in subjects with severe periodontitis. Sera from 28 subjects (mean age: 34.36±6.24; 32% men) with severe periodontitis and 27 healthy controls (mean age: 33.18±6.42; 33% men) were collected prior to periodontal therapy. Blood samples were obtained from 23 subjects who completed therapy (9-12 months). Oral and systemic parameters such as the number of blood cells, glucose examination, lipid profile, and high-sensitivity C-reactive protein levels accessed by high-sensitivity immunonephelometry assay, were included. Before therapy, in the periodontitis group, the ratio of subjects with high-sensitivity C-reactive protein C-reactive protein C-reactive protein C-reactive protein >0.3 mg/dL (28.91±6.03) (Pperiodontitis, periodontal therapy was associated with decreased levels of circulating high-sensitivity C-reactive protein and increase of high density lipoprotein in serum. The clinical trial was registered at http://www.clinicaltrials.gov.br/, No. RBR-24T799.