WorldWideScience

Sample records for safety event detection

  1. Detecting adverse events in surgery: comparing events detected by the Veterans Health Administration Surgical Quality Improvement Program and the Patient Safety Indicators.

    Science.gov (United States)

    Mull, Hillary J; Borzecki, Ann M; Loveland, Susan; Hickson, Kathleen; Chen, Qi; MacDonald, Sally; Shin, Marlena H; Cevasco, Marisa; Itani, Kamal M F; Rosen, Amy K

    2014-04-01

    The Patient Safety Indicators (PSIs) use administrative data to screen for select adverse events (AEs). In this study, VA Surgical Quality Improvement Program (VASQIP) chart review data were used as the gold standard to measure the criterion validity of 5 surgical PSIs. Independent chart review was also used to determine reasons for PSI errors. The sensitivity, specificity, and positive predictive value of PSI software version 4.1a were calculated among Veterans Health Administration hospitalizations (2003-2007) reviewed by VASQIP (n = 268,771). Nurses re-reviewed a sample of hospitalizations for which PSI and VASQIP AE detection disagreed. Sensitivities ranged from 31% to 68%, specificities from 99.1% to 99.8%, and positive predictive values from 31% to 72%. Reviewers found that coding errors accounted for some PSI-VASQIP disagreement; some disagreement was also the result of differences in AE definitions. These results suggest that the PSIs have moderate criterion validity; however, some surgical PSIs detect different AEs than VASQIP. Future research should explore using both methods to evaluate surgical quality. Published by Elsevier Inc.

  2. Signal detection to identify serious adverse events (neuropsychiatric events in travelers taking mefloquine for chemoprophylaxis of malaria

    Directory of Open Access Journals (Sweden)

    Naing C

    2012-08-01

    Full Text Available Cho Naing,1,3 Kyan Aung,1 Syed Imran Ahmed,2 Joon Wah Mak31School of Medical Sciences, 2School of Pharmacy and Health Sciences, 3School of Postgraduate Studies and Research, International Medical University, Kuala Lumpur, MalaysiaBackground: For all medications, there is a trade-off between benefits and potential for harm. It is important for patient safety to detect drug-event combinations and analyze by appropriate statistical methods. Mefloquine is used as chemoprophylaxis for travelers going to regions with known chloroquine-resistant Plasmodium falciparum malaria. As such, there is a concern about serious adverse events associated with mefloquine chemoprophylaxis. The objective of the present study was to assess whether any signal would be detected for the serious adverse events of mefloquine, based on data in clinicoepidemiological studies.Materials and methods: We extracted data on adverse events related to mefloquine chemoprophylaxis from the two published datasets. Disproportionality reporting of adverse events such as neuropsychiatric events and other adverse events was presented in the 2 × 2 contingency table. Reporting odds ratio and corresponding 95% confidence interval [CI] data-mining algorithm was applied for the signal detection. The safety signals are considered significant when the ROR estimates and the lower limits of the corresponding 95% CI are ≥2.Results: Two datasets addressing adverse events of mefloquine chemoprophylaxis (one from a published article and one from a Cochrane systematic review were included for analyses. Reporting odds ratio 1.58, 95% CI: 1.49–1.68 based on published data in the selected article, and 1.195, 95% CI: 0.94–1.44 based on data in the selected Cochrane review. Overall, in both datasets, the reporting odds ratio values of lower 95% CI were less than 2.Conclusion: Based on available data, findings suggested that signals for serious adverse events pertinent to neuropsychiatric event were

  3. The relationship between organizational leadership for safety and learning from patient safety events.

    Science.gov (United States)

    Ginsburg, Liane R; Chuang, You-Ta; Berta, Whitney Blair; Norton, Peter G; Ng, Peggy; Tregunno, Deborah; Richardson, Julia

    2010-06-01

    To examine the relationship between organizational leadership for patient safety and five types of learning from patient safety events (PSEs). Forty-nine general acute care hospitals in Ontario, Canada. A nonexperimental design using cross-sectional surveys of hospital patient safety officers (PSOs) and patient care managers (PCMs). PSOs provided data on organization-level learning from (a) minor events, (b) moderate events, (c) major near misses, (d) major event analysis, and (e) major event dissemination/communication. PCMs provided data on organizational leadership (formal and informal) for patient safety. Hospitals were the unit of analysis. Seemingly unrelated regression was used to examine the influence of formal and informal leadership for safety on the five types of learning from PSEs. The interaction between leadership and hospital size was also examined. Formal organizational leadership for patient safety is an important predictor of learning from minor, moderate, and major near-miss events, and major event dissemination. This relationship is significantly stronger for small hospitals (learning from safety events. Formal leadership support for safety is of particular importance in small organizations where the economic burden of safety programs is disproportionately large and formal leadership is closer to the front lines.

  4. COMPARISON OF FOUR METHODS TO DETECT ADVERSE EVENTS IN HOSPITAL

    Directory of Open Access Journals (Sweden)

    Inge Dhamanti

    2015-09-01

    Full Text Available AbstrakDeteksi terjadinya kejadian yang tidak diharapkan (KTD telah menjadi salah satu tantangan dalam keselamatan pasien oleh karena itu metode untuk mendeteksi terjadinya KTD sangatlah penting untuk meningkatkan keselamatan pasien. Tujuan dari artikel ini adalah untuk membandingkan kelebihan dan kekurangan dari beberapa metode untuk mendeteksi terjadinya KTD di rumah sakit, meliputi review rekam medis, pelaporan insiden secara mandiri, teknologi informasi, dan pelaporan oleh pasien. Studi ini merupakan kajian literatur untuk membandingkan dan menganalisa metode terbaik untuk mendeteksi KTD yang dapat diimplementasikan oleh rumah sakit. Semua dari empat metode telah terbukti mampu untuk mendeteksi terjadinya KTD di rumah sakit, tetapi masing-masing metode mempunyai kelebihan dan kekurangan yang perlu diatasi. Tidak ada satu metode terbaik yang akan memberikan hasil terbaik untuk mendeteksi KTD di rumah sakit. Sehingga untuk mendeteksi lebih banyak KTD yang seharusnya dapat dicegah, atau KTD yang telah terjadi, rumah sakit seharusnya mengkombinasikan lebih dari satu metode untuk mendeteksi, karena masing-masing metode mempunyai sensitivitas berbeda-beda.AbstractDetecting adverse events has become one of the challenges in patient safety thus methods to detect adverse events become critical for improving patient safety. The purpose of this paper is to compare the strengths and weaknesses of several methods of identifying adverse events in hospital, including medical records reviews, self-reported incidents, information technology, and patient self-reports. This study is a literature review to compared and analyzed to determine the best method implemented by the hospital. All of four methods have been proved in their ability in detecting adverse events in hospitals, but each method had strengths and limitations to be overcome. There is no ‘best’ single method that will give the best results for adverse events detection in hospital. Thus to

  5. Latency and mode of error detection as reflected in Swedish licensee event reports

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola; Salo, Ilkka [Stockholm Univ., (Sweden). Dept. of Psychology

    2002-03-01

    Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety.

  6. Latency and mode of error detection as reflected in Swedish licensee event reports

    International Nuclear Information System (INIS)

    Svenson, Ola; Salo, Ilkka

    2002-03-01

    Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety

  7. Automatic Detection and Classification of Audio Events for Road Surveillance Applications

    Directory of Open Access Journals (Sweden)

    Noor Almaadeed

    2018-06-01

    Full Text Available This work investigates the problem of detecting hazardous events on roads by designing an audio surveillance system that automatically detects perilous situations such as car crashes and tire skidding. In recent years, research has shown several visual surveillance systems that have been proposed for road monitoring to detect accidents with an aim to improve safety procedures in emergency cases. However, the visual information alone cannot detect certain events such as car crashes and tire skidding, especially under adverse and visually cluttered weather conditions such as snowfall, rain, and fog. Consequently, the incorporation of microphones and audio event detectors based on audio processing can significantly enhance the detection accuracy of such surveillance systems. This paper proposes to combine time-domain, frequency-domain, and joint time-frequency features extracted from a class of quadratic time-frequency distributions (QTFDs to detect events on roads through audio analysis and processing. Experiments were carried out using a publicly available dataset. The experimental results conform the effectiveness of the proposed approach for detecting hazardous events on roads as demonstrated by 7% improvement of accuracy rate when compared against methods that use individual temporal and spectral features.

  8. Safety related events at nuclear installations in 1995

    DEFF Research Database (Denmark)

    Korsbech, Uffe C C

    1996-01-01

    Nuclear safety related events of significance at least corresponding to level 2 of the International Nuclear Event Scale are described. In 1995 only two events occured at nuclear power plants, and four events occured at plants using ionizing radiation for processing or research.......Nuclear safety related events of significance at least corresponding to level 2 of the International Nuclear Event Scale are described. In 1995 only two events occured at nuclear power plants, and four events occured at plants using ionizing radiation for processing or research....

  9. Probabilistic safety assessment for seismic events

    International Nuclear Information System (INIS)

    1993-10-01

    This Technical Document on Probabilistic Safety Assessment for Seismic Events is mainly associated with the Safety Practice on Treatment of External Hazards in PSA and discusses in detail one specific external hazard, i.e. earthquakes

  10. Event Safety-A Culture of Responsibility

    Institute of Scientific and Technical Information of China (English)

    Christian Alexander Buschhoff

    2015-01-01

    In this paper, the author introduces the concept of events and the importance of safety. And what is emphasized is that guests must set up the safety awareness in the process of the implementation of the safety, to ensure that every guest can move in the area according to their will, and won't produce any risk.

  11. Preliminary safety analysis of unscrammed events for KLFR

    International Nuclear Information System (INIS)

    Kim, S.J.; Ha, G.S.

    2005-01-01

    The report presents the design features of KLFR; Safety Analysis Code; steady-state calculation results and analysis results of unscrammed events. The calculations of the steady-state and unscrammed events have been performed for the conceptual design of KLFR using SSC-K code. UTOP event results in no fuel damage and no centre-line melting. The inherent safety features are demonstrated through the analysis of ULOHS event. Although the analysis of ULOF has much uncertainties in the pump design, the analysis results show the inherent safety characteristics. 6% flow of rated flow of natural circulation is formed in the case of ULOF. In the metallic fuel rod, the cladding temperature is somewhat high due to the low heat transfer coefficient of lead. ULOHS event should be considered in design of RVACS for long-term cooling

  12. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  13. Targeting safety improvements through identification of incident origination and detection in a near-miss incident learning system

    International Nuclear Information System (INIS)

    Novak, Avrey; Nyflot, Matthew J.; Ermoian, Ralph P.; Jordan, Loucille E.; Sponseller, Patricia A.; Kane, Gabrielle M.; Ford, Eric C.; Zeng, Jing

    2016-01-01

    Purpose: Radiation treatment planning involves a complex workflow that has multiple potential points of vulnerability. This study utilizes an incident reporting system to identify the origination and detection points of near-miss errors, in order to guide their departmental safety improvement efforts. Previous studies have examined where errors arise, but not where they are detected or applied a near-miss risk index (NMRI) to gauge severity. Methods: From 3/2012 to 3/2014, 1897 incidents were analyzed from a departmental incident learning system. All incidents were prospectively reviewed weekly by a multidisciplinary team and assigned a NMRI score ranging from 0 to 4 reflecting potential harm to the patient (no potential harm to potential critical harm). Incidents were classified by point of incident origination and detection based on a 103-step workflow. The individual steps were divided among nine broad workflow categories (patient assessment, imaging for radiation therapy (RT) planning, treatment planning, pretreatment plan review, treatment delivery, on-treatment quality management, post-treatment completion, equipment/software quality management, and other). The average NMRI scores of incidents originating or detected within each broad workflow area were calculated. Additionally, out of 103 individual process steps, 35 were classified as safety barriers, the process steps whose primary function is to catch errors. The safety barriers which most frequently detected incidents were identified and analyzed. Finally, the distance between event origination and detection was explored by grouping events by the number of broad workflow area events passed through before detection, and average NMRI scores were compared. Results: Near-miss incidents most commonly originated within treatment planning (33%). However, the incidents with the highest average NMRI scores originated during imaging for RT planning (NMRI = 2.0, average NMRI of all events = 1.5), specifically

  14. Targeting safety improvements through identification of incident origination and detection in a near-miss incident learning system

    Energy Technology Data Exchange (ETDEWEB)

    Novak, Avrey; Nyflot, Matthew J.; Ermoian, Ralph P.; Jordan, Loucille E.; Sponseller, Patricia A.; Kane, Gabrielle M.; Ford, Eric C.; Zeng, Jing, E-mail: jzeng13@uw.edu [Department of Radiation Oncology, University of Washington Medical Center, 1959 NE Pacific Street, Campus Box 356043, Seattle, Washington 98195 (United States)

    2016-05-15

    Purpose: Radiation treatment planning involves a complex workflow that has multiple potential points of vulnerability. This study utilizes an incident reporting system to identify the origination and detection points of near-miss errors, in order to guide their departmental safety improvement efforts. Previous studies have examined where errors arise, but not where they are detected or applied a near-miss risk index (NMRI) to gauge severity. Methods: From 3/2012 to 3/2014, 1897 incidents were analyzed from a departmental incident learning system. All incidents were prospectively reviewed weekly by a multidisciplinary team and assigned a NMRI score ranging from 0 to 4 reflecting potential harm to the patient (no potential harm to potential critical harm). Incidents were classified by point of incident origination and detection based on a 103-step workflow. The individual steps were divided among nine broad workflow categories (patient assessment, imaging for radiation therapy (RT) planning, treatment planning, pretreatment plan review, treatment delivery, on-treatment quality management, post-treatment completion, equipment/software quality management, and other). The average NMRI scores of incidents originating or detected within each broad workflow area were calculated. Additionally, out of 103 individual process steps, 35 were classified as safety barriers, the process steps whose primary function is to catch errors. The safety barriers which most frequently detected incidents were identified and analyzed. Finally, the distance between event origination and detection was explored by grouping events by the number of broad workflow area events passed through before detection, and average NMRI scores were compared. Results: Near-miss incidents most commonly originated within treatment planning (33%). However, the incidents with the highest average NMRI scores originated during imaging for RT planning (NMRI = 2.0, average NMRI of all events = 1.5), specifically

  15. Operating experience feedback from safety significant events at research reactors

    Energy Technology Data Exchange (ETDEWEB)

    Shokr, A.M. [Atomic Energy Authority, Abouzabal (Egypt). Egypt Second Research Reactor; Rao, D. [Bhabha Atomic Research Centre, Mumbai (India)

    2015-05-15

    Operating experience feedback is an effective mechanism to provide lessons learned from the events and the associated corrective actions to prevent recurrence of events, resulting in improving safety in the nuclear installations. This paper analyzes the events of safety significance that have been occurred at research reactors and discusses the root causes and lessons learned from these events. Insights from literature on events at research reactors and feedback from events at nuclear power plants that are relevant to research reactors are also presented along with discussions. The results of the analysis showed the importance of communication of safety information and exchange of operating experience are vital to prevent reoccurrences of events. The analysis showed also the need for continued attention to human factors and training of operating personnel, and the need for establishing systematic ageing management programmes of reactor facilities, and programmes for safety management of handling of nuclear fuel, core components, and experimental devices.

  16. Operating experience feedback from safety significant events at research reactors

    International Nuclear Information System (INIS)

    Shokr, A.M.

    2015-01-01

    Operating experience feedback is an effective mechanism to provide lessons learned from the events and the associated corrective actions to prevent recurrence of events, resulting in improving safety in the nuclear installations. This paper analyzes the events of safety significance that have been occurred at research reactors and discusses the root causes and lessons learned from these events. Insights from literature on events at research reactors and feedback from events at nuclear power plants that are relevant to research reactors are also presented along with discussions. The results of the analysis showed the importance of communication of safety information and exchange of operating experience are vital to prevent reoccurrences of events. The analysis showed also the need for continued attention to human factors and training of operating personnel, and the need for establishing systematic ageing management programmes of reactor facilities, and programmes for safety management of handling of nuclear fuel, core components, and experimental devices.

  17. 76 FR 7131 - Safety Zones; Eleventh Coast Guard District Annual Fireworks Events

    Science.gov (United States)

    2011-02-09

    ...-AA00 Safety Zones; Eleventh Coast Guard District Annual Fireworks Events AGENCY: Coast Guard, DHS... permanent safety zones to ensure public safety during annual firework displays at various locations in the... events, delete events that are no longer occurring, add new unlisted annual fireworks events to the...

  18. Knowledge is power: averting safety-compromising events in the OR.

    Science.gov (United States)

    Catalano, Kathleen

    2008-12-01

    Surgical procedures can be unpredictable, and safety-compromising events can jeopardize patient safety. Perioperative nurses should be watchful for factors that can contribute to safety-compromising events, as well as the errors that can follow, and know how to avert them if possible. Knowledge is power and increased awareness of patient safety issues and the resources that are available to both health care practitioners and consumers can help perioperative nurses ward off patient safety problems before they occur.

  19. Integrating natural language processing expertise with patient safety event review committees to improve the analysis of medication events.

    Science.gov (United States)

    Fong, Allan; Harriott, Nicole; Walters, Donna M; Foley, Hanan; Morrissey, Richard; Ratwani, Raj R

    2017-08-01

    Many healthcare providers have implemented patient safety event reporting systems to better understand and improve patient safety. Reviewing and analyzing these reports is often time consuming and resource intensive because of both the quantity of reports and length of free-text descriptions in the reports. Natural language processing (NLP) experts collaborated with clinical experts on a patient safety committee to assist in the identification and analysis of medication related patient safety events. Different NLP algorithmic approaches were developed to identify four types of medication related patient safety events and the models were compared. Well performing NLP models were generated to categorize medication related events into pharmacy delivery delays, dispensing errors, Pyxis discrepancies, and prescriber errors with receiver operating characteristic areas under the curve of 0.96, 0.87, 0.96, and 0.81 respectively. We also found that modeling the brief without the resolution text generally improved model performance. These models were integrated into a dashboard visualization to support the patient safety committee review process. We demonstrate the capabilities of various NLP models and the use of two text inclusion strategies at categorizing medication related patient safety events. The NLP models and visualization could be used to improve the efficiency of patient safety event data review and analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. A simple strategy for fall events detection

    KAUST Repository

    Harrou, Fouzi

    2017-01-20

    The paper concerns the detection of fall events based on human silhouette shape variations. The detection of fall events is addressed from the statistical point of view as an anomaly detection problem. Specifically, the paper investigates the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart. The MEWMA fall detection scheme has been successfully applied to two publicly available fall detection databases, the UR fall detection dataset (URFD) and the fall detection dataset (FDD). The monitoring strategy developed was able to provide early alert mechanisms in the event of fall situations.

  1. Generalized Detectability for Discrete Event Systems

    Science.gov (United States)

    Shu, Shaolong; Lin, Feng

    2011-01-01

    In our previous work, we investigated detectability of discrete event systems, which is defined as the ability to determine the current and subsequent states of a system based on observation. For different applications, we defined four types of detectabilities: (weak) detectability, strong detectability, (weak) periodic detectability, and strong periodic detectability. In this paper, we extend our results in three aspects. (1) We extend detectability from deterministic systems to nondeterministic systems. Such a generalization is necessary because there are many systems that need to be modeled as nondeterministic discrete event systems. (2) We develop polynomial algorithms to check strong detectability. The previous algorithms are based on observer whose construction is of exponential complexity, while the new algorithms are based on a new automaton called detector. (3) We extend detectability to D-detectability. While detectability requires determining the exact state of a system, D-detectability relaxes this requirement by asking only to distinguish certain pairs of states. With these extensions, the theory on detectability of discrete event systems becomes more applicable in solving many practical problems. PMID:21691432

  2. 33 CFR 165.1191 - Safety zones: Northern California annual fireworks events.

    Science.gov (United States)

    2010-07-01

    ... annual fireworks events. 165.1191 Section 165.1191 Navigation and Navigable Waters COAST GUARD... § 165.1191 Safety zones: Northern California annual fireworks events. (a) General. Safety zones are.... Event Description Fireworks display. Date Last Saturday in May. Location 1,000 feet off Pier 30/32...

  3. Estimation of average hazardous-event-frequency for allocation of safety-integrity levels

    International Nuclear Information System (INIS)

    Misumi, Y.; Sato, Y.

    1999-01-01

    One of the fundamental concepts of the draft international standard, IEC 61508, is target failure measures to be allocated to Electric/Electronic/Programmable Electronic Safety-Related Systems, i.e. Safety Integrity Levels. The Safety Integrity Levels consist of four discrete probabilistic levels for specifying the safety integrity requirements or the safety functions to be allocated to Electric/Electronic/Programmable Electronic Safety-Related Systems. In order to select the Safety Integrity Levels the draft standard classifies Electric/Electronic/Programmable Electronic Safety-Related Systems into two modes of operation using demand frequencies only. It is not clear which modes of operation should be applied to Electric/Electronic/Programmable Electronic Safety-Related Systems taking into account the demand-state probability and the spurious demand frequency. It is essential for the allocation of Safety Integrity Levels that generic algorithms be derived by involving possible parameters, which make it possible to model the actuality of real systems. The present paper addresses this issue. First of all, the overall system including Electric/Electronic/programmable Electronic Safety-Related Systems is described using a simplified fault-tree. Then, the relationships among demands, demand-states and proof-tests are studied. Overall systems are classified into two groups: a non-demand-state-at-proof-test system which includes both repairable and non-repairable demand states and a constant-demand-frequency system. The new ideas such as a demand-state, spurious demand-state, mean time between detections, rates of d-failure and h-failure, and an h/d ratio are introduced in order to make the Safety Integrity Levels and modes of operation generic and comprehensive. Finally, the overall system is simplified and modeled by fault-trees using Priority-AND gates. At the same time the assumptions for modeling are described. Generic algorithms to estimate hazardous-event

  4. Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

    Science.gov (United States)

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2017-07-01

    One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. MedWatch, the FDA Safety Information and Adverse Event Reporting Program

    Science.gov (United States)

    ... Reporting Program MedWatch: The FDA Safety Information and Adverse Event Reporting Program Share Tweet Linkedin Pin it ... approved information that can help patients avoid serious adverse events. Potential Signals of Serious Risks/New Safety ...

  6. Multiple Kernel Learning for Heterogeneous Anomaly Detection: Algorithm and Aviation Safety Case Study

    Science.gov (United States)

    Das, Santanu; Srivastava, Ashok N.; Matthews, Bryan L.; Oza, Nikunj C.

    2010-01-01

    The world-wide aviation system is one of the most complex dynamical systems ever developed and is generating data at an extremely rapid rate. Most modern commercial aircraft record several hundred flight parameters including information from the guidance, navigation, and control systems, the avionics and propulsion systems, and the pilot inputs into the aircraft. These parameters may be continuous measurements or binary or categorical measurements recorded in one second intervals for the duration of the flight. Currently, most approaches to aviation safety are reactive, meaning that they are designed to react to an aviation safety incident or accident. In this paper, we discuss a novel approach based on the theory of multiple kernel learning to detect potential safety anomalies in very large data bases of discrete and continuous data from world-wide operations of commercial fleets. We pose a general anomaly detection problem which includes both discrete and continuous data streams, where we assume that the discrete streams have a causal influence on the continuous streams. We also assume that atypical sequence of events in the discrete streams can lead to off-nominal system performance. We discuss the application domain, novel algorithms, and also discuss results on real-world data sets. Our algorithm uncovers operationally significant events in high dimensional data streams in the aviation industry which are not detectable using state of the art methods

  7. Implementation of a patient safety program at a tertiary health system: A longitudinal analysis of interventions and serious safety events.

    Science.gov (United States)

    Cropper, Douglas P; Harb, Nidal H; Said, Patricia A; Lemke, Jon H; Shammas, Nicolas W

    2018-04-01

    We hypothesize that implementation of a safety program based on high reliability organization principles will reduce serious safety events (SSE). The safety program focused on 7 essential elements: (a) safety rounding, (b) safety oversight teams, (c) safety huddles, (d) safety coaches, (e) good catches/safety heroes, (f) safety education, and (g) red rule. An educational curriculum was implemented focusing on changing high-risk behaviors and implementing critical safety policies. All unusual occurrences were captured in the Midas system and investigated by risk specialists, the safety officer, and the chief medical officer. A multidepartmental committee evaluated these events, and a root cause analysis (RCA) was performed. Events were tabulated and serious safety event (SSE) recorded and plotted over time. Safety success stories (SSSs) were also evaluated over time. A steady drop in SSEs was seen over 9 years. Also a rise in SSSs was evident, reflecting on staff engagement in the program. The parallel change in SSEs, SSSs, and the implementation of various safety interventions highly suggest that the program was successful in achieving its goals. A safety program based on high-reliability organization principles and made a core value of the institution can have a significant positive impact on reducing SSEs. © 2018 American Society for Healthcare Risk Management of the American Hospital Association.

  8. Joint Attributes and Event Analysis for Multimedia Event Detection.

    Science.gov (United States)

    Ma, Zhigang; Chang, Xiaojun; Xu, Zhongwen; Sebe, Nicu; Hauptmann, Alexander G

    2017-06-15

    Semantic attributes have been increasingly used the past few years for multimedia event detection (MED) with promising results. The motivation is that multimedia events generally consist of lower level components such as objects, scenes, and actions. By characterizing multimedia event videos with semantic attributes, one could exploit more informative cues for improved detection results. Much existing work obtains semantic attributes from images, which may be suboptimal for video analysis since these image-inferred attributes do not carry dynamic information that is essential for videos. To address this issue, we propose to learn semantic attributes from external videos using their semantic labels. We name them video attributes in this paper. In contrast with multimedia event videos, these external videos depict lower level contents such as objects, scenes, and actions. To harness video attributes, we propose an algorithm established on a correlation vector that correlates them to a target event. Consequently, we could incorporate video attributes latently as extra information into the event detector learnt from multimedia event videos in a joint framework. To validate our method, we perform experiments on the real-world large-scale TRECVID MED 2013 and 2014 data sets and compare our method with several state-of-the-art algorithms. The experiments show that our method is advantageous for MED.

  9. The effects of power, leadership and psychological safety on resident event reporting.

    Science.gov (United States)

    Appelbaum, Nital P; Dow, Alan; Mazmanian, Paul E; Jundt, Dustin K; Appelbaum, Eric N

    2016-03-01

    Although the reporting of adverse events is a necessary first step in identifying and addressing lapses in patient safety, such events are under-reported, especially by frontline providers such as resident physicians. This study describes and tests relationships between power distance and leader inclusiveness on psychological safety and the willingness of residents to report adverse events. A total of 106 resident physicians from the departments of neurosurgery, orthopaedic surgery, emergency medicine, otolaryngology, neurology, obstetrics and gynaecology, paediatrics and general surgery in a mid-Atlantic teaching hospital were asked to complete a survey on psychological safety, perceived power distance, leader inclusiveness and intention to report adverse events. Perceived power distance (β = -0.26, standard error [SE] 0.06, 95% confidence interval [CI] -0.37 to 0.15; p leadership practices build psychological safety and minimise power distance between low- and high-status members in order to support greater reporting of adverse events. © 2016 John Wiley & Sons Ltd.

  10. Recognising safety critical events: can automatic video processing improve naturalistic data analyses?

    Science.gov (United States)

    Dozza, Marco; González, Nieves Pañeda

    2013-11-01

    New trends in research on traffic accidents include Naturalistic Driving Studies (NDS). NDS are based on large scale data collection of driver, vehicle, and environment information in real world. NDS data sets have proven to be extremely valuable for the analysis of safety critical events such as crashes and near crashes. However, finding safety critical events in NDS data is often difficult and time consuming. Safety critical events are currently identified using kinematic triggers, for instance searching for deceleration below a certain threshold signifying harsh braking. Due to the low sensitivity and specificity of this filtering procedure, manual review of video data is currently necessary to decide whether the events identified by the triggers are actually safety critical. Such reviewing procedure is based on subjective decisions, is expensive and time consuming, and often tedious for the analysts. Furthermore, since NDS data is exponentially growing over time, this reviewing procedure may not be viable anymore in the very near future. This study tested the hypothesis that automatic processing of driver video information could increase the correct classification of safety critical events from kinematic triggers in naturalistic driving data. Review of about 400 video sequences recorded from the events, collected by 100 Volvo cars in the euroFOT project, suggested that drivers' individual reaction may be the key to recognize safety critical events. In fact, whether an event is safety critical or not often depends on the individual driver. A few algorithms, able to automatically classify driver reaction from video data, have been compared. The results presented in this paper show that the state of the art subjective review procedures to identify safety critical events from NDS can benefit from automated objective video processing. In addition, this paper discusses the major challenges in making such video analysis viable for future NDS and new potential

  11. Decision support methods for the detection of adverse events in post-marketing data.

    Science.gov (United States)

    Hauben, M; Bate, A

    2009-04-01

    Spontaneous reporting is a crucial component of post-marketing drug safety surveillance despite its significant limitations. The size and complexity of some spontaneous reporting system databases represent a challenge for drug safety professionals who traditionally have relied heavily on the scientific and clinical acumen of the prepared mind. Computer algorithms that calculate statistical measures of reporting frequency for huge numbers of drug-event combinations are increasingly used to support pharamcovigilance analysts screening large spontaneous reporting system databases. After an overview of pharmacovigilance and spontaneous reporting systems, we discuss the theory and application of contemporary computer algorithms in regular use, those under development, and the practical considerations involved in the implementation of computer algorithms within a comprehensive and holistic drug safety signal detection program.

  12. Phenotyping for patient safety: algorithm development for electronic health record based automated adverse event and medical error detection in neonatal intensive care.

    Science.gov (United States)

    Li, Qi; Melton, Kristin; Lingren, Todd; Kirkendall, Eric S; Hall, Eric; Zhai, Haijun; Ni, Yizhao; Kaiser, Megan; Stoutenborough, Laura; Solti, Imre

    2014-01-01

    Although electronic health records (EHRs) have the potential to provide a foundation for quality and safety algorithms, few studies have measured their impact on automated adverse event (AE) and medical error (ME) detection within the neonatal intensive care unit (NICU) environment. This paper presents two phenotyping AE and ME detection algorithms (ie, IV infiltrations, narcotic medication oversedation and dosing errors) and describes manual annotation of airway management and medication/fluid AEs from NICU EHRs. From 753 NICU patient EHRs from 2011, we developed two automatic AE/ME detection algorithms, and manually annotated 11 classes of AEs in 3263 clinical notes. Performance of the automatic AE/ME detection algorithms was compared to trigger tool and voluntary incident reporting results. AEs in clinical notes were double annotated and consensus achieved under neonatologist supervision. Sensitivity, positive predictive value (PPV), and specificity are reported. Twelve severe IV infiltrates were detected. The algorithm identified one more infiltrate than the trigger tool and eight more than incident reporting. One narcotic oversedation was detected demonstrating 100% agreement with the trigger tool. Additionally, 17 narcotic medication MEs were detected, an increase of 16 cases over voluntary incident reporting. Automated AE/ME detection algorithms provide higher sensitivity and PPV than currently used trigger tools or voluntary incident-reporting systems, including identification of potential dosing and frequency errors that current methods are unequipped to detect. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Cartan invariants and event horizon detection

    Science.gov (United States)

    Brooks, D.; Chavy-Waddy, P. C.; Coley, A. A.; Forget, A.; Gregoris, D.; MacCallum, M. A. H.; McNutt, D. D.

    2018-04-01

    We show that it is possible to locate the event horizon of a black hole (in arbitrary dimensions) by the zeros of certain Cartan invariants. This approach accounts for the recent results on the detection of stationary horizons using scalar polynomial curvature invariants, and improves upon them since the proposed method is computationally less expensive. As an application, we produce Cartan invariants that locate the event horizons for various exact four-dimensional and five-dimensional stationary, asymptotically flat (or (anti) de Sitter), black hole solutions and compare the Cartan invariants with the corresponding scalar curvature invariants that detect the event horizon.

  14. Using Active Learning to Identify Health Information Technology Related Patient Safety Events.

    Science.gov (United States)

    Fong, Allan; Howe, Jessica L; Adams, Katharine T; Ratwani, Raj M

    2017-01-18

    The widespread adoption of health information technology (HIT) has led to new patient safety hazards that are often difficult to identify. Patient safety event reports, which are self-reported descriptions of safety hazards, provide one view of potential HIT-related safety events. However, identifying HIT-related reports can be challenging as they are often categorized under other more predominate clinical categories. This challenge of identifying HIT-related reports is exacerbated by the increasing number and complexity of reports which pose challenges to human annotators that must manually review reports. In this paper, we apply active learning techniques to support classification of patient safety event reports as HIT-related. We evaluated different strategies and demonstrated a 30% increase in average precision of a confirmatory sampling strategy over a baseline no active learning approach after 10 learning iterations.

  15. Event Coverage Detection and Event Source Determination in Underwater Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Zhangbing Zhou

    2015-12-01

    Full Text Available With the advent of the Internet of Underwater Things, smart things are deployed in the ocean space and establish underwater wireless sensor networks for the monitoring of vast and dynamic underwater environments. When events are found to have possibly occurred, accurate event coverage should be detected, and potential event sources should be determined for the enactment of prompt and proper responses. To address this challenge, a technique that detects event coverage and determines event sources is developed in this article. Specifically, the occurrence of possible events corresponds to a set of neighboring sensor nodes whose sensory data may deviate from a normal sensing range in a collective fashion. An appropriate sensor node is selected as the relay node for gathering and routing sensory data to sink node(s. When sensory data are collected at sink node(s, the event coverage is detected and represented as a weighted graph, where the vertices in this graph correspond to sensor nodes and the weight specified upon the edges reflects the extent of sensory data deviating from a normal sensing range. Event sources are determined, which correspond to the barycenters in this graph. The results of the experiments show that our technique is more energy efficient, especially when the network topology is relatively steady.

  16. Probabilistic safety analysis for fire events for the NPP Isar 2

    International Nuclear Information System (INIS)

    Schmaltz, H.; Hristodulidis, A.

    2007-01-01

    The 'Probabilistic Safety Analysis for Fire Events' (Fire-PSA KKI2) for the NPP Isar 2 was performed in addition to the PSA for full power operation and considers all possible events which can be initiated due to a fire. The aim of the plant specific Fire-PSA was to perform a quantitative assessment of fire events during full power operation, which is state of the art. Based on simplistic assumptions referring to the fire induced failures, the influence of system- and component-failures on the frequency of the core damage states was analysed. The Fire-PSA considers events, which will result due to fire-induced failures of equipment on the one hand in a SCRAM and on the other hand in events, which will not have direct operational effects but because of the fire-induced failure of safety related installations the plant will be shut down as a precautionary measure. These events are considered because they may have a not negligible influence on the frequency of core damage states in case of failures during the plant shut down because of the reduced redundancy of safety related systems. (orig.)

  17. Subsurface event detection and classification using Wireless Signal Networks.

    Science.gov (United States)

    Yoon, Suk-Un; Ghazanfari, Ehsan; Cheng, Liang; Pamukcu, Sibel; Suleiman, Muhannad T

    2012-11-05

    Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs). The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.

  18. Reports about Occurrence of Events with Effect on Aviation Safety

    Directory of Open Access Journals (Sweden)

    Vladimír Plos

    2014-07-01

    Full Text Available This article deals with a system, that is established to report the events with effect on safety. This system is based on requirements published in Annex 13 to the Chicago Convention and legislative foundations laid down in Regulation L13, Regulation of the European Parliament and of the Council (EU No 376/2014, Decree No. 359/2006 Sb. and Act No. 49/1997 Sb. Standards and legislative rules precisely define the types of events that are subject of reporting and also define the structure and content of the reporting message. This content is consists mainly of the identification data about the airplane and crew, information about the route and a short description of the damage to the airplane. In the following, we discuss the possible use of such a system of mandatory reporting for the needs of safety indicators. Then there are proposals of changes in the content of the reporting message for the need of safety indicators. The present knowledge indicates that the use of all opportunities provided by the law for the reporting of events can lead to a creating of sufficient basis for safety indicators.

  19. Detection of anomalous events

    Science.gov (United States)

    Ferragut, Erik M.; Laska, Jason A.; Bridges, Robert A.

    2016-06-07

    A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The system can include a plurality of anomaly detectors that together implement an algorithm to identify low-probability events and detect atypical traffic patterns. The anomaly detector provides for comparability of disparate sources of data (e.g., network flow data and firewall logs.) Additionally, the anomaly detector allows for regulatability, meaning that the algorithm can be user configurable to adjust a number of false alerts. The anomaly detector can be used for a variety of probability density functions, including normal Gaussian distributions, irregular distributions, as well as functions associated with continuous or discrete variables.

  20. Subsurface Event Detection and Classification Using Wireless Signal Networks

    Directory of Open Access Journals (Sweden)

    Muhannad T. Suleiman

    2012-11-01

    Full Text Available Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs. The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.

  1. Work stress and patient safety: observer-rated work stressors as predictors of characteristics of safety-related events reported by young nurses.

    Science.gov (United States)

    Elfering, A; Semmer, N K; Grebner, S

    This study investigates the link between workplace stress and the 'non-singularity' of patient safety-related incidents in the hospital setting. Over a period of 2 working weeks 23 young nurses from 19 hospitals in Switzerland documented 314 daily stressful events using a self-observation method (pocket diaries); 62 events were related to patient safety. Familiarity of safety-related events and probability of recurrence, as indicators of non-singularity, were the dependent variables in multilevel regression analyses. Predictor variables were both situational (self-reported situational control, safety compliance) and chronic variables (job stressors such as time pressure, or concentration demands and job control). Chronic work characteristics were rated by trained observers. The most frequent safety-related stressful events included incomplete or incorrect documentation (40.3%), medication errors (near misses 21%), delays in delivery of patient care (9.7%), and violent patients (9.7%). Familiarity of events and probability of recurrence were significantly predicted by chronic job stressors and low job control in multilevel regression analyses. Job stressors and low job control were shown to be risk factors for patient safety. The results suggest that job redesign to enhance job control and decrease job stressors may be an important intervention to increase patient safety.

  2. Evaluating the impact of child safety seat check-up events on parental knowledge.

    Science.gov (United States)

    Herring, Ashley B; Jones, Ches; Nunez, Casandra

    2002-12-01

    Riding unrestrained is the greatest risk factor for death and injury among children in motor vehicles. Restraining a child can reduce the risk of death for that child by up to 71%. However, despite increased awareness, child safety seat usage rates are still disturbingly low. The purpose of this study was to evaluate the impact that child safety seat check-up events have on parental knowledge on child safety seats and installation. The subjects for this study were 101 parents/caregivers who attended child safety seat check-up events in northwest Arkansas from May 2000 through June 2001. A 20-item survey was conducted via the telephone. Results showed that the check-up events in northwest Arkansas have had an impact on self-efficacy. The participants of the events were primarily Caucasian and females in the 30-34 age group. Nine of 10 subjects scored in the high knowledge category. Conclusions are that check-up events do have an impact on parental knowledge and are accepted by the target group. Additionally, participants believed that car seats are of great importance and do protect their children in the event of a crash.

  3. Analysis on typical illegal events for nuclear safety class 1 valve

    International Nuclear Information System (INIS)

    Tian Dongqing; Gao Runsheng; Jiao Dianhui; Yang Lili; Chen Peng

    2014-01-01

    Illegal welding events of nuclear safety class l valve forging occurred to the manufacturer, while the valve was returned to be repaired. Illegal nondestructive test event of nuclear safety class valve occurred also to the manufacturer in the manufacturing process. The two events have resulted in quality incipient fault for the installed valves and the valves in the manufacturing process. It was reflected that operation of the factory quality assurance system isn't activated, and nuclear power engineering and operating company have insufficient supervision. The event-related parties should strengthen quality management and process control, get rid of the quality incipient fault, and experience feedback should be done well to guarantee quality of equipment in nuclear power plant. (authors)

  4. Corrective actions to gas accumulation in safety injection system pipings of PWRs and gas void detection method

    International Nuclear Information System (INIS)

    Maki, Nobuo

    2000-01-01

    In the US, gas accumulation events of safety injection systems of PWRs during plant operation are continuously reported. As the events may result in loss of safety function, the USNRC is alerting licensees by Information Notices. The cause of the events is coolant leakage to interfacing systems with lower pressure, or gas dissolution of primary coolant by partial pressure drop. In this study, it was clarified by the evaluation of the cause of the events of US plants, gas accumulation in piping between an accumulator and Residual Heat Removal System should be quantitatively investigated regarding Japanese plants. Also, effectiveness of ultrasonic testing which is used for monthly gas accumulation surveillance in US plants was demonstrated using a model loop. In addition, the method was confirmed applicable by an experiment carried out at INSS to detect cavitation voids in piping systems. (author)

  5. Event storm detection and identification in communication systems

    International Nuclear Information System (INIS)

    Albaghdadi, Mouayad; Briley, Bruce; Evens, Martha

    2006-01-01

    Event storms are the manifestation of an important class of abnormal behaviors in communication systems. They occur when a large number of nodes throughout the system generate a set of events within a small period of time. It is essential for network management systems to detect every event storm and identify its cause, in order to prevent and repair potential system faults. This paper presents a set of techniques for the effective detection and identification of event storms in communication systems. First, we introduce a new algorithm to synchronize events to a single node in the system. Second, the system's event log is modeled as a normally distributed random process. This is achieved by using data analysis techniques to explore and then model the statistical behavior of the event log. Third, event storm detection is proposed using a simple test statistic combined with an exponential smoothing technique to overcome the non-stationary behavior of event logs. Fourth, the system is divided into non-overlapping regions to locate the main contributing regions of a storm. We show that this technique provides us with a method for event storm identification. Finally, experimental results from a commercially deployed multimedia communication system that uses these techniques demonstrate their effectiveness

  6. "Against the silence": Development and first results of a patient survey to assess experiences of safety-related events in hospital

    Directory of Open Access Journals (Sweden)

    Schwappach David LB

    2008-03-01

    Full Text Available Abstract Background Involvement of patients in the detection and prevention of safety related events and medical errors have been widely recommended. However, it has also been questioned whether patients at large are willing and able to identify safety-related events in their care. The aim of this study was to develop and pilot test a brief patient safety survey applicable to inpatient care in Swiss hospitals. Methods A survey instrument was developed in an iterative procedure. The instrument asks patients to report whether they have experienced specific undesirable events during their hospital stay. The preliminary version was developed together with experts and tested in focus groups with patients. The adapted survey instrument was pilot-tested in random samples of patients of two Swiss hospitals (n = 400. Responders to the survey that had reported experience of any incident were sampled for qualitative interviews (n = 18. Based on the interview, the researcher classified the reported incidents as confirmed or discarded. Results The survey was generally well accepted in the focus groups and interviews. In the quantitative pilot test, 125 patients returned the survey (response rate: 31%. The mean age of responders was 55 years (range 17–91, SD 18 years and 62.5% were female. The 125 participating patients reported 94 "definitive" and 34 "uncertain" events. 14% of the patients rated any of the experienced events as "serious". The definitive and uncertain events reported with highest frequency were phlebitis, missing hand hygiene, allergic drug reaction, unavailability of documents, and infection. 23% of patients reported some or serious concerns about their safety. The qualitative interviews indicate that both, the extent of patients' uncertainty in the classification of events and the likelihood of confirmation by the interviewer vary very much by type of incident. Unexpectedly, many patients reported problems and incidents related to food

  7. Metrics for Polyphonic Sound Event Detection

    Directory of Open Access Journals (Sweden)

    Annamaria Mesaros

    2016-05-01

    Full Text Available This paper presents and discusses various metrics proposed for evaluation of polyphonic sound event detection systems used in realistic situations where there are typically multiple sound sources active simultaneously. The system output in this case contains overlapping events, marked as multiple sounds detected as being active at the same time. The polyphonic system output requires a suitable procedure for evaluation against a reference. Metrics from neighboring fields such as speech recognition and speaker diarization can be used, but they need to be partially redefined to deal with the overlapping events. We present a review of the most common metrics in the field and the way they are adapted and interpreted in the polyphonic case. We discuss segment-based and event-based definitions of each metric and explain the consequences of instance-based and class-based averaging using a case study. In parallel, we provide a toolbox containing implementations of presented metrics.

  8. Facilitating adverse drug event detection in pharmacovigilance databases using molecular structure similarity: application to rhabdomyolysis

    Science.gov (United States)

    Vilar, Santiago; Harpaz, Rave; Chase, Herbert S; Costanzi, Stefano; Rabadan, Raul

    2011-01-01

    Background Adverse drug events (ADE) cause considerable harm to patients, and consequently their detection is critical for patient safety. The US Food and Drug Administration maintains an adverse event reporting system (AERS) to facilitate the detection of ADE in drugs. Various data mining approaches have been developed that use AERS to detect signals identifying associations between drugs and ADE. The signals must then be monitored further by domain experts, which is a time-consuming task. Objective To develop a new methodology that combines existing data mining algorithms with chemical information by analysis of molecular fingerprints to enhance initial ADE signals generated from AERS, and to provide a decision support mechanism to facilitate the identification of novel adverse events. Results The method achieved a significant improvement in precision in identifying known ADE, and a more than twofold signal enhancement when applied to the ADE rhabdomyolysis. The simplicity of the method assists in highlighting the etiology of the ADE by identifying structurally similar drugs. A set of drugs with strong evidence from both AERS and molecular fingerprint-based modeling is constructed for further analysis. Conclusion The results demonstrate that the proposed methodology could be used as a pharmacovigilance decision support tool to facilitate ADE detection. PMID:21946238

  9. Assessment of the nuclear installation's safety significant events

    International Nuclear Information System (INIS)

    Vidican, D.

    2005-01-01

    This document tries to establish, based on the available documentation, the main steps in development of Assessment of the Events in Nuclear Installations. It takes into account: selection of the safety significant occurrences, establishing the direct cause and contributors as well as the root cause and contributors. Also, the document presents the necessary corrective actions and generic lessons to be learned from the event. The document is based especially on IAEA - ASSET guidelines and DOE root cause analysis Guidance. (author)

  10. : Principles of safety measures of sports events organizers without the involvement of police

    OpenAIRE

    Buchalová, Kateřina

    2013-01-01

    Title: Principles of safety measures of sports events organizers without the involvement of police Objectives: The aim of this thesis is a description of security measures at sporting events organizers. Methods: The thesis theoretical style is focused on searching for available sources of study and research, and writing their summary comparing safety measures of the organizers. Results: This work describes the activities of the organizers of sports events and precautions that must be provided...

  11. External Events Excluding Earthquakes in the Design of Nuclear Power Plants. Safety Guide

    International Nuclear Information System (INIS)

    2008-01-01

    This Safety Guide provides recommendations and guidance on design for the protection of nuclear power plants from the effects of external events (excluding earthquakes), i.e. events that originate either off the site or within the boundaries of the site but from sources that are not directly involved in the operational states of the nuclear power plant units. In addition, it provides recommendations on engineering related matters in order to comply with the safety objectives and requirements established in the IAEA Safety Requirements publication, Safety of Nuclear Power Plants: Design. It is also applicable to the design and safety assessment of items important to the safety of land based stationary nuclear power plants with water cooled reactors. Contents: 1. Introduction; 2. Application of safety criteria to the design; 3. Design basis for external events; 4. Aircraft crash; 5. External fire; 6. Explosions; 7. Asphyxiant and toxic gases; 8. Corrosive and radioactive gases and liquids; 9. Electromagnetic interference; 10. Floods; 11. Extreme winds; 12. Extreme meteorological conditions; 13. Biological phenomena; 14. Volcanism; 15. Collisions of floating bodies with water intakes and UHS components; Annex I: Aircraft crashes; Annex II: Detonation and deflagration; Annex III: Toxicity limits.

  12. Detection of goal events in soccer videos

    Science.gov (United States)

    Kim, Hyoung-Gook; Roeber, Steffen; Samour, Amjad; Sikora, Thomas

    2005-01-01

    In this paper, we present an automatic extraction of goal events in soccer videos by using audio track features alone without relying on expensive-to-compute video track features. The extracted goal events can be used for high-level indexing and selective browsing of soccer videos. The detection of soccer video highlights using audio contents comprises three steps: 1) extraction of audio features from a video sequence, 2) event candidate detection of highlight events based on the information provided by the feature extraction Methods and the Hidden Markov Model (HMM), 3) goal event selection to finally determine the video intervals to be included in the summary. For this purpose we compared the performance of the well known Mel-scale Frequency Cepstral Coefficients (MFCC) feature extraction method vs. MPEG-7 Audio Spectrum Projection feature (ASP) extraction method based on three different decomposition methods namely Principal Component Analysis( PCA), Independent Component Analysis (ICA) and Non-Negative Matrix Factorization (NMF). To evaluate our system we collected five soccer game videos from various sources. In total we have seven hours of soccer games consisting of eight gigabytes of data. One of five soccer games is used as the training data (e.g., announcers' excited speech, audience ambient speech noise, audience clapping, environmental sounds). Our goal event detection results are encouraging.

  13. Abnormal Event Detection in Wireless Sensor Networks Based on Multiattribute Correlation

    Directory of Open Access Journals (Sweden)

    Mengdi Wang

    2017-01-01

    Full Text Available Abnormal event detection is one of the vital tasks in wireless sensor networks. However, the faults of nodes and the poor deployment environment have brought great challenges to abnormal event detection. In a typical event detection technique, spatiotemporal correlations are collected to detect an event, which is susceptible to noises and errors. To improve the quality of detection results, we propose a novel approach for abnormal event detection in wireless sensor networks. This approach considers not only spatiotemporal correlations but also the correlations among observed attributes. A dependency model of observed attributes is constructed based on Bayesian network. In this model, the dependency structure of observed attributes is obtained by structure learning, and the conditional probability table of each node is calculated by parameter learning. We propose a new concept named attribute correlation confidence to evaluate the fitting degree between the sensor reading and the abnormal event pattern. On the basis of time correlation detection and space correlation detection, the abnormal events are identified. Experimental results show that the proposed algorithm can reduce the impact of interference factors and the rate of the false alarm effectively; it can also improve the accuracy of event detection.

  14. Initiating events in the safety probabilistic analysis of nuclear power plants

    International Nuclear Information System (INIS)

    Stasiulevicius, R.

    1989-01-01

    The importance of the initiating event in the probabilistic safety analysis of nuclear power plants are discussed and the basic procedures necessary for preparing reports, quantification and grouping of the events are described. The examples of initiating events with its occurence medium frequency, included those calculated for OCONEE reactor and Angra-1 reactor are presented. (E.G.)

  15. Development of Safety Significance Evaluation Program for Accidents and Events in NPPs

    International Nuclear Information System (INIS)

    Yang, Hui Chang; Hong, Seok Jin; Cho, Nam Chul; Chung, Dae Wook; Lee, Chang Joo

    2010-01-01

    To evaluate the significance in terms of safety for the accidents and events occurred in nuclear power plants using probabilistic safety assessment techniques can provide useful insights to the regulator. Based on the quantified risk information of accident or event occurred, regulators can decide which regulatory areas should be focused than the others. To support these regulatory analysis activities, KINS-ASP program was developed. KINS-ASP program can supports the risk increase due to the occurred accidents or events by providing the graphic interfaces and linked quantification engines for the PSA experts and non- PSA acquainted regulators both

  16. Learning Multimodal Deep Representations for Crowd Anomaly Event Detection

    Directory of Open Access Journals (Sweden)

    Shaonian Huang

    2018-01-01

    Full Text Available Anomaly event detection in crowd scenes is extremely important; however, the majority of existing studies merely use hand-crafted features to detect anomalies. In this study, a novel unsupervised deep learning framework is proposed to detect anomaly events in crowded scenes. Specifically, low-level visual features, energy features, and motion map features are simultaneously extracted based on spatiotemporal energy measurements. Three convolutional restricted Boltzmann machines are trained to model the mid-level feature representation of normal patterns. Then a multimodal fusion scheme is utilized to learn the deep representation of crowd patterns. Based on the learned deep representation, a one-class support vector machine model is used to detect anomaly events. The proposed method is evaluated using two available public datasets and compared with state-of-the-art methods. The experimental results show its competitive performance for anomaly event detection in video surveillance.

  17. Meteorological events in site evaluation for nuclear power plants. Safety guide

    International Nuclear Information System (INIS)

    2005-01-01

    This Safety Guide provides recommendations and guidance on conducting hazard assessments of extreme and rare meteorological phenomena. It is of interest to safety assessors and regulators involved in the licensing process as well as to designers of nuclear power plants. This Safety Guide was prepared under the IAEA programme for safety standards for nuclear power plants. It supplements the IAEA Safety Requirements publication on Site Evaluation for Nuclear Facilities which is to supersede the Code on the Safety of Nuclear Power Plants: Siting, Safety Series No. 50-C-S (Rev. 1), IAEA, Vienna (1988). The present Safety Guide supersedes two earlier Safety Guides: Safety Series No. 50-SG-S11A (1981) on Extreme Meteorological Events in Nuclear Power Plant Siting, Excluding Tropical Cyclones and Safety Series No. 50-SG-S11B (1984) on Design Basis Tropical Cyclone for Nuclear Power Plants. The purpose of this Safety Guide is to provide recommendations and guidance on conducting hazard assessments of extreme and rare meteorological phenomena. This Safety Guide provides interpretation of the Safety Requirements publication on Site Evaluation for Nuclear Facilities and guidance on how to fulfil these requirements. It is aimed at safety assessors or regulators involved in the licensing process as well as designers of nuclear power plants, and provides them with guidance on the methods and procedures for analyses that support the assessment of the hazards associated with extreme and rare meteorological events. This Safety Guide discusses the extreme values of meteorological variables and rare meteorological phenomena, as well as their rates of occurrence, according to the following definitions: (a) Extreme values of meteorological variables such as air temperature and wind speed characterize the meteorological or climatological environment. And (b) Rare meteorological phenomena

  18. Extreme meteorological events and nuclear facilities safety

    International Nuclear Information System (INIS)

    Almeida, Patricia Moco Princisval

    2006-01-01

    An External Event is an event that originates outside the site and whose effects on the Nuclear Power Plants (NPP) should be considered. Such events could be of natural or human induced origin and should be identified and selected for design purposes during the site evaluation process. This work shows that the subtropics and mid latitudes of South America east of the Andes Mountain Range have been recognized as prone to severe convective weather. In Brazil, the events of tornadoes are becoming frequent; however there is no institutionalized procedure for a systematic documentation of severe weather. The information is done only for some scientists and by the newspapers. Like strong wind can affect the structural integrity of buildings or the pressure differential can affect the ventilation system, our concern is the safety of NPP and for this purpose the recommendations of International Atomic Energy Agency, Nuclear Regulatory Commission and Comissao Nacional de Energia Nuclear are showed and also a data base of tornadoes in Brazil is done. (author)

  19. A study on method to identify actual causes and conditions of safety rule deviations through analyzing events due to unsafe acts of workers

    International Nuclear Information System (INIS)

    Hirotsu, Yuko; Takeda, Daisuke

    2010-01-01

    The purpose of this study is to establish a method to understand actual causes and condition of intentional deviation from safety rules (including norm and written rules that has developed to anticipate, prevent, detect and recover human errors) in an organization by analyzing events due to unsafe acts of workers (human factor events) and to propose effective measures. Firstly, by reviewing literature regarding safety violations, the following two advantages of investigating actual condition of safety rule deviation through human factor event analysis were extracted, such as (a) being able to clarify relationships between deviations, human errors, and events, and (b) being able to identify specific causal factors that influenced the decision to deviate, including acts of people concerned, problems with rules, task demands, environment and management. Next, through the analysis of human factor event data in accordance with existing human error analysis method on the basis of advantages above, the following three requirements for analyzing event data were extracted, such as (a) gathering information such as rules concerning to the work activities related to the human factor events, and whether there are intentional deviations of the rules, (b) gathering information and identify interrelations among causal factors of the intentional deviations, and (c) gathering information on general condition of deviations and the causal factors. (author)

  20. Analysis of adverse events as a contribution to safety culture in the context of practice development

    Science.gov (United States)

    Hoffmann, Susanne; Frei, Irena Anna

    2017-01-01

    Background: Analysing adverse events is an effective patient safety measure. Aim: We show, how clinical nurse specialists have been enabled to analyse adverse events with the „Learning from Defects-Tool“ (LFD-Tool). Method: Our multi-component implementation strategy addressed both, the safety knowledge of clinical nurse specialists and their attitude towards patient safety. The culture of practice development was taken into account. Results: Clinical nurse specialists relate competency building on patient safety due to the application of the LFD-tool. Applying the tool, fosters the reflection of adverse events in care teams. Conclusion: Applying the „Learning from Defects-Tool“ promotes work-based learning. Analysing adverse events with the „Learning from Defects-Tool“ contributes to the safety culture in a hospital.

  1. Research and development of a high-temperature helium-leak detection system (joint research). Part 1 survey on leakage events and current leak detection technology

    Energy Technology Data Exchange (ETDEWEB)

    Sakaba, Nariaki; Nakazawa, Toshio; Kawasaki, Kozo [Japan Atomic Energy Research Inst., Oarai, Ibaraki (Japan). Oarai Research Establishment; Urakami, Masao; Saisyu, Sadanori [Japan Atomic Power Co., Tokyo (Japan)

    2003-03-01

    In High Temperature Gas-cooled Reactors (HTGR), the detection of leakage of helium at an early stage is very important for the safety and stability of operations. Since helium is a colourless gas, it is generally difficult to identify the location and the amount of leakage when very little leakage has occurred. The purpose of this R and D is to develop a helium leak detection system for the high temperature environment appropriate to the HTGR. As the first step in the development, this paper describes the result of surveying leakage events at nuclear facilities inside and outside Japan and current gas leakage detection technology to adapt optical-fibre detection technology to HTGRs. (author)

  2. RA-6 reactor's probabilistic safety evaluation. Identification and selection of starting events

    International Nuclear Information System (INIS)

    Kay, J.; Chiossi, C.; Felizia, E.; Vallerga, H.; Kalejman, G.; Navarro, R.; Caruso, G.J.

    1987-01-01

    A summary of the 'Identification and selection of starting events' stage of the previous probabilistic safety evaluation of RA-6 reactor is presented. This evaluation was performed to verify if the safety criteria required for the licensing of RA-6 are met and to promote the diffusion of its meaning and usefulness with educational purposes. At this stage the starting events of RA-6 are determined and the probability that such events occur is calculated. The identification and selection of starting events is performed in two steps: determination of proposed starting events and determination of postulated starting events. The proposed starting events are determined by means of the master logic diagram (MLD) method, while the postulated starting events are obtained by grouping the proposed starting events. The simplifying hypothesis required for the application of MLD to the reactor are also formulated. The probability that the proposed and postulated starting events occur is afterwards calculated, adopting different fault models, in accordance with the nature of events that are considered. Conservative hypothesis on the characteristics of these events and the uncertainty of parameter values of those models are also formulated. The numerical values of the above mentioned probabilities are obtained by giving the parameters suitable values that are extracted from specialized publications. (Author)

  3. Analysis of Paks NPP Personnel Activity during Safety Related Event Sequences

    International Nuclear Information System (INIS)

    Bareith, A.; Hollo, Elod; Karsa, Z.; Nagy, S.

    1998-01-01

    Within the AGNES Project (Advanced Generic and New Evaluation of Safety) the Level-1 PSA model of the Paks NPP Unit 3 was developed in form of a detailed event tree/fault tree structure (53 initiating events, 580 event sequences, 6300 basic events are involved). This model gives a good basis for quantitative evaluation of potential consequences of actually occurred safety-related events, i.e. for precursor event studies. To make these studies possible and efficient, the current qualitative event analysis practice should be reviewed and a new additional quantitative analysis procedure and system should be developed and applied. The present paper gives an overview of the method outlined for both qualitative and quantitative analyses of the operator crew activity during off-normal situations. First, the operator performance experienced during past operational events is discussed. Sources of raw information, the qualitative evaluation process, the follow-up actions, as well as the documentation requirements are described. Second, the general concept of the proposed precursor event analysis is described. Types of modeled interactions and the considered performance influences are presented. The quantification of the potential consequences of the identified precursor events is based on the task-oriented, Level-1 PSA model of the plant unit. A precursor analysis system covering the evaluation of operator activities is now under development. Preliminary results gained during a case study evaluation of a past historical event are presented. (authors)

  4. Differences in the rates of patient safety events by payer: implications for providers and policymakers.

    Science.gov (United States)

    Spencer, Christine S; Roberts, Eric T; Gaskin, Darrell J

    2015-06-01

    The reduction of adverse patient safety events and the equitable treatment of patients in hospitals are clinical and policy priorities. Health services researchers have identified disparities in the quality of care provided to patients, both by demographic characteristics and insurance status. However, less is known about the extent to which disparities reflect differences in the places where patients obtain care, versus disparities in the quality of care provided to different groups of patients in the same hospital. In this study, we examine whether the rate of adverse patient safety events differs by the insurance status of patients within the same hospital. Using discharge data from hospitals in 11 states, we compared risk-adjusted rates for 13 AHRQ Patient Safety Indicators by Medicare, Medicaid, and Private payer insurance status, within the same hospitals. We used multivariate regression to assess the relationship between insurance status and rates of adverse patient safety events within hospitals. Medicare and Medicaid patients experienced significantly more adverse safety events than private pay patients for 12 and 7 Patient Safety Indicators, respectively (at P patients had significantly lower event rates than private payers on 2 Patient Safety Indicators. Risk-adjusted Patient Safety Indicator rates varied with patients' insurance within the same hospital. More research is needed to determine the cause of differences in care quality received by patients at the same hospital, especially if quality measures are to be used for payment.

  5. Non-Linguistic Vocal Event Detection Using Online Random

    DEFF Research Database (Denmark)

    Abou-Zleikha, Mohamed; Tan, Zheng-Hua; Christensen, Mads Græsbøll

    2014-01-01

    areas such as object detection, face recognition, and audio event detection. This paper proposes to use online random forest technique for detecting laughter and filler and for analyzing the importance of various features for non-linguistic vocal event classification through permutation. The results...... show that according to the Area Under Curve measure the online random forest achieved 88.1% compared to 82.9% obtained by the baseline support vector machines for laughter classification and 86.8% to 83.6% for filler classification....

  6. Safety assessment and detection methods of genetically modified organisms.

    Science.gov (United States)

    Xu, Rong; Zheng, Zhe; Jiao, Guanglian

    2014-01-01

    Genetically modified organisms (GMOs), are gaining importance in agriculture as well as the production of food and feed. Along with the development of GMOs, health and food safety concerns have been raised. These concerns for these new GMOs make it necessary to set up strict system on food safety assessment of GMOs. The food safety assessment of GMOs, current development status of safety and precise transgenic technologies and GMOs detection have been discussed in this review. The recent patents about GMOs and their detection methods are also reviewed. This review can provide elementary introduction on how to assess and detect GMOs.

  7. Effects of organizational safety practices and perceived safety climate on PPE usage, engineering controls, and adverse events involving liquid antineoplastic drugs among nurses.

    Science.gov (United States)

    DeJoy, David M; Smith, Todd D; Woldu, Henok; Dyal, Mari-Amanda; Steege, Andrea L; Boiano, James M

    2017-07-01

    Antineoplastic drugs pose risks to the healthcare workers who handle them. This fact notwithstanding, adherence to safe handling guidelines remains inconsistent and often poor. This study examined the effects of pertinent organizational safety practices and perceived safety climate on the use of personal protective equipment, engineering controls, and adverse events (spill/leak or skin contact) involving liquid antineoplastic drugs. Data for this study came from the 2011 National Institute for Occupational Safety and Health (NIOSH) Health and Safety Practices Survey of Healthcare Workers which included a sample of approximately 1,800 nurses who had administered liquid antineoplastic drugs during the past seven days. Regression modeling was used to examine predictors of personal protective equipment use, engineering controls, and adverse events involving antineoplastic drugs. Approximately 14% of nurses reported experiencing an adverse event while administering antineoplastic drugs during the previous week. Usage of recommended engineering controls and personal protective equipment was quite variable. Usage of both was better in non-profit and government settings, when workers were more familiar with safe handling guidelines, and when perceived management commitment to safety was higher. Usage was poorer in the absence of specific safety handling procedures. The odds of adverse events increased with number of antineoplastic drugs treatments and when antineoplastic drugs were administered more days of the week. The odds of such events were significantly lower when the use of engineering controls and personal protective equipment was greater and when more precautionary measures were in place. Greater levels of management commitment to safety and perceived risk were also related to lower odds of adverse events. These results point to the value of implementing a comprehensive health and safety program that utilizes available hazard controls and effectively communicates

  8. Predictive modeling of structured electronic health records for adverse drug event detection.

    Science.gov (United States)

    Zhao, Jing; Henriksson, Aron; Asker, Lars; Boström, Henrik

    2015-01-01

    The digitization of healthcare data, resulting from the increasingly widespread adoption of electronic health records, has greatly facilitated its analysis by computational methods and thereby enabled large-scale secondary use thereof. This can be exploited to support public health activities such as pharmacovigilance, wherein the safety of drugs is monitored to inform regulatory decisions about sustained use. To that end, electronic health records have emerged as a potentially valuable data source, providing access to longitudinal observations of patient treatment and drug use. A nascent line of research concerns predictive modeling of healthcare data for the automatic detection of adverse drug events, which presents its own set of challenges: it is not yet clear how to represent the heterogeneous data types in a manner conducive to learning high-performing machine learning models. Datasets from an electronic health record database are used for learning predictive models with the purpose of detecting adverse drug events. The use and representation of two data types, as well as their combination, are studied: clinical codes, describing prescribed drugs and assigned diagnoses, and measurements. Feature selection is conducted on the various types of data to reduce dimensionality and sparsity, while allowing for an in-depth feature analysis of the usefulness of each data type and representation. Within each data type, combining multiple representations yields better predictive performance compared to using any single representation. The use of clinical codes for adverse drug event detection significantly outperforms the use of measurements; however, there is no significant difference over datasets between using only clinical codes and their combination with measurements. For certain adverse drug events, the combination does, however, outperform using only clinical codes. Feature selection leads to increased predictive performance for both data types, in isolation and

  9. Westinghouse Small Modular Reactor passive safety system response to postulated events

    International Nuclear Information System (INIS)

    Smith, M. C.; Wright, R. F.

    2012-01-01

    The Westinghouse Small Modular Reactor (SMR) is an 800 MWt (>225 MWe) integral pressurized water reactor. This paper is part of a series of four describing the design and safety features of the Westinghouse SMR. This paper focuses in particular upon the passive safety features and the safety system response of the Westinghouse SMR. The Westinghouse SMR design incorporates many features to minimize the effects of, and in some cases eliminates the possibility of postulated accidents. The small size of the reactor and the low power density limits the potential consequences of an accident relative to a large plant. The integral design eliminates large loop piping, which significantly reduces the flow area of postulated loss of coolant accidents (LOCAs). The Westinghouse SMR containment is a high-pressure, compact design that normally operates at a partial vacuum. This facilitates heat removal from the containment during LOCA events. The containment is submerged in water which also aides the heat removal and provides an additional radionuclide filter. The Westinghouse SMR safety system design is passive, is based largely on the passive safety systems used in the AP1000 R reactor, and provides mitigation of all design basis accidents without the need for AC electrical power for a period of seven days. Frequent faults, such as reactivity insertion events and loss of power events, are protected by first shutting down the nuclear reaction by inserting control rods, then providing cold, borated water through a passive, buoyancy-driven flow. Decay heat removal is provided using a layered approach that includes the passive removal of heat by the steam drum and independent passive heat removal system that transfers heat from the primary system to the environment. Less frequent faults such as loss of coolant accidents are mitigated by passive injection of a large quantity of water that is readily available inside containment. An automatic depressurization system is used to

  10. Semantic Context Detection Using Audio Event Fusion

    Directory of Open Access Journals (Sweden)

    Cheng Wen-Huang

    2006-01-01

    Full Text Available Semantic-level content analysis is a crucial issue in achieving efficient content retrieval and management. We propose a hierarchical approach that models audio events over a time series in order to accomplish semantic context detection. Two levels of modeling, audio event and semantic context modeling, are devised to bridge the gap between physical audio features and semantic concepts. In this work, hidden Markov models (HMMs are used to model four representative audio events, that is, gunshot, explosion, engine, and car braking, in action movies. At the semantic context level, generative (ergodic hidden Markov model and discriminative (support vector machine (SVM approaches are investigated to fuse the characteristics and correlations among audio events, which provide cues for detecting gunplay and car-chasing scenes. The experimental results demonstrate the effectiveness of the proposed approaches and provide a preliminary framework for information mining by using audio characteristics.

  11. Drug Safety Crises Management in Pharmacovigilance

    Directory of Open Access Journals (Sweden)

    Gloria Shalviri

    2018-05-01

    Full Text Available Background: Adverse drug events can cause serious consequences including death. A published report by Lazarou et al in 1998 showed that adverse drug events were the 4th to 6th leading cause of death in the United States. These events may lead to drug safety crises in some issues, which need to take crises management process for solving the problem and/or preventing similar events.Objectives: To evaluate nature of drug safety crises based on adverse events reported to Iranian Pharmacovigilance Center from 1999 through 2012. To mention success and failure outcomes of crises management process taken against detected crises.Methods: All adverse drug events received by Iranian Pharmacovigilance Center from 1999 through 2012 were evaluated for reports with fatal outcome. All alerting letters and manuscripts published by the Center during the same period were reviewed for detailed information on detected crises. World Health Organization definition was used for detecting drug safety crises.Results: Among 42036 registered cases in our database, 463 deaths were recorded. The most frequent suspected drug for adverse events with fatal outcome was ceftriaxone (100 cases. Ten different drug safety crises issues were detected during the study period and their successful or failure outcomes were evaluated. There were 112 issued alerting letters and 17 published manuscript during the same period which was monitored for detailed information.  Conclusion: It is necessary for national pharmacovigilance centers to have prepared programs for crises management. This could be useful for reducing drug related mortality.

  12. An Examination of Three Spatial Event Cluster Detection Methods

    Directory of Open Access Journals (Sweden)

    Hensley H. Mariathas

    2015-03-01

    Full Text Available In spatial disease surveillance, geographic areas with large numbers of disease cases are to be identified, so that targeted investigations can be pursued. Geographic areas with high disease rates are called disease clusters and statistical cluster detection tests are used to identify geographic areas with higher disease rates than expected by chance alone. In some situations, disease-related events rather than individuals are of interest for geographical surveillance, and methods to detect clusters of disease-related events are called event cluster detection methods. In this paper, we examine three distributional assumptions for the events in cluster detection: compound Poisson, approximate normal and multiple hypergeometric (exact. The methods differ on the choice of distributional assumption for the potentially multiple correlated events per individual. The methods are illustrated on emergency department (ED presentations by children and youth (age < 18 years because of substance use in the province of Alberta, Canada, during 1 April 2007, to 31 March 2008. Simulation studies are conducted to investigate Type I error and the power of the clustering methods.

  13. Trending of low level events and near misses to enhance safety performance in nuclear power plants

    International Nuclear Information System (INIS)

    2005-11-01

    The IAEA Safety Fundamentals publication, Safety of Nuclear Installations, Safety Series No. 110, states the need for operating organizations to establish a programme for the collection and analysis of operating experience in nuclear power plants. Such a programme ensures that operating experience is analysed, events important to safety are reviewed in depth, and lessons learned are disseminated to the staff of the organization and to relevant national and international organizations. As a result of the effort to enhance safety in operating organizations, incidents are progressively decreasing in number and significance. This means that in accordance with international reporting requirements the amount of collected data becomes less sufficient to draw meaningful statistical conclusions. This is where the collection and trend analysis of low level events and near misses can prove to be very useful. These trends can show which of the safety barriers are weak or failing more frequently. Evaluation and trending of low level events and near misses will help to prevent major incidents because latent weaknesses have been identified and corrective actions taken to prevent recurrence. This leads to improved safety and production. Low level events and near misses, which may reach several thousand per reactor operating year, need to be treated by the organizations as learning opportunities. A system for capturing these low level events and near misses truly needs to be an organization-wide system in which all levels of the organization, including contractors, participate. It is desirable that the overall operational experience feedback (OEF) process should integrate the lessons learned and the associated data from significant events with those of lower level events and near misses. To be able to effectively implement a process dealing with low level events and near misses, it is necessary that the organization have a well established OEF process for significant events

  14. Operational safety experience feedback by means of unusual event reports

    International Nuclear Information System (INIS)

    1996-07-01

    Operational experience of nuclear power plants can be used to great advantage to enhance safety performance provided adequate measures are in place to collect and analyse it and to ensure that the conclusions drawn are acted upon. Feedback of operating experience is thus an extremely important tool to ensure high standards of safety in operational nuclear power plants and to improve the capability to prevent serious accidents and to learn from minor deviations and equipment failures - which can serve as early warnings -to prevent even minor events from occurring. Mechanisms also need to be developed to ensure that operating experience is shared both nationally as well as internationally. The operating experience feedback process needs to be fully and effectively established within the nuclear power plant, the utility, the regulatory organization as well as in other institutions such as technical support organizations and designers. The main purpose of this publication is to reflect the international consensus as to the general principles and practices in the operational safety experience feedback process. The examples of national practices for the whole or for particular parts of the process are given in annexes. The publication complements the IAEA Safety Series No.93 ''Systems for Reporting Unusual Events in Nuclear Power Plants'' (1989) and may also give a general guidance for Member States in fulfilling their obligations stipulated in the Nuclear Safety Convention. Figs, tabs

  15. Operational safety experience feedback by means of unusual event reports

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-07-01

    Operational experience of nuclear power plants can be used to great advantage to enhance safety performance provided adequate measures are in place to collect and analyse it and to ensure that the conclusions drawn are acted upon. Feedback of operating experience is thus an extremely important tool to ensure high standards of safety in operational nuclear power plants and to improve the capability to prevent serious accidents and to learn from minor deviations and equipment failures - which can serve as early warnings -to prevent even minor events from occurring. Mechanisms also need to be developed to ensure that operating experience is shared both nationally as well as internationally. The operating experience feedback process needs to be fully and effectively established within the nuclear power plant, the utility, the regulatory organization as well as in other institutions such as technical support organizations and designers. The main purpose of this publication is to reflect the international consensus as to the general principles and practices in the operational safety experience feedback process. The examples of national practices for the whole or for particular parts of the process are given in annexes. The publication complements the IAEA Safety Series No.93 ``Systems for Reporting Unusual Events in Nuclear Power Plants`` (1989) and may also give a general guidance for Member States in fulfilling their obligations stipulated in the Nuclear Safety Convention. Figs, tabs.

  16. Unsupervised Event Characterization and Detection in Multichannel Signals: An EEG application

    Directory of Open Access Journals (Sweden)

    Angel Mur

    2016-04-01

    Full Text Available In this paper, we propose a new unsupervised method to automatically characterize and detect events in multichannel signals. This method is used to identify artifacts in electroencephalogram (EEG recordings of brain activity. The proposed algorithm has been evaluated and compared with a supervised method. To this end an example of the performance of the algorithm to detect artifacts is shown. The results show that although both methods obtain similar classification, the proposed method allows detecting events without training data and can also be applied in signals whose events are unknown a priori. Furthermore, the proposed method provides an optimal window whereby an optimal detection and characterization of events is found. The detection of events can be applied in real-time.

  17. Spatial-Temporal Event Detection from Geo-Tagged Tweets

    Directory of Open Access Journals (Sweden)

    Yuqian Huang

    2018-04-01

    Full Text Available As one of the most popular social networking services in the world, Twitter allows users to post messages along with their current geographic locations. Such georeferenced or geo-tagged Twitter datasets can benefit location-based services, targeted advertising and geosocial studies. Our study focused on the detection of small-scale spatial-temporal events and their textual content. First, we used Spatial-Temporal Density-Based Spatial Clustering of Applications with Noise (ST-DBSCAN to spatially-temporally cluster the tweets. Then, the word frequencies were summarized for each cluster and the potential topics were modeled by the Latent Dirichlet Allocation (LDA algorithm. Using two years of Twitter data from four college cities in the U.S., we were able to determine the spatial-temporal patterns of two known events, two unknown events and one recurring event, which then were further explored and modeled to identify the semantic content about the events. This paper presents our process and recommendations for both finding event-related tweets as well as understanding the spatial-temporal behaviors and semantic natures of the detected events.

  18. Using naturalistic driving data to explore the association between traffic safety-related events and crash risk at driver level.

    Science.gov (United States)

    Wu, Kun-Feng; Aguero-Valverde, Jonathan; Jovanis, Paul P

    2014-11-01

    There has been considerable research conducted over the last 40 years using traffic safety-related events to support road safety analyses. Dating back to traffic conflict studies from the 1960s these observational studies of driver behavior have been criticized due to: poor quality data; lack of available and useful exposure measures linked to the observations; the incomparability of self-reported safety-related events; and, the difficulty in assessing culpability for safety-related events. This study seeks to explore the relationships between driver characteristics and traffic safety-related events, and between traffic safety-related events and crash involvement while mitigating some of those limitations. The Virginia Tech Transportation Institute 100-Car Naturalistic Driving Study dataset, in which the participants' vehicles were instrumented with various cameras and sensors during the study period, was used for this study. The study data set includes 90 drivers observed for 12-13 months driving. This study focuses on single vehicle run-off-road safety-related events only, including 14 crashes and 182 safety-related events (30 near crashes, and 152 crash-relevant incidents). Among the findings are: (1) drivers under age 25 are significantly more likely to be involved in safety-related events and crashes; and (2) significantly positive correlations exist between crashes, near crashes, and crash-relevant incidents. Although there is still much to learn about the factors affecting the positive correlation between safety-related events and crashes, a Bayesian multivariate Poisson log-normal model is shown to be useful to quantify the associations between safety-related events and crash risk while controlling for driver characteristics. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Patient safety event reporting in critical care: a study of three intensive care units.

    Science.gov (United States)

    Harris, Carolyn B; Krauss, Melissa J; Coopersmith, Craig M; Avidan, Michael; Nast, Patricia A; Kollef, Marin H; Dunagan, W Claiborne; Fraser, Victoria J

    2007-04-01

    To increase patient safety event reporting in three intensive care units (ICUs) using a new voluntary card-based event reporting system and to compare and evaluate observed differences in reporting among healthcare workers across ICUs. Prospective, single-center, interventional study. A medical ICU (19 beds), surgical ICU (24 beds), and cardiothoracic ICU (17 beds) at a 1,371-bed urban teaching hospital. Adult patients admitted to these three study ICUs. Use of a new, internally designed, card-based reporting program to solicit voluntary anonymous reporting of medical errors and patient safety concerns. During a 14-month period, 714 patient safety events were reported using a new card-based reporting system, reflecting a significant increase in reporting compared with pre-intervention Web-based reporting (20.4 reported events/1,000 patient days pre-intervention to 41.7 reported events/1,000 patient days postintervention; rate ratio, 2.05; 95% confidence interval, 1.79-2.34). Nurses submitted the majority of reports (nurses, 67.1%; physicians, 23.1%; other reporters, 9.5%); however, physicians experienced the greatest increase in reporting among their group (physicians, 43-fold; nurses, 1.7-fold; other reporters, 4.3-fold) relative to pre-intervention rates. There were significant differences in the reporting of harm by job description: 31.1% of reports from nurses, 36.2% from other staff, and 17.0% from physicians described events that did not reach/affect the patient (p = .001); and 33.9% of reports from physicians, 27.2% from nurses, and 13.0% from other staff described events that caused harm (p = .005). Overall reported patient safety events per 1,000 patient days differed by ICU (medical ICU = 55.5, cardiothoracic ICU = 25.3, surgical ICU = 40.2; p reporting system increased reporting significantly compared with pre-intervention Web-based reporting and revealed significant differences in reporting by healthcare worker and ICU. These differences may reveal

  20. Are measurements of patient safety culture and adverse events valid and reliable? Results from a cross sectional study.

    Science.gov (United States)

    Farup, Per G

    2015-05-02

    The association between measurements of the patient safety culture and the "true" patient safety has been insufficiently documented, and the validity of the tools used for the measurements has been questioned. This study explored associations between the patient safety culture and adverse events, and evaluated the validity of the tools. In 2008/2009, a survey on patient safety culture was performed with Hospital Survey on Patient Safety Culture (HSOPSC) in two medical departments in two geographically separated hospitals of Innlandet Hospital Trust. Later, a retrospective analysis of adverse events during the same period was performed with the Global Trigger Tool (GTT). The safety culture and adverse events were compared between the departments. 185 employees participated in the study, and 272 patient records were analysed. The HSOPSC scores were lower and adverse events less prevalent in department 1 than in department 2. In departments 1 and 2 the mean HSOPSC scores (SD) were at the unit level 3.62 (0.42) and 3.90 (0.37) (p culture and adverse events. Until the criterion validity of the tools for measuring patient safety culture and tracking of adverse events have been further evaluated, measurement of patient safety culture could not be used as a proxy for the "true" safety.

  1. The association between event learning and continuous quality improvement programs and culture of patient safety.

    Science.gov (United States)

    Mazur, Lukasz; Chera, Bhishamjit; Mosaly, Prithima; Taylor, Kinley; Tracton, Gregg; Johnson, Kendra; Comitz, Elizabeth; Adams, Robert; Pooya, Pegah; Ivy, Julie; Rockwell, John; Marks, Lawrence B

    2015-01-01

    To present our approach and results from our quality and safety program and to report their possible impact on our culture of patient safety. We created an event learning system (termed a "good catch" program) and encouraged staff to report any quality or safety concerns in real time. Events were analyzed to assess the utility of safety barriers. A formal continuous quality improvement program was created to address these reported events and make improvements. Data on perceptions of the culture of patient safety were collected using the Agency for Health Care Research and Quality survey administered before, during, and after the initiatives. Of 560 good catches reported, 367 could be ascribed to a specific step on our process map. The calculated utility of safety barriers was highest for those embedded into the pretreatment quality assurance checks performed by physicists and dosimetrists (utility score 0.53; 93 of 174) and routine checks done by therapists on the initial day of therapy. Therapists and physicists reported the highest number of good catches (24% each). Sixty-four percent of events were caused by performance issues (eg, not following standardized processes, including suboptimal communications). Of 31 initiated formal improvement events, 26 were successfully implemented and sustained, 4 were discontinued, and 1 was not implemented. Most of the continuous quality improvement program was conducted by nurses (14) and therapists (7). Percentages of positive responses in the patient safety culture survey appear to have increased on all dimensions (p continuous quality improvement programs can be successfully implemented and that there are contemporaneous improvements in the culture of safety. Copyright © 2015 American Society for Radiation Oncology. Published by Elsevier Inc. All rights reserved.

  2. Abnormal global and local event detection in compressive sensing domain

    Science.gov (United States)

    Wang, Tian; Qiao, Meina; Chen, Jie; Wang, Chuanyun; Zhang, Wenjia; Snoussi, Hichem

    2018-05-01

    Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.

  3. Knowledge Translation and Patient Safety: The Canadian Adverse Events Study

    OpenAIRE

    Baker, G. Ross; Norton, Peter; Flintoft, Virginia

    2006-01-01

    The Canadian Adverse Events Study was the first national study of adverse events in Canadian hospitals. Learning from the controversy surrounding similar studies in other countries, the team engaged in extensive knowledge translation activities throughout the life of the project. Using meetings, Web-based communication and other tools, the team successfully prepared most Canadian stakeholders for the study’s release, allowing them to develop anticipatory patient safety initiatives. However, u...

  4. 78 FR 20454 - Safety Zones; Annual Events Requiring Safety Zones in the Captain of the Port Lake Michigan Zone

    Science.gov (United States)

    2013-04-05

    ... Zone. The last three entries within this rule have been added for races in the Chicago, IL area and on... written--Celebrate Americafest/Fire over the Fox. This event has historically involved both a fireworks... day of the event. To ensure the safety of the Celebrate Americafest/Fire over the Fox event in its...

  5. Piecing together the puzzle: Improving event content coverage for real-time sub-event detection using adaptive microblog crawling.

    Science.gov (United States)

    Tokarchuk, Laurissa; Wang, Xinyue; Poslad, Stefan

    2017-01-01

    In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM) framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The novel combination of

  6. Piecing together the puzzle: Improving event content coverage for real-time sub-event detection using adaptive microblog crawling.

    Directory of Open Access Journals (Sweden)

    Laurissa Tokarchuk

    Full Text Available In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The

  7. Event Detection Intelligent Camera: Demonstration of flexible, real-time data taking and processing

    Energy Technology Data Exchange (ETDEWEB)

    Szabolics, Tamás, E-mail: szabolics.tamas@wigner.mta.hu; Cseh, Gábor; Kocsis, Gábor; Szepesi, Tamás; Zoletnik, Sándor

    2015-10-15

    Highlights: • We present EDICAM's operation principles description. • Firmware tests results. • Software test results. • Further developments. - Abstract: An innovative fast camera (EDICAM – Event Detection Intelligent CAMera) was developed by MTA Wigner RCP in the last few years. This new concept was designed for intelligent event driven processing to be able to detect predefined events and track objects in the plasma. The camera provides a moderate frame rate of 400 Hz at full frame resolution (1280 × 1024), and readout of smaller region of interests can be done in the 1–140 kHz range even during exposure of the full image. One of the most important advantages of this hardware is a 10 Gbit/s optical link which ensures very fast communication and data transfer between the PC and the camera, enabling two level of processing: primitive algorithms in the camera hardware and high-level processing in the PC. This camera hardware has successfully proven to be able to monitoring the plasma in several fusion devices for example at ASDEX Upgrade, KSTAR and COMPASS with the first version of firmware. A new firmware and software package is under development. It allows to detect predefined events in real time and therefore the camera is capable to change its own operation or to give warnings e.g. to the safety system of the experiment. The EDICAM system can handle a huge amount of data (up to TBs) with high data rate (950 MB/s) and will be used as the central element of the 10 camera overview video diagnostic system of Wendenstein 7-X (W7-X) stellarator. This paper presents key elements of the newly developed built-in intelligence stressing the revolutionary new features and the results of the test of the different software elements.

  8. Use of the event tree method for evaluate the safety of radioactive facilities

    International Nuclear Information System (INIS)

    Hernandez S, A.; Cornejo D, N.; Callis F, E.

    2006-01-01

    The work shows the validity of the use of Trees of Events like a quantitative method appropriate to carry out evaluations of radiological safety. Its were took like base the evaluations of safety of five Radiotherapy Departments, carried out in the mark of the process of authorization of these facilities. The risk values were obtained by means of the combination of the probabilities of occurrence of the events with its consequences. The use of the method allowed to suggest improvements to the existent safety systems, as well as to confirm that the current regulator requirements for this type of facilities to lead to practices with acceptable risk levels. (Author)

  9. Root Cause Analysis: Learning from Adverse Safety Events.

    Science.gov (United States)

    Brook, Olga R; Kruskal, Jonathan B; Eisenberg, Ronald L; Larson, David B

    2015-10-01

    Serious adverse events continue to occur in clinical practice, despite our best preventive efforts. It is essential that radiologists, both as individuals and as a part of organizations, learn from such events and make appropriate changes to decrease the likelihood that such events will recur. Root cause analysis (RCA) is a process to (a) identify factors that underlie variation in performance or that predispose an event toward undesired outcomes and (b) allow for development of effective strategies to decrease the likelihood of similar adverse events occurring in the future. An RCA process should be performed within the environment of a culture of safety, focusing on underlying system contributors and, in a confidential manner, taking into account the emotional effects on the staff involved. The Joint Commission now requires that a credible RCA be performed within 45 days for all sentinel or major adverse events, emphasizing the need for all radiologists to understand the processes with which an effective RCA can be performed. Several RCA-related tools that have been found to be useful in the radiology setting include the "five whys" approach to determine causation; cause-and-effect, or Ishikawa, diagrams; causal tree mapping; affinity diagrams; and Pareto charts. © RSNA, 2015.

  10. Abnormal global and local event detection in compressive sensing domain

    Directory of Open Access Journals (Sweden)

    Tian Wang

    2018-05-01

    Full Text Available Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.

  11. Event-Triggered Fault Detection of Nonlinear Networked Systems.

    Science.gov (United States)

    Li, Hongyi; Chen, Ziran; Wu, Ligang; Lam, Hak-Keung; Du, Haiping

    2017-04-01

    This paper investigates the problem of fault detection for nonlinear discrete-time networked systems under an event-triggered scheme. A polynomial fuzzy fault detection filter is designed to generate a residual signal and detect faults in the system. A novel polynomial event-triggered scheme is proposed to determine the transmission of the signal. A fault detection filter is designed to guarantee that the residual system is asymptotically stable and satisfies the desired performance. Polynomial approximated membership functions obtained by Taylor series are employed for filtering analysis. Furthermore, sufficient conditions are represented in terms of sum of squares (SOSs) and can be solved by SOS tools in MATLAB environment. A numerical example is provided to demonstrate the effectiveness of the proposed results.

  12. Hard-Hat Detection for Construction Safety Visualization

    OpenAIRE

    Shrestha, Kishor; Shrestha, Pramen P.; Bajracharya, Dinesh; Yfantis, Evangelos A.

    2015-01-01

    In 2012, 775 fatalities were recorded, and many more were injured at construction sites in the United States. Of these, 415 fatalities (54%) were due to fall, slips, and trips as well as being struck by falling objects. In order to decrease fatalities at construction sites to these types of events, the Occupational Safety and Health Administration (OSHA) provides Fall Prevention and OSHA-10 trainings to construction workers. Moreover, safety personnel monitor whether the workers use personal ...

  13. The sequentially discounting autoregressive (SDAR) method for on-line automatic seismic event detecting on long term observation

    Science.gov (United States)

    Wang, L.; Toshioka, T.; Nakajima, T.; Narita, A.; Xue, Z.

    2017-12-01

    In recent years, more and more Carbon Capture and Storage (CCS) studies focus on seismicity monitoring. For the safety management of geological CO2 storage at Tomakomai, Hokkaido, Japan, an Advanced Traffic Light System (ATLS) combined different seismic messages (magnitudes, phases, distributions et al.) is proposed for injection controlling. The primary task for ATLS is the seismic events detection in a long-term sustained time series record. Considering the time-varying characteristics of Signal to Noise Ratio (SNR) of a long-term record and the uneven energy distributions of seismic event waveforms will increase the difficulty in automatic seismic detecting, in this work, an improved probability autoregressive (AR) method for automatic seismic event detecting is applied. This algorithm, called sequentially discounting AR learning (SDAR), can identify the effective seismic event in the time series through the Change Point detection (CPD) of the seismic record. In this method, an anomaly signal (seismic event) can be designed as a change point on the time series (seismic record). The statistical model of the signal in the neighborhood of event point will change, because of the seismic event occurrence. This means the SDAR aims to find the statistical irregularities of the record thought CPD. There are 3 advantages of SDAR. 1. Anti-noise ability. The SDAR does not use waveform messages (such as amplitude, energy, polarization) for signal detecting. Therefore, it is an appropriate technique for low SNR data. 2. Real-time estimation. When new data appears in the record, the probability distribution models can be automatic updated by SDAR for on-line processing. 3. Discounting property. the SDAR introduces a discounting parameter to decrease the influence of present statistic value on future data. It makes SDAR as a robust algorithm for non-stationary signal processing. Within these 3 advantages, the SDAR method can handle the non-stationary time-varying long

  14. Adverse event reporting in Slovenia - the influence of safety culture, supervisors and communication

    Directory of Open Access Journals (Sweden)

    Birk Karin

    2016-01-01

    Full Text Available Background/Aim. The provision of safe healthcare is considered a priority in European Union (EU member states. Along with other preventative measures in healthcare, the EU also strives to eliminate the “causes of harm to human health”. The aim of this survey was to determine whether safety culture, supervisors and communication between co-workers influence the number of adverse event reports submitted to the heads of clinical departments and to the management of an institution. Methods. This survey is based on cross-sectional analysis. It was carried out in the largest Slovenian university hospital. We received 235 completed questionnaires. Respondents included professionals in the fields of nursingcare, physiotherapy, occupational therapy and radiological technology. Results. Safety culture influences the number of adverse event reports submitted to the head of a clinical department from the organizational point of view. Supervisors and communication between co-workers do not influence the number of adverse event reports. Conclusion. It can be concluded that neither supervisors nor the level of communication between co-workers influence the frequency of adverse event reporting, while safety culture does influence it from an organizational point of view. The presumed factors only partly influence the number of submitted adverse event reports, thus other causes of under-reporting must be sought elsewhere.

  15. Multivariate algorithms for initiating event detection and identification in nuclear power plants

    International Nuclear Information System (INIS)

    Wu, Shun-Chi; Chen, Kuang-You; Lin, Ting-Han; Chou, Hwai-Pwu

    2018-01-01

    Highlights: •Multivariate algorithms for NPP initiating event detection and identification. •Recordings from multiple sensors are simultaneously considered for detection. •Both spatial and temporal information is used for event identification. •Untrained event isolation avoids falsely relating an untrained event. •Efficacy of the algorithms is verified with data from the Maanshan NPP simulator. -- Abstract: To prevent escalation of an initiating event into a severe accident, promptly detecting its occurrence and precisely identifying its type are essential. In this study, several multivariate algorithms for initiating event detection and identification are proposed to help maintain safe operations of nuclear power plants (NPPs). By monitoring changes in the NPP sensing variables, an event is detected when the preset thresholds are exceeded. Unlike existing approaches, recordings from sensors of the same type are simultaneously considered for detection, and no subjective reasoning is involved in setting these thresholds. To facilitate efficient event identification, a spatiotemporal feature extractor is proposed. The extracted features consist of the temporal traits used by existing techniques and the spatial signature of an event. Through an F-score-based feature ranking, only those that are most discriminant in classifying the events under consideration will be retained for identification. Moreover, an untrained event isolation scheme is introduced to avoid relating an untrained event to those in the event dataset so that improper recovery actions can be prevented. Results from experiments containing data of 12 event classes and a total of 125 events generated using a Taiwan’s Maanshan NPP simulator are provided to illustrate the efficacy of the proposed algorithms.

  16. Detecting impacts of extreme events with ecological in situ monitoring networks

    Directory of Open Access Journals (Sweden)

    M. D. Mahecha

    2017-09-01

    Full Text Available Extreme hydrometeorological conditions typically impact ecophysiological processes on land. Satellite-based observations of the terrestrial biosphere provide an important reference for detecting and describing the spatiotemporal development of such events. However, in-depth investigations of ecological processes during extreme events require additional in situ observations. The question is whether the density of existing ecological in situ networks is sufficient for analysing the impact of extreme events, and what are expected event detection rates of ecological in situ networks of a given size. To assess these issues, we build a baseline of extreme reductions in the fraction of absorbed photosynthetically active radiation (FAPAR, identified by a new event detection method tailored to identify extremes of regional relevance. We then investigate the event detection success rates of hypothetical networks of varying sizes. Our results show that large extremes can be reliably detected with relatively small networks, but also reveal a linear decay of detection probabilities towards smaller extreme events in log–log space. For instance, networks with  ≈  100 randomly placed sites in Europe yield a  ≥  90 % chance of detecting the eight largest (typically very large extreme events; but only a  ≥  50 % chance of capturing the 39 largest events. These findings are consistent with probability-theoretic considerations, but the slopes of the decay rates deviate due to temporal autocorrelation and the exact implementation of the extreme event detection algorithm. Using the examples of AmeriFlux and NEON, we then investigate to what degree ecological in situ networks can capture extreme events of a given size. Consistent with our theoretical considerations, we find that today's systematically designed networks (i.e. NEON reliably detect the largest extremes, but that the extreme event detection rates are not higher than would

  17. Online Detection of Abnormal Events in Video Streams

    Directory of Open Access Journals (Sweden)

    Tian Wang

    2013-01-01

    an image descriptor and online nonlinear classification method. We introduce the covariance matrix of the optical flow and image intensity as a descriptor encoding moving information. The nonlinear online support vector machine (SVM firstly learns a limited set of the training frames to provide a basic reference model then updates the model and detects abnormal events in the current frame. We finally apply the method to detect abnormal events on a benchmark video surveillance dataset to demonstrate the effectiveness of the proposed technique.

  18. Contrasting safety assessments of a runway incursion scenario: Event sequence analysis versus multi-agent dynamic risk modelling

    International Nuclear Information System (INIS)

    Stroeve, Sybert H.; Blom, Henk A.P.; Bakker, G.J.

    2013-01-01

    In the safety literature it has been argued, that in a complex socio-technical system safety cannot be well analysed by event sequence based approaches, but requires to capture the complex interactions and performance variability of the socio-technical system. In order to evaluate the quantitative and practical consequences of these arguments, this study compares two approaches to assess accident risk of an example safety critical sociotechnical system. It contrasts an event sequence based assessment with a multi-agent dynamic risk model (MA-DRM) based assessment, both of which are performed for a particular runway incursion scenario. The event sequence analysis uses the well-known event tree modelling formalism and the MA-DRM based approach combines agent based modelling, hybrid Petri nets and rare event Monte Carlo simulation. The comparison addresses qualitative and quantitative differences in the methods, attained risk levels, and in the prime factors influencing the safety of the operation. The assessments show considerable differences in the accident risk implications of the performance of human operators and technical systems in the runway incursion scenario. In contrast with the event sequence based results, the MA-DRM based results show that the accident risk is not manifest from the performance of and relations between individual human operators and technical systems. Instead, the safety risk emerges from the totality of the performance and interactions in the agent based model of the safety critical operation considered, which coincides very well with the argumentation in the safety literature.

  19. On Event Detection and Localization in Acyclic Flow Networks

    KAUST Repository

    Suresh, Mahima Agumbe

    2013-05-01

    Acyclic flow networks, present in many infrastructures of national importance (e.g., oil and gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures have been proven costly and imprecise, particularly when dealing with large-scale distribution systems. In this article, to the best of our knowledge, for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. We propose the idea of using sensors that move along the edges of the network and detect events (i.e., attacks). To localize the events, sensors detect proximity to beacons, which are devices with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensors and beacons deployed) in a predetermined zone of interest, while ensuring a degree of coverage by sensors and a required accuracy in locating events using beacons. We propose algorithms for solving the aforementioned problem and demonstrate their effectiveness with results obtained from a realistic flow network simulator.

  20. 76 FR 42048 - Safety Zones; Swimming Events in Captain of the Port Boston Zone

    Science.gov (United States)

    2011-07-18

    ...-AA00 Safety Zones; Swimming Events in Captain of the Port Boston Zone AGENCY: Coast Guard, DHS. ACTION... events within the Captain of the Port (COTP) Boston Zone for swimming events. This action is necessary to... property on navigable waters from the hazardous nature of swimming events such as large numbers of swimmers...

  1. Hospital staff should use more than one method to detect adverse events and potential adverse events: incident reporting, pharmacist surveillance and local real‐time record review may all have a place

    Science.gov (United States)

    Olsen, Sisse; Neale, Graham; Schwab, Kat; Psaila, Beth; Patel, Tejal; Chapman, E Jane; Vincent, Charles

    2007-01-01

    Background Over the past five years, in most hospitals in England and Wales, incident reporting has become well established but it remains unclear how well reports match clinical adverse events. International epidemiological studies of adverse events are based on retrospective, multi‐hospital case record review. In this paper the authors describe the use of incident reporting, pharmacist surveillance and local real‐time record review for the recognition of clinical risks associated with hospital inpatient care. Methodology Data on adverse events were collected prospectively on 288 patients discharged from adult acute medical and surgical units in an NHS district general hospital using incident reports, active surveillance of prescription charts by pharmacists and record review at time of discharge. Results Record review detected 26 adverse events (AEs) and 40 potential adverse events (PAEs) occurring during the index admission. In contrast, in the same patient group, incident reporting detected 11 PAEs and no AEs. Pharmacy surveillance found 10 medication errors all of which were PAEs. There was little overlap in the nature of events detected by the three methods. Conclusion The findings suggest that incident reporting does not provide an adequate assessment of clinical adverse events and that this method needs to be supplemented with other more systematic forms of data collection. Structured record review, carried out by clinicians, provides an important component of an integrated approach to identifying risk in the context of developing a safety and quality improvement programme. PMID:17301203

  2. Network hydraulics inclusion in water quality event detection using multiple sensor stations data.

    Science.gov (United States)

    Oliker, Nurit; Ostfeld, Avi

    2015-09-01

    Event detection is one of the current most challenging topics in water distribution systems analysis: how regular on-line hydraulic (e.g., pressure, flow) and water quality (e.g., pH, residual chlorine, turbidity) measurements at different network locations can be efficiently utilized to detect water quality contamination events. This study describes an integrated event detection model which combines multiple sensor stations data with network hydraulics. To date event detection modelling is likely limited to single sensor station location and dataset. Single sensor station models are detached from network hydraulics insights and as a result might be significantly exposed to false positive alarms. This work is aimed at decreasing this limitation through integrating local and spatial hydraulic data understanding into an event detection model. The spatial analysis complements the local event detection effort through discovering events with lower signatures by exploring the sensors mutual hydraulic influences. The unique contribution of this study is in incorporating hydraulic simulation information into the overall event detection process of spatially distributed sensors. The methodology is demonstrated on two example applications using base runs and sensitivity analyses. Results show a clear advantage of the suggested model over single-sensor event detection schemes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Adverse Events Associated with Hospitalization or Detected through the RAI-HC Assessment among Canadian Home Care Clients

    Science.gov (United States)

    Doran, Diane; Hirdes, John P.; Blais, Régis; Baker, G. Ross; Poss, Jeff W.; Li, Xiaoqiang; Dill, Donna; Gruneir, Andrea; Heckman, George; Lacroix, Hélène; Mitchell, Lori; O'Beirne, Maeve; Foebel, Andrea; White, Nancy; Qian, Gan; Nahm, Sang-Myong; Yim, Odilia; Droppo, Lisa; McIsaac, Corrine

    2013-01-01

    Background: The occurrence of adverse events (AEs) in care settings is a patient safety concern that has significant consequences across healthcare systems. Patient safety problems have been well documented in acute care settings; however, similar data for clients in home care (HC) settings in Canada are limited. The purpose of this Canadian study was to investigate AEs in HC, specifically those associated with hospitalization or detected through the Resident Assessment Instrument for Home Care (RAI-HC). Method: A retrospective cohort design was used. The cohort consisted of HC clients from the provinces of Nova Scotia, Ontario, British Columbia and the Winnipeg Regional Health Authority. Results: The overall incidence rate of AEs associated with hospitalization ranged from 6% to 9%. The incidence rate of AEs determined from the RAI-HC was 4%. Injurious falls, injuries from other than fall and medication-related events were the most frequent AEs associated with hospitalization, whereas new caregiver distress was the most frequent AE identified through the RAI-HC. Conclusion: The incidence of AEs from all sources of data ranged from 4% to 9%. More resources are needed to target strategies for addressing safety risks in HC in a broader context. Tools such as the RAI-HC and its Clinical Assessment Protocols, already available in Canada, could be very useful in the assessment and management of HC clients who are at safety risk. PMID:23968676

  4. Detection of Abnormal Events via Optical Flow Feature Analysis

    Directory of Open Access Journals (Sweden)

    Tian Wang

    2015-03-01

    Full Text Available In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm.

  5. Detection of Abnormal Events via Optical Flow Feature Analysis

    Science.gov (United States)

    Wang, Tian; Snoussi, Hichem

    2015-01-01

    In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm. PMID:25811227

  6. Defining initiating events for purposes of probabilistic safety assessment

    International Nuclear Information System (INIS)

    1993-09-01

    This document is primarily directed towards technical staff involved in the performance or review of plant specific Probabilistic Safety Assessment (PSA). It highlights different approaches and provides typical examples useful for defining the Initiating Events (IE). The document also includes the generic initiating event database, containing about 300 records taken from about 30 plant specific PSAs. In addition to its usefulness during the actual performance of a PSA, the generic IE database is of the utmost importance for peer reviews of PSAs, such as the IAEA's International Peer Review Service (IPERS) where reference to studies on similar NPPs is needed. 60 refs, figs and tabs

  7. DETECT: a MATLAB toolbox for event detection and identification in time series, with applications to artifact detection in EEG signals.

    Science.gov (United States)

    Lawhern, Vernon; Hairston, W David; Robbins, Kay

    2013-01-01

    Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG) data as an additional illustration.

  8. DETECT: a MATLAB toolbox for event detection and identification in time series, with applications to artifact detection in EEG signals.

    Directory of Open Access Journals (Sweden)

    Vernon Lawhern

    Full Text Available Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG data as an additional illustration.

  9. A robust neural network-based approach for microseismic event detection

    KAUST Repository

    Akram, Jubran

    2017-08-17

    We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset for event detection. The input features used include the average of absolute amplitudes, variance, energy-ratio and polarization rectilinearity. These features are calculated in a moving-window of same length for the entire waveform. The output is set as a user-specified relative probability curve, which provides a robust way of distinguishing between weak and strong events. An optimal network is selected by studying the weight-based saliency and effect of number of neurons on the predicted results. Using synthetic data examples, we demonstrate that this approach is effective in detecting weaker events and reduces the number of false positives.

  10. Application of the Integrated Safety Assessment methodology to safety margins. Dynamic Event Trees, Damage Domains and Risk Assessment

    International Nuclear Information System (INIS)

    Ibánez, L.; Hortal, J.; Queral, C.; Gómez-Magán, J.; Sánchez-Perea, M.; Fernández, I.; Meléndez, E.; Expósito, A.; Izquierdo, J.M.; Gil, J.; Marrao, H.; Villalba-Jabonero, E.

    2016-01-01

    The Integrated Safety Assessment (ISA) methodology, developed by the Consejo de Seguridad Nuclear, has been applied to an analysis of Zion NPP for sequences with Loss of the Component Cooling Water System (CCWS). The ISA methodology proposal starts from the unfolding of the Dynamic Event Tree (DET). Results from this first step allow assessing the sequence delineation of standard Probabilistic Safety Analysis results. For some sequences of interest of the outlined DET, ISA then identifies the Damage Domain (DD). This is the region of uncertain times and/or parameters where a safety limit is exceeded, which indicates the occurrence of certain damage situation. This paper illustrates application of this concept obtained simulating sequences with MAAP and with TRACE. From information of simulation results of sequence transients belonging to the DD and the time-density probability distributions of the manual actions and of occurrence of stochastic phenomena, ISA integrates the dynamic reliability equations proposed to obtain the sequence contribution to the global Damage Exceedance Frequency (DEF). Reported results show a slight increase in the DEF for sequences investigated following a power uprate from 100% to 110%. This demonstrates the potential use of the method to help in the assessment of design modifications. - Highlights: • This paper illustrates an application of the ISA methodology to safety margins. • Dynamic Event Trees are useful tool for verifying the standard PSA Event Trees. • The ISA methodology takes into account the uncertainties in human action times. • The ISA methodology shows the Damage Exceedance Frequency increase in power uprates.

  11. Detecting Seismic Events Using a Supervised Hidden Markov Model

    Science.gov (United States)

    Burks, L.; Forrest, R.; Ray, J.; Young, C.

    2017-12-01

    We explore the use of supervised hidden Markov models (HMMs) to detect seismic events in streaming seismogram data. Current methods for seismic event detection include simple triggering algorithms, such as STA/LTA and the Z-statistic, which can lead to large numbers of false positives that must be investigated by an analyst. The hypothesis of this study is that more advanced detection methods, such as HMMs, may decreases false positives while maintaining accuracy similar to current methods. We train a binary HMM classifier using 2 weeks of 3-component waveform data from the International Monitoring System (IMS) that was carefully reviewed by an expert analyst to pick all seismic events. Using an ensemble of simple and discrete features, such as the triggering of STA/LTA, the HMM predicts the time at which transition occurs from noise to signal. Compared to the STA/LTA detection algorithm, the HMM detects more true events, but the false positive rate remains unacceptably high. Future work to potentially decrease the false positive rate may include using continuous features, a Gaussian HMM, and multi-class HMMs to distinguish between types of seismic waves (e.g., P-waves and S-waves). Acknowledgement: Sandia National Laboratories is a multi-mission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.SAND No: SAND2017-8154 A

  12. Engineering nanomaterials-based biosensors for food safety detection.

    Science.gov (United States)

    Lv, Man; Liu, Yang; Geng, Jinhui; Kou, Xiaohong; Xin, Zhihong; Yang, Dayong

    2018-05-30

    Food safety always remains a grand global challenge to human health, especially in developing countries. To solve food safety pertained problems, numerous strategies have been developed to detect biological and chemical contaminants in food. Among these approaches, nanomaterials-based biosensors provide opportunity to realize rapid, sensitive, efficient and portable detection, overcoming the restrictions and limitations of traditional methods such as complicated sample pretreatment, long detection time, and relying on expensive instruments and well-trained personnel. In this review article, we provide a cross-disciplinary perspective to review the progress of nanomaterials-based biosensors for the detection of food contaminants. The review article is organized by the category of food contaminants including pathogens/toxins, heavy metals, pesticides, veterinary drugs and illegal additives. In each category of food contaminant, the biosensing strategies are summarized including optical, colorimetric, fluorescent, electrochemical, and immune- biosensors; the relevant analytes, nanomaterials and biosensors are analyzed comprehensively. Future perspectives and challenges are also discussed briefly. We envision that our review could bridge the gap between the fields of food science and nanotechnology, providing implications for the scientists or engineers in both areas to collaborate and promote the development of nanomaterials-based biosensors for food safety detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Full-waveform detection of non-impulsive seismic events based on time-reversal methods

    Science.gov (United States)

    Solano, Ericka Alinne; Hjörleifsdóttir, Vala; Liu, Qinya

    2017-12-01

    We present a full-waveform detection method for non-impulsive seismic events, based on time-reversal principles. We use the strain Green's tensor as a matched filter, correlating it with continuous observed seismograms, to detect non-impulsive seismic events. We show that this is mathematically equivalent to an adjoint method for detecting earthquakes. We define the detection function, a scalar valued function, which depends on the stacked correlations for a group of stations. Event detections are given by the times at which the amplitude of the detection function exceeds a given value relative to the noise level. The method can make use of the whole seismic waveform or any combination of time-windows with different filters. It is expected to have an advantage compared to traditional detection methods for events that do not produce energetic and impulsive P waves, for example glacial events, landslides, volcanic events and transform-fault earthquakes for events which velocity structure along the path is relatively well known. Furthermore, the method has advantages over empirical Greens functions template matching methods, as it does not depend on records from previously detected events, and therefore is not limited to events occurring in similar regions and with similar focal mechanisms as these events. The method is not specific to any particular way of calculating the synthetic seismograms, and therefore complicated structural models can be used. This is particularly beneficial for intermediate size events that are registered on regional networks, for which the effect of lateral structure on the waveforms can be significant. To demonstrate the feasibility of the method, we apply it to two different areas located along the mid-oceanic ridge system west of Mexico where non-impulsive events have been reported. The first study area is between Clipperton and Siqueiros transform faults (9°N), during the time of two earthquake swarms, occurring in March 2012 and May

  14. Object-Oriented Query Language For Events Detection From Images Sequences

    Science.gov (United States)

    Ganea, Ion Eugen

    2015-09-01

    In this paper is presented a method to represent the events extracted from images sequences and the query language used for events detection. Using an object oriented model the spatial and temporal relationships between salient objects and also between events are stored and queried. This works aims to unify the storing and querying phases for video events processing. The object oriented language syntax used for events processing allow the instantiation of the indexes classes in order to improve the accuracy of the query results. The experiments were performed on images sequences provided from sport domain and it shows the reliability and the robustness of the proposed language. To extend the language will be added a specific syntax for constructing the templates for abnormal events and for detection of the incidents as the final goal of the research.

  15. TACKLING EVENT DETECTION IN THE CONTEXT OF VIDEO SURVEILLANCE

    Directory of Open Access Journals (Sweden)

    Raducu DUMITRESCU

    2011-11-01

    Full Text Available In this paper we address the problem of event detection in the context of video surveillance systems. First we deal with background extraction. Three methods are being tested, namely: frame differencing, running average and an estimate of median filtering technique. This provides information about changing contents. Further, we use this information to address human presence detection in the scene. This is carried out thought a contour-based approach. Contours are extracted from moving regions and parameterized. Human silhouettes show particular signatures of these parameters. Experimental results prove the potential of this approach to event detection. However, these are our first preliminary results to this application.

  16. External human induced events in site evaluation for nuclear power plants. Safety guide

    International Nuclear Information System (INIS)

    2004-01-01

    The purpose of the present Safety Guide is to provide recommendations and guidance for the examination of the region considered for site evaluation for a plant in order to identity hazardous phenomena associated with human induced events initiated by sources external to the plant. In some cases it also presents preliminary guidance for deriving values of relevant parameters for the design basis. This Safety Guide is also applicable for periodic site evaluation and site evaluation following a major human induced event, and for the design and operation of the site's environmental monitoring system. Site evaluation includes site characterization. Consideration of external events that could lead to a degradation of the safety features of the plant and cause a release of radioactive material from the plant and/or affect the dispersion of such material in the environment. And consideration of population issues and access issues significant to safety (such as the feasibility of evacuation, the population distribution and the location of resources). The process of site evaluation continues throughout the lifetime of the facility, from siting to design, construction, operation and decommissioning. The external human induced events considered in this Safety Guide are all of accidental origin. Considerations relating to the physical protection of the plant against wilful actions by third parties are outside its scope. However, the methods described herein may also have some application for the purposes of such physical protection. The present Safety Guide may also be used for events that may originate within the boundaries of the site, but from sources which are not directly involved in the operational states of the nuclear power plant units, such as fuel depots or areas for the storage of hazardous materials for the construction of other facilities at the same site. Special consideration should be given to the hazardous material handled during the construction, operation and

  17. Analytic 3D image reconstruction using all detected events

    International Nuclear Information System (INIS)

    Kinahan, P.E.; Rogers, J.G.

    1988-11-01

    We present the results of testing a previously presented algorithm for three-dimensional image reconstruction that uses all gamma-ray coincidence events detected by a PET volume-imaging scanner. By using two iterations of an analytic filter-backprojection method, the algorithm is not constrained by the requirement of a spatially invariant detector point spread function, which limits normal analytic techniques. Removing this constraint allows the incorporation of all detected events, regardless of orientation, which improves the statistical quality of the final reconstructed image

  18. Adaptive Sensor Tuning for Seismic Event Detection in Environment with Electromagnetic Noise

    Science.gov (United States)

    Ziegler, Abra E.

    The goal of this research is to detect possible microseismic events at a carbon sequestration site. Data recorded on a continuous downhole microseismic array in the Farnsworth Field, an oil field in Northern Texas that hosts an ongoing carbon capture, utilization, and storage project, were evaluated using machine learning and reinforcement learning techniques to determine their effectiveness at seismic event detection on a dataset with electromagnetic noise. The data were recorded from a passive vertical monitoring array consisting of 16 levels of 3-component 15 Hz geophones installed in the field and continuously recording since January 2014. Electromagnetic and other noise recorded on the array has significantly impacted the utility of the data and it was necessary to characterize and filter the noise in order to attempt event detection. Traditional detection methods using short-term average/long-term average (STA/LTA) algorithms were evaluated and determined to be ineffective because of changing noise levels. To improve the performance of event detection and automatically and dynamically detect seismic events using effective data processing parameters, an adaptive sensor tuning (AST) algorithm developed by Sandia National Laboratories was utilized. AST exploits neuro-dynamic programming (reinforcement learning) trained with historic event data to automatically self-tune and determine optimal detection parameter settings. The key metric that guides the AST algorithm is consistency of each sensor with its nearest neighbors: parameters are automatically adjusted on a per station basis to be more or less sensitive to produce consistent agreement of detections in its neighborhood. The effects that changes in neighborhood configuration have on signal detection were explored, as it was determined that neighborhood-based detections significantly reduce the number of both missed and false detections in ground-truthed data. The performance of the AST algorithm was

  19. Signal Detection of Imipenem Compared to Other Drugs from Korea Adverse Event Reporting System Database.

    Science.gov (United States)

    Park, Kyounghoon; Soukavong, Mick; Kim, Jungmee; Kwon, Kyoung Eun; Jin, Xue Mei; Lee, Joongyub; Yang, Bo Ram; Park, Byung Joo

    2017-05-01

    To detect signals of adverse drug events after imipenem treatment using the Korea Institute of Drug Safety & Risk Management-Korea adverse event reporting system database (KIDS-KD). We performed data mining using KIDS-KD, which was constructed using spontaneously reported adverse event (AE) reports between December 1988 and June 2014. We detected signals calculated the proportional reporting ratio, reporting odds ratio, and information component of imipenem. We defined a signal as any AE that satisfied all three indices. The signals were compared with drug labels of nine countries. There were 807582 spontaneous AEs reports in the KIDS-KD. Among those, the number of antibiotics related AEs was 192510; 3382 reports were associated with imipenem. The most common imipenem-associated AE was the drug eruption; 353 times. We calculated the signal by comparing with all other antibiotics and drugs; 58 and 53 signals satisfied the three methods. We compared the drug labelling information of nine countries, including the USA, the UK, Japan, Italy, Switzerland, Germany, France, Canada, and South Korea, and discovered that the following signals were currently not included in drug labels: hypokalemia, cardiac arrest, cardiac failure, Parkinson's syndrome, myocardial infarction, and prostate enlargement. Hypokalemia was an additional signal compared with all other antibiotics, and the other signals were not different compared with all other antibiotics and all other drugs. We detected new signals that were not listed on the drug labels of nine countries. However, further pharmacoepidemiologic research is needed to evaluate the causality of these signals. © Copyright: Yonsei University College of Medicine 2017

  20. Prescription-event monitoring: developments in signal detection.

    Science.gov (United States)

    Ferreira, Germano

    2007-01-01

    Prescription-event monitoring (PEM) is a non-interventional intensive method for post-marketing drug safety monitoring of newly licensed medicines. PEM studies are cohort studies where exposure is obtained from a centralised service and outcomes from simple questionnaires completed by general practitioners. Follow-up forms are sent for selected events. Because PEM captures all events and not only the suspected adverse drug reactions, PEM cohorts potentially differ in respect to the distribution of number of events per person depending on the nature of the drug under study. This variance can be related either with the condition for which the drug is prescribed (e.g. a condition causing high morbidity will have, in average, a higher number of events per person compared with a condition with lower morbidity) or with the drug effect itself. This paper describes an exploratory investigation of the distortion caused by product-related variations of the number of events to the interpretation of the proportional reporting ratio (PRR) values ("the higher the PRR, the greater the strength of the signal") computed using drug-cohort data. We studied this effect by assessing the agreement between the PRR based on events (event of interest vs all other events) and PRR based on cases (cases with the event of interest vs cases with any other events). PRR were calculated for all combinations reported to ten selected drugs against a comparator of 81 other drugs. Three of the ten drugs had a cohort with an apparent higher proportion of patients with lower number of events. The PRRs based on events were systematically higher than the PRR based on cases for the combinations reported to these three drugs. Additionally, when applying the threshold criteria for signal screening (n > or =3, PRR > or =1.5 and Chi-squared > or =4), the binary agreement was generally high but apparently lower for these three drugs. In conclusion, the distribution of events per patient in drug cohorts shall be

  1. Multilingual event extraction for epidemic detection.

    Science.gov (United States)

    Lejeune, Gaël; Brixtel, Romain; Doucet, Antoine; Lucas, Nadine

    2015-10-01

    This paper presents a multilingual news surveillance system applied to tele-epidemiology. It has been shown that multilingual approaches improve timeliness in detection of epidemic events across the globe, eliminating the wait for local news to be translated into major languages. We present here a system to extract epidemic events in potentially any language, provided a Wikipedia seed for common disease names exists. The Daniel system presented herein relies on properties that are common to news writing (the journalistic genre), the most useful being repetition and saliency. Wikipedia is used to screen common disease names to be matched with repeated characters strings. Language variations, such as declensions, are handled by processing text at the character-level, rather than at the word level. This additionally makes it possible to handle various writing systems in a similar fashion. As no multilingual ground truth existed to evaluate the Daniel system, we built a multilingual corpus from the Web, and collected annotations from native speakers of Chinese, English, Greek, Polish and Russian, with no connection or interest in the Daniel system. This data set is available online freely, and can be used for the evaluation of other event extraction systems. Experiments for 5 languages out of 17 tested are detailed in this paper: Chinese, English, Greek, Polish and Russian. The Daniel system achieves an average F-measure of 82% in these 5 languages. It reaches 87% on BEcorpus, the state-of-the-art corpus in English, slightly below top-performing systems, which are tailored with numerous language-specific resources. The consistent performance of Daniel on multiple languages is an important contribution to the reactivity and the coverage of epidemiological event detection systems. Most event extraction systems rely on extensive resources that are language-specific. While their sophistication induces excellent results (over 90% precision and recall), it restricts their

  2. Towards Detecting the Crowd Involved in Social Events

    Directory of Open Access Journals (Sweden)

    Wei Huang

    2017-10-01

    Full Text Available Knowing how people interact with urban environments is fundamental for a variety of fields, ranging from transportation to social science. Despite the fact that human mobility patterns have been a major topic of study in recent years, a challenge to understand large-scale human behavior when a certain event occurs remains due to a lack of either relevant data or suitable approaches. Psychological crowd refers to a group of people who are usually located at different places and show different behaviors, but who are very sensitively driven to take the same act (gather together by a certain event, which has been theoretically studied by social psychologists since the 19th century. This study aims to propose a computational approach using a machine learning method to model psychological crowds, contributing to the better understanding of human activity patterns under events. Psychological features and mental unity of the crowd are computed to detect the involved individuals. A national event happening across the USA in April, 2015 is analyzed using geotagged tweets as a case study to test our approach. The result shows that 81% of individuals in the crowd can be successfully detected. Through investigating the geospatial pattern of the involved users, not only can the event related users be identified but also those unobserved users before the event can be uncovered. The proposed approach can effectively represent the psychological feature and measure the mental unity of the psychological crowd, which sheds light on the study of large-scale psychological crowd and provides an innovative way to understanding human behavior under events.

  3. Effects of an educational patient safety campaign on patients' safety behaviours and adverse events.

    Science.gov (United States)

    Schwappach, David L B; Frank, Olga; Buschmann, Ute; Babst, Reto

    2013-04-01

    Rationale, aims and objectives  The study aims to investigate the effects of a patient safety advisory on patients' risk perceptions, perceived behavioural control, performance of safety behaviours and experience of adverse incidents. Method  Quasi-experimental intervention study with non-equivalent group comparison was used. Patients admitted to the surgical department of a Swiss large non-university hospital were included. Patients in the intervention group received a safety advisory at their first clinical encounter. Outcomes were assessed using a questionnaire at discharge. Odds ratios for control versus intervention group were calculated. Regression analysis was used to model the effects of the intervention and safety behaviours on the experience of safety incidents. Results  Two hundred eighteen patients in the control and 202 in the intervention group completed the survey (75 and 77% response rates, respectively). Patients in the intervention group were less likely to feel poorly informed about medical errors (OR = 0.55, P = 0.043). There were 73.1% in the intervention and 84.3% in the control group who underestimated the risk for infection (OR = 0.51, CI 0.31-0.84, P = 0.009). Perceived behavioural control was lower in the control group (meanCon  = 3.2, meanInt  = 3.5, P = 0.010). Performance of safety-related behaviours was unaffected by the intervention. Patients in the intervention group were less likely to experience any safety-related incident or unsafe situation (OR for intervention group = 0.57, CI 0.38-0.87, P = 0.009). There were no differences in concerns for errors during hospitalization. There were 96% of patients (intervention) who would recommend other patients to read the advisory. Conclusions  The results suggest that the safety advisory decreases experiences of adverse events and unsafe situations. It renders awareness and perceived behavioural control without increasing concerns for safety and

  4. 75 FR 35650 - Safety Zone; Northern California Annual Fireworks Events, Independence Day Fireworks

    Science.gov (United States)

    2010-06-23

    ... Zone; Northern California Annual Fireworks Events, Independence Day Fireworks AGENCY: Coast Guard, DHS... July Fireworks safety zone from 7 a.m. through 10 p.m. on July 3, 2010 in position 39[deg]13'55.37'' N... will enforce the safety zone for the annual Kings Beach 4th of July Fireworks in 33 CFR 165.1191 on...

  5. An integrated logit model for contamination event detection in water distribution systems.

    Science.gov (United States)

    Housh, Mashor; Ostfeld, Avi

    2015-05-15

    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Undetected latent failures of safety-related systems. Preliminary survey of events in nuclear power plants 1980-1997

    International Nuclear Information System (INIS)

    Lydell, B.

    1998-03-01

    This report summarizes results and insights from a preliminary survey of events involving undetected, latent failures of safety-related systems. The survey was limited to events where mispositioned equipment (e.g., valves, switches) remained undetected, thus rendering standby equipment or systems unavailable for short or long time periods. Typically, these events were symptoms of underlying latent errors (e.g., design errors, procedure errors, unanalyzed safety conditions) and programmatic errors. The preliminary survey identified well over 300 events. Of these, 95 events are documented in this report. Events involving mispositioned equipment are commonplace. Most events are discovered soon after occurrence, however. But as evidenced by the survey results, some events remained undetected beyond several shift changes. The recommendations developed by the survey emphasize the importance of applying modern root cause analysis techniques to the event analysis to ensure that the causes and implications of occurred events are fully understood

  7. A simple strategy for fall events detection

    KAUST Repository

    Harrou, Fouzi; Zerrouki, Nabil; Sun, Ying; Houacine, Amrane

    2017-01-01

    the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart

  8. Safety Assessment for transient event occurred during the ASTS test of Hanbit Unit 2

    International Nuclear Information System (INIS)

    Yang, Changkeun; Kim, Yohan; Ha, Sangjun

    2014-01-01

    Safety Injection has been actuated during the ASTS (Automatic Seismic Trip System) test of Hanbit Unit 2 on Feb. 28, 2014. It could be bad effect on system integrity. KHNP has been performed safety assessment of system for effect of Safety Injection (SI) actuation occurred during the ASTS test of hanbit Unit 2. Stable state of nuclear power plant system has been confirmed according to Safety Injection and reactor trip event occurred during the ASTS test of hanbit Unit 2. In the result of system safety assessment, major variables of nuclear power plant are located in optimal range and not exceed safety limit. It remains nuclear fuel and the integrity of the power plant is in a safe condition were conformed. After ASTS action, thermal elimination has been processed throughout the turbine until turbine signal occurrence because ASTS is connected to M-G set in the present hanbit Unit 2. Therefore, Safety Injection signal has been actuated by rapid reduction of Steam Generator pressure. In this paper, it is concluded that consideration of equipment and setpoint is needed for that Safety Injection has been not occurred under the unnecessary situation. Stable state of nuclear power plant system has been confirmed for Safety Injection and reactor trip event occurred during the ASTS test of hanbit Unit 2. In the result of system safety assessment, major variables of nuclear power plant are located in optimal range and not exceed safety limit. It remains nuclear fuel and the integrity of the plant is in a safe condition were conformed. It is concluded that consideration of equipment and setpoint is needed for that Safety Injection has been not occurred under the unnecessary situation

  9. Coordinated research programme on safety of RBMK type NPPs in relation to external events. V. 1. Working material

    International Nuclear Information System (INIS)

    1999-01-01

    The present volume is a collection of progress reports which have been submitted within the scope of the CRP on safety of RBMK type NPPs in relation to external events including seismic related papers and man-induced events (explosions and airplane crash). It includes papers concerned with experience related to RBMK equipment testing and calculations of seismic resistance, soil-structure interactions analysis, safety assurance, aircraft impact qualification and other external events for RBMK type NPP, seismic stability of NPPs in Eastern Europe, probabilistic assessment of NPP safety under aircraft impact, dynamic analysis of NPPs, screening of external hazards for NPP

  10. Safety management as a foundation for evidence-based aeromedical standards and reporting of medical events.

    Science.gov (United States)

    Evans, Anthony D; Watson, Dougal B; Evans, Sally A; Hastings, John; Singh, Jarnail; Thibeault, Claude

    2009-06-01

    The different interpretations by States (countries) of the aeromedical standards established by the International Civil Aviation Organization has resulted in a variety of approaches to the development of national aeromedical policy, and consequently a relative lack of harmonization. However, in many areas of aviation, safety management systems have been recently introduced and may represent a way forward. A safety management system can be defined as "A systematic approach to managing safety, including the necessary organizational structures, accountabilities, policies, and procedures" (1). There are four main areas where, by applying safety management principles, it may be possible to better use aeromedical data to enhance flight safety. These are: 1) adjustment of the periodicity and content of routine medical examinations to more accurately reflect aeromedical risk; 2) improvement in reporting and analysis of routine medical examination data; 3) improvement in reporting and analysis of in-flight medical events; and 4) support for improved reporting of relevant aeromedical events through the promotion of an appropriate culture by companies and regulatory authorities. This paper explores how the principles of safety management may be applied to aeromedical systems to improve their contribution to safety.

  11. EDICAM (Event Detection Intelligent Camera)

    Energy Technology Data Exchange (ETDEWEB)

    Zoletnik, S. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Szabolics, T., E-mail: szabolics.tamas@wigner.mta.hu [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Kocsis, G.; Szepesi, T.; Dunai, D. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary)

    2013-10-15

    Highlights: ► We present EDICAM's hardware modules. ► We present EDICAM's main design concepts. ► This paper will describe EDICAM firmware architecture. ► Operation principles description. ► Further developments. -- Abstract: A new type of fast framing camera has been developed for fusion applications by the Wigner Research Centre for Physics during the last few years. A new concept was designed for intelligent event driven imaging which is capable of focusing image readout to Regions of Interests (ROIs) where and when predefined events occur. At present these events mean intensity changes and external triggers but in the future more sophisticated methods might also be defined. The camera provides 444 Hz frame rate at full resolution of 1280 × 1024 pixels, but monitoring of smaller ROIs can be done in the 1–116 kHz range even during exposure of the full image. Keeping space limitations and the harsh environment in mind the camera is divided into a small Sensor Module and a processing card interconnected by a fast 10 Gbit optical link. This camera hardware has been used for passive monitoring of the plasma in different devices for example at ASDEX Upgrade and COMPASS with the first version of its firmware. The new firmware and software package is now available and ready for testing the new event processing features. This paper will present the operation principle and features of the Event Detection Intelligent Camera (EDICAM). The device is intended to be the central element in the 10-camera monitoring system of the Wendelstein 7-X stellarator.

  12. Contamination Event Detection with Multivariate Time-Series Data in Agricultural Water Monitoring

    Directory of Open Access Journals (Sweden)

    Yingchi Mao

    2017-12-01

    Full Text Available Time series data of multiple water quality parameters are obtained from the water sensor networks deployed in the agricultural water supply network. The accurate and efficient detection and warning of contamination events to prevent pollution from spreading is one of the most important issues when pollution occurs. In order to comprehensively reduce the event detection deviation, a spatial–temporal-based event detection approach with multivariate time-series data for water quality monitoring (M-STED was proposed. The M-STED approach includes three parts. The first part is that M-STED adopts a Rule K algorithm to select backbone nodes as the nodes in the CDS, and forward the sensed data of multiple water parameters. The second part is to determine the state of each backbone node with back propagation neural network models and the sequential Bayesian analysis in the current timestamp. The third part is to establish a spatial model with Bayesian networks to estimate the state of the backbones in the next timestamp and trace the “outlier” node to its neighborhoods to detect a contamination event. The experimental results indicate that the average detection rate is more than 80% with M-STED and the false detection rate is lower than 9%, respectively. The M-STED approach can improve the rate of detection by about 40% and reduce the false alarm rate by about 45%, compared with the event detection with a single water parameter algorithm, S-STED. Moreover, the proposed M-STED can exhibit better performance in terms of detection delay and scalability.

  13. Energy-Efficient Fault-Tolerant Dynamic Event Region Detection in Wireless Sensor Networks

    DEFF Research Database (Denmark)

    Enemark, Hans-Jacob; Zhang, Yue; Dragoni, Nicola

    2015-01-01

    to a hybrid algorithm for dynamic event region detection, such as real-time tracking of chemical leakage regions. Considering the characteristics of the moving away dynamic events, we propose a return back condition for the hybrid algorithm from distributed neighborhood collaboration, in which a node makes......Fault-tolerant event detection is fundamental to wireless sensor network applications. Existing approaches usually adopt neighborhood collaboration for better detection accuracy, while need more energy consumption due to communication. Focusing on energy efficiency, this paper makes an improvement...... its detection decision based on decisions received from its spatial and temporal neighbors, to local non-communicative decision making. The simulation results demonstrate that the improved algorithm does not degrade the detection accuracy of the original algorithm, while it has better energy...

  14. Basic Safety Considerations for Nuclear Power Plant Dealing with External Human Induced Events

    Energy Technology Data Exchange (ETDEWEB)

    Salem, W., E-mail: wafaasalem21@yahoo.com [Nuclear and Radiological Regulatory Authority (Egypt)

    2014-10-15

    Facilities and human activities in the region in which a nuclear power plant is located may under some conditions affect its safety. The potential sources of human induced events external to the plant should be identified and the severity of the possible resulting hazard phenomena should be evaluated to derive the appropriate design bases for the plant. They should also be monitored and periodically assessed over the lifetime of the plant to ensure that consistency with the design assumptions is maintained. External human induced events that could affect safety should be investigated in the site evaluation stage for every nuclear power plant site. The region is required to be examined for facilities and human activities that have the potential, under certain conditions, to endanger the nuclear power plant over its entire lifetime. Each relevant potential source is required to be identified and assessed to determine the potential interactions with personnel and plant items important to safety. (author)

  15. Analysis of area events as part of probabilistic safety assessment for Romanian TRIGA SSR 14 MW reactor

    International Nuclear Information System (INIS)

    Mladin, D.; Stefan, I.

    2005-01-01

    The international experience has shown that the external events could be an important contributor to plant/ reactor risk. For this reason such events have to be included in the PSA studies. In the context of PSA for nuclear facilities, external events are defined as events originating from outside the plant, but with the potential to create an initiating event at the plant. To support plant safety assessment, PSA can be used to find methods for identification of vulnerable features of the plant and to suggest modifications in order to mitigate the impact of external events or the producing of initiating events. For that purpose, probabilistic assessment of area events concerning fire and flooding risk and impact is necessary. Due to the relatively large power level amongst research reactors, the approach to safety analysis of Romanian 14 MW TRIGA benefits from an ongoing PSA project. In this context, treatment of external events should be considered. The specific tasks proposed for the complete evaluation of area event analysis are: identify the rooms important for facility safety, determine a relative area event risk index for these rooms and a relative area event impact index if the event occurs, evaluate the rooms specific area event frequency, determine the rooms contribution to reactor hazard state frequencies, analyze power supply and room dependencies of safety components (as pumps, motor operated valves). The fire risk analysis methodology is based on Berry's method [1]. This approach provides a systematic procedure to carry out a relative index of different rooms. The factors, which affect the fire probability, are: personal presence in the room, number and type of ignition sources, type and area of combustibles, fuel available in the room, fuel location, and ventilation. The flooding risk analysis is based on the amount of piping in the room. For accuracy of the information regarding piping a facility walk-about is necessary. In case of flooding risk

  16. Undetected latent failures of safety-related systems. Preliminary survey of events in nuclear power plants 1980-1997

    Energy Technology Data Exchange (ETDEWEB)

    Lydell, B. [RSA Technologies, Vista, CA (United States)

    1998-03-01

    This report summarizes results and insights from a preliminary survey of events involving undetected, latent failures of safety-related systems. The survey was limited to events where mispositioned equipment (e.g., valves, switches) remained undetected, thus rendering standby equipment or systems unavailable for short or long time periods. Typically, these events were symptoms of underlying latent errors (e.g., design errors, procedure errors, unanalyzed safety conditions) and programmatic errors. The preliminary survey identified well over 300 events. Of these, 95 events are documented in this report. Events involving mispositioned equipment are commonplace. Most events are discovered soon after occurrence, however. But as evidenced by the survey results, some events remained undetected beyond several shift changes. The recommendations developed by the survey emphasize the importance of applying modern root cause analysis techniques to the event analysis to ensure that the causes and implications of occurred events are fully understood. 7 refs, 4 tabs, 3 figs. Also available at the SKI Home page: //www.ski.se.

  17. An Event Reporting and Early-Warning Safety System Based on the Internet of Things for Underground Coal Mines: A Case Study

    Directory of Open Access Journals (Sweden)

    Byung Wan Jo

    2017-09-01

    Full Text Available Fatal accidents associated with underground coal mines require the implementation of high-level gas monitoring and miner’s localization approaches to promote underground safety and health. This study introduces a real-time monitoring, event-reporting and early-warning platform, based on cluster analysis for outlier detection, spatiotemporal statistical analysis, and an RSS range-based weighted centroid localization algorithm for improving safety management and preventing accidents in underground coal mines. The proposed platform seamlessly integrates monitoring, analyzing, and localization approaches using the Internet of Things (IoT, cloud computing, a real-time operational database, application gateways, and application program interfaces. The prototype has been validated and verified at the operating underground Hassan Kishore coal mine. Sensors for air quality parameters including temperature, humidity, CH4, CO2, and CO demonstrated an excellent performance, with regression constants always greater than 0.97 for each parameter when compared to their commercial equivalent. This framework enables real-time monitoring, identification of abnormal events (>90%, and verification of a miner’s localization (with <1.8 m of error in the harsh environment of underground mines. The main contribution of this study is the development of an open source, customizable, and cost-effective platform for effectively promoting underground coal mine safety. This system is helpful for solving the problems of accessibility, serviceability, interoperability, and flexibility associated with safety in coal mines.

  18. 75 FR 19304 - Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone

    Science.gov (United States)

    2010-04-14

    ... previously published in Coast Guard regulations. These safety zones are necessary to protect spectators...-AA00 Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone AGENCY: Coast Guard, DHS. ACTION: Notice of proposed rulemaking. SUMMARY: The Coast Guard proposes establishment of safety...

  19. The effect of stimulus modality on signal detection: implications for assessing the safety of in-vehicle technology.

    Science.gov (United States)

    Merat, Natasha; Jamson, A Hamish

    2008-02-01

    This study examined the effect of two in-vehicle information systems (IVIS) on signal detection in the visual, auditory, and tactile modalities; established whether the detrimental effects of an IVIS on driving could be quantified by these detection tasks; and examined the effect of stimulus modality on signal detection. The peripheral detection task has been used widely for assessing the effects of an IVIS on driving. However, performance on this task relies on drivers' ability to see a series of LEDs, which can be problematic in field tests (e.g., on sunny days). Participants responded to one of three detection tasks during a simulated driving experiment. The effect of IVIS interaction on these detection tasks was also measured. Reduced performance in the detection tasks was assumed to indicate a decline in drivers' ability to handle sudden events in the driving task. Response time to all detection tasks increased by around 200 ms when drivers performed the IVIS tasks, as compared with baseline driving. Analyses of variance and comparison of effect sizes showed the effects of these two IVISs to be the same across the three detection tasks. These detection tasks are useful for quantifying the safety of an IVIS during driving. The absence of a difference in signal detection by modality suggests that performance on these tasks relies on general attentional resources and is not modality specific. The signal detection tasks employed here should be further investigated for their suitability in assessing the safety of in-vehicle systems.

  20. Guide on a national system for collecting, assessing and disseminating information on safety-related events in nuclear power plants

    International Nuclear Information System (INIS)

    1983-02-01

    There is a wide spectrum of safety significance in the events that can occur during nuclear power plant operations. It is important that lessons be learned from safety-related events (hereinafter referred to as unusual events) so as to improve the safety of nuclear power plants. Hence formal procedures should be established for this purpose. The purpose of this document is to provide guidance to Member States for establishing a system (hereinafter referred to as a national system) for collecting, storing, retrieving, assessing and disseminating information on unusual events in nuclear power plants. The guidance given is based on experience gained in the use of existing national and international systems. This guide covers a national system that is part of a programme to improve nuclear power plant safety using experience gained from operating plants both within and outside the country. Implementing the recommendations in this guide would render any national system compatible with other national systems and facilitate the participation in the IAEA System for Reporting Unusual Events with Safety Significance (hereinafter referred to as the IAEA Incident Reporting System, IAEA-IRS) for more widespread dissemination of lessons learned from nuclear power plant operation

  1. Sudden Event Recognition: A Survey

    Directory of Open Access Journals (Sweden)

    Mohd Asyraf Zulkifley

    2013-08-01

    Full Text Available Event recognition is one of the most active research areas in video surveillance fields. Advancement in event recognition systems mainly aims to provide convenience, safety and an efficient lifestyle for humanity. A precise, accurate and robust approach is necessary to enable event recognition systems to respond to sudden changes in various uncontrolled environments, such as the case of an emergency, physical threat and a fire or bomb alert. The performance of sudden event recognition systems depends heavily on the accuracy of low level processing, like detection, recognition, tracking and machine learning algorithms. This survey aims to detect and characterize a sudden event, which is a subset of an abnormal event in several video surveillance applications. This paper discusses the following in detail: (1 the importance of a sudden event over a general anomalous event; (2 frameworks used in sudden event recognition; (3 the requirements and comparative studies of a sudden event recognition system and (4 various decision-making approaches for sudden event recognition. The advantages and drawbacks of using 3D images from multiple cameras for real-time application are also discussed. The paper concludes with suggestions for future research directions in sudden event recognition.

  2. 77 FR 64411 - Safety Zone; Cooper T. Smith Fireworks Event; Mobile River; Mobile, AL

    Science.gov (United States)

    2012-10-22

    ... 1625-AA00 Safety Zone; Cooper T. Smith Fireworks Event; Mobile River; Mobile, AL AGENCY: Coast Guard... safety zone for a portion of the Mobile River, Mobile, AL in the vicinity of Cooper Riverside Park. This..., mariners, and persons unless specifically authorized by the Captain of the Port Mobile or a designated...

  3. Development of accident event trees and evaluation of safety system failure modes for the nuclear ultra large crude carrier

    International Nuclear Information System (INIS)

    Lewe, C.K.; Coffey, R.S.; Goodwin, E.F.; Maltese, J.G.; Pyatt, D.W.

    1978-01-01

    A method of applying the probabilistic accident event tree methodology to safety assessments of a nuclear powered Ultra Large Crude Carrier is presented. Also presented are the procedures by which an external accident initiating event, such as a ship collision, may be correlated with the probabilities of damage to the ship's safety systems and to their ultimate availabilities to perform required safety functions

  4. Detecting failure events in buildings: a numerical and experimental analysis

    OpenAIRE

    Heckman, V. M.; Kohler, M. D.; Heaton, T. H.

    2010-01-01

    A numerical method is used to investigate an approach for detecting the brittle fracture of welds associated with beam -column connections in instrumented buildings in real time through the use of time-reversed Green’s functions and wave propagation reciprocity. The approach makes use of a prerecorded catalog of Green’s functions for an instrumented building to detect failure events in the building during a later seismic event by screening continuous data for the presence of wavef...

  5. Abnormal Event Detection Using Local Sparse Representation

    DEFF Research Database (Denmark)

    Ren, Huamin; Moeslund, Thomas B.

    2014-01-01

    We propose to detect abnormal events via a sparse subspace clustering algorithm. Unlike most existing approaches, which search for optimized normal bases and detect abnormality based on least square error or reconstruction error from the learned normal patterns, we propose an abnormality measurem...... is found that satisfies: the distance between its local space and the normal space is large. We evaluate our method on two public benchmark datasets: UCSD and Subway Entrance datasets. The comparison to the state-of-the-art methods validate our method's effectiveness....

  6. The value of Doppler LiDAR systems to monitor turbulence intensity during storm events in order to enhance aviation safety in Iceland

    Science.gov (United States)

    Yang, Shu; Nína Petersen, Guðrún; Finger, David C.

    2017-04-01

    Turbulence and wind shear are a major natural hazards for aviation safety in Iceland. The temporal and spatial scale of atmospheric turbulence is very dynamic, requiring an adequate method to detect and monitor turbulence with high resolution. The Doppler Light Detection and Ranging (LiDAR) system can provide continuous information about the wind field using the Doppler effect form emitted light signals. In this study, we use a Leosphere Windcube 200s LiDAR systems stationed near Reykjavik city Airport and at Keflavik International Airport, Iceland, to evaluate turbulence intensity by estimating eddy dissipation rate (EDR). For this purpose, we retrieved radial wind velocity observations from Velocity Azimuth Display (VAD) scans (360°scans at 15° and 75° elevation angle) to compute EDR. The method was used to monitor and characterize storm events in fall 2016 and the following winter. The preliminary result reveal that the LiDAR observations can detect and quantify atmospheric turbulence with high spatial and temporal resolution. This finding is an important step towards enhanced aviation safety in subpolar climate characterized by sever wind turbulence.

  7. Adaptive prediction applied to seismic event detection

    International Nuclear Information System (INIS)

    Clark, G.A.; Rodgers, P.W.

    1981-01-01

    Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data

  8. A study of the recovery from 120 events

    International Nuclear Information System (INIS)

    Baumont, Genevieve; Menage, F.; Bigot, F.

    1998-01-01

    The author reports a study which aimed at providing additional information for improving safety by using event analysis. The approach concentrates on the dynamics of error detection and the way errors and shortcomings are managed. The study is based on a systematic analysis of 120 events in nuclear power plants. The authors first outline the differences between the activities described in significant events and that which is assumed to take place during event and accident situations. They describe the methods used to transpose human reliability PSA model to event analysis, report the analysis (event selection, data studied during event analysis, types of errors). Studies concern events during power operation or plant outage. Results are analyzed in terms of number of events, percentage of error type, percentage of activation of engineered safety features before operators recovered the situation. They comment who recovers the error and how it is recovered, and more precisely discuss the case of multiple error situations

  9. Towards Optimal Event Detection and Localization in Acyclic Flow Networks

    KAUST Repository

    Agumbe Suresh, Mahima

    2012-01-03

    Acyclic flow networks, present in many infrastructures of national importance (e.g., oil & gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures, have been proven costly and imprecise, especially when dealing with large scale distribution systems. In this paper, to the best of our knowledge for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. Sensor nodes move along the edges of the network and detect events (i.e., attacks) and proximity to beacon nodes with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensor and beacon nodes deployed), while ensuring a degree of sensing coverage in a zone of interest and a required accuracy in locating events. We propose algorithms for solving these problems and demonstrate their effectiveness with results obtained from a high fidelity simulator.

  10. Evaluation of a Broad-Spectrum Partially Automated Adverse Event Surveillance System: A Potential Tool for Patient Safety Improvement in Hospitals With Limited Resources.

    Science.gov (United States)

    Saikali, Melody; Tanios, Alain; Saab, Antoine

    2017-11-21

    The aim of the study was to evaluate the sensitivity and resource efficiency of a partially automated adverse event (AE) surveillance system for routine patient safety efforts in hospitals with limited resources. Twenty-eight automated triggers from the hospital information system's clinical and administrative databases identified cases that were then filtered by exclusion criteria per trigger and then reviewed by an interdisciplinary team. The system, developed and implemented using in-house resources, was applied for 45 days of surveillance, for all hospital inpatient admissions (N = 1107). Each trigger was evaluated for its positive predictive value (PPV). Furthermore, the sensitivity of the surveillance system (overall and by AE category) was estimated relative to incidence ranges in the literature. The surveillance system identified a total of 123 AEs among 283 reviewed medical records, yielding an overall PPV of 52%. The tool showed variable levels of sensitivity across and within AE categories when compared with the literature, with a relatively low overall sensitivity estimated between 21% and 44%. Adverse events were detected in 23 of the 36 AE categories defined by an established harm classification system. Furthermore, none of the detected AEs were voluntarily reported. The surveillance system showed variable sensitivity levels across a broad range of AE categories with an acceptable PPV, overcoming certain limitations associated with other harm detection methods. The number of cases captured was substantial, and none had been previously detected or voluntarily reported. For hospitals with limited resources, this methodology provides valuable safety information from which interventions for quality improvement can be formulated.

  11. Evaluation of common mode failure of safety functions for limiting fault events

    International Nuclear Information System (INIS)

    Rezendes, J.P.; Hyde, A.W.

    2004-01-01

    The draft U.S. Nuclear Regulatory Commission (NRC) policy on digital protection system software requires all Advanced Light Water Reactors (ALWRs) to be evaluated assuming a hypothetical common mode failure (CMF) which incapacitates the normal automatic initiation of safety functions. The System 80 + ALWR has been evaluated for such hypothetical conditions. The results show that the diverse automatic and manual protective systems in System 80 + provide ample safety performance margins relative to core coolability, offsite radiological releases. Reactor Coolant System (RCS) pressurization and containment integrity. This deterministic evaluation served to quantify the significant inherent safety margins in the System 80 + Standard Plant design even in the event of this extremely low probability scenario of a common mode failure. (author)

  12. Event Detection Challenges, Methods, and Applications in Natural and Artificial Systems

    Science.gov (United States)

    2009-03-01

    Sauvageon, Agogino, Mehr, and Tumer [2006], for instance, use a fourth degree polynomial within an event detection algorithm to sense high... cancer , and coronary artery disease. His study examines the age at which to begin screening exams, the intervals between the exams, and (possibly...AM, Mehr AF, and Tumer IY. 2006. “Comparison of Event Detection Methods for Centralized Sensor Networks.” IEEE Sensors Applications Symposium 2006

  13. National Earthquake Information Center Seismic Event Detections on Multiple Scales

    Science.gov (United States)

    Patton, J.; Yeck, W. L.; Benz, H.; Earle, P. S.; Soto-Cordero, L.; Johnson, C. E.

    2017-12-01

    The U.S. Geological Survey National Earthquake Information Center (NEIC) monitors seismicity on local, regional, and global scales using automatic picks from more than 2,000 near-real time seismic stations. This presents unique challenges in automated event detection due to the high variability in data quality, network geometries and density, and distance-dependent variability in observed seismic signals. To lower the overall detection threshold while minimizing false detection rates, NEIC has begun to test the incorporation of new detection and picking algorithms, including multiband (Lomax et al., 2012) and kurtosis (Baillard et al., 2014) pickers, and a new bayesian associator (Glass 3.0). The Glass 3.0 associator allows for simultaneous processing of variably scaled detection grids, each with a unique set of nucleation criteria (e.g., nucleation threshold, minimum associated picks, nucleation phases) to meet specific monitoring goals. We test the efficacy of these new tools on event detection in networks of various scales and geometries, compare our results with previous catalogs, and discuss lessons learned. For example, we find that on local and regional scales, rapid nucleation of small events may require event nucleation with both P and higher-amplitude secondary phases (e.g., S or Lg). We provide examples of the implementation of a scale-independent associator for an induced seismicity sequence (local-scale), a large aftershock sequence (regional-scale), and for monitoring global seismicity. Baillard, C., Crawford, W. C., Ballu, V., Hibert, C., & Mangeney, A. (2014). An automatic kurtosis-based P-and S-phase picker designed for local seismic networks. Bulletin of the Seismological Society of America, 104(1), 394-409. Lomax, A., Satriano, C., & Vassallo, M. (2012). Automatic picker developments and optimization: FilterPicker - a robust, broadband picker for real-time seismic monitoring and earthquake early-warning, Seism. Res. Lett. , 83, 531-540, doi: 10

  14. Adaptive prediction applied to seismic event detection

    Energy Technology Data Exchange (ETDEWEB)

    Clark, G.A.; Rodgers, P.W.

    1981-09-01

    Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data.

  15. First CNGS events detected by LVD

    International Nuclear Information System (INIS)

    Selvi, M.

    2007-01-01

    The Cern Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at Cern and send it towards the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Montecarlo simulations

  16. Context-aware event detection smartphone application for first responders

    Science.gov (United States)

    Boddhu, Sanjay K.; Dave, Rakesh P.; McCartney, Matt; West, James A.; Williams, Robert L.

    2013-05-01

    The rise of social networking platforms like Twitter, Facebook, etc…, have provided seamless sharing of information (as chat, video and other media) among its user community on a global scale. Further, the proliferation of the smartphones and their connectivity networks has powered the ordinary individuals to share and acquire information regarding the events happening in his/her immediate vicinity in a real-time fashion. This human-centric sensed data being generated in "human-as-sensor" approach is tremendously valuable as it delivered mostly with apt annotations and ground truth that would be missing in traditional machine-centric sensors, besides high redundancy factor (same data thru multiple users). Further, when appropriately employed this real-time data can support in detecting localized events like fire, accidents, shooting, etc…, as they unfold and pin-point individuals being affected by those events. This spatiotemporal information, when made available for first responders in the event vicinity (or approaching it) can greatly assist them to make effective decisions to protect property and life in a timely fashion. In this vein, under SATE and YATE programs, the research team at AFRL Tec^Edge Discovery labs had demonstrated the feasibility of developing Smartphone applications, that can provide a augmented reality view of the appropriate detected events in a given geographical location (localized) and also provide an event search capability over a large geographic extent. In its current state, the application thru its backend connectivity utilizes a data (Text & Image) processing framework, which deals with data challenges like; identifying and aggregating important events, analyzing and correlating the events temporally and spatially and building a search enabled event database. Further, the smartphone application with its backend data processing workflow has been successfully field tested with live user generated feeds.

  17. Safety based on organisational learning (SOL) - Conceptual approach and verification of a method for event analysis

    International Nuclear Information System (INIS)

    Miller, R.; Wilpert, B.; Fahlbruch, B.

    1999-01-01

    This paper discusses a method for analysing safety-relevant events in NPP which is known as 'SOL', safety based on organisational learning. After discussion of the specific organisational and psychological problems examined in the event analysis, the analytic process using the SOL approach is explained as well as the required general setting. The SOL approach has been tested both with scientific experiments and from the practical perspective, by operators of NPPs and experts from other branches of industry. (orig./CB) [de

  18. Impact of sensor detection limits on protecting water distribution systems from contamination events

    International Nuclear Information System (INIS)

    McKenna, Sean Andrew; Hart, David Blaine; Yarrington, Lane

    2006-01-01

    Real-time water quality sensors are becoming commonplace in water distribution systems. However, field deployable, contaminant-specific sensors are still in the development stage. As development proceeds, the necessary operating parameters of these sensors must be determined to protect consumers from accidental and malevolent contamination events. This objective can be quantified in several different ways including minimization of: the time necessary to detect a contamination event, the population exposed to contaminated water, the extent of the contamination within the network, and others. We examine the ability of a sensor set to meet these objectives as a function of both the detection limit of the sensors and the number of sensors in the network. A moderately sized distribution network is used as an example and different sized sets of randomly placed sensors are considered. For each combination of a certain number of sensors and a detection limit, the mean values of the different objectives across multiple random sensor placements are calculated. The tradeoff between the necessary detection limit in a sensor and the number of sensors is evaluated. Results show that for the example problem examined here, a sensor detection limit of 0.01 of the average source concentration is adequate for maximum protection. Detection of events is dependent on the detection limit of the sensors, but for those events that are detected, the values of the performance measures are not a function of the sensor detection limit. The results of replacing a single sensor in a network with a sensor having a much lower detection limit show that while this replacement can improve results, the majority of the additional events detected had performance measures of relatively low consequence.

  19. Feedback from peer review missions of the self-assessment of operational events reflecting safety culture (Leningrad, Smolemsk and Balakovo NPP's, the Russian Federation)

    International Nuclear Information System (INIS)

    Gantchev, T.

    1997-01-01

    The presentation discusses the following issues: criteria for reporting events inside NPP; screening of the plant operational events; third safety culture indicator; list of the pending safety problems; significance of the safety problems for plant reliability; prioritization of the safety culture issues. Tabs

  20. Neutron detector for detecting rare events of spontaneous fission

    International Nuclear Information System (INIS)

    Ter-Akop'yan, G.M.; Popeko, A.G.; Sokol, E.A.; Chelnokov, L.P.; Smirnov, V.I.; Gorshkov, V.A.

    1981-01-01

    The neutron detector for registering rare events of spontaneous fission by detecting multiple neutron emission is described. The detector represents a block of plexiglas of 550 mm diameter and 700 mm height in the centre of which there is a through 160 mm diameter channel for the sample under investigation. The detector comprises 56 3 He filled counters (up to 7 atm pressure) with 1% CO 2 addition. The counters have a 500 mm length and a 32 mm diameter. The sampling of fission events is realized by an electron system which allows determining the number of detected neutrons, numbers of operated counters, signal amplitude and time for fission event detecting. A block diagram of a neutron detector electron system is presented and its operation principle is considered. For protection against cosmic radiation the detector is surronded by a system of plastic scintillators and placed behind the concrete shield of 6 m thickness. The results of measurements of background radiation are given. It has been found that the background radiation of single neutron constitutes about 150 counts per hour, the detecting efficiency of single neutron equals 0.483 +- 0.005, for a 10l detector sensitive volume. By means of the detector described the parameters of multiplicity distribution of prompt neutrons for 256 Fm spontaneous fission are measured. The average multiplicity equals 3.59+-0.06 the dispersion being 2.30+-0.65

  1. Machine learning for the automatic detection of anomalous events

    Science.gov (United States)

    Fisher, Wendy D.

    In this dissertation, we describe our research contributions for a novel approach to the application of machine learning for the automatic detection of anomalous events. We work in two different domains to ensure a robust data-driven workflow that could be generalized for monitoring other systems. Specifically, in our first domain, we begin with the identification of internal erosion events in earth dams and levees (EDLs) using geophysical data collected from sensors located on the surface of the levee. As EDLs across the globe reach the end of their design lives, effectively monitoring their structural integrity is of critical importance. The second domain of interest is related to mobile telecommunications, where we investigate a system for automatically detecting non-commercial base station routers (BSRs) operating in protected frequency space. The presence of non-commercial BSRs can disrupt the connectivity of end users, cause service issues for the commercial providers, and introduce significant security concerns. We provide our motivation, experimentation, and results from investigating a generalized novel data-driven workflow using several machine learning techniques. In Chapter 2, we present results from our performance study that uses popular unsupervised clustering algorithms to gain insights to our real-world problems, and evaluate our results using internal and external validation techniques. Using EDL passive seismic data from an experimental laboratory earth embankment, results consistently show a clear separation of events from non-events in four of the five clustering algorithms applied. Chapter 3 uses a multivariate Gaussian machine learning model to identify anomalies in our experimental data sets. For the EDL work, we used experimental data from two different laboratory earth embankments. Additionally, we explore five wavelet transform methods for signal denoising. The best performance is achieved with the Haar wavelets. We achieve up to 97

  2. Assessing the impact of safety monitoring on the efficacy analysis in large Phase III group sequential trials with non-trivial safety event rate.

    Science.gov (United States)

    Weng, Yanqiu; Palesch, Yuko Y; DeSantis, Stacia M; Zhao, Wenle

    2016-01-01

    In Phase III clinical trials for life-threatening conditions, some serious but expected adverse events, such as early deaths or congestive heart failure, are often treated as the secondary or co-primary endpoint, and are closely monitored by the Data and Safety Monitoring Committee (DSMC). A naïve group sequential design (GSD) for such a study is to specify univariate statistical boundaries for the efficacy and safety endpoints separately, and then implement the two boundaries during the study, even though the two endpoints are typically correlated. One problem with this naïve design, which has been noted in the statistical literature, is the potential loss of power. In this article, we develop an analytical tool to evaluate this negative impact for trials with non-trivial safety event rates, particularly when the safety monitoring is informal. Using a bivariate binary power function for the GSD with a random-effect component to account for subjective decision-making in safety monitoring, we demonstrate how, under common conditions, the power loss in the naïve design can be substantial. This tool may be helpful to entities such as the DSMCs when they wish to deviate from the prespecified stopping boundaries based on safety measures.

  3. First CNGS events detected by LVD

    International Nuclear Information System (INIS)

    Agafonova, N.Yu.; Boyarkin, V.V.; Kuznetsov, V.V.; Kuznetsov, V.A.; Malguin, A.S.; Ryasny, V.G.; Ryazhskaya, O.G.; Yakushev, V.F.; Zatsepin, G.T.; Aglietta, M.; Bonardi, A.; Fulgione, W.; Galeotti, P.; Porta, A.; Saavedra, O.; Vigorito, C.; Antonioli, P.; Bari, G.; Giusti, P.; Menghetti, H.; Persiani, R.; Pesci, A.; Sartorelli, G.; Selvi, M.; Zichichi, A.; Bruno, G.; Ghia, P.L.; Garbini, M.; Kemp, E.; Pless, I.A.; Votano, L.

    2007-01-01

    The CERN Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at CERN and send it toward the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 x 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Monte Carlo simulations. (orig.)

  4. Development of time dependent safety analysis code for plasma anomaly events in fusion reactors

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    A safety analysis code SAFALY has been developed to analyze plasma anomaly events in fusion reactors, e.g., a loss of plasma control. The code is a hybrid code comprising a zero-dimensional plasma dynamics and a one-dimensional thermal analysis of in-vessel components. The code evaluates the time evolution of plasma parameters and temperature distributions of in-vessel components. As the plasma-safety interface model, we proposed a robust plasma physics model taking into account updated data for safety assessment. For example, physics safety guidelines for beta limit, density limit and H-L mode confinement transition threshold power, etc. are provided in the model. The model of the in-vessel components are divided into twenty temperature regions in the poloidal direction taking account of radiative heat transfer between each surface of each region. This code can also describe the coolant behavior under hydraulic accidents with the results by hydraulics code and treat vaporization (sublimation) from plasma facing components (PFCs). Furthermore, the code includes the model of impurity transport form PFCs by using a transport probability and a time delay. Quantitative analysis based on the model is possible for a scenario of plasma passive shutdown. We examined the possibility of the code as a safety analysis code for plasma anomaly events in fusion reactors and had a prospect that it would contribute to the safety analysis of the International Thermonuclear Experimental Reactor (ITER). (author)

  5. Detection and interpretation of seismoacoustic events at German infrasound stations

    Science.gov (United States)

    Pilger, Christoph; Koch, Karl; Ceranna, Lars

    2016-04-01

    Three infrasound arrays with collocated or nearby installed seismometers are operated by the Federal Institute for Geosciences and Natural Resources (BGR) as the German National Data Center (NDC) for the verification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). Infrasound generated by seismoacoustic events is routinely detected at these infrasound arrays, but air-to-ground coupled acoustic waves occasionally show up in seismometer recordings as well. Different natural and artificial sources like meteoroids as well as industrial and mining activity generate infrasonic signatures that are simultaneously detected at microbarometers and seismometers. Furthermore, many near-surface sources like earthquakes and explosions generate both seismic and infrasonic waves that can be detected successively with both technologies. The combined interpretation of seismic and acoustic signatures provides additional information about the origin time and location of remote infrasound events or about the characterization of seismic events distinguishing man-made and natural origins. Furthermore, seismoacoustic studies help to improve the modelling of infrasound propagation and ducting in the atmosphere and allow quantifying the portion of energy coupled into ground and into air by seismoacoustic sources. An overview of different seismoacoustic sources and their detection by German infrasound stations as well as some conclusions on the benefit of a combined seismoacoustic analysis are presented within this study.

  6. Root-Cause Analysis of a Potentially Sentinel Transfusion Event: Lessons for Improvement of Patient Safety

    Directory of Open Access Journals (Sweden)

    Ali Reza Jeddian

    2012-09-01

    Full Text Available Errors prevention and patient safety in transfusion medicine are a serious concern. Errors can occur at any step in transfusion and evaluation of their root causes can be helpful for preventive measures. Root cause analysis as a structured and systematic approach can be used for identification of underlying causes of adverse events. To specify system vulnerabilities and illustrate the potential of such an approach, we describe the root cause analysis of a case of transfusion error in emergency ward that could have been fatal. After reporting of the mentioned event, through reviewing records and interviews with the responsible personnel, the details of the incident were elaborated. Then, an expert panel meeting was held to define event timeline and the care and service delivery problems and discuss their underlying causes, safeguards and preventive measures. Root cause analysis of the mentioned event demonstrated that certain defects of the system and the ensuing errors were main causes of the event. It also points out systematic corrective actions. It can be concluded that health care organizations should endeavor to provide opportunities to discuss errors and adverse events and introduce preventive measures to find areas where resources need to be allocated to improve patient safety.

  7. A coupled classification - evolutionary optimization model for contamination event detection in water distribution systems.

    Science.gov (United States)

    Oliker, Nurit; Ostfeld, Avi

    2014-03-15

    This study describes a decision support system, alerts for contamination events in water distribution systems. The developed model comprises a weighted support vector machine (SVM) for the detection of outliers, and a following sequence analysis for the classification of contamination events. The contribution of this study is an improvement of contamination events detection ability and a multi-dimensional analysis of the data, differing from the parallel one-dimensional analysis conducted so far. The multivariate analysis examines the relationships between water quality parameters and detects changes in their mutual patterns. The weights of the SVM model accomplish two goals: blurring the difference between sizes of the two classes' data sets (as there are much more normal/regular than event time measurements), and adhering the time factor attribute by a time decay coefficient, ascribing higher importance to recent observations when classifying a time step measurement. All model parameters were determined by data driven optimization so the calibration of the model was completely autonomic. The model was trained and tested on a real water distribution system (WDS) data set with randomly simulated events superimposed on the original measurements. The model is prominent in its ability to detect events that were only partly expressed in the data (i.e., affecting only some of the measured parameters). The model showed high accuracy and better detection ability as compared to previous modeling attempts of contamination event detection. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. 78 FR 26508 - Safety Zone; Fireworks Event in Captain of the Port New York Zone

    Science.gov (United States)

    2013-05-07

    ... Harbor located in approximate Safety Zone, 33 CFR 165.160(3.8). position 40[deg]51'58'' N, 073[deg]39'34... Zone; Fireworks Event in Captain of the Port New York Zone AGENCY: Coast Guard, DHS. ACTION: Notice of enforcement of regulation. SUMMARY: The Coast Guard will enforce safety zones in the Captain of the Port New...

  9. Feedback from peer review missions of the self-assessment of operational events reflecting safety culture (Leningrad, Smolemsk and Balakovo NPP`s, the Russian Federation)

    Energy Technology Data Exchange (ETDEWEB)

    Gantchev, T [Committee on the Use of Atomic Energy for Peaceful Purposes (Bulgaria)

    1997-10-01

    The presentation discusses the following issues: criteria for reporting events inside NPP; screening of the plant operational events; third safety culture indicator; list of the pending safety problems; significance of the safety problems for plant reliability; prioritization of the safety culture issues. Tabs.

  10. Safety culture in nuclear installations: Bangladesh perspectives and key lessons learned from major events

    International Nuclear Information System (INIS)

    Jalil, A.; Rabbani, G.

    2002-01-01

    Steps necessary to be taken to ensure safety in nuclear installations are suggested. One of the steps suggested is enhancing the safety culture. It is necessary to gain a common understanding of the concept itself, the development stages of safety culture by way of good management practices and leadership for safety culture improvement in the long-term. International topical meetings on safety culture may serve as an important forum for exchange of experiences. From such conventions new initiatives and programmes may crop up which when implemented around the world is very likely to improve safety management and thus boost up the safety culture in nuclear installations. International co-operation and learning are to be prompted to facilitate the sharing of the achievements to face the challenges involved in the management of safety and fixing priorities for future work and identify areas of co-operations. Key lessons learned from some major events have been reported. Present status and future trend of nuclear safety culture in Bangladesh have been dealt with. (author)

  11. Method for detecting binding events using micro-X-ray fluorescence spectrometry

    Science.gov (United States)

    Warner, Benjamin P.; Havrilla, George J.; Mann, Grace

    2010-12-28

    Method for detecting binding events using micro-X-ray fluorescence spectrometry. Receptors are exposed to at least one potential binder and arrayed on a substrate support. Each member of the array is exposed to X-ray radiation. The magnitude of a detectable X-ray fluorescence signal for at least one element can be used to determine whether a binding event between a binder and a receptor has occurred, and can provide information related to the extent of binding between the binder and receptor.

  12. Insight and Lessons Learned on Organizational Factors and Safety Culture from the Review of Human Error-related Events of NPPs in Korea

    International Nuclear Information System (INIS)

    Kim, Ji Tae; Lee, Dhong Hoon; Choi, Young Sung

    2014-01-01

    Event investigation is one of the key means of enhancing nuclear safety deriving effective measures and preventing recurrences. However, it is difficult to analyze organizational factors and safety culture. This paper tries to review human error-related events from perspectives of organizational factors and safety culture, and to derive insights and lessons learned in developing the regulatory infrastructure of plant oversight on safety culture

  13. Insight and Lessons Learned on Organizational Factors and Safety Culture from the Review of Human Error-related Events of NPPs in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Tae; Lee, Dhong Hoon; Choi, Young Sung [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2014-08-15

    Event investigation is one of the key means of enhancing nuclear safety deriving effective measures and preventing recurrences. However, it is difficult to analyze organizational factors and safety culture. This paper tries to review human error-related events from perspectives of organizational factors and safety culture, and to derive insights and lessons learned in developing the regulatory infrastructure of plant oversight on safety culture.

  14. Developing and Testing the Health Care Safety Hotline: A Prototype Consumer Reporting System for Patient Safety Events.

    Science.gov (United States)

    Schneider, Eric C; Ridgely, M Susan; Quigley, Denise D; Hunter, Lauren E; Leuschner, Kristin J; Weingart, Saul N; Weissman, Joel S; Zimmer, Karen P; Giannini, Robert C

    2017-06-01

    This article describes the design, development, and testing of the Health Care Safety Hotline, a prototype consumer reporting system for patient safety events. The prototype was designed and developed with ongoing review by a technical expert panel and feedback obtained during a public comment period. Two health care delivery organizations in one metropolitan area collaborated with the researchers to demonstrate and evaluate the system. The prototype was deployed and elicited information from patients, family members, and caregivers through a website or an 800 phone number. The reports were considered useful and had little overlap with information received by the health care organizations through their usual risk management, customer service, and patient safety monitoring systems. However, the frequency of reporting was lower than anticipated, suggesting that further refinements, including efforts to raise awareness by actively soliciting reports from subjects, might be necessary to substantially increase the volume of useful reports. It is possible that a single technology platform could be built to meet a variety of different patient safety objectives, but it may not be possible to achieve several objectives simultaneously through a single consumer reporting system while also establishing trust with patients, caregivers, and providers.

  15. A retrospective look on plant events for prospective affirmation of nuclear safety

    International Nuclear Information System (INIS)

    Koshy, Thomas; Khamis, Ibrahim

    2014-01-01

    The nuclear industry continues to rise above the challenges resulting from major plant events around the world. It is important to study the significant events, develop solutions to overcome the vulnerabilities identified, and retain the lessons while technology evolves to the next generation. The historical Station-Black-Out needs to be examined further in a new dimension in the light of 'Fukushima type' events where normal AC power recovery in a reasonable period was not practical. The plants would need to incorporate diversity in emergency core cooling to account for a condition that inhibits electrical energy as a source of motive power. An electrical event in Sweden that propagated from an electrical switchyard resulted in two core cooling divisions disabled and consequently exacerbating the plant condition by opening the relief system for reactor coolant system and that significantly increased the probability for core damage. A minor spark in an electronic control system card in a US plant caused inadvertent emergency core cooling and disabled the Control Room Operators' capability to intervene and prevent the primary loop from getting completely filled. A renewed assessment is needed to address the following areas for advancing reactor safety in the new evolving generation of plants to advance safety from the event lessons of the past. - Evaluate the diversity in core cooling systems following loss of all AC power onsite - Confirm independence in Reactor Trip, Depressurization and Core and Containment cooling systems for sensors, power supplies and actuation systems - Evaluate the suitability of logic/control system failure mode resulting from power supply failures in instrument channels and/or divisions (Conduct Failure Mode and Effects Analysis for system, power supplies and components). (authors)

  16. 75 FR 35649 - Safety Zone; Northern California Annual Fireworks Events, July 4th Fireworks Display

    Science.gov (United States)

    2010-06-23

    ... Zone; Northern California Annual Fireworks Events, July 4th Fireworks Display AGENCY: Coast Guard, DHS... July Fireworks Display safety zone, from 9 a.m. through 10 p.m. on July 4, 2010 in position 39[deg]10... safety zone for the annual Tahoe City 4th of July Fireworks in 33 CFR 165.1191 on July 4, 2010, from 9 a...

  17. Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed

    International Nuclear Information System (INIS)

    Semmens, Kathryn Alese; Ramage, Joan; Bartsch, Annett; Liston, Glen E

    2013-01-01

    High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change

  18. Review of nuclear power reactor coolant system leakage events and leak detection requirements

    International Nuclear Information System (INIS)

    Chokshi, N.C.; Srinivasan, M.; Kupperman, D.S.; Krishnaswamy, P.

    2005-01-01

    In response to the vessel head event at the Davis-Besse reactor, the U.S. Nuclear Regulatory Commission (NRC) formed a Lessons Learned Task Force (LLTF). Four action plans were formulated to respond to the recommendations of the LLTF. The action plans involved efforts on barrier integrity, stress corrosion cracking (SCC), operating experience, and inspection and program management. One part of the action plan on barrier integrity was an assessment to identify potential safety benefits from changes in requirements pertaining to leakage in the reactor coolant system (RCS). In this effort, experiments and models were reviewed to identify correlations between crack size, crack-tip-opening displacement (CTOD), and leak rate in the RCS. Sensitivity studies using the Seepage Quantification of Upsets In Reactor Tubes (SQUIRT) code were carried out to correlate crack parameters, such as crack size, with leak rate for various types of crack configurations in RCS components. A database that identifies the leakage source, leakage rate, and resulting actions from RCS leaks discovered in U.S. light water reactors was developed. Humidity monitoring systems for detecting leakage and acoustic emission crack monitoring systems for the detection of crack initiation and growth before a leak occurs were also considered. New approaches to the detection of a leak in the reactor head region by monitoring boric-acid aerosols were also considered. (authors)

  19. 75 FR 16140 - Common Formats for Patient Safety Data Collection and Event Reporting

    Science.gov (United States)

    2010-03-31

    ... FR 45457-45458. Definition of Common Formats The term ``Common Formats'' is used to describe clinical... DEPARTMENT OF HEALTH AND HUMAN SERVICES Agency for Healthcare Research and Quality Common Formats for Patient Safety Data Collection and Event Reporting AGENCY: Agency for Healthcare Research and...

  20. 76 FR 37646 - Safety Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, City of...

    Science.gov (United States)

    2011-06-28

    ... Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, City of Sausalito... Guard will enforce the Fourth of July Fireworks, City of Sausalito annual safety zone. This action is... for the annual Fourth of July Fireworks, City of Sausalito, safety zone in 33 CFR 165.1191 on July 4...

  1. Event detection for car park entries by video-surveillance

    Science.gov (United States)

    Coquin, Didier; Tailland, Johan; Cintract, Michel

    2007-10-01

    Intelligent surveillance has become an important research issue due to the high cost and low efficiency of human supervisors, and machine intelligence is required to provide a solution for automated event detection. In this paper we describe a real-time system that has been used for detecting car park entries, using an adaptive background learning algorithm and two indicators representing activity and identity to overcome the difficulty of tracking objects.

  2. A novel seizure detection algorithm informed by hidden Markov model event states

    Science.gov (United States)

    Baldassano, Steven; Wulsin, Drausin; Ung, Hoameng; Blevins, Tyler; Brown, Mesha-Gay; Fox, Emily; Litt, Brian

    2016-06-01

    Objective. Recently the FDA approved the first responsive, closed-loop intracranial device to treat epilepsy. Because these devices must respond within seconds of seizure onset and not miss events, they are tuned to have high sensitivity, leading to frequent false positive stimulations and decreased battery life. In this work, we propose a more robust seizure detection model. Approach. We use a Bayesian nonparametric Markov switching process to parse intracranial EEG (iEEG) data into distinct dynamic event states. Each event state is then modeled as a multidimensional Gaussian distribution to allow for predictive state assignment. By detecting event states highly specific for seizure onset zones, the method can identify precise regions of iEEG data associated with the transition to seizure activity, reducing false positive detections associated with interictal bursts. The seizure detection algorithm was translated to a real-time application and validated in a small pilot study using 391 days of continuous iEEG data from two dogs with naturally occurring, multifocal epilepsy. A feature-based seizure detector modeled after the NeuroPace RNS System was developed as a control. Main results. Our novel seizure detection method demonstrated an improvement in false negative rate (0/55 seizures missed versus 2/55 seizures missed) as well as a significantly reduced false positive rate (0.0012 h versus 0.058 h-1). All seizures were detected an average of 12.1 ± 6.9 s before the onset of unequivocal epileptic activity (unequivocal epileptic onset (UEO)). Significance. This algorithm represents a computationally inexpensive, individualized, real-time detection method suitable for implantable antiepileptic devices that may considerably reduce false positive rate relative to current industry standards.

  3. 76 FR 34867 - Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone

    Science.gov (United States)

    2011-06-15

    ....941(a)(51) Target Fireworks, Detroit, MI The first safety zone will be enforced from 7 a.m. on June 24... Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone AGENCY: Coast Guard, DHS. ACTION: Notice of enforcement of regulation. SUMMARY: The Coast Guard will enforce various safety zones for...

  4. Assessment of the safety of Ulchin nuclear power plant in the event of tsunami using parametric study

    International Nuclear Information System (INIS)

    Kim, Ji Young; Kang, Keum Seok

    2011-01-01

    Previous evaluations of the safety of the Ulchin Nuclear Power Plant in the event of a tsunami have the shortcoming of uncertainty of the tsunami sources. To address this uncertainty, maximum and minimum wave heights at the intake of Ulchin NPP have been estimated through a parametric study, and then assessment of the safety margin for the intake has been carried out. From the simulation results for the Ulchin NPP site, it can be seen that the coefficient of eddy viscosity considerably affects wave height at the inside of the breakwater. In addition, assessment of the safety margin shows that almost all of the intake water pumps have a safety margin over 2 m, and Ulchin NPP site seems to be safe in the event of a tsunami according to this parametric study, although parts of the CWPs rarely have a margin for the minimum wave height

  5. LAN attack detection using Discrete Event Systems.

    Science.gov (United States)

    Hubballi, Neminath; Biswas, Santosh; Roopa, S; Ratti, Ritesh; Nandi, Sukumar

    2011-01-01

    Address Resolution Protocol (ARP) is used for determining the link layer or Medium Access Control (MAC) address of a network host, given its Internet Layer (IP) or Network Layer address. ARP is a stateless protocol and any IP-MAC pairing sent by a host is accepted without verification. This weakness in the ARP may be exploited by malicious hosts in a Local Area Network (LAN) by spoofing IP-MAC pairs. Several schemes have been proposed in the literature to circumvent these attacks; however, these techniques either make IP-MAC pairing static, modify the existing ARP, patch operating systems of all the hosts etc. In this paper we propose a Discrete Event System (DES) approach for Intrusion Detection System (IDS) for LAN specific attacks which do not require any extra constraint like static IP-MAC, changing the ARP etc. A DES model is built for the LAN under both a normal and compromised (i.e., spoofed request/response) situation based on the sequences of ARP related packets. Sequences of ARP events in normal and spoofed scenarios are similar thereby rendering the same DES models for both the cases. To create different ARP events under normal and spoofed conditions the proposed technique uses active ARP probing. However, this probing adds extra ARP traffic in the LAN. Following that a DES detector is built to determine from observed ARP related events, whether the LAN is operating under a normal or compromised situation. The scheme also minimizes extra ARP traffic by probing the source IP-MAC pair of only those ARP packets which are yet to be determined as genuine/spoofed by the detector. Also, spoofed IP-MAC pairs determined by the detector are stored in tables to detect other LAN attacks triggered by spoofing namely, man-in-the-middle (MiTM), denial of service etc. The scheme is successfully validated in a test bed. Copyright © 2010 ISA. Published by Elsevier Ltd. All rights reserved.

  6. Microseismic Events Detection on Xishancun Landslide, Sichuan Province, China

    Science.gov (United States)

    Sheng, M.; Chu, R.; Wei, Z.

    2016-12-01

    On landslide, the slope movement and the fracturing of the rock mass often lead to microearthquakes, which are recorded as weak signals on seismographs. The distribution characteristics of temporal and spatial regional unstability as well as the impact of external factors on the unstable regions can be understand and analyzed by monitoring those microseismic events. Microseismic method can provide some information inside the landslide, which can be used as supplementary of geodetic methods for monitoring the movement of landslide surface. Compared to drilling on landslide, microseismic method is more economical and safe. Xishancun Landslide is located about 60km northwest of Wenchuan earthquake centroid, it keep deforming after the earthquake, which greatly increases the probability of disasters. In the autumn of 2015, 30 seismometers were deployed on the landslide for 3 months with intervals of 200 500 meters. First, we used regional earthquakes for time correction of seismometers to eliminate the influence of inaccuracy GPS clocks and the subsurface structure of stations. Due to low velocity of the loose medium, the travel time difference of microseismic events on the landslide up to 5s. According to travel time and waveform characteristics, we found many microseismic events and converted them into envelopes as templates, then we used a sliding-window cross-correlation technique based on waveform envelope to detect the other microseismic events. Consequently, 100 microseismic events were detected with the waveforms recorded on all seismometers. Based on the location, we found most of them located on the front of the landslide while the others located on the back end. The bottom and top of the landslide accumulated considerable energy and deformed largely, radiated waves could be recorded by all stations. What's more, the bottom with more events seemed very active. In addition, there were many smaller events happened in middle part of the landslide where released

  7. Vision-based Event Detection of the Sit-to-Stand Transition

    Directory of Open Access Journals (Sweden)

    Victor Shia

    2015-12-01

    Full Text Available Sit-to-stand (STS motions are one of the most important activities of daily living as they serve as a precursor to mobility and walking. However, there exist no standard method of segmenting STS motions. This is partially due to the variety of different sensors and modalities used to study the STS motion such as force plate, vision, and accelerometers, each providing different types of data, and the variability of the STS motion in video data. In this work, we present a method using motion capture to detect events in the STS motion by estimating ground reaction forces, thereby eliminating the variability in joint angles from visual data. We illustrate the accuracy of this method with 10 subjects with an average difference of 16.5ms in event times obtained via motion capture vs force plate. This method serves as a proof of concept for detecting events in the STS motion via video which are comparable to those obtained via force plate.

  8. 77 FR 30245 - Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone

    Science.gov (United States)

    2012-05-22

    ...'' N, 082-51'-18.70'' W (NAD 83). This proposed zone would be enforced one evening during the last week...-AA00 Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone AGENCY: Coast Guard... by adding three permanent safety zones within the Captain of the Port Detroit Zone. This action is...

  9. Probabilistic safety analysis on an SBWR 72 hours after the initiating event

    International Nuclear Information System (INIS)

    Dominguez Bautista, M.T.; Peinador Veira, M.

    1996-01-01

    Passive plants, including SBWRs, are designed to carry out safety functions with passive systems during the first 72 hours after the initiation event with no need for manual actions or external support. After this period, some recovery actions are required to enable the passive systems to continue performing their safety functions. The study was carried out by the INITEC-Empresarios Agrupados Joint Venture within the framework of the international group collaborating with GE on this project. Its purpose has been to assess, by means of probabilistic criteria, the importance to safety of each of these support actions, in order to define possible requirements to be considered in the design in respect of said recovery actions. In brief, the methodology developed for this objective consists of (1) quantifying success event trees from the PSA up to 72 hours, (2) determining the actions required in each sequence to maintain Steady State after 72 hours, (3) identifying available alternative core cooling methods in each sequence, (4) establishing the approximate (order of magnitude) realizability of each alternative method, (5) calculating the frequency of core damage as a function of the failure probability of post-72-hour actions and (6) analysing the importance of post-72-hour actions. The results of this analysis permit the establishment, right from the conceptual design phase, of the requirements that will arise to ensure these actions in the long term, enhancing their reliability and preventing the accident from continuing beyond this period. (Author)

  10. Duke Surgery Patient Safety: an open-source application for anonymous reporting of adverse and near-miss surgical events.

    Science.gov (United States)

    Pietrobon, Ricardo; Lima, Raquel; Shah, Anand; Jacobs, Danny O; Harker, Matthew; McCready, Mariana; Martins, Henrique; Richardson, William

    2007-05-01

    Studies have shown that 4% of hospitalized patients suffer from an adverse event caused by the medical treatment administered. Some institutions have created systems to encourage medical workers to report these adverse events. However, these systems often prove to be inadequate and/or ineffective for reviewing the data collected and improving the outcomes in patient safety. To describe the Web-application Duke Surgery Patient Safety, designed for the anonymous reporting of adverse and near-miss events as well as scheduled reporting to surgeons and hospital administration. SOFTWARE ARCHITECTURE: DSPS was developed primarily using Java language running on a Tomcat server and with MySQL database as its backend. Formal and field usability tests were used to aid in development of DSPS. Extensive experience with DSPS at our institution indicate that DSPS is easy to learn and use, has good speed, provides needed functionality, and is well received by both adverse-event reporters and administrators. This is the first description of an open-source application for reporting patient safety, which allows the distribution of the application to other institutions in addition for its ability to adapt to the needs of different departments. DSPS provides a mechanism for anonymous reporting of adverse events and helps to administer Patient Safety initiatives. The modifiable framework of DSPS allows adherence to evolving national data standards. The open-source design of DSPS permits surgical departments with existing reporting mechanisms to integrate them with DSPS. The DSPS application is distributed under the GNU General Public License.

  11. Analysis of arrhythmic events is useful to detect lead failure earlier in patients followed by remote monitoring.

    Science.gov (United States)

    Nishii, Nobuhiro; Miyoshi, Akihito; Kubo, Motoki; Miyamoto, Masakazu; Morimoto, Yoshimasa; Kawada, Satoshi; Nakagawa, Koji; Watanabe, Atsuyuki; Nakamura, Kazufumi; Morita, Hiroshi; Ito, Hiroshi

    2018-03-01

    Remote monitoring (RM) has been advocated as the new standard of care for patients with cardiovascular implantable electronic devices (CIEDs). RM has allowed the early detection of adverse clinical events, such as arrhythmia, lead failure, and battery depletion. However, lead failure was often identified only by arrhythmic events, but not impedance abnormalities. To compare the usefulness of arrhythmic events with conventional impedance abnormalities for identifying lead failure in CIED patients followed by RM. CIED patients in 12 hospitals have been followed by the RM center in Okayama University Hospital. All transmitted data have been analyzed and summarized. From April 2009 to March 2016, 1,873 patients have been followed by the RM center. During the mean follow-up period of 775 days, 42 lead failure events (atrial lead 22, right ventricular pacemaker lead 5, implantable cardioverter defibrillator [ICD] lead 15) were detected. The proportion of lead failures detected only by arrhythmic events, which were not detected by conventional impedance abnormalities, was significantly higher than that detected by impedance abnormalities (arrhythmic event 76.2%, 95% CI: 60.5-87.9%; impedance abnormalities 23.8%, 95% CI: 12.1-39.5%). Twenty-seven events (64.7%) were detected without any alert. Of 15 patients with ICD lead failure, none has experienced inappropriate therapy. RM can detect lead failure earlier, before clinical adverse events. However, CIEDs often diagnose lead failure as just arrhythmic events without any warning. Thus, to detect lead failure earlier, careful human analysis of arrhythmic events is useful. © 2017 Wiley Periodicals, Inc.

  12. Roy's safety-first portfolio principle in financial risk management of disastrous events.

    Science.gov (United States)

    Chiu, Mei Choi; Wong, Hoi Ying; Li, Duan

    2012-11-01

    Roy pioneers the concept and practice of risk management of disastrous events via his safety-first principle for portfolio selection. More specifically, his safety-first principle advocates an optimal portfolio strategy generated from minimizing the disaster probability, while subject to the budget constraint and the mean constraint that the expected final wealth is not less than a preselected disaster level. This article studies the dynamic safety-first principle in continuous time and its application in asset and liability management. We reveal that the distortion resulting from dropping the mean constraint, as a common practice to approximate the original Roy's setting, either leads to a trivial case or changes the problem nature completely to a target-reaching problem, which produces a highly leveraged trading strategy. Recognizing the ill-posed nature of the corresponding Lagrangian method when retaining the mean constraint, we invoke a wisdom observed from a limited funding-level regulation of pension funds and modify the original safety-first formulation accordingly by imposing an upper bound on the funding level. This model revision enables us to solve completely the safety-first asset-liability problem by a martingale approach and to derive an optimal policy that follows faithfully the spirit of the safety-first principle and demonstrates a prominent nature of fighting for the best and preventing disaster from happening. © 2012 Society for Risk Analysis.

  13. Towards the creation of a flexible classification scheme for voluntarily reported transfusion and laboratory safety events.

    Science.gov (United States)

    Whitehurst, Julie M; Schroder, John; Leonard, Dave; Horvath, Monica M; Cozart, Heidi; Ferranti, Jeffrey

    2012-05-18

    Transfusion and clinical laboratory services are high-volume activities involving complicated workflows across both ambulatory and inpatient environments. As a result, there are many opportunities for safety lapses, leading to patient harm and increased costs. Organizational techniques such as voluntary safety event reporting are commonly used to identify and prioritize risk areas across care settings. Creation of functional, standardized safety data structures that facilitate effective exploratory examination is therefore essential to drive quality improvement interventions. Unfortunately, voluntarily reported adverse event data can often be unstructured or ambiguously defined. To address this problem, we sought to create a "best-of-breed" patient safety classification for data contained in the Duke University Health System Safety Reporting System (SRS). Our approach was to implement the internationally recognized World Health Organization International Classification for Patient Safety Framework, supplemented with additional data points relevant to our organization. Data selection and integration into the hierarchical framework is discussed, as well as placement of the classification into the SRS. We evaluated the impact of the new SRS classification on system usage through comparisons of monthly average report rates and completion times before and after implementation. Monthly average inpatient transfusion reports decreased from 102.1 ± 14.3 to 91.6 ± 11.2, with the proportion of transfusion reports in our system remaining consistent before and after implementation. Monthly average transfusion report rates in the outpatient and homecare environments were not significantly different. Significant increases in clinical lab report rates were present across inpatient and outpatient environments, with the proportion of lab reports increasing after implementation. Report completion times increased modestly but not significantly from a practical standpoint. A

  14. Triangulating case-finding tools for patient safety surveillance: a cross-sectional case study of puncture/laceration.

    Science.gov (United States)

    Taylor, Jennifer A; Gerwin, Daniel; Morlock, Laura; Miller, Marlene R

    2011-12-01

    To evaluate the need for triangulating case-finding tools in patient safety surveillance. This study applied four case-finding tools to error-associated patient safety events to identify and characterise the spectrum of events captured by these tools, using puncture or laceration as an example for in-depth analysis. Retrospective hospital discharge data were collected for calendar year 2005 (n=48,418) from a large, urban medical centre in the USA. The study design was cross-sectional and used data linkage to identify the cases captured by each of four case-finding tools. Three case-finding tools (International Classification of Diseases external (E) and nature (N) of injury codes, Patient Safety Indicators (PSI)) were applied to the administrative discharge data to identify potential patient safety events. The fourth tool was Patient Safety Net, a web-based voluntary patient safety event reporting system. The degree of mutual exclusion among detection methods was substantial. For example, when linking puncture or laceration on unique identifiers, out of 447 potential events, 118 were identical between PSI and E-codes, 152 were identical between N-codes and E-codes and 188 were identical between PSI and N-codes. Only 100 events that were identified by PSI, E-codes and N-codes were identical. Triangulation of multiple tools through data linkage captures potential patient safety events most comprehensively. Existing detection tools target patient safety domains differently, and consequently capture different occurrences, necessitating the integration of data from a combination of tools to fully estimate the total burden.

  15. Detection of planets in extremely weak central perturbation microlensing events via next-generation ground-based surveys

    International Nuclear Information System (INIS)

    Chung, Sun-Ju; Lee, Chung-Uk; Koo, Jae-Rim

    2014-01-01

    Even though the recently discovered high-magnification event MOA-2010-BLG-311 had complete coverage over its peak, confident planet detection did not happen due to extremely weak central perturbations (EWCPs, fractional deviations of ≲ 2%). For confident detection of planets in EWCP events, it is necessary to have both high cadence monitoring and high photometric accuracy better than those of current follow-up observation systems. The next-generation ground-based observation project, Korea Microlensing Telescope Network (KMTNet), satisfies these conditions. We estimate the probability of occurrence of EWCP events with fractional deviations of ≤2% in high-magnification events and the efficiency of detecting planets in the EWCP events using the KMTNet. From this study, we find that the EWCP events occur with a frequency of >50% in the case of ≲ 100 M E planets with separations of 0.2 AU ≲ d ≲ 20 AU. We find that for main-sequence and sub-giant source stars, ≳ 1 M E planets in EWCP events with deviations ≤2% can be detected with frequency >50% in a certain range that changes with the planet mass. However, it is difficult to detect planets in EWCP events of bright stars like giant stars because it is easy for KMTNet to be saturated around the peak of the events because of its constant exposure time. EWCP events are caused by close, intermediate, and wide planetary systems with low-mass planets and close and wide planetary systems with massive planets. Therefore, we expect that a much greater variety of planetary systems than those already detected, which are mostly intermediate planetary systems, regardless of the planet mass, will be significantly detected in the near future.

  16. Removal of Open Safety Pin in Larynx: A Challenging Event for an Otolaryngologist

    Directory of Open Access Journals (Sweden)

    Alok Kumar

    2013-11-01

    Full Text Available Inhalation of foreign body is a serious event. The numbers of foreign bodies that become impacted in the larynx are small and require urgent recognition. We describe the case of a 12 year old girl with an impacted open safety pin in the larynx. The sharp end of the safety pin was upward, below the level of the vocal cords and had pierced the soft tissue. Tracheostomy was required to secure the airway and the child had an uneventful recovery. We discuss the management and describe our method of removal of the foreign body with a brief review of literature.

  17. Post-licensure safety monitoring of quadrivalent human papillomavirus vaccine in the Vaccine Adverse Event Reporting System (VAERS), 2009-2015.

    Science.gov (United States)

    Arana, Jorge E; Harrington, Theresa; Cano, Maria; Lewis, Paige; Mba-Jonas, Adamma; Rongxia, Li; Stewart, Brock; Markowitz, Lauri E; Shimabukuro, Tom T

    2018-03-20

    The Food and Drug Administration (FDA) approved quadrivalent human papillomavirus vaccine (4vHPV) for use in females and males aged 9-26 years, since 2006 and 2009 respectively. We characterized reports to the Vaccine Adverse Event Reporting System (VAERS), a US spontaneous reporting system, in females and males who received 4vHPV vaccination. We searched VAERS for US reports of adverse events (AEs) following 4vHPV from January 2009 through December 2015. Signs and symptoms were coded using Medical Dictionary for Regulatory Activities (MedDRA). We calculated reporting rates and conducted empirical Bayesian data mining to identify disproportional reports. Clinicians reviewed available information, including medical records, and reports of selected pre-specified conditions. VAERS received 19,760 reports following 4vHPV; 60.2% in females, 17.2% in males, and in 22.6% sex was missing. Overall, 94.2% of reports were non-serious; dizziness, syncope and injection site reactions were commonly reported in both males and females. Headache, fatigue and nausea were commonly reported serious AEs. More than 60 million 4vHPV doses were distributed during the study period. Crude AE reporting rates were 327 reports per million 4vHPV doses distributed for all reports, and 19 per million for serious reports. Among 29 verified reports of death, there was no pattern of clustering of deaths by diagnosis, co-morbidities, age, or interval from vaccination to death. No new or unexpected safety concerns or reporting patterns of 4vHPV with clinically important AEs were detected. Safety profile of 4vHPV is consistent with data from pre-licensure trials and postmarketing safety data. Published by Elsevier Ltd.

  18. EVENT DETECTION USING MOBILE PHONE MASS GPS DATA AND THEIR RELIAVILITY VERIFICATION BY DMSP/OLS NIGHT LIGHT IMAGE

    Directory of Open Access Journals (Sweden)

    A. Yuki

    2016-06-01

    Full Text Available In this study, we developed a method to detect sudden population concentration on a certain day and area, that is, an “Event,” all over Japan in 2012 using mass GPS data provided from mobile phone users. First, stay locations of all phone users were detected using existing methods. Second, areas and days where Events occurred were detected by aggregation of mass stay locations into 1-km-square grid polygons. Finally, the proposed method could detect Events with an especially large number of visitors in the year by removing the influences of Events that occurred continuously throughout the year. In addition, we demonstrated reasonable reliability of the proposed Event detection method by comparing the results of Event detection with light intensities obtained from the night light images from the DMSP/OLS night light images. Our method can detect not only positive events such as festivals but also negative events such as natural disasters and road accidents. These results are expected to support policy development of urban planning, disaster prevention, and transportation management.

  19. Zero-inflated Poisson model based likelihood ratio test for drug safety signal detection.

    Science.gov (United States)

    Huang, Lan; Zheng, Dan; Zalkikar, Jyoti; Tiwari, Ram

    2017-02-01

    In recent decades, numerous methods have been developed for data mining of large drug safety databases, such as Food and Drug Administration's (FDA's) Adverse Event Reporting System, where data matrices are formed by drugs such as columns and adverse events as rows. Often, a large number of cells in these data matrices have zero cell counts and some of them are "true zeros" indicating that the drug-adverse event pairs cannot occur, and these zero counts are distinguished from the other zero counts that are modeled zero counts and simply indicate that the drug-adverse event pairs have not occurred yet or have not been reported yet. In this paper, a zero-inflated Poisson model based likelihood ratio test method is proposed to identify drug-adverse event pairs that have disproportionately high reporting rates, which are also called signals. The maximum likelihood estimates of the model parameters of zero-inflated Poisson model based likelihood ratio test are obtained using the expectation and maximization algorithm. The zero-inflated Poisson model based likelihood ratio test is also modified to handle the stratified analyses for binary and categorical covariates (e.g. gender and age) in the data. The proposed zero-inflated Poisson model based likelihood ratio test method is shown to asymptotically control the type I error and false discovery rate, and its finite sample performance for signal detection is evaluated through a simulation study. The simulation results show that the zero-inflated Poisson model based likelihood ratio test method performs similar to Poisson model based likelihood ratio test method when the estimated percentage of true zeros in the database is small. Both the zero-inflated Poisson model based likelihood ratio test and likelihood ratio test methods are applied to six selected drugs, from the 2006 to 2011 Adverse Event Reporting System database, with varying percentages of observed zero-count cells.

  20. Safety in the operating room during orthopedic trauma surgery-incidence of adverse events related to technical equipment and logistics

    NARCIS (Netherlands)

    van Delft, E. A. K.; Schepers, T.; Bonjer, H. J.; Kerkhoffs, G. M. M. J.; Goslings, J. C.; Schep, N. W. L.

    2017-01-01

    Safety in the operating room is widely debated. Adverse events during surgery are potentially dangerous for the patient and staff. The incidence of adverse events during orthopedic trauma surgery is unknown. Therefore, we performed a study to quantify the incidence of these adverse events. Primary

  1. Plant specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events

    International Nuclear Information System (INIS)

    2011-01-01

    The German Parliament requested (17 March 2011) a comprehensive inspection of German nuclear power plants. For this purpose independent expert commissions should perform a new risk analysis of all German NPPS and nuclear installations with respect to the lessons learned from the Fukushima (Japan) events and other extraordinary damage scenarios. The Reactor safety commission (RSK) was assigned by the German Bundesamt fuer Strahlenschutz to develop a catalogue of requirements for this safety inspection. The contribution summarizes the required inspection volume (status 30.03.2011) including the following events: natural events like earth quakes, floods, weather-based consequences and possible superposition. Additionally the following assumptions have to be considered: event independent postulated common failures or systematic faults, station blackout larger than 2 hours, long-term failure of the auxiliary cooling water supply; aggravating boundary conditions for the performance of emergency measures (non-availability of power supply), hydrogen generation and detonation hazard, restricted personnel availability, non-accessibility due to high radiation levels, impeded technical support from outside. (orig.)

  2. Proof-testing strategies induced by dangerous detected failures of safety-instrumented systems

    International Nuclear Information System (INIS)

    Liu, Yiliu; Rausand, Marvin

    2016-01-01

    Some dangerous failures of safety-instrumented systems (SISs) are detected almost immediately by diagnostic self-testing as dangerous detected (DD) failures, whereas other dangerous failures can only be detected by proof-testing, and are therefore called dangerous undetected (DU) failures. Some items may have a DU- and a DD-failure at the same time. After the repair of a DD-failure is completed, the maintenance team has two options: to perform an insert proof test for DU-failure or not. If an insert proof test is performed, it is necessary to decide whether the next scheduled proof test should be postponed or performed at the scheduled time. This paper analyzes the effects of different testing strategies on the safety performance of a single channel of a SIS. The safety performance is analyzed by Petri nets and by approximation formulas and the results obtained by the two approaches are compared. It is shown that insert testing improves the safety performance of the channel, but the feasibility and cost of the strategy may be a hindrance to recommend insert testing. - Highlights: • Identify the tests induced by detected failures. • Model the testing strategies following DD-failures. • Propose analytical formulas for effects of strategies. • Simulate and verify the proposed models.

  3. 77 FR 42176 - Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone

    Science.gov (United States)

    2012-07-18

    ... fireworks launch site located at position 41-34'-18.10'' N, 082-51'-18.70'' W (NAD 83). This zone will be... at position 41-34'-18.10'' N, 082- 51'-18.70'' W (NAD 83). (ii) Expected date. This safety zone will...-AA00 Safety Zones; Annual Fireworks Events in the Captain of the Port Detroit Zone AGENCY: Coast Guard...

  4. 76 FR 37646 - Safety Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, Lake Tahoe, CA

    Science.gov (United States)

    2011-06-28

    ... Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, Lake Tahoe, CA AGENCY... annual safety zone for the Fourth of July Fireworks, Lake Tahoe, California, located off Incline Village...,000 foot safety zone for the annual Fourth of July Fireworks Display in 33 CFR 165.1191 on July 4...

  5. Complexity of deciding detectability in discrete event systems

    Czech Academy of Sciences Publication Activity Database

    Masopust, Tomáš

    2018-01-01

    Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer science s, information science , bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www. science direct.com/ science /article/pii/S0005109818301730

  6. Complexity of deciding detectability in discrete event systems

    Czech Academy of Sciences Publication Activity Database

    Masopust, Tomáš

    2018-01-01

    Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www.sciencedirect.com/science/article/pii/S0005109818301730

  7. Real-time detection and classification of anomalous events in streaming data

    Science.gov (United States)

    Ferragut, Erik M.; Goodall, John R.; Iannacone, Michael D.; Laska, Jason A.; Harrison, Lane T.

    2016-04-19

    A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The events can be displayed to a user in user-defined groupings in an animated fashion. The system can include a plurality of anomaly detectors that together implement an algorithm to identify low probability events and detect atypical traffic patterns. The atypical traffic patterns can then be classified as being of interest or not. In one particular example, in a network environment, the classification can be whether the network traffic is malicious or not.

  8. A safety control device for detecting undesirable conditions

    Energy Technology Data Exchange (ETDEWEB)

    1974-09-26

    The invention relates to safety control devices. It deals with a device adapted to transmit a warning signal and to the detection of an undesirable condition in an associated apparatus, said device comprising switching means comprising transistors mounted in a reaction path, feeding means for opening the switching means whenever an undesirable condition has been detected by sensors, whereby an oscillator is caused to stop oscillating, and an outlet device controlled by the oscillator stoppage. This can be applied to the supervision of nuclear reactor.

  9. Very low frequency earthquakes (VLFEs) detected during episodic tremor and slip (ETS) events in Cascadia using a match filter method indicate repeating events

    Science.gov (United States)

    Hutchison, A. A.; Ghosh, A.

    2016-12-01

    Very low frequency earthquakes (VLFEs) occur in transitional zones of faults, releasing seismic energy in the 0.02-0.05 Hz frequency band over a 90 s duration and typically have magntitudes within the range of Mw 3.0-4.0. VLFEs can occur down-dip of the seismogenic zone, where they can transfer stress up-dip potentially bringing the locked zone closer to a critical failure stress. VLFEs also occur up-dip of the seismogenic zone in a region along the plate interface that can rupture coseismically during large megathrust events, such as the 2011 Tohoku-Oki earthquake [Ide et al., 2011]. VLFEs were first detected in Cascadia during the 2011 episodic tremor and slip (ETS) event, occurring coincidentally with tremor [Ghosh et al., 2015]. However, during the 2014 ETS event, VLFEs were spatially and temporally asynchronous with tremor activity [Hutchison and Ghosh, 2016]. Such contrasting behaviors remind us that the mechanics behind such events remain elusive, yet they are responsible for the largest portion of the moment release during an ETS event. Here, we apply a match filter method using known VLFEs as template events to detect additional VLFEs. Using a grid-search centroid moment tensor inversion method, we invert stacks of the resulting match filter detections to ensure moment tensor solutions are similar to that of the respective template events. Our ability to successfully employ a match filter method to VLFE detection in Cascadia intrinsically indicates that these events can be repeating, implying that the same asperities are likely responsible for generating multiple VLFEs.

  10. 76 FR 37649 - Safety Zone; Northern California Annual Fireworks Events, Independence Day Fireworks

    Science.gov (United States)

    2011-06-28

    ... Zone; Northern California Annual Fireworks Events, Independence Day Fireworks AGENCY: Coast Guard, DHS... Independence Day Fireworks (Kings Beach 4th of July Fireworks) safety zone. This action is necessary to control... Fireworks in 33 CFR 165.1191 on July 3, 2011, from 7 a.m. through 10 p.m. The fireworks launch site is...

  11. Work Placements as Learning Environments for Patient Safety: Finnish and British Preregistration Nursing Students' Important Learning Events

    Science.gov (United States)

    Tella, Susanna; Smith, Nancy-Jane; Partanen, Pirjo; Turunen, Hannele

    2016-01-01

    Learning to ensure patient safety in complex health care environments is an internationally recognised concern. This article explores and compares Finnish (n = 22) and British (n = 32) pre-registration nursing students' important learning events about patient safety from their work placements in health care organisations. Written descriptions were…

  12. Description and detection of burst events in turbulent flows

    Science.gov (United States)

    Schmid, P. J.; García-Gutierrez, A.; Jiménez, J.

    2018-04-01

    A mathematical and computational framework is developed for the detection and identification of coherent structures in turbulent wall-bounded shear flows. In a first step, this data-based technique will use an embedding methodology to formulate the fluid motion as a phase-space trajectory, from which state-transition probabilities can be computed. Within this formalism, a second step then applies repeated clustering and graph-community techniques to determine a hierarchy of coherent structures ranked by their persistencies. This latter information will be used to detect highly transitory states that act as precursors to violent and intermittent events in turbulent fluid motion (e.g., bursts). Used as an analysis tool, this technique allows the objective identification of intermittent (but important) events in turbulent fluid motion; however, it also lays the foundation for advanced control strategies for their manipulation. The techniques are applied to low-dimensional model equations for turbulent transport, such as the self-sustaining process (SSP), for varying levels of complexity.

  13. Evaluating the impact of grade crossing safety factors through signal detection theory

    Science.gov (United States)

    2012-10-22

    The purpose of this effort was to apply signal detection theory to descriptively model the impact : of five grade crossing safety factors to understand their effect on driver decision making. The : safety factors consisted of: improving commercial mo...

  14. Safety assessment of multi-unit NPP sites subject to external events

    International Nuclear Information System (INIS)

    Samaddar, Sujit; Hibino, Kenta; Coman, Ovidiu

    2014-01-01

    This paper presents a framework for conducting a probabilistic safety assessment of multi-unit sites against external events. The treatment of multiple hazard on a unit, interaction between units, implementation of severe accident measures, human reliability, environmental conditions, metric of risk for both reactor and non-reactor sources, integration of risk and responses and many such important factors need to be addressed within the context of this framework. The framework facilitates the establishment of a comprehensive methodology that can be applied internationally to the peer review of safety assessment of multi-unit sites under the impact of multiple external hazards. In summary, it can be said that the site safety assessment for a multi-unit site will be quite complex and need to start with individual unit risk assessments, these need to be combined considering the interactions between units and their responses, and the fragilities of the installations established considering the combined demands from all interactions. Using newly established risk metric the risk can then be integrated for the overall site. Fig. 2 shows schematically such a proposal. Much work has to done and the IAEA has established a working group that is systematically establishing the structure and process to incorporate the many issues that are a part of a multi-unit site safety assessment. (authors)

  15. Potential off-normal events and associated radiological source terms for the compact ignition tokamak: Fusion Safety Program

    International Nuclear Information System (INIS)

    Holland, D.F.; Lyon, R.E.

    1987-10-01

    The Compact Ignition Tokamak (CIT), the latest step in the United States program to develop the commercial application of fusion power, is designed as the first fusion device to achieve ignition conditions. It is to be constructed near Princeton, New Jersey on the site of the existing Tokamak Fusion Test Reactor (TFTR). To address the environmental impact and public safety concerns, a preliminary analysis was performed of potential off-normal radiological releases. Operational occurrences, natural phenomena, accidents with external origins, and accidents external to the PPPL site were considered as potential sources for off-normal events. Based on an initial screening, events were selected for preliminary analysis. Included in these events were tritium releases from the tritium delivery and recovery system, tritium releases from the torus, releases of activated nitrogen from the test cell or cryostat, seismic events, and shipping accidents. In each case, the design considerations related to the event were reviewed and the release scenarios discussed. Because of the complexity of some of the proposed safety systems, in some cases event trees were used to describe the accident scenarios. For each scenario, the probability was estimated as well as the release magnitude, isotope, chemical form, and release mode. 10 refs., 17 figs., 5 tabs

  16. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Anticipation and the adaptive control of safety margins in driving

    NARCIS (Netherlands)

    van der Hulst, M.; Meijman, T.F.; Rothengatter, J.A.

    Driving is a task that requires the timely detection of critical events and relevant changes in traffic circumstances. Adaptation of speed and safety margins allows drivers to control the time available to react to potential hazards. One of the basic safety margins in driving is the time headway

  18. Review of events at large pool-type irradiators

    International Nuclear Information System (INIS)

    Trager, E.A. Jr.

    1989-03-01

    Large pool-type gamma irradiators are used in applications such as the ''cold'' sterilization of medical and pharmaceutical supplies, and recent changes in federal regulations make it possible they will be used extensively in the preservation of foodstuffs. Because of this possible large increase in the use of irradiators, the Office of Nuclear Materials Safety and Safeguards was interested in knowing what events had occurred at irradiators. The event data would be used as background in developing new regulations on irradiators. Therefore, AEOD began a study of the operating experience at large, wet source storage gamma irradiators. The scope of the study was to assess all available operating information on large (≥ 250,000 curie), pool-type irradiators licensed by both the NRC and the Agreement States, and events at foreign facilities. The study found that about 0.12 events have been reported per irradiator-year. Most of these events were precursor events, in that there was no evidence of damage to the radioactive sources or degradation in the level of safety of the facility. Events with more significant impacts had a reported frequency of about 0.01 event per irradiator-year. However, the actual rate of occurrence of events of concern to the staff may be higher because there are few specific reporting requirements for events at irradiators. It is suggested that during development of a regulation for large pool-type irradiators consideration be given to specifying requirements for: reporting breakdowns in access control systems; periodic inspection of the source movement and suspension system; systems to detect source leakage and product contamination; allowable pool leakage; and feedback of information on operational events involving safety-important systems

  19. Safety of the Transport of Radioactive Materials for Civilian Use in France. Lessons learned by IRSN from analysis of significant events reported in 2014 and 2015. Mission report 2016

    International Nuclear Information System (INIS)

    2017-01-01

    IRSN publishes its report on the safety of transport of radioactive materials for civilian use in France for the years 2014 and 2015. It is based on an overall review of the significant events that occurred during this period during transport operations in France by road, railway, inland waterway, sea and air of 980 000 parcels loaded with radioactive substances. In 2014 and 2015, respectively 139 and 122 events were reported, which is about one event reported for 7,500 packages carried. While these figures are up significantly compared to 2013 (93 reported events, or 1 in 10,000 packages carried), IRSN believes that this trend should not however be interpreted as a deterioration of the safety level of the transport of radioactive materials. Indeed, it is largely explained by better detection of events relevant to safety by the actors concerned and therefore their declaration to the authorities. None of these events had significant radiological consequences for the workers, the population or the environment. As part of progress made, IRSN notes a sharp decrease, in 2015, in the number of damage of packages intended for medical activities during their handling in airport areas. This decrease is linked to awareness actions conducted for airlines companies and staff involved in the handling of packages. Finally, three themes must be the subject of particular vigilance of the actors concerned and of corrective actions: - Compliance with the requirements for the transport of gamma radiography devices, in particular those associated with the locking of the source; events related to the transport of gamma radiography devices appeared as remarkable events over the period (3 level 1 events and 1 level 2 events); - The tie-down of packages on their means of transport, given the risks of fall of the package during transport, as well as tie-down of the objects in their transport container; - The operations of filling and closing of drums containing uranium ore in order to

  20. Safety at basic nuclear facilities other than nuclear power plants. Lessons learned from significant events reported in 2011 and 2012

    International Nuclear Information System (INIS)

    2014-01-01

    The third report on the safety of basic nuclear installations in France other than power reactors presents an IRSN's analysis of significant events reported to the Nuclear Safety Authority in the years 2011 and 2012. It covers plants, laboratories, research reactors and facilities for the treatment, storage or disposal of waste. This report aims to contribute to a better understanding by stakeholders and more widely by the public of the safety and radiation protection issues associated with the operation of nuclear facilities, the progress made in terms of safety as well as the identified deficiencies. The main trend shows, once again, the significant role of organizational and human factors in the significant events that occurred in 2011 and 2012, of which the vast majority are without noteworthy consequences. Aging mechanisms are another major cause of equipment failure and require special attention. The report also provides IRSN's analysis of specific events that are particularly instructive for facility safety and a synthesis of assessments performed by IRSN on topics that are important for safety and radiation protection. IRSN also includes an overview of its analysis of measures proposed by licensees for increasing the safety of their facilities after the March 2011 accident at the Fukushima Daiichi nuclear power plant in Japan, which consist of providing a 'hardened safety core' to confront extreme situations (earthquake, flooding, etc.) that are unlikely but plausible and can bring about levels of hazards higher than those taken into account in the design of the facilities

  1. Intraoperative imaging for patient safety and QA: detection of intracranial hemorrhage using C-arm cone-beam CT

    Science.gov (United States)

    Schafer, Sebastian; Wang, Adam; Otake, Yoshito; Stayman, J. W.; Zbijewski, Wojciech; Kleinszig, Gerhard; Xia, Xuewei; Gallia, Gary L.; Siewerdsen, Jeffrey H.

    2013-03-01

    Intraoperative imaging could improve patient safety and quality assurance (QA) via the detection of subtle complications that might otherwise only be found hours after surgery. Such capability could therefore reduce morbidity and the need for additional intervention. Among the severe adverse events that could be more quickly detected by high-quality intraoperative imaging is acute intracranial hemorrhage (ICH), conventionally assessed using post-operative CT. A mobile C-arm capable of high-quality cone-beam CT (CBCT) in combination with advanced image reconstruction techniques is reported as a means of detecting ICH in the operating room. The system employs an isocentric C-arm with a flat-panel detector in dual gain mode, correction of x-ray scatter and beam-hardening, and a penalized likelihood (PL) iterative reconstruction method. Performance in ICH detection was investigated using a quantitative phantom focusing on (non-contrast-enhanced) blood-brain contrast, an anthropomorphic head phantom, and a porcine model with injection of fresh blood bolus. The visibility of ICH was characterized in terms of contrast-to-noise ratio (CNR) and qualitative evaluation of images by a neurosurgeon. Across a range of size and contrast of the ICH as well as radiation dose from the CBCT scan, the CNR was found to increase from ~2.2-3.7 for conventional filtered backprojection (FBP) to ~3.9-5.4 for PL at equivalent spatial resolution. The porcine model demonstrated superior ICH detectability for PL. The results support the role of high-quality mobile C-arm CBCT employing advanced reconstruction algorithms for detecting subtle complications in the operating room at lower radiation dose and lower cost than intraoperative CT scanners and/or fixedroom C-arms. Such capability could present a potentially valuable aid to patient safety and QA.

  2. Ontology-based knowledge management for personalized adverse drug events detection.

    Science.gov (United States)

    Cao, Feng; Sun, Xingzhi; Wang, Xiaoyuan; Li, Bo; Li, Jing; Pan, Yue

    2011-01-01

    Since Adverse Drug Event (ADE) has become a leading cause of death around the world, there arises high demand for helping clinicians or patients to identify possible hazards from drug effects. Motivated by this, we present a personalized ADE detection system, with the focus on applying ontology-based knowledge management techniques to enhance ADE detection services. The development of electronic health records makes it possible to automate the personalized ADE detection, i.e., to take patient clinical conditions into account during ADE detection. Specifically, we define the ADE ontology to uniformly manage the ADE knowledge from multiple sources. We take advantage of the rich semantics from the terminology SNOMED-CT and apply it to ADE detection via the semantic query and reasoning.

  3. Life on the line: Job demands, perceived co-worker support for safety, and hazardous work events.

    Science.gov (United States)

    Turner, Nick; Chmiel, Nik; Hershcovis, M Sandy; Walls, Melanie

    2010-10-01

    The present study of 334 United Kingdom trackside workers tested an interaction hypothesis. We hypothesized, drawing on the job demands-resources framework, that perceived support for safety (from senior managers, supervisors, and coworkers) as job resources would weaken the relationship between higher job demands and more frequent hazardous work events. Consistent with social impact theory, we predicted that perceived coworker support for safety would be particularly influential when trackside workers faced higher job demands. Moderated multiple regression showed that, of all three sources of perceived support for safety, perceived coworker support for safety was most important for keeping employees safe in the face of high job demands. © 2010 APA, all rights reserved.

  4. Technical report on design base events related to the safety assessment of a Low-level Waste Storage Facility (LWSF)

    International Nuclear Information System (INIS)

    Karino, Motonobu; Uryu, Mitsuru; Miyata, Kazutoshi; Matsui, Norio; Imamoto, Nobuo; Kawamata, Tatsuo; Saito, Yasuo; Nagayama, Mineo; Wakui, Yasuyuki

    1999-07-01

    The construction of a new Low-level Waste Storage Facility (LWSF) is planned for storage of concentrated liquid waste from existing Low-level Radioactive Waste Treatment Facility in Tokai Reprocessing Plant of JNC. An essential base for the safety designing of the facility is correctly implemented the adoption of the defence in depth principle. This report summarized criteria for judgement, selection of postulated events, major analytical conditions for anticipated operational occurrences and accidents for the safety assessment and evaluation of each event were presented. (Itami, H.)

  5. 76 FR 55566 - Safety Zones; Fireworks Displays and Surfing Events in Captain of the Port Long Island Sound Zone

    Science.gov (United States)

    2011-09-08

    ...-AA00 Safety Zones; Fireworks Displays and Surfing Events in Captain of the Port Long Island Sound Zone... zones for marine events within the Captain of the Port (COTP) Long Island Sound Zone for a surfing event... unless authorized by the COTP Sector Long Island Sound. DATES: This rule is effective in the CFR on...

  6. Detection of red tide events in the Ariake Sound, Japan

    Science.gov (United States)

    Ishizaka, Joji

    2003-05-01

    High resolution SeaWiFS data was used to detect a red tide event occurred in the Ariake Sound, Japan, in winter of 2000 to 2001. The area is small embayment surrounding by tidal flat, and it is known as one of the most productive areas in coast of Japan. The red tide event damaged to seaweed (Nori) culture, and the relation to the reclamation at the Isahaya Bay in the Sound has been discussed. SeaWiFS chlorophyll data showed the red tide started early December 2000, from the Isahaya Bay, although direct relationship to the reclamation was not clear. The red tide persisted to the end of February. Monthly average of SeaWiFS data from May 1998 to December 2001 indicated that the chlorophyll increased twice a year, early summer and fall after the rain. The red tide event was part of the fall bloom which started later and continued longer than other years. Ocean color is useful to detect the red tide; however, it is required to improve the algorithms to accurately estimate chlorophyll in high turbid water and to discriminate toxic flagellates.

  7. Event detection intelligent camera development

    International Nuclear Information System (INIS)

    Szappanos, A.; Kocsis, G.; Molnar, A.; Sarkozi, J.; Zoletnik, S.

    2008-01-01

    A new camera system 'event detection intelligent camera' (EDICAM) is being developed for the video diagnostics of W-7X stellarator, which consists of 10 distinct and standalone measurement channels each holding a camera. Different operation modes will be implemented for continuous and for triggered readout as well. Hardware level trigger signals will be generated from real time image processing algorithms optimized for digital signal processor (DSP) and field programmable gate array (FPGA) architectures. At full resolution a camera sends 12 bit sampled 1280 x 1024 pixels with 444 fps which means 1.43 Terabyte over half an hour. To analyse such a huge amount of data is time consuming and has a high computational complexity. We plan to overcome this problem by EDICAM's preprocessing concepts. EDICAM camera system integrates all the advantages of CMOS sensor chip technology and fast network connections. EDICAM is built up from three different modules with two interfaces. A sensor module (SM) with reduced hardware and functional elements to reach a small and compact size and robust action in harmful environment as well. An image processing and control unit (IPCU) module handles the entire user predefined events and runs image processing algorithms to generate trigger signals. Finally a 10 Gigabit Ethernet compatible image readout card functions as the network interface for the PC. In this contribution all the concepts of EDICAM and the functions of the distinct modules are described

  8. Selected problems and results of the transient event and reliability analyses for the German safety study

    International Nuclear Information System (INIS)

    Hoertner, H.

    1977-01-01

    For the investigation of the risk of nuclear power plants loss-of-coolant accidents and transients have to be analyzed. The different functions of the engineered safety features installed to cope with transients are explained. The event tree analysis is carried out for the important transient 'loss of normal onsite power'. Preliminary results of the reliability analyses performed for quantitative evaluation of this event tree are shown. (orig.) [de

  9. An integrative review of patient safety in studies on the care and safety of patients with communication disabilities in hospital.

    Science.gov (United States)

    Hemsley, Bronwyn; Georgiou, Andrew; Hill, Sophie; Rollo, Megan; Steel, Joanne; Balandin, Susan

    2016-04-01

    To review the research literature on the experiences of patients with communication disabilities in hospital according to the Generic Model of patient safety. In 2014 and 2015, we searched four scientific databases for studies with an aim or result relevant to safety of hospital patients with communication disabilities. The review included 27 studies. A range of adverse event types were outlined in qualitative research. Little detail was provided about contributing or protective factors for safety incidents in hospital for these patients or the impact of the incidents on the patient or organisations involved. Further research addressing the safety of patients with communication disabilities is needed. Sufficient detail is required to identify the nature, timing, and detection of incidents; factors that contribute to or prevent adverse events; and detail the impact of the adverse events. In order to provide safe and effective care to people with communication disabilities in hospital, a priority for health and disability services must be the design and evaluation of ecologically appropriate and evidence-based interventions to improve patient care, communication, and reduce the risk of costly and harmful patient safety incidents. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Safety analyses for transient behavior of plasma and in-vessel components during plasma abnormal events in fusion reactor

    International Nuclear Information System (INIS)

    Honda, Takuro; Okazaki, Takashi; Bartels, H.W.; Uckan, N.A.; Seki, Yasushi.

    1997-01-01

    Safety analyses on plasma abnormal events have been performed using a hybrid code of a plasma dynamics model and a heat transfer model of in-vessel components. Several abnormal events, e.g., increase in fueling rate, were selected for the International Thermonuclear Experimental Reactor (ITER) and transient behavior of the plasma and the invessel components during the events was analyzed. The physics model for safety analysis was conservatively prepared. In most cases, the plasma is terminated by a disruption or it returns to the original operation point. When the energy confinement improves by a factor of 2.0 in the steady state, which is a hypothetical assumption under the present plasma data, the maximum fusion power reaches about 3.3 GW at about 3.6 s and the plasma is terminated due to a disruption. However, the results obtained in this study show the confinement boundary of ITER can be kept almost intact during the abnormal plasma transients, as long as the cooling system works normally. Several parametric studies are needed to comprehend the overpower transient including structure behavior, since many uncertainties are connected to the filed of the plasma physics. And, future work will need to discuss the burn control scenario considering confinement mode transition, system specifications, experimental plans and safety regulations, etc. to confirm the safety related to the plasma anomaly. (author)

  11. 78 FR 16211 - Safety Zone, Corp. Event Finale UHC, St. Thomas Harbor; St. Thomas, U.S. Virgin Islands

    Science.gov (United States)

    2013-03-14

    ... 1625-AA00 Safety Zone, Corp. Event Finale UHC, St. Thomas Harbor; St. Thomas, U.S. Virgin Islands... establish a temporary safety zone on the waters of St. Thomas Harbor in St. Thomas, U.S. Virgin Islands... through Friday, except federal holidays. The telephone number is 202-366-9329. See the ``Public...

  12. Facilitated Nurse Medication-Related Event Reporting to Improve Medication Management Quality and Safety in Intensive Care Units.

    Science.gov (United States)

    Xu, Jie; Reale, Carrie; Slagle, Jason M; Anders, Shilo; Shotwell, Matthew S; Dresselhaus, Timothy; Weinger, Matthew B

    Medication safety presents an ongoing challenge for nurses working in complex, fast-paced, intensive care unit (ICU) environments. Studying ICU nurse's medication management-especially medication-related events (MREs)-provides an approach to analyze and improve medication safety and quality. The goal of this study was to explore the utility of facilitated MRE reporting in identifying system deficiencies and the relationship between MREs and nurses' work in the ICUs. We conducted 124 structured 4-hour observations of nurses in three different ICUs. Each observation included measurement of nurse's moment-to-moment activity and self-reports of workload and negative mood. The observer then obtained MRE reports from the nurse using a structured tool. The MREs were analyzed by three experts. MREs were reported in 35% of observations. The 60 total MREs included four medication errors and seven adverse drug events. Of the 49 remaining MREs, 65% were associated with negative patient impact. Task/process deficiencies were the most common contributory factor for MREs. MRE occurrence was correlated with increased total task volume. MREs also correlated with increased workload, especially during night shifts. Most of these MREs would not be captured by traditional event reporting systems. Facilitated MRE reporting provides a robust information source about potential breakdowns in medication management safety and opportunities for system improvement.

  13. Incidence of patient safety events and process-related human failures during intra-hospital transportation of patients: retrospective exploration from the institutional incident reporting system.

    Science.gov (United States)

    Yang, Shu-Hui; Jerng, Jih-Shuin; Chen, Li-Chin; Li, Yu-Tsu; Huang, Hsiao-Fang; Wu, Chao-Ling; Chan, Jing-Yuan; Huang, Szu-Fen; Liang, Huey-Wen; Sun, Jui-Sheng

    2017-11-03

    Intra-hospital transportation (IHT) might compromise patient safety because of different care settings and higher demand on the human operation. Reports regarding the incidence of IHT-related patient safety events and human failures remain limited. To perform a retrospective analysis of IHT-related events, human failures and unsafe acts. A hospital-wide process for the IHT and database from the incident reporting system in a medical centre in Taiwan. All eligible IHT-related patient safety events between January 2010 to December 2015 were included. Incidence rate of IHT-related patient safety events, human failure modes, and types of unsafe acts. There were 206 patient safety events in 2 009 013 IHT sessions (102.5 per 1 000 000 sessions). Most events (n=148, 71.8%) did not involve patient harm, and process events (n=146, 70.9%) were most common. Events at the location of arrival (n=101, 49.0%) were most frequent; this location accounted for 61.0% and 44.2% of events with patient harm and those without harm, respectively (pprocess step was the preparation of the transportation team (n=91, 48.9%). Contributing unsafe acts included perceptual errors (n=14, 7.5%), decision errors (n=56, 30.1%), skill-based errors (n=48, 25.8%), and non-compliance (n=68, 36.6%). Multivariate analysis showed that human failure found in the arrival and hand-off sub-process (OR 4.84, pprocess at the location of arrival and prevent errors other than omissions. Long-term monitoring of IHT-related events is also warranted. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. A robust neural network-based approach for microseismic event detection

    KAUST Repository

    Akram, Jubran; Ovcharenko, Oleg; Peter, Daniel

    2017-01-01

    We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset

  15. Complex Event Detection via Multi Source Video Attributes (Open Access)

    Science.gov (United States)

    2013-10-03

    Complex Event Detection via Multi-Source Video Attributes Zhigang Ma† Yi Yang‡ Zhongwen Xu‡§ Shuicheng Yan Nicu Sebe† Alexander G. Hauptmann...under its International Research Centre @ Singapore Fund- ing Initiative and administered by the IDM Programme Of- fice, and the Intelligence Advanced

  16. Energy Reconstruction for Events Detected in TES X-ray Detectors

    Science.gov (United States)

    Ceballos, M. T.; Cardiel, N.; Cobo, B.

    2015-09-01

    The processing of the X-ray events detected by a TES (Transition Edge Sensor) device (such as the one that will be proposed in the ESA AO call for instruments for the Athena mission (Nandra et al. 2013) as a high spectral resolution instrument, X-IFU (Barret et al. 2013)), is a several step procedure that starts with the detection of the current pulses in a noisy signal and ends up with their energy reconstruction. For this last stage, an energy calibration process is required to convert the pseudo energies measured in the detector to the real energies of the incoming photons, accounting for possible nonlinearity effects in the detector. We present the details of the energy calibration algorithm we implemented as the last part of the Event Processing software that we are developing for the X-IFU instrument, that permits the calculation of the calibration constants in an analytical way.

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  18. Patient Drug Safety Reporting: Diabetes Patients' Perceptions of Drug Safety and How to Improve Reporting of Adverse Events and Product Complaints.

    Science.gov (United States)

    Patel, Puja; Spears, David; Eriksen, Betina Østergaard; Lollike, Karsten; Sacco, Michael

    2018-03-01

    Global health care manufacturer Novo Nordisk commissioned research regarding awareness of drug safety department activities and potential to increase patient feedback. Objectives were to examine patients' knowledge of pharmaceutical manufacturers' responsibilities and efforts regarding drug safety, their perceptions and experiences related to these efforts, and how these factors influence their thoughts and behaviors. Data were collected before and after respondents read a description of a drug safety department and its practices. We conducted quantitative survey research across 608 health care consumers receiving treatment for diabetes in the United States, Germany, United Kingdom, and Italy. This research validated initial, exploratory qualitative research (across 40 comparable consumers from the same countries) which served to guide design of the larger study. Before reading a drug safety department description, 55% of respondents were unaware these departments collect safety information on products and patients. After reading the description, 34% reported the department does more than they expected to ensure drug safety, and 56% reported "more confidence" in the industry as a whole. Further, 66% reported themselves more likely to report an adverse event or product complaint, and 60% reported that they were more likely to contact a drug safety department with questions. The most preferred communication methods were websites/online forums (39%), email (27%), and telephone (25%). Learning about drug safety departments elevates consumers' confidence in manufacturers' safety efforts and establishes potential for patients to engage in increased self-monitoring and reporting. Study results reveal potentially actionable insights for the industry across patient and physician programs and communications.

  19. Insertable cardiac event recorder in detection of atrial fibrillation after cryptogenic stroke: an audit report.

    Science.gov (United States)

    Etgen, Thorleif; Hochreiter, Manfred; Mundel, Markus; Freudenberger, Thomas

    2013-07-01

    Atrial fibrillation (AF) is the most frequent risk factor in ischemic stroke but often remains undetected. We analyzed the value of insertable cardiac event recorder in detection of AF in a 1-year cohort of patients with cryptogenic ischemic stroke. All patients with cryptogenic stroke and eligibility for oral anticoagulation were offered the insertion of a cardiac event recorder. Regular follow-up for 1 year recorded the incidence of AF. Of the 393 patients with ischemic stroke, 65 (16.5%) had a cryptogenic stroke, and in 22 eligible patients, an event recorder was inserted. After 1 year, in 6 of 22 patients (27.3%), AF was detected. These preliminary data show that insertion of cardiac event recorder was eligible in approximately one third of patients with cryptogenic stroke and detected in approximately one quarter of these patients new AF.

  20. Automated Feature and Event Detection with SDO AIA and HMI Data

    Science.gov (United States)

    Davey, Alisdair; Martens, P. C. H.; Attrill, G. D. R.; Engell, A.; Farid, S.; Grigis, P. C.; Kasper, J.; Korreck, K.; Saar, S. H.; Su, Y.; Testa, P.; Wills-Davey, M.; Savcheva, A.; Bernasconi, P. N.; Raouafi, N.-E.; Delouille, V. A.; Hochedez, J. F..; Cirtain, J. W.; Deforest, C. E.; Angryk, R. A.; de Moortel, I.; Wiegelmann, T.; Georgouli, M. K.; McAteer, R. T. J.; Hurlburt, N.; Timmons, R.

    The Solar Dynamics Observatory (SDO) represents a new frontier in quantity and quality of solar data. At about 1.5 TB/day, the data will not be easily digestible by solar physicists using the same methods that have been employed for images from previous missions. In order for solar scientists to use the SDO data effectively they need meta-data that will allow them to identify and retrieve data sets that address their particular science questions. We are building a comprehensive computer vision pipeline for SDO, abstracting complete metadata on many of the features and events detectable on the Sun without human intervention. Our project unites more than a dozen individual, existing codes into a systematic tool that can be used by the entire solar community. The feature finding codes will run as part of the SDO Event Detection System (EDS) at the Joint Science Operations Center (JSOC; joint between Stanford and LMSAL). The metadata produced will be stored in the Heliophysics Event Knowledgebase (HEK), which will be accessible on-line for the rest of the world directly or via the Virtual Solar Observatory (VSO) . Solar scientists will be able to use the HEK to select event and feature data to download for science studies.

  1. Experience feedback from event reports: the human contribution

    International Nuclear Information System (INIS)

    Swaton, E.; Tolstykh, V.

    1990-01-01

    Analysis of reported events reveals that in a large number of areas human intervention contributed to the initiation and/or development of these events. Since an accident at any nuclear power plant can have a world-wide effect on public acceptance, the need for attentive and reliable human behavior assumes an even greater significance. The identification of areas where human interaction can have an impact on safe operation is mainly relying on the analysis of events reported to the nuclear community. Any substantial compilation of safety significant operational events such as contained in the IAEA-IRS (Incident Reporting System) is bound to provide valuable and factual insights into problem areas, their origin, development, impact and some remedial actions. Thus a systematic analysis has been carried out on over 200 events where a human contribution could be identified. Some events of particular interest will be discussed and furthermore generic lessons will be presented. In addition the Assessment of Safety Significant Event Technique (ASSET) developed within IAEA which provides a structured methodology to identify not only the direct cause explaining why an individual failed but more important, insights on the root causes explaining why this latent deficiency was not detected earlier through the plant surveillance programme was applied. (author)

  2. Distributed Event Detection in Wireless Sensor Networks for Disaster Management

    NARCIS (Netherlands)

    Bahrepour, M.; Meratnia, Nirvana; Poel, Mannes; Taghikhaki, Zahra; Havinga, Paul J.M.

    2010-01-01

    Recently, wireless sensor networks (WSNs) have become mature enough to go beyond being simple fine-grained continuous monitoring platforms and become one of the enabling technologies for disaster early-warning systems. Event detection functionality of WSNs can be of great help and importance for

  3. Comparison of event tree, fault tree and Markov methods for probabilistic safety assessment and application to accident mitigation

    International Nuclear Information System (INIS)

    James, H.; Harris, M.J.; Hall, S.F.

    1992-01-01

    Probabilistic safety assessment (PSA) is used extensively in the nuclear industry. The main stages of PSA and the traditional event tree method are described. Focussing on hydrogen explosions, an event tree model is compared to a novel Markov model and a fault tree, and unexpected implication for accident mitigation is revealed. (author)

  4. An Unsupervised Anomalous Event Detection and Interactive Analysis Framework for Large-scale Satellite Data

    Science.gov (United States)

    LIU, Q.; Lv, Q.; Klucik, R.; Chen, C.; Gallaher, D. W.; Grant, G.; Shang, L.

    2016-12-01

    Due to the high volume and complexity of satellite data, computer-aided tools for fast quality assessments and scientific discovery are indispensable for scientists in the era of Big Data. In this work, we have developed a framework for automated anomalous event detection in massive satellite data. The framework consists of a clustering-based anomaly detection algorithm and a cloud-based tool for interactive analysis of detected anomalies. The algorithm is unsupervised and requires no prior knowledge of the data (e.g., expected normal pattern or known anomalies). As such, it works for diverse data sets, and performs well even in the presence of missing and noisy data. The cloud-based tool provides an intuitive mapping interface that allows users to interactively analyze anomalies using multiple features. As a whole, our framework can (1) identify outliers in a spatio-temporal context, (2) recognize and distinguish meaningful anomalous events from individual outliers, (3) rank those events based on "interestingness" (e.g., rareness or total number of outliers) defined by users, and (4) enable interactively query, exploration, and analysis of those anomalous events. In this presentation, we will demonstrate the effectiveness and efficiency of our framework in the application of detecting data quality issues and unusual natural events using two satellite datasets. The techniques and tools developed in this project are applicable for a diverse set of satellite data and will be made publicly available for scientists in early 2017.

  5. Detecting Micro-seismicity and Long-duration Tremor-like Events from the Oklahoma Wavefield Experiment

    Science.gov (United States)

    Li, C.; Li, Z.; Peng, Z.; Zhang, C.; Nakata, N.

    2017-12-01

    Oklahoma has experienced abrupt increase of induced seismicity in the last decade. An important way to fully understand seismic activities in Oklahoma is to obtain more complete earthquake catalogs and detect different types of seismic events. The IRIS Community Wavefield Demonstration Experiment was deployed near Enid, Oklahoma in Summer of 2016. The dataset from this ultra-dense array provides an excellent opportunity for detecting microseismicity in that region with wavefield approaches. Here we examine continuous waveforms recorded by 3 seismic lines using local coherence for ultra-dense arrays (Li et al., 2017), which is a measure of cross-correlation of waveform at each station with its nearby stations. So far we have detected more than 5,000 events from 06/22/2016 to 07/20/2016, and majority of them are not listed on the regional catalog of Oklahoma or global catalogs, indicating that they are local events. We also identify 15-20 long-period long-duration events, some of them lasting for more than 500 s. Such events have been found at major plate-boundary faults (also known as deep tectonic tremor), as well as during hydraulic fracturing, slow-moving landslides and glaciers. Our next step is to locate these possible tremor-like events with their relative arrival times across the array and compare their occurrence times with solid-earth tides and injection histories to better understand their driving mechanisms.

  6. Event Investigation

    International Nuclear Information System (INIS)

    Korosec, D.

    2000-01-01

    The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

  7. Towards Real-Time Detection of Gait Events on Different Terrains Using Time-Frequency Analysis and Peak Heuristics Algorithm.

    Science.gov (United States)

    Zhou, Hui; Ji, Ning; Samuel, Oluwarotimi Williams; Cao, Yafei; Zhao, Zheyi; Chen, Shixiong; Li, Guanglin

    2016-10-01

    Real-time detection of gait events can be applied as a reliable input to control drop foot correction devices and lower-limb prostheses. Among the different sensors used to acquire the signals associated with walking for gait event detection, the accelerometer is considered as a preferable sensor due to its convenience of use, small size, low cost, reliability, and low power consumption. Based on the acceleration signals, different algorithms have been proposed to detect toe off (TO) and heel strike (HS) gait events in previous studies. While these algorithms could achieve a relatively reasonable performance in gait event detection, they suffer from limitations such as poor real-time performance and are less reliable in the cases of up stair and down stair terrains. In this study, a new algorithm is proposed to detect the gait events on three walking terrains in real-time based on the analysis of acceleration jerk signals with a time-frequency method to obtain gait parameters, and then the determination of the peaks of jerk signals using peak heuristics. The performance of the newly proposed algorithm was evaluated with eight healthy subjects when they were walking on level ground, up stairs, and down stairs. Our experimental results showed that the mean F1 scores of the proposed algorithm were above 0.98 for HS event detection and 0.95 for TO event detection on the three terrains. This indicates that the current algorithm would be robust and accurate for gait event detection on different terrains. Findings from the current study suggest that the proposed method may be a preferable option in some applications such as drop foot correction devices and leg prostheses.

  8. Effect of parameters in moving average method for event detection enhancement using phase sensitive OTDR

    Science.gov (United States)

    Kwon, Yong-Seok; Naeem, Khurram; Jeon, Min Yong; Kwon, Il-bum

    2017-04-01

    We analyze the relations of parameters in moving average method to enhance the event detectability of phase sensitive optical time domain reflectometer (OTDR). If the external events have unique frequency of vibration, then the control parameters of moving average method should be optimized in order to detect these events efficiently. A phase sensitive OTDR was implemented by a pulsed light source, which is composed of a laser diode, a semiconductor optical amplifier, an erbium-doped fiber amplifier, a fiber Bragg grating filter, and a light receiving part, which has a photo-detector and high speed data acquisition system. The moving average method is operated with the control parameters: total number of raw traces, M, number of averaged traces, N, and step size of moving, n. The raw traces are obtained by the phase sensitive OTDR with sound signals generated by a speaker. Using these trace data, the relation of the control parameters is analyzed. In the result, if the event signal has one frequency, then the optimal values of N, n are existed to detect the event efficiently.

  9. Integrating physically based simulators with Event Detection Systems: Multi-site detection approach.

    Science.gov (United States)

    Housh, Mashor; Ohar, Ziv

    2017-03-01

    The Fault Detection (FD) Problem in control theory concerns of monitoring a system to identify when a fault has occurred. Two approaches can be distinguished for the FD: Signal processing based FD and Model-based FD. The former concerns of developing algorithms to directly infer faults from sensors' readings, while the latter uses a simulation model of the real-system to analyze the discrepancy between sensors' readings and expected values from the simulation model. Most contamination Event Detection Systems (EDSs) for water distribution systems have followed the signal processing based FD, which relies on analyzing the signals from monitoring stations independently of each other, rather than evaluating all stations simultaneously within an integrated network. In this study, we show that a model-based EDS which utilizes a physically based water quality and hydraulics simulation models, can outperform the signal processing based EDS. We also show that the model-based EDS can facilitate the development of a Multi-Site EDS (MSEDS), which analyzes the data from all the monitoring stations simultaneously within an integrated network. The advantage of the joint analysis in the MSEDS is expressed by increased detection accuracy (higher true positive alarms and fewer false alarms) and shorter detection time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. 76 FR 80850 - Special Local Regulations and Safety Zones; Recurring Events in Northern New England

    Science.gov (United States)

    2011-12-27

    ..., design, or operation; test methods; sampling procedures; and related management systems practices) that... safety of life or property. (f) For all power boat races listed, vessels operating within the regulated... that will not interfere with the progress of the event. (g) For all regattas and boat parades listed...

  11. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

    Science.gov (United States)

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

    2017-01-01

    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  12. Development of 4S and related technologies. (3) Statistical evaluation of safety performance of 4S on ULOF event

    International Nuclear Information System (INIS)

    Ishii, Kyoko; Matsumiya, Hisato; Horie, Hideki; Miyagi, Kazumi

    2009-01-01

    The purpose of this work is to evaluate quantitatively and statistically the safety performance of Super-Safe, Small, and Simple reactor (4S) by analyzing with ARGO code, a plant dynamics code for a sodium-cooled fast reactor. In this evaluation, an Anticipated Transient Without Scram (ATWS) is assumed, and an Unprotected Loss of Flow (ULOF) event is selected as a typical ATWS case. After a metric concerned with safety design is defined as performance factor a Phenomena Identification Ranking Table (PIRT) is produced in order to select the plausible phenomena that affect the metric. Then a sensitivity analysis is performed for the parameters related to the selected plausible phenomena. Finally the metric is evaluated with statistical methods whether it satisfies the given safety acceptance criteria. The result is as follows: The Cumulative Damage Fraction (CDF) for the cladding is defined as a metric, and the statistical estimation of the one-sided upper tolerance limit of 95 percent probability at a 95 percent confidence level in CDF is within the safety acceptance criterion; CDF < 0.1. The result shows that the 4S safety performance is acceptable in the ULOF event. (author)

  13. On the event detected by the Mont Blanc underground neutrino detector on February 23, 1987

    Energy Technology Data Exchange (ETDEWEB)

    Dadykin, V L; Zatsepin, G T; Korchagin, V B

    1988-02-01

    The event detected by the Mont Balnc Soviet -Italian scintillation detector on February 23, 1987 at 2:52:37 are discussed. The corrected energies of the pulases of the event and the probability of the event imitation by the background are presented.

  14. Data-mining for detecting signals of adverse drug reactions of fluoxetine using the Korea Adverse Event Reporting System (KAERS) database.

    Science.gov (United States)

    Kim, Seonji; Park, Kyounghoon; Kim, Mi-Sook; Yang, Bo Ram; Choi, Hyun Jin; Park, Byung-Joo

    2017-10-01

    Selective serotonin reuptake inhibitors (SSRIs) have become one of the most broadly used medications in psychiatry. Fluoxetine is the first representative antidepressant SSRI drug approved by the Food and Drug Administration (FDA) in 1987. Safety information on fluoxetine use alone was less reported than its combined use with other drugs. There were no published papers on adverse drug reactions (ADRs) of fluoxetine analyzing spontaneous adverse events reports. We detected signals of the adverse drug reactions of fluoxetine by data mining using the Korea Adverse Events Reporting System (KAERS) database. We defined signals in this study by the reporting odds ratios (ROR), proportional reporting ratios (PRR), and information components (IC) indices. The KAERS database included 860,224 AE reports, among which 866 reports contained fluoxetine. We compared the labels of fluoxetine among the United States, UK, Germany, France, China, and Korea. Some of the signals, including emotional lability, myositis, spinal stenosis, paradoxical drug reaction, drug dependence, extrapyramidal disorder, adrenal insufficiency, and intracranial hemorrhage, were not labeled in the six countries. In conclusion, we identified new signals that were not known at the time of market approval. However, certain factors should be required for signal evaluation, such as clinical significance, preventability, and causality of the detected signals. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Effects of auditing patient safety in hospital care: design of a mixed-method evaluation

    NARCIS (Netherlands)

    Hanskamp-Sebregts, M.E.; Zegers, M.; Boeijen, W.M.J.; Westert, G.P.; Gurp, P.J.M. van; Wollersheim, H.C.

    2013-01-01

    BACKGROUND: Auditing of patient safety aims at early detection of risks of adverse events and is intended to encourage the continuous improvement of patient safety. The auditing should be an independent, objective assurance and consulting system. Auditing helps an organisation accomplish its

  16. Secure access control and large scale robust representation for online multimedia event detection.

    Science.gov (United States)

    Liu, Changyu; Lu, Bin; Li, Huiling

    2014-01-01

    We developed an online multimedia event detection (MED) system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC) model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK) event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.

  17. Secure Access Control and Large Scale Robust Representation for Online Multimedia Event Detection

    Directory of Open Access Journals (Sweden)

    Changyu Liu

    2014-01-01

    Full Text Available We developed an online multimedia event detection (MED system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.

  18. TNO at TRECVID 2013: Multimedia Event Detection and Instance Search

    NARCIS (Netherlands)

    Bouma, H.; Azzopardi, G.; Spitters, M.M.; Wit, J.J. de; Versloot, C.A.; Zon, R.W.L. van der; Eendebak, P.T.; Baan, J.; Hove, R.J.M. ten; Eekeren, A.W.M. van; Haar, F.B. ter; Hollander, R.J.M. den; Huis, R.J. van; Boer, M.H.T. de; Antwerpen, G. van; Broekhuijsen, B.J.; Daniele, L.M.; Brandt, P.; Schavemaker, J.G.M.; Kraaij, W.; Schutte, K.

    2013-01-01

    We describe the TNO system and the evaluation results for TRECVID 2013 Multimedia Event Detection (MED) and instance search (INS) tasks. The MED system consists of a bag-of-word (BOW) approach with spatial tiling that uses low-level static and dynamic visual features, an audio feature and high-level

  19. Trends and characteristics observed in nuclear events based on international nuclear event scale reports

    International Nuclear Information System (INIS)

    Watanabe, Norio

    2001-01-01

    The International Nuclear Event Scale (INES) is jointly operated by the IAEA and the OECD-NEA as a means designed for providing prompt, clear and consistent information related to nuclear events, that occurred at nuclear facilities, and facilitating communication between the nuclear community, the media and the public. Nuclear events are reported to the INES with the Scale', a consistent safety significance indicator, which runs from level 0, for events with no safety significance, to level 7 for a major accident with widespread health and environmental effects. Since the operation of INES was initiated in 1990, approximately 500 events have been reported and disseminated. The present paper discusses the trends observed in nuclear events, such as overall trends of the reported events and characteristics of safety significant events with level 2 or higher, based on the INES reports. (author)

  20. Assessment of Quadrivalent Human Papillomavirus Vaccine Safety Using the Self-Controlled Tree-Temporal Scan Statistic Signal-Detection Method in the Sentinel System.

    Science.gov (United States)

    Yih, W Katherine; Maro, Judith C; Nguyen, Michael; Baker, Meghan A; Balsbaugh, Carolyn; Cole, David V; Dashevsky, Inna; Mba-Jonas, Adamma; Kulldorff, Martin

    2018-06-01

    The self-controlled tree-temporal scan statistic-a new signal-detection method-can evaluate whether any of a wide variety of health outcomes are temporally associated with receipt of a specific vaccine, while adjusting for multiple testing. Neither health outcomes nor postvaccination potential periods of increased risk need be prespecified. Using US medical claims data in the Food and Drug Administration's Sentinel system, we employed the method to evaluate adverse events occurring after receipt of quadrivalent human papillomavirus vaccine (4vHPV). Incident outcomes recorded in emergency department or inpatient settings within 56 days after first doses of 4vHPV received by 9- through 26.9-year-olds in 2006-2014 were identified using International Classification of Diseases, Ninth Revision, diagnosis codes and analyzed by pairing the new method with a standard hierarchical classification of diagnoses. On scanning diagnoses of 1.9 million 4vHPV recipients, 2 statistically significant categories of adverse events were found: cellulitis on days 2-3 after vaccination and "other complications of surgical and medical procedures" on days 1-3 after vaccination. Cellulitis is a known adverse event. Clinically informed investigation of electronic claims records of the patients with "other complications" did not suggest any previously unknown vaccine safety problem. Considering that thousands of potential short-term adverse events and hundreds of potential risk intervals were evaluated, these findings add significantly to the growing safety record of 4vHPV.

  1. Earthquake-associated events. Annual safety research report, JFY 2011

    International Nuclear Information System (INIS)

    2012-01-01

    For the tsunami and slope stability as the earthquake-associated events that increased with the revision of the regulatory guide for reviewing seismic design of nuclear power reactor facilities, related technical standard and analysis code were leveled up to support the safety examination of the country. For tsunami study, the original plan was changed due to the 2011 Tohoku earthquake tsunami, analysis code of river run-up, sedimentation, probabilistic tsunami hazard and tsunami trace database were developed. For slope study, in addition to conventional stress criteria, in order to build a slope stability evaluation method, incorporating new indicators, such as deformation and strain, the following study was conducted. The large-scale shaking table test for E-defense, the test data were obtained. The applicability of slope stability analysis code was examined by using the shaking table test data. (author)

  2. Safety logic systems of PFBR

    International Nuclear Information System (INIS)

    Sambasivan, S. Ilango

    2004-01-01

    Full text : PFBR is provided with two independent, fast acting and diverse shutdown systems to detect any abnormalities and to initiate safety action. Each system consists of sensors, signal processing systems, logics, drive mechanisms and absorber rods. The absorber rods of the first system are Control and Safety Rods (CSR) and that of the second are called as Diverse Safety Rods (DSR). There are nine CSR and three DSR. While CSR are used for startup, control of reactor power, controlled shutdown and SCRAM, the DSR are used only for SCRAM. The respective drive mechanisms are called as CSRDM and DSRDM. Each of these two systems is capable of executing the shutdown satisfactorily with single failure criteria. Two independent safety logic systems based on diverse principles have been designed for the two shut down systems. The analog outputs of the sensors of Core Monitoring Systems comprising of reactor flux monitoring, core temperature monitoring, failed fuel detection and core flow monitoring systems are processed and converted into binary signals depending on their instantaneous values. Safety logic systems receive the binary signals from these core-monitoring systems and process them logically to protect the reactor against postulated initiating events. Neutronic and power to flow (P/Q) signals form the inputs to safety logic system-I and temperature signals are inputs to the safety logic system II. Failed fuel detection signals are processed by both the shut down systems. The two logic systems to actuate the safety rods are also based on two diverse designs and implemented with solid-state devices to meet all the requirements of safety systems. Safety logic system I that caters to neutronic and P/Q signals is designed around combinational logic and has an on-line test facility to detect struck at faults. The second logic system is based on dynamic logic and hence is inherently safe. This paper gives an overview of the two logic systems that have been

  3. A novel CUSUM-based approach for event detection in smart metering

    Science.gov (United States)

    Zhu, Zhicheng; Zhang, Shuai; Wei, Zhiqiang; Yin, Bo; Huang, Xianqing

    2018-03-01

    Non-intrusive load monitoring (NILM) plays such a significant role in raising consumer awareness on household electricity use to reduce overall energy consumption in the society. With regard to monitoring low power load, many researchers have introduced CUSUM into the NILM system, since the traditional event detection method is not as effective as expected. Due to the fact that the original CUSUM faces limitations given the small shift is below threshold, we therefore improve the test statistic which allows permissible deviation to gradually rise as the data size increases. This paper proposes a novel event detection and corresponding criterion that could be used in NILM systems to recognize transient states and to help the labelling task. Its performance has been tested in a real scenario where eight different appliances are connected to main line of electric power.

  4. Could chiropractors screen for adverse drug events in the community? Survey of US chiropractors

    Directory of Open Access Journals (Sweden)

    Bero Lisa

    2010-11-01

    Full Text Available Abstract Background The "Put Prevention into Practice" campaign of the US Public Health Service (USPHS was launched with the dissemination of the Clinician's Handbook of Preventive Services that recommended standards of clinical care for various prevention activities, including preventive clinical strategies to reduce the risk of adverse drug events. We explored whether nonprescribing clinicians such as chiropractors may contribute to advancing drug safety initiatives by identifying potential adverse drug events in their chiropractic patients, and by bringing suspected adverse drug events to the attention of the prescribing clinicians. Methods Mail survey of US chiropractors about their detection of potential adverse drug events in their chiropractic patients. Results Over half of responding chiropractors (62% reported having identified a suspected adverse drug event occurring in one of their chiropractic patients. The severity of suspected drug-related events detected ranged from mild to severe. Conclusions Chiropractors or other nonprescribing clinicians may be in a position to detect potential adverse drug events in the community. These detection and reporting mechanisms should be standardized and policies related to clinical case management of suspected adverse drug events occurring in their patients should be developed.

  5. Vaxtracker: Active on-line surveillance for adverse events following inactivated influenza vaccine in children.

    Science.gov (United States)

    Cashman, Patrick; Moberley, Sarah; Dalton, Craig; Stephenson, Jody; Elvidge, Elissa; Butler, Michelle; Durrheim, David N

    2014-09-22

    Vaxtracker is a web based survey for active post marketing surveillance of Adverse Events Following Immunisation. It is designed to efficiently monitor vaccine safety of new vaccines by early signal detection of serious adverse events. The Vaxtracker system automates contact with the parents or carers of immunised children by email and/or sms message to their smart phone. A hyperlink on the email and text messages links to a web based survey exploring adverse events following the immunisation. The Vaxtracker concept was developed during 2011 (n=21), and piloted during the 2012 (n=200) and 2013 (n=477) influenza seasons for children receiving inactivated influenza vaccine (IIV) in the Hunter New England Local Health District, New South Wales, Australia. Survey results were reviewed by surveillance staff to detect any safety signals and compare adverse event frequencies among the different influenza vaccines administered. In 2012, 57% (n=113) of the 200 participants responded to the online survey and 61% (290/477) in 2013. Vaxtracker appears to be an effective method for actively monitoring adverse events following influenza vaccination in children. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  6. Importance of the lower limit of detection in radiological safety

    International Nuclear Information System (INIS)

    Rafael Terol T.; Hermenegildo Maldonado M.

    1991-01-01

    The concept of the Lower Limit of Detection (LLD) it contributes in the solution of some problems related with the radiological safety, such as the realization of the tests of flight of the sealed radioactive sources; the determination of radioisotopes in environmental samples; the estimate of present radionuclides in polluted foods; in general, the detection of small quantities of radioactive materials present in materials of use or consumption by part of the man in his daily life; as the one Lower Limit of Detection is related with topics of statistics, in this work a small review of them is made, it was superficially discussed the mensuration problems related with the establishment of the Lower Limit of Detection

  7. Method to Find Recovery Event Combinations in Probabilistic Safety Assessment

    International Nuclear Information System (INIS)

    Jung, Woo Sik; Riley, Jeff

    2016-01-01

    These research activities may develop mathematical methods, engineering analyses, and business processes. The research activities of the project covered by this scope are directed toward the specific issues of implementing the methods and strategies on a computational platform, identifying the features and enhancements to EPRI tools that would be necessary to realize significant improvements to the risk assessments performed by the end user. Fault tree analysis is extensively and successfully applied to the risk assessment of safety-critical systems such as nuclear, chemical and aerospace systems. The fault tree analysis is being used together with an event tree analysis in PSA of nuclear power plants. Fault tree solvers for a PSA are mostly based on the cutset-based algorithm. They generate minimal cut sets (MCSs) from a fault tree. The most popular fault tree solver in the PSA industry is FTREX. During the course of this project, certain technical issues (see Sections 2 to 5) have been identified that need to be addressed regarding how minimal cut sets are generated and quantified. The objective of this scope of the work was to develop new methods or techniques to address these technical limitations. By turning on all the cutset initiators (%1, %2, %3, %), all the possible minimal cut sets can be calculated easier than with the original fault tree. It is accomplished by the fact that the number of events in the minimal cut sets are significantly reduced by using cutset initiators instead of random failure events. And byy turning on a few chosen cutset initiators and turning off the other cutset initiators, minimal cut sets of the selected cutset initiator(s) can be easily calculated. As explained in the previous Sections, there is no way to calculate these minimal cut sets by turning off/on the random failure events in the original fault tree

  8. Method to Find Recovery Event Combinations in Probabilistic Safety Assessment

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Woo Sik [Sejong University, Seoul (Korea, Republic of); Riley, Jeff [Electric Power Research, Palo Alto (United States)

    2016-05-15

    These research activities may develop mathematical methods, engineering analyses, and business processes. The research activities of the project covered by this scope are directed toward the specific issues of implementing the methods and strategies on a computational platform, identifying the features and enhancements to EPRI tools that would be necessary to realize significant improvements to the risk assessments performed by the end user. Fault tree analysis is extensively and successfully applied to the risk assessment of safety-critical systems such as nuclear, chemical and aerospace systems. The fault tree analysis is being used together with an event tree analysis in PSA of nuclear power plants. Fault tree solvers for a PSA are mostly based on the cutset-based algorithm. They generate minimal cut sets (MCSs) from a fault tree. The most popular fault tree solver in the PSA industry is FTREX. During the course of this project, certain technical issues (see Sections 2 to 5) have been identified that need to be addressed regarding how minimal cut sets are generated and quantified. The objective of this scope of the work was to develop new methods or techniques to address these technical limitations. By turning on all the cutset initiators (%1, %2, %3, %), all the possible minimal cut sets can be calculated easier than with the original fault tree. It is accomplished by the fact that the number of events in the minimal cut sets are significantly reduced by using cutset initiators instead of random failure events. And byy turning on a few chosen cutset initiators and turning off the other cutset initiators, minimal cut sets of the selected cutset initiator(s) can be easily calculated. As explained in the previous Sections, there is no way to calculate these minimal cut sets by turning off/on the random failure events in the original fault tree.

  9. Automatic crack detection and classification method for subway tunnel safety monitoring.

    Science.gov (United States)

    Zhang, Wenyu; Zhang, Zhenjiang; Qi, Dapeng; Liu, Yun

    2014-10-16

    Cracks are an important indicator reflecting the safety status of infrastructures. This paper presents an automatic crack detection and classification methodology for subway tunnel safety monitoring. With the application of high-speed complementary metal-oxide-semiconductor (CMOS) industrial cameras, the tunnel surface can be captured and stored in digital images. In a next step, the local dark regions with potential crack defects are segmented from the original gray-scale images by utilizing morphological image processing techniques and thresholding operations. In the feature extraction process, we present a distance histogram based shape descriptor that effectively describes the spatial shape difference between cracks and other irrelevant objects. Along with other features, the classification results successfully remove over 90% misidentified objects. Also, compared with the original gray-scale images, over 90% of the crack length is preserved in the last output binary images. The proposed approach was tested on the safety monitoring for Beijing Subway Line 1. The experimental results revealed the rules of parameter settings and also proved that the proposed approach is effective and efficient for automatic crack detection and classification.

  10. Automatic Crack Detection and Classification Method for Subway Tunnel Safety Monitoring

    Directory of Open Access Journals (Sweden)

    Wenyu Zhang

    2014-10-01

    Full Text Available Cracks are an important indicator reflecting the safety status of infrastructures. This paper presents an automatic crack detection and classification methodology for subway tunnel safety monitoring. With the application of high-speed complementary metal-oxide-semiconductor (CMOS industrial cameras, the tunnel surface can be captured and stored in digital images. In a next step, the local dark regions with potential crack defects are segmented from the original gray-scale images by utilizing morphological image processing techniques and thresholding operations. In the feature extraction process, we present a distance histogram based shape descriptor that effectively describes the spatial shape difference between cracks and other irrelevant objects. Along with other features, the classification results successfully remove over 90% misidentified objects. Also, compared with the original gray-scale images, over 90% of the crack length is preserved in the last output binary images. The proposed approach was tested on the safety monitoring for Beijing Subway Line 1. The experimental results revealed the rules of parameter settings and also proved that the proposed approach is effective and efficient for automatic crack detection and classification.

  11. SYSTEMS SAFETY ANALYSIS FOR FIRE EVENTS ASSOCIATED WITH THE ECRB CROSS DRIFT

    International Nuclear Information System (INIS)

    R. J. Garrett

    2001-01-01

    The purpose of this analysis is to systematically identify and evaluate fire hazards related to the Yucca Mountain Site Characterization Project (YMP) Enhanced Characterization of the Repository Block (ECRB) East-West Cross Drift (commonly referred to as the ECRB Cross-Drift). This analysis builds upon prior Exploratory Studies Facility (ESF) System Safety Analyses and incorporates Topopah Springs (TS) Main Drift fire scenarios and ECRB Cross-Drift fire scenarios. Accident scenarios involving the fires in the Main Drift and the ECRB Cross-Drift were previously evaluated in ''Topopah Springs Main Drift System Safety Analysis'' (CRWMS M and O 1995) and the ''Yucca Mountain Site Characterization Project East-West Drift System Safety Analysis'' (CRWMS M and O 1998). In addition to listing required mitigation/control features, this analysis identifies the potential need for procedures and training as part of defense-in-depth mitigation/control features. The inclusion of this information in the System Safety Analysis (SSA) is intended to assist the organization(s) (e.g., Construction, Environmental Safety and Health, Design) responsible for these aspects of the ECRB Cross-Drift in developing mitigation/control features for fire events, including Emergency Refuge Station(s). This SSA was prepared, in part, in response to Condition/Issue Identification and Reporting/Resolution System (CIRS) item 1966. The SSA is an integral part of the systems engineering process, whereby safety is considered during planning, design, testing, and construction. A largely qualitative approach is used which incorporates operating experiences and recommendations from vendors, the constructor and the operating contractor. The risk assessment in this analysis characterizes the scenarios associated with fires in terms of relative risk and includes recommendations for mitigating all identified hazards. The priority for recommending and implementing mitigation control features is: (1) Incorporate

  12. Using additional external inputs to forecast water quality with an artificial neural network for contamination event detection in source water

    Science.gov (United States)

    Schmidt, F.; Liu, S.

    2016-12-01

    Source water quality plays an important role for the safety of drinking water and early detection of its contamination is vital to taking appropriate countermeasures. However, compared to drinking water, it is more difficult to detect contamination events because its environment is less controlled and numerous natural causes contribute to a high variability of the background values. In this project, Artificial Neural Networks (ANNs) and a Contamination Event Detection Process (CED Process) were used to identify events in river water. The ANN models the response of basic water quality sensors obtained in laboratory experiments in an off-line learning stage and continuously forecasts future values of the time line in an on-line forecasting step. During this second stage, the CED Process compares the forecast to the measured value and classifies it as regular background or event value, which modifies the ANN's continuous learning and influences its forecasts. In addition to this basic setup, external information is fed to the CED Process: A so-called Operator Input (OI) is provided to inform about unusual water quality levels that are unrelated to the presence of contamination, for example due to cooling water discharge from a nearby power plant. This study's primary goal is to evaluate how well the OI fits into the design of the combined forecasting ANN and CED Process and to understand its effects on the online forecasting stage. To test this, data from laboratory experiments conducted previously at the School of Environment, Tsinghua University, have been used to perform simulations highlighting features and drawbacks of this method. Applying the OI has been shown to have a positive influence on the ANN's ability to handle a sudden change in background values, which is unrelated to contamination. However, it might also mask the presence of an event, an issue that underlines the necessity to have several instances of the algorithm run in parallel. Other difficulties

  13. EXAMINATION OF SECURITY EVENTS AS DBEs FOR MGDS IMPORTANT TO SAFETY SSCs

    International Nuclear Information System (INIS)

    J.M. Hartsell

    1998-01-01

    A portion of the safeguards and security system for the Mined Geologic Disposal System (MGDS) has been identified as QA-1 based on the classification of structures, systems, and components (SSCs) performed in accordance with QAP-2-3, ''Classification of Permanent Items'' (Reference 5.2). The classification analysis, ''Classification of the Preliminary MGDS Repository Design'' (Reference 5.9), identifies the ''Safeguards Material Control and Accountability'' system as a QA-1 SSC based on the identification of unauthorized intrusion, sabotage, theft, and diversion as potential Design Basis Events (DBEs). The purpose of this analysis is to provide justification to eliminate these events as DBEs for the MGDS based on a review of the Codes of Federal Regulation (CFRs) for geologic repositories (10 CFR 60), commercial reactor facilities (10 CFR 50), independent spent fuel storage installations (ISFSIs) and monitored retrievable storage (MRS) installations (10 CFR 72), and other relevant guidance documents in an effort to clarify that security events should not be considered in the QA design process of important to safety SSCs for the MGDS. The MGDS is a first of a kind geologic repository and no licensing precedent has been established for this type of facility

  14. Drug Adverse Event Detection in Health Plan Data Using the Gamma Poisson Shrinker and Comparison to the Tree-based Scan Statistic

    Directory of Open Access Journals (Sweden)

    David Smith

    2013-03-01

    Full Text Available Background: Drug adverse event (AE signal detection using the Gamma Poisson Shrinker (GPS is commonly applied in spontaneous reporting. AE signal detection using large observational health plan databases can expand medication safety surveillance. Methods: Using data from nine health plans, we conducted a pilot study to evaluate the implementation and findings of the GPS approach for two antifungal drugs, terbinafine and itraconazole, and two diabetes drugs, pioglitazone and rosiglitazone. We evaluated 1676 diagnosis codes grouped into 183 different clinical concepts and four levels of granularity. Several signaling thresholds were assessed. GPS results were compared to findings from a companion study using the identical analytic dataset but an alternative statistical method—the tree-based scan statistic (TreeScan. Results: We identified 71 statistical signals across two signaling thresholds and two methods, including closely-related signals of overlapping diagnosis definitions. Initial review found that most signals represented known adverse drug reactions or confounding. About 31% of signals met the highest signaling threshold. Conclusions: The GPS method was successfully applied to observational health plan data in a distributed data environment as a drug safety data mining method. There was substantial concordance between the GPS and TreeScan approaches. Key method implementation decisions relate to defining exposures and outcomes and informed choice of signaling thresholds.

  15. 76 FR 37649 - Safety Zone; Northern California Annual Fireworks Events, July 4th Fireworks Display

    Science.gov (United States)

    2011-06-28

    ... Zone; Northern California Annual Fireworks Events, July 4th Fireworks Display AGENCY: Coast Guard, DHS... annual July 4th Fireworks Display (Tahoe City 4th of July Fireworks Display). This action is necessary to... INFORMATION: The Coast Guard will enforce the safety zone for the annual Tahoe City 4th of July Fireworks in...

  16. Developing tools for the safety specification in risk management plans: lessons learned from a pilot project.

    Science.gov (United States)

    Cooper, Andrew J P; Lettis, Sally; Chapman, Charlotte L; Evans, Stephen J W; Waller, Patrick C; Shakir, Saad; Payvandi, Nassrin; Murray, Alison B

    2008-05-01

    Following the adoption of the ICH E2E guideline, risk management plans (RMP) defining the cumulative safety experience and identifying limitations in safety information are now required for marketing authorisation applications (MAA). A collaborative research project was conducted to gain experience with tools for presenting and evaluating data in the safety specification. This paper presents those tools found to be useful and the lessons learned from their use. Archive data from a successful MAA were utilised. Methods were assessed for demonstrating the extent of clinical safety experience, evaluating the sensitivity of the clinical trial data to detect treatment differences and identifying safety signals from adverse event and laboratory data to define the extent of safety knowledge with the drug. The extent of clinical safety experience was demonstrated by plots of patient exposure over time. Adverse event data were presented using dot plots, which display the percentages of patients with the events of interest, the odds ratio, and 95% confidence interval. Power and confidence interval plots were utilised for evaluating the sensitivity of the clinical database to detect treatment differences. Box and whisker plots were used to display laboratory data. This project enabled us to identify new evidence-based methods for presenting and evaluating clinical safety data. These methods represent an advance in the way safety data from clinical trials can be analysed and presented. This project emphasises the importance of early and comprehensive planning of the safety package, including evaluation of the use of epidemiology data.

  17. Linking Safety Analysis to Safety Requirements

    DEFF Research Database (Denmark)

    Hansen, Kirsten Mark

    Software for safety critical systems must deal with the hazards identified by safety analysistechniques: Fault trees, event trees,and cause consequence diagrams can be interpreted as safety requirements and used in the design activity. We propose that the safety analysis and the system design use...

  18. Detection of visual events along the apparent motion trace in patients with paranoid schizophrenia.

    Science.gov (United States)

    Sanders, Lia Lira Olivier; Muckli, Lars; de Millas, Walter; Lautenschlager, Marion; Heinz, Andreas; Kathmann, Norbert; Sterzer, Philipp

    2012-07-30

    Dysfunctional prediction in sensory processing has been suggested as a possible causal mechanism in the development of delusions in patients with schizophrenia. Previous studies in healthy subjects have shown that while the perception of apparent motion can mask visual events along the illusory motion trace, such motion masking is reduced when events are spatio-temporally compatible with the illusion, and, therefore, predictable. Here we tested the hypothesis that this specific detection advantage for predictable target stimuli on the apparent motion trace is reduced in patients with paranoid schizophrenia. Our data show that, although target detection along the illusory motion trace is generally impaired, both patients and healthy control participants detect predictable targets more often than unpredictable targets. Patients had a stronger motion masking effect when compared to controls. However, patients showed the same advantage in the detection of predictable targets as healthy control subjects. Our findings reveal stronger motion masking but intact prediction of visual events along the apparent motion trace in patients with paranoid schizophrenia and suggest that the sensory prediction mechanism underlying apparent motion is not impaired in paranoid schizophrenia. Copyright © 2012. Published by Elsevier Ireland Ltd.

  19. Detection of unusual events and trends in complex non-stationary data streams

    International Nuclear Information System (INIS)

    Charlton-Perez, C.; Perez, R.B.; Protopopescu, V.; Worley, B.A.

    2011-01-01

    The search for unusual events and trends hidden in multi-component, nonlinear, non-stationary, noisy signals is extremely important for diverse applications, ranging from power plant operation to homeland security. In the context of this work, we define an unusual event as a local signal disturbance and a trend as a continuous carrier of information added to and different from the underlying baseline dynamics. The goal of this paper is to investigate the feasibility of detecting hidden events inside intermittent signal data sets corrupted by high levels of noise, by using the Hilbert-Huang empirical mode decomposition method.

  20. Probabilistic analysis of external events with focus on the Fukushima event

    International Nuclear Information System (INIS)

    Kollasko, Heiko; Jockenhoevel-Barttfeld, Mariana; Klapp, Ulrich

    2014-01-01

    External hazards are those natural or man-made hazards to a site and facilities that are originated externally to both the site and its processes, i.e. the duty holder may have very little or no control over the hazard. External hazards can have the potential of causing initiating events at the plant, typically transients like e.g., loss of offsite power. Simultaneously, external events may affect safety systems required to control the initiating event and, where applicable, also back-up systems implemented for risk-reduction. The plant safety may especially be threatened when loads from external hazards exceed the load assumptions considered in the design of safety-related systems, structures and components. Another potential threat is given by hazards inducing initiating events not considered in the safety demonstration otherwise. An example is loss of offsite power combined with prolonged plant isolation. Offsite support, e.g., delivery of diesel fuel oil, usually credited in the deterministic safety analysis may not be possible in this case. As the Fukushima events have shown, the biggest threat is likely given by hazards inducing both effects. Such hazards may well be dominant risk contributors even if their return period is very high. In order to identify relevant external hazards for a certain Nuclear Power Plant (NPP) location, a site specific screening analysis is performed, both for single events and for combinations of external events. As a result of the screening analysis, risk significant and therefore relevant (screened-in) single external events and combinations of them are identified for a site. The screened-in events are further considered in a detailed event tree analysis in the frame of the Probabilistic Safety Analysis (PSA) to calculate the core damage/large release frequency resulting from each relevant external event or from each relevant combination. Screening analyses of external events performed at AREVA are based on the approach provided

  1. Acoustic Event Detection in Multichannel Audio Using Gated Recurrent Neural Networks with High‐Resolution Spectral Features

    Directory of Open Access Journals (Sweden)

    Hyoung‐Gook Kim

    2017-12-01

    Full Text Available Recently, deep recurrent neural networks have achieved great success in various machine learning tasks, and have also been applied for sound event detection. The detection of temporally overlapping sound events in realistic environments is much more challenging than in monophonic detection problems. In this paper, we present an approach to improve the accuracy of polyphonic sound event detection in multichannel audio based on gated recurrent neural networks in combination with auditory spectral features. In the proposed method, human hearing perception‐based spatial and spectral‐domain noise‐reduced harmonic features are extracted from multichannel audio and used as high‐resolution spectral inputs to train gated recurrent neural networks. This provides a fast and stable convergence rate compared to long short‐term memory recurrent neural networks. Our evaluation reveals that the proposed method outperforms the conventional approaches.

  2. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    Energy Technology Data Exchange (ETDEWEB)

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-30

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  3. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    International Nuclear Information System (INIS)

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-01

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  4. Processing of the quench detection signals in W7-X

    International Nuclear Information System (INIS)

    Birus, Dietrich; Schneider, Matthias; Rummel, Thomas; Fricke, Marko; Petry, Klaus; Ebersoldt, Andreas

    2009-01-01

    The Wendelstein 7-X (W7-X) project uses superconductive coils for generation of the magnetic field to keep the plasma. One of the important safety systems is the protection against quench events. The quench detection system of W7-X protects the superconducting coils, the superconducting bus bar sections and the high temperature superconductor of the current leads against the damage because of a quench and against the high stress by a fast discharge of the magnet system. Therefore, the present design of the quench detection system (QDS) uses a two-stage safety concept for discharging the magnetic system. This paper describes the present design of the system assembly from the quench detection unit (QDU) for the detection of the quench to the quench detection interface (QDI) to implement the two-stage safety concept.

  5. Nuclear fuel cycle facilities, laboratories, irradiators, particle accelerators, under-decommissioning reactors and radioactive waste management facilities safety. Lessons learned from events notified between 2005 and 2008

    International Nuclear Information System (INIS)

    2001-01-01

    Maintaining high levels of safety in nuclear facilities requires constant vigilance by everyone involved, especially by plant operators who are first and foremost responsible for safety in their facilities. Safety can never be taken for granted; constant efforts must be made to improve it, by taking new knowledge and available operating feedback into account. In this respect, a substantial part of operating feedback is made up of lessons learned from analysing events, incidents or accidents occurring in France or in similar facilities abroad. To encourage the diffusion of operating feedback, IRSN has produced a report concerning events notified to the Nuclear Safety Authority (ASN) by operators of LUDD facilities between 2005 and 2008. The main objective is to make general lessons for safety in this type of facility available based on a cross-disciplinary analysis of notified events and noted evolution trends. IRSN has had tools for managing information concerning events occurring in France and abroad for many years. These tools are used to analyse the events in order to take into account the relevant lessons learned in the safety assessments performed on behalf of ASN and also to define study and research programmes to maintain its expertise and expand its knowledge. The report has 4 sections: - the first section (chapters 2 to 4) presents the LUDD facilities so that the facilities themselves, their diversity and the main associated risks can be better understood. It also includes a brief reminder of plant operator obligations in notifying events and describes the database used by the Institute to manage the data relating to the notified events; - the second section (chapter 5) summarises the main changes noted in the events notified to ASN during 2005 to 2008 and provides an overall assessment of the consequences of these events for the environment, the population and the workers; - the third section (chapter 6) describes significant events occurring in France

  6. Event detection and exception handling strategies in the ASDEX Upgrade discharge control system

    International Nuclear Information System (INIS)

    Treutterer, W.; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.

    2013-01-01

    Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control

  7. Event detection and exception handling strategies in the ASDEX Upgrade discharge control system

    Energy Technology Data Exchange (ETDEWEB)

    Treutterer, W., E-mail: Wolfgang.Treutterer@ipp.mpg.de; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.

    2013-10-15

    Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control

  8. Safety analysis on Non-LOCA events for the revision of Wolsong NPP unit 2,3,4 sar

    International Nuclear Information System (INIS)

    Kim, Jong Hyun; Jin, Dong Sik; Ryu, Eui Seung; Kho, Dong Wook; Kim, Sung Min

    2015-01-01

    Korean Wolsong Nuclear Power Plant Units 2,3,4 (CANDU-6 Type) has prepared the revision of safety analysis report (Final Safety Analysis Report (FSAR) chapter 15) from the original performed in the year of 1990s, using the updated and state-of-the-art methodology and tools including IST safety analysis codes and more detail modelling. Compared with the original FSAR15, the revised FSAR15 has significant improvement in both the scope and the depth of safety analysis, which has demonstrated the safety analysis results have complied with the safety requirements(acceptance criteria). This paper will present the analysis scope for Non-LOCA events re-analyzed or added for the FSAR15 revision, methodologies applied such as codes and modelling and some important analysis results will be demonstrated with comparison to acceptance criteria. Application of more detail and near-realistic assumptions and method including Dev-PDO options and uncertainty related to the CHF correlations has altogether brought about more safety margin compared with the original FSAR15 with respect to SDS trip effectiveness etc. (author)

  9. 78 FR 55775 - Pipeline Safety: Information Collection Activities

    Science.gov (United States)

    2013-09-11

    ... important tool for identifying safety trends in the hazardous liquid pipeline industry. In a Federal... reference of American Petroleum Institute (API) API 1130 (the industry standard on leak detection) which... requests that volume exiting a system during a controlled event not be reported. PHMSA Response: PHMSA does...

  10. The necessity of recognizing all events in x-ray detection

    International Nuclear Information System (INIS)

    Papp, T.; Maxwell, J.A.; Papp, A.T.

    2008-01-01

    -ray detection. Examples will be given in detection of x-rays in nuclear backgrounds, and in industrial measurements for ROHS and WEEE compliance with input rates of up to several hundred thousands counts per seconds. The availability of all the events allows one to see the other part of the spectrum, and thus offer explanations why the basic parameters are in such a bad shape

  11. Fundamental aspects of seismic event detection, magnitude estimation and their interrelation

    International Nuclear Information System (INIS)

    Ringdal, F.

    1977-01-01

    The main common subject of the papers forming this thesis is statistical model development within the seismological disciplines of seismic event detection and event magnitude estimation. As more high quality seismic data become available as a result of recent seismic network developments, the opportunity will exist for large scale application and further refinement of these models. It is hoped that the work presented here will facilitate improved understanding of the basic issues, both within earthquake-explosion discrimination, in the framework of which most of this work originated, and in seismology in general. (Auth.)

  12. Report of the ASSET (Assessment of Safety Significant Events Team) mission to the Cernavoda nuclear power plant in Romania 8-12 August 1994 Division of Nuclear Safety. Root cause analysis of a significant event that occurred during commissioning of unit 1

    International Nuclear Information System (INIS)

    1994-01-01

    The IAEA Assessment of Safety Significant Events Team (ASSET) report presents the results of the team's investigation of a significant event that occurred during commissioning of Unit 1 of Cernavoda nuclear power plant. The results, conclusions and suggestions presented herein reflect the views of the ASSET experts. They are provided for consideration by the responsible authorities in Romania. The ASSET team's views presented in this report are based on visits to the plant, on review of documentation made available by the operating organization and on discussions with utility personnel. The report is intended to enhance operational safety at Cernavoda by proposing improvements to the policy for the prevention of incidents at the plant. The report includes, as a usual practice, the official response of the Regulatory Body and Operating Organization to the ASSET recommendations. Figs

  13. Safety assessment of the advanced CANDU reactor in postulated LOCA/LOECC events

    International Nuclear Information System (INIS)

    Hazen Hezhi Fan; Zoran Bilanovic

    2005-01-01

    The Advanced CANDU Reactor TM (ACR TM ) retains the proven strengths and features of CANDU reactors, and incorporates innovative new features and state-of-the-art technology. In addition to the enhanced emergency core cooling system, the reserve water system is designed to be available to inject reserve water by gravity into the reactor inlet headers after a postulated loss-of-coolant accident (LOCA). To assist in the ACR design and analysis of beyond the design basis events, simulations are needed to demonstrate the effectiveness of these two independent systems on core cooling, and to assess the consequences of the postulated accident coincident with the impairment of either of the two systems. The current paper is subject to an assessment of a postulated large LOCA coincident with loss of the emergency core cooling (LOECC) system. A postulated LOCA/LOECC has very low probability, in the range usually associated with severe core damage events. However, in the CANDU design, including ACR, the presence of moderator water surrounding the fuel channels acts as an effective heat sink, together with other safety features, to prevents severe core damage following a postulated LOCA/LOECC. Therefore, it is possible to analyse LOCA/LOECC using the same deterministic tools that are used for analysis of events with much higher frequencies, in the design basis event range. The assessment is conducted based on the current ACR-700 design. However, the analysis methodology, scope, computer tools, and the results in principle, are applicable to larger ACR designs. This assessment includes system (circuit), fuel channel, and fuel analyses. Some assessment results are needed in subsequent moderator analysis and containment analysis. In the assessment, several simulations were performed to analyse the full circuit and individual fuel channel transient behaviours, as well as the fission product release behaviour. The assessment has captured the key responses of the reactor heat

  14. Individual differences in event-based prospective memory: Evidence for multiple processes supporting cue detection.

    Science.gov (United States)

    Brewer, Gene A; Knight, Justin B; Marsh, Richard L; Unsworth, Nash

    2010-04-01

    The multiprocess view proposes that different processes can be used to detect event-based prospective memory cues, depending in part on the specificity of the cue. According to this theory, attentional processes are not necessary to detect focal cues, whereas detection of nonfocal cues requires some form of controlled attention. This notion was tested using a design in which we compared performance on a focal and on a nonfocal prospective memory task by participants with high or low working memory capacity. An interaction was found, such that participants with high and low working memory performed equally well on the focal task, whereas the participants with high working memory performed significantly better on the nonfocal task than did their counterparts with low working memory. Thus, controlled attention was only necessary for detecting event-based prospective memory cues in the nonfocal task. These results have implications for theories of prospective memory, the processes necessary for cue detection, and the successful fulfillment of intentions.

  15. Evaluating Monitoring Strategies to Detect Precipitation-Induced Microbial Contamination Events in Karstic Springs Used for Drinking Water

    Directory of Open Access Journals (Sweden)

    Michael D. Besmer

    2017-11-01

    Full Text Available Monitoring of microbial drinking water quality is a key component for ensuring safety and understanding risk, but conventional monitoring strategies are typically based on low sampling frequencies (e.g., quarterly or monthly. This is of concern because many drinking water sources, such as karstic springs are often subject to changes in bacterial concentrations on much shorter time scales (e.g., hours to days, for example after precipitation events. Microbial contamination events are crucial from a risk assessment perspective and should therefore be targeted by monitoring strategies to establish both the frequency of their occurrence and the magnitude of bacterial peak concentrations. In this study we used monitoring data from two specific karstic springs. We assessed the performance of conventional monitoring based on historical records and tested a number of alternative strategies based on a high-resolution data set of bacterial concentrations in spring water collected with online flow cytometry (FCM. We quantified the effect of increasing sampling frequency and found that for the specific case studied, at least bi-weekly sampling would be needed to detect precipitation events with a probability of >90%. We then proposed an optimized monitoring strategy with three targeted samples per event, triggered by precipitation measurements. This approach is more effective and efficient than simply increasing overall sampling frequency. It would enable the water utility to (1 analyze any relevant event and (2 limit median underestimation of peak concentrations to approximately 10%. We conclude with a generalized perspective on sampling optimization and argue that the assessment of short-term dynamics causing microbial peak loads initially requires increased sampling/analysis efforts, but can be optimized subsequently to account for limited resources. This offers water utilities and public health authorities systematic ways to evaluate and optimize their

  16. 76 FR 37650 - Safety Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, South Lake...

    Science.gov (United States)

    2011-06-28

    ... Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, South Lake Tahoe Gaming... will enforce the safety zone for the annual Fourth of July Fireworks, South Lake Tahoe Gaming Alliance (Lights on the Lake Fireworks Display). This action is necessary to control vessel traffic and to ensure...

  17. Temporal and spatial predictability of an irrelevant event differently affect detection and memory of items in a visual sequence

    Directory of Open Access Journals (Sweden)

    Junji eOhyama

    2016-02-01

    Full Text Available We examined how the temporal and spatial predictability of a task-irrelevant visual event affects the detection and memory of a visual item embedded in a continuously changing sequence. Participants observed 11 sequentially presented letters, during which a task-irrelevant visual event was either present or absent. Predictabilities of spatial location and temporal position of the event were controlled in 2 × 2 conditions. In the spatially predictable conditions, the event occurred at the same location within the stimulus sequence or at another location, while, in the spatially unpredictable conditions, it occurred at random locations. In the temporally predictable conditions, the event timing was fixed relative to the order of the letters, while in the temporally unpredictable condition, it could not be predicted from the letter order. Participants performed a working memory task and a target detection reaction time task. Memory accuracy was higher for a letter simultaneously presented at the same location as the event in the temporally unpredictable conditions, irrespective of the spatial predictability of the event. On the other hand, the detection reaction times were only faster for a letter simultaneously presented at the same location as the event when the event was both temporally and spatially predictable. Thus, to facilitate ongoing detection processes, an event must be predictable both in space and time, while memory processes are enhanced by temporally unpredictable (i.e., surprising events. Evidently, temporal predictability has differential effects on detection and memory of a visual item embedded in a sequence of images.

  18. Flow detection via sparse frame analysis for suspicious event recognition in infrared imagery

    Science.gov (United States)

    Fernandes, Henrique C.; Batista, Marcos A.; Barcelos, Celia A. Z.; Maldague, Xavier P. V.

    2013-05-01

    It is becoming increasingly evident that intelligent systems are very bene¯cial for society and that the further development of such systems is necessary to continue to improve society's quality of life. One area that has drawn the attention of recent research is the development of automatic surveillance systems. In our work we outline a system capable of monitoring an uncontrolled area (an outside parking lot) using infrared imagery and recognizing suspicious events in this area. The ¯rst step is to identify moving objects and segment them from the scene's background. Our approach is based on a dynamic background-subtraction technique which robustly adapts detection to illumination changes. It is analyzed only regions where movement is occurring, ignoring in°uence of pixels from regions where there is no movement, to segment moving objects. Regions where movement is occurring are identi¯ed using °ow detection via sparse frame analysis. During the tracking process the objects are classi¯ed into two categories: Persons and Vehicles, based on features such as size and velocity. The last step is to recognize suspicious events that may occur in the scene. Since the objects are correctly segmented and classi¯ed it is possible to identify those events using features such as velocity and time spent motionless in one spot. In this paper we recognize the suspicious event suspicion of object(s) theft from inside a parked vehicle at spot X by a person" and results show that the use of °ow detection increases the recognition of this suspicious event from 78:57% to 92:85%.

  19. Change detection in urban and rural driving scenes: Effects of target type and safety relevance on change blindness.

    Science.gov (United States)

    Beanland, Vanessa; Filtness, Ashleigh J; Jeans, Rhiannon

    2017-03-01

    The ability to detect changes is crucial for safe driving. Previous research has demonstrated that drivers often experience change blindness, which refers to failed or delayed change detection. The current study explored how susceptibility to change blindness varies as a function of the driving environment, type of object changed, and safety relevance of the change. Twenty-six fully-licenced drivers completed a driving-related change detection task. Changes occurred to seven target objects (road signs, cars, motorcycles, traffic lights, pedestrians, animals, or roadside trees) across two environments (urban or rural). The contextual safety relevance of the change was systematically manipulated within each object category, ranging from high safety relevance (i.e., requiring a response by the driver) to low safety relevance (i.e., requiring no response). When viewing rural scenes, compared with urban scenes, participants were significantly faster and more accurate at detecting changes, and were less susceptible to "looked-but-failed-to-see" errors. Interestingly, safety relevance of the change differentially affected performance in urban and rural environments. In urban scenes, participants were more efficient at detecting changes with higher safety relevance, whereas in rural scenes the effect of safety relevance has marginal to no effect on change detection. Finally, even after accounting for safety relevance, change blindness varied significantly between target types. Overall the results suggest that drivers are less susceptible to change blindness for objects that are likely to change or move (e.g., traffic lights vs. road signs), and for moving objects that pose greater danger (e.g., wild animals vs. pedestrians). Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Single Versus Multiple Events Error Potential Detection in a BCI-Controlled Car Game With Continuous and Discrete Feedback.

    Science.gov (United States)

    Kreilinger, Alex; Hiebel, Hannah; Müller-Putz, Gernot R

    2016-03-01

    This work aimed to find and evaluate a new method for detecting errors in continuous brain-computer interface (BCI) applications. Instead of classifying errors on a single-trial basis, the new method was based on multiple events (MEs) analysis to increase the accuracy of error detection. In a BCI-driven car game, based on motor imagery (MI), discrete events were triggered whenever subjects collided with coins and/or barriers. Coins counted as correct events, whereas barriers were errors. This new method, termed ME method, combined and averaged the classification results of single events (SEs) and determined the correctness of MI trials, which consisted of event sequences instead of SEs. The benefit of this method was evaluated in an offline simulation. In an online experiment, the new method was used to detect erroneous MI trials. Such MI trials were discarded and could be repeated by the users. We found that, even with low SE error potential (ErrP) detection rates, feasible accuracies can be achieved when combining MEs to distinguish erroneous from correct MI trials. Online, all subjects reached higher scores with error detection than without, at the cost of longer times needed for completing the game. Findings suggest that ErrP detection may become a reliable tool for monitoring continuous states in BCI applications when combining MEs. This paper demonstrates a novel technique for detecting errors in online continuous BCI applications, which yields promising results even with low single-trial detection rates.

  1. Contribution from Belgium - Belgian contribution to the PWG1 Generic Study on Undetected Failures of Safety systems

    International Nuclear Information System (INIS)

    Vincke, Marc

    1997-01-01

    retrieve additional cases of interest. The six selected cases are detailed below, including the source of selection, the plant(s) concerned, the (safety) systems and equipment involved, the context, the way failures were detected, the reason of late detection, corrective actions, safety significance and the period of time involved. In some cases, additional information could be found in AVN's ARIANE (Automatic Retrieval of Information on Abnormal Nuclear Events) database of international events. The coding of this database is also based on the IRS Coding Manual. Finally, event characteristics are summarized, and discussed along the two proposed lines: 1. try to understand the causes of late detection, the difficulty of detection, and specify the means of discovery and the safety significance of failures; 2. draw corrective and preventive means that would preclude or reduce the likelihood of such events

  2. Investigating the potential benefits of on-site food safety training for Folklorama, a temporary food service event.

    Science.gov (United States)

    Mancini, Roberto; Murray, Leigh; Chapman, Benjamin J; Powell, Douglas A

    2012-10-01

    Folklorama in Winnipeg, Manitoba, Canada, is a 14-day temporary food service event that explores the many different cultural realms of food, food preparation, and entertainment. In 2010, the Russian pavilion at Folklorama was implicated in a foodborne outbreak of Escherichia coli O157 that caused 37 illnesses and 18 hospitalizations. The ethnic nature and diversity of foods prepared within each pavilion presents a unique problem for food inspectors, as each culture prepares food in their own very unique way. The Manitoba Department of Health and Folklorama Board of Directors realized a need to implement a food safety information delivery program that would be more effective than a 2-h food safety course delivered via PowerPoint slides. The food operators and event coordinators of five randomly chosen pavilions selling potentially hazardous food were trained on-site, in their work environment, focusing on critical control points specific to their menu. A control group (five pavilions) did not receive on-site food safety training and were assessed concurrently. Public health inspections for all 10 pavilions were performed by Certified Public Health Inspectors employed with Manitoba Health. Critical infractions were assessed by means of standardized food protection inspection reports. The results suggest no statistically significant difference in food inspection scores between the trained and control groups. However, it was found that inspection report results increased for both the control and trained groups from the first inspection to the second, implying that public health inspections are necessary in correcting unsafe food safety practices. The results further show that in this case, the 2-h food safety course delivered via slides was sufficient to pass public health inspections. Further evaluations of alternative food safety training approaches are warranted.

  3. Safety analysis results for the control rod banks withdrawal event at a full power of the SMART-P

    International Nuclear Information System (INIS)

    Yang, S. H.; Chung, Y. J.; Kim, H. C.; Zee, S. Q.

    2005-01-01

    For the validation of the 330 MWt SMART (System-integrated Modular Advanced ReacTor), a detailed design for the SMART-P has been accomplished by KAERI. In the SMART-P design similar to the SMART design, the soluble boron free design is adapted. This concept results in a larger reactivity worth of the control rod bank compared to that of the commercial pressurized water reactor. Moreover, in the SMART-P design, the control rod banks are fairly well inserted into the core, even at a full power condition. Therefore, accidents related to the reactivity anomalies have been evaluated as crucial events when compared to the other initiating events. In this paper, safety analysis for the control rod banks withdrawal event at a full power of the SMART-P has been accomplished by considering various initial conditions, different withdrawal times of the control rod banks and the reactivity feedback. To perform the safety analysis, the TASS/SMR (Transients And Setpoint Simulation/Small and Medium Reactor) code for a system response and SSF-1 correlation for a CHFR (Critical Heat Flux Ratio) have been used

  4. On the feasibility of using satellite gravity observations for detecting large-scale solid mass transfer events

    Science.gov (United States)

    Peidou, Athina C.; Fotopoulos, Georgia; Pagiatakis, Spiros

    2017-10-01

    The main focus of this paper is to assess the feasibility of utilizing dedicated satellite gravity missions in order to detect large-scale solid mass transfer events (e.g. landslides). Specifically, a sensitivity analysis of Gravity Recovery and Climate Experiment (GRACE) gravity field solutions in conjunction with simulated case studies is employed to predict gravity changes due to past subaerial and submarine mass transfer events, namely the Agulhas slump in southeastern Africa and the Heart Mountain Landslide in northwestern Wyoming. The detectability of these events is evaluated by taking into account the expected noise level in the GRACE gravity field solutions and simulating their impact on the gravity field through forward modelling of the mass transfer. The spectral content of the estimated gravity changes induced by a simulated large-scale landslide event is estimated for the known spatial resolution of the GRACE observations using wavelet multiresolution analysis. The results indicate that both the Agulhas slump and the Heart Mountain Landslide could have been detected by GRACE, resulting in {\\vert }0.4{\\vert } and {\\vert }0.18{\\vert } mGal change on GRACE solutions, respectively. The suggested methodology is further extended to the case studies of the submarine landslide in Tohoku, Japan, and the Grand Banks landslide in Newfoundland, Canada. The detectability of these events using GRACE solutions is assessed through their impact on the gravity field.

  5. Detection of microsleep events in a car driving simulation study using electrocardiographic features

    Directory of Open Access Journals (Sweden)

    Lenis Gustavo

    2016-09-01

    Full Text Available Microsleep events (MSE are short intrusions of sleep under the demand of sustained attention. They can impose a major threat to safety while driving a car and are considered one of the most significant causes of traffic accidents. Driver’s fatigue and MSE account for up to 20% of all car crashes in Europe and at least 100,000 accidents in the US every year. Unfortunately, there is not a standardized test developed to quantify the degree of vigilance of a driver. To account for this problem, different approaches based on biosignal analysis have been studied in the past. In this paper, we investigate an electrocardiographic-based detection of MSE using morphological and rhythmical features. 14 records from a car driving simulation study with a high incidence of MSE were analyzed and the behavior of the ECG features before and after an MSE in relation to reference baseline values (without drowsiness were investigated. The results show that MSE cannot be detected (or predicted using only the ECG. However, in the presence of MSE, the rhythmical and morphological features were observed to be significantly different than the ones calculated for the reference signal without sleepiness. In particular, when MSE were present, the heart rate diminished while the heart rate variability increased. Time distances between P wave and R peak, and R peak and T wave and their dispersion increased also. This demonstrates a noticeable change of the autonomous regulation of the heart. In future, the ECG parameter could be used as a surrogate measure of fatigue.

  6. A Macro-Observation Scheme for Abnormal Event Detection in Daily-Life Video Sequences

    Directory of Open Access Journals (Sweden)

    Chiu Wei-Yao

    2010-01-01

    Full Text Available Abstract We propose a macro-observation scheme for abnormal event detection in daily life. The proposed macro-observation representation records the time-space energy of motions of all moving objects in a scene without segmenting individual object parts. The energy history of each pixel in the scene is instantly updated with exponential weights without explicitly specifying the duration of each activity. Since possible activities in daily life are numerous and distinct from each other and not all abnormal events can be foreseen, images from a video sequence that spans sufficient repetition of normal day-to-day activities are first randomly sampled. A constrained clustering model is proposed to partition the sampled images into groups. The new observed event that has distinct distance from any of the cluster centroids is then classified as an anomaly. The proposed method has been evaluated in daily work of a laboratory and BEHAVE benchmark dataset. The experimental results reveal that it can well detect abnormal events such as burglary and fighting as long as they last for a sufficient duration of time. The proposed method can be used as a support system for the scene that requires full time monitoring personnel.

  7. Safety of Basic nuclear facilities (INB) other than electronuclear reactors. Lessons learned from declared significant events in 2011 and 2012

    International Nuclear Information System (INIS)

    2013-01-01

    The first part of this report presents the different types of basic nuclear facilities other than electronuclear reactors. These installations can be industrial installations dedicated or not to the nuclear fuel cycle, research and support installations, be definitively stopped or being dismantled, or radioactive waste storage installations. After a comment of the main trends noticed in 2011 and 2012, the report proposes a transverse analysis of events which occurred in these installations. These events are related to various risks: dissemination of radioactive materials, exposure to ionizing radiations, criticality, fire and explosion, handling operations, loss of electric supplies or fluids, external aggression. Other events are those significant for the environment with a radiological component, or related to periodic controls and tests. The causes of these events are analysed. Specific events are presented which occurred on different sites (in the MELOX plant, in Areva sites in La Hague, Pierrelatte, in CEA sites in Cadarache and Saclay, in a fuel factory in Romans). Other topics are finally addressed: safety measures after the Fukushima accident, safety and radiation protection management systems of Areva and CEA, dismantling of nuclear installations

  8. Polygraph lie detection on real events in a laboratory setting.

    Science.gov (United States)

    Bradley, M T; Cullen, M C

    1993-06-01

    This laboratory study dealt with real-life intense emotional events. Subjects generated embarrassing stories from their experience, then submitted to polygraph testing and, by lying, denied their stories and, by telling the truth, denied a randomly assigned story. Money was given as an incentive to be judged innocent on each story. An interrogator, blind to the stories, used Control Question Tests and found subjects more deceptive when lying than when truthful. Stories interacted with order such that lying on the second story was more easily detected than lying on the first. Embarrassing stories provide an alternative to the use of mock crimes to study lie detection in the laboratory.

  9. Safety Needs Mediate Stressful Events Induced Mental Disorders

    Science.gov (United States)

    Gu, Simeng; Lei, Yu; Lu, Shanshan

    2016-01-01

    Safety first,” we say these words almost every day, but we all take this for granted for what Maslow proposed in his famous theory of Hierarchy of Needs: safety needs come second to physiological needs. Here we propose that safety needs come before physiological needs. Safety needs are personal security, financial security, and health and well-being, which are more fundamental than physiological needs. Safety worrying is the major reason for mental disorders, such as anxiety, phobia, depression, and PTSD. The neural basis for safety is amygdala, LC/NE system, and corticotrophin-releasing hormone system, which can be regarded as a “safety circuitry,” whose major behavior function is “fight or flight” and “fear and anger” emotions. This is similar to the Appraisal theory for emotions: fear is due to the primary appraisal, which is related to safety of individual, while anger is due to secondary appraisal, which is related to coping with the unsafe situations. If coping is good, the individual will be happy; if coping failed, the individual will be sad or depressed. PMID:27738527

  10. Safety Needs Mediate Stressful Events Induced Mental Disorders.

    Science.gov (United States)

    Zheng, Zheng; Gu, Simeng; Lei, Yu; Lu, Shanshan; Wang, Wei; Li, Yang; Wang, Fushun

    2016-01-01

    "Safety first," we say these words almost every day, but we all take this for granted for what Maslow proposed in his famous theory of Hierarchy of Needs : safety needs come second to physiological needs. Here we propose that safety needs come before physiological needs. Safety needs are personal security, financial security, and health and well-being, which are more fundamental than physiological needs. Safety worrying is the major reason for mental disorders, such as anxiety, phobia, depression, and PTSD. The neural basis for safety is amygdala, LC/NE system, and corticotrophin-releasing hormone system, which can be regarded as a "safety circuitry," whose major behavior function is "fight or flight" and "fear and anger" emotions. This is similar to the Appraisal theory for emotions: fear is due to the primary appraisal, which is related to safety of individual, while anger is due to secondary appraisal, which is related to coping with the unsafe situations. If coping is good, the individual will be happy; if coping failed, the individual will be sad or depressed.

  11. Safety Needs Mediate Stressful Events Induced Mental Disorders

    Directory of Open Access Journals (Sweden)

    Zheng Zheng

    2016-01-01

    Full Text Available “Safety first,” we say these words almost every day, but we all take this for granted for what Maslow proposed in his famous theory of Hierarchy of Needs: safety needs come second to physiological needs. Here we propose that safety needs come before physiological needs. Safety needs are personal security, financial security, and health and well-being, which are more fundamental than physiological needs. Safety worrying is the major reason for mental disorders, such as anxiety, phobia, depression, and PTSD. The neural basis for safety is amygdala, LC/NE system, and corticotrophin-releasing hormone system, which can be regarded as a “safety circuitry,” whose major behavior function is “fight or flight” and “fear and anger” emotions. This is similar to the Appraisal theory for emotions: fear is due to the primary appraisal, which is related to safety of individual, while anger is due to secondary appraisal, which is related to coping with the unsafe situations. If coping is good, the individual will be happy; if coping failed, the individual will be sad or depressed.

  12. Development of Quantitative Framework for Event Significance Evaluation

    International Nuclear Information System (INIS)

    Lee, Durk Hun; Kim, Min Chull; Kim, Inn Seock

    2010-01-01

    There is an increasing trend in quantitative evaluation of the safety significance of operational events using Probabilistic Safety Assessment (PSA) technique. An integrated framework for evaluation of event significance has been developed by Korea Institute of Nuclear Safety (KINS), which consists of an assessment hierarchy and a number of matrices. The safety significance of various events, e.g., internal or external initiating events that occurred during at-power or shutdown conditions, can be quantitatively analyzed using this framework, and then, the events rated according to their significance. This paper briefly describes the basic concept of the integrated quantitative framework for evaluation of event significance, focusing on the assessment hierarchy

  13. Detection of Unusual Events and Trends in Complex Non-Stationary Data Streams

    International Nuclear Information System (INIS)

    Perez, Rafael B.; Protopopescu, Vladimir A.; Worley, Brian Addison; Perez, Cristina

    2006-01-01

    The search for unusual events and trends hidden in multi-component, nonlinear, non-stationary, noisy signals is extremely important for a host of different applications, ranging from nuclear power plant and electric grid operation to internet traffic and implementation of non-proliferation protocols. In the context of this work, we define an unusual event as a local signal disturbance and a trend as a continuous carrier of information added to and different from the underlying baseline dynamics. The goal of this paper is to investigate the feasibility of detecting hidden intermittent events inside non-stationary signal data sets corrupted by high levels of noise, by using the Hilbert-Huang empirical mode decomposition method

  14. Enabling social listening for cardiac safety monitoring: Proceedings from a drug information association-cardiac safety research consortium cosponsored think tank.

    Science.gov (United States)

    Seifert, Harry A; Malik, Raleigh E; Bhattacharya, Mondira; Campbell, Kevin R; Okun, Sally; Pierce, Carrie; Terkowitz, Jeffrey; Turner, J Rick; Krucoff, Mitchell W; Powell, Gregory E

    2017-12-01

    This white paper provides a summary of the presentations and discussions from a think tank on "Enabling Social Listening for Cardiac Safety Monitoring" trials that was cosponsored by the Drug Information Association and the Cardiac Safety Research Consortium, and held at the White Oak headquarters of the US Food and Drug Administration on June 3, 2016. The meeting's goals were to explore current methods of collecting and evaluating social listening data and to consider their applicability to cardiac safety surveillance. Social listening is defined as the act of monitoring public postings on the Internet. It has several theoretical advantages for drug and device safety. First, these include the ability to detect adverse events that are "missed" by traditional sources and the ability to detect adverse events sooner than would be allowed by traditional sources, both by affording near-real-time access to data from culturally and geographically diverse sources. Social listening can also potentially introduce a novel patient voice into the conversation about drug safety, which could uniquely augment understanding of real-world medication use obtained from more traditional methodologies. Finally, it can allow for access to information about drug misuse and diversion. To date, the latter 2 of these have been realized. Although regulators from the Food and Drug Administration and the United Kingdom's Medicines and Healthcare Products Regulatory Agency participated in the think tank along with representatives from industry, academia, and patient groups, this article should not be construed to constitute regulatory guidance. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Formulation of nuclear safety under various induced events. Part 1. Current status and challenges for risk-informed activities in nuclear safety

    International Nuclear Information System (INIS)

    Itoi, Tatsuya; Hayashi, Kentaro; Yamato, Masaaki

    2016-01-01

    The Nuclear Safety Subcommittee published in March 2013 a report on 'Seminar on the Fukushima Daiichi Nuclear Power Station accident' (hereinafter referred to as Seminar Report), and has thereafter continued discussions on the challenges that were pointed out in Seminar Report as the target of discussions. This commentary series summarizes the current situation and challenges for the ideal way of nuclear safety against a variety of causal events as one of the above challenges. This paper, as Part 1 of the above theme, firstly summarizes the current state of the challenges of regulatory bodies and business operators who are engaging risk information utilization. It secondly discusses the future risk information utilization of regulations and business operators, realization of integrated decision-making process, timeliness and promptness required in decision-making, and future efforts including incentives. (A.O.)

  16. 10 CFR 70.62 - Safety program and integrated safety analysis.

    Science.gov (United States)

    2010-01-01

    ...; (iv) Potential accident sequences caused by process deviations or other events internal to the... have experience in nuclear criticality safety, radiation safety, fire safety, and chemical process... this safety program; namely, process safety information, integrated safety analysis, and management...

  17. 75 FR 35652 - Safety Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, South Lake...

    Science.gov (United States)

    2010-06-23

    ... Zone; Northern California Annual Fireworks Events, Fourth of July Fireworks, South Lake Tahoe Gaming... will enforce Lights on the Lake Fireworks Display safety zone for South Lake Tahoe, from 8:30 a.m. on... the Lake Fireworks in 33 CFR 165.1191 on July 4, 2010, from 8:30 a.m. on July 1, 2010 through 10 p.m...

  18. Simultaneous Event-Triggered Fault Detection and Estimation for Stochastic Systems Subject to Deception Attacks.

    Science.gov (United States)

    Li, Yunji; Wu, QingE; Peng, Li

    2018-01-23

    In this paper, a synthesized design of fault-detection filter and fault estimator is considered for a class of discrete-time stochastic systems in the framework of event-triggered transmission scheme subject to unknown disturbances and deception attacks. A random variable obeying the Bernoulli distribution is employed to characterize the phenomena of the randomly occurring deception attacks. To achieve a fault-detection residual is only sensitive to faults while robust to disturbances, a coordinate transformation approach is exploited. This approach can transform the considered system into two subsystems and the unknown disturbances are removed from one of the subsystems. The gain of fault-detection filter is derived by minimizing an upper bound of filter error covariance. Meanwhile, system faults can be reconstructed by the remote fault estimator. An recursive approach is developed to obtain fault estimator gains as well as guarantee the fault estimator performance. Furthermore, the corresponding event-triggered sensor data transmission scheme is also presented for improving working-life of the wireless sensor node when measurement information are aperiodically transmitted. Finally, a scaled version of an industrial system consisting of local PC, remote estimator and wireless sensor node is used to experimentally evaluate the proposed theoretical results. In particular, a novel fault-alarming strategy is proposed so that the real-time capacity of fault-detection is guaranteed when the event condition is triggered.

  19. Improving battery safety by early detection of internal shorting with a bifunctional separator

    Science.gov (United States)

    Wu, Hui; Zhuo, Denys; Kong, Desheng; Cui, Yi

    2014-10-01

    Lithium-based rechargeable batteries have been widely used in portable electronics and show great promise for emerging applications in transportation and wind-solar-grid energy storage, although their safety remains a practical concern. Failures in the form of fire and explosion can be initiated by internal short circuits associated with lithium dendrite formation during cycling. Here we report a new strategy for improving safety by designing a smart battery that allows internal battery health to be monitored in situ. Specifically, we achieve early detection of lithium dendrites inside batteries through a bifunctional separator, which offers a third sensing terminal in addition to the cathode and anode. The sensing terminal provides unique signals in the form of a pronounced voltage change, indicating imminent penetration of dendrites through the separator. This detection mechanism is highly sensitive, accurate and activated well in advance of shorting and can be applied to many types of batteries for improved safety.

  20. Drug safety data mining with a tree-based scan statistic.

    Science.gov (United States)

    Kulldorff, Martin; Dashevsky, Inna; Avery, Taliser R; Chan, Arnold K; Davis, Robert L; Graham, David; Platt, Richard; Andrade, Susan E; Boudreau, Denise; Gunter, Margaret J; Herrinton, Lisa J; Pawloski, Pamala A; Raebel, Marsha A; Roblin, Douglas; Brown, Jeffrey S

    2013-05-01

    In post-marketing drug safety surveillance, data mining can potentially detect rare but serious adverse events. Assessing an entire collection of drug-event pairs is traditionally performed on a predefined level of granularity. It is unknown a priori whether a drug causes a very specific or a set of related adverse events, such as mitral valve disorders, all valve disorders, or different types of heart disease. This methodological paper evaluates the tree-based scan statistic data mining method to enhance drug safety surveillance. We use a three-million-member electronic health records database from the HMO Research Network. Using the tree-based scan statistic, we assess the safety of selected antifungal and diabetes drugs, simultaneously evaluating overlapping diagnosis groups at different granularity levels, adjusting for multiple testing. Expected and observed adverse event counts were adjusted for age, sex, and health plan, producing a log likelihood ratio test statistic. Out of 732 evaluated disease groupings, 24 were statistically significant, divided among 10 non-overlapping disease categories. Five of the 10 signals are known adverse effects, four are likely due to confounding by indication, while one may warrant further investigation. The tree-based scan statistic can be successfully applied as a data mining tool in drug safety surveillance using observational data. The total number of statistical signals was modest and does not imply a causal relationship. Rather, data mining results should be used to generate candidate drug-event pairs for rigorous epidemiological studies to evaluate the individual and comparative safety profiles of drugs. Copyright © 2013 John Wiley & Sons, Ltd.

  1. RB research reactor safety report

    International Nuclear Information System (INIS)

    Sotic, O.; Pesic, M.; Vranic, S.

    1979-04-01

    This new version of the safety report is a revision of the safety report written in 1962 when the RB reactor started operation after reconstruction. The new safety report was needed because reactor systems and components have been improved and the administrative procedures were changed. the most important improvements and changes were concerned with the use of highly enriched fuel (80% enriched), construction of reactor converter outside the reactor vessel, improved control system by two measuring start-up channels, construction of system for heavy water leak detection, new inter phone connection between control room and other reactor rooms. This report includes description of reactor building with installations, rector vessel, reactor core, heavy water system, control system, safety system, dosimetry and alarm systems, experimental channels, neutron converter, reactor operation. Safety aspects contain analyses of accident reasons, method for preventing reactivity insertions, analyses of maximum hypothetical accidents for cores with natural uranium, 2% enriched and 80% enriched fuel elements. Influence of seismic events on the reactor safety and well as coupling between reactor and the converter are parts of this document

  2. Automatic detection of lexical change: an auditory event-related potential study.

    Science.gov (United States)

    Muller-Gass, Alexandra; Roye, Anja; Kirmse, Ursula; Saupe, Katja; Jacobsen, Thomas; Schröger, Erich

    2007-10-29

    We investigated the detection of rare task-irrelevant changes in the lexical status of speech stimuli. Participants performed a nonlinguistic task on word and pseudoword stimuli that occurred, in separate conditions, rarely or frequently. Task performance for pseudowords was deteriorated relative to words, suggesting unintentional lexical analysis. Furthermore, rare word and pseudoword changes had a similar effect on the event-related potentials, starting as early as 165 ms. This is the first demonstration of the automatic detection of change in lexical status that is not based on a co-occurring acoustic change. We propose that, following lexical analysis of the incoming stimuli, a mental representation of the lexical regularity is formed and used as a template against which lexical change can be detected.

  3. Safety design guide for safety related systems for CANDU 9

    International Nuclear Information System (INIS)

    Lee, Duk Su; Chang, Woo Hyun; Lee, Nam Young; A. C. D. Wright

    1996-03-01

    In general, two types of safety related systems and structures exist in the nuclear plant; The one is a systems and structures which perform safety functions during the normal operation of the plant, and the other is a systems and structures which perform safety functions to mitigate events caused by failure of the normally operating systems or by naturally occurring phenomena. In this safety design guide, these systems are identified in detail, and the major events for which the safety functions are required and the major safety requirements are identified in the list. As the probabilistic safety assessments are completed during the course of the project, additions or deletions to the list may be justified. 3 tabs. (Author) .new

  4. Safety design guide for safety related systems for CANDU 9

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Duk Su; Chang, Woo Hyun; Lee, Nam Young [Korea Atomic Energy Research Institute, Daeduk (Korea, Republic of); Wright, A.C.D. [Atomic Energy of Canada Ltd., Toronto (Canada)

    1996-03-01

    In general, two types of safety related systems and structures exist in the nuclear plant; The one is a systems and structures which perform safety functions during the normal operation of the plant, and the other is a systems and structures which perform safety functions to mitigate events caused by failure of the normally operating systems or by naturally occurring phenomena. In this safety design guide, these systems are identified in detail, and the major events for which the safety functions are required and the major safety requirements are identified in the list. As the probabilistic safety assessments are completed during the course of the project, additions or deletions to the list may be justified. 3 tabs. (Author) .new.

  5. Accuracy and precision of equine gait event detection during walking with limb and trunk mounted inertial sensors

    DEFF Research Database (Denmark)

    Olsen, Emil; Andersen, Pia Haubro; Pfau, Thilo

    2012-01-01

    The increased variations of temporal gait events when pathology is present are good candidate features for objective diagnostic tests. We hypothesised that the gait events hoof-on/off and stance can be detected accurately and precisely using features from trunk and distal limb-mounted Inertial....... Accuracy (bias) and precision (SD of bias) was calculated to compare force plate and IMU timings for gait events. Data were collected from seven horses. One hundred and twenty three (123) front limb steps were analysed; hoof-on was detected with a bias (SD) of -7 (23) ms, hoof-off with 0.7 (37) ms...... and front limb stance with -0.02 (37) ms. A total of 119 hind limb steps were analysed; hoof-on was found with a bias (SD) of -4 (25) ms, hoof-off with 6 (21) ms and hind limb stance with 0.2 (28) ms. IMUs mounted on the distal limbs and sacrum can detect gait events accurately and precisely....

  6. Discrete Event Simulation Model of the Polaris 2.1 Gamma Ray Imaging Radiation Detection Device

    Science.gov (United States)

    2016-06-01

    release; distribution is unlimited DISCRETE EVENT SIMULATION MODEL OF THE POLARIS 2.1 GAMMA RAY IMAGING RADIATION DETECTION DEVICE by Andres T...ONLY (Leave blank) 2. REPORT DATE June 2016 3. REPORT TYPE AND DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE DISCRETE EVENT SIMULATION MODEL...modeled. The platform, Simkit, was utilized to create a discrete event simulation (DES) model of the Polaris. After carefully constructing the DES

  7. CNE (Embalse nuclear power plant): probabilistic safety study. Loss of service water. Probabilistic evaluation and analysis through events sequence

    International Nuclear Information System (INIS)

    Couto, A.J.; Perez, S.S.

    1987-01-01

    This work is part of a study on the service water systems of the Embalse nuclear power plant from a safety point of view. The faults of service water systems of high and low pressure that can lead to situations threatening the plant safety were analyzed in a previous report. The event 'total loss of low pressure service water' causes the largest number of such conditions. Such event is an operational incident that can lead to an accident situation due to faults in the required process systems or by omission of a procedure. The annual frequency of the event 'total loss of low pressure service water' is calculated. The main contribution comes from pump failure. The evaluation of the accident sequences shows that the most direct way to the liberation of fission products is the loss of steam generators as heat sink. The contributions to small and large LOCA and electric supply loss are analyzed. The sequence that leads to tritium release through boiling of moderator is also evaluated. (Author)

  8. Integrated Initiating Event Performance Indicators

    International Nuclear Information System (INIS)

    S. A. Eide; Dale M. Rasmuson; Corwin L. Atwood

    2005-01-01

    The U.S. Nuclear Regulatory Commission Industry Trends Program (ITP) collects and analyses industry-wide data, assesses the safety significance of results, and communicates results to Congress and other stakeholders. This paper outlines potential enhancements in the ITP to comprehensively cover the Initiating Events Cornerstone of Safety. Future work will address other cornerstones of safety. The proposed Tier 1 activity involves collecting data on ten categories of risk-significant initiating events, trending the results, and comparing early performance with prediction limits (allowable numbers of events, above which NRC action may occur). Tier 1 results would be used to monitor industry performance at the level of individual categories of initiating events. The proposed Tier 2 activity involves integrating the information for individual categories of initiating events into a single risk-based indicator, termed the Baseline Risk Index for Initiating Events or BRIIE. The BRIIE would be evaluated yearly and compared against a threshold. BRIIE results would be reported to Congress on a yearly basis

  9. Detections of Planets in Binaries Through the Channel of Chang–Refsdal Gravitational Lensing Events

    Energy Technology Data Exchange (ETDEWEB)

    Han, Cheongho [Department of Physics, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Shin, In-Gu; Jung, Youn Kil [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

    2017-02-01

    Chang–Refsdal (C–R) lensing, which refers to the gravitational lensing of a point mass perturbed by a constant external shear, provides a good approximation in describing lensing behaviors of either a very wide or a very close binary lens. C–R lensing events, which are identified by short-term anomalies near the peak of high-magnification lensing light curves, are routinely detected from lensing surveys, but not much attention is paid to them. In this paper, we point out that C–R lensing events provide an important channel to detect planets in binaries, both in close and wide binary systems. Detecting planets through the C–R lensing event channel is possible because the planet-induced perturbation occurs in the same region of the C–R lensing-induced anomaly and thus the existence of the planet can be identified by the additional deviation in the central perturbation. By presenting the analysis of the actually observed C–R lensing event OGLE-2015-BLG-1319, we demonstrate that dense and high-precision coverage of a C–R lensing-induced perturbation can provide a strong constraint on the existence of a planet in a wide range of planet parameters. The sample of an increased number of microlensing planets in binary systems will provide important observational constraints in giving shape to the details of planet formation, which have been restricted to the case of single stars to date.

  10. Unsupervised behaviour-specific dictionary learning for abnormal event detection

    DEFF Research Database (Denmark)

    Ren, Huamin; Liu, Weifeng; Olsen, Søren Ingvor

    2015-01-01

    the training data is only a small proportion of the surveillance data. Therefore, we propose behavior-specific dictionaries (BSD) through unsupervised learning, pursuing atoms from the same type of behavior to represent one behavior dictionary. To further improve the dictionary by introducing information from...... potential infrequent normal patterns, we refine the dictionary by searching ‘missed atoms’ that have compact coefficients. Experimental results show that our BSD algorithm outperforms state-of-the-art dictionaries in abnormal event detection on the public UCSD dataset. Moreover, BSD has less false alarms...

  11. Detection of water-quality contamination events based on multi-sensor fusion using an extented Dempster–Shafer method

    International Nuclear Information System (INIS)

    Hou, Dibo; He, Huimei; Huang, Pingjie; Zhang, Guangxin; Loaiciga, Hugo

    2013-01-01

    This study presents a method for detecting contamination events of sources of drinking water based on the Dempster–Shafer (D-S) evidence theory. The detection method has the purpose of protecting water supply systems against accidental and intentional contamination events. This purpose is achieved by first predicting future water-quality parameters using an autoregressive (AR) model. The AR model predicts future water-quality parameters using recent measurements of these parameters made with automated (on-line) water-quality sensors. Next, a probabilistic method assigns probabilities to the time series of residuals formed by comparing predicted water-quality parameters with threshold values. Finally, the D-S fusion method searches for anomalous probabilities of the residuals and uses the result of that search to determine whether the current water quality is normal (that is, free of pollution) or contaminated. The D-S fusion method is extended and improved in this paper by weighted averaging of water-contamination evidence and by the analysis of the persistence of anomalous probabilities of water-quality parameters. The extended D-S fusion method makes determinations that have a high probability of being correct concerning whether or not a source of drinking water has been contaminated. This paper's method for detecting water-contamination events was tested with water-quality time series from automated (on-line) water quality sensors. In addition, a small-scale, experimental, water-pipe network was tested to detect water-contamination events. The two tests demonstrated that the extended D-S fusion method achieves a low false alarm rate and high probabilities of detecting water contamination events. (paper)

  12. Quench detection of fast plasma events for the JT-60SA central solenoid

    International Nuclear Information System (INIS)

    Murakami, Haruyuki; Kizu, Kaname; Tsuchiya, Katsuhiko; Kamiya, Koji; Takahashi, Yoshikazu; Yoshida, Kiyoshi

    2012-01-01

    Highlights: ► Pick-up coil method is used for the quench detection of JT-60SA magnet system. ► Disk-shaped pick-up coils are inserted in CS module to compensate inductive voltage. ► Applicability of pick-up coil is evaluated by two dimensional analysis. ► Pick-up coil is applicable whenever disruption, mini collapse and other plasma event. - Abstract: The JT-60 is planned to be modified to a full-superconducting tokamak referred to as the JT-60 Super Advanced (JT-60SA). The maximum temperature of the magnet during its quench might reach the temperature of higher than several hundreds Kelvin that will damage the superconducting magnet itself. The high precision quench detection system, therefore, is one of the key technologies in the superconducting magnet protection system. The pick-up coil method, which is using voltage taps to detect the normal voltage, is used for the quench detection of the JT-60SA superconducting magnet system. The disk-shaped pick-up coils are inserted in the central solenoid (CS) module to compensate the inductive voltage. In the previous study, the quench detection system requires a large number of pick-up coils. The reliability of quench detection system would be higher by simplifying the detection system such as reducing the number of pick-up coils. Simplifying the quench detection system is also important to reduce the total cost of the protection system. Hence the design method is improved by increasing optimizing parameters. The improved design method can reduce the number of pick-up coils without reducing the sensitivity of detection; consequently the protection system can be designed with higher reliability and lower cost. The applicability of the disk-shaped pick-up coil for quench detection system is evaluated by the two dimensional analysis. In the previous study, however, the analysis model only took into account the CS, EF (equilibrium field) coils and plasma. Therefore, applicability of the disk-shaped pick-up coil for

  13. How Good Is Good: Improved Tracking and Managing of Safety Goals, Performance Indicators, Production Targets and Significant Events Using Learning Curves

    International Nuclear Information System (INIS)

    Duffey, Rommey B.; Saull, John W.

    2002-01-01

    We show a new way to track and measure safety and performance using learning curves derived on a mathematical basis. When unusual or abnormal events occur in plants and equipment, the regulator and good management practice requires they be reported, investigated, understood and rectified. In addition to reporting so-called 'significant events', both management and the regulator often set targets for individual and collective performance, which are used for both reward and criticism. For almost completely safe systems, like nuclear power plants, commercial aircraft and chemical facilities, many parameters are tracked and measured. Continuous improvement has to be demonstrated, as well as meeting reduced occurrence rates, which are set as management goals or targets. This process usually takes the form of statistics for availability of plant and equipment, forced or unplanned maintenance outage, loss of safety function, safety or procedural violations, etc. These are often rolled up into a set of so-called 'Performance Indicators' as measures of how well safety and operation is being managed at a given facility. The overall operating standards of an industry are also measured. A whole discipline is formed of tracking, measuring, reporting, managing and understanding the plethora of indicators and data. Decreasing occurrence rates and meeting or exceeding goals are seen and rewarded as virtues. Managers and operators need to know how good is their safety management system that has been adopted and used (and paid for), and whether it can itself be improved. We show the importance of accumulated experience in correctly measuring and tracking the decreasing event and error rates speculating a finite minimum rate. We show that the rate of improvement constitutes a measurable 'learning curve', and the attainment of the goals and targets can be affected by the adopted measures. We examine some of the available data on significant events, reportable occurrences, and loss of

  14. A review of significant events analysed in general practice: implications for the quality and safety of patient care

    Directory of Open Access Journals (Sweden)

    Bradley Nick

    2009-09-01

    Full Text Available Abstract Background Significant event analysis (SEA is promoted as a team-based approach to enhancing patient safety through reflective learning. Evidence of SEA participation is required for appraisal and contractual purposes in UK general practice. A voluntary educational model in the west of Scotland enables general practitioners (GPs and doctors-in-training to submit SEA reports for feedback from trained peers. We reviewed reports to identify the range of safety issues analysed, learning needs raised and actions taken by GP teams. Method Content analysis of SEA reports submitted in an 18 month period between 2005 and 2007. Results 191 SEA reports were reviewed. 48 described patient harm (25.1%. A further 109 reports (57.1% outlined circumstances that had the potential to cause patient harm. Individual 'error' was cited as the most common reason for event occurrence (32.5%. Learning opportunities were identified in 182 reports (95.3% but were often non-specific professional issues not shared with the wider practice team. 154 SEA reports (80.1% described actions taken to improve practice systems or professional behaviour. However, non-medical staff were less likely to be involved in the changes resulting from event analyses describing patient harm (p Conclusion The study provides some evidence of the potential of SEA to improve healthcare quality and safety. If applied rigorously, GP teams and doctors in training can use the technique to investigate and learn from a wide variety of quality issues including those resulting in patient harm. This leads to reported change but it is unclear if such improvement is sustained.

  15. Automatic Multi-sensor Data Quality Checking and Event Detection for Environmental Sensing

    Science.gov (United States)

    LIU, Q.; Zhang, Y.; Zhao, Y.; Gao, D.; Gallaher, D. W.; Lv, Q.; Shang, L.

    2017-12-01

    With the advances in sensing technologies, large-scale environmental sensing infrastructures are pervasively deployed to continuously collect data for various research and application fields, such as air quality study and weather condition monitoring. In such infrastructures, many sensor nodes are distributed in a specific area and each individual sensor node is capable of measuring several parameters (e.g., humidity, temperature, and pressure), providing massive data for natural event detection and analysis. However, due to the dynamics of the ambient environment, sensor data can be contaminated by errors or noise. Thus, data quality is still a primary concern for scientists before drawing any reliable scientific conclusions. To help researchers identify potential data quality issues and detect meaningful natural events, this work proposes a novel algorithm to automatically identify and rank anomalous time windows from multiple sensor data streams. More specifically, (1) the algorithm adaptively learns the characteristics of normal evolving time series and (2) models the spatial-temporal relationship among multiple sensor nodes to infer the anomaly likelihood of a time series window for a particular parameter in a sensor node. Case studies using different data sets are presented and the experimental results demonstrate that the proposed algorithm can effectively identify anomalous time windows, which may resulted from data quality issues and natural events.

  16. Developing Fluorescence Sensor Systems for Early Detection of Nitrification Events in Chloraminated Drinking Water Distribution Systems

    Science.gov (United States)

    Detection of nitrification events in chloraminated drinking water distribution systems remains an ongoing challenge for many drinking water utilities, including Dallas Water Utilities (DWU) and the City of Houston (CoH). Each year, these utilities experience nitrification events ...

  17. On Event/Time Triggered and Distributed Analysis of a WSN System for Event Detection, Using Fuzzy Logic

    Directory of Open Access Journals (Sweden)

    Sofia Maria Dima

    2016-01-01

    Full Text Available Event detection in realistic WSN environments is a critical research domain, while the environmental monitoring comprises one of its most pronounced applications. Although efforts related to the environmental applications have been presented in the current literature, there is a significant lack of investigation on the performance of such systems, when applied in wireless environments. Aiming at addressing this shortage, in this paper an advanced multimodal approach is followed based on fuzzy logic. The proposed fuzzy inference system (FIS is implemented on TelosB motes and evaluates the probability of fire detection while aiming towards power conservation. Additionally to a straightforward centralized approach, a distributed implementation of the above FIS is also proposed, aiming towards network congestion reduction while optimally distributing the energy consumption among network nodes so as to maximize network lifetime. Moreover this work proposes an event based execution of the aforementioned FIS aiming to further reduce the computational as well as the communication cost, compared to a periodical time triggered FIS execution. As a final contribution, performance metrics acquired from all the proposed FIS implementation techniques are thoroughly compared and analyzed with respect to critical network conditions aiming to offer realistic evaluation and thus objective conclusions’ extraction.

  18. Consumer reporting of adverse events following immunization.

    Science.gov (United States)

    Clothier, Hazel J; Selvaraj, Gowri; Easton, Mee Lee; Lewis, Georgina; Crawford, Nigel W; Buttery, Jim P

    2014-01-01

    Surveillance of adverse events following immunisation (AEFI) is an essential component of vaccine safety monitoring. The most commonly utilized passive surveillance systems rely predominantly on reporting by health care providers (HCP). We reviewed adverse event reports received in Victoria, Australia since surveillance commencement in July 2007, to June 2013 (6 years) to ascertain the contribution of consumer (vaccinee or their parent/guardian) reporting to vaccine safety monitoring and to inform future surveillance system development directions. Categorical data included were: reporter type; serious and non-serious AEFI category; and, vaccinee age group. Chi-square test and 2-sample test of proportions were used to compare categories; trend changes were assessed using linear regression. Consumer reporting increased over the 6 years, reaching 21% of reports received in 2013 (PConsumer reports were 5% more likely to describe serious AEFI than HCP (P=0.018) and 10% more likely to result in specialist clinic attendance (Preporting increased to 32% of all report since its introduction in 2010, 85% of consumers continued to report by phone. Consumer reporting of AEFI is a valuable component of vaccine safety surveillance in addition to HCP reporting. Changes are required to AEFI reporting systems to implement efficient consumer AEFI reporting, but may be justified for their potential impact on signal detection sensitivity.

  19. Development of safety analysis and constraint detection techniques for process interaction errors

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Chin-Feng, E-mail: csfanc@saturn.yzu.edu.tw [Computer Science and Engineering Dept., Yuan-Ze University, Taiwan (China); Tsai, Shang-Lin; Tseng, Wan-Hui [Computer Science and Engineering Dept., Yuan-Ze University, Taiwan (China)

    2011-02-15

    Among the new failure modes introduced by computer into safety systems, the process interaction error is the most unpredictable and complicated failure mode, which may cause disastrous consequences. This paper presents safety analysis and constraint detection techniques for process interaction errors among hardware, software, and human processes. Among interaction errors, the most dreadful ones are those that involve run-time misinterpretation from a logic process. We call them the 'semantic interaction errors'. Such abnormal interaction is not adequately emphasized in current research. In our static analysis, we provide a fault tree template focusing on semantic interaction errors by checking conflicting pre-conditions and post-conditions among interacting processes. Thus, far-fetched, but highly risky, interaction scenarios involve interpretation errors can be identified. For run-time monitoring, a range of constraint types is proposed for checking abnormal signs at run time. We extend current constraints to a broader relational level and a global level, considering process/device dependencies and physical conservation rules in order to detect process interaction errors. The proposed techniques can reduce abnormal interactions; they can also be used to assist in safety-case construction.

  20. Development of safety analysis and constraint detection techniques for process interaction errors

    International Nuclear Information System (INIS)

    Fan, Chin-Feng; Tsai, Shang-Lin; Tseng, Wan-Hui

    2011-01-01

    Among the new failure modes introduced by computer into safety systems, the process interaction error is the most unpredictable and complicated failure mode, which may cause disastrous consequences. This paper presents safety analysis and constraint detection techniques for process interaction errors among hardware, software, and human processes. Among interaction errors, the most dreadful ones are those that involve run-time misinterpretation from a logic process. We call them the 'semantic interaction errors'. Such abnormal interaction is not adequately emphasized in current research. In our static analysis, we provide a fault tree template focusing on semantic interaction errors by checking conflicting pre-conditions and post-conditions among interacting processes. Thus, far-fetched, but highly risky, interaction scenarios involve interpretation errors can be identified. For run-time monitoring, a range of constraint types is proposed for checking abnormal signs at run time. We extend current constraints to a broader relational level and a global level, considering process/device dependencies and physical conservation rules in order to detect process interaction errors. The proposed techniques can reduce abnormal interactions; they can also be used to assist in safety-case construction.

  1. A Novel Event-Based Incipient Slip Detection Using Dynamic Active-Pixel Vision Sensor (DAVIS).

    Science.gov (United States)

    Rigi, Amin; Baghaei Naeini, Fariborz; Makris, Dimitrios; Zweiri, Yahya

    2018-01-24

    In this paper, a novel approach to detect incipient slip based on the contact area between a transparent silicone medium and different objects using a neuromorphic event-based vision sensor (DAVIS) is proposed. Event-based algorithms are developed to detect incipient slip, slip, stress distribution and object vibration. Thirty-seven experiments were performed on five objects with different sizes, shapes, materials and weights to compare precision and response time of the proposed approach. The proposed approach is validated by using a high speed constitutional camera (1000 FPS). The results indicate that the sensor can detect incipient slippage with an average of 44.1 ms latency in unstructured environment for various objects. It is worth mentioning that the experiments were conducted in an uncontrolled experimental environment, therefore adding high noise levels that affected results significantly. However, eleven of the experiments had a detection latency below 10 ms which shows the capability of this method. The results are very promising and show a high potential of the sensor being used for manipulation applications especially in dynamic environments.

  2. DER 83: outstanding events

    International Nuclear Information System (INIS)

    1984-01-01

    The DER's activity is presented through 82 ''outstanding events''. Each one is a stage in the effort of research and development of the DER. These events concern the following fields: new applications of electric power for customers; environment protection and new energy sources; improvements of electric power production units; electrical materials; electric network planning and control; computer codes. In the production field, one deals more particularly with nuclear reactor safety studies: analysis of the behaviour of different components; reactor safety experiments; reliability of different systems (safety, communications...) [fr

  3. Application of ultrasonic testing technique to detect gas accumulation in important pipings for pressurized water reactors safety

    Energy Technology Data Exchange (ETDEWEB)

    Fushimi, Yasuyuki [Inst. of Nuclear Safety System Inc., Mihama, Fukui (Japan)

    2002-09-01

    Since 1988, the USNRC has pointed out that gas-binding events might occur at high head safety injection (HHSI) pumps of pressurized water reactors (PWRs). In Japanese PWR plants, corrective actions were taken in response to gas-binding events that occurred on HHSI pumps in the USA, so no gas accumulation event has been reported so far. However, when venting frequency is prolonged with operating cycle extension, the probability of gas accumulation in pipings may increase as in the USA. The purpose of this study was to establish a technique to identify gas accumulation and to measure the gas volume accurately. Taking dominant causes of the gas-binding events in the USA into consideration, we pointed out the following sections in the Japanese PWRs where gas srtipping and/or gas accumulation might occur: residual heat removal system pipings and charging/safety injection pump minimum flow line. Then an ultrasonic testing technique, adopted to identify gas accumulation in the USA, was applied to those sections of the typical Japanese PWR. Consequently, no gas accumulation was found in those pipings. (author)

  4. A review for identification of initiating events in event tree development process on nuclear power plants

    International Nuclear Information System (INIS)

    Riyadi, Eko H.

    2014-01-01

    Initiating event is defined as any event either internal or external to the nuclear power plants (NPPs) that perturbs the steady state operation of the plant, if operating, thereby initiating an abnormal event such as transient or loss of coolant accident (LOCA) within the NPPs. These initiating events trigger sequences of events that challenge plant control and safety systems whose failure could potentially lead to core damage or large early release. Selection for initiating events consists of two steps i.e. first step, definition of possible events, such as by evaluating a comprehensive engineering, and by constructing a top level logic model. Then the second step, grouping of identified initiating event's by the safety function to be performed or combinations of systems responses. Therefore, the purpose of this paper is to discuss initiating events identification in event tree development process and to reviews other probabilistic safety assessments (PSA). The identification of initiating events also involves the past operating experience, review of other PSA, failure mode and effect analysis (FMEA), feedback from system modeling, and master logic diagram (special type of fault tree). By using the method of study for the condition of the traditional US PSA categorization in detail, could be obtained the important initiating events that are categorized into LOCA, transients and external events

  5. How does structured sparsity work in abnormal event detection?

    DEFF Research Database (Denmark)

    Ren, Huamin; Pan, Hong; Olsen, Søren Ingvor

    the training, which is the due to the fact that abnormal videos are limited or even unavailable in advance in most video surveillance applications. As a result, there could be only one label in the training data which hampers supervised learning; 2) Even though there are multiple types of normal behaviors, how...... many normal patterns lie in the whole surveillance data is still unknown. This is because there is huge amount of video surveillance data and only a small proportion is used in algorithm learning, consequently, the normal patterns in the training data could be incomplete. As a result, any sparse...... structure learned from the training data could have a high bias and ruin the precision of abnormal event detection. Therefore, we in the paper propose an algorithm to solve the abnormality detection problem by sparse representation, in which local structured sparsity is preserved in coefficients. To better...

  6. System safety analysis of an autonomous mobile robot

    International Nuclear Information System (INIS)

    Bartos, R.J.

    1994-01-01

    Analysis of the safety of operating and maintaining the Stored Waste Autonomous Mobile Inspector (SWAMI) II in a hazardous environment at the Fernald Environmental Management Project (FEMP) was completed. The SWAMI II is a version of a commercial robot, the HelpMate trademark robot produced by the Transitions Research Corporation, which is being updated to incorporate the systems required for inspecting mixed toxic chemical and radioactive waste drums at the FEMP. It also has modified obstacle detection and collision avoidance subsystems. The robot will autonomously travel down the aisles in storage warehouses to record images of containers and collect other data which are transmitted to an inspector at a remote computer terminal. A previous study showed the SWAMI II has economic feasibility. The SWAMI II will more accurately locate radioactive contamination than human inspectors. This thesis includes a System Safety Hazard Analysis and a quantitative Fault Tree Analysis (FTA). The objectives of the analyses are to prevent potentially serious events and to derive a comprehensive set of safety requirements from which the safety of the SWAMI II and other autonomous mobile robots can be evaluated. The Computer-Aided Fault Tree Analysis (CAFTA copyright) software is utilized for the FTA. The FTA shows that more than 99% of the safety risk occurs during maintenance, and that when the derived safety requirements are implemented the rate of serious events is reduced to below one event per million operating hours. Training and procedures in SWAMI II operation and maintenance provide an added safety margin. This study will promote the safe use of the SWAMI II and other autonomous mobile robots in the emerging technology of mobile robotic inspection

  7. 75 FR 4134 - Pipeline Safety: Leak Detection on Hazardous Liquid Pipelines

    Science.gov (United States)

    2010-01-26

    ... safety study on pipeline Supervisory Control and Data Acquisition (SCADA) systems (NTSB/SS-05/02). The... indications of a leak on the SCADA interface was the impetus for this study. The NTSB examined 13 hazardous... pipelines, the line balance technique for leak detection can often be performed with manual calculations...

  8. Patient safety: Safety culture and patient safety ethics

    DEFF Research Database (Denmark)

    Madsen, Marlene Dyrløv

    2006-01-01

    ,demonstrating significant, consistent and sometimes large differences in terms of safety culture factors across the units participating in the survey. Paper 5 is the results of a study of the relation between safety culture, occupational health andpatient safety using a safety culture questionnaire survey......Patient safety - the prevention of medical error and adverse events - and the initiative of developing safety cultures to assure patients from harm have become one of the central concerns in quality improvement in healthcare both nationally andinternationally. This subject raises numerous...... challenging issues of systemic, organisational, cultural and ethical relevance, which this dissertation seeks to address through the application of different disciplinary approaches. The main focus of researchis safety culture; through empirical and theoretical studies to comprehend the phenomenon, address...

  9. Real Time Robot Soccer Game Event Detection Using Finite State Machines with Multiple Fuzzy Logic Probability Evaluators

    Directory of Open Access Journals (Sweden)

    Elmer P. Dadios

    2009-01-01

    Full Text Available This paper presents a new algorithm for real time event detection using Finite State Machines with multiple Fuzzy Logic Probability Evaluators (FLPEs. A machine referee for a robot soccer game is developed and is used as the platform to test the proposed algorithm. A novel technique to detect collisions and other events in microrobot soccer game under inaccurate and insufficient information is presented. The robots' collision is used to determine goalkeeper charging and goal score events which are crucial for the machine referee's decisions. The Main State Machine (MSM handles the schedule of event activation. The FLPE calculates the probabilities of the true occurrence of the events. Final decisions about the occurrences of events are evaluated and compared through threshold crisp probability values. The outputs of FLPEs can be combined to calculate the probability of an event composed of subevents. Using multiple fuzzy logic system, the FLPE utilizes minimal number of rules and can be tuned individually. Experimental results show the accuracy and robustness of the proposed algorithm.

  10. Procedure for conducting probabilistic safety assessment: level 1 full power internal event analysis

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Won Dae; Lee, Y. H.; Hwang, M. J. [and others

    2003-07-01

    This report provides guidance on conducting a Level I PSA for internal events in NPPs, which is based on the method and procedure that was used in the PSA for the design of Korea Standard Nuclear Plants (KSNPs). Level I PSA is to delineate the accident sequences leading to core damage and to estimate their frequencies. It has been directly used for assessing and modifying the system safety and reliability as a key and base part of PSA. Also, Level I PSA provides insights into design weakness and into ways of preventing core damage, which in most cases is the precursor to accidents leading to major accidents. So Level I PSA has been used as the essential technical bases for risk-informed application in NPPs. The report consists six major procedural steps for Level I PSA; familiarization of plant, initiating event analysis, event tree analysis, system fault tree analysis, reliability data analysis, and accident sequence quantification. The report is intended to assist technical persons performing Level I PSA for NPPs. A particular aim is to promote a standardized framework, terminology and form of documentation for PSAs. On the other hand, this report would be useful for the managers or regulatory persons related to risk-informed regulation, and also for conducting PSA for other industries.

  11. Power Load Event Detection and Classification Based on Edge Symbol Analysis and Support Vector Machine

    Directory of Open Access Journals (Sweden)

    Lei Jiang

    2012-01-01

    Full Text Available Energy signature analysis of power appliance is the core of nonintrusive load monitoring (NILM where the detailed data of the appliances used in houses are obtained by analyzing changes in the voltage and current. This paper focuses on developing an automatic power load event detection and appliance classification based on machine learning. In power load event detection, the paper presents a new transient detection algorithm. By turn-on and turn-off transient waveforms analysis, it can accurately detect the edge point when a device is switched on or switched off. The proposed load classification technique can identify different power appliances with improved recognition accuracy and computational speed. The load classification method is composed of two processes including frequency feature analysis and support vector machine. The experimental results indicated that the incorporation of the new edge detection and turn-on and turn-off transient signature analysis into NILM revealed more information than traditional NILM methods. The load classification method has achieved more than ninety percent recognition rate.

  12. Application of best estimate and uncertainty safety analysis methodology to loss of flow events at Ontario's Power Generation's Darlington Nuclear Generating Station

    International Nuclear Information System (INIS)

    Huget, R.G.; Lau, D.K.; Luxat, J.C.

    2001-01-01

    Ontario Power Generation (OPG) is currently developing a new safety analysis methodology based on best estimate and uncertainty (BEAU) analysis. The framework and elements of the new safety analysis methodology are defined. The evolution of safety analysis technology at OPG has been thoroughly documented. Over the years, the use of conservative limiting assumptions in OPG safety analyses has led to gradual erosion of predicted safety margins. The main purpose of the new methodology is to provide a more realistic quantification of safety margins within a probabilistic framework, using best estimate results, with an integrated accounting of the underlying uncertainties. Another objective of the new methodology is to provide a cost-effective means for on-going safety analysis support of OPG's nuclear generating stations. Discovery issues and plant aging effects require that the safety analyses be periodically revised and, in the past, the cost of reanalysis at OPG has been significant. As OPG enters the new competitive marketplace for electricity, there is a strong need to conduct safety analysis in a less cumbersome manner. This paper presents the results of the first licensing application of the new methodology in support of planned design modifications to the shutdown systems (SDSs) at Darlington Nuclear Generating Station (NGS). The design modifications restore dual trip parameter coverage over the full range of reactor power for certain postulated loss-of-flow (LOF) events. The application of BEAU analysis to the single heat transport pump trip event provides a realistic estimation of the safety margins for the primary and backup trip parameters. These margins are significantly larger than those predicted by conventional limit of the operating envelope (LOE) analysis techniques. (author)

  13. Detection of genetically modified maize events in Brazilian maize-derived food products

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2013-09-01

    Full Text Available The Brazilian government has approved many transgenic maize lines for commercialization and has established a threshold of 1% for food labeling, which underscores need for monitoring programs. Thirty four samples including flours and different types of nacho chips were analyzed by conventional and real-time PCR in 2011 and 2012. The events MON810, Bt11, and TC1507 were detected in most of the samples, and NK603 was present only in the samples analyzed in 2012. The authorized lines GA21, T25, and the unauthorized Bt176 were not detected. All positive samples in the qualitative tests collected in 2011 showed a transgenic content higher than 1%, and none of them was correctly labeled. Regarding the samples collected in 2012, all positive samples were quantified higher than the threshold, and 47.0% were not correctly labeled. The overall results indicated that the major genetically modified organisms detected were MON810, TC1507, Bt11, and NK603 events. Some industries that had failed to label their products in 2011 started labeling them in 2012, demonstrating compliance with the current legislation observing the consumer rights. Although these results are encouraging, it has been clearly demonstrated the need for continuous monitoring programs to ensure consumers that food products are labeled properly.

  14. Application of Data Cubes for Improving Detection of Water Cycle Extreme Events

    Science.gov (United States)

    Albayrak, Arif; Teng, William

    2015-01-01

    As part of an ongoing NASA-funded project to remove a longstanding barrier to accessing NASA data (i.e., accessing archived time-step array data as point-time series), for the hydrology and other point-time series-oriented communities, "data cubes" are created from which time series files (aka "data rods") are generated on-the-fly and made available as Web services from the Goddard Earth Sciences Data and Information Services Center (GES DISC). Data cubes are data as archived rearranged into spatio-temporal matrices, which allow for easy access to the data, both spatially and temporally. A data cube is a specific case of the general optimal strategy of reorganizing data to match the desired means of access. The gain from such reorganization is greater the larger the data set. As a use case of our project, we are leveraging existing software to explore the application of the data cubes concept to machine learning, for the purpose of detecting water cycle extreme events, a specific case of anomaly detection, requiring time series data. We investigate the use of support vector machines (SVM) for anomaly classification. We show an example of detection of water cycle extreme events, using data from the Tropical Rainfall Measuring Mission (TRMM).

  15. A multivariate statistical methodology for detection of degradation and failure trends using nuclear power plant operational data

    International Nuclear Information System (INIS)

    Samanta, P.K.; Teichmann, T.

    1990-01-01

    In this paper, a multivariate statistical method is presented and demonstrated as a means for analyzing nuclear power plant transients (or events) and safety system performance for detection of malfunctions and degradations within the course of the event based on operational data. The study provides the methodology and illustrative examples based on data gathered from simulation of nuclear power plant transients (due to lack of easily accessible operational data). Such an approach, once fully developed, can be used to detect failure trends and patterns and so can lead to prevention of conditions with serious safety implications

  16. Risk-based reconfiguration of safety monitoring system using dynamic Bayesian network

    International Nuclear Information System (INIS)

    Kohda, Takehisa; Cui Weimin

    2007-01-01

    To prevent an abnormal event from leading to an accident, the role of its safety monitoring system is very important. The safety monitoring system detects symptoms of an abnormal event to mitigate its effect at its early stage. As the operation time passes by, the sensor reliability decreases, which implies that the decision criteria of the safety monitoring system should be modified depending on the sensor reliability as well as the system reliability. This paper presents a framework for the decision criteria (or diagnosis logic) of the safety monitoring system. The logic can be dynamically modified based on sensor output data monitored at regular intervals to minimize the expected loss caused by two types of safety monitoring system failure events: failed-dangerous (FD) and failed-safe (FS). The former corresponds to no response under an abnormal system condition, while the latter implies a spurious activation under a normal system condition. Dynamic Bayesian network theory can be applied to modeling the entire system behavior composed of the system and its safety monitoring system. Using the estimated state probabilities, the optimal decision criterion is given to obtain the optimal diagnosis logic. An illustrative example of a three-sensor system shows the merits and characteristics of the proposed method, where the reasonable interpretation of sensor data can be obtained

  17. Detection of genetically modified organisms in foreign-made processed foods containing corn and potato.

    Science.gov (United States)

    Monma, Kimio; Araki, Rie; Sagi, Naoki; Satoh, Masaki; Ichikawa, Hisatsugu; Satoh, Kazue; Tobe, Takashi; Kamata, Kunihiro; Hino, Akihiro; Saito, Kazuo

    2005-06-01

    Investigations of the validity of labeling regarding genetically modified (GM) products were conducted using polymerase chain reaction (PCR) methods for foreign-made processed foods made from corn and potato purchased in the Tokyo area and in the USA. Several kinds of GM crops were detected in 12 of 32 samples of processed corn samples. More than two GM events for which safety reviews have been completed in Japan were simultaneously detected in 10 samples. GM events MON810 and Bt11 were most frequently detected in the samples by qualitative PCR methods. MON810 was detected in 11 of the 12 samples, and Bt11 was detected in 6 of the 12 samples. In addition, Roundup Ready soy was detected in one of the 12 samples. On the other hand, CBH351, for which the safety assessment was withdrawn in Japan, was not detected in any of the 12 samples. A trial quantitative analysis was performed on six of the GM maize qualitatively positive samples. The estimated amounts of GM maize in these samples ranged from 0.2 to 2.8%, except for one sample, which contained 24.1%. For this sample, the total amount found by event-specific quantitative analysis was 23.8%. Additionally, Roundup Ready soy was detected in one sample of 21 potato-processed foods, although GM potatoes were not detected in any sample.

  18. Extreme meteorological events and nuclear facilities safety; Fenomenos meteorologicos extremos e a seguranca das instalacoes nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Patricia Moco Princisval

    2006-07-01

    An External Event is an event that originates outside the site and whose effects on the Nuclear Power Plants (NPP) should be considered. Such events could be of natural or human induced origin and should be identified and selected for design purposes during the site evaluation process. This work shows that the subtropics and mid latitudes of South America east of the Andes Mountain Range have been recognized as prone to severe convective weather. In Brazil, the events of tornadoes are becoming frequent; however there is no institutionalized procedure for a systematic documentation of severe weather. The information is done only for some scientists and by the newspapers. Like strong wind can affect the structural integrity of buildings or the pressure differential can affect the ventilation system, our concern is the safety of NPP and for this purpose the recommendations of International Atomic Energy Agency, Nuclear Regulatory Commission and Comissao Nacional de Energia Nuclear are showed and also a data base of tornadoes in Brazil is done. (author)

  19. Safety device of thermonuclear device

    International Nuclear Information System (INIS)

    Aoki, Isao; Ueda, Shuzo; Seki, Yasushi; Sakurai, Akiko; Kasahara, Fumio; Obara, Atsushi; Yamauchi, Michinori.

    1997-01-01

    The present invention provides a safety device against an event of intrusion of coolants in a vacuum vessel. Namely, a coolant supply system comprises cooling tubes for supplying coolants to main reactor structure components including a vacuum vessel. A detection means detects leakage of coolants in the vacuum vessel. A coolant supply control means controls the supply of coolants to the main reactor structural components based on the leakage detection signals of the detection means. A stagnated material discharging means discharges stagnated materials in the main reactor structural components caused by the leakage of coolants. The leakage of coolants (for example, water) in the vacuum vessel can thus be detected by the water detection device in the vacuum vessel. A control value of a coolant supply means is closed by the leakage detection signals. The supply of coolants to the main reactor structural components is restricted to suppress the leakage. The stagnated materials are discharged to a tank by way of a water draining valve. (I.S.)

  20. Monitoring antimalarial safety and tolerability in clinical trials: A case study from Uganda

    Directory of Open Access Journals (Sweden)

    Mpimbaza Arthur

    2008-06-01

    Full Text Available Abstract Background New antimalarial regimens, including artemisinin-based combination therapies (ACTs, have been adopted widely as first-line treatment for uncomplicated malaria. Although these drugs appear to be safe and well-tolerated, experience with their use in Africa is limited and continued assessment of safety is a priority. However, no standardized guidelines for evaluating drug safety and tolerability in malaria studies exist. A system for monitoring adverse events in antimalarial trials conducted in Uganda was developed. Here the reporting system is described, and difficulties faced in analysing and interpreting the safety results are illustrated, using data from the trials. Case description Between 2002 and 2007, eleven randomized, controlled clinical trials were conducted to compare the efficacy, safety, and tolerability of different antimalarial regimens for treatment of uncomplicated malaria in Uganda. The approach to adverse event monitoring was similar in all studies. A total of 5,614 treatments were evaluated in 4,876 patients. Differences in baseline characteristics and patterns of adverse event reporting were noted between the sites, which limited the ability to pool and analyse data. Clinical failure following antimalarial treatment confounded associations between treatment and adverse events that were also common symptoms of malaria, particularly in areas of lower transmission intensity. Discussion and evaluation Despite prospectively evaluating for adverse events, limitations in the monitoring system were identified. New standardized guidelines for monitoring safety and tolerability in antimalarial trials are needed, which should address how to detect events of greatest importance, including serious events, those with a causal relationship to the treatment, those which impact on adherence, and events not previously reported. Conclusion Although the World Health Organization has supported the development of

  1. Improving patient safety via automated laboratory-based adverse event grading.

    Science.gov (United States)

    Niland, Joyce C; Stiller, Tracey; Neat, Jennifer; Londrc, Adina; Johnson, Dina; Pannoni, Susan

    2012-01-01

    The identification and grading of adverse events (AEs) during the conduct of clinical trials is a labor-intensive and error-prone process. This paper describes and evaluates a software tool developed by City of Hope to automate complex algorithms to assess laboratory results and identify and grade AEs. We compared AEs identified by the automated system with those previously assessed manually, to evaluate missed/misgraded AEs. We also conducted a prospective paired time assessment of automated versus manual AE assessment. We found a substantial improvement in accuracy/completeness with the automated grading tool, which identified an additional 17% of severe grade 3-4 AEs that had been missed/misgraded manually. The automated system also provided an average time saving of 5.5 min per treatment course. With 400 ongoing treatment trials at City of Hope and an average of 1800 laboratory results requiring assessment per study, the implications of these findings for patient safety are enormous.

  2. Barriers to Safety Event Reporting in an Academic Radiology Department: Authority Gradients and Other Human Factors.

    Science.gov (United States)

    Siewert, Bettina; Swedeen, Suzanne; Brook, Olga R; Eisenberg, Ronald L; Hochman, Mary

    2018-05-15

    Purpose To investigate barriers to reporting safety concerns in an academic radiology department and to evaluate the role of human factors, including authority gradients, as potential barriers to safety concern reporting. Materials and Methods In this institutional review board-approved, HIPAA-compliant retrospective study, an online questionnaire link was emailed four times to all radiology department staff members (n = 648) at a tertiary care institution. Survey questions included frequency of speaking up about safety concerns, perceived barriers to speaking up, and the annual number of safety concerns that respondents were unsuccessful in reporting. Respondents' sex, role in the department, and length of employment were recorded. Statistical analysis was performed with the Fisher exact test. Results The survey was completed by 363 of the 648 employees (56%). Of those 363 employees, 182 (50%) reported always speaking up about safety concerns, 134 (37%) reported speaking up most of the time, 36 (10%) reported speaking up sometimes, seven (2%) reported rarely speaking up, and four (1%) reported never speaking up. Thus, 50% of employees spoke up about safety concerns less than 100% of the time. The most frequently reported barriers to speaking up included high reporting threshold (69%), reluctance to challenge someone in authority (67%), fear of disrespect (53%), and lack of listening (52%). Conclusion Of employees in a large academic radiology department, 50% do not attain 100% reporting of safety events. The most common human barriers to speaking up are high reporting threshold, reluctance to challenge authority, fear of disrespect, and lack of listening, which suggests that existing authority gradients interfere with full reporting of safety concerns. © RSNA, 2018.

  3. The effectiveness of pretreatment physics plan review for detecting errors in radiation therapy

    International Nuclear Information System (INIS)

    Gopan, Olga; Zeng, Jing; Novak, Avrey; Nyflot, Matthew; Ford, Eric

    2016-01-01

    Purpose: The pretreatment physics plan review is a standard tool for ensuring treatment quality. Studies have shown that the majority of errors in radiation oncology originate in treatment planning, which underscores the importance of the pretreatment physics plan review. This quality assurance measure is fundamentally important and central to the safety of patients and the quality of care that they receive. However, little is known about its effectiveness. The purpose of this study was to analyze reported incidents to quantify the effectiveness of the pretreatment physics plan review with the goal of improving it. Methods: This study analyzed 522 potentially severe or critical near-miss events within an institutional incident learning system collected over a three-year period. Of these 522 events, 356 originated at a workflow point that was prior to the pretreatment physics plan review. The remaining 166 events originated after the pretreatment physics plan review and were not considered in the study. The applicable 356 events were classified into one of the three categories: (1) events detected by the pretreatment physics plan review, (2) events not detected but “potentially detectable” by the physics review, and (3) events “not detectable” by the physics review. Potentially detectable events were further classified by which specific checks performed during the pretreatment physics plan review detected or could have detected the event. For these events, the associated specific check was also evaluated as to the possibility of automating that check given current data structures. For comparison, a similar analysis was carried out on 81 events from the international SAFRON radiation oncology incident learning system. Results: Of the 356 applicable events from the institutional database, 180/356 (51%) were detected or could have been detected by the pretreatment physics plan review. Of these events, 125 actually passed through the physics review; however

  4. The effectiveness of pretreatment physics plan review for detecting errors in radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Gopan, Olga; Zeng, Jing; Novak, Avrey; Nyflot, Matthew; Ford, Eric, E-mail: eford@uw.edu [Department of Radiation Oncology, University of Washington Medical Center, 1959 NE Pacific Street, Box 356043, Seattle, Washington 98195 (United States)

    2016-09-15

    Purpose: The pretreatment physics plan review is a standard tool for ensuring treatment quality. Studies have shown that the majority of errors in radiation oncology originate in treatment planning, which underscores the importance of the pretreatment physics plan review. This quality assurance measure is fundamentally important and central to the safety of patients and the quality of care that they receive. However, little is known about its effectiveness. The purpose of this study was to analyze reported incidents to quantify the effectiveness of the pretreatment physics plan review with the goal of improving it. Methods: This study analyzed 522 potentially severe or critical near-miss events within an institutional incident learning system collected over a three-year period. Of these 522 events, 356 originated at a workflow point that was prior to the pretreatment physics plan review. The remaining 166 events originated after the pretreatment physics plan review and were not considered in the study. The applicable 356 events were classified into one of the three categories: (1) events detected by the pretreatment physics plan review, (2) events not detected but “potentially detectable” by the physics review, and (3) events “not detectable” by the physics review. Potentially detectable events were further classified by which specific checks performed during the pretreatment physics plan review detected or could have detected the event. For these events, the associated specific check was also evaluated as to the possibility of automating that check given current data structures. For comparison, a similar analysis was carried out on 81 events from the international SAFRON radiation oncology incident learning system. Results: Of the 356 applicable events from the institutional database, 180/356 (51%) were detected or could have been detected by the pretreatment physics plan review. Of these events, 125 actually passed through the physics review; however

  5. Engineering safety review mission Krsko NPP external events PSA. Ljubljana, Slovenia 19-23 February 1996. Final report

    International Nuclear Information System (INIS)

    Budnitz, R.J.; Smith, P.

    1996-01-01

    Within the scope of the TC Project RER/9/035, a review mission visited Ljubljana, Slovenia, 19-23 February 1996. Two outside experts, Messrs. R.J. Budnitz (USA) and Paul Smith (USA), as well as a staff member, A. Guerpinar (ESS-NSNI) took part in the review. The purpose of the mission was to assist the Slovenian Nuclear Safety Administration to review the external events PSA prepared by Krsko NPP consultants Westinghouse Energy Systems Europe and EQE International. Another seismic safety review was performed concurrently in Ljubljana involving the investigations in relation to the tectonic stability and reassessment of the design basis ground motion characterization for the Krsko NPP site

  6. A review for identification of initiating events in event tree development process on nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Riyadi, Eko H., E-mail: e.riyadi@bapeten.go.id [Center for Regulatory Assessment of Nuclear Installation and Materials, Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada 8 Jakarta 10120 (Indonesia)

    2014-09-30

    Initiating event is defined as any event either internal or external to the nuclear power plants (NPPs) that perturbs the steady state operation of the plant, if operating, thereby initiating an abnormal event such as transient or loss of coolant accident (LOCA) within the NPPs. These initiating events trigger sequences of events that challenge plant control and safety systems whose failure could potentially lead to core damage or large early release. Selection for initiating events consists of two steps i.e. first step, definition of possible events, such as by evaluating a comprehensive engineering, and by constructing a top level logic model. Then the second step, grouping of identified initiating event's by the safety function to be performed or combinations of systems responses. Therefore, the purpose of this paper is to discuss initiating events identification in event tree development process and to reviews other probabilistic safety assessments (PSA). The identification of initiating events also involves the past operating experience, review of other PSA, failure mode and effect analysis (FMEA), feedback from system modeling, and master logic diagram (special type of fault tree). By using the method of study for the condition of the traditional US PSA categorization in detail, could be obtained the important initiating events that are categorized into LOCA, transients and external events.

  7. Reactor safety study. An assessment of accident risks in U.S. commercial nuclear power plants. Appendix I. Accident definition and use of event trees

    International Nuclear Information System (INIS)

    1975-10-01

    Information is presented concerning accident definition and use of event trees, event tree methodology, potential accidents covered by the reactor safety study, analysis of potential accidents involving the reactor core, and analysis of potential accidents not involving the core

  8. Safety assessment, safety performance indicators at the Paks Nuclear Power Plant

    International Nuclear Information System (INIS)

    Baji, C.; Vamos, G.; Toth, J.

    2001-01-01

    The Paks Nuclear Power Plant has been using different methods of safety assessment (event analysis, self-assessment, probabilistic safety analysis), including performance indicators characterizing both operational and safety performance since the early years of operation of the plant. Regarding the safety performance, the indicators include safety system performance, number of scrams, release of radioactive materials, number of safety significant events, industrial safety indicator, etc. The Paks NPP also reports a set of ten indicators to WANO Performance Indicator Programme which, among others, include safety related indicators as well. However, a more systematic approach to structuring and trending safety indicators is needed so that they can contribute to the enhancement of the operational safety. A more comprehensive set of indicators and a systematic evaluation process was introduced in 1996. The performance indicators framework proposed by the IAEA was adapted to Paks in this year to further improve the process. Safety culture assessment and characterizing safety culture is part of the assessment process. (author)

  9. A fuzzy-based reliability approach to evaluate basic events of fault tree analysis for nuclear power plant probabilistic safety assessment

    International Nuclear Information System (INIS)

    Purba, Julwan Hendry

    2014-01-01

    Highlights: • We propose a fuzzy-based reliability approach to evaluate basic event reliabilities. • It implements the concepts of failure possibilities and fuzzy sets. • Experts evaluate basic event failure possibilities using qualitative words. • Triangular fuzzy numbers mathematically represent qualitative failure possibilities. • It is a very good alternative for conventional reliability approach. - Abstract: Fault tree analysis has been widely utilized as a tool for nuclear power plant probabilistic safety assessment. This analysis can be completed only if all basic events of the system fault tree have their quantitative failure rates or failure probabilities. However, it is difficult to obtain those failure data due to insufficient data, environment changing or new components. This study proposes a fuzzy-based reliability approach to evaluate basic events of system fault trees whose failure precise probability distributions of their lifetime to failures are not available. It applies the concept of failure possibilities to qualitatively evaluate basic events and the concept of fuzzy sets to quantitatively represent the corresponding failure possibilities. To demonstrate the feasibility and the effectiveness of the proposed approach, the actual basic event failure probabilities collected from the operational experiences of the David–Besse design of the Babcock and Wilcox reactor protection system fault tree are used to benchmark the failure probabilities generated by the proposed approach. The results confirm that the proposed fuzzy-based reliability approach arises as a suitable alternative for the conventional probabilistic reliability approach when basic events do not have the corresponding quantitative historical failure data for determining their reliability characteristics. Hence, it overcomes the limitation of the conventional fault tree analysis for nuclear power plant probabilistic safety assessment

  10. CNE (Embalse nuclear power plant): probabilistic safety study. Electric power supply. Events sequence

    International Nuclear Information System (INIS)

    Figueroa, N.

    1987-01-01

    The plant response to the occurrence of the starting event 'total loss of electric power supply to class IV and class III' is analyzed. This involves the study of automatical actions of safety and process systems as well as the operator actions. The probabilistic evaluation of starting event frequency is performed through fault-tree techniques. The frequency of occurrence 'loss of electric power supply to class IV (λIV = 0.56/year) and the probability of failure to demand of 'reserve' generating groups (Pd III 6.79 x 10 -3 ) contribute to the mentioned frequency. As soon as the starting event occurs, the reactor power must be reduced to 0%, the fuel must be cooled through the thermo siphon and decay heat has to be removed. The events sequence analysis leads to the conclusion that the non shutting down of the reactor with any of the shutdown systems is 'incredible' (10 -6 /year). In all cases the fuel is cooled by building the thermo siphon except when a substantial inventory loss exist due to a closure failure of some valve of pressure and inventory control system. The order of magnitude of the failure of decay heat removal through the steam generators is 4 x 10 -4 . This removal would be assured by the emergency water system. Therefore, the frequency of the sequence of possible core meltdown, when the reactor does not shut down is: λ = 5 x 10 -9 /year and for the failure of heat removal: λ = 2 x 10 -6 /year. (Author)

  11. Detection of Visual Events in Underwater Video Using a Neuromorphic Saliency-based Attention System

    Science.gov (United States)

    Edgington, D. R.; Walther, D.; Cline, D. E.; Sherlock, R.; Salamy, K. A.; Wilson, A.; Koch, C.

    2003-12-01

    The Monterey Bay Aquarium Research Institute (MBARI) uses high-resolution video equipment on remotely operated vehicles (ROV) to obtain quantitative data on the distribution and abundance of oceanic animals. High-quality video data supplants the traditional approach of assessing the kinds and numbers of animals in the oceanic water column through towing collection nets behind ships. Tow nets are limited in spatial resolution, and often destroy abundant gelatinous animals resulting in species undersampling. Video camera-based quantitative video transects (QVT) are taken through the ocean midwater, from 50m to 4000m, and provide high-resolution data at the scale of the individual animals and their natural aggregation patterns. However, the current manual method of analyzing QVT video by trained scientists is labor intensive and poses a serious limitation to the amount of information that can be analyzed from ROV dives. Presented here is an automated system for detecting marine animals (events) visible in the videos. Automated detection is difficult due to the low contrast of many translucent animals and due to debris ("marine snow") cluttering the scene. Video frames are processed with an artificial intelligence attention selection algorithm that has proven a robust means of target detection in a variety of natural terrestrial scenes. The candidate locations identified by the attention selection module are tracked across video frames using linear Kalman filters. Typically, the occurrence of visible animals in the video footage is sparse in space and time. A notion of "boring" video frames is developed by detecting whether or not there is an interesting candidate object for an animal present in a particular sequence of underwater video -- video frames that do not contain any "interesting" events. If objects can be tracked successfully over several frames, they are stored as potentially "interesting" events. Based on low-level properties, interesting events are

  12. Automatic detection of whole night snoring events using non-contact microphone.

    Directory of Open Access Journals (Sweden)

    Eliran Dafna

    Full Text Available OBJECTIVE: Although awareness of sleep disorders is increasing, limited information is available on whole night detection of snoring. Our study aimed to develop and validate a robust, high performance, and sensitive whole-night snore detector based on non-contact technology. DESIGN: Sounds during polysomnography (PSG were recorded using a directional condenser microphone placed 1 m above the bed. An AdaBoost classifier was trained and validated on manually labeled snoring and non-snoring acoustic events. PATIENTS: Sixty-seven subjects (age 52.5 ± 13.5 years, BMI 30.8 ± 4.7 kg/m(2, m/f 40/27 referred for PSG for obstructive sleep apnea diagnoses were prospectively and consecutively recruited. Twenty-five subjects were used for the design study; the validation study was blindly performed on the remaining forty-two subjects. MEASUREMENTS AND RESULTS: To train the proposed sound detector, >76,600 acoustic episodes collected in the design study were manually classified by three scorers into snore and non-snore episodes (e.g., bedding noise, coughing, environmental. A feature selection process was applied to select the most discriminative features extracted from time and spectral domains. The average snore/non-snore detection rate (accuracy for the design group was 98.4% based on a ten-fold cross-validation technique. When tested on the validation group, the average detection rate was 98.2% with sensitivity of 98.0% (snore as a snore and specificity of 98.3% (noise as noise. CONCLUSIONS: Audio-based features extracted from time and spectral domains can accurately discriminate between snore and non-snore acoustic events. This audio analysis approach enables detection and analysis of snoring sounds from a full night in order to produce quantified measures for objective follow-up of patients.

  13. Review of licensee event reports, 1976 to 1978

    International Nuclear Information System (INIS)

    1979-09-01

    This report was prepared in response to a request by the Chairman of the US Nuclear Regulatory Commission for the Advisory Committee on Reactor Safeguards to review, with specific objectives, the Licensee Event Reports (LERs) issued fom 1976 through 1978. A principal objective of the present study was to identify those events which have implications for improved reactor safety. Approximately 8,700 LERs were filed during the three-year period under review. These described events ranging from the trivial to those of major safety significance. This study has confirmed that LERs represent a source of valuable data and information. However, it must be recognized that a detailed review of LERs will not identify all safety problems likely to be encountered in the operation of nuclear power plants. As a result of this review, a number of classes of events were identified. These classes were subsequently categorized into three groups: (a) those having potentially serious safety implications, (b) events that must be regarded as matters of concern, and (c) events of lower safety significance but with excessive frequency

  14. An Ensemble Approach for Emotion Cause Detection with Event Extraction and Multi-Kernel SVMs

    Institute of Scientific and Technical Information of China (English)

    Ruifeng Xu; Jiannan Hu; Qin Lu; Dongyin Wu; Lin Gui

    2017-01-01

    In this paper,we present a new challenging task for emotion analysis,namely emotion cause extraction.In this task,we focus on the detection of emotion cause a.k.a the reason or the stimulant of an emotion,rather than the regular emotion classification or emotion component extraction.Since there is no open dataset for this task available,we first designed and annotated an emotion cause dataset which follows the scheme of W3C Emotion Markup Language.We then present an emotion cause detection method by using event extraction framework,where a tree structure-based representation method is used to represent the events.Since the distribution of events is imbalanced in the training data,we propose an under-sampling-based bagging algorithm to solve this problem.Even with a limited training set,the proposed approach may still extract sufficient features for analysis by a bagging of multi-kernel based SVMs method.Evaluations show that our approach achieves an F-measure 7.04% higher than the state-of-the-art methods.

  15. NPP unusual events: data, analysis and application

    International Nuclear Information System (INIS)

    Tolstykh, V.

    1990-01-01

    Subject of the paper are the IAEA cooperative patterns of unusual events data treatment and utilization of the operating safety experience feedback. The Incident Reporting System (IRS) and the Analysis of Safety Significant Event Team (ASSET) are discussed. The IRS methodology in collection, handling, assessment and dissemination of data on NPP unusual events (deviations, incidents and accidents) occurring during operations, surveillance and maintenance is outlined by the reports gathering and issuing practice, the experts assessment procedures and the parameters of the system. After 7 years of existence the IAEA-IRS contains over 1000 reports and receives 1.5-4% of the total information on unusual events. The author considers the reports only as detailed technical 'records' of events requiring assessment. The ASSET approaches implying an in-depth occurrences analysis directed towards level-1 PSA utilization are commented on. The experts evaluated root causes for the reported events and some trends are presented. Generally, internal events due to unexpected paths of water in the nuclear installations, occurrences related to the integrity of the primary heat transport systems, events associated with the engineered safety systems and events involving human factor represent the large groups deserving close attention. Personal recommendations on how to use the events related information use for NPP safety improvement are given. 2 tabs (R.Ts)

  16. Use of wireless sensor networks for distributed event detection in disaster management applications

    NARCIS (Netherlands)

    Bahrepour, M.; Meratnia, Nirvana; Poel, Mannes; Taghikhaki, Zahra; Havinga, Paul J.M.

    Recently, wireless sensor networks (WSNs) have become mature enough to go beyond being simple fine-grained continuous monitoring platforms and have become one of the enabling technologies for early-warning disaster systems. Event detection functionality of WSNs can be of great help and importance

  17. The safety of influenza vaccines in children: An Institute for Vaccine Safety white paper.

    Science.gov (United States)

    Halsey, Neal A; Talaat, Kawsar R; Greenbaum, Adena; Mensah, Eric; Dudley, Matthew Z; Proveaux, Tina; Salmon, Daniel A

    2015-12-30

    Most influenza vaccines are generally safe, but influenza vaccines can cause rare serious adverse events. Some adverse events, such as fever and febrile seizures, are more common in children than adults. There can be differences in the safety of vaccines in different populations due to underlying differences in genetic predisposition to the adverse event. Live attenuated vaccines have not been studied adequately in children under 2 years of age to determine the risks of adverse events; more studies are needed to address this and several other priority safety issues with all influenza vaccines in children. All vaccines intended for use in children require safety testing in the target age group, especially in young children. Safety of one influenza vaccine in children should not be extrapolated to assumed safety of all influenza vaccines in children. The low rates of adverse events from influenza vaccines should not be a deterrent to the use of influenza vaccines because of the overwhelming evidence of the burden of disease due to influenza in children. Copyright © 2016. Published by Elsevier Ltd.

  18. Time Based Workload Analysis Method for Safety-Related Operator Actions in Safety Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yun Goo; Oh, Eung Se [Korea Hydro and Nuclear Power Co., Daejeon (Korea, Republic of)

    2016-05-15

    During the design basis event, the safety system performs safety functions to mitigate the event. The most of safety system is actuated by automatic system however, there are operator manual actions that are needed for the plant safety. These operator actions are classified as important human actions in human factors engineering design. The human factors engineering analysis and evaluation is needed for these important human actions to assure that operator successfully perform their tasks for plant safety and operational goals. The work load analysis is one of the required analysis for the important human actions.

  19. Time Based Workload Analysis Method for Safety-Related Operator Actions in Safety Analysis

    International Nuclear Information System (INIS)

    Kim, Yun Goo; Oh, Eung Se

    2016-01-01

    During the design basis event, the safety system performs safety functions to mitigate the event. The most of safety system is actuated by automatic system however, there are operator manual actions that are needed for the plant safety. These operator actions are classified as important human actions in human factors engineering design. The human factors engineering analysis and evaluation is needed for these important human actions to assure that operator successfully perform their tasks for plant safety and operational goals. The work load analysis is one of the required analysis for the important human actions.

  20. Mandatory Rest Stops Improve Athlete Safety during Event Medical Coverage for Ultramarathons.

    Science.gov (United States)

    Joslin, Jeremy; Mularella, Joshua; Bail, Allison; Wojcik, Susan; Cooney, Derek R

    2016-02-01

    Provisions of medical direction and clinical services for ultramarathons require specific attention to heat illness. Heat stress can affect athlete performance negatively, and heat accumulation without acclimatization is associated with the development of exertional heat stroke (EHS). In order to potentially mitigate the risk of this safety concern, the Jungle Marathon (Para, Brazil) instituted mandatory rest periods during the first two days of this 7-day, staged, Brazilian ultramarathon. Race records were reviewed retrospectively to determine the number of runners that suffered an emergency medical complication related to heat stress and did not finish (DNF) the race. Review of records included three years before and three years after the institution of these mandatory rest periods. A total of 326 runners competed in the Jungle Marathon during the 2008-2013 period of study. During the pre-intervention years, a total of 46 athletes (21%) DNF the full race with 25 (54.3%) cases attributed to heat-related factors. During the post-intervention years, a total of 26 athletes (24.3%) DNF the full race with four (15.4%) cases attributed to heat-related factors. Mandatory rest stops during extreme running events in hot or tropical environments, like the Jungle Marathon, are likely to improve athlete safety and improve the heat acclimatization process.

  1. Integrated hydraulic and organophosphate pesticide injection simulations for enhancing event detection in water distribution systems.

    Science.gov (United States)

    Schwartz, Rafi; Lahav, Ori; Ostfeld, Avi

    2014-10-15

    As a complementary step towards solving the general event detection problem of water distribution systems, injection of the organophosphate pesticides, chlorpyrifos (CP) and parathion (PA), were simulated at various locations within example networks and hydraulic parameters were calculated over 24-h duration. The uniqueness of this study is that the chemical reactions and byproducts of the contaminants' oxidation were also simulated, as well as other indicative water quality parameters such as alkalinity, acidity, pH and the total concentration of free chlorine species. The information on the change in water quality parameters induced by the contaminant injection may facilitate on-line detection of an actual event involving this specific substance and pave the way to development of a generic methodology for detecting events involving introduction of pesticides into water distribution systems. Simulation of the contaminant injection was performed at several nodes within two different networks. For each injection, concentrations of the relevant contaminants' mother and daughter species, free chlorine species and water quality parameters, were simulated at nodes downstream of the injection location. The results indicate that injection of these substances can be detected at certain conditions by a very rapid drop in Cl2, functioning as the indicative parameter, as well as a drop in alkalinity concentration and a small decrease in pH, both functioning as supporting parameters, whose usage may reduce false positive alarms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. 123I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

    International Nuclear Information System (INIS)

    Horiguchi, Yoriko; Morita, Yukiko; Tsurikisawa, Naomi; Akiyama, Kazuo

    2011-01-01

    In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether 123 I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. 123 I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using 123 I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M ≤ 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP ≤ 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. 123 I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

  3. 76 FR 53337 - Special Local Regulation and Safety Zones; Marine Events in Captain of the Port Long Island Sound...

    Science.gov (United States)

    2011-08-26

    ... Fireworks and Spincola Wedding Fireworks stated their events are held in conjunction with birth dates... Business Regulatory Fairness Boards. The Ombudsman evaluates these actions annually and rates each agency's... Environmental Health Risks and Safety Risks. This rule is not an economically significant rule and does not...

  4. RELAP5/MOD3.3 Analysis of the Loss of External Power Event with Safety Injection Actuation

    Directory of Open Access Journals (Sweden)

    Andrej Prošek

    2018-01-01

    Full Text Available The code assessment typically comprises basic tests cases, separate effects test, and integral effects tests. On the other hand, the thermal hydraulic system codes like RELAP5/MOD3.3 are primarily intended for simulation of transients and accidents in light water reactors. The plant measured data come mostly from startup tests and operational events. Also, for operational events the measured plant data may not be sufficient to explain all details of the event. The purpose of this study was therefore besides code assessment to demonstrate that simulations can be very beneficial for deep understanding of the plant response and further corrective measures. The abnormal event with reactor trip and safety injection signal actuation was simulated with the latest RELAP5/MOD3.3 Patch 05 best-estimate thermal hydraulic computer code. The measured and simulated data agree well considering the major plant system responses and operator actions. This suggests that the RELAP5 code simulation is good representative of the plant response and can complement not available information from plant measured data. In such a way, an event can be better understood.

  5. A semi-automated method for rapid detection of ripple events on interictal voltage discharges in the scalp electroencephalogram.

    Science.gov (United States)

    Chu, Catherine J; Chan, Arthur; Song, Dan; Staley, Kevin J; Stufflebeam, Steven M; Kramer, Mark A

    2017-02-01

    High frequency oscillations are emerging as a clinically important indicator of epileptic networks. However, manual detection of these high frequency oscillations is difficult, time consuming, and subjective, especially in the scalp EEG, thus hindering further clinical exploration and application. Semi-automated detection methods augment manual detection by reducing inspection to a subset of time intervals. We propose a new method to detect high frequency oscillations that co-occur with interictal epileptiform discharges. The new method proceeds in two steps. The first step identifies candidate time intervals during which high frequency activity is increased. The second step computes a set of seven features for each candidate interval. These features require that the candidate event contain a high frequency oscillation approximately sinusoidal in shape, with at least three cycles, that co-occurs with a large amplitude discharge. Candidate events that satisfy these features are stored for validation through visual analysis. We evaluate the detector performance in simulation and on ten examples of scalp EEG data, and show that the proposed method successfully detects spike-ripple events, with high positive predictive value, low false positive rate, and high intra-rater reliability. The proposed method is less sensitive than the existing method of visual inspection, but much faster and much more reliable. Accurate and rapid detection of high frequency activity increases the clinical viability of this rhythmic biomarker of epilepsy. The proposed spike-ripple detector rapidly identifies candidate spike-ripple events, thus making clinical analysis of prolonged, multielectrode scalp EEG recordings tractable. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. SENTINEL EVENTS

    Directory of Open Access Journals (Sweden)

    Andrej Robida

    2004-09-01

    Full Text Available Background. The Objective of the article is a two year statistics on sentinel events in hospitals. Results of a survey on sentinel events and the attitude of hospital leaders and staff are also included. Some recommendations regarding patient safety and the handling of sentinel events are given.Methods. In March 2002 the Ministry of Health introduce a voluntary reporting system on sentinel events in Slovenian hospitals. Sentinel events were analyzed according to the place the event, its content, and root causes. To show results of the first year, a conference for hospital directors and medical directors was organized. A survey was conducted among the participants with the purpose of gathering information about their view on sentinel events. One hundred questionnaires were distributed.Results. Sentinel events. There were 14 reports of sentinel events in the first year and 7 in the second. In 4 cases reports were received only after written reminders were sent to the responsible persons, in one case no reports were obtained. There were 14 deaths, 5 of these were in-hospital suicides, 6 were due to an adverse event, 3 were unexplained. Events not leading to death were a suicide attempt, a wrong side surgery, a paraplegia after spinal anaesthesia, a fall with a femoral neck fracture, a damage of the spleen in the event of pleural space drainage, inadvertent embolization with absolute alcohol into a femoral artery and a physical attack on a physician by a patient. Analysis of root causes of sentinel events showed that in most cases processes were inadequate.Survey. One quarter of those surveyed did not know about the sentinel events reporting system. 16% were having actual problems when reporting events and 47% beleived that there was an attempt to blame individuals. Obstacles in reporting events openly were fear of consequences, moral shame, fear of public disclosure of names of participants in the event and exposure in mass media. The majority of

  7. Potential safety-related incidents with possible applicability to a nuclear fuel reprocessing plant

    International Nuclear Information System (INIS)

    Perkins, W.C.; Durant, W.S.; Dexter, A.H.

    1980-12-01

    The occurrence of certain potential events in nuclear fuel reprocessing plants could lead to significant consequences involving risk to operating personnel or to the general public. This document is a compilation of such potential initiating events in nuclear fuel reprocessing plants. Possible general incidents and incidents specific to key operations in fuel reprocessing are considered, including possible causes, consequences, and safety features designed to prevent, detect, or mitigate such incidents

  8. Balloon-Borne Infrasound Detection of Energetic Bolide Events

    Science.gov (United States)

    Young, Eliot F.; Ballard, Courtney; Klein, Viliam; Bowman, Daniel; Boslough, Mark

    2016-10-01

    Infrasound is usually defined as sound waves below 20 Hz, the nominal limit of human hearing. Infrasound waves propagate over vast distances through the Earth's atmosphere: the CTBTO (Comprehensive Nuclear-Test-Ban Treaty Organization) has 48 installed infrasound-sensing stations around the world to detect nuclear detonations and other disturbances. In February 2013, several CTBTO infrasound stations detected infrasound signals from a large bolide that exploded over Chelyabinsk, Russia. Some stations recorded signals that had circumnavigated the Earth, over a day after the original event. The goal of this project is to improve upon the sensitivity of the CTBTO network by putting microphones on small, long-duration super-pressure balloons, with the overarching goal of studying the small end of the NEO population by using the Earth's atmosphere as a witness plate.A balloon-borne infrasound sensor is expected to have two advantages over ground-based stations: a lack of wind noise and a concentration of infrasound energy in the "stratospheric duct" between roughly 5 - 50 km altitude. To test these advantages, we have built a small balloon payload with five calibrated microphones. We plan to fly this payload on a NASA high-altitude balloon from Ft Sumner, NM in August 2016. We have arranged for three large explosions to take place in Socorro, NM while the balloon is aloft to assess the sensitivity of balloon-borne vs. ground-based infrasound sensors. We will report on the results from this test flight and the prospects for detecting/characterizing small bolides in the stratosphere.

  9. A Study of Time Response for Safety-Related Operator Actions in Non-LOCA Safety Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Min Seok; Lee, Sang Seob; Park, Min Soo; Lee, Gyu Cheon; Kim, Shin Whan [KEPCO E and C Company, Daejeon (Korea, Republic of)

    2014-10-15

    The classification of initiating events for safety analysis report (SAR) chapter 15 is categorized into moderate frequency events (MF), infrequent events (IF), and limiting faults (LF) depending on the frequency of its occurrence. For the non-LOCA safety analysis with the purpose to get construction or operation license, however, it is assumed that the operator response action to mitigate the events starts at 30 minutes after the initiation of the transient regardless of the event categorization. Such an assumption of corresponding operator response time may have over conservatism with the MF and IF events and results in a decrease in the safety margin compared to its acceptance criteria. In this paper, the plant conditions (PC) are categorized with the definitions in SAR 15 and ANS 51.1. Then, the consequence of response for safety-related operator action time is determined based on the PC in ANSI 58.8. The operator response time for safety analysis regarding PC are reviewed and suggested. The clarifying alarm response procedure would be required for the guideline to reduce the operator response time when the alarms indicate the occurrence of the transient.

  10. Unified framework for triaxial accelerometer-based fall event detection and classification using cumulants and hierarchical decision tree classifier.

    Science.gov (United States)

    Kambhampati, Satya Samyukta; Singh, Vishal; Manikandan, M Sabarimalai; Ramkumar, Barathram

    2015-08-01

    In this Letter, the authors present a unified framework for fall event detection and classification using the cumulants extracted from the acceleration (ACC) signals acquired using a single waist-mounted triaxial accelerometer. The main objective of this Letter is to find suitable representative cumulants and classifiers in effectively detecting and classifying different types of fall and non-fall events. It was discovered that the first level of the proposed hierarchical decision tree algorithm implements fall detection using fifth-order cumulants and support vector machine (SVM) classifier. In the second level, the fall event classification algorithm uses the fifth-order cumulants and SVM. Finally, human activity classification is performed using the second-order cumulants and SVM. The detection and classification results are compared with those of the decision tree, naive Bayes, multilayer perceptron and SVM classifiers with different types of time-domain features including the second-, third-, fourth- and fifth-order cumulants and the signal magnitude vector and signal magnitude area. The experimental results demonstrate that the second- and fifth-order cumulant features and SVM classifier can achieve optimal detection and classification rates of above 95%, as well as the lowest false alarm rate of 1.03%.

  11. Achieving world's highest level of nuclear safety learning from overseas nuclear trouble events

    International Nuclear Information System (INIS)

    Okumoto, Masaru

    2014-01-01

    Nuclear Information Research Project of Institute of Nuclear Safety System, Incorporated (INSS) had acquired trouble information of nuclear power plants (NPPs) up to annual several thousand events issued by overseas regulatory agencies for more than 20 years since INSS established and analyzed it in details respectively after the screening. Lessons extracted from the analysis were offered as suggestions to electric utilities having PWRs in Japan. Such activities would surely contribute to maintain and improve nuclear safety with no objection. However, they could not prevent the occurrence of accident of Fukushima Daiichi NPPs. Thus the project had reviewed usefulness of past activities and how improved could be by listening sincerely to outside opinions. This report introduced outlines of recent activities. Competent suggestions to electric utilities might be made with improved reflection of lessons to needed rules, deepened information sharing within the project and raised awareness of the problem. (T. Tanaka)

  12. Dynamic event Tress applied to sequences Full Spectrum LOCA. Calculating the frequency of excedeence of damage by integrated Safety Analysis Methodology

    International Nuclear Information System (INIS)

    Gomez-Magan, J. J.; Fernandez, I.; Gil, J.; Marrao, H.; Queral, C.; Gonzalez-Cadelo, J.; Montero-Mayorga, J.; Rivas, J.; Ibane-Llano, C.; Izquierdo, J. M.; Sanchez-Perea, M.; Melendez, E.; Hortal, J.

    2013-01-01

    The Integrated Safety Analysis (ISA) methodology, developed by the Spanish Nuclear Safety council (CSN), has been applied to obtain the dynamic Event Trees (DETs) for full spectrum Loss of Coolant Accidents (LOCAs) of a Westinghouse 3-loop PWR plant. The purpose of this ISA application is to obtain the Damage Excedence Frequency (DEF) for the LOCA Event Tree by taking into account the uncertainties in the break area and the operator actuation time needed to cool down and de pressurize reactor coolant system by means of steam generator. Simulations are performed with SCAIS, a software tool which includes a dynamic coupling with MAAP thermal hydraulic code. The results show the capability of the ISA methodology to obtain the DEF taking into account the time uncertainty in human actions. (Author)

  13. Detection of Healthcare-Related Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Transmission Events Using Combined Genetic and Phenotypic Epidemiology.

    Directory of Open Access Journals (Sweden)

    Anne F Voor In 't Holt

    Full Text Available Since the year 2000 there has been a sharp increase in the prevalence of healthcare-related infections caused by extended-spectrum beta-lactamase (ESBL-producing Escherichia coli. However, the high community prevalence of ESBL-producing E. coli isolates means that many E. coli typing techniques may not be suitable for detecting E. coli transmission events. Therefore, we investigated if High-throughput MultiLocus Sequence Typing (HiMLST and/or Raman spectroscopy were suitable techniques for detecting recent E. coli transmission events.This study was conducted from January until December 2010 at Erasmus University Medical Center, Rotterdam, the Netherlands. Isolates were typed using HiMLST and Raman spectroscopy. A genetic cluster was defined as two or more patients carrying identical isolates. We used predefined definitions for epidemiological relatedness to assess healthcare-related transmission.We included 194 patients; strains of 112 patients were typed using HiMLST and strains of 194 patients were typed using Raman spectroscopy. Raman spectroscopy identified 16 clusters while HiMLST identified 10 clusters. However, no healthcare-related transmission events were detected. When combining data from both typing techniques, we identified eight clusters (n = 34 patients, as well as 78 patients with a non-cluster isolate. However, we could not detect any healthcare-related transmission in these 8 clusters.Although clusters were genetically detected using HiMLST and Raman spectroscopy, no definite epidemiological relationships could be demonstrated which makes the possibility of healthcare-related transmission events highly unlikely. Our results suggest that typing of ESBL-producing E. coli using HiMLST and/or Raman spectroscopy is not helpful in detecting E. coli healthcare-related transmission events.

  14. Assessing propensity to learn from safety-related events

    NARCIS (Netherlands)

    Drupsteen, L.; Wybo, J.L.

    2015-01-01

    Most organisations aim to use experience from the past to improve safety, for instance through learning from safety-related incidents and accidents. Whether an organisation is able to learn successfully can however only be determined afterwards. So far, there are no proactive measures to assess

  15. Optimized Swinging Door Algorithm for Wind Power Ramp Event Detection: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Mingjian; Zhang, Jie; Florita, Anthony R.; Hodge, Bri-Mathias; Ke, Deping; Sun, Yuanzhang

    2015-08-06

    Significant wind power ramp events (WPREs) are those that influence the integration of wind power, and they are a concern to the continued reliable operation of the power grid. As wind power penetration has increased in recent years, so has the importance of wind power ramps. In this paper, an optimized swinging door algorithm (SDA) is developed to improve ramp detection performance. Wind power time series data are segmented by the original SDA, and then all significant ramps are detected and merged through a dynamic programming algorithm. An application of the optimized SDA is provided to ascertain the optimal parameter of the original SDA. Measured wind power data from the Electric Reliability Council of Texas (ERCOT) are used to evaluate the proposed optimized SDA.

  16. The Blayais event

    International Nuclear Information System (INIS)

    2000-01-01

    This document provides the main events occurred to the Blayais installation during the year 2000. For each events, the detailed chronology, the situation analysis, the crisis management and the public information are provided. Some recommendations are also provided by the nuclear safety authorities. (A.L.B.)

  17. Safety of nuclear power plants: Design. Safety requirements

    International Nuclear Information System (INIS)

    2000-01-01

    other reactor types, including innovative developments in future systems, some of the requirements may not be applicable, or may need some judgment in their interpretation. Various Safety Guides will provide guidance in the interpretation and implementation of these requirements. This publication is intended for use by organizations designing, manufacturing, constructing and operating nuclear power plants as well as by regulatory bodies. This publication establishes design requirements for structures, systems and components important to safety that must be met for safe operation of a nuclear power plant, and for preventing or mitigating the consequences of events that could jeopardize safety. It also establishes requirements for a comprehensive safety assessment, which is carried out in order to identify the potential hazards that may arise from the operation of the plant, under the various plant states (operational states and accident conditions). The safety assessment process includes the complementary techniques of deterministic safety analysis and probabilistic safety analysis. These analyses necessitate consideration of postulated initiating events (PlEs), which include many factors that, singly or in combination, may affect safety and which may: originate in the operation of the nuclear power plant itself; be caused by human action; be directly related to the nuclear power plant and its environment. This publication also addresses events that are very unlikely to occur, such as severe accidents that may result in major radioactive releases, and for which it may be appropriate and practicable to provide preventive or mitigatory features in the design. This publication does not address: external natural or human induced events that are extremely unlikely (such as the impact of a meteorite or an artificial satellite); conventional industrial accidents that under no circumstances could affect the safety of the nuclear power plant; or non-radiological effects arising

  18. Safety of nuclear power plants: Design. Safety requirements

    International Nuclear Information System (INIS)

    2004-01-01

    other reactor types, including innovative developments in future systems, some of the requirements may not be applicable, or may need some judgment in their interpretation. Various Safety Guides will provide guidance in the interpretation and implementation of these requirements. This publication is intended for use by organizations designing, manufacturing, constructing and operating nuclear power plants as well as by regulatory bodies. This publication establishes design requirements for structures, systems and components important to safety that must be met for safe operation of a nuclear power plant, and for preventing or mitigating the consequences of events that could jeopardize safety. It also establishes requirements for a comprehensive safety assessment, which is carried out in order to identify the potential hazards that may arise from the operation of the plant, under the various plant states (operational states and accident conditions). The safety assessment process includes the complementary techniques of deterministic safety analysis and probabilistic safety analysis. These analyses necessitate consideration of postulated initiating events (PlEs), which include many factors that, singly or in combination, may affect safety and which may: originate in the operation of the nuclear power plant itself. Be caused by human action. Be directly related to the nuclear power plant and its environment. This publication also addresses events that are very unlikely to occur, such as severe accidents that may result in major radioactive releases, and for which it may be appropriate and practicable to provide preventive or mitigatory features in the design. This publication does not address: external natural or human induced events that are extremely unlikely (such as the impact of a meteorite or an artificial satellite). Conventional industrial accidents that under no circumstances could affect the safety of the nuclear power plant. Or non-radiological effects arising

  19. Analysis of external events - Nuclear Power Plant Dukovany

    International Nuclear Information System (INIS)

    Hladky, Milan

    2000-01-01

    PSA of external events at level 1 covers internal events, floods, fires, other external events are not included yet. Shutdown PSA takes into account internal events, floods, fires, heavy load drop, other external events are not included yet. Final safety analysis report was conducted after 10 years of operation for all Dukovany operational units. Probabilistic approach was used for analysis of aircraft drop and external man-induced events. The risk caused by man-induced events was found to be negligible and was accepted by State Office for Nuclear Safety (SONS)

  20. Effects of auditing patient safety in hospital care: design of a mixed-method evaluation

    OpenAIRE

    Hanskamp-Sebregts, M.E.; Zegers, M.; Boeijen, W.M.J.; Westert, G.P.; Gurp, P.J.M. van; Wollersheim, H.C.

    2013-01-01

    BACKGROUND: Auditing of patient safety aims at early detection of risks of adverse events and is intended to encourage the continuous improvement of patient safety. The auditing should be an independent, objective assurance and consulting system. Auditing helps an organisation accomplish its objectives by bringing a systematic, disciplined approach to evaluating and improving the effectiveness of risk management, control, and governance. Audits are broadly conducted in hospitals, but little i...

  1. Architecture Level Safety Analyses for Safety-Critical Systems

    Directory of Open Access Journals (Sweden)

    K. S. Kushal

    2017-01-01

    Full Text Available The dependency of complex embedded Safety-Critical Systems across Avionics and Aerospace domains on their underlying software and hardware components has gradually increased with progression in time. Such application domain systems are developed based on a complex integrated architecture, which is modular in nature. Engineering practices assured with system safety standards to manage the failure, faulty, and unsafe operational conditions are very much necessary. System safety analyses involve the analysis of complex software architecture of the system, a major aspect in leading to fatal consequences in the behaviour of Safety-Critical Systems, and provide high reliability and dependability factors during their development. In this paper, we propose an architecture fault modeling and the safety analyses approach that will aid in identifying and eliminating the design flaws. The formal foundations of SAE Architecture Analysis & Design Language (AADL augmented with the Error Model Annex (EMV are discussed. The fault propagation, failure behaviour, and the composite behaviour of the design flaws/failures are considered for architecture safety analysis. The illustration of the proposed approach is validated by implementing the Speed Control Unit of Power-Boat Autopilot (PBA system. The Error Model Annex (EMV is guided with the pattern of consideration and inclusion of probable failure scenarios and propagation of fault conditions in the Speed Control Unit of Power-Boat Autopilot (PBA. This helps in validating the system architecture with the detection of the error event in the model and its impact in the operational environment. This also provides an insight of the certification impact that these exceptional conditions pose at various criticality levels and design assurance levels and its implications in verifying and validating the designs.

  2. Guide to the declaration procedure and coding system for criteria concerning significant events related to safety, radiation protection or the environment, applicable to basic nuclear installations and the transport of radioactive materials

    International Nuclear Information System (INIS)

    Lacoste, Andre-Claude

    2005-01-01

    This guide notably contains various forms associated with the declaration of significant events, and explanations to fill them in: significant event declaration form for a basic nuclear installation, significant event declaration form for radioactive material transport, significant event report for a basic nuclear installation, significant event report for radioactive material transport, declaration criteria for significant events related to the safety of non-PWR basic nuclear installations, declaration criteria for significant events related to PWR safety, significant events declared further to events resulting in group 1 unavailability and non-compliance with technical operating specifications, declaration criteria for significant events concerning radiation protection for basic nuclear installations, declaration criteria for significant events concerning environmental protection, applicable to basic nuclear installations, and declaration criteria for significant events concerning radioactive material transport

  3. ITER plasma safety interface models and assessments

    International Nuclear Information System (INIS)

    Uckan, N.A.; Bartels, H-W.; Honda, T.; Amano, T.; Boucher, D.; Post, D.; Wesley, J.

    1996-01-01

    Physics models and requirements to be used as a basis for safety analysis studies are developed and physics results motivated by safety considerations are presented for the ITER design. Physics specifications are provided for enveloping plasma dynamic events for Category I (operational event), Category II (likely event), and Category III (unlikely event). A safety analysis code SAFALY has been developed to investigate plasma anomaly events. The plasma response to ex-vessel component failure and machine response to plasma transients are considered

  4. Ventilator-Related Adverse Events: A Taxonomy and Findings From 3 Incident Reporting Systems.

    Science.gov (United States)

    Pham, Julius Cuong; Williams, Tamara L; Sparnon, Erin M; Cillie, Tam K; Scharen, Hilda F; Marella, William M

    2016-05-01

    In 2009, researchers from Johns Hopkins University's Armstrong Institute for Patient Safety and Quality; public agencies, including the FDA; and private partners, including the Emergency Care Research Institute and the University HealthSystem Consortium (UHC) Safety Intelligence Patient Safety Organization, sought to form a public-private partnership for the promotion of patient safety (P5S) to advance patient safety through voluntary partnerships. The study objective was to test the concept of the P5S to advance our understanding of safety issues related to ventilator events, to develop a common classification system for categorizing adverse events related to mechanical ventilators, and to perform a comparison of adverse events across different adverse event reporting systems. We performed a cross-sectional analysis of ventilator-related adverse events reported in 2012 from the following incident reporting systems: the Pennsylvania Patient Safety Authority's Patient Safety Reporting System, UHC's Safety Intelligence Patient Safety Organization database, and the FDA's Manufacturer and User Facility Device Experience database. Once each organization had its dataset of ventilator-related adverse events, reviewers read the narrative descriptions of each event and classified it according to the developed common taxonomy. A Pennsylvania Patient Safety Authority, FDA, and UHC search provided 252, 274, and 700 relevant reports, respectively. The 3 event types most commonly reported to the UHC and the Pennsylvania Patient Safety Authority's Patient Safety Reporting System databases were airway/breathing circuit issue, human factor issues, and ventilator malfunction events. The top 3 event types reported to the FDA were ventilator malfunction, power source issue, and alarm failure. Overall, we found that (1) through the development of a common taxonomy, adverse events from 3 reporting systems can be evaluated, (2) the types of events reported in each database were related

  5. Ventilator-Related Adverse Events: A Taxonomy and Findings From 3 Incident Reporting Systems

    Science.gov (United States)

    Pham, Julius Cuong; Williams, Tamara L; Sparnon, Erin M; Cillie, Tam K; Scharen, Hilda F; Marella, William M

    2016-01-01

    BACKGROUND: In 2009, researchers from Johns Hopkins University's Armstrong Institute for Patient Safety and Quality; public agencies, including the FDA; and private partners, including the Emergency Care Research Institute and the University HealthSystem Consortium (UHC) Safety Intelligence Patient Safety Organization, sought to form a public-private partnership for the promotion of patient safety (P5S) to advance patient safety through voluntary partnerships. The study objective was to test the concept of the P5S to advance our understanding of safety issues related to ventilator events, to develop a common classification system for categorizing adverse events related to mechanical ventilators, and to perform a comparison of adverse events across different adverse event reporting systems. METHODS: We performed a cross-sectional analysis of ventilator-related adverse events reported in 2012 from the following incident reporting systems: the Pennsylvania Patient Safety Authority's Patient Safety Reporting System, UHC's Safety Intelligence Patient Safety Organization database, and the FDA's Manufacturer and User Facility Device Experience database. Once each organization had its dataset of ventilator-related adverse events, reviewers read the narrative descriptions of each event and classified it according to the developed common taxonomy. RESULTS: A Pennsylvania Patient Safety Authority, FDA, and UHC search provided 252, 274, and 700 relevant reports, respectively. The 3 event types most commonly reported to the UHC and the Pennsylvania Patient Safety Authority's Patient Safety Reporting System databases were airway/breathing circuit issue, human factor issues, and ventilator malfunction events. The top 3 event types reported to the FDA were ventilator malfunction, power source issue, and alarm failure. CONCLUSIONS: Overall, we found that (1) through the development of a common taxonomy, adverse events from 3 reporting systems can be evaluated, (2) the types of

  6. Safety goals and safety culture opening plenary. 1. WANO's Role in Maintaining and Improving Safety Culture

    International Nuclear Information System (INIS)

    Tsutsumi, Ryosuke

    2001-01-01

    Over the past several years, operators of the world's nuclear plants have compiled an increasingly impressive record of operational performance. Among the many factors that have led to this improvement are the unprecedented cooperation and information exchange among the world's nuclear operators. This paper presents the World Association of Nuclear Operators (WANO) operating experience program and WANO peer review program as examples of the kinds of interaction that are occurring around the globe to maintain and improve the nuclear safety culture. In addition, some unique features of WANO are discussed. WANO has established four programs to help its members communicate effectively with each other. These include the exchange of operating experiences, voluntary peer reviews, professional and technical development, and technical support and exchange. The operating experience program alerts members to events that have occurred at other NPPs and enables members to take appropriate actions to prevent event recurrence. When an event occurs at a plant, management at that plant analyses the event and completes an event report, which is then sent to the WANO regional center to which the plant belongs. After a regional center review and necessary iteration, the report is posted onto the WANO Web site to make it available to all WANO members. By the end of 2000, more than 1500 event reports had been posted. The WANO Peer Review Program is a unique opportunity for members to learn and share the best worldwide insights into safe and reliable nuclear operations. The peer review program has become one of WANO's most important activities containing all essential elements of WANO's mission. A WANO peer review team consists of 15 to 16 people with NPP experience; most team members are from countries outside the one that they are visiting. These teams of peers from plants around the world visit host plants upon request to identify strengths and areas for improvement, with a strong

  7. Vision-based fall detection system for improving safety of elderly people

    KAUST Repository

    Harrou, Fouzi; Zerrouki, Nabil; Sun, Ying; Houacine, Amrane

    2017-01-01

    Recognition of human movements is very useful for several applications, such as smart rooms, interactive virtual reality systems, human detection and environment modeling. The objective of this work focuses on the detection and classification of falls based on variations in human silhouette shape, a key challenge in computer vision. Falls are a major health concern, specifically for the elderly. In this study, the detection is achieved with a multivariate exponentially weighted moving average (MEWMA) monitoring scheme, which is effective in detecting falls because it is sensitive to small changes. Unfortunately, an MEWMA statistic fails to differentiate real falls from some fall-like gestures. To remedy this limitation, a classification stage based on a support vector machine (SVM) is applied on detected sequences. To validate this methodology, two fall detection datasets have been tested: the University of Rzeszow fall detection dataset (URFD) and the fall detection dataset (FDD). The results of the MEWMA-based SVM are compared with three other classifiers: neural network (NN), naïve Bayes and K-nearest neighbor (KNN). These results show the capability of the developed strategy to distinguish fall events, suggesting that it can raise an early alert in the fall incidents.

  8. Vision-based fall detection system for improving safety of elderly people

    KAUST Repository

    Harrou, Fouzi

    2017-12-06

    Recognition of human movements is very useful for several applications, such as smart rooms, interactive virtual reality systems, human detection and environment modeling. The objective of this work focuses on the detection and classification of falls based on variations in human silhouette shape, a key challenge in computer vision. Falls are a major health concern, specifically for the elderly. In this study, the detection is achieved with a multivariate exponentially weighted moving average (MEWMA) monitoring scheme, which is effective in detecting falls because it is sensitive to small changes. Unfortunately, an MEWMA statistic fails to differentiate real falls from some fall-like gestures. To remedy this limitation, a classification stage based on a support vector machine (SVM) is applied on detected sequences. To validate this methodology, two fall detection datasets have been tested: the University of Rzeszow fall detection dataset (URFD) and the fall detection dataset (FDD). The results of the MEWMA-based SVM are compared with three other classifiers: neural network (NN), naïve Bayes and K-nearest neighbor (KNN). These results show the capability of the developed strategy to distinguish fall events, suggesting that it can raise an early alert in the fall incidents.

  9. [Out of hospital emergencies towards a safety culture].

    Science.gov (United States)

    Cano-del Pozo, M I; Obón-Azuara, B; Valderrama-Rodríguez, M; Revilla-López, C; Brosed-Yuste, C; Fajardo-Trasobares, E; Garcés-Baquero, P; Mateo-Clavería, J; Molina-Estrada, I; Perona-Flores, N; Salcedo-de Dios, S; Tomé-Rey, A

    2014-01-01

    The aim of this study is to measure the degree of safety culture (CS) among healthcare professional workers of an out-of-hospital Emergency Medical Service. Most patient safety studies have been conducted in relation to the hospital rather than pre-hospital Emergency Medical Services. The objective is to analyze the dimensions with lower scores in order to plan futures strategies. A descriptive study using the AHRQ (Agency for Healthcare Research and Quality) questionnaire. The questionnaire was delivered to all healthcare professionals workers of 061 Advanced Life Support Units of Aragón, during the month of August 2013. The response rate was 55%. Main strengths detected: an adequate number of staff (96%), good working conditions (89%), tasks supported from immediate superior (77%), teamwork climate (74%), and non-punitive environment to report adverse events (68%). Areas for improvement: insufficient training in patient safety (53%) and lack of feedback of incidents reported (50%). The opportunities for improvement identified focus on the training of professionals in order to ensure safer care, while extending the safety culture. Also, the implementation of a system of notification and registration of adverse events in the service is deemed necessary. Copyright © 2014 SECA. Published by Elsevier Espana. All rights reserved.

  10. [Comparison of the "Trigger" tool with the minimum basic data set for detecting adverse events in general surgery].

    Science.gov (United States)

    Pérez Zapata, A I; Gutiérrez Samaniego, M; Rodríguez Cuéllar, E; Gómez de la Cámara, A; Ruiz López, P

    Surgery is a high risk for the occurrence of adverse events (AE). The main objective of this study is to compare the effectiveness of the Trigger tool with the Hospital National Health System registration of Discharges, the minimum basic data set (MBDS), in detecting adverse events in patients admitted to General Surgery and undergoing surgery. Observational and descriptive retrospective study of patients admitted to general surgery of a tertiary hospital, and undergoing surgery in 2012. The identification of adverse events was made by reviewing the medical records, using an adaptation of "Global Trigger Tool" methodology, as well as the (MBDS) registered on the same patients. Once the AE were identified, they were classified according to damage and to the extent to which these could have been avoided. The area under the curve (ROC) were used to determine the discriminatory power of the tools. The Hanley and Mcneil test was used to compare both tools. AE prevalence was 36.8%. The TT detected 89.9% of all AE, while the MBDS detected 28.48%. The TT provides more information on the nature and characteristics of the AE. The area under the curve was 0.89 for the TT and 0.66 for the MBDS. These differences were statistically significant (P<.001). The Trigger tool detects three times more adverse events than the MBDS registry. The prevalence of adverse events in General Surgery is higher than that estimated in other studies. Copyright © 2017 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Active SMS-based influenza vaccine safety surveillance in Australian children.

    Science.gov (United States)

    Pillsbury, Alexis; Quinn, Helen; Cashman, Patrick; Leeb, Alan; Macartney, Kristine

    2017-12-18

    Australia's novel, active surveillance system, AusVaxSafety, monitors the post-market safety of vaccines in near real time. We analysed cumulative surveillance data for children aged 6 months to 4 years who received seasonal influenza vaccine in 2015 and/or 2016 to determine: adverse event following immunisation (AEFI) rates by vaccine brand, age and concomitant vaccine administration. Parent/carer reports of AEFI occurring within 3 days of their child receiving an influenza vaccine in sentinel immunisation clinics were solicited by Short Message Service (SMS) and/or email-based survey. Retrospective data from 2 years were combined to examine specific AEFI rates, particularly fever and medical attendance as a proxy for serious adverse events (SAE), with and without concomitant vaccine administration. As trivalent influenza vaccines (TIV) were funded in Australia's National Immunisation Program (NIP) in 2015 and quadrivalent (QIV) in 2016, respectively, we compared their safety profiles. 7402 children were included. Data were reported weekly through each vaccination season; no safety signals or excess of adverse events were detected. More children who received a concomitant vaccine had fever (7.5% versus 2.8%; p vaccine was associated with the highest increase in AEFI rates among children receiving a specified concomitant vaccine: 30.3% reported an AEFI compared with 7.3% who received an influenza vaccine alone (p safety profiles included low and expected AEFI rates (fever: 4.3% for TIV compared with 3.2% for QIV (p = .015); injection site reaction: 1.9% for TIV compared with 3.0% for QIV (p safety profile between brands. Active participant-reported data provided timely vaccine brand-specific safety information. Our surveillance system has particular utility in monitoring the safety of influenza vaccines, given that they may vary in composition annually. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Data-driven drug safety signal detection methods in pharmacovigilance using electronic primary care records: A population based study

    Directory of Open Access Journals (Sweden)

    Shang-Ming Zhou

    2017-04-01

    Data-driven analytic methods are a valuable aid to signal detection of ADEs from large electronic health records for drug safety monitoring. This study finds the methods can detect known ADE and so could potentially be used to detect unknown ADE.

  13. Building a Global Catalog of Nonvolcanic Tremor Events Using an Automatic Detection Algorithm

    Science.gov (United States)

    Bagley, B. C.; Revenaugh, J.

    2009-12-01

    Nonvolcanic tremor is characterized by a long-period seismic event containing a series of low-frequency earthquakes (LFEs). Tremor has been detected in regions of subduction (e.g. Kao et. al. 2007, 2008; Shelly 2006) and beneath the San Andreas fault near Cholame, California (e.g. Nadeau and Dolenc, 2005). In some cases tremor events seem to have periodicity, and these are often referred to as episodic tremor and slip (ETS). The origin of nonvolcanic tremor has been ascribed to shear slip along plate boundaries and/or high pore-fluid pressure. The apparent periodicity and tectonic setting associated with ETS has led to the suggestion that there may be a link between ETS and megathrust earthquakes. Until recently tremor detection has been a manual process requiring visual inspection of seismic data. In areas that have dense seismic arrays (e.g. Japan) waveform cross correlation techniques have been successfully employed (e.g. Obara, 2002). Kao et al. (2007) developed an algorithm for automatic detection of seismic tremor that can be used in regions without dense arrays. This method has been used to create the Tremor Activity Monitoring System (TAMS), which is used by the Geologic Survey of Canada to monitor northern Cascadia. So far the study of nonvolcanic tremor has been limited to regions of subduction or along major transform faults. It is unknown if tremor events occur in other tectonic settings, or if the current detection schemes will be useful for finding them. We propose to look for tremor events in non-subduction regions. It is possible that if tremor exists in other regions it will have different characteristics and may not trigger the TAMS system or be amenable to other existing detection schemes. We are developing algorithms for searching sparse array data sets for quasi-harmonic energy bursts in hopes of recognizing and cataloging nonvolcanic tremor in an expanded tectonic setting. Statistical comparisons against the TAMS algorithm will be made if

  14. Mathematical aspects of assessing extreme events for the safety of nuclear plants

    Science.gov (United States)

    Potempski, Slawomir; Borysiewicz, Mieczyslaw

    2015-04-01

    In the paper the review of mathematical methodologies applied for assessing low frequencies of rare natural events like earthquakes, tsunamis, hurricanes or tornadoes, floods (in particular flash floods and surge storms), lightning, solar flares, etc., will be given in the perspective of the safety assessment of nuclear plants. The statistical methods are usually based on the extreme value theory, which deals with the analysis of extreme deviation from the median (or the mean). In this respect application of various mathematical tools can be useful, like: the extreme value theorem of Fisher-Tippett-Gnedenko leading to possible choices of general extreme value distributions, or the Pickands-Balkema-de Haan theorem for tail fitting, or the methods related to large deviation theory. In the paper the most important stochastic distributions relevant for performing rare events statistical analysis will be presented. This concerns, for example, the analysis of the data with the annual extreme values (maxima - "Annual Maxima Series" or minima), or the peak values, exceeding given thresholds at some periods of interest ("Peak Over Threshold"), or the estimation of the size of exceedance. Despite of the fact that there is a lack of sufficient statistical data directly containing rare events, in some cases it is still possible to extract useful information from existing larger data sets. As an example one can consider some data sets available from the web sites for floods, earthquakes or generally natural hazards. Some aspects of such data sets will be also presented taking into account their usefulness for the practical assessment of risk for nuclear power plants coming from extreme weather conditions.

  15. [Improving patient safety: Usefulness of safety checklists in a neonatal unit].

    Science.gov (United States)

    Arriaga Redondo, María; Sanz López, Ester; Rodríguez Sánchez de la Blanca, Ana; Marsinyach Ros, Itziar; Collados Gómez, Laura; Díaz Redondo, Alicia; Sánchez Luna, Manuel

    2017-10-01

    Due to the complexity and characteristics of their patients, neonatal units are risk areas for the development of adverse events (AE). For this reason, there is a need to introduce and implement some tools and strategies that will help to improve the safety of the neonatal patient. Safety check-lists have shown to be a useful tool in other health areas but they are not sufficiently developed in Neonatal Units. A quasi-experimental prospective study was conducted on the design and implementation of the use of a checklist and evaluation of its usefulness for detecting incidents. The satisfaction of the health professionals on using the checklist tool was also assessed. The compliance rate in the neonatal intensive care unit (NICU) was 56.5%, with 4.03 incidents per patient being detected. One incident was detected for every 5.3 checklists used. The most frequent detected incidents were those related to medication, followed by inadequate alarm thresholds, adjustments of the monitors, and medication pumps. The large majority (75%) of the NICU health professionals considered the checklist useful or very useful, and 68.75% considered that its use had managed to avoid an AE. The overall satisfaction was 83.33% for the professionals with less than 5 years working experience, and 44.4% of the professionals with more than 5 years of experience were pleased or very pleased. The checklists have shown to be a useful tool for the detection of incidents, especially in NICU, with a positive assessment from the health professionals of the unit. Copyright © 2016 Asociación Española de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Selection of important initiating events for Level 1 probabilistic safety assessment study at Puspati TRIGA Reactor

    International Nuclear Information System (INIS)

    Maskin, M.; Charlie, F.; Hassan, A.; Prak Tom, P.; Ramli, Z.; Mohamed, F.

    2016-01-01

    Highlights: • Identifying possible important initiating events (IEs) for Level 1 probabilistic safety assessment performed on research nuclear reactor. • Methods in screening and grouping IEs are addressed. • Focusing only on internal IEs due to random failures of components. - Abstract: This paper attempts to present the results in identifying possible important initiating events (IEs) as comprehensive as possible to be applied in the development of Level-1 probabilistic safety assessment (PSA) study. This involves the approaches in listing and the methods in screening and grouping IEs, by focusing only on the internal IEs due to random failures of components and human errors with full power operational conditions and reactor core as the radioactivity source. Five approaches were applied in listing the IEs and each step of the methodology was described and commented. The criteria in screening and grouping the IEs were also presented. The results provided the information on how the Malaysian PSA team applied the approaches in selecting the most probable IEs as complete as possible in order to ensure the set of IEs was identified systematically and as representative as possible, hence providing confidence to the completeness of the PSA study. This study is perhaps one of the first to address classic comprehensive steps in identifying important IEs to be used in a Level-1 PSA study.

  17. Safety case for the disposal of spent nuclear fuel at Olkiluoto. Features, events and processes 2012

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    Features, Events and Processes sits within Posiva Oy's Safety Case 'TURVA-2012' portfolio and has the objective of presenting the main features, events and processes (FEPs) that are considered to be potentially significant for the long-term safety of the planned KBS-3V repository for spent nuclear fuel at Olkiluoto. The primary purpose of this report is to support Performance Assessment, Formulation of Radionuclide Release Scenarios, Assessment of the Radionuclide Release Scenarios for the Repository System and Biosphere Assessment by ensuring that the scenarios are comprehensive and take account of all significant FEPs. The main FEPs potentially affecting the disposal system are described for each relevant subsystem component or barrier (i.e. the spent nuclear fuel, the canister, the buffer and tunnel backfill, the auxiliary components, the geosphere and the surface environment). In addition, a small number of external FEPs that may potentially influence the evolution of the disposal system are described. The conceptual understanding and operation of each FEP is described, together with the main features (variables) of the disposal system that may affect its occurrence or significance. Olkiluoto-specific issues are considered when relevant. The main uncertainties (conceptual and parameter/data) associated with each FEP that may affect understanding are also documented. Indicative parameter values are provided, in some cases, to illustrate the magnitude or rate of a process, but it is not the intention of this report to provide the complete set of numerical values that are used in the quantitative safety assessment calculations. Many of the FEPs are interdependent and, therefore, the descriptions also identify the most important direct couplings between the FEPs. This information is used in the formulation of scenarios to ensure the conceptual models and calculational cases are both comprehensive and representative. (orig.)

  18. Safety case for the disposal of spent nuclear fuel at Olkiluoto. Features, events and processes 2012

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    Features, Events and Processes sits within Posiva Oy's Safety Case 'TURVA-2012' portfolio and has the objective of presenting the main features, events and processes (FEPs) that are considered to be potentially significant for the long-term safety of the planned KBS-3V repository for spent nuclear fuel at Olkiluoto. The primary purpose of this report is to support Performance Assessment, Formulation of Radionuclide Release Scenarios, Assessment of the Radionuclide Release Scenarios for the Repository System and Biosphere Assessment by ensuring that the scenarios are comprehensive and take account of all significant FEPs. The main FEPs potentially affecting the disposal system are described for each relevant subsystem component or barrier (i.e. the spent nuclear fuel, the canister, the buffer and tunnel backfill, the auxiliary components, the geosphere and the surface environment). In addition, a small number of external FEPs that may potentially influence the evolution of the disposal system are described. The conceptual understanding and operation of each FEP is described, together with the main features (variables) of the disposal system that may affect its occurrence or significance. Olkiluoto-specific issues are considered when relevant. The main uncertainties (conceptual and parameter/data) associated with each FEP that may affect understanding are also documented. Indicative parameter values are provided, in some cases, to illustrate the magnitude or rate of a process, but it is not the intention of this report to provide the complete set of numerical values that are used in the quantitative safety assessment calculations. Many of the FEPs are interdependent and, therefore, the descriptions also identify the most important direct couplings between the FEPs. This information is used in the formulation of scenarios to ensure the conceptual models and calculational cases are both comprehensive and representative. (orig.)

  19. Safety case for the disposal of spent nuclear fuel at Olkiluoto. Features, events and processes 2012

    International Nuclear Information System (INIS)

    2012-12-01

    Features, Events and Processes sits within Posiva Oy's Safety Case 'TURVA-2012' portfolio and has the objective of presenting the main features, events and processes (FEPs) that are considered to be potentially significant for the long-term safety of the planned KBS-3V repository for spent nuclear fuel at Olkiluoto. The primary purpose of this report is to support Performance Assessment, Formulation of Radionuclide Release Scenarios, Assessment of the Radionuclide Release Scenarios for the Repository System and Biosphere Assessment by ensuring that the scenarios are comprehensive and take account of all significant FEPs. The main FEPs potentially affecting the disposal system are described for each relevant subsystem component or barrier (i.e. the spent nuclear fuel, the canister, the buffer and tunnel backfill, the auxiliary components, the geosphere and the surface environment). In addition, a small number of external FEPs that may potentially influence the evolution of the disposal system are described. The conceptual understanding and operation of each FEP is described, together with the main features (variables) of the disposal system that may affect its occurrence or significance. Olkiluoto-specific issues are considered when relevant. The main uncertainties (conceptual and parameter/data) associated with each FEP that may affect understanding are also documented. Indicative parameter values are provided, in some cases, to illustrate the magnitude or rate of a process, but it is not the intention of this report to provide the complete set of numerical values that are used in the quantitative safety assessment calculations. Many of the FEPs are interdependent and, therefore, the descriptions also identify the most important direct couplings between the FEPs. This information is used in the formulation of scenarios to ensure the conceptual models and calculational cases are both comprehensive and representative. (orig.)

  20. The critical safety functions and plant operation

    International Nuclear Information System (INIS)

    Corcoran, W.R.; Church, J.F.; Cross, M.T.; Guinn, W.M.; Porter, N.J.

    1981-01-01

    The operator's role in nuclear safety is outlined and the concept of ''safety functions'' introduced. Safety functions are a group of actions that prevent core melt or minimize radiation releases to the general public. They can be used to provide a hierarchy of practical plant protection that an operator should use. The plant safety evaluation uses four inputs in predicting the results of an event: the event initiator, the plant design, the initial plant conditions and setup, and the operator actions. If any of these inputs are not as assumed in the evaluation, confidence that the consequences will be as predicted is reduced. Based on the safety evaluation, the operator has three roles in assuring that the consequences of an event will be no worse than the predicted acceptable results: Maintain plant setup in readiness to properly respond. Operate the plant in a manner such that fewer, milder events minimize the frequency and the severity of adverse events. Monitor the plant to verify that the safety functions are accomplished. The operator needs a systematic approach to mitigating the consequences of an event. The concept of safety functions introduces this systematic approach and presents a hierarchy of protection. If the operator has difficulty identifying an event for any reason, the systematic safety function approach allows accomplishing the overall path of mitigating consequences. Ten functions designed to protect against core melt, preserve containment integrity, prevent indirect release of radioactivity, and maintain vital auxiliaries needed to support the other safety functions are identified

  1. [Description of contributing factors in adverse events related to patient safety and their preventability].

    Science.gov (United States)

    Guerra-García, María Mercedes; Campos-Rivas, Beatriz; Sanmarful-Schwarz, Alexandra; Vírseda-Sacristán, Alicia; Dorrego-López, M Aránzazu; Charle-Crespo, Ángeles

    2017-11-25

    To assess the extent of healthcare related adverse events (AEs), their effect on patients, and their seriousness. To analyse the factors leading to the development of AEs, their relationship with the damage caused, and their degree of preventability. Retrospective descriptive study. Porriño, Pontevedra, Spain, Primary Care Service, from January-2014 to April-2016. Reported AEs were entered into the Patient Safety Reporting and Learning System (SiNASP). The variables measured were: Near Incident (NI) an occurrence with no effect or harm on the patient; Adverse Event (AE) an occurrence that affects or harms a patient. The level of harm is classified as minimal, minor, moderate, critical, and catastrophic. Preventability was classified as little evidence of being preventable, 50% preventable, and sound evidence of being preventable. percentages and Chi-squared test for qualitative variables; P<.05 with SPSS.15. SiNASP. Ethical considerations: approved by the Research Ethics Committee (2016/344). There were 166 recorded AEs (50.6% in males, and 46.4% in women. The mean age was 60.80years). Almost two-thirds 62.7% of AEs affected the patient, with 45.8% causing minimal damage, while 2.4% caused critical damages. Healthcare professionals were a contributing factor in 71.7% of the AEs, with the trend showing that poor communication and lack of protocols were related to the damage caused. Degree of preventability: 96.4%. Most AEs affected the patient, and were related to medication, diagnostic tests, and laboratory errors. The level of harm was related to communication problems, lack of, or deficient, protocols and a poor safety culture. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  2. Key terms for the assessment of the safety of vaccines in pregnancy: Results of a global consultative process to initiate harmonization of adverse event definitions.

    Science.gov (United States)

    Munoz, Flor M; Eckert, Linda O; Katz, Mark A; Lambach, Philipp; Ortiz, Justin R; Bauwens, Jorgen; Bonhoeffer, Jan

    2015-11-25

    The variability of terms and definitions of Adverse Events Following Immunization (AEFI) represents a missed opportunity for optimal monitoring of safety of immunization in pregnancy. In 2014, the Brighton Collaboration Foundation and the World Health Organization (WHO) collaborated to address this gap. Two Brighton Collaboration interdisciplinary taskforces were formed. A landscape analysis included: (1) a systematic literature review of adverse event definitions used in vaccine studies during pregnancy; (2) a worldwide stakeholder survey of available terms and definitions; (3) and a series of taskforce meetings. Based on available evidence, taskforces proposed key terms and concept definitions to be refined, prioritized, and endorsed by a global expert consultation convened by WHO in Geneva, Switzerland in July 2014. Using pre-specified criteria, 45 maternal and 62 fetal/neonatal events were prioritized, and key terms and concept definitions were endorsed. In addition recommendations to further improve safety monitoring of immunization in pregnancy programs were specified. This includes elaboration of disease concepts into standardized case definitions with sufficient applicability and positive predictive value to be of use for monitoring the safety of immunization in pregnancy globally, as well as the development of guidance, tools, and datasets in support of a globally concerted approach. There is a need to improve the safety monitoring of immunization in pregnancy programs. A consensus list of terms and concept definitions of key events for monitoring immunization in pregnancy is available. Immediate actions to further strengthen monitoring of immunization in pregnancy programs are identified and recommended. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. [Peripheral venous catheter use in the emergency department: reducing adverse events in patients and biosafety problems for staff].

    Science.gov (United States)

    Tomás Vecina, Santiago; Mozota Duarte, Julián; Ortega Marcos, Miguel; Gracia Ruiz Navarro, María; Borillo, Vicente; San Juan Gago, Leticia; Roqueta Egea, Fermin; Chanovas Borrás, Manuel

    2016-01-01

    To test a strategy to reduce the rate of adverse events in patients and safety problems for emergency department staff who insert peripheral venous catheters (PVCs). The strategy consisted of training, implementing a protocol, and introducing safety-engineered PVCs. Prospective, multicenter, observational, preauthorization study in patients requiring PVC placement in an emergency department. The study had 2 phases. The first consisted of training, implementing a protocol for using conventional PVCs, and monitoring practice. The second phase introduced safety-engineered PVC sets. The number of adverse events in patients and threats to safety for staff were compared between the 2 phases. A total of 520 patients were included, 180 in the first phase and 340 in the second. We detected breaches in aseptic technique, failure to maintain a sterile field, and improper management of safety equipment and devices. Some practices improved significantly during the second phase. Eighty-six adverse events occurred in the first phase and 52 (15.4%) in the second; the between-phase difference was not statistically significant. The incidence of postinfusion phlebitis was 50% lower in the second phase. Seven splash injuries and 1 accidental puncture occurred with conventional PVCs in the first phase; 2 splash injuries occurred with the safety-engineered PVCs in the second phase (36% decrease, P = .04). Differences were particularly noticeable for short-term PVC placements (P = .02). Combining training, a protocol, and the use of safety-engineered PVC sets offers an effective strategy for improving patient and staff safety.

  4. Automatic detection of esophageal pressure events. Is there an alternative to rule-based criteria?

    DEFF Research Database (Denmark)

    Kruse-Andersen, S; Rütz, K; Kolberg, Jens Godsk

    1995-01-01

    of relevant pressure peaks at the various recording levels. Until now, this selection has been performed entirely by rule-based systems, requiring each pressure deflection to fit within predefined rigid numerical limits in order to be detected. However, due to great variations in the shapes of the pressure...... curves generated by muscular contractions, rule-based criteria do not always select the pressure events most relevant for further analysis. We have therefore been searching for a new concept for automatic event recognition. The present study describes a new system, based on the method of neurocomputing.......79-0.99 and accuracies of 0.89-0.98, depending on the recording level within the esophageal lumen. The neural networks often recognized peaks that clearly represented true contractions but that had been rejected by a rule-based system. We conclude that neural networks have potentials for automatic detections...

  5. Gait Event Detection in Real-World Environment for Long-Term Applications: Incorporating Domain Knowledge Into Time-Frequency Analysis.

    Science.gov (United States)

    Khandelwal, Siddhartha; Wickstrom, Nicholas

    2016-12-01

    Detecting gait events is the key to many gait analysis applications that would benefit from continuous monitoring or long-term analysis. Most gait event detection algorithms using wearable sensors that offer a potential for use in daily living have been developed from data collected in controlled indoor experiments. However, for real-word applications, it is essential that the analysis is carried out in humans' natural environment; that involves different gait speeds, changing walking terrains, varying surface inclinations and regular turns among other factors. Existing domain knowledge in the form of principles or underlying fundamental gait relationships can be utilized to drive and support the data analysis in order to develop robust algorithms that can tackle real-world challenges in gait analysis. This paper presents a novel approach that exhibits how domain knowledge about human gait can be incorporated into time-frequency analysis to detect gait events from long-term accelerometer signals. The accuracy and robustness of the proposed algorithm are validated by experiments done in indoor and outdoor environments with approximately 93 600 gait events in total. The proposed algorithm exhibits consistently high performance scores across all datasets in both, indoor and outdoor environments.

  6. Online Least Squares One-Class Support Vector Machines-Based Abnormal Visual Event Detection

    Directory of Open Access Journals (Sweden)

    Tian Wang

    2013-12-01

    Full Text Available The abnormal event detection problem is an important subject in real-time video surveillance. In this paper, we propose a novel online one-class classification algorithm, online least squares one-class support vector machine (online LS-OC-SVM, combined with its sparsified version (sparse online LS-OC-SVM. LS-OC-SVM extracts a hyperplane as an optimal description of training objects in a regularized least squares sense. The online LS-OC-SVM learns a training set with a limited number of samples to provide a basic normal model, then updates the model through remaining data. In the sparse online scheme, the model complexity is controlled by the coherence criterion. The online LS-OC-SVM is adopted to handle the abnormal event detection problem. Each frame of the video is characterized by the covariance matrix descriptor encoding the moving information, then is classified into a normal or an abnormal frame. Experiments are conducted, on a two-dimensional synthetic distribution dataset and a benchmark video surveillance dataset, to demonstrate the promising results of the proposed online LS-OC-SVM method.

  7. Process variant comparison: using event logs to detect differences in behavior and business rules

    NARCIS (Netherlands)

    Bolt, A.; de Leoni, M.; van der Aalst, W.M.P.

    2018-01-01

    This paper addresses the problem of comparing different variants of the same process. We aim to detect relevant differences between processes based on what was recorded in event logs. We use transition systems to model behavior and to highlight differences. Transition systems are annotated with

  8. Assessing the association between omalizumab and arteriothrombotic events through spontaneous adverse event reporting

    Directory of Open Access Journals (Sweden)

    Ali AK

    2012-05-01

    Full Text Available Ayad K Ali, Abraham G HartzemaDepartment of Pharmaceutical Outcomes and Policy, College of Pharmacy, University of Florida, Gainesville, FL, USABackground: Omalizumab is a monoclonal antibody, indicated for the treatment of severe allergic asthma. In Europe, there have been concerns about the cardiovascular safety of omalizumab. The objective of this study was to analyze the association between omalizumab and arterial thrombotic events in a spontaneous adverse drug reaction reporting database in the US.Methods and materials: Reports of arterial thrombotic events submitted to the US Food and Drug Administration's Adverse Event Reporting System (AERS between 2004 and 2011 were retrieved and analyzed by the reporting odds ratio data mining algorithm. The reporting odds ratio of arterial thrombotic events for omalizumab was compared with specific asthma medications and all drugs in the AERS. Values ≥2 were considered significant safety signals. The Medical Dictionary for Regulatory Activities Preferred Terms were used to identify arterial thrombotic events (eg, stroke, myocardial infarction.Results: In total, 293,783 reports of arterial thrombotic events were retrieved (about 2% of all adverse drug reaction reports, corresponding to 2274 asthma drug-arterial thrombotic events pairs (omalizumab, 222; inhaled corticosteroids [ICS], 131; long-acting beta-agonists [LABA], 102; single-device combination ICS-LABA, 506; inhaled short-acting beta-agonists [SABA], 475; oral SABA, 6; inhaled antimuscarinics [AMC], 477; single-device combination AMC-SABA, 127; xanthines, 50; leukotriene modifiers, 174; and mast cell stabilizers, 4. Reporting odds ratio and 95% confidence interval values for omalizumab compared with other asthma drugs and all drugs in AERS were 2.75 (2.39–316 and 1.09 (0.95–1.24, respectively. Omalizumab ranked second after ICS in the risk of arterial thrombotic events, followed by AMC, AMC-SABA, and ICS-LABA.Conclusion: Omalizumab is

  9. Computerized surveillance of opioid-related adverse drug events in perioperative care: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Gattis Katherine G

    2009-08-01

    Full Text Available Abstract Background Given the complexity of surgical care, perioperative patients are at high risk of opioid-related adverse drug events. Existing methods of detection, such as trigger tools and manual chart review, are time-intensive which makes sustainability challenging. Using strategic rule design, computerized surveillance may be an efficient, pharmacist-driven model for event detection that leverages existing staff resources. Methods Computerized adverse drug event surveillance uses a logic-based rules engine to identify potential adverse drug events or evolving unsafe clinical conditions. We extended an inpatient rule (administration of naloxone to detect opioid-related oversedation and respiratory depression to perioperative care at a large academic medical center. Our primary endpoint was the adverse drug event rate. For all patients with a naloxone alert, manual chart review was performed by a perioperative clinical pharmacist to assess patient harm. In patients with confirmed oversedation, other patient safety event databases were queried to determine if they could detect duplicate, prior, or subsequent opioid-related events. Results We identified 419 cases of perioperative naloxone administration. Of these, 101 were given postoperatively and 69 were confirmed as adverse drug events after chart review yielding a rate of 1.89 adverse drug events/1000 surgical encounters across both the inpatient and ambulatory settings. Our ability to detect inpatient opioid adverse drug events increased 22.7% by expanding surveillance into perioperative care. Analysis of historical surveillance data as well as a voluntary reporting database revealed that 11 of our perioperative patients had prior or subsequent harmful oversedation. Nine of these cases received intraoperative naloxone, and 2 had received naloxone in the post-anesthesia care unit. Pharmacist effort was approximately 3 hours per week to evaluate naloxone alerts and confirm adverse drug

  10. Validating administrative data for the detection of adverse events in older hospitalized patients

    Directory of Open Access Journals (Sweden)

    Ackroyd-Stolarz S

    2014-08-01

    -related injuries, and 69 adverse drug events were identified through health record review. Of these, 34 pressure ulcers, 54 fall-related injuries, and 47 adverse drug events were also identified in administrative data. Overall, the diagnostic codes for adverse events had a sensitivity and specificity exceeding 0.67 (95% confidence interval [CI]: 0.56–0.99 and 0.89 (95% CI: 0.72–0.99, respectively. Conclusion: It is feasible and valid to identify pressure ulcers, fall-related injuries, and adverse drug events in older hospitalized patients using routinely collected administrative hospitalization data. The information is relatively inexpensive and easy to access with no impact on clinical staff. Keywords: geriatrics, patient safety, adverse drug events, pressure ulcers, fall-related injuries

  11. Femtomolar detection of single mismatches by discriminant analysis of DNA hybridization events using gold nanoparticles.

    Science.gov (United States)

    Ma, Xingyi; Sim, Sang Jun

    2013-03-21

    Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.

  12. Technical organization of safety authorities for the event of an accident at a nuclear installation

    International Nuclear Information System (INIS)

    Scherrer, J.; Evrard, J.M.; Ney, J.

    1986-01-01

    Within the general context of nuclear safety, the Central Nuclear Installation Safety Service of the French Ministry for Industry and its technical backup, the Institute for Radiation Protection and Nuclear Safety of the CEA (Atomic Energy Commission), have established a special organization designed to provide real-time forecasts of the evolution of a nuclear accident situation with sufficient forewarning for the local representative of the Government (the Commissaire de la Republique in the Departement affected) to implement, as required, effective countermeasures to protect the population - for example, confinement indoors or evacuation. Descriptions are given of the principles of this organization and the particular precautions taken to confront the problems of mobilizing experts and of dealing with the saturation of normal telecommunications channels to be expected in the event of a nuclear accident. The organization set up for the installations belonging to Electricite de France is given as a detailed example. Particular stress is placed on the organizational arrangements of the Institute for Radiation Protection and Nuclear Safety designed to provide the emergency teams with the evaluation and forecasting tools they require to carry out their tasks. The procedures are on the whole well developed for atmospheric radioactivity transport, for which operational models already exist. Computer-backed methods with improved performance are at present being developed. A method of forecasting the behaviour of the releases resulting from nuclear accidents is set out for pressurized water reactors, based on evaluating the physical state of the installation, confinement integrity, availability of safety and backup systems, support systems and feed sources and on forecasting how this state will develop on the basis of measured and inferred physical values transmitted from the affected power station through a national network. The experience acquired during accident

  13. Selection of design basis event for modular high temperature gas-cooled reactor

    International Nuclear Information System (INIS)

    Sato, Hiroyuki; Nakagawa, Shigeaki; Ohashi, Hirofumi

    2016-06-01

    Japan Atomic Energy Agency (JAEA) has been investigating safety requirements and basic approach of safety guidelines for modular High Temperature Gas-cooled Reactor (HTGR) aiming to increase internarial contribution for nuclear safety by developing an international HTGR safety standard under International Atomic Energy Agency. In this study, we investigate a deterministic approach to select design basis events utilizing information obtained from probabilistic approach. In addition, selections of design basis events are conducted for commercial HTGR designed by JAEA. As a result, an approach for selecting design basis event considering multiple failures of safety systems is established which has not been considered as design basis in the safety guideline for existing nuclear facility. Furthermore, selection of design basis events for commercial HTGR has completed. This report provides an approach and procedure for selecting design basis events of modular HTGR as well as selected events for the commercial HTGR, GTHTR300. (author)

  14. 76 FR 38077 - Special Local Regulations and Safety Zones; Recurring Events in Captain of the Port New York Zone

    Science.gov (United States)

    2011-06-29

    ...: All Zone. waters of Long Island Sound in an area bound by the following points: 40[deg]51'43.5'' N 073... Zone. located in approximate position 40[deg]51'52'' N 073[deg]56'24'' W (NAD 1983), approximately 1750...] RIN 1625-AA00; 1625-AA08 Special Local Regulations and Safety Zones; Recurring Events in Captain of...

  15. Event classification related to overflow of solvent containing uranium according to the INES scale (International Nuclear and Radiological Event Scale)

    International Nuclear Information System (INIS)

    Dourado, Eneida R.G.; Assis, Juliana T. de; Lage, Ricardo F.; Lopes, Karina B.

    2013-01-01

    This paper aims to frame the event overflow organic solvent rich in uranium, from a decanter of ore beneficiation plant, caused by the fall in the supply of electricity, according to the criteria established by the International Nuclear Event Scale and radiological (INES), facilitating the understanding of the occurrence and communication with the public regarding the radiation safety aspects involved. With the fall of electricity, routine procedures in situations of installation stop were performed, however, due to operational failure, the valve on the transfer line liquor was not closed. Thus, the mixer continued being fed with liquor, that led the consequent leakage of solvent loaded with uranium. It reached the drainage system, and the box of rainwater harvesting of the plant. However, immediately after the detection of the event, corrective actions were initiated and the overflow was contained. Regulatory agencies followed the removal of the solvent and on the results of the analysis of environmental monitoring, found that the event did not provide exposure to workers or any other impact. Therefore, comparing the characteristics of the event and the guidelines proposed by the INES scale, it is concluded that the classification of the event is below scale/level 0, confirming the absence of risk to the local population, workers and the environment

  16. The reasons for Chinese nursing staff to report adverse events: a questionnaire survey.

    Science.gov (United States)

    Hong, Su; Li, QiuJie

    2017-04-01

    To investigate the impact of nurses' perception of patient safety culture and adverse event reporting, and demographic factors on adverse event reporting in Chinese hospitals. Accurate and timely adverse event reporting is integral in promoting patient safety and professional learning around the incident. In a cross-sectional survey, a sample of 919 nurses completed a structured questionnaire composed of two validated instruments measuring nurses' perception of patient safety culture and adverse event reporting. Associations between the variables were examined using multiple linear regression analysis. The positive response rates of five dimensions of the Patient Safety Culture Assessment Scale varied from 47.55% to 80.62%. The accuracy rate of Adverse Event Reporting Perception Scale was 63.16%. Five hundred and thirty-one (58.03%) nurses did not report adverse event in past 12 months. Six variables were found to be associated with nurses' adverse event reporting: total work experience (P = 0.003), overall patient safety culture score (P teamwork climate (P importance or reporting (P = 0.002). The results confirmed that improvements in the patient safety culture and nurses' perception of adverse event reporting were related to an increase in voluntary adverse event reporting. The knowledge of adverse event reporting should be integrated into the patient safety curriculum. Interventions that target a specific domain are necessary to improve the safety culture. © 2017 John Wiley & Sons Ltd.

  17. Performance Evaluation of Wireless Sensor Networks for Event-Detection with Shadowing-Induced Radio Irregularities

    Directory of Open Access Journals (Sweden)

    Giuseppe De Marco

    2007-01-01

    Full Text Available In this paper, we study a particular application of wireless sensor networks for event-detection and tracking. In this kind of application, the transport of data is simplified, and guaranteeing a minimum number of packets at the monitoring node is the only constraint on the performance of the sensor network. This minimum number of packets is called event-reliability. Contrary to other studies on the subject, here we consider the behavior of such a network in presence of a realistic radio model, such as the shadowing of the radio signal. With this setting, we extend our previous analysis of the event-reliability approach for the transport of data. In particular, both regular and random networks are considered. The contribute of this work is to show via simulations that, in the presence of randomness or irregularities in the radio channel, the event-reliability can be jeopardized, that is the constraint on the minimum number of packets at the sink node could not be satisfied.

  18. Safety through organizational learning

    International Nuclear Information System (INIS)

    Fahlbruch, B.; Miller, R.; Wilpert, B.

    1998-01-01

    Systems safety is a characteristic of a system enabling it to function under the required operating conditions with a minimum of losses and unforeseen damage to the system and its environment and without any systems breakdowns. The system is influenced by human factors as those factors which, in a general way, influence people in working with a technical system, i.e., people, technology, and organization. Different approaches to learning from events, and processes of event analysis in nuclear technology are presented. The theoretical basis of the 'Safety through Organizational Learning' event analysis technique is the sociotechnical event creation model, which postulates that events can be described as a chain of individual events arising from the joint action of factors contributing directly and indirectly. (orig.) [de

  19. A study of the state of the art on the determination of the threshold values of the performance indicators for safety systems and initiating events of nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Kang, D. I.; Kim, K. Y.; Hwang, M. J.; Park, J. H.; Ha, J. J

    2004-02-01

    The threshold values of Korean Institute of Nuclear Safety (KINS) Performance Indicators (PIs)' determining the safety class of initiating events and safety systems can not sufficiently reflect the operating experience and PSA results of domestic NPPs. Therefore, the state of arts on the PI study of domestic and foreign countries is analyzed in order to reflect the operating experience and PSA results of domestic NPPs in the determination of the threshold values of the PIs for safety systems and initiating events of domestic NPPs. We identified the state of arts of PIs through reviewing the objectives and types of WANO, IAEA, NRC, OECD/NEA and domestic PIs, and the technical issues of the threshold values of SECY 99-007 and NUREG-1753. We also, identified the current status of recently developed MSPI (Mitigating System Performance Index) and IIIEI (Integrated Industry Initiating Event Indicator). From this study of the state of the arts on the PIs, we expect that if the NRC's MSPI and a PI similar to NRC's IIIEI would be introduced into the KINS, it is not necessary to determine the threshold values of PIs applied to the safety systems and initiating events of entire domestic NPPs. Otherwise the threshold values of PIs applied to the individual NPP should be developed using PSA models of typical reactor types. For the active development and use of the risk informed PIs for the domestic NPPs, we expect that the system and component reliability analysis and initiating events analysis for the domestic NPPs, MSPI, IIIEI, and PSA requirements for the PIs be further studied.

  20. Surface Management System Departure Event Data Analysis

    Science.gov (United States)

    Monroe, Gilena A.

    2010-01-01

    This paper presents a data analysis of the Surface Management System (SMS) performance of departure events, including push-back and runway departure events.The paper focuses on the detection performance, or the ability to detect departure events, as well as the prediction performance of SMS. The results detail a modest overall detection performance of push-back events and a significantly high overall detection performance of runway departure events. The overall detection performance of SMS for push-back events is approximately 55%.The overall detection performance of SMS for runway departure events nears 100%. This paper also presents the overall SMS prediction performance for runway departure events as well as the timeliness of the Aircraft Situation Display for Industry data source for SMS predictions.

  1. Risk and sensitivity analysis in relation to external events

    International Nuclear Information System (INIS)

    Alzbutas, R.; Urbonas, R.; Augutis, J.

    2001-01-01

    This paper presents risk and sensitivity analysis of external events impacts on the safe operation in general and in particular the Ignalina Nuclear Power Plant safety systems. Analysis is based on the deterministic and probabilistic assumptions and assessment of the external hazards. The real statistic data are used as well as initial external event simulation. The preliminary screening criteria are applied. The analysis of external event impact on the NPP safe operation, assessment of the event occurrence, sensitivity analysis, and recommendations for safety improvements are performed for investigated external hazards. Such events as aircraft crash, extreme rains and winds, forest fire and flying parts of the turbine are analysed. The models are developed and probabilities are calculated. As an example for sensitivity analysis the model of aircraft impact is presented. The sensitivity analysis takes into account the uncertainty features raised by external event and its model. Even in case when the external events analysis show rather limited danger, the sensitivity analysis can determine the highest influence causes. These possible variations in future can be significant for safety level and risk based decisions. Calculations show that external events cannot significantly influence the safety level of the Ignalina NPP operation, however the events occurrence and propagation can be sufficiently uncertain.(author)

  2. Automatic detection of adverse events to predict drug label changes using text and data mining techniques.

    Science.gov (United States)

    Gurulingappa, Harsha; Toldo, Luca; Rajput, Abdul Mateen; Kors, Jan A; Taweel, Adel; Tayrouz, Yorki

    2013-11-01

    The aim of this study was to assess the impact of automatically detected adverse event signals from text and open-source data on the prediction of drug label changes. Open-source adverse effect data were collected from FAERS, Yellow Cards and SIDER databases. A shallow linguistic relation extraction system (JSRE) was applied for extraction of adverse effects from MEDLINE case reports. Statistical approach was applied on the extracted datasets for signal detection and subsequent prediction of label changes issued for 29 drugs by the UK Regulatory Authority in 2009. 76% of drug label changes were automatically predicted. Out of these, 6% of drug label changes were detected only by text mining. JSRE enabled precise identification of four adverse drug events from MEDLINE that were undetectable otherwise. Changes in drug labels can be predicted automatically using data and text mining techniques. Text mining technology is mature and well-placed to support the pharmacovigilance tasks. Copyright © 2013 John Wiley & Sons, Ltd.

  3. Features, events, processes, and safety factor analysis applied to a near-surface low-level radioactive waste disposal facility

    Energy Technology Data Exchange (ETDEWEB)

    Stephens, M.E.; Dolinar, G.M.; Lange, B.A. [Atomic Energy of Canada Limited, Ontario (Canada)] [and others

    1995-12-31

    An analysis of features, events, processes (FEPs) and other safety factors was applied to AECL`s proposed IRUS (Intrusion Resistant Underground Structure) near-surface LLRW disposal facility. The FEP analysis process which had been developed for and applied to high-level and transuranic disposal concepts was adapted for application to a low-level facility for which significant efforts in developing a safety case had already been made. The starting point for this process was a series of meetings of the project team to identify and briefly describe FEPs or safety factors which they thought should be considered. At this early stage participants were specifically asked not to screen ideas. This initial list was supplemented by selecting FEPs documented in other programs and comments received from an initial regulatory review. The entire list was then sorted by topic and common issues were grouped, and issues were classified in three priority categories and assigned to individuals for resolution. In this paper, the issue identification and resolution process will be described, from the initial description of an issue to its resolution and inclusion in the various levels of the safety case documentation.

  4. Assessing progress in the development of safety culture

    International Nuclear Information System (INIS)

    Rotaru, I.; Ghita, S.; Biro, L.

    2002-01-01

    This paper is focussed on the organizational culture and learning processes required for the implementation of all aspects of safety culture. There is no prescriptive formula for improving safety culture. However, some common characteristics and practices are emerging that can be adopted by organizations in order to make progress. The paper refers to some approaches that have been successful in a number of countries. The experience of the international nuclear industry in the development and improvement of safety culture could be extended and found useful in other nuclear activities, irrespective of scale. The examples given of specific practice cover a wide range of activities including analysis of events, the regulatory approach on safety culture, employee participation and safety performance measures. Many of these practices may be relevant to smaller organizations and could contribute to improving safety culture, whatever the size of the organization. The most effective approach is to pursue a range of practices that can be mutually supportive in the development of a progressive safety culture, supported by professional standards, organizational and management commitment. Some guidance is also given on the assessment of safety culture and on the detection of a weakening safety culture. Few suggestions for accelerating the safety culture development and improvement process are also provided. (author)

  5. Effects of auditing patient safety in hospital care: design of a mixed-method evaluation.

    Science.gov (United States)

    Hanskamp-Sebregts, Mirelle; Zegers, Marieke; Boeijen, Wilma; Westert, Gert P; van Gurp, Petra J; Wollersheim, Hub

    2013-06-22

    Auditing of patient safety aims at early detection of risks of adverse events and is intended to encourage the continuous improvement of patient safety. The auditing should be an independent, objective assurance and consulting system. Auditing helps an organisation accomplish its objectives by bringing a systematic, disciplined approach to evaluating and improving the effectiveness of risk management, control, and governance. Audits are broadly conducted in hospitals, but little is known about their effects on the behaviour of healthcare professionals and patient safety outcomes. This study was initiated to evaluate the effects of patient safety auditing in hospital care and to explore the processes and mechanisms underlying these effects. Our study aims to evaluate an audit system to monitor and improve patient safety in a hospital setting. We are using a mixed-method evaluation with a before-and-after study design in eight departments of one university hospital in the period October 2011-July 2014. We measure several outcomes 3 months before the audit and 15 months after the audit. The primary outcomes are adverse events and complications. The secondary outcomes are experiences of patients, the standardised mortality ratio, prolonged hospital stay, patient safety culture, and team climate. We use medical record reviews, questionnaires, hospital administrative data, and observations to assess the outcomes. A process evaluation will be used to find out which components of internal auditing determine the effects. We report a study protocol of an effect and process evaluation to determine whether auditing improves patient safety in hospital care. Because auditing is a complex intervention targeted on several levels, we are using a combination of methods to collect qualitative and quantitative data about patient safety at the patient, professional, and department levels. This study is relevant for hospitals that want to early detect unsafe care and improve patient

  6. Methodological Considerations for Comparison of Brand Versus Generic Versus Authorized Generic Adverse Event Reports in the US Food and Drug Administration Adverse Event Reporting System (FAERS).

    Science.gov (United States)

    Rahman, Md Motiur; Alatawi, Yasser; Cheng, Ning; Qian, Jingjing; Peissig, Peggy L; Berg, Richard L; Page, David C; Hansen, Richard A

    2017-12-01

    The US Food and Drug Administration Adverse Event Reporting System (FAERS), a post-marketing safety database, can be used to differentiate brand versus generic safety signals. To explore the methods for identifying and analyzing brand versus generic adverse event (AE) reports. Public release FAERS data from January 2004 to March 2015 were analyzed using alendronate and carbamazepine as examples. Reports were classified as brand, generic, and authorized generic (AG). Disproportionality analyses compared reporting odds ratios (RORs) of selected known labeled serious adverse events stratifying by brand, generic, and AG. The homogeneity of these RORs was compared using the Breslow-Day test. The AG versus generic was the primary focus since the AG is identical to brand but marketed as a generic, therefore minimizing generic perception bias. Sensitivity analyses explored how methodological approach influenced results. Based on 17,521 US event reports involving alendronate and 3733 US event reports involving carbamazepine (immediate and extended release), no consistently significant differences were observed across RORs for the AGs versus generics. Similar results were obtained when comparing reporting patterns over all time and just after generic entry. The most restrictive approach for classifying AE reports yielded smaller report counts but similar results. Differentiation of FAERS reports as brand versus generic requires careful attention to risk of product misclassification, but the relative stability of findings across varying assumptions supports the utility of these approaches for potential signal detection.

  7. Aging of safety class 1E transformers in safety systems of nuclear power plants

    International Nuclear Information System (INIS)

    Roberts, E.W.; Edson, J.L.; Udy, A.C.

    1996-02-01

    This report discusses aging effects on safety-related power transformers in nuclear power plants. It also evaluates maintenance, testing, and monitoring practices with respect to their effectiveness in detecting and mitigating the effects of aging. The study follows the US Nuclear Regulatory Commission's (NRC's) Nuclear Plant-Aging Research approach. It investigates the materials used in transformer construction, identifies stressors and aging mechanisms, presents operating and testing experience with aging effects, analyzes transformer failure events reported in various databases, and evaluates maintenance practices. Databases maintained by the nuclear industry were analyzed to evaluate the effects of aging on the operation of nuclear power plants

  8. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    Science.gov (United States)

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young

    2017-01-01

    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  9. An analog cell to detect single event transients in voltage references

    Energy Technology Data Exchange (ETDEWEB)

    Franco, F.J., E-mail: fjfranco@fis.ucm.es [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Palomar, C. [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Izquierdo, J.G. [Centro de Láseres Ultrarrápidos, Facultad de Químicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Agapito, J.A. [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain)

    2015-01-11

    A reliable voltage reference is mandatory in mixed-signal systems. However, this family of components can undergo very long single event transients when operating in radiation environments such as space and nuclear facilities due to the impact of heavy ions. The purpose of the present paper is to demonstrate how a simple cell can be used to detect these transients. The cell was implemented with typical COTS components and its behavior was verified by SPICE simulations and in a laser facility. Different applications of the cell are explored as well.

  10. High-Performance Signal Detection for Adverse Drug Events using MapReduce Paradigm.

    Science.gov (United States)

    Fan, Kai; Sun, Xingzhi; Tao, Ying; Xu, Linhao; Wang, Chen; Mao, Xianling; Peng, Bo; Pan, Yue

    2010-11-13

    Post-marketing pharmacovigilance is important for public health, as many Adverse Drug Events (ADEs) are unknown when those drugs were approved for marketing. However, due to the large number of reported drugs and drug combinations, detecting ADE signals by mining these reports is becoming a challenging task in terms of computational complexity. Recently, a parallel programming model, MapReduce has been introduced by Google to support large-scale data intensive applications. In this study, we proposed a MapReduce-based algorithm, for common ADE detection approach, Proportional Reporting Ratio (PRR), and tested it in mining spontaneous ADE reports from FDA. The purpose is to investigate the possibility of using MapReduce principle to speed up biomedical data mining tasks using this pharmacovigilance case as one specific example. The results demonstrated that MapReduce programming model could improve the performance of common signal detection algorithm for pharmacovigilance in a distributed computation environment at approximately liner speedup rates.

  11. Formal Verification of Safety Buffers for Sate-Based Conflict Detection and Resolution

    Science.gov (United States)

    Herencia-Zapana, Heber; Jeannin, Jean-Baptiste; Munoz, Cesar A.

    2010-01-01

    The information provided by global positioning systems is never totally exact, and there are always errors when measuring position and velocity of moving objects such as aircraft. This paper studies the effects of these errors in the actual separation of aircraft in the context of state-based conflict detection and resolution. Assuming that the state information is uncertain but that bounds on the errors are known, this paper provides an analytical definition of a safety buffer and sufficient conditions under which this buffer guarantees that actual conflicts are detected and solved. The results are presented as theorems, which were formally proven using a mechanical theorem prover.

  12. Hazardous Traffic Event Detection Using Markov Blanket and Sequential Minimal Optimization (MB-SMO

    Directory of Open Access Journals (Sweden)

    Lixin Yan

    2016-07-01

    Full Text Available The ability to identify hazardous traffic events is already considered as one of the most effective solutions for reducing the occurrence of crashes. Only certain particular hazardous traffic events have been studied in previous studies, which were mainly based on dedicated video stream data and GPS data. The objective of this study is twofold: (1 the Markov blanket (MB algorithm is employed to extract the main factors associated with hazardous traffic events; (2 a model is developed to identify hazardous traffic event using driving characteristics, vehicle trajectory, and vehicle position data. Twenty-two licensed drivers were recruited to carry out a natural driving experiment in Wuhan, China, and multi-sensor information data were collected for different types of traffic events. The results indicated that a vehicle’s speed, the standard deviation of speed, the standard deviation of skin conductance, the standard deviation of brake pressure, turn signal, the acceleration of steering, the standard deviation of acceleration, and the acceleration in Z (G have significant influences on hazardous traffic events. The sequential minimal optimization (SMO algorithm was adopted to build the identification model, and the accuracy of prediction was higher than 86%. Moreover, compared with other detection algorithms, the MB-SMO algorithm was ranked best in terms of the prediction accuracy. The conclusions can provide reference evidence for the development of dangerous situation warning products and the design of intelligent vehicles.

  13. Organization of public authorities in France for the event of an incident or accident involving nuclear safety: Simulation of a nuclear crisis

    International Nuclear Information System (INIS)

    Cartigny, J.; Majorel, Y.

    1986-01-01

    The French nuclear safety regulations lay down the action to be taken in the event of an incident or accident involving the types of radiological hazard that could arise in a nuclear installation or during the transport of radioactive material. The organization established for this purpose is designed to ensure that the technical measures taken by the authorities responsible for nuclear safety, radiation protection, public order and public safety are fully effective. The Interministerial Nuclear Safety Committee (Comite interministeriel de la securite nucleaire), which reports to the Prime Minister, co-ordinates the measures taken by the public authorities. The public authorities and the operators together organize exercises designed to verify the whole complex of measures foreseen in the event of an incident or accident. These exercises, which have been carried out in a systematic manner in France for some years, are based on scenarios which are as realistic as possible and enable the following objectives to be achieved: (1) analysis of the crisis apparatus (ORSECRAD plans, individual intervention plans, information conventions); (2) uncovering gaps or inadequacies; (3) arrangements for interchange of information between the various participants whose responsibilities involve them in the emergency; and (4) allowance for the information requirements of the media and the population. The information drawn from these exercises enables the various procedures to be improved step by step. (author)

  14. {sup 123}I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Horiguchi, Yoriko; Morita, Yukiko [National Hospital Organization Sagamihara National Hospital, Department of Cardiology, Sagamihara City, Kanagawa (Japan); Tsurikisawa, Naomi; Akiyama, Kazuo [National Hospital Organization Sagamihara National Hospital, Clinical Research Centre for Allergy and Rheumatology, Sagamihara City, Kanagawa (Japan)

    2011-02-15

    In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. {sup 123}I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using {sup 123}I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M {<=} 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP {<=} 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. {sup 123}I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)

  15. Detecting regular sound changes in linguistics as events of concerted evolution.

    Science.gov (United States)

    Hruschka, Daniel J; Branford, Simon; Smith, Eric D; Wilkins, Jon; Meade, Andrew; Pagel, Mark; Bhattacharya, Tanmoy

    2015-01-05

    Concerted evolution is normally used to describe parallel changes at different sites in a genome, but it is also observed in languages where a specific phoneme changes to the same other phoneme in many words in the lexicon—a phenomenon known as regular sound change. We develop a general statistical model that can detect concerted changes in aligned sequence data and apply it to study regular sound changes in the Turkic language family. Linguistic evolution, unlike the genetic substitutional process, is dominated by events of concerted evolutionary change. Our model identified more than 70 historical events of regular sound change that occurred throughout the evolution of the Turkic language family, while simultaneously inferring a dated phylogenetic tree. Including regular sound changes yielded an approximately 4-fold improvement in the characterization of linguistic change over a simpler model of sporadic change, improved phylogenetic inference, and returned more reliable and plausible dates for events on the phylogenies. The historical timings of the concerted changes closely follow a Poisson process model, and the sound transition networks derived from our model mirror linguistic expectations. We demonstrate that a model with no prior knowledge of complex concerted or regular changes can nevertheless infer the historical timings and genealogical placements of events of concerted change from the signals left in contemporary data. Our model can be applied wherever discrete elements—such as genes, words, cultural trends, technologies, or morphological traits—can change in parallel within an organism or other evolving group. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  16. [Detection of adverse events in hospitalized adult patients by using the Global Trigger Tool method].

    Science.gov (United States)

    Guzmán-Ruiz, O; Ruiz-López, P; Gómez-Cámara, A; Ramírez-Martín, M

    2015-01-01

    To identify and characterize adverse events (AE) in an Internal Medicine Department of a district hospital using an extension of the Global Trigger Tool (GTT), analyzing the diagnostic validity of the tool. An observational, analytical, descriptive and retrospective study was conducted on 2013 clinical charts from an Internal Medicine Department in order to detect EA through the identification of 'triggers' (an event often related to an AE). The 'triggers' and AE were located by systematic review of clinical documentation. The AE were characterized after they were identified. A total of 149 AE were detected in 291 clinical charts during 2013, of which 75.3% were detected directly by the tool, while the rest were not associated with a trigger. The percentage of charts that had at least one AE was 35.4%. The most frequent AE found was pressure ulcer (12%), followed by delirium, constipation, nosocomial respiratory infection and altered level of consciousness by drugs. Almost half (47.6%) of the AE were related to drug use, and 32.2% of all AE were considered preventable. The tool demonstrated a sensitivity of 91.3% (95%CI: 88.9-93.2) and a specificity of 32.5% (95%CI: 29.9-35.1). It had a positive predictive value of 42.5% (95%CI: 40.1-45.1) and a negative predictive value of 87.1% (95%CI: 83.8-89.9). The tool used in this study is valid, useful and reproducible for the detection of AE. It also serves to determine rates of injury and to observe their progression over time. A high frequency of both AE and preventable events were observed in this study. Copyright © 2014 SECA. Published by Elsevier Espana. All rights reserved.

  17. Patient safety incident reports related to traditional Japanese Kampo medicines: medication errors and adverse drug events in a university hospital for a ten-year period.

    Science.gov (United States)

    Shimada, Yutaka; Fujimoto, Makoto; Nogami, Tatsuya; Watari, Hidetoshi; Kitahara, Hideyuki; Misawa, Hiroki; Kimbara, Yoshiyuki

    2017-12-21

    Kampo medicine is traditional Japanese medicine, which originated in ancient traditional Chinese medicine, but was introduced and developed uniquely in Japan. Today, Kampo medicines are integrated into the Japanese national health care system. Incident reporting systems are currently being widely used to collect information about patient safety incidents that occur in hospitals. However, no investigations have been conducted regarding patient safety incident reports related to Kampo medicines. The aim of this study was to survey and analyse incident reports related to Kampo medicines in a Japanese university hospital to improve future patient safety. We selected incident reports related to Kampo medicines filed in Toyama University Hospital from May 2007 to April 2017, and investigated them in terms of medication errors and adverse drug events. Out of 21,324 total incident reports filed in the 10-year survey period, we discovered 108 Kampo medicine-related incident reports. However, five cases were redundantly reported; thus, the number of actual incidents was 103. Of those, 99 incidents were classified as medication errors (77 administration errors, 15 dispensing errors, and 7 prescribing errors), and four were adverse drug events, namely Kampo medicine-induced interstitial pneumonia. The Kampo medicine (crude drug) that was thought to induce interstitial pneumonia in all four cases was Scutellariae Radix, which is consistent with past reports. According to the incident severity classification system recommended by the National University Hospital Council of Japan, of the 99 medication errors, 10 incidents were classified as level 0 (an error occurred, but the patient was not affected) and 89 incidents were level 1 (an error occurred that affected the patient, but did not cause harm). Of the four adverse drug events, two incidents were classified as level 2 (patient was transiently harmed, but required no treatment), and two incidents were level 3b (patient was

  18. Motion Pattern Extraction and Event Detection for Automatic Visual Surveillance

    Directory of Open Access Journals (Sweden)

    Benabbas Yassine

    2011-01-01

    Full Text Available Efficient analysis of human behavior in video surveillance scenes is a very challenging problem. Most traditional approaches fail when applied in real conditions and contexts like amounts of persons, appearance ambiguity, and occlusion. In this work, we propose to deal with this problem by modeling the global motion information obtained from optical flow vectors. The obtained direction and magnitude models learn the dominant motion orientations and magnitudes at each spatial location of the scene and are used to detect the major motion patterns. The applied region-based segmentation algorithm groups local blocks that share the same motion direction and speed and allows a subregion of the scene to appear in different patterns. The second part of the approach consists in the detection of events related to groups of people which are merge, split, walk, run, local dispersion, and evacuation by analyzing the instantaneous optical flow vectors and comparing the learned models. The approach is validated and experimented on standard datasets of the computer vision community. The qualitative and quantitative results are discussed.

  19. The association between EMS workplace safety culture and safety outcomes.

    Science.gov (United States)

    Weaver, Matthew D; Wang, Henry E; Fairbanks, Rollin J; Patterson, Daniel

    2012-01-01

    Prior studies have highlighted wide variation in emergency medical services (EMS) workplace safety culture across agencies. To determine the association between EMS workplace safety culture scores and patient or provider safety outcomes. We administered a cross-sectional survey to EMS workers affiliated with a convenience sample of agencies. We recruited these agencies from a national EMS management organization. We used the EMS Safety Attitudes Questionnaire (EMS-SAQ) to measure workplace safety culture and the EMS Safety Inventory (EMS-SI), a tool developed to capture self-reported safety outcomes from EMS workers. The EMS-SAQ provides reliable and valid measures of six domains: safety climate, teamwork climate, perceptions of management, working conditions, stress recognition, and job satisfaction. A panel of medical directors, emergency medical technicians and paramedics, and occupational epidemiologists developed the EMS-SI to measure self-reported injury, medical errors and adverse events, and safety-compromising behaviors. We used hierarchical linear models to evaluate the association between EMS-SAQ scores and EMS-SI safety outcome measures. Sixteen percent of all respondents reported experiencing an injury in the past three months, four of every 10 respondents reported an error or adverse event (AE), and 89% reported safety-compromising behaviors. Respondents reporting injury scored lower on five of the six domains of safety culture. Respondents reporting an error or AE scored lower for four of the six domains, while respondents reporting safety-compromising behavior had lower safety culture scores for five of the six domains. Individual EMS worker perceptions of workplace safety culture are associated with composite measures of patient and provider safety outcomes. This study is preliminary evidence of the association between safety culture and patient or provider safety outcomes.

  20. The German nuclear power plant safety study

    International Nuclear Information System (INIS)

    1979-01-01

    With this study a new approach has been chosen, taking nuclear power plants as an example to assess and to describe the risks arising from the use of modern technology, including those hazards emanating from the rather hypothetical possibility of occurrence of very serious accidents. Following the definition of basic concepts and methods to be applied in risk assessment studied, as well as a brief account of the design and operating mode of nuclear power plants with PWRs', accidents and failures to be considered in a safety study are described. Using the course-of-event and fault tree analysis, the probability of fission product release as a consequence of failures in safety systems or of core meltdown is evaluated. Subsequently, the theoretical model for assessment of reactor accident consequences is presented, discussing such aspects as the dispersion of radioactivity in the atmosphere, the radiation dose model, safety and countermeasures, the model for the evaluation of health hazards as well as methods and calculations for estimating the reliability of risk assessments together with the remaining uncertainties. In an appendix to this study, the analyses presented in the study are discussed in the light of the TMI-2 event. This safety study showing the possibilities of detecting, keeping in check and minimizing harmful effects, can be regarded as a contribution to a better understanding of our modern, highly industrialised society, and eventually to an improvement of the quality of life. (GL) 891 GL/GL 892 MB [de

  1. [Safety data of the new, reduced-dose influenza vaccine FluArt after its first season on the market].

    Science.gov (United States)

    Vajó, Péter; Gyurján, Orsolya; Szabó, Ágnes Mira; Kalabay, László; Vajó, Zoltán; Torzsa, Péter

    2017-12-01

    The currently licensed seasonal influenza vaccines contain split, subunit or whole virions, typically in amounts of 15 µg hemagglutinin per virus strain for adult and up to 60 µg in elderly patients. The present study reports safety data of the newly licensed, reduced dose vaccine with 6 µg of hemagglutinin per strain produced by Fluart (Hungary) after its first season on the market. The main objective of enhanced safety surveillance was to detect a potential increase in reactogenicity and allergic events that is intrinsic to the product in near real-time in the earliest vaccinated cohorts. The study methods were based on the Interim guidance on enhanced safety surveillance for seasonal influenza vaccines in the EU by the European Medicines Agency. We used the Fisher exact test with 95% confidence intervals. We studied 587 patients and detected a total 24 adverse events, all of which have already been known during the licensing studies of the present vaccine. The frequencies of the adverse events were not different from what had been seen with the previously licensed 15 µg vaccine. Based on the results, the authors conclude that the new, reduced dose vaccine FluArt is safe and tolerable. Orv Hetil. 2017; 158(49): 1953-1959.

  2. Improving the safety and protective automatic actions of the CMS electromagnetic calorimeter detector control system

    CERN Document Server

    Jimenez Estupinan, Raul; Cirkovic, Predrag; Di Calafiori, Diogo Raphael; Dissertori, Guenther; Djambazov, Lubomir; Jovanovic, Dragoslav; Lustermann, Werner; Milenovic, Predrag; Zelepoukine, Serguei

    2017-01-01

    The CMS ECAL Detector Control System (DCS) features several monitoring mechanisms able to react and perform automatic actions based on pre-defined action matrices. The DCS is capable of early detection of anomalies inside the ECAL and on its off-detector support systems, triggering automatic actions to mitigate the impact of these events and preventing them from escalating to the safety system. The treatment of such events by the DCS allows for a faster recovery process, better understanding of the development of issues, and in most cases, actions with higher granularity than the safety system. This paper presents the details of the DCS automatic action mechanisms, as well as their evolution based on several years of CMS ECAL operations.

  3. Management of safety culture

    International Nuclear Information System (INIS)

    Kavsek, D.

    2004-01-01

    The strengthening of safety culture in an organization has become an increasingly important issue for nuclear industry. A high level of safety performance is essential for business success in intensely competitive global environment. This presentation offers a discussion of some principles and activities used in enhancing safety performance and appropriate safety behaviour at the Krsko NPP. Over the years a number of events have occurred in nuclear industry that have involved problems in human performance. A review of these and other significant events has identified recurring weaknesses in plant safety culture and policy. Focusing attention on the strengthening of relevant processes can help plants avoid similar undesirable events. The policy of the Krsko NPP is that all employees concerned shall constantly be alert to opportunities to reduce risks to the lowest practicable level and to achieve excellence in plant safety. The most important objective is to protect individuals, society and the environment by establishing and maintaining an effective defense against radiological hazard in the nuclear power plant. It is achieved through the use of reliable structures, components, systems, and procedures, as well as plant personnel committed to a strong safety culture. The elements of safety culture include both organizational and individual aspects. Elements commonly included at the organizational level are senior management commitment to safety, organizational effectiveness, effective communication, organizational learning, and a culture that encourages identification and resolution of safety issues. Elements identified at the individual level include personal accountability, a questioning attitude, communication, procedural adherence, etc.(author)

  4. Cardiovascular safety of linagliptin in type 2 diabetes: a comprehensive patient-level pooled analysis of prospectively adjudicated cardiovascular events.

    Science.gov (United States)

    Rosenstock, Julio; Marx, Nikolaus; Neubacher, Dietmar; Seck, Thomas; Patel, Sanjay; Woerle, Hans-Juergen; Johansen, Odd Erik

    2015-05-21

    The cardiovascular (CV) safety of linagliptin was evaluated in subjects with type 2 diabetes (T2DM). Pre-specified patient-level pooled analysis of all available double-blind, randomized, controlled trials, ≥ 12 weeks' duration (19 trials, 9459 subjects) of linagliptin versus placebo/active treatment. Primary end point: composite of prospectively adjudicated CV death, non-fatal myocardial infarction, non-fatal stroke, and hospitalization for unstable angina (4P-MACE). Hospitalization for congestive heart failure (CHF) was also evaluated; adjudication of CHF was introduced during the phase 3 program (8 trials; 3314 subjects). 4P-MACE was assessed in placebo-controlled trials (subgroup of 18 trials; 7746 subjects). Investigator-reported events suggestive of CHF from 24 placebo-controlled trials (including trials 4P-MACE incidence rates: 13.4 per 1000 patient-years, linagliptin (60 events), 18.9, total comparators (62 events); overall hazard ratio (HR), 0.78 (95% confidence interval [CI], 0.55-1.12). HR for adjudicated hospitalization for CHF (n = 21): 1.04 (0.43-2.47). For placebo-controlled trials, 4P-MACE incidence rates: 14.9 per 1000 patient-years, linagliptin (43 events), 16.4, total comparators (29 events); overall HR, 1.09 (95% CI, 0.68-1.75). Occurrence of investigator-reported events suggestive of CHF was low for linagliptin- (26 events, 0.5%; serious: 16 events, 0.3%) and placebo-treated (8 events, 0.2%; serious: 6 events, 0.2%) patients. Linagliptin is not associated with increased CV risk versus pooled active comparators or placebo in patients with T2DM.

  5. INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

    Energy Technology Data Exchange (ETDEWEB)

    Savchenko, V.; Ferrigno, C.; Bozzo, E.; Courvoisier, T. J.-L. [ISDC, Department of Astronomy, University of Geneva, Chemin d’Écogia, 16 CH-1290 Versoix (Switzerland); Kuulkers, E. [European Space Research and Technology Centre (ESA/ESTEC), Keplerlaan 1, 2201 AZ Noordwijk (Netherlands); Bazzano, A.; Natalucci, L.; Rodi, J. [INAF-Institute for Space Astrophysics and Planetology, Via Fosso del Cavaliere 100, I-00133-Rome (Italy); Brandt, S.; Chenevez, J. [DTU Space, National Space Institute Elektrovej, Building 327 DK-2800 Kongens Lyngby (Denmark); Diehl, R.; Von Kienlin, A. [Max-Planck-Institut für Extraterrestrische Physik, Garching (Germany); Domingo, A. [Centro de Astrobiología (CAB-CSIC/INTA, ESAC Campus), Camino bajo del Castillo S/N, E-28692 Villanueva de la Cañada, Madrid (Spain); Hanlon, L.; Martin-Carrillo, A. [Space Science Group, School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Jourdain, E. [IRAP, Université de Toulouse, CNRS, UPS, CNES, 9 Av. Roche, F-31028 Toulouse (France); Laurent, P.; Lebrun, F. [APC, AstroParticule et Cosmologie, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris Sorbonne Paris Cité, 10 rue Alice Domont et Léonie Duquet, F-75205 Paris Cedex 13 (France); Lutovinov, A. [Space Research Institute of Russian Academy of Sciences, Profsoyuznaya 84/32, 117997 Moscow (Russian Federation); Mereghetti, S. [INAF, IASF-Milano, via E.Bassini 15, I-20133 Milano (Italy); and others

    2017-10-20

    We report the INTernational Gamma-ray Astrophysics Laboratory ( INTEGRAL ) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi -GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi -GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about 2 s after the end of the GW event. We measure a fluence of (1.4 ± 0.4 ± 0.6) × 10{sup −7} erg cm{sup −2} (75–2000 keV), where, respectively, the statistical error is given at the 1σ confidence level, and the systematic error corresponds to the uncertainty in the spectral model and instrument response. We also report on the pointed follow-up observations carried out by INTEGRAL , starting 19.5 hr after the event, and lasting for 5.4 days. We provide a stringent upper limit on any electromagnetic signal in a very broad energy range, from 3 keV to 8 MeV, constraining the soft gamma-ray afterglow flux to <7.1 × 10{sup −11} erg cm{sup −2} s{sup −1} (80–300 keV). Exploiting the unique capabilities of INTEGRAL , we constrained the gamma-ray line emission from radioactive decays that are expected to be the principal source of the energy behind a kilonova event following a BNS coalescence. Finally, we put a stringent upper limit on any delayed bursting activity, for example, from a newly formed magnetar.

  6. The Event Chain of Survival in the Context of Music Festivals: A Framework for Improving Outcomes at Major Planned Events.

    Science.gov (United States)

    Lund, Adam; Turris, Sheila

    2017-08-01

    Despite the best efforts of event producers and on-site medical teams, there are sometimes serious illnesses, life-threatening injuries, and fatalities related to music festival attendance. Producers, clinicians, and researchers are actively seeking ways to reduce the mortality and morbidity associated with these events. After analyzing the available literature on music festival health and safety, several major themes emerged. Principally, stakeholder groups planning in isolation from one another (ie, in silos) create fragmentation, gaps, and overlap in plans for major planned events (MPEs). The authors hypothesized that one approach to minimizing this fragmentation may be to create a framework to "connect the dots," or join together the many silos of professionals responsible for safety, security, health, and emergency planning at MPEs. Adapted from the well-established literature regarding the management of cardiac arrests, both in and out of hospital, the "chain of survival" concept is applied to the disparate groups providing services that support event safety in the context of music festivals. The authors propose this framework for describing, understanding, coordinating and planning around the integration of safety, security, health, and emergency service for events. The adapted Event Chain of Survival contains six interdependent links, including: (1) event producers; (2) police and security; (3) festival health; (4) on-site medical services; (5) ambulance services; and (6) off-site medical services. The authors argue that adapting and applying this framework in the context of MPEs in general, and music festivals specifically, has the potential to break down the current disconnected approach to event safety, security, health, and emergency planning. It offers a means of shifting the focus from a purely reactive stance to a more proactive, collaborative, and integrated approach. Improving health outcomes for music festival attendees, reducing gaps in planning

  7. An Event-Triggered Machine Learning Approach for Accelerometer-Based Fall Detection.

    Science.gov (United States)

    Putra, I Putu Edy Suardiyana; Brusey, James; Gaura, Elena; Vesilo, Rein

    2017-12-22

    The fixed-size non-overlapping sliding window (FNSW) and fixed-size overlapping sliding window (FOSW) approaches are the most commonly used data-segmentation techniques in machine learning-based fall detection using accelerometer sensors. However, these techniques do not segment by fall stages (pre-impact, impact, and post-impact) and thus useful information is lost, which may reduce the detection rate of the classifier. Aligning the segment with the fall stage is difficult, as the segment size varies. We propose an event-triggered machine learning (EvenT-ML) approach that aligns each fall stage so that the characteristic features of the fall stages are more easily recognized. To evaluate our approach, two publicly accessible datasets were used. Classification and regression tree (CART), k -nearest neighbor ( k -NN), logistic regression (LR), and the support vector machine (SVM) were used to train the classifiers. EvenT-ML gives classifier F-scores of 98% for a chest-worn sensor and 92% for a waist-worn sensor, and significantly reduces the computational cost compared with the FNSW- and FOSW-based approaches, with reductions of up to 8-fold and 78-fold, respectively. EvenT-ML achieves a significantly better F-score than existing fall detection approaches. These results indicate that aligning feature segments with fall stages significantly increases the detection rate and reduces the computational cost.

  8. Safety design requirements for safety systems and components of JSFR

    International Nuclear Information System (INIS)

    Kubo, Shigenobu; Shimakawa, Yoshio; Yamano, Hidemasa; Kotake, Shoji

    2011-01-01

    Safety design requirements for JSFR were summarized taking the development targets of the FaCT project and design feature of JSFR into account. The related safety principle and requirements for Monju, CRBRP, PRISM, SPX, LWRs, IAEA standards, goals of GIF, basic principle of INPRO etc. were also taken into account so that the safety design requirements can be a next-generation global standard. The development targets for safety and reliability are set based on those of FaCT, namely, ensuring safety and reliability equal to future LWR and related fuel cycle facilities. In order to achieve these targets, the defence-in-depth concept is used as the basic safety design principle. General features of the safety design requirements are 1) Achievement of higher reliability, 2) Achievement of higher inspectability and maintainability, 3) Introduction of passive safety features, 4) Reduction of operator action needs, 5) Design consideration against Beyond Design Basis Events, 6) In-Vessel Retention of degraded core materials, 7) Prevention and mitigation against sodium chemical reactions, and 8) Design against external events. The current specific requirements for each system and component are summarized taking the basic design concept of JSFR into account, which is an advanced loop-type large-output power plant with a mixed-oxide-fuelled core. (author)

  9. Probabilistic safety assessment goals in Canada

    International Nuclear Information System (INIS)

    Snell, V.G.

    1986-01-01

    CANDU safety philosphy, both in design and in licensing, has always had a strong bias towards quantitative probabilistically-based goals derived from comparative safety. Formal probabilistic safety assessment began in Canada as a design tool. The influence of this carried over later on into the definition of the deterministic safety guidelines used in CANDU licensing. Design goals were further developed which extended the consequence/frequency spectrum of 'acceptable' events, from the two points defined by the deterministic single/dual failure analysis, to a line passing through lower and higher frequencies. Since these were design tools, a complete risk summation was not necessary, allowing a cutoff at low event frequencies while preserving the identification of the most significant safety-related events. These goals gave a logical framework for making decisions on implementing design changes proposed as a result of the Probabilistic Safety Analysis. Performing this analysis became a regulatory requirement, and the design goals remained the framework under which this was submitted. Recently, there have been initiatives to incorporate more detailed probabilistic safety goals into the regulatory process in Canada. These range from far-reaching safety optimization across society, to initiatives aimed at the nuclear industry only. The effectiveness of the latter is minor at very low and very high event frequencies; at medium frequencies, a justification against expenditures per life saved in other industries should be part of the goal setting

  10. FOREWORD: 3rd Symposium on Large TPCs for Low Energy Event Detection

    Science.gov (United States)

    Irastorza, Igor G.; Colas, Paul; Gorodetzky, Phillippe

    2007-05-01

    The Third International Symposium on large TPCs for low-energy rare-event detection was held at Carré des sciences, Poincaré auditorium, 25 rue de la Montagne Ste Geneviève in Paris on 11 12 December 2006. This prestigious location belonging to the Ministry of Research is hosted in the former Ecole Polytechnique. The meeting, held in Paris every two years, gathers a significant community of physicists involved in rare event detection. Its purpose is an extensive discussion of present and future projects using large TPCs for low energy, low background detection of rare events (low-energy neutrinos, dark matter, solar axions). The use of a new generation of Micro-Pattern Gaseous Detectors (MPGD) appears to be a promising way to reach this goal. The program this year was enriched by a new session devoted to the detection challenge of polarized gamma rays, relevant novel experimental techniques and the impact on particle physics, astrophysics and astronomy. A very particular feature of this conference is the large variety of talks ranging from purely theoretical to purely experimental subjects including novel technological aspects. This allows discussion and exchange of useful information and new ideas that are emerging to address particle physics experimental challenges. The scientific highlights at the Symposium came on many fronts: Status of low-energy neutrino physics and double-beta decay New ideas on double-beta decay experiments Gamma ray polarization measurement combining high-precision TPCs with MPGD read-out Dark Matter challenges in both axion and WIMP search with new emerging ideas for detection improvements Progress in gaseous and liquid TPCs for rare event detection Georges Charpak opened the meeting with a talk on gaseous detectors for applications in the bio-medical field. He also underlined the importance of new MPGD detectors for both physics and applications. There were about 100 registered participants at the symposium. The successful

  11. Practices and Exploration on Competition of Molecular Biological Detection Technology among Students in Food Quality and Safety Major

    Science.gov (United States)

    Chang, Yaning; Peng, Yuke; Li, Pengfei; Zhuang, Yingping

    2017-01-01

    With the increasing importance in the application of the molecular biological detection technology in the field of food safety, strengthening education in molecular biology experimental techniques is more necessary for the culture of the students in food quality and safety major. However, molecular biology experiments are not always in curricula…

  12. Nano-biosensors as new tool for detection of food quality and safety

    Directory of Open Access Journals (Sweden)

    2010-12-01

    Full Text Available Nanosensors can be defined as sensors based on nanotechnology. The aim of some nanobiosensor projects at potentially high volume applications in the public health sector, as preventing food poisoning where markets might be significant, while the other aim to improve on existing clinical practises by allowing the more quantification and rapid detection of bacteria and viruses. It should increase the safety of the food for the customer.

  13. Safety for Users

    CERN Multimedia

    HR Department

    2008-01-01

    CERN welcomes more than 8000 Users every year. The PH Department as host to these scientific associates requires the highest safety standards. The PH Safety Office has published a Safety Flyer for Users. Important safety topics and procedures are presented. Although the Flyer is intended primarily to provide safety information for Users, the PH Safety Office invites all those on the CERN sites to keep a copy of the flyer as it gives guidance in matters of safety and explains what to do in the event of an emergency. Link: http://ph-dep.web.cern.ch/ph-dep/Safety/SafetyOffice.html PH-Safety Office PH Department

  14. Safety for Users

    CERN Multimedia

    HR Department

    2008-01-01

    CERN welcomes more than 8000 Users every year. The PH Department as host to these scientific associates requires the highest safety standards. The PH Safety Office has published a safety flyer for Users. Important safety topics and procedures are presented. Although the flyer is intended primarily to provide safety information for Users, the PH Safety Office invites all those on the CERN sites to keep a copy of the flyer as it gives guidance in matters of safety and explains what to do in the event of an emergency. The flyer is available at: http://ph-dep.web.cern.ch/ph-dep/Safety/SafetyOffice.html PH-Safety Office PH Department

  15. Event-by-event simulation of quantum phenomena

    NARCIS (Netherlands)

    De Raedt, Hans; Michielsen, Kristel

    A discrete-event simulation approach is reviewed that does not require the knowledge of the solution of the wave equation of the whole system, yet reproduces the statistical distributions of wave theory by generating detection events one-by-one. The simulation approach is illustrated by applications

  16. A System for the Feedback of Experience from Events in Nuclear Installations. Safety Guide (Spanish Edition); Un sistema de retroinformacion sobre la experiencia derivada de sucesos ocurridos en establecimientos nucleares. Guia de seguridad

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-07-15

    This Safety Guide provides recommendations on all the main components of operating experience feedback systems, utilizing relevant information on events and abnormal conditions that have occurred at nuclear installations around the world. It focuses on the interaction between the different systems for using operating experience feedback and constitutes an update and an extension of Part I, A National System, of Systems for Reporting Unusual Events in Nuclear Power Plants (IAEA Safety Series No. 93). Contents: 1. Introduction; 2. Main elements of a national system for the feedback of operational experience; 3. Screening of events; 4. Investigation and analysis of events; 5. Corrective actions; 6. Trending and review to recognize emergent problems; 7. Utilization, dissemination and exchange of information on operating experience; 8. Reviewing the effectiveness of the process for feedback of operational experience; 9. Quality assurance; 10. Reporting of safety related events; Appendix I: Reporting criteria and categories; Appendix II: Types of event report, timing, format and content; Appendix III: Investigation and analysis of events; Appendix IV: Approval and implementation of corrective actions; Annex I: Data management for the feedback of operating experience; Annex II: Example of elements of a national feedback system for operating experience.

  17. Independent safety organization

    International Nuclear Information System (INIS)

    Kato, W.Y.; Weinstock, E.V.; Carew, J.F.; Cerbone, R.J.; Guppy, J.G.; Hall, R.E.; Taylor, J.H.

    1985-01-01

    Brookhaven National Laboratory has conducted a study on the need and feasibility of an independent organization to investigate significant safety events for the Office for Analysis and Evaluation of Operational Data, USNRC. The study consists of three parts: the need for an independent organization to investigate significant safety events, alternative organizations to conduct investigations, and legislative requirements. The determination of need was investigated by reviewing current NRC investigation practices, comparing aviation and nuclear industry practices, and interviewing a spectrum of representatives from the nuclear industry, the regulatory agency, and the public sector. The advantages and disadvantages of alternative independent organizations were studied, namely, an Office of Nuclear Safety headed by a director reporting to the Executive Director for Operations (EDO) of NRC; an Office of Nuclear Safety headed by a director reporting to the NRC Commissioners; a multi-member NTSB-type Nuclear Safety Board independent of the NRC. The costs associated with operating a Nuclear Safety Board were also included in the study. The legislative requirements, both new authority and changes to the existing NRC legislative authority, were studied. 134 references

  18. Study on the KALIMER safety approach

    International Nuclear Information System (INIS)

    Kim, Eui Kwang; Han, Do Hee; Kim, Young Cheol.

    1997-01-01

    This study describes KALIMER's safety approach, how to establish the safety criteria and temperature limit, how to define safety evaluation events, and some safety research and development needs items. It is recommended that the KALIMER's approach to safety use seven levels of safety design and a defense-in-depth design approach with particular emphasis on inherent passive features. In order to establish as set DBEs for KALIMER safety evaluation, the procedure is explained how to define safety evaluation events. Final selection is to be determined later with the final establishment of design concepts. On the basis of preliminary studies and evaluation of the plant safety related areas, the KALIMER and PRISM have following three main difference that may require special research and development for KALIMER. (author). 7 refs., 6 tabs., 6 figs

  19. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  20. Unusual event report from Oskarshamn

    International Nuclear Information System (INIS)

    1996-01-01

    The title of the report was intended to reflect the cause of the shutdown and the report to be regarded as a summary of the deficiencies that had been revealed and remedied. No single deficiency was regarded as reportable as an unusual event, but taken together the identified deficiencies deviated from the assumed safety level to the extent that it should be reported. The unusual event report refers to two main documents presenting measures taken to return to reported safety level, one concerning technical and one organizational measures

  1. Safety analysis for research reactors

    International Nuclear Information System (INIS)

    2008-01-01

    The aim of safety analysis for research reactors is to establish and confirm the design basis for items important to safety using appropriate analytical tools. The design, manufacture, construction and commissioning should be integrated with the safety analysis to ensure that the design intent has been incorporated into the as-built reactor. Safety analysis assesses the performance of the reactor against a broad range of operating conditions, postulated initiating events and other circumstances, in order to obtain a complete understanding of how the reactor is expected to perform in these situations. Safety analysis demonstrates that the reactor can be kept within the safety operating regimes established by the designer and approved by the regulatory body. This analysis can also be used as appropriate in the development of operating procedures, periodic testing and inspection programmes, proposals for modifications and experiments and emergency planning. The IAEA Safety Requirements publication on the Safety of Research Reactors states that the scope of safety analysis is required to include analysis of event sequences and evaluation of the consequences of the postulated initiating events and comparison of the results of the analysis with radiological acceptance criteria and design limits. This Safety Report elaborates on the requirements established in IAEA Safety Standards Series No. NS-R-4 on the Safety of Research Reactors, and the guidance given in IAEA Safety Series No. 35-G1, Safety Assessment of Research Reactors and Preparation of the Safety Analysis Report, providing detailed discussion and examples of related topics. Guidance is given in this report for carrying out safety analyses of research reactors, based on current international good practices. The report covers all the various steps required for a safety analysis; that is, selection of initiating events and acceptance criteria, rules and conventions, types of safety analysis, selection of

  2. Radiation safety assessment of cobalt 60 external beam radiotherapy using the risk-matrix method

    International Nuclear Information System (INIS)

    Dumenigo, C; Vilaragut, J.J.; Ferro, R.; Guillen, A.; Ramirez, M.L.; Ortiz Lopez, P.; Rodriguez, M.; McDonnell, J.D.; Papadopulos, S.; Pereira, P.P.; Goncalvez, M.; Morales, J.; Larrinaga, E.; Lopez Morones, R.; Sanchez, R.; Delgado, J.M.; Sanchez, C.; Somoano, F.

    2008-01-01

    External beam radiotherapy is the only practice in which humans are placed directly in a radiation beam with the intention to deliver a very high dose. This is why safety in radiotherapy is very critical, and is a matter of interest to both radiotherapy departments and regulatory bodies. Accidental exposures have occurred throughout the world, thus showing the need for systematic safety assessments, capable to identify preventive measures and to minimize consequences of accidental exposure. Risk-matrix is a systematic approach which combines the relevant event features to assess the overall risk of each particular event. Once an event sequence is identified, questions such as how frequent the event, how severe the potential consequences and how reliable the existing safety measures are answered in a risk-matrix table. The ultimate goal is to achieve that the overall risk for events with severe consequences should always be low o very low. In the present study, the risk-matrix method has been applied to an hypothetical radiotherapy department, which could be equivalent to an upper level hospital of the Ibero American region, in terms of safety checks and preventive measures. The application of the method has identified 76 event sequences and revealed that the hypothetical radiotherapy department is sufficiently protected (low risk) against them, including 23 event sequences with severe consequences. The method has revealed that the risk of these sequences could grow to high level if certain specific preventive measures were degraded with time. This study has identified these preventive measures, thus facilitating a rational allocation of resources in regular controls to detect any loss of reliability. The method has proven to have an important practical value and is affordable at hospital level. The elaborated risk-matrix can be easily adapted to local circumstances, in terms of existing controls and safety measures. This approach can help hospitals to identify

  3. Drug Safety Monitoring in Children: Performance of Signal Detection Algorithms and Impact of Age Stratification

    NARCIS (Netherlands)

    O.U. Osokogu (Osemeke); C. Dodd (Caitlin); A.C. Pacurariu (Alexandra C.); F. Kaguelidou (Florentia); D.M. Weibel (Daniel); M.C.J.M. Sturkenboom (Miriam)

    2016-01-01

    textabstractIntroduction: Spontaneous reports of suspected adverse drug reactions (ADRs) can be analyzed to yield additional drug safety evidence for the pediatric population. Signal detection algorithms (SDAs) are required for these analyses; however, the performance of SDAs in the pediatric

  4. Prediction of Clinically Relevant Safety Signals of Nephrotoxicity through Plasma Metabolite Profiling

    Directory of Open Access Journals (Sweden)

    W. B. Mattes

    2013-01-01

    Full Text Available Addressing safety concerns such as drug-induced kidney injury (DIKI early in the drug pharmaceutical development process ensures both patient safety and efficient clinical development. We describe a unique adjunct to standard safety assessment wherein the metabolite profile of treated animals is compared with the MetaMap Tox metabolomics database in order to predict the potential for a wide variety of adverse events, including DIKI. To examine this approach, a study of five compounds (phenytoin, cyclosporin A, doxorubicin, captopril, and lisinopril was initiated by the Technology Evaluation Consortium under the auspices of the Drug Safety Executive Council (DSEC. The metabolite profiles for rats treated with these compounds matched established reference patterns in the MetaMap Tox metabolomics database indicative of each compound’s well-described clinical toxicities. For example, the DIKI associated with cyclosporine A and doxorubicin was correctly predicted by metabolite profiling, while no evidence for DIKI was found for phenytoin, consistent with its clinical picture. In some cases the clinical toxicity (hepatotoxicity, not generally seen in animal studies, was detected with MetaMap Tox. Thus metabolite profiling coupled with the MetaMap Tox metabolomics database offers a unique and powerful approach for augmenting safety assessment and avoiding clinical adverse events such as DIKI.

  5. Shutdown Safety in NEK

    International Nuclear Information System (INIS)

    Gluhak, Mario; Senegovic, Marko

    2014-01-01

    Industry performance analysis since 2004 has revealed that 23% of the events reported to WANO occurred during outage periods. Given the fact that a plant is in the outage only 5 percent of the time, this emphasizes the importance of shutdown safety and measures station staffs undertake to maintain effective barriers to safety margins during the outage. Back in 1990s, the industry adopted guidance to meet safety requirements by focusing on safety functions. Both WANO and INPO released various documents, reports and guidelines to help accomplish those requirements. However, in the last decade inadequate 'defence in depth' has led to several events affecting shutdown safety and challenging one of the most important nuclear safety principles: 'The special characteristics of nuclear technology are taken into account in all decisions and actions. Reactivity control, continuity of core cooling, and integrity of fission product barriers are valued as essential, distinguishing attributes of nuclear station work environment'. NEK has recognized the importance of 'defence in depth'Industry performance analysis since 2004 has revealed that 23% of the events reported to WANO occurred during outage periods. Given the fact that a plant is in the outage only 5 percent of the time, this emphasizes the importance of shutdown safety and measures station staffs undertake to maintain effective barriers to safety margins during the outage. Back in 1990s, the industry adopted guidance to meet safety requirements by focusing on safety functions. Both WANO and INPO released various documents, reports and guidelines to help accomplish those requirements. However, in the last decade inadequate 'defence in depth' has led to several events affecting shutdown safety and challenging one of the most important nuclear safety principles: 'The special characteristics of nuclear technology are taken into account in all decisions and actions. Reactivity

  6. Liquid metal reactor development -Studies on safety measure of LMR coolant

    International Nuclear Information System (INIS)

    Hwang, Sung Tae; Choi, Yoon Dong; Park, Jin Hoh; Kwon, Sun Kil; Choi, Jong Hyun; Cho, Byung Ryul; Kim, Tae Joon; Kwon, Sang Woon; Jung, Kyung Chae; Kim, Byung Hoh; Hong, Soon Bok; Jung, Ji Yung

    1995-07-01

    A study on the safety measures of LMR coolant showed the results as follows; 1. LMR coolant safety measure. A. Analysis and improvement of sodium fire code. B. Analysis of sodium fire phenomena. 2. Sodium fire aerosol characteristics. It was carried out conceptual design and basic design for sodium fire facility of medium size composed of sodium supply tank, sodium reactor vessel, sodium fire aerosol filter system and scrubbing column, and drain tank etc. 3. Sodium purification technology. A. Construction of calibration loop. (1) Design of sodium loop for the calibration of the equipment. (2) Construction of sodium loop including test equipments and other components. B. Na-analysis technology. (1) Oxygen concentration determination by the wet method. (2) Cover gas purification preliminary experiment. 4. The characteristics of sodium-water reaction. A. Analysis of the micro and small leak phenomena. (1) Manufacture of the micro-leak test apparatus. B. Analysis of large leak events. (1) Development of preliminary code for analysis of initial spike pressure. (2) Sample calculation and comparison with previous works. C. Development of test facility for large leak event evaluation. (1) Conceptional and basic design for the water and sodium-water test facility. D. Technology development for water leak detection system. (1) Investigations for the characteristics of active acoustic detection system. (2) Testing of the characteristics of hydrogen leak detection system. 171 figs, 29 tabs, 3 refs. (Author)

  7. Liquid metal reactor development -Studies on safety measure of LMR coolant

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Sung Tae; Choi, Yoon Dong; Park, Jin Hoh; Kwon, Sun Kil; Choi, Jong Hyun; Cho, Byung Ryul; Kim, Tae Joon; Kwon, Sang Woon; Jung, Kyung Chae; Kim, Byung Hoh; Hong, Soon Bok; Jung, Ji Yung [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1995-07-01

    A study on the safety measures of LMR coolant showed the results as follows; 1. LMR coolant safety measure. A. Analysis and improvement of sodium fire code. B. Analysis of sodium fire phenomena. 2. Sodium fire aerosol characteristics. It was carried out conceptual design and basic design for sodium fire facility of medium size composed of sodium supply tank, sodium reactor vessel, sodium fire aerosol filter system and scrubbing column, and drain tank etc. 3. Sodium purification technology. A. Construction of calibration loop. (1) Design of sodium loop for the calibration of the equipment. (2) Construction of sodium loop including test equipments and other components. B. Na-analysis technology. (1) Oxygen concentration determination by the wet method. (2) Cover gas purification preliminary experiment. 4. The characteristics of sodium-water reaction. A. Analysis of the micro and small leak phenomena. (1) Manufacture of the micro-leak test apparatus. B. Analysis of large leak events. (1) Development of preliminary code for analysis of initial spike pressure. (2) Sample calculation and comparison with previous works. C. Development of test facility for large leak event evaluation. (1) Conceptional and basic design for the water and sodium-water test facility. D. Technology development for water leak detection system. (1) Investigations for the characteristics of active acoustic detection system. (2) Testing of the characteristics of hydrogen leak detection system. 171 figs, 29 tabs, 3 refs. (Author).

  8. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. National Waste Repository Novi Han operational safety analysis report. Safety assessment methodology

    International Nuclear Information System (INIS)

    2003-01-01

    The scope of the safety assessment (SA), presented includes: waste management functions (acceptance, conditioning, storage, disposal), inventory (current and expected in the future), hazards (radiological and non-radiological) and normal and accidental modes. The stages in the development of the SA are: criteria selection, information collection, safety analysis and safety assessment documentation. After the review the facilities functions and the national and international requirements, the criteria for safety level assessment are set. As a result from the 2nd stage actual parameters of the facility, necessary for safety analysis are obtained.The methodology is selected on the base of the comparability of the results with the results of previous safety assessments and existing standards and requirements. The procedure and requirements for scenarios selection are described. A radiological hazard categorisation of the facilities is presented. Qualitative hazards and operability analysis is applied. The resulting list of events are subjected to procedure for prioritization by method of 'criticality analysis', so the estimation of the risk is given for each event. The events that fall into category of risk on the boundary of acceptability or are unacceptable are subjected to the next steps of the analysis. As a result the lists with scenarios for PSA and possible design scenarios are established. PSA logical modeling and quantitative calculations of accident sequences are presented

  10. Distributed fiber optic sensing enhances pipeline safety and security

    Energy Technology Data Exchange (ETDEWEB)

    Frings, Jochen; Walk, Tobias [ILF Consulting Engineers, Munich (Germany)

    2011-09-15

    Pipelines are efficient, highly reliable and safe means of transportation. However, despite intensive right of way surveillance by foot, car and out of the air, pipeline leaks and illegal tappings are a reality - sometimes with catastrophic results. These events show a gap in real-time monitoring caused by the highly distributed nature of pipelines. Parts of this gap now can be closed with distributed fiber optic sensing technology. Using various physical effects this technology is apt to detect temperature, strain, vibrations and sound with very good localization over spans up to 50 km with a single sensor cable. Various field tested applications like leakage detection, third party activity monitoring and intrusion detection or ground movement detection as well as integrity monitoring proof that distributed fiber optic sensing can enhance pipeline safety and security. (orig.)

  11. Patient safety goals for the proposed Federal Health Information Technology Safety Center.

    Science.gov (United States)

    Sittig, Dean F; Classen, David C; Singh, Hardeep

    2015-03-01

    The Office of the National Coordinator for Health Information Technology is expected to oversee creation of a Health Information Technology (HIT) Safety Center. While its functions are still being defined, the center is envisioned as a public-private entity focusing on promotion of HIT related patient safety. We propose that the HIT Safety Center leverages its unique position to work with key administrative and policy stakeholders, healthcare organizations (HCOs), and HIT vendors to achieve four goals: (1) facilitate creation of a nationwide 'post-marketing' surveillance system to monitor HIT related safety events; (2) develop methods and governance structures to support investigation of major HIT related safety events; (3) create the infrastructure and methods needed to carry out random assessments of HIT related safety in complex HCOs; and (4) advocate for HIT safety with government and private entities. The convening ability of a federally supported HIT Safety Center could be critically important to our transformation to a safe and effective HIT enabled healthcare system. © The Author 2014. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Evaluation of Adverse Events in Total Disc Replacement: A Meta-Analysis of FDA Summary of Safety and Effectiveness Data.

    Science.gov (United States)

    Anderson, Paul A; Nassr, Ahmad; Currier, Bradford L; Sebastian, Arjun S; Arnold, Paul M; Fehlings, Michael G; Mroz, Thomas E; Riew, K Daniel

    2017-04-01

    Systematic review and meta-analysis. The safety of new technology such as cervical total disc replacement (TDR) is of paramount importance and is best evaluated in randomized clinical trials (RCT). We compared complication risks of TDR to fusion using data from Investigational Device Exemptions. A systematic review of FDA Summary of Safety and Effectiveness reports of the 8 approved cervical TDRs was performed. These were all randomized controlled trials comparing anterior cervical discectomy and fusion (ACDF) to TDR. Important outcome variables were dysphagia, wound infection, neurologic injuries, heterotopic ossification, death, and secondary surgeries. A random effects model was selected a priori. Data on adverse events was abstracted and analyzed by calculating relative risk of ACDF to TDR by meta-analysis techniques. The study included 3027 patients with 1377 randomized to ACDF and 1652 to TDR. No statistical differences were present between the 2 groups in dysphagia/dysphonia, hardware related, heterotopic ossification, death, and overall neurologic adverse events and incidence of neurologic deterioration. The relative risk of wound-related problems ACDF to TDR was 0.76 (95% confidence interval [CI] = 0.59, 0.98) favoring ACDF, which was statistically significant, but these were minor and never required a second surgical procedure for deep wound infection. The relative risk of ACDF to TDR in surgical-related neurologic events and secondary surgeries was 1.62 (95% CI = 1.04, 2.53) and 1.79 (95% CI = 1.17, 2.74), both favoring TDR. Cervical TDR appears to be as safe as or safer than ACDF at 2-year follow-up.

  13. Aging of safety class 1E transformers in safety systems of nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, E.W.; Edson, J.L.; Udy, A.C. [Lockheed Idaho Technologies Co., Idaho Falls, ID (United States)

    1996-02-01

    This report discusses aging effects on safety-related power transformers in nuclear power plants. It also evaluates maintenance, testing, and monitoring practices with respect to their effectiveness in detecting and mitigating the effects of aging. The study follows the US Nuclear Regulatory Commission`s (NRC`s) Nuclear Plant-Aging Research approach. It investigates the materials used in transformer construction, identifies stressors and aging mechanisms, presents operating and testing experience with aging effects, analyzes transformer failure events reported in various databases, and evaluates maintenance practices. Databases maintained by the nuclear industry were analyzed to evaluate the effects of aging on the operation of nuclear power plants.

  14. Associations of patient safety outcomes with models of nursing care organization at unit level in hospitals.

    Science.gov (United States)

    Dubois, Carl-Ardy; D'amour, Danielle; Tchouaket, Eric; Clarke, Sean; Rivard, Michèle; Blais, Régis

    2013-04-01

    To examine the associations of four distinct nursing care organizational models with patient safety outcomes. Cross-sectional correlational study. Using a standardized protocol, patients' records were screened retrospectively to detect occurrences of patient safety-related events. Binary logistic regression was used to assess the associations of those events with four nursing care organizational models. Twenty-two medical units in 11 hospitals in Quebec, Canada, were clustered into 4 nursing care organizational models: 2 professional models and 2 functional models. Two thousand six hundred and ninety-nine were patients hospitalized for at least 48 h on the selected units. Composite of six safety-related events widely-considered sensitive to nursing care: medication administration errors, falls, pneumonia, urinary tract infection, unjustified restraints and pressure ulcers. Events were ultimately sorted into two categories: events 'without major' consequences for patients and events 'with' consequences. After controlling for patient characteristics, patient risk of experiencing one or more events (of any severity) and of experiencing an event with consequences was significantly lower, by factors of 25-52%, in both professional models than in the functional models. Event rates for both functional models were statistically indistinguishable from each other. Data suggest that nursing care organizational models characterized by contrasting staffing, work environment and innovation characteristics may be associated with differential risk for hospitalized patients. The two professional models, which draw mainly on registered nurses (RNs) to deliver nursing services and reflect stronger support for nurses' professional practice, were associated with lower risks than are the two functional models.

  15. Semblance for microseismic event detection

    Czech Academy of Sciences Publication Activity Database

    Staněk, František; Anikiev, D.; Valenta, Jan; Eisner, Leo

    2015-01-01

    Roč. 201, č. 3 (2015), s. 1362-1369 ISSN 0956-540X R&D Projects: GA ČR GAP210/12/2451 Institutional support: RVO:67985891 Keywords : microseismic event * microseismic monitoring * source mechanisms Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.484, year: 2015

  16. On-line early fault detection and diagnosis of municipal solid waste incinerators

    International Nuclear Information System (INIS)

    Zhao Jinsong; Huang Jianchao; Sun Wei

    2008-01-01

    A fault detection and diagnosis framework is proposed in this paper for early fault detection and diagnosis (FDD) of municipal solid waste incinerators (MSWIs) in order to improve the safety and continuity of production. In this framework, principal component analysis (PCA), one of the multivariate statistical technologies, is used for detecting abnormal events, while rule-based reasoning performs the fault diagnosis and consequence prediction, and also generates recommendations for fault mitigation once an abnormal event is detected. A software package, SWIFT, is developed based on the proposed framework, and has been applied in an actual industrial MSWI. The application shows that automated real-time abnormal situation management (ASM) of the MSWI can be achieved by using SWIFT, resulting in an industrially acceptable low rate of wrong diagnosis, which has resulted in improved process continuity and environmental performance of the MSWI

  17. MAPLE-X10 reactor safety assessment

    International Nuclear Information System (INIS)

    Cotnam, K.D.; Lounsbury, R.I.; Gillespie, G.E.

    1990-01-01

    This paper reports on the safety assessment of the 10 MW MAPLE-X10 reactor which has involved a substantial component of PSA analysis to supplement deterministic analysis. Initiating events are identified through the use of a master logic diagram. The events are then examined through event sequence diagrams, at the concept design stage, followed by a set of reliability analyses that are coordinated with the event sequence diagrams. Improvements identified through the reliability analyses are incorporated into the design to ensure that safety objectives are attained

  18. Nuclear safety review for the year 2001

    International Nuclear Information System (INIS)

    2002-07-01

    The Nuclear Safety Review for the Year 2001 reports on worldwide efforts to strengthen nuclear and radiation safety, including radioactive waste safety. It is in three parts. Part 1 describes those events in 2001 that have, or may have, significance for nuclear, radiation and waste safety worldwide. It includes developments such as new initiatives in international cooperation, events of safety significance and events that may be indicative of trends in safety. Part 2 describes some of the IAEA's efforts to strengthen international co-operation in nuclear, radiation and waste safety during 2001. It covers legally binding international agreements, non-binding safety standards, and provisions for the application of safety standards. This is done in a very brief manner, because these issues are addressed in more detail in the Agency's Annual Report for 2001. Part 3 presents a brief look ahead to some issues that are likely to be prominent in the coming year(s). The topics covered were selected by the IAEA Secretariat on the basis of trends observed in recent years, account being taken of planned or expected future developments. A draft of the Nuclear Safety Review for the Year 2001 was presented to the March 2002 session of IAEA's Board of Governors. This final version has been prepared taking account of the discussion in the Board. In some places, information has been added to describe developments early in 2002 that were considered pertinent to the discussion of events during 2001

  19. Cross-comparison of three surrogate safety methods to diagnose cyclist safety problems at intersections in Norway.

    Science.gov (United States)

    Laureshyn, Aliaksei; Goede, Maartje de; Saunier, Nicolas; Fyhri, Aslak

    2017-08-01

    Relying on accident records as the main data source for studying cyclists' safety has many drawbacks, such as high degree of under-reporting, the lack of accident details and particularly of information about the interaction processes that led to the accident. It is also an ethical problem as one has to wait for accidents to happen in order to make a statement about cyclists' (un-)safety. In this perspective, the use of surrogate safety measures based on actual observations in traffic is very promising. In this study we used video data from three intersections in Norway that were all independently analysed using three methods: the Swedish traffic conflict technique (Swedish TCT), the Dutch conflict technique (DOCTOR) and the probabilistic surrogate measures of safety (PSMS) technique developed in Canada. The first two methods are based on manual detection and counting of critical events in traffic (traffic conflicts), while the third considers probabilities of multiple trajectories for each interaction and delivers a density map of potential collision points per site. Due to extensive use of microscopic data, PSMS technique relies heavily on automated tracking of the road users in video. Across the three sites, the methods show similarities or are at least "compatible" with the accident records. The two conflict techniques agree quite well for the number, type and location of conflicts, but some differences with no obvious explanation are also found. PSMS reports many more safety-relevant interactions including less severe events. The location of the potential collision points is compatible with what the conflict techniques suggest, but the possibly significant share of false alarms due to inaccurate trajectories extracted from video complicates the comparison. The tested techniques still require enhancement, with respect to better adjustment to analysis of the situations involving cyclists (and vulnerable road users in general) and further validation. However, we

  20. [Performance and optimisation of a trigger tool for the detection of adverse events in hospitalised adult patients].

    Science.gov (United States)

    Guzmán Ruiz, Óscar; Pérez Lázaro, Juan José; Ruiz López, Pedro

    To characterise the performance of the triggers used in the detection of adverse events (AE) of hospitalised adult patients and to define a simplified panel of triggers to facilitate the detection of AE. Cross-sectional study of charts of patients from a service of internal medicine to detect EA through systematic review of the charts and identification of triggers (clinical event often related to AE), determining if there was AE as the context in which it appeared the trigger. Once the EA was detected, we proceeded to the characterization of the triggers that detected it. Logistic regression was applied to select the triggers with greater AE detection capability. A total of 291 charts were reviewed, with a total of 562 triggers in 103 patients, of which 163 were involved in detecting an AE. The triggers that detected the most AE were "A.1. Pressure ulcer" (9.82%), "B.5. Laxative or enema" (8.59%), "A.8. Agitation" (8.59%), "A.9. Over-sedation" (7.98%), "A.7. Haemorrhage" (6.75%) and "B.4. Antipsychotic" (6.75%). A simplified model was obtained using logistic regression, and included the variable "Number of drugs" and the triggers "Over-sedation", "Urinary catheterisation", "Readmission in 30 days", "Laxative or enema" and "Abrupt medication stop". This model showed a probability of 81% to correctly classify charts with EA or without EA (p <0.001; 95% confidence interval: 0.763-0.871). A high number of triggers were associated with AE. The summary model is capable of detecting a large amount of AE, with a minimum of elements. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.