Ewa Koc-Zorawska; Jerzy Janica; Malgorzata Skawronska; Jacek Robert Janica; Witold Pepinski; Anna Niemcunowicz-Janica; Ireneusz Stolyszewski
2008-01-01
In cases of decomposed bodies Y chromosomal STR markers may be useful in identification of a male relative. The authors assessed typeability PowerPlex Y (Promega) loci in tissue material stored in water and soil environment. Tissue material was collected during autopsies of five persons aged 20-30 years with time of death determined within the limit of 14 hours. Heart muscle, liver and lung specimens were stored in pond water, sea water, sand and peat soil. DNA was extracted by organic method...
Góes, Andrea Carla de Souza; Silva, Dayse Aparecida da; Gil, Érica Helena Fonseca; Silva, Márcia Teixeira Desidério; Pereira, Rinaldo Wellerson; Carvalho, Elizeu Fagundes de
2004-01-01
Allele frequencies for 16 short tandem repeats (STR) loci were determined with a sample of 230–300 unrelated individuals from the population of Rio de Janeiro, Brazil. The loci are the most commonly used in forensic and paternity testing, being analysed by the Identifiler (Applied Biosystems) and PowerPlex 2.1 (Promega) commercial kits. It was proved that Penta E and D18S51 are the most polymorphic loci.
Niemcunowicz-Janica, Anna; Pepiński, Witold; Janica, Jacek Robert; Janica, Jerzy; Skawrońska, Małgorzata; Koc-Zórawska, Ewa
2007-01-01
In cases of decomposed bodies, Y chromosomal STR markers may be useful in identification of a male relative. The authors assessed typeability of PowerPlex Y (Promega) loci in post mortem tissue material stored in various environments. Kidney, spleen and pancreas specimens were collected during autopsies of five persons aged 20-30 years, whose time of death was determined within the limit of 14 hours. Tissue material was incubated at 21 degrees C and 4 degrees C in various environmental conditions. DNA was extracted by the organic method from tissue samples collected in 7-day intervals and subsequently typed using the PowerPlexY-STR kit and ABI 310. A fast decrease in the typeability rate was seen in specimens incubated in peat soil and in sand. Kidney tissue samples were typeable in all PowerPlexY-STR loci within 63 days of incubation at 4 degrees C. Faster DNA degradation was recorded in spleen and pancreas specimens. In samples with negative genotyping results, no DNA was found by fluorometric quantitation. Decomposed soft tissues are a potential material for DNA typing.
A silent allele in the locus D5S818 contained within the PowerPlex®21 PCR Amplification Kit.
Chen, Ling; Tai, Yunchun; Qiu, Pingming; Du, Weian; Liu, Chao
2015-11-01
Three paternity tests cases were found with a single locus mismatch at the locus D5S818 with PowerPlex®21 PCR Amplification Kit (Promega). Forward and reverse primers were redesigned to type the samples again and to evaluate if there were alleles dropped out. The results showed the existence of a silent allele 12 in all the three families, due to a point mutation that changed cytosine to adenine at 90 nucleotides upstream from the 5' end of the AGAT repeat sequences in all the six individuals. A single locus mismatch due to a silent allele may occur in any locus using any kit. Therefore, we recommend using multiple kits to confirm the results in paternity testing cases with mismatches, especially when there is a single locus mismatch with homozygote involved. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Niemcunowicz-Janica, Anna; Pepinski, Witold; Janica, Jacek Robert; Skawronska, Malgorzata; Janica, Jerzy; Koc-Zorawska, Ewa; Stolyszewski, Ireneusz
2007-01-01
In cases of decomposed bodies Y chromosomal STR markers may be useful in identification of a male relative. The authors assessed typeability PowerPlex Y (Promega) loci in tissue material stored in water and soil environment. Tissue material was collected during autopsies of five persons aged 20-30 years with time of death determined within the limit of 14 hours. Heart muscle, liver and lung specimens were stored in pond water, sea water, sand and peat soil. DNA was extracted by organic method from tissue samples collected in 7-day intervals. Liver specimens were typeable in all PowerPlex Y loci within 100 days of storage in pond water with gradual decline at DYS392 in sea water. Heart muscle specimens stored in pond water exhibited allelic loss at DYS19, DYS385, DYS389II and DYS392, while all loci were typeable in sea water stored samples. For lung specimens allelic loss was noted throughout the profile. Storage of liver specimens in peat soil for more than 14 days resulted in allelic drop-out, and after 21 days no profiles were typeable. Heart muscle specimens were typeable in all PowerPlex Y systems after 35-day storage in sand, while allelic drop-out and subsequent lack of profiles were noted after 14 and 35 days respectively. Lung specimens stored in garden soil exhibited allelic drop-out and subsequent lack of profiles after 7 and 21 days, respectively. All PowerPlex Y loci were typeable in the latter material in sand up to day 35 with gradual decline of longer amplicons (DYS19, DYS385, DYS389II and DYS392).
Directory of Open Access Journals (Sweden)
Ewa Koc-Zorawska
2008-01-01
Full Text Available In cases of decomposed bodies Y chromosomal STR markers may be useful in identification of a male relative. The authors assessed typeability PowerPlex Y (Promega loci in tissue material stored in water and soil environment. Tissue material was collected during autopsies of five persons aged 20-30 years with time of death determined within the limit of 14 hours. Heart muscle, liver and lung specimens were stored in pond water, sea water, sand and peat soil. DNA was extracted by organic method from tissue samples collected in 7-day intervals. Liver specimens were typeable in all PowerPlex Y loci within 100 days of storage in pond water with gradual decline at DYS392 in sea water. Heart muscle specimens stored in pond water exhibited allelic loss at DYS19, DYS385, DYS389II and DYS392, while all loci were typeable in sea water stored samples. For lung specimens allelic loss was noted throughout the profile. Storage of liver specimens in peat soil for more than 14 days resulted in allelic drop-out, and after 21 days no profiles were typeable. Heart muscle specimens were typeable in all PowerPlex Y systems after 35-day storage in sand, while allelic drop-out and subsequent lack of profiles were noted after 14 and 35 days respectively. Lung specimens stored in garden soil exhibited allelic drop-out and subsequent lack of profiles after 7 and 21 days, respectively. All PowerPlex Y loci were typeable in the latter material in sand up to day 35 with gradual decline of longer amplicons (DYS19, DYS385, DYS389II and DYS392.
Quantum spectral curve for the η-deformed AdS5 × S5 superstring
Klabbers, Rob; van Tongeren, Stijn J.
2017-12-01
The spectral problem for the AdS5 ×S5 superstring and its dual planar maximally supersymmetric Yang-Mills theory can be efficiently solved through a set of functional equations known as the quantum spectral curve. We discuss how the same concepts apply to the η-deformed AdS5 ×S5 superstring, an integrable deformation of the AdS5 ×S5 superstring with quantum group symmetry. This model can be viewed as a trigonometric version of the AdS5 ×S5 superstring, like the relation between the XXZ and XXX spin chains, or the sausage and the S2 sigma models for instance. We derive the quantum spectral curve for the η-deformed string by reformulating the corresponding ground-state thermodynamic Bethe ansatz equations as an analytic Y system, and map this to an analytic T system which upon suitable gauge fixing leads to a Pμ system - the quantum spectral curve. We then discuss constraints on the asymptotics of this system to single out particular excited states. At the spectral level the η-deformed string and its quantum spectral curve interpolate between the AdS5 ×S5 superstring and a superstring on "mirror" AdS5 ×S5, reflecting a more general relationship between the spectral and thermodynamic data of the η-deformed string. In particular, the spectral problem of the mirror AdS5 ×S5 string, and the thermodynamics of the undeformed AdS5 ×S5 string, are described by a second rational limit of our trigonometric quantum spectral curve, distinct from the regular undeformed limit.
International Nuclear Information System (INIS)
Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.
1989-01-01
The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig
DEFF Research Database (Denmark)
Hansen, Hanna Elsebeth; Morling, N
1993-01-01
Paternity testing was carried out in 271 cases of disputed paternity using the 5 VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a), and 10-15 conventional marker systems including the HLA-A,B system. By means of the matching criteria for the VNTR systems...
IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT
Directory of Open Access Journals (Sweden)
Marin CIOBANU
2014-11-01
Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.
The Vibrio cholerae VprA-VprB Two-Component System Controls Virulence Through Endotoxin Modification
2014-12-23
concomitant reduction in glycine-lipid A modifica- tion. Wild-type cells grown in the presence of iron Fe3 (40 M), however, did not show a significant...CaCl2, 0.015 mM FeSO4, 0.075 mM thiamine, and 0.15 mM KH2PO4 (20, 66). In all cases, cells were grown with aeration at 37°C. E. coli strains were...dephosphory- lated and labeled with [-32P]ATP (Amersham) using a DNA 5=-end- labeling system (Promega). Removal of unincorporated nucleotides was carried out
Y-chromosome polymorphisms of the domestic Bactrian camel in ...
Indian Academy of Sciences (India)
HUILING CHEN
2018-01-05
Jan 5, 2018 ... specific to male-specific regions on the Y chromosome can provide effective .... T vectors using the pGEM-T Easy Vector system I. (Promega ..... in cattle and their association with male reproductive traits in. Holstein bulls.
Directory of Open Access Journals (Sweden)
SUTARNO
2002-07-01
Full Text Available The aims of the study were to: Investigate polymorphisms in the ND-5 region of bovine mitochondrial DNA in the composite and purebred Hereford herds from the Wokalup selection experiment, sequencing and compare the sequences between haplotypes and published sequence from Genebank. A total of 194 Hereford and 235 composite breed cattle from Wokalup Research Station were used in this study. The mitochondrial DNA was extracted using Wizard genomic DNA purification system from Promega. ND-5 fragment of mitochondrial DNA was amplified using PCR and continued with RFLP. Each haplotypes were sequenced. PCR products of each haplotype were cloned into pCR II, transformed, colonies selection, plasmid DNA extraction continued with cycle sequencing. Polymorphisms were found in both breeds of cattle in ND-5 region of mitochondrial DNA by PCR-RFLP analysis. Sequencing analysis confirmed the RFLPs data.
Buntru, Matthias; Vogel, Simon; Spiegel, Holger; Schillberg, Stefan
2014-05-03
Cell-free protein synthesis is a rapid and efficient method for the production of recombinant proteins. Usage of prokaryotic cell-free extracts often leads to non-functional proteins. Eukaryotic counterparts such as wheat germ extract (WGE) and rabbit reticulocyte lysate (RLL) may improve solubility and promote the correct folding of eukaryotic multi-domain proteins that are difficult to express in bacteria. However, the preparation of WGEs is complex and time-consuming, whereas RLLs suffer from low yields. Here we report the development of a novel cell-free system based on tobacco Bright Yellow 2 (BY-2) cells harvested in the exponential growth phase. The highly-productive BY-2 lysate (BYL) can be prepared quickly within 4-5 h, compared to 4-5 d for WGE. The efficiency of the BYL was tested using three model proteins: enhanced yellow fluorescent protein (eYFP) and two versions of luciferase. The added mRNA was optimized by testing different 5' and 3' untranslated regions (UTRs). The protein yield in batch and dialysis reactions using BYL was much higher than that of a commercial Promega WGE preparation, achieving a maximum yield of 80 μg/mL of eYFP and 100 μg/mL of luciferase, compared to only 45 μg/mL of eYFP and 35 μg/mL of luciferase in WGEs. In dialysis reactions, the BYL yielded about 400 μg/mL eYFP, representing up to 50% more of the target protein than the Promega WGE, and equivalent to the amount using 5Prime WGE system. Due to the high yield and the short preparation time the BYL represents a remarkable improvement over current eukaryotic cell-free systems.
Directory of Open Access Journals (Sweden)
Ericson Martins Nascimento
2003-09-01
Full Text Available É apresentada a padronização de protocolo de extração de DNA de material parafinado para análise da instabilidade de microssatélites de genes relacionados ao leiomioma uterino, utilizando-se 30mg a 40mg de tecido retirado de blocos de parafina. Os blocos são desparafinizados por banhos de xilol a 65ºC, reidratados com soluções de concentrações decrescentes de ETOH e água deionizada. A extração de DNA é obtida através das etapas de lise celular, com solução Promega, digestão de proteínas por proteinase K, precipitação com proteínas com solução Promega e precipitação do DNA com ETOH 70% gelado e ressuspendido com solução Promega. Este protocolo resulta em um DNA viável para uso na reação em cadeia da polimerase (PCR.The standardization of the protocol of the DNA extraction from paraffin material in order to analyze the instability of microsatellites in genes related to the uterine leiomyoma, using 30 to 40mg of tissue removed from paraffin blocks is presented. Desparaffin throught xilol baths to 65ºC, rehydrated with solutions of decreasing concentrations of ETOH and deionisation water. The extraction of DNA was obtained through the stages of cellular lysis, with Promega solution, digestion of proteins by Proteinase K, precipitation proteins with Promega solution and precipitation of DNA with ETOH 70% colded and ressuspended with Promega solution. This protocol results in a viable DNA to be use in the Polimerase Chain Reaction (PCR.
International Nuclear Information System (INIS)
Wang, Z.B.; Gou, B.C.; Chen, F.
2006-01-01
The relativistic energies, the oscillator strength, and the lifetimes of high-lying core-excited states 1s2s2pnp 5 P (n=2-5) and 1s2p 2 mp 5 S 0 (m=2-5) of Li - ion are calculated with the saddle-point variational method and restricted variation method. The fine structure and the hyperfine structure of the core-excited states for this system are also explored. The results are compared with other theoretical and experimental data in the literature. The energy obtained in this work are much lower than the others previously published whereas the wavelengths and radiative life-times are in agreement
Mission Planning System Increment 5 (MPS Inc 5)
2016-03-01
2016 Major Automated Information System Annual Report Mission Planning System Increment 5 (MPS Inc 5) Defense Acquisition Management Information...President’s Budget RDT&E - Research, Development, Test, and Evaluation SAE - Service Acquisition Executive TBD - To Be Determined TY - Then Year...Phone: 845-9625 DSN Fax: Date Assigned: May 19, 2014 Program Information Program Name Mission Planning System Increment 5 (MPS Inc 5) DoD
Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions
International Nuclear Information System (INIS)
Churilov, S.S.; Joshi, Y.N.
2001-01-01
The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)
Transmission of 2.5 Gbit/s Spectrum-sliced WDM System for 50 km Single-mode Fiber
Ahmed, Nasim; Aljunid, Sayed Alwee; Ahmad, R. Badlisha; Fadil, Hilal Adnan; Rashid, Mohd Abdur
2011-06-01
The transmission of a spectrum-sliced WDM channel at 2.5 Gbit/s for 50 km of single mode fiber using an system channel spacing only 0.4 nm is reported. We have investigated the system performance using NRZ modulation format. The proposed system is compared with conventional system. The system performance is characterized as the bit-error-rate (BER) received against the system bit rates. Simulation results show that the NRZ modulation format performs well for 2.5 Gbit/s system bit rates. Using this narrow channel spectrum-sliced technique, the total number of multiplexed channels can be increased greatly in WDM system. Therefore, 0.4 nm channel spacing spectrum-sliced WDM system is highly recommended for the long distance optical access networks, like the Metro Area Network (MAN), Fiber-to-the-Building (FTTB) and Fiber-to-the-Home (FTTH).
The blue light indicator in rubidium 5S-5P-5D cascade excitation
Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan
2017-07-01
The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.
Tumor Immunotherapy by Gene-circuit Recruited Immunomodulatory Systems (TIGRIS) for Prostate Cancer
2017-09-01
Commercial Assays CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit Promega Cat #G1780 Human IFN-g DuoSet ELISA R&D systems Cat #DY285 Human CCL21/6Ckine...DuoSet ELISA R&D systems Cat #DY366 Human IL-12 p70 DuoSet ELISA R&D systems Cat #DY1270 Cell Culture Reagents DMEM Life Technologies Cat #10569-044...after 24h and IFN-g concentration determined by Human IFN-g DuoSet ELISA (R&D systems, Min- neapolis, MN; catalog #DY285). Multiple-Output Circuit
A Low-Power CMOS Trans-Impedance Amplifier for 2.5 Gb/S Optical Communication Systems
Directory of Open Access Journals (Sweden)
Mojgan Mohseni
2013-01-01
Full Text Available This Paper presents a new Trans-impedance amplifier for optical receiver circuits. The amplifier is based on parallel (R-C feedback topology which is optimized for power consumption and uses shunt-peaking technique to enhance the frequency bandwidth of the amplifier. However, the circuit is designed and simulated using 0.18µm CMOS technology parameters. As simulation results show, the amplifier has a gain of 67.5dBΩ, bandwidth of 3GHz while consumes only 12.16 mW power which shows a very good performance for using in a 2.5Gb/S (SONET OC-48 optical communication system. Finally, as the simulated Eye-Diagram shows, the circuit has a very good performance for a 2.5Gb/S system for a 10µA input current.
Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton
International Nuclear Information System (INIS)
Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing
2003-01-01
The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)
DEFF Research Database (Denmark)
Morling, N; Hansen, Hanna Elsebeth
1993-01-01
-systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). The intra gel variability of 970 duplicate investigations on the same gel of DNA from 122 individuals showed no differences exceeding 1.25 mm between the positions of the corresponding DNA fragments. The comparison of 1...
A Rapid and Inexpensive PCR-Based STR Genotyping Method for Identifying Forensic Specimens
2006-06-01
this report) 20. Security Classif. (of this page) 21 . No. of Pages 22. Price Unclassified Unclassified 18 Form DOT F 1700.7 (8-72) Reproduction of...Promega PowerPlex 2.1 system (7) except that the buffer was 1x Amplitaq gold reaction buffer, 0.1% TritonX-100, and 0.2mM each dNTP in a 25µl final...electrophoresis were done using the PowerPlex 16 System (Promega Corp.; Madison, WI). rEsulTs ANd dIsCussION The goal of this study was to develop a simple DNA
Localized AdS_{5}×S^{5} Black Holes.
Dias, Óscar J C; Santos, Jorge E; Way, Benson
2016-10-07
According to heuristic arguments, global AdS_{5}×S^{5} black holes are expected to undergo a phase transition in the microcanonical ensemble. At high energies, one expects black holes that respect the symmetries of the S^{5}; at low energies, one expects "localized" black holes that appear pointlike on the S^{5}. According to anti-de Sitter/conformal field theory correspondence, N=4 supersymmetric Yang-Mills (SYM) theory on a 3-sphere should therefore exhibit spontaneous R-symmetry breaking at strong coupling. In this Letter, we numerically construct these localized black holes. We extrapolate the location of this phase transition, and compute the expectation value of the broken scalar operator with lowest conformal dimension. Via the correspondence, these results offer quantitative predictions for N=4 SYM theory.
Folded three-spin string solutions in AdS5 x S5
International Nuclear Information System (INIS)
Ryang Shijong
2004-01-01
We construct a spinning closed string solution in AdS 5 x S 5 which is folded in the radial direction and has two equal spins in AdS 5 and a spin in S 5 . The energy expression of the three-spin solution specified by the folding and winding numbers for the small S 5 spin shows a logarithmic behavior and a one-third power behavior of the large total AdS 5 spin, in the long string and in the short string located near the boundary of AdS 5 respectively. It exhibits the non-regular expansion in the 't Hooft coupling constant, while it takes the regular one when the S 5 spin becomes large. (author)
39 CFR 262.5 - Systems (Privacy).
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Systems (Privacy). 262.5 Section 262.5 Postal... DEFINITIONS § 262.5 Systems (Privacy). (a) Privacy Act system of records. A Postal Service system containing... individual. (c) Computer matching program. A “matching program,” as defined in the Privacy Act, 5 U.S.C. 552a...
Making safety an integral part of 5S in healthcare.
Ikuma, Laura H; Nahmens, Isabelina
2014-01-01
Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.
Foundations of the AdS5 x S5 superstring: I
International Nuclear Information System (INIS)
Arutyunov, Gleb; Frolov, Sergey
2009-01-01
We review the recent advances towards finding the spectrum of the AdS 5 x S 5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing literature. The present part I deals with foundations of classical string theory in AdS 5 x S 5 , light-cone perturbative quantization and the derivation of the exact light-cone world-sheet scattering matrix
The AdS5xS5 superstring worldsheet S matrix and crossing symmetry
International Nuclear Information System (INIS)
Janik, Romuald A.
2006-01-01
An S matrix satisfying the Yang-Baxter equation with symmetries relevant to the AdS 5 xS 5 superstring recently has been determined up to an unknown scalar factor. Such scalar factors are typically fixed using crossing relations; however, due to the lack of conventional relativistic invariance, in this case its determination remained an open problem. In this paper we propose an algebraic way to implement crossing relations for the AdS 5 xS 5 superstring worldsheet S matrix. We base our construction on a Hopf-algebraic formulation of crossing in terms of the antipode and introduce generalized rapidities living on the universal cover of the parameter space which is constructed through an auxillary, coupling-constant dependent, elliptic curve. We determine the crossing transformation and write functional equations for the scalar factor of the S matrix in the generalized rapidity plane
Jordanian deformations of the AdS5×S5 superstring
Kawaguchi, I.; Matsumoto, T.; Yoshida, K
2014-01-01
We consider Jordanian deformations of the AdS_5xS^5 superstring action. The deformations correspond to non-standard q-deformation. In particular, it is possible to perform partial deformations, for example, only for the S^5 part. Then the classical action and the Lax pair are constructed with a
Implementation of 5S Method for Ergonomic Laboratory
Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus
2017-06-01
This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment
International Nuclear Information System (INIS)
Glesk, I.; Baby, V.; Bres, C.-S.; Xu, L.; Rand, D.; Prucnal, P.R.
2004-01-01
We demonstrated error-free operation of 4 simultaneous users in a fast frequency-hopping time-spreading optical code division multiple access system operating at 2.5 Gbit/s a Star architecture. Effective power penalty was ≤0.5dB. Novel optical code division multiple access receiver based on Terahertz Optical Asymmetric Demultiplexer was demonstrated to eliminate multiple access interference (Authors)
Validation of the DNATyper™15 PCR Genotyping System for Forensic Application
Directory of Open Access Journals (Sweden)
Jian Ye
2015-01-01
Full Text Available We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR genotyping system for autosomal short tandem repeat (STR amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA and amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magnesium concentration, primer concentration, annealing temperature, reaction volume, and cycle number. The performance of the assay was validated with respect to species specificity, sensitivity to template concentration, stability, accuracy, influence of the DNA extraction methods, and the ability to genotype the mixture samples. The performance of the DNATyper™15 system on casework samples was compared with that of two widely used STR amplification kits, Identifiler™ (Applied Biosystems, Carlsbad, CA, USA and PowerPlex 16 ® (Promega, Madison, WI, USA. The conditions for PCR-based DNATyper™15 genotyping were optimized. Contamination from forensically relevant nonhuman DNA was not found to impact genotyping results, and full profiles were generated for all the reactions containing ≥ 0.125 ng of DNA template. No significant difference in performance was observed even after the DNATyper™15 assay components were subjected to 20 freeze-thaw cycles. The performances of DNATyper™15, Identifiler™, and PowerPlex 16 ® were comparable in terms of sensitivity and the ability to genotype the mixed samples and case-type samples, with the assays giving the same genotyping results for all the shared loci. The DNA extraction methods did not affect the performance of any of the systems. Our results demonstrate that the DNATyper™15 system is suitable for genotyping in both forensic DNA database work and case-type samples.
effect of sorghum seed treatment in burkina faso varies with baseline
African Journals Online (AJOL)
ACSS
consisting of eleven paired experiments was extracted separately ... study: 11 were purchased from farmers from seven different .... Polymerase (Promega Corporation, WI, USA). For the 18S ..... compared. The 18S profile of the microflora (Fig.
Forensic population data for 20 STR loci in Argentina
Borosky, Alicia; Toscanini, Ulises; Gómez, Andrea; Parolin, María Laura; Basso, Nestor Guillermo; Vullo, Carlos
2017-01-01
In order to provide useful information of forensic interest for the new markers included in the PowerPlex1 21 System (Promega Corp, USA), namely D1S1656, D6S1043 and D12S391, a population study was conducted in a sample of 907 unrelated healthy individuals from Argentina. Samples were randomly chosen from routine paternity testing. Blood samples or buccal swabs were collected after informed consent, taken from individuals of different urban populations from 7 provinces of Argentina: 464 indiv...
M5-branes, orientifolds, and S-duality
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yoonseok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of); Kim, Joonho [School of Physics, Korea Institute for Advanced Study,85 Hoegiro, Seoul (Korea, Republic of); Kim, Seok [Department of Physics and Astronomy & Center for Theoretical Physics,Seoul National University, 1 Gwanak-ro, Seoul (Korea, Republic of)
2016-12-29
We study the instanton partition functions of 5d maximal super Yang-Mills theories with all classical gauge groups. They are computed from the ADHM quantum mechanics of the D0-D4-O4 systems. Our partition functions respect S-dualities of the circle compactified Yang-Mills theories and various orientifold backgrounds. We also compute and study the S{sup 5} partition functions that correspond to the 6d (2,0) superconformal indices. Our SO(2N) index takes the form of the vacuum character of W{sub D} algebra in a special limit, supporting the W algebra conjecture. We propose new indices for (2,0) theories with outer automorphism twists along the temporal circle, obtained from non-simply-laced SYMs on S{sup 5}.
Review on Implementation of 5S in Various Organization
Vipulkumar C. Patel; Dr. Hemant Thakkar
2014-01-01
This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...
Lumpy AdS5× S5 black holes and black belts
International Nuclear Information System (INIS)
Dias, Óscar J.C.; Santos, Jorge E.; Way, Benson
2015-01-01
Sufficiently small Schwarzschild black holes in global AdS 5 ×S 5 are Gregory-Laflamme unstable. We construct new families of black hole solutions that bifurcate from the onset of this instability and break the full SO(6) symmetry group of the S 5 down to SO(5). These new “lumpy" solutions are labelled by the harmonics ℓ. We find evidence that the ℓ=1 branch never dominates the microcanonical/canonical ensembles and connects through a topology-changing merger to a localised black hole solution with S 8 topology. We argue that these S 8 black holes should become the dominant phase in the microcanonical ensemble for small enough energies, and that the transition to Schwarzschild black holes is first order. Furthermore, we find two branches of solutions with ℓ=2. We expect one of these branches to connect to a solution containing two localised black holes, while the other branch connects to a black hole solution with horizon topology S 4 ×S 4 which we call a “black belt”.
DEFF Research Database (Denmark)
Hansen, Hanna Elsebeth; Morling, N
1993-01-01
with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving...
Total synthesis of (3S, 5R, 3'S, 5'R)-capsorubin
International Nuclear Information System (INIS)
Frederico, Daniel; Constantino, Mauricio G.; Donate, Paulo M.
2009-01-01
The total synthesis of enantiomerically enriched (3S, 5R, 3'S, 5'R)-capsorubin (1) by aldol condensation of (1R, 4S)-1-(4-hydroxy-1,2,2-trimethyl-cyclopentyl)ethanone (2a) and crocetindial (3) is described. An alternative, short eight-step synthesis of the optically active compound 2a (ee 89%) is also reported. (author)
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...
Implementation Of 5S Quality Tool In Manufacturing Company A Case Study
Directory of Open Access Journals (Sweden)
Vibhor Kakkar
2015-02-01
Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .
Crystal structure and optical absorption spectra of Ga0.5Fe0.5InS3 and Ga0.5Fe0.25In1.25S3 crystals
International Nuclear Information System (INIS)
Gusejnov, G.G.; Musaeva, N.N.; Kyazumov, M.G.; Asadova, I.B.; Aliev, O.M.
2003-01-01
Single crystals of Ga 0.5 Fe 0.5 InS 3 are grown by the method of chemical gas-transport reactions and those of Ga 0.5 Fe 0.25 In 1.25 S 3 - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E g = 1.885 eV for Ga 0.5 Fe 0.5 InS 3 and E g 1.843 eV for Ga 0.5 Fe 0.25 In 1.25 S 3 [ru
Khalid, A.M.; Baltus, P.G.M.; Dommele, A.R.; Mekonnen, K.A.; Cao, Z.; Oh, C.W.; Matters, M.K.; Koonen, A.M.J.
2017-01-01
We present a full-duplex dynamic indoor optical wireless system using 2D passive optical beam steering for downlink and 60-GHz communication for upstream transmission. We demonstrate 35-Gb/s NRZ-OOK downstream multicasting and 5-Gb/s NRZ-ASK upstream communication.
Pre-potential in the AdS{sub 5}×S{sup 5} type IIB superspace
Energy Technology Data Exchange (ETDEWEB)
Poláček, Martin; Siegel, Warren [C.N. Yang Institute for Theoretical Physics, State University of New York,100 Nicolls Rd., Stony Brook, NY 11794-3840 (United States)
2017-01-16
We found the pre-potential in the superspace with AdS{sub 5} × S{sup 5} background. The pre-potential appears as part of the vielbeins, without derivatives. In both subspaces (AdS{sub 5} and S{sup 5}) we used Poincaré coordinates. We picked one bulk coordinate in AdS{sub 5} and one bulk coordinate in S{sup 5} to define the space-cone gauge. Such space-cone gauge destroys the bulk Lorentz covariance. However, it still preserves boundary Lorentz covariance (and gives projective superspace) SO(3,1)⊗SO(4) and so symmetries of boundary CFT are manifest.
Three spin string configuration in γ-Deformed AdS5xS5 background
International Nuclear Information System (INIS)
Bobev, N.; Rashkov, R.; Dimov, H.
2006-01-01
The aim of this paper is to investigate semiclassical rotating string configurations in the recently found Lunin-Maldacena background. This background is conjectured to be dual to the Leigh-Strassler β-deformation of N = 4 SYM and therefore a good laboratory for tests of the AdS/CFT correspondence beyond the well explored AdS 5 xS 5 case. We consider different multispin configurations of rotating strings by allowing the strings to move in both the AdS 5 and the deformed S 5 part of the Lunin-Maldacena background. For all of these configurations we compute the string energy in terms of the angular momenta and the string winding numbers and thus provide the possibility of reproducing our results from a computation of the anomalous dimension of the corresponding dilatation operator. This can be achieved by means of the Bethe ansatz techniques for the relevant sectors of the corresponding Yang-Mills theory. We also compare our results to those for multispin rotating strings on AdS 5 xS 5 . (authors)
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions
International Nuclear Information System (INIS)
Li Guangyuan
1998-01-01
The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given
Foundations of the AdS5 × S5 Superstring Part I
Arutyunov, G.E.; Frolov, S.
2009-01-01
We review the recent advances towards finding the spectrum of the AdS_5 x S^5 superstring. We thoroughly explain the theoretical techniques which should be useful for the ultimate solution of the spectral problem. In certain cases our exposition is original and cannot be found in the existing
A demonstrator for a level-1 trigger system based on MicroTCA technology and 5Gb/s optical links
Energy Technology Data Exchange (ETDEWEB)
Foudas, C; Hall, G; Iles, G; Marrouche, J; Rose, A [Blackett Laboratory, Imperial College, London SW7 2BW (United Kingdom); Frazier, R; Newbold, D [H.H. Wills Physics Laboratory, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Jones, J [Weathertop, Claverton Down Road, Bath BA2 7AL (United Kingdom)
2010-11-15
A demonstrator for the CMS Level-1 calorimeter trigger system has been designed, manufactured, tested and a time-multiplexed trigger implemented. The prototype card uses the AMC double width form factor, 5Gb/s links and a Xilinx XC5VTX150T or XC5VTX240T FPGA. A possible implementation of such a trigger architecture in CMS is described.
19 CFR 143.5 - System performance requirements.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false System performance requirements. 143.5 Section 143.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... must demonstrate that his system can interface directly with the Customs computer and ensure accurate...
AdS5 black holes with fermionic hair
International Nuclear Information System (INIS)
Burrington, Benjamin A.; Liu, James T.; Sabra, W. A.
2005-01-01
The study of new Bogomol'nyi-Prasad-Sommerfield (BPS) objects in AdS 5 has led to a deeper understanding of AdS/CFT. To help complete this picture, and to fully explore the consequences of the supersymmetry algebra, it is also important to obtain new solutions with bulk fermions turned on. In this paper we construct superpartners of the 1/2 BPS black hole in AdS 5 using a natural set of fermion zero modes. We demonstrate that these superpartners, carrying fermionic hair, have conserved charges differing from the original bosonic counterpart. To do so, we find the R-charge and dipole moment of the new system, as well as the mass and angular momentum, defined through the boundary stress tensor. The complete set of superpartners fits nicely into a chiral representation of AdS 5 supersymmetry, and the spinning solutions have the expected gyromagnetic ratio, g=1
Three-spin Strings on AdS_5 x S^5 from N=4 SYM
DEFF Research Database (Denmark)
Kristjansen, C.
2004-01-01
Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate the anal......Using the integrable spin chain picture we study the one-loop anomalous dimension of certain single trace scalar operators of N=4 SYM expected to correspond to semi-classical string states on AdS_5 x S^5 with three large angular momenta (J_1,J_2,J_3) on S^5. In particular, we investigate...... the analyticity structure encoded in the Bethe equations for various distributions of Bethe roots. In a certain region of the parameter space our operators reduce to the gauge theory duals of the folded string with two large angular momenta and in another region to the duals of the circular string with angular...... momentum assignment (J,J',J'), J>J'. In between we locate a critical line. We propose that the operators above the critical line are the gauge theory duals of the circular elliptic string with three different spins and support this by a perturbative calculation....
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Simplified TBA equations of the AdS5 × S5 mirror model
Arutyunov, G.E.; Frolov, S.
2009-01-01
We use the recently found integral representation for the dressing phase in the kinematic region of the mirror theory to simplify the TBA equations for the AdS5 × S5 mirror model. The resulting set of equations provides an efficient starting point for both analytic and numerical studies.
Spectrum and quantum symmetries of the AdS{sub 5} x S{sup 5} superstring
Energy Technology Data Exchange (ETDEWEB)
Heinze, Martin
2014-12-18
The initial AdS/CFT duality pair, the duality between N=4 SYM and the AdS{sub 5} x S{sup 5} superstring, appears to enjoy quantum integrability in the planar limit, which allowed to devise powerful methods ostensibly solving the spectral problem. However, quantization of the AdS{sub 5} x S{sup 5} superstring from first principles is still an open question and especially the spectrum of short string states has previously been derived only at leading order in large 't Hooft coupling. In this thesis we investigate possible routes to quantize short string states perturbatively beyond the leading order, where equally our aim is to gain better appreciation of the quantum symmetries at play. A prominent role is played by the lowest excited string states, dual to the Konishi supermultiplet, and we start by reviewing critically an asserted derivation of the Konishi anomalous dimension in the setup of pure spinor string theory. Next, we constrain ourselves to bosonic AdS{sub 5} x S{sup 5} String in static gauge, where we construct a so-called single-mode string solution, a generalization of the pulsating string allowing for unconstrained zero-modes. This solution shows classical integrability and invariance under the isometries SO(2,4) x SO(6) at the quantum level. Arguing heuristically about the effects of supersymmetry, we indeed recover the first non-trivial quantum correction to the Konishi anomalous dimension. We continue by implementing static gauge for the full AdS{sub 5} x S{sup 5} superstring and find elegant expressions for the Lagrangian density and the supercharges. We then constrain our interest to the superparticle and, using two different methods, find canonical coordinates at quadratic order in fermions. We conclude by exploring another quantization scheme: As the single-mode string is nothing but the SO(2,4) x SO(6) orbit of the pulsating string, we apply orbit method quantization to the particle and spinning string solutions in bosonic AdS{sub 3} x S
Puzzles of η-deformed AdS_5×S"5
International Nuclear Information System (INIS)
Arutyunov, Gleb; Borsato, Riccardo; Frolov, Sergey
2015-01-01
We derive the part of the Lagrangian for the sigma model on the η-deformed AdS_5×S"5 space which is quadratic in fermions and has the full dependence on bosons. We then show that there exists a field redefinition which brings the corresponding Lagrangian to the standard form of type IIB Green-Schwarz superstring. Reading off the corresponding RR couplings, we observe that they fail to satisfy the supergravity equations of motion, despite the presence of κ-symmetry. However, in a special scaling limit our solution reproduces the supergravity background found by Maldacena and Russo. Further, using the fermionic Lagrangian, we compute a number of new matrix elements of the tree level world-sheet scattering matrix. We then show that after a unitary transformation on the basis of two-particle states which is not one-particle factorisable, the corresponding T-matrix factorises into two equivalent parts. Each part satisfies the classical Yang-Baxter equation and coincides with the large tension limit of the q-deformed S-matrix.
DEFF Research Database (Denmark)
Bräuner-Osborne, Hans; Krogsgaard-Larsen, P
1998-01-01
1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...
Enhanced antioxidative responses of a salt-resistant wheat cultivar ...
African Journals Online (AJOL)
use
2011-11-23
Nov 23, 2011 ... prove its tolerance to salt stress, at the same time, signifi- cant increases in .... Reverse Transcription System Kit (Promega, USA) using oligo-dT-primers. ..... salinity and extreme temperatures: towards genetic engineering for.
D = 4 Yang-Mills correlators from NSR strings on AdS5 x S5
International Nuclear Information System (INIS)
Polyakov, D.
1999-07-01
In our previous work (hep-th/9812044) we have proposed the sigma-model action, conjectured to be the NSR analogue of superstring theory on AdS 5 x S 5 . This sigma-model is the NSR superstring action with potential term corresponding to the exotic 5-form vertex operator (branelike state). This 5-form potential plays the role of cosmological term, effectively curving the flat space-time geometry to that of AdS 5 x S 5 . In this paper we study this ansatz in more detail and provide the derivation of the correlators of the four-dimensional super Yang-Mills theory from the above mentioned sigma-model. In particular, we show that the correlation function of two dilaton vertex operators in such a model reproduces the well-known result for the two-point function in N = 4 four-dimensional super Yang-Mills theory. (author)
25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.
Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S
2013-01-28
We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.
Energy Technology Data Exchange (ETDEWEB)
Gusejnov, G G; Musaeva, N N; Kyazumov, M G [NAN Azerbajdzhana, Inst. Fiziki, Baku (Azerbaijan); Asadova, I B; Aliev, O M [NAN Azerbajdzhana, Inst. Neorganicheskoj i Fizicheskoj Khimii, Baku (Azerbaijan)
2003-09-01
Single crystals of Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} are grown by the method of chemical gas-transport reactions and those of Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3} - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E{sub g} = 1.885 eV for Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} and E{sub g} 1.843 eV for Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3}.
Liu, Zhi-Qiang; Wu, Lin; Zheng, Ling; Wang, Wen-Zhong; Zhang, Xiao-Jian; Jin, Li-Qun; Zheng, Yu-Guo
2018-02-01
tert-Butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate ((3R,5S)-CDHH) is the key intermediate for synthesis of atorvastatin and rosuvastatin. Carbonyl reductase exhibits excellent activity toward tert-butyl (S)-6-chloro-5-hydroxy-3-oxohexanoate ((S)-CHOH) to synthesize (3R,5S)-CDHH. In this study, a whole cell biosynthesis reaction system to produce (3R,5S)-CDHH was constructed in organic solvents. A solution of 10% (v/v) Tween-80 was introduced to the reaction system as a co-solvent, which greatly enhanced biotransformation process, giving 98.9% yield, >99% ee and 1.8-fold higher space time yield in 5 h bioconversion of 1 M (S)-CHOH, compared with 98.7% yield and >99% ee in 9 h bioconversion of a purely aqueous reaction system. Moreover, a water-octanol biphasic reaction system was built and 20% of octanol was added as reservoir of substrate resulting in 98% yield, >99% ee and 4.08 mmol L -1 h -1 g -1 (wet cell weight) space time yield. This study paved a way for the whole cell biosynthesis of (3R,5S)-CDHH in mono and biphasic media. Copyright © 2017 Elsevier Ltd. All rights reserved.
New holographic limit of AdS5(multiply-in-circle sign)S5
International Nuclear Information System (INIS)
Hatsuda, Machiko; Siegel, Warren
2003-01-01
We reexamine the projective light cone limit of the gauge-invariant Green-Schwarz action on five-dimensional anti-de Sitter (multiply-in-circle sign) the five-sphere. It implies the usual holography for AdS 5 , but also (a complex) one for S 5 . The result is N=4 projective superspace, which unlike N=4 harmonic superspace can describe N=4 super Yang-Mills theory off shell
O5S, Calibration of Organic Scintillation Detector by Monte-Carlo
International Nuclear Information System (INIS)
1985-01-01
1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user
AdS5 solutions from M5-branes on Riemann surface and D6-branes sources
Energy Technology Data Exchange (ETDEWEB)
Bah, Ibrahima [Department of Physics and Astronomy, University of Southern California,Los Angeles, CA 90089 (United States); Institut de Physique Théorique, CEA/Saclay,91191 Gif-sur-Yvette (France)
2015-09-24
We describe the gravity duals of four-dimensional N=1 superconformal field theories obtained by wrapping M5-branes on a punctured Riemann surface. The internal geometry, normal to the AdS{sub 5} factor, generically preserves two U(1)s, with generators (J{sup +},J{sup −}), that are fibered over the Riemann surface. The metric is governed by a single potential that satisfies a version of the Monge-Ampère equation. The spectrum of N=1 punctures is given by the set of supersymmetric sources of the potential that are localized on the Riemann surface and lead to regular metrics near a puncture. We use this system to study a class of punctures where the geometry near the sources corresponds to M-theory description of D6-branes. These carry a natural (p,q) label associated to the circle dual to the killing vector pJ{sup +}+qJ{sup −} which shrinks near the source. In the generic case the world volume of the D6-branes is AdS{sub 5}×S{sup 2} and they locally preserve N=2 supersymmetry. When p=−q, the shrinking circle is dual to a flavor U(1). The metric in this case is non-degenerate only when there are co-dimension one sources obtained by smearing M5-branes that wrap the AdS{sub 5} factor and the circle dual the superconformal R-symmetry. The D6-branes are extended along the AdS{sub 5} and on cups that end on the co-dimension one branes. In the special case when the shrinking circle is dual to the R-symmetry, the D6-branes are extended along the AdS{sub 5} and wrap an auxiliary Riemann surface with an arbitrary genus. When the Riemann surface is compact with constant curvature, the system is governed by a Monge-Ampère equation.
Ultra-Reliable Communication in 5G Wireless Systems
DEFF Research Database (Denmark)
Popovski, Petar
2014-01-01
—Wireless 5G systems will not only be “4G, but faster”. One of the novel features discussed in relation to 5G is Ultra-Reliable Communication (URC), an operation mode not present in today’s wireless systems. URC refers to provision of certain level of communication service almost 100 % of the time....... Example URC applications include reliable cloud connectivity, critical connections for industrial automation and reliable wireless coordination among vehicles. This paper puts forward a systematic view on URC in 5G wireless systems. It starts by analyzing the fundamental mechanisms that constitute......-term URC (URC-S). The second dimension is represented by the type of reliability impairment that can affect the communication reliability in a given scenario. The main objective of this paper is to create the context for defining and solving the new engineering problems posed by URC in 5G....
Evolution of primary and secondary structures in 5S and 5.8S rRNA
International Nuclear Information System (INIS)
Curtiss, W.C.
1986-01-01
The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented
Fine structure of the 1s5f and 1s5g levels of He I
International Nuclear Information System (INIS)
Kriescher, Y.; Hilt, O.; Oppen, G. v.
1994-01-01
The fine structure of the 1s 5f and 1s 5g levels of He I was measured using microwave spectroscopy. The helium atoms were excited by ion impact, and the eleven allowed 1s 5f 2S+1 F J -1s 5g 2S'+1 G J , transitions near ν∼15 GHz were induced and detected by measuring the 1s 4d-1s 2p or 1s 3d-1s 2p spectral-line intensities of the impact radiation as a function of the microwave frequency. The measured transition frequencies are in accord with theoretical values and, except for one transition frequency, with earlier experimental data. The existing discrepancy between these earlier data and theory could be solved. (orig.)
Allele frequency distribution for 21 autosomal STR loci in Bhutan.
Kraaijenbrink, Thirsa; van Driem, George L; Tshering of Gaselô, Karma; de Knijff, Peter
2007-07-20
We studied the allele frequency distribution of 21 autosomal STR loci contained in the AmpFlSTR Identifiler (Applied Biosystems), the Powerplex 16 (Promega) and the FFFL (Promega) multiplex PCR kits among 936 individuals from the Royal Kingdom of Bhutan. As such these are the first published autosomal DNA results from this country.
1986-01-01
We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...
Finite-size effect of η-deformed AdS5×S5 at strong coupling
Directory of Open Access Journals (Sweden)
Changrim Ahn
2017-04-01
Full Text Available We compute Lüscher corrections for a giant magnon in the η-deformed (AdS5×S5η using the su(2|2q-invariant S-matrix at strong coupling and compare with the finite-size effect of the corresponding string state, derived previously. We find that these two results match and confirm that the su(2|2q-invariant S-matrix is describing world-sheet excitations of the η-deformed background.
Superconductivity in REO0.5F0.5BiS2 with high-entropy-alloy-type blocking layers
Sogabe, Ryota; Goto, Yosuke; Mizuguchi, Yoshikazu
2018-05-01
We synthesized new REO0.5F0.5BiS2 (RE: rare earth) superconductors with high-entropy-alloy-type (HEA-type) REO blocking layers. The lattice constant a systematically changed in the HEA-type samples with the RE concentration and the RE ionic radius. A sharp superconducting transition was observed in the resistivity measurements for all the HEA-type samples, and the transition temperature of the HEA-type samples was higher than that of typical REO0.5F0.5BiS2. The sharp superconducting transition and the enhanced superconducting properties of the HEA-type samples may indicate the effectiveness of the HEA states of the REO blocking layers in the REO0.5F0.5BiS2 system.
International Nuclear Information System (INIS)
McCreary, T.; Stevens, J.
2006-01-01
South Korea, through its nuclear operating arm, Korea Hydro and Nuclear Power, Ltd. (KHNP), has been one of the leading countries in the routine construction and operation of nuclear power plants. While standardizing on certain design approaches in the plant, KHNP continues to stress the need for the most reliable and cutting edge I and C technologies available for safety and non safety related NSSS and BOP functions. Its specifications are among the most challenging in the world with regard to the system performance and reliability requirements that must be met for the systems to be supplied. The Ulchin Units 5 and 6 (1000 MW each) nuclear power plants have been recently commissioned (2004 and 2005 respectively) with advanced programmable digital control systems in the NSSS and BOP (which includes both safety and non-safety applications). The systems supplied met what the authors believe are the most rigorous performance and functional specification criteria in use today. The authors will highlight a number of the specification requirements, the rationale for same and the plant experiences in the resultant supplied systems. As the existing U.S. nuclear fleet is faced with the prospect of upgrading legacy controls with digital controls, there are valuable lessons to be learned in the Ulchin 5 and 6 experiences that can be applied to retrofits and even new U.S. plant designs. Ulchin 5 and 6 is one of the success stories in the application of advanced digital technology to nuclear power plants. The specification focus that guided the selection and project execution for the digital controls supplied for Ulchin was on several key areas: a) a high reliable fault tolerant system, b)functional segmentation to minimize the failure effects on operation, c) validation and verification of the owner's engineer's application design (for regulatory compliance) as well as validation and verification of the system architecture and operation (to assure system performance met
Recent characterization of cowpea aphid-borne mosaic virus (CABMV)
African Journals Online (AJOL)
Romário
2015-03-04
Mar 4, 2015 ... region where CABMV was first identified (in that time reported as PWV) in South ... Wizard SV Gel and PCR Clean-Up System – Promega) and cloning ..... prefecture, Japan is the third strain of the proposed new species East.
Bischoff, Christian; Schuller, Katherine; Martin, Steve W
2014-04-03
The 0.5Na2S + 0.5[xGeS2 + (1 - x)PS5/2] mixed glass former (MGF) glass system exhibits a nonlinear and nonadditive negative change in the Na(+) ion conductivity as one glass former, PS5/2, is exchanged for the other, GeS2. This behavior, known as the mixed glass former effect (MGFE), is also manifest in a negative deviation from the linear interpolation of the glass transition temperatures (T(g)) of the binary end-member glasses, x = 0 and x = 1. Interestingly, the composition dependence of the densities of these ternary MGF glasses reveals a slightly positive MGFE deviation from a linear interpolation of the densities of the binary end-member glasses, x = 0 and x = 1. From our previous studies of the structures of these glasses using IR, Raman, and NMR spectroscopies, we find that a disproportionation reaction occurs between PS7/2(4-) and GeS3(2-) units into PS4(3-) and GeS5/2(1-) units. This disproportionation combined with the formation of Ge4S10(4-) anions from GeS5/2(1-) groups leads to the negative MGFE in T(g). A best-fit model of the T(g)s of these glasses was developed to quantify the amount of GeS5/2(1-) units that form Ge4S10(4-) molecular anions in the ternary glasses (∼ 5-10%). This refined structural model was used to develop a short-range structural model of the molar volumes, which shows that the slight densification of the ternary glasses is due to the improved packing efficiency of the germanium sulfide species.
Finite-size giant magnons on η-deformed AdS5×S5
Directory of Open Access Journals (Sweden)
Changrim Ahn
2014-10-01
Full Text Available We consider strings moving in the Rt×Sη3 subspace of the η-deformed AdS5×S5 and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.
Identification of a human ABCC10 orthologue in Catharanthus ...
Indian Academy of Sciences (India)
2014-04-16
Apr 16, 2014 ... into pGEM T-Easy vector (Promega, France) and sequenced. The '5 CrABCC1' .... products (figure 2B) revealing two transcription start sites for the CrABCC1 ..... Wanke D. et al. 2002 Family business: the multidrug-resistance.
The kinematical AdS{sub 5}×S{sup 5} Neumann coefficient
Energy Technology Data Exchange (ETDEWEB)
Bajnok, Zoltan [MTA Lendület Holographic QFT Group, Wigner Research Centre,P.O.B. 49, Budapest 114, H-1525 (Hungary); Janik, Romuald A. [Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, Kraków, 30-348 (Poland)
2016-02-22
For the case of two particles a solution of the string field theory vertex axioms can be factorized into a standard form factor and a kinematical piece which includes the dependence on the size of the third string. In this paper we construct an exact solution of the kinematical axioms for AdS{sub 5}×S{sup 5} which includes all order wrapping corrections w.r.t. the size of the third string. This solution is expressed in terms of elliptic Gamma functions and ordinary elliptic functions. The solution is valid at any coupling and we analyze its weak coupling, pp-wave and large L limit.
Master symmetry in the AdS{sub 5}×S{sup 5} pure spinor string
Energy Technology Data Exchange (ETDEWEB)
Chandía, Osvaldo [Departamento de Ciencias, Facultad de Artes Liberales & Facultad de Ingeniería y Ciencias, Universidad Adolfo Ibáñez,Diagonal Las Torres 2640, Peñalolén, Santiago (Chile); III, William Divine Linch [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy,Texas A& M University,College Station, TX 77843-4242 (United States); Vallilo, Brenno Carlini [Departamento de Ciencias Físicas, Universidad Andres Bello,Sazie 2212, Santiago (Chile)
2017-01-09
We lift the set of classical non-local symmetries recently studied by Klose, Loebbert, and Münkler in the context of ℤ{sub 2} cosets to the pure spinor description of the superstring in the AdS{sub 5}×S{sup 5} background.
Analyzing Digital Library Initiatives: 5S Theory Perspective
Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko
2015-01-01
This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…
Neumann and Neumann-Rosochatius integrable systems from membranes on AdS4 x S7
International Nuclear Information System (INIS)
Bozhilov, Plamen
2007-01-01
It is known that large class of classical string solutions in the type IIB AdS 5 x S 5 background is related to the Neumann and Neumann-Rosochatius integrable systems, including spiky strings and giant magnons. It is also interesting if these integrable systems can be associated with some membrane configurations in M-theory. We show here that this is indeed the case by presenting explicitly several types of membrane embedding in AdS 4 x S 7 with the searched properties
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka
Directory of Open Access Journals (Sweden)
Chee Houa San
2018-01-01
Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.
Kaikula, Kari-Marko
2017-01-01
Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...
Hughes, Bill
2014-01-01
Explore Samsung's next generation Galaxy smartphone Do you want an easy-to-follow guide to everything your new Galaxy S5 smartphone can do? From the basics of texting and accessing the Internet to the most advanced features and new software apps, Samsung Galaxy S5 For Dummies makes the need for tech support obsolete. The Galaxy S5 is designed to be faster and more powerful than ever. This latest release in the market-leading line of smartphones is full of new features for you to explore with the help of Samsung Galaxy S5 For Dummies. With over 1 million apps available for the Google Android o
Resende, Ana; Amorim, António; da Silva, Cláudia Vieira; Ribeiro, Teresa; Porto, Maria João; Costa Santos, Jorge; Afonso Costa, Heloísa
2017-01-01
Twenty-two autosomal short tandem repeats included in the PowerPlex® Fusion System Amplification kit (Promega Corporation) were genotyped in a population sample of 500 unrelated individuals from Cabo Verde living in Lisboa. Allelic frequency data and forensic and statistical parameters were calculated and evaluated in this work. The genetic relationship among immigrant population from Cabo Verde living in Lisboa and other populations, such as Brazilian and Angola immigrants living in Lisboa; Afro-Americans, Caucasians, Hispanics and Asians living in the USA and the population from Lisboa was assessed, and a multidimensional scaling plot was drown to show these results.
Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation
International Nuclear Information System (INIS)
Terao, K.; Uchiumi, T.; Ogata, K.
1980-01-01
After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)
Resurgence of the dressing phase for AdS5 × S5
Arutyunov, Gleb; Dorigoni, Daniele; Savin, Sergei
2017-01-01
We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS5 × S5 superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.
Finite-size giant magnons on η-deformed AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Ahn, Changrim, E-mail: ahn@ewha.ac.kr; Bozhilov, Plamen, E-mail: bozhilov@inrne.bas.bg
2014-10-07
We consider strings moving in the R{sub t}×S{sub η}{sup 3} subspace of the η-deformed AdS{sub 5}×S{sup 5} and obtain a class of solutions depending on several parameters. They are characterized by the string energy and two angular momenta. Finite-size dyonic giant magnon belongs to this class of solutions. Further on, we restrict ourselves to the case of giant magnon with one nonzero angular momentum, and obtain the leading finite-size correction to the dispersion relation.
Implementation Of 5S Methodology In The Small Scale Industry A Case Study
Directory of Open Access Journals (Sweden)
R. S. Agrahari
2015-04-01
Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.
DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT
Directory of Open Access Journals (Sweden)
Marcelo Cavaglieri
2017-06-01
Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Quantizing String Theory in AdS_5 X S^5: Beyond the pp-Wave
Callan, Jr., Curtis G.; Lee, Hok Kong; McLoughlin, Tristan; Schwarz, John H.; Swanson, Ian; Wu, Xinkai
2003-01-01
In a certain kinematic limit, where the effects of spacetime curvature (and other background fields) greatly simplify, the light-cone gauge world-sheet action for a type IIB superstring on AdS_5 x S^5 reduces to that of a free field theory. It has been conjectured by Berenstein, Maldacena, and Nastase that the energy spectrum of this string theory matches the dimensions of operators in the appropriately defined large R-charge large-N_c sector of N=4 supersymmetric Yang--Mills theory in four d...
Evidence-based management of otitis media: a 5S model approach.
Wasson, J D; Yung, M W
2015-02-01
The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.
Mapping clusters of chikungunya and dengue transmission in ...
African Journals Online (AJOL)
Michael Alifrangis
2014; Kajeguka et al., 2016; Vairo et al., 2012) and recent dengue fever ... disease transmission is useful for targeting strategies for surveillance, prevention and control, .... up system (Promega) and sequenced on an ABI 3130xl Genetic Analyzer ..... (2005) Carbon dioxide instantly sensitizes female yellow fever mosquitoes.
African Journals Online (AJOL)
AISA
MATERIALS AND METHODS. NEMATODE COLLECTION AND EXTRACTION ... of the PCR-product cut out of gel were performed according to the manufacturer's instructions1. All samples ... available in database of NCBI. (Genbank). 1Wizard SV Gel and PCR Clean-Up System, Promega Corporation, Madison USA, 2009 ...
Luciferase assay to study the activity of a cloned promoter DNA fragment.
Solberg, Nina; Krauss, Stefan
2013-01-01
Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.
International Nuclear Information System (INIS)
Safarov, M.G.; Gamidov, R.S.; Poladov, P.M.
1991-01-01
The system Sb 2 Te 3 -InS was investigated by the methods of physicochemical analysis. Its state diagram was constructed. It represents the stable diagonal of the mutual ternary system InTe-Sb 2 Te 3 -Sb 2 S 3 -InS. It was established that limited regions of α- and β-solid solutions on the basis of Sb 2 Te 3 and InS, achieving 15.5 and 8 mol.% respectively, formed in the system. Lattice periods of α- and β-solid solutions, their lattice volumes, number of atoms in them and densities were calculated
Lampela, Saara
2017-01-01
Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...
Hill, Carolyn R; Duewer, David L; Kline, Margaret C; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Krenke, Benjamin E; Ensenberger, Martin G; Fulmer, Patricia M; Storts, Douglas R; Butler, John M
2011-08-01
The PowerPlex(®) ESX 17 and ESI 17 Systems for short tandem repeat (STR) amplification were developed by the Promega Corporation to meet the European Network of Forensic Science Institutes (ENFSI) and the European DNA Profiling (EDNAP) Group recommendations for increasing the number of STR loci included in the European Standard Set (ESS). The PowerPlex ESX 17 and ESI 17 Systems utilize different PCR primer combinations to co-amplify the following 17 loci: D1S1656, D2S441, D2S1338, D3S1358, D8S1179, D10S1248, D12S391, D16S539, D18S51, D19S433, D21S11, D22S1045, FGA, TH01, vWA, SE33, and the sex-typing locus amelogenin. A total of 1443 U.S. population samples were evaluated with pre-commercialization versions of both kits. Stutter and heterozygote peak height ratios have been used to characterize kit performance. Typing results have been used to estimate the match probabilities provided by the chosen loci as well as in concordance studies. Full concordance between the typing results for the two kits was observed in 99.994% (49,055 out of 49,062) STR allele calls compared. All genotyping discrepancies were confirmed by DNA sequence analysis. As a result of these comparisons, a second forward primer for the D22S1045 locus has been added to the PowerPlex ESX 17 System to address a primer binding site mutation and the D1S1656 locus reverse primer in the PowerPlex ESI 17 System was modified to eliminate an amplification-efficiency reducing primer dimer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Hyperfine splitting of B mesons and Bs production at the Υ(5S)
International Nuclear Information System (INIS)
Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.
1990-01-01
Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems
Small hairy black holes in AdS(5) x S-5
Bhattacharyya, Sayantani; Minwalla, Shiraz; Papadodimas, Kyriakos
2011-01-01
We study small hairy black holes in a consistent truncation of N = 8 gauged supergravity that consists of a single charged scalar field interacting with the metric and a U(1) gauge field. Small very near extremal RNAdS black holes in this system are unstable to decay by superradiant emission. The
Small hairy black holes in AdS(5) x S-5
Bhattacharyya, Sayantani; Minwalla, Shiraz; Papadodimas, Kyriakos
We study small hairy black holes in a consistent truncation of N = 8 gauged supergravity that consists of a single charged scalar field interacting with the metric and a U(1) gauge field. Small very near extremal RNAdS black holes in this system are unstable to decay by superradiant emission. The
Dark-red-emitting CdTe0.5Se0.5/Cd0.5Zn0.5S quantum dots: Effect of chemicals on properties
International Nuclear Information System (INIS)
Yang, Ping; Zhang, Aiyu; Li, Xiaoyu; Liu, Ning; Zhang, Yulan; Zhang, Ruili
2013-01-01
CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S core/shell quantum dots (QDs) with a tunable photoluminescence (PL) range from yellow to dark red (up to a PL peak wavelength of 683 nm) were fabricated using various reaction systems. The core/shell QDs created in the reaction solution of trioctylamine (TOA) and oleic acid (OA) at 300 °C exhibited narrow PL spectra and a related low PL efficiency (38%). In contrast, the core/shell QDs prepared in the solution of 1-octadecene (ODE) and hexadecylamine (HDA) at 200 °C revealed a high PL efficiency (70%) and broad PL spectra. This phenomenon is ascribed that the precursor of Cd, reaction temperature, solvents, and ligands affected the formation process of the shell. The slow growth rate of the shell in the solution of ODE and HDA made QDs with a high PL efficiency. Metal acetate salts without reaction with HDA led to the core/shell QDs with a broad size distribution. - Graphical abstract: CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots (QDs) with tunable photoluminescence, high PL efficiency, and high stability through organic synthesis, in which chemicals affected the properties of the QDs. Display Omitted - Highlights: • CdTe 0.5 Se 0.5 /Cd 0.5 Zn 0.5 S quantum dots created via organic synthesis. • Chemicals affected the properties of the quantum dots. • The quantum dots revealed high photoluminescence efficiency and stability. • The quantum dots with tunable photoluminescence in a range from yellow to dark red. • The QDs are utilizable for various applications such as biological labeling
Higher conserved charges and integrability for spinning strings in AdS5 x S5
International Nuclear Information System (INIS)
Engquist, Johan
2004-01-01
We demonstrate the existence of an infinite number of local commuting charges for classical solutions of the string sigma model on AdS 5 x S 5 associated with a certain circular three-spin solution spinning with large angular momenta in three orthogonal directions on the five-sphere. Using the AdS/CFT correspondence we find agreement to one-loop with the tower of conserved higher charges in planar N = 4 super Yang-Mills theory associated with the dual composite single-trace operator in the highest weight representation (J 1 ,J 2 ,J 2 ) of SO(6). The agreement can be explained by the presence of integrability on both sides of the duality. (author)
On stringy AdS5 x S5 and higher spin holography
International Nuclear Information System (INIS)
Bianchi, Massimo; Morales, Jose F.; Samtleben, Henning
2003-01-01
We derive the spectrum of Kaluza-Klein descendants of string excitations on AdS 5 x S 5 . String states are organized in long multiplets of the AdS supergroup SU(2,2|4,R) with a rich pattern of shortenings at the higher spin enhancement point λ=0. The string states holographically dual to the higher spin currents of SYM theory in the strict zero coupling limit are identified together with the corresponding Goldstone particles responsible for the Higgsing of the higher spin symmetry at λ≠ 0. Exploiting higher spin symmetry we propose a very simple yet effective mass formula and establish a one-to-one correspondence between the complete spectrum of Δ 0 ≤ 4 string states and relevant/marginal single-trace deformations in N = 4 SYM theory at large N. To this end, we describe how to efficiently enumerate scaling operators in 'free' YM theory, with the inclusion of fermionic 'letters', by resorting to Polya theory. Comparison between the spectra of 1/4-BPS states is also presented. Finally, we discuss how to organize the spectrum of N = 4 SYM theory in SU(2,2|4,R) supermultiplets by means of some kind of 'Eratostenes's sieve'. (author)
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong
Directory of Open Access Journals (Sweden)
Tsoi Vincent F. K.
2014-11-01
Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.
Type IIB supergravity solution for the T-dual of the η-deformed AdS_5×S"5 superstring
International Nuclear Information System (INIS)
Hoare, B.; Tseytlin, A.A.
2015-01-01
We find an exact type IIB supergravity solution that represents a one-parameter deformation of the T-dual of the AdS_5×S"5 background (with T-duality applied in all 6 abelian bosonic isometric directions). The non-trivial fields are the metric, dilaton and RR 5-form only. The latter has remarkably simple “undeformed” form when written in terms of a “deformation-rotated” vielbein basis. An unusual feature of this solution is that the dilaton contains a linear dependence on the isometric coordinates of the metric precluding a straightforward reversal of T-duality. If we still formally dualize back, we find exactly the metric, B-field and product of dilaton with RR field strengths as recently extracted from the η-deformed AdS_5×S"5 superstring action in http://arxiv.org/abs/1507.04239. We also discuss similar solutions for deformed AdS_n×S"n backgrounds with n=2,3. In the η→i limit we demonstrate that all these backgrounds can be interpreted as special limits of gauged WZW models and are also related to (a limit of) the Pohlmeyer-reduced models of the AdS_n×S"n superstrings.
TS Seminar: Overview of Fermilab’s Power Distribution System
CERN. Geneva
2006-01-01
A 27.5 km2 (6800 acre) site is powered by two 345 kV, two 34.5 kV, one 12.4 kV and five 7.2 kV lines. The talk gives an overview of Fermilab’s power distribution system with emphasis on accelerator power. The accelerator power distribution system provides 13.8 kV power to all accelerators and conventional loads. Design criteria, design features and operational experience are given.Organiser(s): F. Rodriguez-Mateos & Emmanuel Tsesmelis
Experiment data report for semiscale Mod-1 Test S-06-5. (LOFT counterpart test)
International Nuclear Information System (INIS)
1977-06-01
Recorded test data are presented for Test S-06-5 of the Semiscale Mod-1 LOFT counterpart test series. These tests are among several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a pressurized water reactor (PWR) system. Test S-06-5 was conducted from initial conditions of 2272 psia and 536 0 F to investigate the response of the Semiscale Mod-1 system to a depressurization and reflood transient following a simulated double-ended offset shear of the broken loop cold leg piping. During the test, cooling water was injected into the cold legs of the intact and broken loops to simulate emergency core coolant injection in a PWR. The purpose of Test S-06-5 was to assess the influence of the break nozzle geometry on core thermal and system response and on the subcooled and low quality mass flow rates at the break locations
Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions
International Nuclear Information System (INIS)
Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.
1996-01-01
The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)
Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr
International Nuclear Information System (INIS)
Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.
1993-01-01
The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Fabrication and characterization of biomorphic 45S5 bioglass scaffold from sugarcane
International Nuclear Information System (INIS)
Qian Junmin; Kang Yahong; Wei Zilin; Zhang Wei
2009-01-01
A biomorphic 45S5 bioglass scaffold has been fabricated from natural plant sugarcane successfully by a novel biotemplating process. Scanning electron microscopy (SEM), X-ray powder diffraction (XRD), Fourier-transform infrared spectroscopy (FTIR), and thermogravimetry and differential scanning calorimetry (TG-DSC) technologies were employed to characterize the morphology, phase and chemical composition of the products. Experimental results show that the as-fabricated 45S5 bioglass scaffold retained the microstructure of sugarcane very well, and consisted of major crystal phase Na 2 Ca 2 Si 3 O 9 of hexagonal system, secondary crystal phase orthorhombic NaCaPO 4 and amorphous glass. The biomorphic 45S5 bioglass scaffold may be a promising candidate scaffold for bone tissue engineering.
Resurgence of the dressing phase for AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Arutyunov, Gleb [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany); Dorigoni, Daniele [Centre for Particle Theory & Department of Mathematical Sciences, Durham University, Lower Mountjoy Stockton Road, Durham DH1 3LE (United Kingdom); Savin, Sergei [Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany); Zentrum für Mathematische Physik, Universität Hamburg, Bundesstrasse 55, 20146 Hamburg (Germany)
2017-01-13
We discuss the resummation of the strong coupling asymptotic expansion of the dressing phase of the AdS{sub 5}×S{sup 5} superstring. The dressing phase proposed by Beisert, Eden and Staudacher can be recovered from a modified Borel-Ecalle resummation of this asymptotic expansion only by completing it with new, non-perturbative and exponentially suppressed terms that can be organized into different sectors labelled by an instanton-like number. We compute the contribution to the dressing phase coming from the sum over all the instanton sectors and show that it satisfies the homogeneous crossing symmetry equation. We comment on the semiclassical origin of the non-perturbative terms from the world-sheet theory point of view even though their precise explanation remains still quite mysterious.
Directory of Open Access Journals (Sweden)
BOCA GRATIELA DANA
2015-07-01
Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.
Additional 5 kWe thermoelectric system temperature transients
International Nuclear Information System (INIS)
Halfen, F.J.
1972-01-01
Several additional system transients have been calculated for the 5 kW(e) TE system and are reported in this document. They include a startup transient with a reactivity rate of 0.005 cents/sec, several startup accidents, a step reactivity insertion at full power and a loss of electrical load. These data are intended for input to system design analyses and for possible use in the protected accident section of the safety report. (U.S.)
Is the S.O.S. diagnostic algorithm applicable to creating highly safe protective systems?
International Nuclear Information System (INIS)
Drab, F.
1994-01-01
The S.O.S. diagnostic system is analyzed and compared with KOMPARACE and MIN-MAX type diagnostic systems. Designed for the identification of failed sensors, the S.O.S. dynamic algorithm is based on a digital monitoring of output signals from a pair of sensors measuring the same technological parameter. The last 3 output signal data from the two sensors are stored in the algorithm memory. The analysis indicates that S.O.S. is no major achievement in the field of diagnosis because its properties are nearly identical with those of the conventional MIN-MAX system. Some degradation failures of the sensor are incorrectly interpreted by the new algorithm, some failures are not detected at all. From this point of view the new algorithm is inferior to the KOMPARACE type algorithm. (J.B.). 2 figs., 5 refs
NOAA’s Physical Oceanographic Real-Time Systems (PORTS(Registered))
2010-06-01
1 NOAA’s Physical Oceanographic Real - Time Systems (PORTS®) Darren Wright and Robert Bassett National Oceanic and Atmospheric Administration...operation of several Physical Oceanographic Real - Time Systems (PORTS®). 0-933957-38-1 ©2009 MTS Report Documentation Page Form ApprovedOMB No. 0704-0188...TITLE AND SUBTITLE NOAAs Physical Oceanographic Real - Time Systems (PORTS®) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6
A User's Manual for MASH V1.5 - A Monte Carlo Adjoint Shielding Code System
Energy Technology Data Exchange (ETDEWEB)
C. O. Slater; J. M. Barnes; J. O. Johnson; J.D. Drischler
1998-10-01
The Monte Carlo ~djoint ~ielding Code System, MASH, calculates neutron and gamma- ray environments and radiation protection factors for armored military vehicles, structures, trenches, and other shielding configurations by coupling a forward discrete ordinates air- over-ground transport calculation with an adjoint Monte Carlo treatment of the shielding geometry. Efficiency and optimum use of computer time are emphasized. The code system includes the GRTUNCL and DORT codes for air-over-ground transport calculations, the MORSE code with the GIFT5 combinatorial geometry package for adjoint shielding calculations, and several peripheral codes that perform the required data preparations, transformations, and coupling functions. The current version, MASH v 1.5, is the successor to the original MASH v 1.0 code system initially developed at Oak Ridge National Laboratory (ORNL). The discrete ordinates calculation determines the fluence on a coupling surface surrounding the shielding geometry due to an external neutron/gamma-ray source. The Monte Carlo calculation determines the effectiveness of the fluence at that surface in causing a response in a detector within the shielding geometry, i.e., the "dose importance" of the coupling surface fluence. A coupling code folds the fluence together with the dose importance, giving the desired dose response. The coupling code can determine the dose response as a function of the shielding geometry orientation relative to the source, distance from the source, and energy response of the detector. This user's manual includes a short description of each code, the input required to execute the code along with some helpful input data notes, and a representative sample problem.
The full spectrum of AdS5/CFT4 I: representation theory and one-loop Q-system
Marboe, Christian; Volin, Dmytro
2018-04-01
With the formulation of the quantum spectral curve for the AdS5/CFT4 integrable system, it became potentially possible to compute its full spectrum with high efficiency. This is the first paper in a series devoted to the explicit design of such computations, with no restrictions to particular subsectors being imposed. We revisit the representation theoretical classification of possible states in the spectrum and map the symmetry multiplets to solutions of the quantum spectral curve at zero coupling. To this end it is practical to introduce a generalisation of Young diagrams to the case of non-compact representations and define algebraic Q-systems directly on these diagrams. Furthermore, we propose an algorithm to explicitly solve such Q-systems that circumvents the traditional usage of Bethe equations and simplifies the computation effort. For example, our algorithm quickly obtains explicit analytic results for all 495 multiplets that accommodate single-trace operators in N=4 SYM with classical conformal dimension up to \\frac{13}{2} . We plan to use these results as the seed for solving the quantum spectral curve perturbatively to high loop orders in the next paper of the series.
Growth differentiation factor 9 gene variants in Sudanese desert ...
African Journals Online (AJOL)
User
2016-11-12
Nov 12, 2016 ... divided by an intron of 1126 base pairs. The exons code for a ... nucleotide polymorphisms (SNPs) cause amino acid substitutions, and some of them have an effect on ovulation rate and .... MgCl2, 20 pmol of each primer, 1.5 U Go Taq Flexi Polymerase in 1-fold Colourless GoTaq Flexi buffer. (Promega ...
MINERAL INFORMATION EXTRACTION BASED ON GAOFEN-5’S THERMAL INFRARED DATA
Directory of Open Access Journals (Sweden)
L. Liu
2018-04-01
Full Text Available Gaofen-5 carries six instruments aimed at various land and atmosphere applications, and it’s an important unit of China High-resolution Earth Observation System. As Gaofen-5’s thermal infrared payload is similar to that of ASTER, which is widely used in mineral exploration, application of Gaofen-5’s thermal infrared data is discussed regarding its capability in mineral classification and silica content estimation. First, spectra of silicate, carbonate, sulfate minerals from a spectral library are used to conduct spectral feature analysis on Gaofen-5’s thermal infrared emissivities. Spectral indices of band emissivities are proposed, and by setting thresholds of these spectral indices, it can classify three types of minerals mentioned above. This classification method is tested on a simulated Gaofen-5 emissivity image. With samples acquired from the study area, this method is proven to be feasible. Second, with band emissivities of silicate and their silica content from the same spectral library, correlation models have been tried to be built for silica content inversion. However, the highest correlation coefficient is merely 0.592, which is much lower than that of correlation model built on ASTER thermal infrared emissivity. It can be concluded that GF-5’s thermal infrared data can be utilized in mineral classification but not in silica content inversion.
Linking Baecklund and monodromy charges for strings on AdS5 x S5
International Nuclear Information System (INIS)
Arutyunov, Gleb; Zamaklar, Marija
2005-01-01
We find an explicit relation between the two known ways of generating an infinite set of local conserved charges for the string sigma model on AdS 5 x S 5 : the Baecklund and monodromy approaches. We start by constructing the two-parameter family of Baecklund transformations for the string with an arbitrary world-sheet metric. We then show that only for a special value of one of the parameters the solutions generated by this transformation are compatible with the Virasoro constraints. By solving the Baecklund equations in a non-perturbative fashion, we finally show that the generating functional of the Baecklund conservation laws is equal to a certain sum of the quasi-momenta. The positions of the quasi-momenta in the complex spectral plane are uniquely determined by the real parameter of the Baecklund transform
Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite
Yu, Wen; Fang, Pengfei; Wang, Shaojie
2014-12-01
Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.
Global population variability in Qiagen Investigator HDplex STRs.
Phillips, C; Fernandez-Formoso, L; Gelabert-Besada, M; García-Magariños, M; Amigo, J; Carracedo, A; Lareu, M V
2014-01-01
Supplementary short tandem repeats (STRs) can be added to forensic analyses if the 15-24 core STRs in routine use fail to give sufficient discrimination power in complex identification or relationship testing scenarios. In this study, 10 of 12 supplementary STRs in the Qiagen Investigator HDplex kit (SE33, D2S1360, D3S1744, D4S2366, D5S2500, D6S474, D7S1517, D8S1132, D10S2325, D21S2055) were genotyped in 941 individuals from the 51 populations of the CEPH Human Genome Diversity Panel (HGDP-CEPH). The other two components of the 12-STR HDplex kit are established STRs D12S391 and D18S51 that we previously genotyped for the HGDP-CEPH panel. We describe the rare alleles identified and outline allele frequency distributions in the seven population groups of the HGDP-CEPH panel. The HDplex STRs novel to forensic application were found to be both highly informative and comparable in their power across all populations studied: at least six of the nine loci showing above average forensic discrimination power in each population group. In some rare instances certain low frequency alleles in D2S1360 were found to overlap in mobility with the neighbouring allele size ranges of D12S391, as well as those of D7S1517 with neighbouring D3S1744 and D10S2325 with neighbouring SE33. Lastly, since expanded five-dye multiplex kits of 20 STRs (Promega Powerplex 21) and 22 STRs (Promega Powerplex Fusion) have recently been introduced, we assess through simulations the increased power to analyse pairwise relationships in deficient pedigrees that can be expected from an optimum kit pair: combining HDplex with either of the above sets to provide 30 or 32 unique STRs and just two overlapping loci. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
A physical design of extracting/accelerating system for a neutron tube with yields of 1.5 X 1010 n/s
International Nuclear Information System (INIS)
Li Wenjie; Li Zhongmin; Dong Aiping; Tian Shengjun
2000-01-01
A new screened type of extracting/accelerating system that accelerates ion beam up to 1.1 mA and 180 kV based on the requirements of high-yield neutron tube is described. The optimization of structure has been realized and a neutron yield of more than 1.5 x 10 10 n/s has reached. The long-term practices prove this physical design is rational and lays a foundation for developing neutron tubes with still higher yield
The camera of the fifth H.E.S.S. telescope. Part I: System description
Energy Technology Data Exchange (ETDEWEB)
Bolmont, J., E-mail: bolmont@in2p3.fr [LPNHE, Université Pierre et Marie Curie Paris 6, Université Denis Diderot Paris 7, CNRS/IN2P3, 4 Place Jussieu, F-75252 Paris Cedex 5 (France); Corona, P.; Gauron, P.; Ghislain, P.; Goffin, C.; Guevara Riveros, L.; Huppert, J.-F.; Martineau-Huynh, O.; Nayman, P.; Parraud, J.-M.; Tavernet, J.-P.; Toussenel, F.; Vincent, D.; Vincent, P. [LPNHE, Université Pierre et Marie Curie Paris 6, Université Denis Diderot Paris 7, CNRS/IN2P3, 4 Place Jussieu, F-75252 Paris Cedex 5 (France); Bertoli, W.; Espigat, P.; Punch, M. [APC, AstroParticule et Cosmologie, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris, Sorbonne Paris Cité, 10, rue Alice Domon et Léonie Duquet, F-75205 Paris Cedex 13 (France); Besin, D.; Delagnes, E.; Glicenstein, J.-F. [CEA Saclay, DSM/IRFU, F-91191 Gif-Sur-Yvette Cedex (France); and others
2014-10-11
In July 2012, as the four ground-based gamma-ray telescopes of the H.E.S.S. (High Energy Stereoscopic System) array reached their tenth year of operation in Khomas Highlands, Namibia, a fifth telescope took its first data as part of the system. This new Cherenkov detector, comprising a 614.5 m{sup 2} reflector with a highly pixelized camera in its focal plane, improves the sensitivity of the current array by a factor two and extends its energy domain down to a few tens of GeV. The present part I of the paper gives a detailed description of the fifth H.E.S.S. telescope's camera, presenting the details of both the hardware and the software, emphasizing the main improvements as compared to previous H.E.S.S. camera technology.
Prediction of Xaa-Pro peptide bond conformation from sequence and chemical shifts
Energy Technology Data Exchange (ETDEWEB)
Shen Yang; Bax, Ad, E-mail: bax@nih.go [National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Laboratory of Chemical Physics (United States)
2010-03-15
We present a program, named Promega, to predict the Xaa-Pro peptide bond conformation on the basis of backbone chemical shifts and the amino acid sequence. Using a chemical shift database of proteins of known structure together with the PDB-extracted amino acid preference of cis Xaa-Pro peptide bonds, a cis/trans probability score is calculated from the backbone and {sup 13}C{sup {beta}} chemical shifts of the proline and its neighboring residues. For an arbitrary number of input chemical shifts, which may include Pro-{sup 13}C{sup {gamma}}, Promega calculates the statistical probability that a Xaa-Pro peptide bond is cis. Besides its potential as a validation tool, Promega is particularly useful for studies of larger proteins where Pro-{sup 13}C{sup {gamma}} assignments can be challenging, and for on-going efforts to determine protein structures exclusively on the basis of backbone and {sup 13}C{sup {beta}} chemical shifts.
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
PM2.5 monitoring system based on ZigBee wireless sensor network
Lin, Lukai; Li, Xiangshun; Gu, Weiying
2017-06-01
In the view of the haze problem, aiming at improving the deficiency of the traditional PM2.5 monitoring methods, such as the insufficient real-time monitoring, limited transmission distance, high cost and the difficulty to maintain, the atmosphere PM2.5 monitoring system based on ZigBee technology is designed. The system combines the advantages of ZigBee’s low cost, low power consumption, high reliability and GPRS/Internet’s capability of remote transmission of data. Furthermore, it adopts TI’s Z-Stack protocol stack, and selects CC2530 chip and TI’s MSP430 microcontroller as the core, which establishes the air pollution monitoring network that is helpful for the early prediction of major air pollution disasters.
Noncentral extension of the $AdS_5 x S^5$ superalgebra supermultiplet of brane charges
Lee, S; Lee, Sangmin; Park, Jeong-Hyuck
2004-01-01
We propose an extension of the su(2,2|4) superalgebra to incorporate the F1/D1 string charges in type IIB string theory on the AdS_5 X S^5 background, or the electro-magnetic charges in the dual super Yang-Mills theory. With the charges introduced, the superalgebra inevitably undergoes a noncentral extension, as noted recently in [1]. After developing a group theoretical method of obtaining the noncentral extension, we show that the charges form a certain nonunitary representation of the original unextended superalgebra, subject to some constraints. We solve the constraints completely and show that, apart from the su(2,2|4) generators, there exist 899 complex brane charges in the extended algebra. Explicitly we present all the super-commutators among them.
Drone Defense System Architecture for U.S. Navy Strategic Facilities
2017-09-01
unlimited. DRONE DEFENSE SYSTEM ARCHITECTURE FOR U.S. NAVY STRATEGIC FACILITIES by David Arteche, Kenneth Chivers, Bryce Howard, Terrell Long, Walter...and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction...project report 4. TITLE AND SUBTITLE DRONE DEFENSE SYSTEM ARCHITECTURE FOR U.S. NAVY STRATEGIC FACILITIES 5. FUNDING NUMBERS 6. AUTHOR(S) David Arteche
Strong decays and dipion transitions of Y(5S)
International Nuclear Information System (INIS)
Simonov, Yu.A.; Veselov, A.I.
2009-01-01
Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ
Energy Technology Data Exchange (ETDEWEB)
Kowalski, K., E-mail: kamil.kowalski@put.poznan.pl [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland); Jurczyk, M.U. [Division of Mother’s and Child’s Health, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Wirstlein, P.K. [Department of Gynecology and Obstetrics, Division of Reproduction, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Jakubowicz, J.; Jurczyk, M. [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland)
2017-05-15
Highlights: • Ultrafine grained composites were formed by consolidating mechanically alloyed powders. • Mechanical properties were sensitive to the content of 45S5 Bioglass in Mg-4Y-5.5Dy-0.5Zr alloy. • Fluoride treated composites displayed superior corrosion resistance in Ringer solution. • Composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material. - Abstract: Bulk samples of an ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-x wt% 45S5 Bioglass (x = 0, 5) and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites have been synthesized by consolidating mechanically alloyed powders. The influence of the chemical composition on the microstructure, mechanical properties and corrosion behavior of bulk composites were studied. The sintering of (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass powders led to the formation of a bulk composite with grain size of approx. 95 nm. The corrosion behavior of Mg-based composites before and after hydrofluoric acid treatment was also investigated. The ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass composite was more corrosion resistant than the bulk Mg-4Y-5.5Dy-0.5Zr alloy after HF treatment. The in vitro biocompatibility of synthesized composites was evaluated and compared with microcrystalline magnesium. Magnesium, (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material.
Coherent Detection for 1550 nm, 5 Gbit/s VCSEL Based 40 km Bidirectional PON Transmission
DEFF Research Database (Denmark)
Jensen, Jesper Bevensee; Rodes Lopez, Roberto; Zibar, Darko
2011-01-01
Coherent detection of directly modulated 1550nm VCSELs in 5Gbit/s bidirectional 40km SSMF PON-links is presented. Receiver sensitivity of –37.3dBm after transmission is achieved with 30dB system margin, corresponding to 1:1024 passive powersplitting.......Coherent detection of directly modulated 1550nm VCSELs in 5Gbit/s bidirectional 40km SSMF PON-links is presented. Receiver sensitivity of –37.3dBm after transmission is achieved with 30dB system margin, corresponding to 1:1024 passive powersplitting....
International Nuclear Information System (INIS)
Zhang, Jia-Lin; Cai, Rong-Gen; Yu, Hongwei
2015-01-01
We study the thermodynamics and thermodynamic geometry of a five-dimensional Schwarzschild AdS black hole in AdS_5×S"5 spacetime by treating the cosmological constant as the number of colors in the boundary gauge theory and its conjugate quantity as the associated chemical potential. It is found that the chemical potential is always negative in the stable branch of black hole thermodynamics and it has a chance to be positive, but appears in the unstable branch. We calculate the scalar curvatures of the thermodynamical Weinhold metric, Ruppeiner metric and Quevedo metric, respectively and we find that the scalar curvature in the Weinhold metric is always vanishing, while in the Ruppeiner metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed chemical potential, and in the Quevedo metric the divergence of the scalar curvature is related to the divergence of the heat capacity with fixed number of colors and to the vanishing of the heat capacity with fixed chemical potential.
A distributed high speed data acquisition system for KT5C tokamak
International Nuclear Information System (INIS)
Sun Xiang; Wang Zhijiang; Lu Ronghua; Wang Jun; Yu Yi; Zhu Zhenghua; Wen Yizhi; Wan Shude; Liu Wandong; Yu Changxuan
2005-01-01
The development of a distributed data acquisition system with low cost to implement high speed data collection through the campus networks for a small tokamak, KT5C, is presented. Data of 512 k bytes at 5 MHz from 5 channels for each can be collected during about 10s after three researchers at different positions demand this system for acquisitions. This system realizes long distance multiuser operations; virtually efficiency of the data acquisition is enhanced. (authors)
[Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].
Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem
2014-04-01
Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on
Loft CIS analysis 2''-LS-118-AB outside containment penetration S5-D
International Nuclear Information System (INIS)
Morton, D.K.
1978-01-01
A stress analysis was performed on the 2''-LS-118-AB pipe system outside containment penetration S5-D. Deadweight, thermal expansion, and seismic loads were considered. The results indicate that this piping will meet ASME Section III, Class 2 requirements provided a U-bolt (S4) is installed as indicated in this report
Instrumentation of air conditioning and ventilation system - R-5 project
International Nuclear Information System (INIS)
Kulkarni, P.B.; Naik, C.D.; Narasingha Rao, S.N.
1977-01-01
A detailed account of instrumentation proposed for airconditioning and ventilation system in the R-5, 100 MW thermal research reactor, under construction is presented. Controls and instrumentation provided in this system are electronic, pneumatic and hydraulic in nature depending on the application. They cater to the accurate operation of the system and maintain the conditions strictly within desired tolerances. (S.K.K.)
On semiclassical analysis of pure spinor superstring in an AdS{sub 5} x S{sup 5} background
Energy Technology Data Exchange (ETDEWEB)
Aisaka, Yuri [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Sao Paulo State Univ. (Brazil). Inst. de Fisica Teorica; Ibiapina Bevilaqua, L. [Univ. Federal do Rio Grande do Norte, Natal (Brazil). Esola de Ciencias e Tecnologia; Vallilo, Brenno C. [Santiago Univ. (Chile). Dept. de Ciencias Fisicas
2012-06-15
Relation between semiclassical analyses of Green-Schwarz and pure spinor formalisms in an AdS{sub 5} x S{sup 5} background is clarified. It is shown that the two formalisms have identical semiclassical partition functions for a simple family of classical solutions. It is also shown that, when the classical string is furthermore rigid, this in turn implies that the two formalisms predict the same one-loop corrections to spacetime energies.
Minimal surfaces in AdS space and integrable systems
Burrington, Benjamin A.; Gao, Peng
2010-04-01
We consider the Pohlmeyer reduction for spacelike minimal area worldsheets in AdS5. The Lax pair for the reduced theory is found, and written entirely in terms of the A3 = D3 root system, generalizing the B2 affine Toda system which appears for the AdS4 string. For the B2 affine Toda system, we show that the area of the worlsheet is obtainable from the moduli space Kähler potential of a related Hitchin system. We also explore the Saveliev-Leznov construction for solutions of the B2 affine Toda system, and recover the rotationally symmetric solution associated to Painleve transcendent.
High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.
Baskakov, O I; Civis, S; Kawaguchi, K
2005-03-15
In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.
International Nuclear Information System (INIS)
Zameroski, Nathan D; Hager, Gordon D; Erickson, Christopher J; Burke, John H
2014-01-01
Doppler free two photon absorption spectroscopy was employed to measure the pressure broadening and frequency shift rates of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) (778.105 nm) and the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) (760.126 nm) two photon transitions in 85 Rb by the noble gases and N 2 . To our knowledge, these rates are reported on for the first time. The self-broadening and shift rate of the 5S 1/2 (F = 3) → 5D 5/2 (F = 5, 4, 3, 2, 1) transition and self -broadening rate of the 5S 1/2 (F = 2) → 7S 1/2 (F = 2) transition were also measured. The temperature dependence of the self-frequency shift (Rb-Rb collisions) of these transitions is presented. Helium diffusion rates through Quartz and Pyrex cells are also calculated and the implication of helium diffusion through glass vapor cells is discussed in regards to atomic frequency standards based on these transitions. Experimental pressure broadening and shift rates are compared to theoretically calculated rates assuming a 6, 8 or 6, 8, 10 difference potential and pseudo potential model. Reasonable agreement is achieved between experimental and theoretical values. (paper)
Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes
Czifra, György
2017-09-01
Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.
Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes
Directory of Open Access Journals (Sweden)
Czifra György
2017-09-01
Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.
Large spin limit of AdS5xS5 string theory and low energy expansion of ferromagnetic spin chains
International Nuclear Information System (INIS)
Kruczenski, M.; Ryzhov, A.V.; Tseytlin, A.A.
2004-01-01
By considering AdS 5 xS 5 string states with large S 5 angular momenta one can provide non-trivial quantitative checks of the AdS/CFT duality. A string rotating in S 5 with two angular momenta J 1 , J 2 is dual to an operator in N=4 SYM theory whose conformal dimension can be computed by diagonalizing a (generalization of) spin 1/2 Heisenberg chain Hamiltonian. It was recently argued and verified to lowest order in a large J=J 1 +J 2 expansion, that the Heisenberg chain can be described using a non-relativistic low energy effective 2d action for a unit vector field n i which exactly matches the corresponding large J limit of the classical AdS 5 xS 5 string action. In this paper we show that this agreement extends to the next order and develop a systematic procedure for computing higher orders in such large angular momentum expansion. This involves several non-trivial steps. On the string side, we need to choose a special gauge with a non-diagonal world-sheet metric which insures that the angular momentum is uniformly distributed along the string, as indeed is the case on the spin chain side. We need also to implement an order by order redefinition of the field n i to get an action linear in the time derivative. On the spin chain side, it turns out to be crucial to include the effects of integrating out short wave-length modes. In this way we gain a better understanding of how (a subsector of) the string sigma model emerges from the dual gauge theory, allowing us to demonstrate the duality beyond comparing particular examples of states with large J
The heavy quarkonium spectrum at order $m\\alpha_{s}^{5}\\ln\\alpha_{s}$
Brambilla, Nora; Soto, Joan; Vairo, Antonio
1999-01-01
We compute the complete leading-log terms of the next-to-next-to-next-to-leading-order corrections to potential NRQCD. As a by-product we obtain the leading logs at $O(m\\alpha_s^5)$ in the heavy quarkonium spectrum. These leading logs, when $\\Lambda_{QCD} \\ll m\\alpha_s^2$, give the complete $O(m\\alpha_s^5 \\ln \\alpha_s)$ corrections to the heavy quarkonium spectrum.
Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan
2012-01-01
5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.
The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.
Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo
2017-10-27
The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
Energy Technology Data Exchange (ETDEWEB)
Yang, Ping, E-mail: mse_yangp@ujn.edu.cn; Zhang, Aiyu; Li, Xiaoyu; Liu, Ning; Zhang, Yulan; Zhang, Ruili
2013-08-15
CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S core/shell quantum dots (QDs) with a tunable photoluminescence (PL) range from yellow to dark red (up to a PL peak wavelength of 683 nm) were fabricated using various reaction systems. The core/shell QDs created in the reaction solution of trioctylamine (TOA) and oleic acid (OA) at 300 °C exhibited narrow PL spectra and a related low PL efficiency (38%). In contrast, the core/shell QDs prepared in the solution of 1-octadecene (ODE) and hexadecylamine (HDA) at 200 °C revealed a high PL efficiency (70%) and broad PL spectra. This phenomenon is ascribed that the precursor of Cd, reaction temperature, solvents, and ligands affected the formation process of the shell. The slow growth rate of the shell in the solution of ODE and HDA made QDs with a high PL efficiency. Metal acetate salts without reaction with HDA led to the core/shell QDs with a broad size distribution. - Graphical abstract: CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S quantum dots (QDs) with tunable photoluminescence, high PL efficiency, and high stability through organic synthesis, in which chemicals affected the properties of the QDs. Display Omitted - Highlights: • CdTe{sub 0.5}Se{sub 0.5}/Cd{sub 0.5}Zn{sub 0.5}S quantum dots created via organic synthesis. • Chemicals affected the properties of the quantum dots. • The quantum dots revealed high photoluminescence efficiency and stability. • The quantum dots with tunable photoluminescence in a range from yellow to dark red. • The QDs are utilizable for various applications such as biological labeling.
D1/D5 systems in N=4 string theories
International Nuclear Information System (INIS)
Gava, Edi; Hammou, Amine B.; Morales, Jose F.; Narain, Kumar S.
2001-01-01
We propose CFT descriptions of the D1/D5 system in a class of freely acting Z 2 orbifolds/orientifolds of type IIB theory, with sixteen unbroken supercharges. The CFTs describing D1/D5 systems involve N=(4,4) or N=(4,0) sigma models on (R 3 xS 1 xT 4 x(T 4 ) N /S N )/Z 2 , where the action of Z 2 is diagonal and its precise nature depends on the model. We also discuss D1(D5)-brane states carrying non-trivial Kaluza-Klein charges, which correspond to excitations of two-dimensional CFTs of the type (R 3 xS 1 xT 4 ) N /S N xZ 2 N . The resulting multiplicities for two-charge bound states are shown to agree with the predictions of U-duality. We raise a puzzle concerning the multiplicities of three-charge systems, which is generically present in all vacuum configurations with sixteen unbroken supercharges studied so far, including the more familiar type IIB on K3 case: the constraints put on BPS counting formulae by U-duality are apparently in contradiction with any CFT interpretation. We argue that the presence of RR backgrounds appearing in the symmetric product CFT may provide a resolution of this puzzle. Finally, we show that the whole tower of D-instanton corrections to certain 'BPS saturated couplings' in the low energy effective actions match with the corresponding one-loop threshold corrections on the dual fundamental string side
Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon
International Nuclear Information System (INIS)
Johnson, W. R.; Cheng, K. T.
2001-01-01
Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled
Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr
Energy Technology Data Exchange (ETDEWEB)
Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)
1993-12-01
The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)
Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe
International Nuclear Information System (INIS)
Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.
2007-01-01
The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well
Experiment data report for Semiscale Mod-1 test S-02-5 (blowdown heat transfer test)
International Nuclear Information System (INIS)
1975-12-01
Recorded test data are presented for Test S-02-5 of the Semiscale Mod-1 blowdown heat transfer test series. Test S-02-5 is one of several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a water-cooled nuclear reactor system and to provide data for the assessment of the Loss-of-Fluid Test (LOFT) design basis. Test S-02-5 was conducted from an initial cold leg fluid temperature of 544 0 F and an initial pressure of 2,253 psia. A simulated double-ended offset shear cold leg break was used to investigate the system response to a depressurization transient with full core power (1.6 MW). An electrically heated core was used in the pressure vessel to simulate the effects of a nuclear core. System flow was set to achieve the full design core temperature differential of 66 0 F. The flow resistance of the intact loop was based on core area scaling. During system depressurization, core power was reduced from the initial level of 1.6 MW in such a manner as to simulate the surface heat flux response of the LOFT nuclear fuel rods until such time that departure from nucleate boiling occurs
DEFF Research Database (Denmark)
Tullberg, Hugo; Popovski, Petar; Li, Zexian
2016-01-01
The authors describe the most important system-level 5G features, enabled by the concept, necessary to meet the very diverse 5G requirements. System-level evaluation results of the METIS 5G system concept are presented, and they conclude that the 5G requirements can be met with the proposed system...... concept....
Attosecond relative delay among xenon 5p, 5s, and 4d photoionization
Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri
2017-04-01
Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.
Energy Technology Data Exchange (ETDEWEB)
Tsuji, N.; Sugiyama, M.; Abe, S. [Toyota Motor Corp. (Japan)
2006-07-01
A new 3.5L V6 engine was introduced for the new Lexus sedan vehicles, GS350 and IS350 in Japan in August 2005. In 2006, this engine will be adapted to the power source of the new hybrid rear wheel driven vehicle GS450h. This new engine uses a newly developed stoichiometric direct injection system with two fuel injectors in each cylinder (this system is called D-4S: direct injection 4-stroke gasoline engine system superior version). One is a direct injection injector generating a dual-vertical-fan-shaped spray with wide dispersion, while the other is a port injector. This new fuel injection system can maximize the DI advantage for full-load performance. Simultaneously the optimisation of the intake and exhaust system and the increase of stiffness of the moving parts such as the timing chain system and the valve train system enable a specific power of 67kW/L and 234kW at 6400r/min to be achieved, placing it near the top of all naturally aspirated production gasoline engines in the world. Additionally, employing the dual-VVTi system (intake and exhaust VVT system) and the long dual exhaust pipe, an excellent maximum torque of 380Nm at 4800r/min was achieved while keeping 90 percent of maximum torque for a wide engine speed range from 2000r/min to 6500r/min. (orig.)
TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD
Directory of Open Access Journals (Sweden)
Raluca BRAD
2015-05-01
Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.
Yee, Nathan K; Dong, Yong; Kapadia, Suresh R; Song, Jinhua J
2002-11-29
A practical and improved synthesis of (3S,5S)-3-[(tert-butyloxycarbonyl)methyl]-5-[(methanesulfonyloxy)methyl]-2-pyrrolidinone (1) is described. The key transformations involve a highly efficient reaction sequence consisting of ethoxycarbonylation, alkylation, hydrolysis, and decarboxylation to produce compound 10. The process described herein is practical, robust, and cost-effective, and it has been successfully implemented in a pilot plant to produce a multikilogram quantity of mesylate 1.
Tevatron global radius and 0s system
International Nuclear Information System (INIS)
Bristol, S.; Kerns, C.; Kerns, Q.; Miller, H.W.
1985-06-01
It has been found to be practical to extract a turn-average measurement of bunch beam phase relative to cavity gap voltage. This 0s signal shows the bunch position on the rf wave throughout injection, acceleration and extraction, including coherent synchrotron oscillations when present. In turn, the time derivative of 0s is a direct measure of global radial position error. We use the 0s signal, driving a phase shifter in the rf low-level system, to damp coherent synchrotron oscillations. Design and operation will be discussed including single beam bunch operation if available. 8 refs., 5 figs
Data archiving system implementation in ITER's CODAC Core System
Energy Technology Data Exchange (ETDEWEB)
Castro, R., E-mail: rodrigo.castro@visite.es [CIEMAT Fusion Program, Avda. Complutense 40, Madrid (Spain); Abadie, L. [ITER Organization, Route de Vinon-sur-Verdon, 13115 St. Paul-lez-Durance (France); Makushok, Y. [Sgenia, C/Chile, 4 Edificio II, Las Rozas, Madrid (Spain); Ruiz, M.; Sanz, D. [Instrumentation and Applied Acoustic Research Group, Technical University of Madrid, Madrid (Spain); Vega, J. [CIEMAT Fusion Program, Avda. Complutense 40, Madrid (Spain); Faig, J. [INDRA Sistemas, S.A. Unid. de Sistemas de Control, Dirección de Tecnología Energética, Madrid (Spain); Román-Pérez, G. [Sgenia, C/Chile, 4 Edificio II, Las Rozas, Madrid (Spain); Simrock, S.; Makijarvi, P. [ITER Organization, Route de Vinon-sur-Verdon, 13115 St. Paul-lez-Durance (France)
2015-10-15
Highlights: • Implementation of ITER's data archiving solution. • Integration of the solution into CODAC Core System. • Data archiving structure. • High efficient data transmission into fast plant system controllers. • Fast control and data acquisition in Linux. - Abstract: The aim of this work is to present the implementation of data archiving in ITER's CODAC Core System software. This first approach provides a client side API and server side software allowing the creation of a simplified version of ITERDB data archiving software, and implements all required elements to complete data archiving flow from data acquisition until its persistent storage technology. The client side includes all necessary components that run on devices that acquire or produce data, distributing and streaming to configure remote archiving servers. The server side comprises an archiving service that stores into HDF5 files all received data. The archiving solution aims at storing data coming for the data acquisition system, the conventional control and also processed/simulated data.
Phase diagrams for systems Cu2S-AIIS (AII=Mg, Ca, Sr, Ba)
International Nuclear Information System (INIS)
Andreev, O.V.; Sikerina, N.V.; Solov'eva, A.V.
2005-01-01
By the methods of physicochemical analysis phase diagrams of Cu 2 S-A II S (A II =Mg, Ca, Sr, Ba) systems are studied. The system Cu 2 S-SrS is of eutectic type with eutectic coordinates 1095 K and 21.5 mol.% of SrS. Solubility of SrS in Cu 2 S is 2 mol.% at 1095 K. Regularities of phase diagram changes of Cu 2 S-A II S (A II =Mg, Ca, Sr, Ba) system are determined. Thermodynamic analysis is done [ru
Pelvimetry and patient acceptability compared between open 0.5-T and closed 1.5-T MR systems
Energy Technology Data Exchange (ETDEWEB)
Michel, Sven C.A.; Treiber, Karl; Marincek, Borut; Kubik-Huch, Rahel A. [Institute of Diagnostic Radiology, University Hospital Zurich, Raemistrasse 100, 8091 Zurich (Switzerland); Rake, Annett; Chaoui, Rabih; Keller, Thomas M. [Department of Obstetrics, University Hospital Zurich, Raemistrasse 100, 8091 Zurich (Switzerland); Goetzmann, Lutz [Institute of Psychosocial Medicine, University Hospital Zurich, Raemistrasse 100, 8091 Zurich (Switzerland); Seifert, Burkhardt [Department of Biostatistics, University Hospital Zurich, Sumatrastrasse 30, 8006 Zurich (Switzerland); Department of Biostatistics, University Hospital Zurich, Sumatrastrasse 30, 8006 Zurich (Switzerland); Ferrazzini, Mattia [Department of Otorhinolaryngology, University Hospital Zurich, Raemistrasse 100, 8091 Zurich (Switzerland)
2002-12-01
Our objective was to compare maternal pelvimetry and patient acceptability between open low-field (0.5-T) and closed 1.5-T MR systems. Thirty women referred for pelvimetry (pregnant: n=15) were scanned twice in the supine position, once in the vertical open system and once in the closed system. Each patient completed a comfort and acceptability questionnaire. Pelvimetric and questionnaire data were compared between systems. Total scan time was double in the open system (7:52{+-}1:47 vs 3:12{+-}1:20 min). Poor image quality in the open system prevented assessment of interspinous and intertuberous diameters in one woman and all measurements in another, both pregnant, with abdominal circumferences >120 cm. The open system was much more acceptable in terms of claustrophobia and confinement (both p<0.01). Claustrophobia interrupted one closed examination. Thirty-three percent of pregnant women in both systems reported fear of fetal harm. Sixty percent of all women preferred the open system, 7% the closed system, and 33% had no preference. Limits of agreement of 3-5% from the mean for all diameters confirmed good pelvimetric reproducibility. Women's preference for open-system MR pelvimetry is feasible with abdominal circumferences {<=}120 cm. (orig.)
GEOS-5 Seasonal Forecast System: ENSO Prediction Skill and Bias
Borovikov, Anna; Kovach, Robin; Marshak, Jelena
2018-01-01
The GEOS-5 AOGCM known as S2S-1.0 has been in service from June 2012 through January 2018 (Borovikov et al. 2017). The atmospheric component of S2S-1.0 is Fortuna-2.5, the same that was used for the Modern-Era Retrospective Analysis for Research and Applications (MERRA), but with adjusted parameterization of moist processes and turbulence. The ocean component is the Modular Ocean Model version 4 (MOM4). The sea ice component is the Community Ice CodE, version 4 (CICE). The land surface model is a catchment-based hydrological model coupled to the multi-layer snow model. The AGCM uses a Cartesian grid with a 1 deg × 1.25 deg horizontal resolution and 72 hybrid vertical levels with the upper most level at 0.01 hPa. OGCM nominal resolution of the tripolar grid is 1/2 deg, with a meridional equatorial refinement to 1/4 deg. In the coupled model initialization, selected atmospheric variables are constrained with MERRA. The Goddard Earth Observing System integrated Ocean Data Assimilation System (GEOS-iODAS) is used for both ocean state and sea ice initialization. SST, T and S profiles and sea ice concentration were assimilated.
TFP5/TP5 peptide provides neuroprotection in the MPTP model of Parkinson′s disease
Directory of Open Access Journals (Sweden)
B K Binukumar
2016-01-01
Full Text Available Cyclin-dependent kinase 5 (Cdk5 is a member of the serine-threonine kinase family of cyclin-dependent kinases. Cdk5 is critical to normal mammalian nervous system development and plays important regulatory roles in multiple cellular functions. Recent evidence indicates that Cdk5 is inappropriately activated in several neurodegenerative conditions, including Parkinson′s disease (PD. PD is a chronic neurodegenerative disorder characterized by the loss of dopamine neurons in the substantia nigra, decreased striatal dopamine levels, and consequent extrapyramidal motor dysfunction. During neurotoxicity, p35 is cleaved to form p25. Binding of p25 with Cdk5 leads deregulation of Cdk5 resulting in number of neurodegenerative pathologies. To date, strategies to specifically inhibit Cdk5 hyperactivity have not been successful without affecting normal Cdk5 activity. Here we show that inhibition of p25/Cdk5 hyperactivation through TFP5/TP5, truncated 24-aa peptide derived from the Cdk5 activator p35 rescues nigrostriatal dopaminergic neurodegeneration induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP/MPP + in a mouse model of PD. TP5 peptide treatment also blocked dopamine depletion in the striatum and improved gait dysfunction after MPTP administration. The neuroprotective effect of TFP5/TP5 peptide is also associated with marked reduction in neuroinflammation and apoptosis. Here we show inhibition of Cdk5/p25-hyperactivation by TFP5/TP5 peptide, which identifies Cdk5/p25 as a potential therapeutic target to reduce neurodegeneration in PD.
Y-chromosome STR haplotypes in Danes
DEFF Research Database (Denmark)
Hallenberg, Charlotte; Nielsen, Karsten; Simonsen, Bo Thisted
2005-01-01
A total of 185 unrelated Danish males were typed for the Y-chromosome STRs DYS19, DYS385a/b, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438 and DYS439 using the kits PowerPlex Y (Promega), ReliaGene Y-Plex 6 and ReliaGene Y-Plex 5 (Reliagene Technologies). A total of 163...
Assessment of fungal diversity in deep-sea sediments by multiple primer approach
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...
Electrochemical Behavior of Molten V2O5-K2S2O7-KHSO4 Systems
DEFF Research Database (Denmark)
Petrushina, Irina; Bjerrum, Niels; Berg, Rolf W.
1997-01-01
The electrochemical behavior of K2S2O7-KHSO4-V2O5, K2S2O7-V2O4 and K2S2O7-KHSO4-V2O4 melts was studied in argon and SO2/air atmospheres using a gold electrode. In order to identify the voltammetric waves due to KHSO4, molten KHSO4 and mixtures of K2S2O7-KHSO4 were investigated by voltammetry...
Large Scale Construction Project Innovative Management Through 5-S
Directory of Open Access Journals (Sweden)
Hashim Hj. Abdul Ghani Mohd.
2014-11-01
Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.
Analysis of Characteristics and Requirements for 5G Mobile Communication Systems
Ancans, G.; Stafecka, A.; Bobrovs, V.; Ancans, A.; Caiko, J.
2017-08-01
One of the main objectives of the fifth generation (5G) mobile communication systems, also known as IMT-2020, is to increase the current data rates up to several gigabits per second (Gbit/s) or even up to 10 Gbit/s and higher. One of the possibilities to consider is the use of higher frequencies in order to enlarge the available bandwidth. Wider bandwidth is necessary to achieve much higher data rates. It should be noted that wireless broadband transmission technologies require frequencies for their development. The main goal of the research is to investigate the characteristics and requirements of 5G mobile communication systems. The paper provides an insight into deployment scenario and radio wave propagation in frequencies above 24 GHz of IMT-2020.
The H.E.S.S. data acquisition system
Balzer, A; Gajdus, M; Göring, D; Lopatin, A; Murach, T; de Naurois, M; Schlenker, S; Schwanke, U; Stegmann, C; Wagner, P
2014-01-01
The High Energy Stereoscopic System (H.E.S.S.) is an array of five Imaging Atmospheric Cherenkov Telescopes located in the Khomas Highland in Namibia. It measures cosmic gamma-rays with very high energies (> 100 GeV) using the Earth's atmosphere as a calorimeter. The H.E.S.S. experiment has entered Phase II in September 2012 with the inauguration of a fifth telescope that is larger and more complex than the other four. The very large mirror area of 600 m(2) in comparison to the 100 m(2) of the smaller telescopes results in a lower energy threshold as well as an increased overall sensitivity of the system. Moreover, the huge effective area, due to the large mirror size, is crucial in the detection of short time scale low energy transient events. This paper will give a brief overview of the design principles of the current H.E.S.S. data acquisition and array control system. Particular emphasis is given to the new Target of Opportunity alert system that has recently been introduced to the array and allows the in...
RELAP5 assessment using semiscale SBLOCA test S-NH-1
International Nuclear Information System (INIS)
Lee, E.J.; Chung, B.D.; Kim, H.J.
1993-06-01
2-inch cold leg break test S-NH-1, conducted at the 1/1705 volume scaled facility Semiscale was analyzed using RELAP5/MOD2 Cycle 36.04 and MOD3 Version 5m5. Loss of HPIS was assumed, and reactor trip occurred on a low PZR pressure signal (13.1 MPa), and pumps began an unpowered coastdown on SI signal (12.5 MPa). The system was recovered by opening ADV's when the PCT became higher than 811 K. Accumulator was finally injected into the system when the primary system pressure was less than 4.0 MPa. The experiment was terminated when the pressure reached the LPIS actuation set point RELAP5/MOD2 analysis demonstrated its capability to predict, with a sufficient accuracy, the main phenomena occurring in the depressurization transient, both from a qualitative and quantitative points of view. Nevertheless, several differences were noted regarding the break flow rate and inventory distribution due to deficiencies in two-phase choked flow model, horizontal stratification interfacial drag, and a CCFL model. The main reason for the core to remain nearly fully covered with the liquid was the under-prediction of the break flow by the code. Several sensitivity calculations were tried using the MOD2 to improve the results by using the different options of break flow modeling (downward, homogeneous, and area increase). The break area compensating concept based on ''the integrated break flow matching'' gave the best results than downward junction and homogeneous options. And the MOD3 showed improvement in predicting a CCFL in SG and a heatup in the core
International Nuclear Information System (INIS)
Zender, S.N.; Crapo, H.S.; Jensen, M.F.; Sackett, K.E.
1975-04-01
Recorded test data are presented for Test S-01-5 of the semiscale Mod-1 isothermal blowdown test series. Test S-01-5 is one of several semiscale Mod-1 experiments which are counterparts of the LOFT nonnuclear experiments. System hardware is representative of LOFT with the design based on volumetric scaling methods and with initial conditions duplicating those identified for LOFT nonnuclear tests. Test S-01-5 was conducted with the secondary side of the steam generator pressurized with nitrogen gas in order to effectively eliminate heat transfer from the steam generator during blowdown and thereby to investigate the effect on overall system behavior of heat transfer from the steam generator. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. The test was initiated at isothermal conditions of 2270 psig and 540 0 F by a simulated offset shear of the cold leg broken loop piping. During system depressurization, coolant was injected into the cold leg of the operating loop to simulate emergency core cooling (ECC). Following the blowdown portion of the test, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. The uninterpreted data from Test S-01-5 and the reference material needed for future data analysis and test results reporting activities are presented. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. (U.S.)
Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI
International Nuclear Information System (INIS)
Sharma, M.K.; Tauheed, A.; Rahimullah, K.
2014-01-01
The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated
Directory of Open Access Journals (Sweden)
Dominik M Schulte
Full Text Available Obesity is associated with macrophage infiltration of adipose tissue. These inflammatory cells affect adipocytes not only by classical cytokines but also by the secreted glycopeptide wnt5a. Healthy adipocytes are able to release the wnt5a inhibitor sFRP5. This protective effect, however, was found to be diminished in obesity. The aim of the present study was to examine (1 whether obese human subjects exhibit increased serum concentrations of wnt5a and (2 whether wnt5a and/or sFRP5 serum concentrations in obese subjects can be influenced by caloric restriction.23 obese human subjects (BMI 44.1 ± 1.1 kg/m(2 and 12 age- and sex-matched lean controls (BMI 22.3 ± 0.4 kg/m(2 were included in the study. Obese subjects were treated with a very low-calorie diet (approximately 800 kcal/d for 12 weeks. Body composition was assessed by impedance analysis, insulin sensitivity was estimated by HOMA-IR and the leptin-to-adiponectin ratio and wnt5a and sFRP5 serum concentrations were measured by ELISA. sFRP5 expression in human adipose tissue biopsies was further determined on protein level by immunohistology.Pro-inflammatory wnt5a was not measurable in any serum sample of lean control subjects. In patients with obesity, however, wnt5a became significantly detectable consistent with low grade inflammation in such subjects. Caloric restriction resulted in a weight loss from 131.9 ± 4.0 to 112.3 ± 3.2 kg in the obese patients group. This was accompanied by a significant decrease of HOMA-IR and leptin-to-adiponectin ratio, indicating improved insulin sensitivity. Interestingly, these metabolic improvements were associated with a significant increase in serum concentrations of the anti-inflammatory factor and wnt5a-inhibitor sFRP5.Obesity is associated with elevated serum levels of pro-inflammatory wnt5a in humans. Furthermore, caloric restriction beneficially affects serum concentrations of anti-inflammatory sFRP5 in such subjects. These findings suggest a
5S-toimintamallin kehittäminen nostintuotannossa
Laine, Atte
2017-01-01
TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Tucker, Valerie C; Hopwood, Andrew J; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Ensenberger, Martin G; Thompson, Jonelle M; Storts, Douglas R
2011-11-01
In response to the ENFSI and EDNAP groups' call for new STR multiplexes for Europe, Promega(®) developed a suite of four new DNA profiling kits. This paper describes the developmental validation study performed on the PowerPlex(®) ESI 16 (European Standard Investigator 16) and the PowerPlex(®) ESI 17 Systems. The PowerPlex(®) ESI 16 System combines the 11 loci compatible with the UK National DNA Database(®), contained within the AmpFlSTR(®) SGM Plus(®) PCR Amplification Kit, with five additional loci: D2S441, D10S1248, D22S1045, D1S1656 and D12S391. The multiplex was designed to reduce the amplicon size of the loci found in the AmpFlSTR(®) SGM Plus(®) kit. This design facilitates increased robustness and amplification success for the loci used in the national DNA databases created in many countries, when analyzing degraded DNA samples. The PowerPlex(®) ESI 17 System amplifies the same loci as the PowerPlex(®) ESI 16 System, but with the addition of a primer pair for the SE33 locus. Tests were designed to address the developmental validation guidelines issued by the Scientific Working Group on DNA Analysis Methods (SWGDAM), and those of the DNA Advisory Board (DAB). Samples processed include DNA mixtures, PCR reactions spiked with inhibitors, a sensitivity series, and 306 United Kingdom donor samples to determine concordance with data generated with the AmpFlSTR(®) SGM Plus(®) kit. Allele frequencies from 242 white Caucasian samples collected in the United Kingdom are also presented. The PowerPlex(®) ESI 16 and ESI 17 Systems are robust and sensitive tools, suitable for the analysis of forensic DNA samples. Full profiles were routinely observed with 62.5pg of a fully heterozygous single source DNA template. This high level of sensitivity was found to impact on mixture analyses, where 54-86% of unique minor contributor alleles were routinely observed in a 1:19 mixture ratio. Improved sensitivity combined with the robustness afforded by smaller amplicons
The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron
Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.
1982-01-01
The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.
DEFF Research Database (Denmark)
Paulsen, Andreas L.; Borup, Flemming; Berg, Rolf W.
2010-01-01
The structural and vibrational properties of NbV oxosulfato complexes formed in Nb2O5-K2S2O7 and Nb2O5-K2S2O7-K2SO4 molten mixtures with 0 ... for the binary Nb2O5-K2S2O7 molten system indicate that the dissolution of Nb2O5 proceeds with consumption of S2O7 leading to the formation of a NbV oxosulfato complex according to Nb2O5 + nS2O7 --> C2n-; a simple formalism exploiting the relative Raman band intensities is used for determining the stoichiometric...... coefficient, n, pointing to n = 3 and to the following reaction: Nb2O5 + 3S2O7 --> 2NbO(SO4)3, which is consistent with the Raman spectra of the molten mixtures. Nb2O5 could be dissolved much easier when K2SO4 was present in an equimolar (1:1) SO4/Nb ratio; the incremental presence of K2SO4 in Nb2O5-K2S2O7...
Hund’s Rule-Driven Dzyaloshinskii-Moriya Interaction at 3d−5d Interfaces
Belabbes, Abderrezak
2016-12-09
Using relativistic first-principles calculations, we show that the chemical trend of the Dzyaloshinskii-Moriya interaction (DMI) in 3d-5d ultrathin films follows Hund\\'s first rule with a tendency similar to their magnetic moments in either the unsupported 3d monolayers or 3d-5d interfaces. We demonstrate that, besides the spin-orbit coupling (SOC) effect in inversion asymmetric noncollinear magnetic systems, the driving force is the 3d orbital occupations and their spin-flip mixing processes with the spin-orbit active 5d states control directly the sign and magnitude of the DMI. The magnetic chirality changes are discussed in the light of the interplay between SOC, Hund\\'s first rule, and the crystal-field splitting of d orbitals. © 2016 American Physical Society.
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
Project 5S: A Safe Stepping Stone into the Solar System
Brophy, John; Culick, Fred; Dimotakis, Paul; Friedman, Louis
2012-01-01
The human exploration program, at least in NASA, has been directed to move beyond the Moon and travel on a flexible path into the solar system. Reaching a Near-Earth Asteroid (NEA) is a major human space flight goal but such missions have tight times and life-support requirements that require huge steps from current capabilities. An objective between the Moon and a NEA is needed. Example interim objectives are the Lagrangian points in either the Sun-Earth or Earth-Moon (EM) system. The nearest of these points beyond the Moon is E-M L2. The Lagrangian points are empty (as far as we know). As objectives for human flight,it has been argued that they suffer from a lack of public interest and of meaningful objectives for astronaut operations. To provide a physical target, a robotic spacecraft could retrieve a small NEA and bring it to a Lagrangian or other nearer-Earth point to be accessed and utilized for human-mission objectives. This paper reports on the results of a recently completed study of an asteroid retrieval mission sponsored by the Keck Institute for Space Studies (KISS) at the California Institute of Technology. The study included an evaluation of potential targets, mission objectives, mission and system design, and potential capture mechanisms. The study concluded that, while challenging, there are no fundamental show stoppers and that such a mission would be possible with technology expected to be available in this decade. The final destination selected (for safety and mission operations) was high lunar orbit. Two options for target selection are considered: (i) retrieving a small (7 meter) NEA with a mass of order 500,000 kg, and (ii) taking a similar size boulder of a large known carbonaceous NEA. Several areas of technology and program requirements were identified, but the most important conclusion was that this approach enables meeting a goal of humans going to a NEA by the mid-2020s. The advantages and benefits for human exploration are considerable
Newman-Tancredi, A; Rivet, J; Chaput, C; Touzard, M; Verrièle, L; Millan, M J
1999-11-19
4-(Benzodioxan-5-yl)1-(indan-2-yl)piperazine (S15535) is a highly selective ligand at 5-HT(1A) receptors. The present study compared its autoradiographic labelling of rat brain sections with its functional actions, visualised by guanylyl-5'-[gamma-thio]-triphosphate ([35S]GTPgammaS) autoradiography, which affords a measure of G-protein activation. [3H]S15535 binding was highest in hippocampus, frontal cortex, entorhinal cortex, lateral septum, interpeduncular nucleus and dorsal raphe, consistent with specific labelling of 5-HT(1A) receptors. In functional studies, S15535 (10 microM) did not markedly stimulate G-protein activation in any brain region, but abolished the activation induced by the selective 5-HT(1A) agonist, (+)-8-hydroxy-dipropyl-aminotetralin ((+)-8-OH-DPAT, 1 microM), in structures enriched in [3H]S15535 labelling. S15535 did not block 5-HT-stimulated activation in caudate nucleus or substantia nigra, regions where (+)-8-OH-DPAT was ineffective and [3H]S15535 binding was absent. Interestingly, S15535 attenuated (+)-8-OH-DPAT and 5-HT-stimulated G-protein activation in dorsal raphe, a region in which S15535 is known to exhibit agonist properties in vivo [Lejeune, F., Millan, M.J., 1998. Induction of burst firing in ventral tegmental area dopaminergic neurons by activation of serotonin (5-HT)(1A) receptors: WAY100,635-reversible actions of the highly selective ligands, flesinoxan and S15535. Synapse 30, 172-180.]. The present data show that (i) [3H]S15535 labels pre- and post-synaptic populations of 5-HT(1A) sites in rat brain sections, (ii) S15535 exhibits antagonist properties at post-synaptic 5-HT(1A) receptors in corticolimbic regions, and (iii) S15535 also attenuates agonist-stimulated G-protein activation at raphe-localised 5-HT(1A) receptors.
Directory of Open Access Journals (Sweden)
Lip Lin Koh
2011-01-01
Full Text Available In the title compound, C16H13N7O, the 1,2,4-triazolo[1,5-a][1,3,5]triazine heterocyclic system is essentially planar (r.m.s. deviation = 0.0375 Å. The attached benzene ring lies almost in the mean plane of 1,2,4-triazolo[1,5-a][1,3,5]triazine [dihedral angle = 1.36 (23°], while the pyridine ring is turned out of this plane by the aminomethyl bridge [dihedral angle = 69.22 (9°]. The amino group H atom is involved in intramolecular hydrogen bonding with a triazole N atom. In the crystal, molecules are connected via C(=ONH...N hydrogen bonds into C(11 chains parallel to [100]. The amino group H atom acts as a hydrogen-bond donor, forming an NH...O=C hydrogen bond with the carbonyl O atom, which links the molecules into C(6 chains running along [011] and [01overline{1}].
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
Chatrchyan, Serguei; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Krätschmer, Ilse; Liko, Dietrich; Mikulec, Ivan; Rabady, Dinyar; Rahbaran, Babak; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Treberer-Treberspurg, Wolfgang; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; Bansal, Monika; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Knutsson, Albert; Luyckx, Sten; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Heracleous, Natalie; Kalogeropoulos, Alexis; Keaveney, James; Kim, Tae Jeong; Lowette, Steven; Maes, Michael; Olbrechts, Annik; Strom, Derek; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Caillol, Cécile; Clerbaux, Barbara; De Lentdecker, Gilles; Favart, Laurent; Gay, Arnaud; Hreus, Tomas; Léonard, Alexandre; Marage, Pierre Edouard; Mohammadi, Abdollah; Perniè, Luca; Reis, Thomas; Seva, Tomislav; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Adler, Volker; Beernaert, Kelly; Benucci, Leonardo; Cimmino, Anna; Costantini, Silvia; Dildick, Sven; Garcia, Guillaume; Klein, Benjamin; Lellouch, Jérémie; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Ryckbosch, Dirk; Sigamani, Michael; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Walsh, Sinead; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Beluffi, Camille; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Da Silveira, Gustavo Gil; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Jez, Pavel; Komm, Matthias; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Nuttens, Claude; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Popov, Andrey; Quertenmont, Loic; Selvaggi, Michele; Vidal Marono, Miguel; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Alves, Gilvan; Correa Martins Junior, Marcos; Martins, Thiago; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Aldá Júnior, Walter Luiz; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Malbouisson, Helena; Malek, Magdalena; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santaolalla, Javier; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Bernardes, Cesar Augusto; De Almeida Dias, Flavia; Tomei, Thiago; De Moraes Gregores, Eduardo; Lagana, Caio; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Genchev, Vladimir; Iaydjiev, Plamen; Marinov, Andrey; Piperov, Stefan; Rodozov, Mircho; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Du, Ran; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Plestina, Roko; Tao, Junquan; Wang, Xianyou; Wang, Zheng; Asawatangtrakuldee, Chayanit; Ban, Yong; Guo, Yifei; Li, Wenbo; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Wang, Dayong; Zhang, Linlin; Zou, Wei; Avila, Carlos; Carrillo Montoya, Camilo Andres; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Kadija, Kreso; Luetic, Jelena; Mekterovic, Darko; Morovic, Srecko; Tikvica, Lucija; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Finger, Miroslav; Finger Jr, Michael; Abdelalim, Ahmed Ali; Assran, Yasser; Elgammal, Sherif; Ellithi Kamel, Ali; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Müntel, Mait; Murumaa, Marion; Raidal, Martti; Rebane, Liis; Tiko, Andres; Eerola, Paula; Fedi, Giacomo; Voutilainen, Mikko; Härkönen, Jaakko; Karimäki, Veikko; Kinnunen, Ritva; Kortelainen, Matti J; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Nayak, Aruna; Rander, John; Rosowsky, André; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Charlot, Claude; Daci, Nadir; Dahms, Torsten; Dalchenko, Mykhailo; Dobrzynski, Ludwik; Filipovic, Nicolas; Florent, Alice; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Naranjo, Ivo Nicolas; Nguyen, Matthew; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Veelken, Christian; Yilmaz, Yetkin; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Goetzmann, Christophe; Juillot, Pierre; Le Bihan, Anne-Catherine; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Beaupere, Nicolas; Boudoul, Gaelle; Brochet, Sébastien; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fan, Jiawei; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Ruiz Alvarez, José David; Sgandurra, Louis; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Xiao, Hong; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Bontenackels, Michael; Calpas, Betty; Edelhoff, Matthias; Feld, Lutz; Hindrichs, Otto; Klein, Katja; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Caudron, Julien; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Knutzen, Simon; Kreuzer, Peter; Merschmeyer, Markus; Meyer, Arnd; Olschewski, Mark; Padeken, Klaas; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Teyssier, Daniel; Thüer, Sebastian; Weber, Martin; Cherepanov, Vladimir; Erdogan, Yusuf; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Lingemann, Joschka; Nowack, Andreas; Nugent, Ian Michael; Perchalla, Lars; Pooth, Oliver; Stahl, Achim; Asin, Ivan; Bartosik, Nazar; Behr, Joerg; Behrenhoff, Wolf; Behrens, Ulf; Bell, Alan James; Bergholz, Matthias; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Choudhury, Somnath; Costanza, Francesco; Diez Pardos, Carmen; Dooling, Samantha; Dorland, Tyler; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Flucke, Gero; Geiser, Achim; Grebenyuk, Anastasia; Gunnellini, Paolo; Habib, Shiraz; Hauk, Johannes; Hellwig, Gregor; Hempel, Maria; Horton, Dean; Jung, Hannes; Kasemann, Matthias; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Krämer, Mira; Krücker, Dirk; Lange, Wolfgang; Leonard, Jessica; Lipka, Katerina; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Novgorodova, Olga; Nowak, Friederike; Olzem, Jan; Perrey, Hanno; Petrukhin, Alexey; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Riedl, Caroline; Ron, Elias; Sahin, Mehmet Özgür; Salfeld-Nebgen, Jakob; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Schröder, Matthias; Sen, Niladri; Stein, Matthias; Vargas Trevino, Andrea Del Rocio; Walsh, Roberval; Wissing, Christoph; Aldaya Martin, Maria; Blobel, Volker; Enderle, Holger; Erfle, Joachim; Garutti, Erika; Görner, Martin; Gosselink, Martijn; Haller, Johannes; Goebel, Kristin; Höing, Rebekka Sophie; Kirschenmann, Henning; Klanner, Robert; Kogler, Roman; Lange, Jörn; Marchesini, Ivan; Ott, Jochen; Peiffer, Thomas; Pietsch, Niklas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Schum, Torben; Seidel, Markus; Sibille, Jennifer; Sola, Valentina; Stadie, Hartmut; Steinbrück, Georg; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Barth, Christian; Baus, Colin; Berger, Joram; Böser, Christian; Butz, Erik; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Guthoff, Moritz; Hartmann, Frank; Hauth, Thomas; Held, Hauke; Hoffmann, Karl-Heinz; Husemann, Ulrich; Katkov, Igor; Kornmayer, Andreas; Kuznetsova, Ekaterina; Lobelle Pardo, Patricia; Martschei, Daniel; Mozer, Matthias Ulrich; Müller, Thomas; Niegel, Martin; Nürnberg, Andreas; Oberst, Oliver; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Röcker, Steffen; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Wolf, Roger; Zeise, Manuel; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Markou, Athanasios; Markou, Christos; Ntomari, Eleni; Topsis-Giotis, Iasonas; Gouskos, Loukas; Panagiotou, Apostolos; Saoulidou, Niki; Stiliaris, Efstathios; Aslanoglou, Xenofon; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Karancsi, János; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Swain, Sanjay Kumar; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Kaur, Manjit; Mehta, Manuk Zubin; Mittal, Monika; Nishu, Nishu; Sharma, Archana; Singh, Jasbir; Kumar, Ashok; Kumar, Arun; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Saxena, Pooja; Sharma, Varun; Shivpuri, Ram Krishen; Banerjee, Sunanda; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Modak, Atanu; Mukherjee, Swagata; Roy, Debarati; Sarkar, Subir; Sharan, Manoj; Singh, Anil; Abdulsalam, Abdulla; Dutta, Dipanwita; Kailas, Swaminathan; Kumar, Vineet; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Chatterjee, Rajdeep Mohan; Ganguly, Sanmay; Ghosh, Saranya; Guchait, Monoranjan; Gurtu, Atul; Kole, Gouranga; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Behnamian, Hadi; Etesami, Seyed Mohsen; Fahim, Ali; Jafari, Abideh; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Grunewald, Martin; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Selvaggi, Giovanna; Silvestris, Lucia; Singh, Gurpreet; Venditti, Rosamaria; Verwilligen, Piet; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Gallo, Elisabetta; Gonzi, Sandro; Gori, Valentina; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Ferretti, Roberta; Ferro, Fabrizio; Lo Vetere, Maurizio; Musenich, Riccardo; Robutti, Enrico; Tosi, Silvano; Benaglia, Andrea; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Lucchini, Marco Toliman; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellato, Marco; Biasotto, Massimo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Dorigo, Tommaso; Fanzago, Federica; Galanti, Mario; Gasparini, Fabrizio; Gasparini, Ugo; Giubilato, Piero; Gozzelino, Andrea; Kanishchev, Konstantin; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Triossi, Andrea; Zotto, Pierluigi; Zucchetta, Alberto; Zumerle, Gianni; Gabusi, Michele; Ratti, Sergio P; Riccardi, Cristina; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Fanò, Livio; Lariccia, Paolo; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Romeo, Francesco; Saha, Anirban; Santocchia, Attilio; Spiezia, Aniello; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Grippo, Maria Teresa; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Moon, Chang-Seong; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Vernieri, Caterina; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Diemoz, Marcella; Grassi, Marco; Jorda, Clara; Longo, Egidio; Margaroli, Fabrizio; Meridiani, Paolo; Micheli, Francesco; Nourbakhsh, Shervin; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Soffi, Livia; Traczyk, Piotr; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Casasso, Stefano; Costa, Marco; Degano, Alessandro; Demaria, Natale; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Ortona, Giacomo; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Tamponi, Umberto; Belforte, Stefano; Candelise, Vieri; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; La Licata, Chiara; Marone, Matteo; Montanino, Damiana; Penzo, Aldo; Schizzi, Andrea; Umer, Tomo; Zanetti, Anna; Chang, Sunghyun; Kim, Tae Yeon; Nam, Soon-Kwon; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Lee, Sangeun; Oh, Young Do; Park, Hyangkyu; Son, Dong-Chul; Kim, Jae Yool; Kim, Zero Jaeho; Song, Sanghyeon; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Yongsun; Lee, Kyong Sei; Park, Sung Keun; Roh, Youn; Choi, Minkyoo; Kim, Ji Hyun; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Min Suk; Kwon, Eunhyang; Lee, Byounghoon; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Grigelionis, Ignas; Juodagalvis, Andrius; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Lopez-Fernandez, Ricardo; Martínez-Ortega, Jorge; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Doesburg, Robert; Reucroft, Steve; Silverwood, Hamish; Ahmad, Muhammad; Asghar, Muhammad Irfan; Butt, Jamila; Hoorani, Hafeez R; Khalid, Shoaib; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Shah, Mehar Ali; Shoaib, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Wolszczak, Weronika; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Nguyen, Federico; Rodrigues Antunes, Joao; Seixas, Joao; Varela, Joao; Vischia, Pietro; Afanasiev, Serguei; Bunin, Pavel; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Konoplyanikov, Viktor; Kozlov, Guennady; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Skatchkov, Nikolai; Smirnov, Vitaly; Zarubin, Anatoli; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Safronov, Grigory; Semenov, Sergey; Spiridonov, Alexander; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Belyaev, Andrey; Boos, Edouard; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Korotkikh, Vladimir; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Snigirev, Alexander; Vardanyan, Irina; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Ekmedzic, Marko; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Merino, Gonzalo; Navarro De Martino, Eduardo; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; Willmott, Carlos; Albajar, Carmen; de Trocóniz, Jorge F; Brun, Hugues; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Graziano, Alberto; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Bachtis, Michail; Baillon, Paul; Ball, Austin; Barney, David; Bendavid, Joshua; Benhabib, Lamia; Benitez, Jose F; Bernet, Colin; Bianchi, Giovanni; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Bondu, Olivier; Botta, Cristina; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Colafranceschi, Stefano; D'Alfonso, Mariarosaria; D'Enterria, David; Dabrowski, Anne; David Tinoco Mendes, Andre; De Guio, Federico; De Roeck, Albert; De Visscher, Simon; Di Guida, Salvatore; Dobson, Marc; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Eugster, Jürg; Franzoni, Giovanni; Funk, Wolfgang; Giffels, Manuel; Gigi, Dominique; Gill, Karl; Girone, Maria; Giunta, Marina; Glege, Frank; Gomez-Reino Garrido, Robert; Gowdy, Stephen; Guida, Roberto; Hammer, Josef; Hansen, Magnus; Harris, Philip; Hinzmann, Andreas; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Kousouris, Konstantinos; Krajczar, Krisztian; Lecoq, Paul; Lee, Yen-Jie; Lourenco, Carlos; Magini, Nicolo; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moortgat, Filip; Mulders, Martijn; Musella, Pasquale; Orsini, Luciano; Palencia Cortezon, Enrique; Perez, Emmanuelle; Perrozzi, Luca; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Piparo, Danilo; Plagge, Michael; Racz, Attila; Reece, William; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Santanastasio, Francesco; Schäfer, Christoph; Schwick, Christoph; Sekmen, Sezen; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Steggemann, Jan; Stieger, Benjamin; Stoye, Markus; Tsirou, Andromachi; Veres, Gabor Istvan; Vlimant, Jean-Roch; Wöhri, Hermine Katharina; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Renker, Dieter; Rohe, Tilman; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Bortignon, Pierluigi; Buchmann, Marco-Andrea; Casal, Bruno; Chanon, Nicolas; Deisher, Amanda; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Dünser, Marc; Eller, Philipp; Grab, Christoph; Hits, Dmitry; Lustermann, Werner; Mangano, Boris; Marini, Andrea Carlo; Martinez Ruiz del Arbol, Pablo; Meister, Daniel; Mohr, Niklas; Nägeli, Christoph; Nef, Pascal; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pape, Luc; Pauss, Felicitas; Peruzzi, Marco; Quittnat, Milena; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Starodumov, Andrei; Takahashi, Maiko; Tauscher, Ludwig; Theofilatos, Konstantinos; Treille, Daniel; Wallny, Rainer; Weber, Hannsjoerg Artur; Amsler, Claude; Chiochia, Vincenzo; De Cosa, Annapaola; Favaro, Carlotta; Ivova Rikova, Mirena; Kilminster, Benjamin; Millan Mejias, Barbara; Ngadiuba, Jennifer; Robmann, Peter; Snoek, Hella; Taroni, Silvia; Verzetti, Mauro; Yang, Yong; Cardaci, Marco; Chen, Kuan-Hsin; Ferro, Cristina; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Lu, Yun-Ju; Volpe, Roberta; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Liu, Yueh-Feng; Lu, Rong-Shyang; Majumder, Devdatta; Petrakou, Eleni; Shi, Xin; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Wilken, Rachel; Asavapibhop, Burin; Suwonjandee, Narumon; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilin, Bugra; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Karapinar, Guler; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Bahtiyar, Hüseyin; Barlas, Esra; Cankocak, Kerem; Günaydin, Yusuf Oguzhan; Vardarli, Fuat Ilkehan; Yücel, Mete; Levchuk, Leonid; Sorokin, Pavel; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Jacob, Jeson; Kreczko, Lukasz; Lucas, Chris; Meng, Zhaoxia; Metson, Simon; Newbold, Dave M; Nirunpong, Kachanon; Paramesvaran, Sudarshan; Poll, Anthony; Senkin, Sergey; Smith, Vincent J; Williams, Thomas; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Ilic, Jelena; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Womersley, William John; Worm, Steven; Baber, Mark; Bainbridge, Robert; Buchmuller, Oliver; Burton, Darren; Colling, David; Cripps, Nicholas; Cutajar, Michael; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Ferguson, William; Fulcher, Jonathan; Futyan, David; Gilbert, Andrew; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Kenzie, Matthew; Lane, Rebecca; Lucas, Robyn; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Mathias, Bryn; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardle, Nicholas; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Martin, William; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Dittmann, Jay; Hatakeyama, Kenichi; Kasmi, Azeddine; Liu, Hongxuan; Scarborough, Tara; Charaf, Otman; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Heister, Arno; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; St John, Jason; Sulak, Lawrence; Alimena, Juliette; Bhattacharya, Saptaparna; Christopher, Grant; Cutts, David; Demiragli, Zeynep; Ferapontov, Alexey; Garabedian, Alex; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Laird, Edward; Landsberg, Greg; Luk, Michael; Narain, Meenakshi; Segala, Michael; Sinthuprasith, Tutanon; Speer, Thomas; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Gardner, Michael; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Miceli, Tia; Pellett, Dave; Pilot, Justin; Ricci-Tam, Francesca; Rutherford, Britney; Searle, Matthew; Shalhout, Shalhout; Smith, John; Squires, Michael; Tripathi, Mani; Wilbur, Scott; Yohay, Rachel; Andreev, Valeri; Cline, David; Cousins, Robert; Erhan, Samim; Everaerts, Pieter; Farrell, Chris; Felcini, Marta; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Takasugi, Eric; Valuev, Vyacheslav; Weber, Matthias; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Lacroix, Florent; Liu, Hongliang; Long, Owen Rosser; Luthra, Arun; Malberti, Martina; Nguyen, Harold; Shrinivas, Amithabh; Sturdy, Jared; Sumowidagdo, Suharyo; Wimpenny, Stephen; Andrews, Warren; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; D'Agnolo, Raffaele Tito; Evans, David; Holzner, André; Kelley, Ryan; Kovalskyi, Dmytro; Lebourgeois, Matthew; Letts, James; Macneill, Ian; Padhi, Sanjay; Palmer, Christopher; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Sudano, Elizabeth; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Wasserbaech, Steven; Würthwein, Frank; Yagil, Avraham; Yoo, Jaehyeok; Barge, Derek; Campagnari, Claudio; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; George, Christopher; Golf, Frank; Incandela, Joe; Justus, Christopher; Magaña Villalba, Ricardo; Mccoll, Nickolas; Pavlunin, Viktor; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; West, Christopher; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Di Marco, Emanuele; Duarte, Javier; Kcira, Dorian; Ma, Yousi; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Rogan, Christopher; Spiropulu, Maria; Timciuc, Vladlen; Wilkinson, Richard; Xie, Si; Zhu, Ren-Yuan; Azzolini, Virginia; Calamba, Aristotle; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Paulini, Manfred; Russ, James; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Drell, Brian Robert; Ford, William T; Gaz, Alessandro; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Eggert, Nicholas; Gibbons, Lawrence Kent; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Tucker, Jordan; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Gutsche, Oliver; Hare, Daryl; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Kaadze, Ketino; Klima, Boaz; Kwan, Simon; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Martinez Outschoorn, Verena Ingrid; Maruyama, Sho; Mason, David; McBride, Patricia; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Nahn, Steve; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Ratnikova, Natalia; Sexton-Kennedy, Elizabeth; Sharma, Seema; Spalding, William J; Spiegel, Leonard; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Cheng, Tongguang; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Dobur, Didar; Field, Richard D; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Hugon, Justin; Kim, Bockjoo; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Rinkevicius, Aurelijus; Skhirtladze, Nikoloz; Snowball, Matthew; Yelton, John; Zakaria, Mohammed; Gaultney, Vanessa; Hewamanage, Samantha; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Dorney, Brian; Hohlmann, Marcus; Kalakhety, Himali; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Bucinskaite, Inga; Cavanaugh, Richard; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Kurt, Pelin; Moon, Dong Ho; O'Brien, Christine; Silkworth, Christopher; Turner, Paul; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Duru, Firdevs; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Tan, Ping; Tiras, Emrah; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Fehling, David; Gritsan, Andrei; Maksimovic, Petar; Martin, Christopher; Swartz, Morris; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Kenny III, Raymond Patrick; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Sekaric, Jadranka; Stringer, Robert; Wang, Quan; Wood, Jeffrey Scott; Barfuss, Anne-Fleur; Chakaberia, Irakli; Ivanov, Andrew; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Saini, Lovedeep Kaur; Shrestha, Shruti; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Rebassoo, Finn; Wright, Douglas; Baden, Drew; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G; Kolberg, Ted; Lu, Ying; Marionneau, Matthieu; Mignerey, Alice; Pedro, Kevin; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C; Apyan, Aram; Bauer, Gerry; Busza, Wit; Cali, Ivan Amos; Chan, Matthew; Di Matteo, Leonardo; Dutta, Valentina; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Gulhan, Doga; Klute, Markus; Lai, Yue Shi; Levin, Andrew; Luckey, Paul David; Ma, Teng; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Stephans, George; Stöckli, Fabian; Sumorok, Konstanty; Velicanu, Dragos; Veverka, Jan; Wyslouch, Bolek; Yang, Mingming; Yoon, Sungho; Zanetti, Marco; Zhukova, Victoria; Dahmes, Bryan; De Benedetti, Abraham; Gude, Alexander; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Pastika, Nathaniel; Rusack, Roger; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Cremaldi, Lucien Marcus; Kroeger, Rob; Oliveros, Sandra; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Claes, Daniel R; Dominguez, Aaron; Gonzalez Suarez, Rebeca; Keller, Jason; Kravchenko, Ilya; Lazo-Flores, Jose; Malik, Sudhir; Meier, Frank; Snow, Gregory R; Dolen, James; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Rappoccio, Salvatore; Wan, Zongru; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Haley, Joseph; Massironi, Andrea; Nash, David; Orimoto, Toyoko; Trocino, Daniele; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Hahn, Kristan Allan; Kubik, Andrew; Lusito, Letizia; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Sung, Kevin; Velasco, Mayda; Won, Steven; Berry, Douglas; Brinkerhoff, Andrew; Chan, Kwok Ming; Drozdetskiy, Alexey; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Planer, Michael; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Puigh, Darren; Rodenburg, Marissa; Smith, Geoffrey; Vuosalo, Carl; Winer, Brian L; Wolfe, Homer; Wulsin, Howard Wells; Berry, Edmund; Elmer, Peter; Halyo, Valerie; Hebda, Philip; Hegeman, Jeroen; Hunt, Adam; Jindal, Pratima; Koay, Sue Ann; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Raval, Amita; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zenz, Seth Conrad; Zuranski, Andrzej; Brownson, Eric; Lopez, Angel; Mendez, Hector; Ramirez Vargas, Juan Eduardo; Alagoz, Enver; Benedetti, Daniele; Bolla, Gino; Bortoletto, Daniela; De Mattia, Marco; Everett, Adam; Hu, Zhen; Jones, Matthew; Jung, Kurt; Kress, Matthew; Leonardo, Nuno; Lopes Pegna, David; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Radburn-Smith, Benjamin Charles; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Wang, Fuqiang; Xie, Wei; Xu, Lingshan; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Parashar, Neeti; Adair, Antony; Akgun, Bora; Ecklund, Karl Matthew; Geurts, Frank JM; Li, Wei; Michlin, Benjamin; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Ferbel, Thomas; Garcia-Bellido, Aran; Goldenzweig, Pablo; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Malik, Sarah; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Patel, Rishi; Rekovic, Vladimir; Robles, Jorge; Salur, Sevil; Schnetzer, Steve; Seitz, Claudia; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Rose, Keith; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Bouhali, Othmane; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Krutelyov, Vyacheslav; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Perloff, Alexx; Roe, Jeffrey; Safonov, Alexei; Sakuma, Tai; Suarez, Indara; Tatarinov, Aysen; Toback, David; Akchurin, Nural; Cowden, Christopher; Damgov, Jordan; Dragoiu, Cosmin; Dudero, Phillip Russell; Kovitanggoon, Kittikul; Kunori, Shuichi; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Appelt, Eric; Delannoy, Andrés G; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Maguire, Charles; Mao, Yaxian; Melo, Andrew; Sharma, Monika; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Wood, John; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sakharov, Alexandre; Belknap, Donald; Borrello, Laura; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Duric, Senka; Friis, Evan; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Perry, Thomas; Pierro, Giuseppe Antonio; Polese, Giovanni; Ross, Ian; Sarangi, Tapas; Savin, Alexander; Smith, Wesley H; Swanson, Joshua
2014-04-15
The production of Y(1S), Y(2S), and Y(3S) is investigated in pPb and pp collisions at centre-of-mass energies per nucleon pair of 5.02 TeV and 2.76 TeV, respectively. The datasets correspond to integrated luminosities of about 31 inverse nanobarns (pPb) and 5.4 inverse picobarns (pp), collected in 2013 by the CMS experiment at the LHC. Upsilons that decay into muons are reconstructed within the rapidity interval abs(y[CM])<1.93 in the nucleon-nucleon centre-of-mass frame. Their production is studied as a function of two measures of event activity, namely the charged-particle multiplicity measured in the pseudorapidity interval abs(eta)<2.4, and the sum of transverse energy deposited at forward pseudorapidity, 4.0
International Nuclear Information System (INIS)
Paliwal, U.; Swarkar, C. B.; Sharma, M. D.; Joshi, K. B.
2016-01-01
The optical, vibrational, structural and elasto-optic properties of quaternary II-VI alloys Zn_0_._2_5Cd_0_._7_5S_0_._2_5Se_0_._7_5, Zn_0_._2_5Cd_0_._7_5S_0_._5_0Se_0_._5_0 and Zn_0_._2_5Cd_0_._7_5S_0_._7_5Se_0_._2_5 are presented. Within the empirical pseudopotential method (EPM) the disorder effects are modeled via modified virtual crystal approximation (MVCA). The computed bandgaps and the refined form factors are utilized to evaluate optical, vibrational, structural and elasto-optic properties. The refractive index (n), static (ε_0) and high frequency dielectric (ε_∞) constants are calculated to reveal optical behavior of alloys. The longitudinal ω_L_O(0) and transverse ω_T_O(0) optical frequencies are obtained to see vibrational characteristics. Moreover, the elastic constants (c_i_j) and bulk moduli (B) are computed by combining the EPM with Harrison bond orbital model. The elasto-optic nature of alloys is examined by computing the photo-elastic constants. These values are significant with regard to the opto-electronic applications especially when no experimental data are available on this system.
Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions
Zhang, Yawei; Li, Gang
2018-01-01
Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.
Results of Semiscale Mod-2C small-break (5%) loss-of-coolant accident. Experiments S-LH-1 and S-LH-2
International Nuclear Information System (INIS)
Loomis, G.G.; Streit, J.E.
1985-11-01
Two experiments simulating small break (5%) loss-of-coolant accidents (5% SBLOCAs) were performed in the Semiscale Mod-2C facility. These experiments were identical except for downcomer-to-upper-head bypass flow (0.9% in Experiment S-LH-1 and 3.0% in Experiment S-LH-2) and were performed at high pressure and temperature [15.6 MPa (2262 psia) system pressure; 37 K (67 0 F) core differential temperature; 595 K(610 0 F) hot leg fluid temperature]. From the experimental results, the signature response and transient mass distribution are determined for a 5% SBLOCA. The core thermal-hydraulic response is characterized, including core void distribution maps, and the effect of core bypass flow on transient severity is assessed. Comparisons are made between postexperiment RELAP5 calculations and the experimental results, and the capability of RELAP5 to calculate the phenomena is assessed. 115 figs
The phase system Fe-Ir-S at 1100, 1000 and 800 degree C
DEFF Research Database (Denmark)
Makovicky, Emil; Karup-Møller, Sven
1999-01-01
Phase relations in the dry condensed Fe-Ir-S system were determined at 1100, 1000 and 800 degrees C. Orientational runs were performed at 500 degrees C. Between 1100 and 800 degrees C, the system comprises five sulphides and an uninterrupted field of gamma(Fe, Ir). Fe1-xS dissolves 5.8 at.% Ir...... at 1100 degrees C, 3.4 at.% Ir at 1000 degrees C and 1.0 at.% Ir at 800 degrees C. The solubility of Fe in Ir2S3, IrS2 and IrSsimilar to 3 increases with decreasing temperature, reaching 2.5 at.% in the latter two sulphides at 800 degrees C. Thiospinel 'FeIr2S4' is nonstoichiometric, from Fe22.3Ir19.8S58...
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Entropy of near-extremal black holes in AdS_5
Balasubramanian, V.; de Boer, J.; Jejjala, V.; Simón, J.
2008-01-01
We construct the microstates of near-extremal black holes in AdS_5 x S^5 as gases of defects distributed in heavy BPS operators in the dual SU(N) Yang-Mills theory. These defects describe open strings on spherical D3-branes in the S^5, and we show that they dominate the entropy by directly
Thermodynamic evaluation and optimization of the (Na+K+S) system
International Nuclear Information System (INIS)
Lindberg, Daniel; Backman, Rainer; Hupa, Mikko; Chartrand, Patrice
2006-01-01
The (Na+K+S) system is of primary importance for the combustion of black liquor in the kraft recovery boilers in pulp and paper mills. A thermodynamic evaluation and optimization for the (Na+K+S) system has been made. All available data for the system have been critically evaluated to obtain optimized parameters of thermodynamic models for all phases. The liquid model is the quasichemical model in the quadruplet approximation, which evaluates 1st- and 2nd-nearest-neighbour short-range-order. In this model, cations (Na + and K + ) are assumed to mix on a cationic sublattice, while anions (S 2- ,S 2 2- ,S 3 2- ,S 4 2- ,S 5 2- ,S 6 2- ,S 7 2- ,S 8 2- ,Va - ) are assumed to mix on an anionic sublattice. The thermodynamic data of the liquid polysulphide components M 2 S 1+n (M=Na, K and n=1-7) are fitted to ΔG=A(n)+B(n).T for the reaction M 2 S(l)+nS(l)=M 2 S n+1 (l). The solid phases are the alkali alloys, alkali sulphides, several different alkali polysulphides and sulphur. The solid solutions (Na,K) (Na,K) 2 S and (Na,K) 2 S 2 are modelled using the compound energy formalism. The models can be used to predict the thermodynamic properties and phase equilibria in the multicomponent heterogeneous system. The experimental data are reproduced within experimental error limits for equilibria between solid, liquid and gas. The ternary phase diagram of the system (Na 2 S+K 2 S+S) has been predicted as no experimental determinations of the phase diagram have been made previously
Energy Technology Data Exchange (ETDEWEB)
Berkovits, Nathan [ICTP South American Institute for Fundamental Research,Instituto de Física Teórica, UNESP - Universidade Estadual Paulista,Rua Dr. Bento T. Ferraz 271, 01140-070, São Paulo, SP (Brazil)
2016-06-21
The pure spinor formalism for the superstring can be formulated as a twisted N=2 worldsheet theory with fermionic generators j{sub BRST} and composite b ghost. After untwisting the formalism to an N=1 worldsheet theory with fermionic stress tensor j{sub BRST}+b, the worldsheet variables combine into N=1 worldsheet superfields X{sup m} and Θ{sup α} together with a superfield constraint relating DX{sup m} and DΘ{sup α}. The constraint implies that the worldsheet superpartner of θ{sup α} is a bosonic twistor variable, and different solutions of the constraint give rise to the pure spinor or extended RNS formalisms, as well as a new twistor-string formalism with manifest N=1 worldsheet supersymmetry. These N=1 worldsheet methods generalize in curved Ramond-Ramond backgrounds, and a manifestly N=1 worldsheet supersymmetric action is proposed for the superstring in an AdS{sub 5}×S{sup 5} background in terms of the twistor superfields. This AdS{sub 5}×S{sup 5} worldsheet action is a remarkably simple fermionic coset model with manifest PSU(2,2|4) symmetry and might be useful for computing AdS{sub 5}×S{sup 5} superstring scattering amplitudes.
Loft CIS analysis 2''-LS-118-AB outside containment penetration S5-D
Energy Technology Data Exchange (ETDEWEB)
Morton, D.K.
1978-09-28
A stress analysis was performed on the 2''-LS-118-AB pipe system outside containment penetration S5-D. Deadweight, thermal expansion, and seismic loads were considered. The results indicate that this piping will meet ASME Section III, Class 2 requirements provided a U-bolt (S4) is installed as indicated in this report.
International Nuclear Information System (INIS)
Cagnazzo, Alessandra; Sorokin, Dmitri; Tseytlin, Arkady A; Wulff, Linus
2013-01-01
We demonstrate the equivalence between the worldsheet one-loop partition functions computed near classical string solutions in the Green–Schwarz and in the pure–spinor formulations of superstrings in AdS 5 × S 5 . While their bosonic sectors are the same in the conformal gauge, their fermionic sectors superficially appear to be very different (first versus second-derivative kinetic terms, presence versus absence of fermionic gauge symmetry). Still, we show that the quadratic fluctuation spectrum of 16 fermionic modes of the pure–spinor formulation is the same as in the Green–Schwarz superstring and the contribution of the extra ‘massless’ fermionic modes cancels against that of the pure–spinor ghosts. We also provide evidence for a similar semiclassical equivalence between the Green–Schwarz and the hybrid formulations of superstrings in AdS 2 × S 2 × T 6 by studying several particular examples of string solutions. (paper)
Du, Hong; Guo, Hong-Li; Liu, Ya-Nan; Xie, Xiao; Liang, Kuang; Zhou, Xiao; Wang, Xin; Xu, An-Wu
2016-02-17
In the present work, metallic 1T-LixMoS2 is utilized as a novel cocatalyst for Cd0.5Zn0.5S photocatalyst. The obtained LixMoS2/Cd0.5Zn0.5S hybrids show excellent photocatalytic performance for H2 generation from aqueous solution containing Na2S and Na2SO3 under splitting visible light illumination (λ ≥ 420 nm) without precious metal cocatalysts. It turns out that a certain amount of intercalating Li(+) ions ultimately drives the transition of MoS2 crystal from semiconductor triagonal phase (2H phase) to metallic phase (1T phase). The distinct properties of 1T-LixMoS2 promote the efficient separation of photoexcited electrons and holes when used as cocatalyst for Cd0.5Zn0.5S photocatalyst. As compared to 2H-MoS2 nanosheets only having edge active sites, photoinduced electrons not only transfer to the edge sites of 1T-LixMoS2, but also to the plane active sites of 1T-LixMoS2 nanosheets. The content of LixMoS2 in hybrid photocatalysts influences the photocatalytic activity. The optimal 1T-LixMoS2 (1.0 wt %)/Cd0.5Zn0.5S nanojunctions display the best activity for hydrogen production, achieving a hydrogen evolution rate of 769.9 μmol h(-1), with no use of noble metal loading, which is about 3.5 times higher than that of sole Cd0.5Zn0.5S, and 2 times higher than that of 2H-MoS2 (1.0 wt %)/Cd0.5Zn0.5S samples. Our results demonstrate that Li(+)-intercalated MoS2 nanosheets with high conductivity, high densities of active sites, low cost, and environmental friendliness are a prominent H2 evolution cocatalyst that might substitute for noble metal for potential hydrogen energy applications.
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
Directory of Open Access Journals (Sweden)
Mateus Mondin
2007-01-01
Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.
Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas
2015-12-25
Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Thermodynamic evaluation and optimization of the (Na+K+S) system
Energy Technology Data Exchange (ETDEWEB)
Lindberg, Daniel [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland)]. E-mail: Daniel.Lindberg@abo.fi; Backman, Rainer [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland); Energy Technology and Thermal Process Chemistry, Umea University, SE-90187 Umea (Sweden); Hupa, Mikko [Abo Akademi Process Chemistry Centre, Abo Akademi University, Biskopsgatan 8, FI-20500 Turku (Finland); Chartrand, Patrice [Centre de Recherche en Calcul Thermochimique (CRCT), Ecole Polytechnique, Box 6079, Station Downtown, Montreal, Que., H3C 3A7 (Canada)
2006-07-15
The (Na+K+S) system is of primary importance for the combustion of black liquor in the kraft recovery boilers in pulp and paper mills. A thermodynamic evaluation and optimization for the (Na+K+S) system has been made. All available data for the system have been critically evaluated to obtain optimized parameters of thermodynamic models for all phases. The liquid model is the quasichemical model in the quadruplet approximation, which evaluates 1st- and 2nd-nearest-neighbour short-range-order. In this model, cations (Na{sup +} and K{sup +}) are assumed to mix on a cationic sublattice, while anions (S{sup 2-},S{sub 2}{sup 2-},S{sub 3}{sup 2-},S{sub 4}{sup 2-},S{sub 5}{sup 2-},S{sub 6}{sup 2-},S{sub 7}{sup 2-},S{sub 8}{sup 2-},Va{sup -}) are assumed to mix on an anionic sublattice. The thermodynamic data of the liquid polysulphide components M{sub 2}S{sub 1+n} (M=Na, K and n=1-7) are fitted to {delta}G=A(n)+B(n).T for the reaction M{sub 2}S(l)+nS(l)=M{sub 2}S{sub n+1}(l). The solid phases are the alkali alloys, alkali sulphides, several different alkali polysulphides and sulphur. The solid solutions (Na,K) (Na,K){sub 2}S and (Na,K){sub 2}S{sub 2} are modelled using the compound energy formalism. The models can be used to predict the thermodynamic properties and phase equilibria in the multicomponent heterogeneous system. The experimental data are reproduced within experimental error limits for equilibria between solid, liquid and gas. The ternary phase diagram of the system (Na{sub 2}S+K{sub 2}S+S) has been predicted as no experimental determinations of the phase diagram have been made previously.
Sizewell B cycle 5 core design with Framatome ANP's CASCADE-3D and British Energy's PANTHER
Energy Technology Data Exchange (ETDEWEB)
Attale, F.; Koegl, J. [Framatome ANP GmbH, Nuclear Fuel Cycle, Erlangen (Germany); Knight, M.; Bryce, P. [British Energy, Nuclear Technology Branch, Gloucester (United Kingdom)
2001-07-01
Sizewell B Cycle 5 is the first cycle, after 4 cycles with BNFL fuel, with a reload consisting of Framatome ANP HTP (high thermal performance) fuel assemblies. The impact of this fuel vendor change on the Nuclear Design area is that, according to British energy's (BE) practice, the Framatome ANP's nuclear design code system CASCADE-3D is used for the majority of the cycle specific safety case calculations. However, other parts of the safety submission (e.g. 3D transient analyses) are made by using the BE code PANTHER. Before using in parallel two different code systems for reload core licensing extensive comparisons of applied methodologies and obtained results were required to ensure an acceptable level of agreement. (orig.)
PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY
Directory of Open Access Journals (Sweden)
Beata GALA
2013-10-01
Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.
Mo0.5W0.5S2 for Q-switched pulse generation in ytterbium-doped fiber laser
Wang, Junli; Chen, Lei; Dou, Chenxi; Yan, Haiting; Meng, Lingjie; Wei, Zhiyi
2018-06-01
In this work, we fabricate the Mo0.5W0.5S2 by microwave-assisted solvothermal method, and report the Q-switched Yb-doped fiber lasers (YDFL) using Mo0.5W0.5S2 polymer film and tapered fiber as the saturable absorbers (SAs). The modulation depth and saturable intensity of the film SA are 5.63% and 6.82 MW cm‑2. The shortest pulse duration and the maximum single pulse energy are 1.22 μs and 148.8 nJ for the film SA, 1.46 μs and 339 nJ for the fiber-taper SA. To the best of our knowledge, this is the first report on the Q-switched YDFL using Mo0.5W0.5S2 SAs.
A proposal of the gauge theory description of the small Schwarzschild black hole in AdS5×S5
International Nuclear Information System (INIS)
Hanada, Masanori; Maltz, Jonathan
2017-01-01
Based on 4d N=4 SYM on ℝ 1 ×S 3 , a gauge theory description of a small black hole in AdS 5 ×S 5 is proposed. The change of the number of dynamical degrees of freedom associated with the emission of the scalar fields’ eigenvalues plays a crucial role in this description. By analyzing the microcanonical ensemble, the Hagedorn behavior of long strings at low energy is obtained. Modulo an assumption based on the AdS/CFT duality for a large black hole, the energy of the small ten-dimensional Schwarzschild black hole E∼1/(G 10,N T 7 ) is derived. A heuristic gauge theory argument supporting this assumption is also given. The same argument applied to the ABJM theory correctly reproduces the relation for the eleven-dimensional Schwarzschild black hole. One of the consequences of our proposal is that the small and large black holes are very similar when seen from the gauge theory point of view.
Zurkowski, C. C.; Chidester, B.; Davis, A.; Brauser, N.; Greenberg, E.; Prakapenka, V. B.; Campbell, A.
2017-12-01
Earth's core is comprised of an iron-nickel alloy that contains 5-15% of a light element component. The abundance and alloying capability of sulfur, silicon and oxygen in the bulk Earth make them important core alloy candidates; therefore, the high-pressure phase equilibria of the Fe-S-O and Fe-S-Si systems are relevant for understanding the possible chemistry of Earth's core. Previously, a Fe3S2 phase was recognized as a low-pressure intermediate phase in the Fe-FeS system that is stable from 14-21 GPa, but the structure of this phase has not been resolved. We report in-situ XRD and chemical analysis of recovered samples to further examine the stability and structure of Fe3S2 as it coexists with other phases in the Fe-S-O and Fe-S-Si systems. In situ high P-T synchrotron XRD experiments were conducted in the laser-heated diamond anvil cell to determine the equilibrium phases in Fe75S7O18 and Fe80S5Si15 compositions between 30 and 174 GPa and up to 3000 K. In the S,O-rich samples, an orthorhombic Fe3S2 phase coexists with hcp-Fe, Fe3S and FeO and undergoes two monoclinic distortions between 60 and 174 GPa. In the S,Si-rich samples, the orthorhombic Fe3S2 phase was observed up to 115 GPa. With increasing pressure, the Fe3S2 phase becomes stable to higher temperatures in both compositions, suggesting possible Fe3(S,O)2 or Fe3(S,Si)2 solid solutions. SEM analysis of a laser heated Fe75S7O18 sample recovered from 40 GPa and 1450 K confirms a Fe3(S,O)2 phase with O dissolved into the structure. Based on the current melting data in the Fe-S-O and Fe-S-Si systems, the Fe3(S,O)2 stability field intersects the solidus in the outer core and could be a possible liquidus phase in Fe,S,O-rich planetary cores, whereas Fe3S is the stable sulfide at outer core pressures in Fe,S,Si-rich systems.
Experiment data report for Semiscale Mod-1 Test S-05-5 (alternate ECC injection test)
International Nuclear Information System (INIS)
Collins, B.L.; Patton, M.L. Jr.; Sackett, K.E.
1977-04-01
Recorded test data are presented for Test S-05-5 of the Semiscale Mod-1 alternate ECC injection test series. These tests are among several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a pressurized water reactor (PWR) system. Test S-05-5 was conducted from initial conditions of 2263 psia and 537 0 F to investigate the response of the Semiscale Mod-1 system to a depressurization and reflood transient following a simulated double-ended offset shear of the cold leg broken loop piping. During the test, cooling water was injected into the cold leg of the intact and broken loops to simulate emergency core coolant injection in a PWR. The upper plenum was vented through a reflood bypass line interconnecting the hot and cold legs of the broken loop
Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.
Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera
2017-01-23
Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental
New antiferromagnetic semiconductor CuCr1.5Sb0.5S4
International Nuclear Information System (INIS)
Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.
1993-01-01
New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic
Viscosity and Structure of CaO-SiO2-P2O5-FetO System with Varying P2O5 and FeO Content
Diao, Jiang; Gu, Pan; Liu, De-Man; Jiang, Lu; Wang, Cong; Xie, Bing
2017-10-01
A rotary viscosimeter and Raman spectrum were employed to measure the viscosity and structural information of the CaO-SiO2-P2O5-FetO system at 1673 K. The experimental data have been compared with the calculated results using different viscosity models. It shows that the National Physical Laboratory (NPL) and Pal models fit the CaO-SiO2-P2O5-FeOt system better. With the P2O5 content increasing from 5% to 14%, the viscosity increases from 0.12 Pa s to 0.27 Pa s. With the FeO content increasing from 30% to 40%, the viscosity decreases from 0.21 Pa s to 0.12 Pa s. Increasing FeO content makes the complicated molten melts become simple, and increasing P2O5 content will complicate the molten melts. The linear relation between viscosity and structure parameter Q(Si + P) was obtained by regression analysis. The calculated viscosity by using the optimized NPL and Pal model are almost identical with the fitted values.
VLSI and system architecture-the new development of system 5G
Energy Technology Data Exchange (ETDEWEB)
Sakamura, K.; Sekino, A.; Kodaka, T.; Uehara, T.; Aiso, H.
1982-01-01
A research and development proposal is presented for VLSI CAD systems and for a hardware environment called system 5G on which the VLSI CAD systems run. The proposed CAD systems use a hierarchically organized design language to enable design of anything from basic architectures of VLSI to VLSI mask patterns in a uniform manner. The cad systems will eventually become intelligent cad systems that acquire design knowledge and perform automatic design of VLSI chips when the characteristic requirements of VLSI chip is given. System 5G will consist of superinference machines and the 5G communication network. The superinference machine will be built based on a functionally distributed architecture connecting inferommunication network. The superinference machine will be built based on a functionally distributed architecture connecting inference machines and relational data base machines via a high-speed local network. The transfer rate of the local network will be 100 mbps at the first stage of the project and will be improved to 1 gbps. Remote access to the superinference machine will be possible through the 5G communication network. Access to system 5G will use the 5G network architecture protocol. The users will access the system 5G using standardized 5G personal computers. 5G personal logic programming stations, very high intelligent terminals providing an instruction set that supports predicate logic and input/output facilities for audio and graphical information.
Community of solution for the U.S. health care system: lessons from the U.S. educational system.
Devoe, Jennifer E; Gold, Rachel
2013-01-01
The Folsom Group asserts that radical changes are needed to fix the health care system in the United States. The U.S. education system is one potential model to emulate. Could a future health care system-level community of solution be modeled after the U.S. education system? Could community health care services be planned, organized, and delivered at the neighborhood level by district, similar to the structure for delivering public education? Could community health centers, governed by community boards, serve every neighborhood? This essay imagines how U.S. health care system reforms could be designed using our public school system as a roadmap. Our intention is to challenge readers to recognize the urgent need for radical reform in the U.S. health care system, to introduce one potential model for reform, and to encourage creative thinking about other system-level communities of solution that could lead to profound change and improvements in the U.S. health care system.
Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons
International Nuclear Information System (INIS)
Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.
2007-01-01
Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%
Gray, Kerryn; Crowle, Damian; Scott, Pam
2014-09-01
A significant number of evidence items submitted to Forensic Science Service Tasmania (FSST) are blood swabs or bloodstained items. Samples from these items routinely undergo phenol:chloroform:isoamyl alcohol organic extraction and quantitative Polymerase Chain Reaction (qPCR) testing prior to PowerPlex(®) 21 amplification. This multi-step process has significant cost and timeframe implications in a fiscal climate of tightening government budgets, pressure towards improved operating efficiencies, and an increasing emphasis on rapid techniques better supporting intelligence-led policing. Direct amplification of blood and buccal cells on cloth and Whatman FTA™ card with PowerPlex(®) 21 has already been successfully implemented for reference samples, eliminating the requirement for sample pre-treatment. Scope for expanding this method to include less pristine casework blood swabs and samples from bloodstained items was explored in an endeavour to eliminate lengthy DNA extraction, purification and qPCR steps for a wider subset of samples. Blood was deposited onto a range of substrates including those historically found to inhibit STR amplification. Samples were collected with micro-punch, micro-swab, or both. The potential for further fiscal savings via reduced volume amplifications was assessed by amplifying all samples at full and reduced volume (25 and 13μL). Overall success rate data showed 80% of samples yielded a complete profile at reduced volume, compared to 78% at full volume. Particularly high success rates were observed for the blood on fabric/textile category with 100% of micro-punch samples yielding complete profiles at reduced volume and 85% at full volume. Following the success of this trial, direct amplification of suitable casework blood samples has been implemented at reduced volume. Significant benefits have been experienced, most noticeably where results from crucial items have been provided to police investigators prior to interview of suspects, and a coronial identification has been successfully completed in a short timeframe to avoid delay in the release of human remains to family members. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Mechanical loading of the gymnast’s motor system during swings on rings
Directory of Open Access Journals (Sweden)
R Serafin
2008-12-01
Full Text Available The aim of this work was to identify the mechanical loading of the gymnast’s motor system during forward and backward swings on gymnastic rings. A junior gymnast of the First Class, aged 14, with body mass 53.1 kg and body length 1.61 m, participated in the study. He executed a series of ten cyclic swing movements on rings with his maximum amplitude. Kinematic variables of the gymnast’s centre of mass (COM as well as reaction forces in the cables were measured and synchronized using the SIMI MOTION movement analysis system. Two separate phases of mechanical loading of the motor system have been identified: resistance phase and non resistance phase. In the non resistance phase the gymnast attains similar values of the COM’s momentum but different angular displacements. In the resistance phase the forces acting on the motor system have their maximum. They amount to 5.5 BW for the forward swing and 6.5 BW for the backward swing movement. The maximum rate of change of the force for forward and backward swing is 42.6 BWs-1 and 67.4 BWs-1, respectively. These two variables differentiate the mechanical loading of the gymnast’s motor system between forward and backward swings. The reaction force produced by the gymnast is significantly greater during the execution of forward swings. It seems probable that horizontal displacements of COM may be the factor responsible for reduction of the mechanical loading experienced by the gymnast.
Particle Production in pp and Heavy Ion Collisions from $\\sqrt{s_{NN}}$ = 200 GeV to 5.5 TeV
Mondal, Mriganka Mouli; Chattopadhyay, Subhasis
Exploring the creation of Quark Gluon Plasma (QGP), a new state of Nuclear matter is the main aim in Relativistic Heavy Ion collision experiments which √ are being performed in the STAR experiment at RHIC ( s = 200 GeV) and √ ALICE ( s = 5.5 TeV) experiment at LHC. Various observables derived from the properties of the produced particles of the interacting system. Specialized detectors are built for detection of specific types of particles. Dedicated efforts are made in data analysis studying the observables in the soft and hard sector in AA collisions which are then compared with the results form pp and dAu collisions for attaining at a consistent picture. In this thesis as a part of the detector developmental work, fabrication and testing of the Photon Multiplic- ity Detector (PMD) installed in the ALICE experiment at LHC have been discussed. A detailed√ simulation using PYTHIA with GEANT is performed with pp collision (at s = 14 TeV) events at LHC as a readiness exercise of data analysis in such coll...
[Polymorphism analysis of 20 autosomal short-tandem repeat loci in southern Chinese Han population].
Chen, Ling; Lu, Hui-Jie; DU, Wei-An; Qiu, Ping-Ming; Liu, Chao
2016-02-20
To evaluate the value of PowerPlex ® 21 System (Promega) and study the genetic polymorphism of its 20 short-tandem repeat (STR) loci in southern Chinese Han population. We conducted genotyping experiments using PowerPlex ® 21 System on 20 autosomal STR loci (D3S1358, D1S1656, D6S1043, D13S317, Penta E, D16S539, D18S51, D2S1338, CSF1PO, Penta D, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433 and FGA) in 2367 unrelated Chinese Han individuals living in South China. The allele frequencies and parameters commonly used in forensic science were statistically analyzed in these individuals and compared with the reported data of other populations. The PowerPlex ® 21 System had a power of discrimination (PD) ranging from 0.7839 to 0.9852 and a power of exclusion (PE) ranging from 0.2974 to 0.8099 for the 20 loci. No significant deviation from Hardy-Weinberg expectations was found for all the loci except for D5S818. This southern Chinese Han population had significant differences in the allele frequencies from 8 ethnic groups reported in China, and showed significant differences at 8 to 20 STR foci from 5 foreign populations. The allele frequency at the locus D1S1656 in this southern Chinese Han population differed significantly from those in the 5 foreign populations and from 3 reported Han populations in Beijing, Zhejiang Province and Fujian Province of China. The neighbor-joining phylogenetictree showed clustering of all the Asian populations in one branch, while the northern Italian and Argentina populations clustered in a separate branch. This southern Chinese Han population had the nearest affinity with the Yi ethnic population in Yunnan Province of China. The 20 STR loci are highly polymorphic in this southern Chinese Han population, suggesting the value of this set of STR loci in forensic personal identification, paternity testing and anthropological study.
International Nuclear Information System (INIS)
Jelassi, H.; Viaris de Lesegno, B.; Pruvost, L.
2006-01-01
We report on photoassociation of cold 87 Rb atoms providing the spectroscopy of (5s 1/2 +5p 1/2 )0 u + long-range molecular states, in the energy range of [-12.5, -0.7 cm -1 ] below the dissociation limit. A Lu-Fano approach coupled to the LeRoy-Bernstein formula is used to analyze the data. The Lu-Fano graph exhibits the coupling of the molecular series with the (5s 1/2 +5p 3/2 )0 u + one, which is due to spin effects in the molecule. A two-channel model involving an improved LeRoy-Bernstein formula allows us to characterize the molecular series, to localize (5s 1/2 +5p 3/2 )0 u + levels, to evaluate the coupling, and to predict the energy and width of the first predissociated level of (5s 1/2 +5p 3/2 )0 u + series. An experimental spectrum confirms the prediction
The 5S methodology as a tool for improving the organisation
J. Michalska; D. Szewieczek
2007-01-01
Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...
International Nuclear Information System (INIS)
English, R.B.; Liddell, R.J.; Whiteley, C.G.
1987-01-01
One pair of diastereomeric bromoamides, (2'R,1S,2S)- and (2'S,1S,2S)-N(2-bromopropanoyl)-2-amino-1-phenylpropane-1,3-diol have been synthesized from ethyl 2-bromopropionate and an optically active amino-diol. The crystal structures of both were determined from single-crystal X-ray analyses. Both compounds are orthorhombic with space group P2 1 2 1 2 1 with Z = 4 in a unit cell of dimensions a 22,124(5),b 12,812(5), and c 4,886(5)A and a 15,510(5), b 9,707(5), and c 9,457(5)A. The proton chemical shifts of the groups attached to the asymmetric centre C(2'), and consequently, the identification of the configuration of the molecules, were resolved with the help of high-resolution nuclear magnetic resonance
Implementacija metode 5S v proces proizvodnje
Directory of Open Access Journals (Sweden)
Alojz Gorše
2016-03-01
Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction
EBT-S 28-GHz, 200-kW, CW, mixed-mode, quasi-optical plasma heating system
International Nuclear Information System (INIS)
White, T.L.; Kimrey, H.D.; Bigelow, T.S.; Bates, D.D.; Eason, H.O.
1984-07-01
The ELMO Bumpy Torus-Scale (EBT-S) 28-GHz, 200-kW, cw, plasma heating system consists of a gyrotron oscillator, an oversized waveguide two-bend transmission system, and a quasi-optical mixed-mode microwave distribution manifold that feeds microwave power to the 24 plasma loads of the EBT-S fusion experiment. Balancing power to the 24 loads of the EBT-S fusion experiment. Balancing power to the 24 loads was achieved by adjusting the areas at 24 coupling irises. System performance is easily measured using system calorimetry. The distribution manifold mixed-mode power transmission, reflection, and loss coefficients are 89%, 6%, and 5%, respectively. The overall system efficiency (plasma power/gyrotron power) is 80%, but with some modifications to the distribution manifold we believe the ultimate efficiency can approach 90%. The system reliability is outstanding with a world's record 1 x 10 5 kW h of 28-GHz energy delivered to the EBT-S device with well over 1 x 10 3 operating hours
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Shen, Fahua; Wang, Bangxin; Shi, Wenjuan; Zhuang, Peng; Zhu, Chengyun; Xie, Chenbo
2018-04-01
A novel design of the 532 nm Rayleigh-Mie Doppler lidar receiving system is carried out. The use of polarization isolation technology to effectively improve the receiving system optical reception efficiency, suppress the background noise, not only improves the system wind field detection accuracy, while achieving a high-accuracy temperature measurement. The wind speed and temperature measurement principle of the system are discussed in detail, and the triple Fabry-Perot etalon parameters are optimized. Utilizing the overall design parameters of the system, the system detection performance is simulated. The simulation results show that from 5 to 50 km altitude with vertical resolution of 0.1 km@5 ∼20 km, 0.5 km@20 ∼40 km, 1 km@40 ∼50 km, by using the laser with single pulse energy of 600 mJ, repetition frequency of 50 Hz and the receiving telescope with aperture of 0.8 m, with 2min integration time and in ±50 m/s radial wind speed range, the radial wind speed measurement accuracies of our designed lidar in the day and night are better than 2.6 m/s and 0.9 m/s respectively, and its performance is obviously superior to that of traditional system 5.6 m/s and 1.4 m/s wind speed accuracies; with 10min integration time and in 210 ∼280 K temperature range, the temperature measurement accuracies of the system in the day and night are better than 3.4 K and 1.2 K respectively; since the wind speed sensitivities of the Mie and Rayleigh scattering signals are not exactly the same, in ±50 m/s radial wind speed range, the wind speed bias induced by Mie signal is less than 1 m/s in the temperature range of 210-290 K and in the backscatter ratio range of 1-1.5 for pair measurement.
Precision calculation of 1/4-BPS Wilson loops in AdS{sub 5}×S{sup 5}
Energy Technology Data Exchange (ETDEWEB)
Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany); Puletti, V. Giangreco M. [Science Institute, University of Iceland,Dunhaga 3, 107 Reykjavik (Iceland); Griguolo, L. [Dipartimento di Fisica e Scienze della Terra, Università di Parma andINFN Gruppo Collegato di Parma,Viale G.P. Usberti 7/A, 43100 Parma (Italy); Seminara, D. [Dipartimento di Fisica, Università di Firenze and INFN Sezione di Firenze,Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof, Zum Großen Windkanal 6, 12489 Berlin (Germany)
2016-02-16
We study the strong coupling behaviour of 1/4-BPS circular Wilson loops (a family of “latitudes') in N=4 Super Yang-Mills theory, computing the one-loop corrections to the relevant classical string solutions in AdS{sub 5}×S{sup 5}. Supersymmetric localization provides an exact result that, in the large ’t Hooft coupling limit, should be reproduced by the sigma-model approach. To avoid ambiguities due to the absolute normalization of the string partition function, we compare the ratio between the generic latitude and the maximal 1/2-BPS circle: any measure-related ambiguity should simply cancel in this way. We use the Gel’fand-Yaglom method with Dirichlet boundary conditions to calculate the relevant functional determinants, that present some complications with respect to the standard circular case. After a careful numerical evaluation of our final expression we still find disagreement with the localization answer: the difference is encoded into a precise “remainder function'. We comment on the possible origin and resolution of this discordance.
Time of action of 4.5 S RNA in Escherichia coli translation
DEFF Research Database (Denmark)
Brown, S
1989-01-01
A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
Planet-induced Stellar Pulsations in HAT-P-2's Eccentric System
International Nuclear Information System (INIS)
Wit, Julien de; Lewis, Nikole K.; Knutson, Heather A.; Batygin, Konstantin; Fuller, Jim; Antoci, Victoria; Fulton, Benjamin J.; Laughlin, Gregory; Deming, Drake; Shporer, Avi; Cowan, Nicolas B.; Agol, Eric; Burrows, Adam S.; Fortney, Jonathan J.; Langton, Jonathan; Showman, Adam P.
2017-01-01
Extrasolar planets on eccentric short-period orbits provide a laboratory in which to study radiative and tidal interactions between a planet and its host star under extreme forcing conditions. Studying such systems probes how the planet’s atmosphere redistributes the time-varying heat flux from its host and how the host star responds to transient tidal distortion. Here, we report the insights into the planet–star interactions in HAT-P-2's eccentric planetary system gained from the analysis of ∼350 hr of 4.5 μ m observations with the Spitzer Space Telescope . The observations show no sign of orbit-to-orbit variability nor of orbital evolution of the eccentric planetary companion, HAT-P-2 b. The extensive coverage allows us to better differentiate instrumental systematics from the transient heating of HAT-P-2 b’s 4.5 μ m photosphere and yields the detection of stellar pulsations with an amplitude of approximately 40 ppm. These pulsation modes correspond to exact harmonics of the planet’s orbital frequency, indicative of a tidal origin. Transient tidal effects can excite pulsation modes in the envelope of a star, but, to date, such pulsations had only been detected in highly eccentric stellar binaries. Current stellar models are unable to reproduce HAT-P-2's pulsations, suggesting that our understanding of the interactions at play in this system is incomplete.
Assembly and Regulation of the Membrane Attack Complex Based on Structures of C5b6 and sC5b9
Directory of Open Access Journals (Sweden)
Michael A. Hadders
2012-03-01
Full Text Available Activation of the complement system results in formation of membrane attack complexes (MACs, pores that disrupt lipid bilayers and lyse bacteria and other pathogens. Here, we present the crystal structure of the first assembly intermediate, C5b6, together with a cryo-electron microscopy reconstruction of a soluble, regulated form of the pore, sC5b9. Cleavage of C5 to C5b results in marked conformational changes, distinct from those observed in the homologous C3-to-C3b transition. C6 captures this conformation, which is preserved in the larger sC5b9 assembly. Together with antibody labeling, these structures reveal that complement components associate through sideways alignment of the central MAC-perforin (MACPF domains, resulting in a C5b6-C7-C8β-C8α-C9 arc. Soluble regulatory proteins below the arc indicate a potential dual mechanism in protection from pore formation. These results provide a structural framework for understanding MAC pore formation and regulation, processes important for fighting infections and preventing complement-mediated tissue damage.
Decay rate ratios of Υ(5S)→B anti B reactions
International Nuclear Information System (INIS)
Hwang, Dae Sung; Son, Hyungsuk
2010-01-01
We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)
International Nuclear Information System (INIS)
Castro, Beatriz; Sánchez, Pilar; Torres, Jesús M.; Ortega, Esperanza
2015-01-01
Background: Early-life exposure to the endocrine disruptor bisphenol A (BPA) affects brain function and behavior, which might be attributed to its interference with hormonal steroid signaling and/or neurotransmitter systems. Alternatively, the use of structural analogs of BPA, mainly bisphenol F (BPF) and bisphenol S (BPS), has increased recently. However, limited in vivo toxicity data exist. Objectives: We investigated the effects of BPA, BPF and BPS on 5α-reductase (5α-R), a key enzyme involved in neurosteroidogenesis, as well as on dopamine (DA)- and serotonin (5-HT)-related genes, in the prefrontal cortex (PFC) of juvenile female rats. Methods: Gestating Wistar rats were treated with either vehicle or 10 μg/kg/day of BPA, BPF or BPS from gestational day 12 to parturition. Then, female pups were exposed from postnatal day 1 through day 21 (PND21), when they were euthanized and RT-PCR, western blot and quantitative PCR-array experiments were performed. Results: BPA decreased 5α-R2 and 5α-R3 mRNA and protein levels, while both BPF and BPS decreased 5α-R3 mRNA levels in PFC at PND21. Further, BPA, BPF and BPS significantly altered, respectively, the transcription of 25, 56 and 24 genes out of the 84 DA and 5-HT-related genes assayed. Of particular interest was the strong induction by all these bisphenols of Cyp2d4, implicated in corticosteroids synthesis. Conclusions: Our results demonstrate for the first time that BPA, BPF and BPS differentially affect 5α-R and genes related to DA/5-HT systems in the female PFC. In vivo evidence of the potential adverse effects of BPF and BPS in the brain of mammals is provided in this work, raising questions about the safety of these chemicals as substitutes for BPA. - Highlights: • Juvenile prefrontal cortex of female rats exposed to bisphenol A, F or S was analyzed. • We provide the first in vivo data of BPF and BPS effects in mammal brain. • BPA, BPF and BPS differently affected dopamine and serotonin
Energy Technology Data Exchange (ETDEWEB)
Castro, Beatriz; Sánchez, Pilar [Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Granada, Avda. de Madrid s/n, 18012 Granada (Spain); Torres, Jesús M., E-mail: torrespi@ugr.es [Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Granada, Avda. de Madrid s/n, 18012 Granada (Spain); Institute of Neurosciences, Faculty of Medicine, University of Granada, Granada (Spain); Ortega, Esperanza, E-mail: esortega@ugr.es [Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Granada, Avda. de Madrid s/n, 18012 Granada (Spain); Institute of Neurosciences, Faculty of Medicine, University of Granada, Granada (Spain)
2015-10-15
Background: Early-life exposure to the endocrine disruptor bisphenol A (BPA) affects brain function and behavior, which might be attributed to its interference with hormonal steroid signaling and/or neurotransmitter systems. Alternatively, the use of structural analogs of BPA, mainly bisphenol F (BPF) and bisphenol S (BPS), has increased recently. However, limited in vivo toxicity data exist. Objectives: We investigated the effects of BPA, BPF and BPS on 5α-reductase (5α-R), a key enzyme involved in neurosteroidogenesis, as well as on dopamine (DA)- and serotonin (5-HT)-related genes, in the prefrontal cortex (PFC) of juvenile female rats. Methods: Gestating Wistar rats were treated with either vehicle or 10 μg/kg/day of BPA, BPF or BPS from gestational day 12 to parturition. Then, female pups were exposed from postnatal day 1 through day 21 (PND21), when they were euthanized and RT-PCR, western blot and quantitative PCR-array experiments were performed. Results: BPA decreased 5α-R2 and 5α-R3 mRNA and protein levels, while both BPF and BPS decreased 5α-R3 mRNA levels in PFC at PND21. Further, BPA, BPF and BPS significantly altered, respectively, the transcription of 25, 56 and 24 genes out of the 84 DA and 5-HT-related genes assayed. Of particular interest was the strong induction by all these bisphenols of Cyp2d4, implicated in corticosteroids synthesis. Conclusions: Our results demonstrate for the first time that BPA, BPF and BPS differentially affect 5α-R and genes related to DA/5-HT systems in the female PFC. In vivo evidence of the potential adverse effects of BPF and BPS in the brain of mammals is provided in this work, raising questions about the safety of these chemicals as substitutes for BPA. - Highlights: • Juvenile prefrontal cortex of female rats exposed to bisphenol A, F or S was analyzed. • We provide the first in vivo data of BPF and BPS effects in mammal brain. • BPA, BPF and BPS differently affected dopamine and serotonin
45 CFR 5b.11 - Exempt systems.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Exempt systems. 5b.11 Section 5b.11 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.11 Exempt systems. (a) General policy. The Act permits certain types of specific systems of records to be exempt from...
Effects of microbial DNA on human DNA profiles generated using the PowerPlex® 16 HS system.
Dembinski, Gina M; Picard, Christine J
2017-11-01
Most crime scenes are not sterile and therefore may be contaminated with environmental DNA, especially if a decomposing body is found. Collecting biological evidence from this individual will yield DNA samples mixed with microbial DNA. This also becomes important if postmortem swabs are collected from sexually assaulted victims. Although genotyping kits undergo validation tests, including bacterial screens, they do not account for the diverse microbial load during decomposition. We investigated the effect of spiking human DNA samples with known concentrations of DNA from 17 microbe species associated with decomposition on DNA profiles produced using the Promega PowerPlex ® HS system. Two species, Bacillus subtilis and Mycobacterium smegmatis, produced an extraneous allele at the TPOX locus. When repeated with the PowerPlex ® Fusion kit, the extra allele no longer amplified with these two species. This experiment demonstrates that caution should be exhibited if microbial load is high and the PowerPlex ® 16HS system is used. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA
Ovaskainen, Tatu-Pekka
2014-01-01
Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...
Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli
DEFF Research Database (Denmark)
Brown, S
1991-01-01
4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....
Common MspI RFLP of the human fibronectin gene (FN1)
Energy Technology Data Exchange (ETDEWEB)
Gardella, R; Colombi, M; Barlati, S
1988-02-25
The probe used, pFH154, contains a sequence of 2.5 kb of the fibronectin cDNA inserted in pAT153/Pvu/8 plasmid vector. The recombinant plasmid and the HindIII/BamHI purified cDNA insert give identical patterns. MspI (C/CGG) (Promega Biotec) detects invariant bands at 8.5, 4.2, 2.5, 2.1, 1.55, 1.4, 1.1 and 0.75 kb in addition to a simple two allele polymorphism with a band at either 0.35 kb (F1) or 2.7 kb (F2). Co-dominant segregation was demonstrated in 6 families.
S5-4: Formal Modeling of Affordance in Human-Included Systems
Directory of Open Access Journals (Sweden)
Namhun Kim
2012-10-01
Full Text Available In spite of it being necessary for humans to consider modeling, analysis, and control of human-included systems, it has been considered a challenging problem because of the critical role of humans in complex systems and of humans' capability of executing unanticipated actions–both beneficial and detrimental ones. Thus, to provide systematic approaches to modeling human actions as a part of system behaviors, a formal modeling framework for human-involved systems in which humans play a controlling role based on their perceptual information is presented. The theory of affordance provides definitions of human actions and their associated properties; Finite State Automata (FSA based modeling is capable of mapping nondeterministic humans into computable components in the system representation. In this talk, we investigate the role of perception in human actions in the system operation and examine the representation of perceptual elements in affordance-based modeling formalism. The proposed framework is expected to capture the natural ways in which humans participate in the system as part of its operation. A human-machine cooperative manufacturing system control example and a human agent simulation example will be introduced for the illustrative purposes at the end of the presentation.
Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.
Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A
2017-11-14
The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.
Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S
1984-01-01
Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
International Nuclear Information System (INIS)
Olsson, T.; Fraenkel, L.; Lindgren, I.; Nyberg, A.; Robertsson, L.; Rosen, A.
1986-01-01
A series of experiments has been performed to determine the hyperfine structure in the metastable 4d 5 5s 5 Dsub(1,2,3,4) states of Mo I by means of the laser radiofrequency double-resonance technique. Furthermore, hyperfine structure splittings and isotope shifts in seven optical transitions connecting the 4d 5 5s 5 Dsub(0,1,2,3,4) and the 4d 4 5s5p 5 Psub(1,2,3) states were resolved with the high-resolution laser spectroscopy technique. Radial hyperfine structure parameters are deduced for the effective operator within the 5 D states using the configurations 4d 4 5s 2 , 4d 5 5s and 4d 6 as a model space. The isotope shifts are also discussed, utilizing an effective operator, with particular emphasis on the J dependence. (orig.)
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Directory of Open Access Journals (Sweden)
Inda, Luis A.
2013-06-01
Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en
Design of 5G Full Dimension Massive MIMO Systems
Nadeem, Qurrat-Ul-Ain
2017-10-13
This work discusses full-dimension multiple-inputmultiple- output (FD-MIMO) technology, which is currently an active area of research and standardization in wireless communications for evolution towards Fifth Generation (5G) cellular systems. FD-MIMO utilizes an active antenna system (AAS) with a two-dimensional (2D) planar array structure, that not only allows a large number of antenna elements to be packed within feasible base station form factors but also provides the ability of adaptive electronic beamforming in the threedimensional (3D) space. However, the compact structure of largescale planar arrays drastically increases the spatial correlation in FD-MIMO systems. In order to account for its effects, the generalized spatial correlation functions for channels constituted by individual elements and overall antenna ports in the AAS are derived. Exploiting the quasi-static channel covariance matrices of users, the problem of determining the optimal downtilt weight vector for antenna ports, which maximizes the minimum signalto- interference ratio of a multi-user multiple-input-single-output system, is formulated as a fractional optimization problem. A quasi-optimal solution is obtained through the application of semi-definite relaxation and Dinkelbach’s method. Finally, the user-group specific elevation beamforming scenario is devised, which offers significant performance gains as confirmed through simulations. These results have direct application in the analysis of 5G FD-MIMO systems.
Design of 5G Full Dimension Massive MIMO Systems
Nadeem, Qurrat-Ul-Ain; Kammoun, Abla; Debbah, Merouane; Alouini, Mohamed-Slim
2017-01-01
This work discusses full-dimension multiple-inputmultiple- output (FD-MIMO) technology, which is currently an active area of research and standardization in wireless communications for evolution towards Fifth Generation (5G) cellular systems. FD-MIMO utilizes an active antenna system (AAS) with a two-dimensional (2D) planar array structure, that not only allows a large number of antenna elements to be packed within feasible base station form factors but also provides the ability of adaptive electronic beamforming in the threedimensional (3D) space. However, the compact structure of largescale planar arrays drastically increases the spatial correlation in FD-MIMO systems. In order to account for its effects, the generalized spatial correlation functions for channels constituted by individual elements and overall antenna ports in the AAS are derived. Exploiting the quasi-static channel covariance matrices of users, the problem of determining the optimal downtilt weight vector for antenna ports, which maximizes the minimum signalto- interference ratio of a multi-user multiple-input-single-output system, is formulated as a fractional optimization problem. A quasi-optimal solution is obtained through the application of semi-definite relaxation and Dinkelbach’s method. Finally, the user-group specific elevation beamforming scenario is devised, which offers significant performance gains as confirmed through simulations. These results have direct application in the analysis of 5G FD-MIMO systems.
Wilson lines for AdS5 black strings
International Nuclear Information System (INIS)
Hristov, Kiril; Katmadas, Stefanos
2015-01-01
We describe a simple method of extending AdS 5 black string solutions of 5d gauged supergravity in a supersymmetric way by addition of Wilson lines along a circular direction in space. When this direction is chosen along the string, and due to the specific form of 5d supergravity that features Chern-Simons terms, the existence of magnetic charges automatically generates conserved electric charges in a 5d analogue of the Witten effect. Therefore we find a rather generic, model-independent way of adding electric charges to already existing solutions with no backreaction from the geometry or breaking of any symmetry. We use this method to explicitly write down more general versions of the Benini-Bobev black strings (http://dx.doi.org/10.1103/PhysRevLett.110.061601, http://dx.doi.org/10.1007/JHEP06(2013)005) and comment on the implications for the dual field theory and the similarities with generalizations of the Cacciatori-Klemm black holes (http://dx.doi.org/10.1007/JHEP01(2010)085) in AdS 4 .
Common 5S rRNA variants are likely to be accepted in many sequence contexts
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Energy Technology Data Exchange (ETDEWEB)
Forini, V. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Tseytlin, A.A. [Theoretical Physics Group, Blackett Laboratory, Imperial College,London, SW7 2AZ (United Kingdom); Vescovi, E. [Institut für Physik, Humboldt-Universität zu Berlin, IRIS Adlershof,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institute of Physics, University of São Paulo,Rua do Matão 1371, 05508-090 São Paulo (Brazil)
2017-03-01
We revisit the computation of the 1-loop string correction to the “latitude' minimal surface in AdS{sub 5}×S{sup 5} representing 1/4 BPS Wilson loop in planar N=4 SYM theory previously addressed in https://arxiv.org/abs/1512.00841 and https://arxiv.org/abs/1601.04708. We resolve the problem of matching with the subleading term in the strong coupling expansion of the exact gauge theory result (derived previously from localization) using a different method to compute determinants of 2d string fluctuation operators. We apply perturbation theory in a small parameter (angle of the latitude) corresponding to an expansion near the AdS{sub 2} minimal surface representing 1/2 BPS circular Wilson loop. This allows us to compute the corrections to the heat kernels and zeta-functions of the operators in terms of the known heat kernels on AdS{sub 2}. We apply the same method also to two other examples of Wilson loop surfaces: generalized cusp and k-wound circle.
Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng
2016-07-01
Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.
First-principles study on structure stabilities of α-S and Na-S battery systems
Momida, Hiroyoshi; Oguchi, Tamio
2014-03-01
To understand microscopic mechanisms of charge and discharge reactions in Na-S batteries, there has been increasing needs to study fundamental atomic and electronic structures of elemental S as well as that of Na-S phases. The most stable form of S is known to be an orthorhombic α-S crystal at ambient temperature and pressure, and α-S consists of puckered S8 rings which crystallize in space group Fddd . In this study, the crystal structure of α-S is examined by using first-principles calculations with and without the van der Waals interaction corrections of Grimme's method, and results clearly show that the van der Waals interactions between the S8 rings have crucial roles on cohesion of α-S. We also study structure stabilities of Na2S, NaS, NaS2, and Na2S5 phases with reported crystal structures. Using calculated total energies of the crystal structure models, we estimate discharge voltages assuming discharge reactions from 2Na+ xS -->Na2Sx, and discharge reactions in Na/S battery systems are discussed by comparing with experimental results. This work was partially supported by Elements Strategy Initiative for Catalysts and Batteries (ESICB) of Ministry of Education, Culture, Sports, Science, and Technology (MEXT), Japan.
Androgen Receptor Splice Variants and Resistance to Taxane Chemotherapy
2015-10-01
or absence of 10 nM DHT . Dual-luciferase assay was performed at 24 h post treatment using the Dual-luciferase Reporter Assay System (Promega). The...were cultured under androgen-deprived condition unless specified. DHT , 1 nmol/L for 24 hours. Xu et al. Cancer Res; 75(17) September 1, 2015 Cancer...the dihydrotestosterone ( DHT ) groups, 1 nmol/L DHT was added at 24 hours after transfection. At 48 hours after transfection, cells were fixed with 70
Stellar and Planetary Parameters for K2 's Late-type Dwarf Systems from C1 to C5
Energy Technology Data Exchange (ETDEWEB)
Martinez, Arturo O. [Department of Astronomy, San Diego State University, 5500 Campanile Drive, San Diego, CA 92182 (United States); Crossfield, Ian J. M.; Peacock, Sarah [Lunar and Planetary Laboratory, University of Arizona, 1629 E. University Blvd, Tucson, AZ 85721 (United States); Schlieder, Joshua E. [NASA Ames Research Center, Moffett Field, CA 94035 (United States); Dressing, Courtney D. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Obermeier, Christian [Max Planck Institut für Astronomie, Heidelberg (Germany); Livingston, John; Petigura, Erik A. [Department of Astronomy, Graduate School of Science, The University of Tokyo, 7-3-1 Bunkyo-ku, Tokyo 113-0033 (Japan); Ciceri, Simona [Department of Astronomy, Stockholm University, SE-106 91 Stockholm (Sweden); Beichman, Charles A. [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Lépine, Sébastien [Department of Physics and Astronomy, Georgia State University, 25 Park Pl NE #605, Atlanta, GA 30303 (United States); Aller, Kimberly M. [Institute for Astronomy, University of Hawai’i at Mānoa, 2680 Woodlawn Dr., Honolulu, HI 96822 (United States); Chance, Quadry A. [Steward Observatory, University of Arizona, 933 N. Cherry Ave, Tucson, AZ 85719 (United States); Howard, Andrew W. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Werner, Michael W. [Jet Propulsion Laboratory, 4800 Oak Grove Dr., Pasadena, CA 91109 (United States)
2017-03-01
The NASA K2 mission uses photometry to find planets transiting stars of various types. M dwarfs are of high interest since they host more short-period planets than any other type of main-sequence star and transiting planets around M dwarfs have deeper transits compared to other main-sequence stars. In this paper, we present stellar parameters from K and M dwarfs hosting transiting planet candidates discovered by our team. Using the SOFI spectrograph on the European Southern Observatory’s New Technology Telescope, we obtained R ≈ 1000 J -, H -, and K -band (0.95–2.52 μ m) spectra of 34 late-type K2 planet and candidate planet host systems and 12 bright K4–M5 dwarfs with interferometrically measured radii and effective temperatures. Out of our 34 late-type K2 targets, we identify 27 of these stars as M dwarfs. We measure equivalent widths of spectral features, derive calibration relations using stars with interferometric measurements, and estimate stellar radii, effective temperatures, masses, and luminosities for the K2 planet hosts. Our calibrations provide radii and temperatures with median uncertainties of 0.059 R {sub ⊙} (16.09%) and 160 K (4.33%), respectively. We then reassess the radii and equilibrium temperatures of known and candidate planets based on our spectroscopically derived stellar parameters. Since a planet’s radius and equilibrium temperature depend on the parameters of its host star, our study provides more precise planetary parameters for planets and candidates orbiting late-type stars observed with K2 . We find a median planet radius and an equilibrium temperature of approximately 3 R {sub ⊕} and 500 K, respectively, with several systems (K2-18b and K2-72e) receiving near-Earth-like levels of incident irradiation.
Hydrogen sorption properties of the Lasub(1-x)Casub(x)Ni5 and La(Nisub(1-x)Cusub(x))5 systems
International Nuclear Information System (INIS)
Shinar, J.; Shaltiel, D.; Davidov, D.; Grayevsky, A.
1978-01-01
The hydrogen sorption properties of the Lasub(1-x)Casub(x)Ni 5 and La(Nisub(1-x)Cusub(x)) 5 systems were investigated at various temperatures and at pressures up to 20 atm. It was found that initial substitution of La by Ca in LaNi 5 caused an increase in the hydrogen dissociation pressure, up to Casub(0.3)Lasub(0.7)Ni 5 . In the Casub(0.3)Lasub(0.7)Ni 5 -CaNi 5 range, the dissociation pressure decreased. The absorption capacity of CaNi 5 was dependent on the purity of the sample and increased significantly at low temperatures. The stability of La(Nisub(1-x)Cusub(x)) 5 hydrides increased linearly from LaNi 5 to LaCu 5 . These features are discussed in the light of existing models of ternary and pseudoternary hydride stability. Finally, the role of the measured change in entropy ΔS in determining the occupied interstitial sites in the hydride is outlined and discussed in relation to these systems. (Auth.)
40 Gb/s optical transmission systems
DEFF Research Database (Denmark)
Buxens Azcoaga, Alvaro Juan; Nielsen, Steen Krogh
2003-01-01
; chromatic dispersion, Polarization Mode Dispersion (PMD), Self Phase Modulation (SPM) and linear or non-linear crosstalk among others. Regarding chromatic dispersion, sufficient evidence is presented for the need in 40 Gb/s systems of either modulation formats that allow for higher tolerance than....... Using a 9 ps pulsed RZ Tx, transmission is achieved over a 400 km link consisting of 5 spans of 80 km standard-SMF with a Quality (Q) factor of 17.7 dB, while for NRZ it is reduced to 15 dB. In another experimental verification over 40 km spans of standard-SMF, we could achieve transmission over 6 spans...
RELAP5 progress summary: simulation of semiscale isothermal blowdown (Test S-01-4A)
International Nuclear Information System (INIS)
Kuo, H.H.; Wagner, R.J.; Carlson, K.E.; Kiser, D.M.; Trapp, J.A.; Ransom, V.H.
1978-07-01
The RELAP5/MOD''O'' LOCA analysis code has been applied to Simulation of the Semiscale Isothermal Blowdown Test (S-01-4A) from initiation to 60 seconds. Subcooled ECC injection was simulated from 23 seconds until accumulator emptying. The calculated results are in very good agreement with the experimental data. This is the first full system application of the RELAP5 code and only the pressurizer surge line resistance was modified to achieve the results reported. An analysis of the code execution time using a time-step statistical edit is included
The 4p-5d, 6d and 4p-6s, 7s transitions of Mo IX
International Nuclear Information System (INIS)
Khatoon, S.; Chaghtai, M.S.Z.; Rahimullah, K.
1979-01-01
The transitions 4p-5d, 6d and 4p-6s, 7s have been studied for the first time in Mo IX. The authors have identified 42 4p-5d, 36 4p-6d, 22 4p-6s and 22 4p-7s transitions, establishing 16 4p 3 5d, 14 4p 3 6d and all the ten 4p 3 6s, 7s levels of the spectrum concerned. The ionization energy is estimated to be (1 323 700 +- 700)cm -1 or (164.11 +- 0.09)eV. The spectrum was recorded in sliding and open spark discharges with a 5 m grazing incidence spectrograph of Lund University (Sweden) from about 40 A to 440 A. (Auth.)
International Nuclear Information System (INIS)
Kovchegov, Yuri V.
2011-01-01
We study heavy ion collisions at strong 't Hooft coupling using AdS/CFT correspondence. Heavy ion collisions correspond to gravitational shock wave collisions in AdS 5 . We construct the metric in the forward light cone after the collision perturbatively through expansion of Einstein equations in graviton exchanges. We obtain an analytic expression for the metric including all-order graviton exchanges with one shock wave, while keeping the exchanges with another shock wave at the lowest order. We read off the corresponding energy-momentum tensor of the produced medium. Unfortunately this energy-momentum tensor does not correspond to ideal hydrodynamics, indicating that higher order graviton exchanges are needed to construct the full solution of the problem. We also show that shock waves must completely stop almost immediately after the collision in AdS 5 , which, on the field theory side, corresponds to complete nuclear stopping due to strong coupling effects, likely leading to Landau hydrodynamics. Finally, we perform trapped surface analysis of the shock wave collisions demonstrating that a bulk black hole, corresponding to ideal hydrodynamics on the boundary, has to be created in such collisions, thus constructing a proof of thermalization in heavy ion collisions at strong coupling.
10 CFR 960.5-1 - System guidelines.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false System guidelines. 960.5-1 Section 960.5-1 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Preclosure Guidelines § 960.5-1 System guidelines. (a) Qualifying conditions—(1) Preclosure...
DEFF Research Database (Denmark)
Riishøj, Jesper
1993-01-01
A laser-diode driver GaAs IC incorporating an optional NRZ/RZ (non-return-to-zero/return-to-zero) conversion facility, having ECL (emitter-coupled logic) and SCFL (source-coupled FET logic)-compatible inputs and providing a 0-60-mA adjustable output current into a 50-Ω/5-V termination at bit rates...... obtained. To verify laser driving performance a back-to-back optical-fiber transmission experiment was performed, giving good optical eye diagrams at 2.5 Gb/s. The electrooptical interplay between laser-diode driver and laser-diode has been demonstrated using SPICE simulations...... up to 2 Gb/s NRZ and maintaining a clear eye opening of 50 mA at 2.5 Gb/s NRZ bit rate has been designed, using a commercial 1-μm gate-length (Fτ=12 GHz) GaAs MESFET foundry service. The high maximum output current is obtained by implementing the output driver as a cascode differential amplifier...
Planet-induced Stellar Pulsations in HAT-P-2's Eccentric System
Energy Technology Data Exchange (ETDEWEB)
Wit, Julien de [Department of Earth, Atmospheric and Planetary Sciences, MIT, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Lewis, Nikole K. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Knutson, Heather A.; Batygin, Konstantin [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Fuller, Jim [TAPIR, Walter Burke Institute for Theoretical Physics, Mailcode 350-17, California Institute of Technology, Pasadena, CA 91125 (United States); Antoci, Victoria [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Fulton, Benjamin J. [Institute for Astronomy, University of Hawaii, Honolulu, HI 96822 (United States); Laughlin, Gregory [Department of Astronomy, Yale University, New Haven, CT 06511 (United States); Deming, Drake [Department of Astronomy, University of Maryland at College Park, College Park, MD 20742 (United States); Shporer, Avi [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91009 (United States); Cowan, Nicolas B. [Department of Physics, Department of Earth and Planetary Sciences, McGill University, 3550 rue University, Montreal, QC H3A 2A7 (Canada); Agol, Eric [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Burrows, Adam S. [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Fortney, Jonathan J. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Langton, Jonathan [Department of Physics, Principia College, Elsah, IL 62028 (United States); Showman, Adam P. [Lunar and Planetary Laboratory, University of Arizona, Tucson, AZ 85721 (United States)
2017-02-20
Extrasolar planets on eccentric short-period orbits provide a laboratory in which to study radiative and tidal interactions between a planet and its host star under extreme forcing conditions. Studying such systems probes how the planet’s atmosphere redistributes the time-varying heat flux from its host and how the host star responds to transient tidal distortion. Here, we report the insights into the planet–star interactions in HAT-P-2's eccentric planetary system gained from the analysis of ∼350 hr of 4.5 μ m observations with the Spitzer Space Telescope . The observations show no sign of orbit-to-orbit variability nor of orbital evolution of the eccentric planetary companion, HAT-P-2 b. The extensive coverage allows us to better differentiate instrumental systematics from the transient heating of HAT-P-2 b’s 4.5 μ m photosphere and yields the detection of stellar pulsations with an amplitude of approximately 40 ppm. These pulsation modes correspond to exact harmonics of the planet’s orbital frequency, indicative of a tidal origin. Transient tidal effects can excite pulsation modes in the envelope of a star, but, to date, such pulsations had only been detected in highly eccentric stellar binaries. Current stellar models are unable to reproduce HAT-P-2's pulsations, suggesting that our understanding of the interactions at play in this system is incomplete.
Harun, S. I.; Idris, S. R. A.; Tamar Jaya, N.
2017-09-01
Local exhaust ventilation (LEV) is an engineering system frequently used in the workplace to protect operators from hazardous substances. The objective of this project is design and fabricate the ventilation system as installation for chamber room of laser cutting machine and to stimulate the air flow inside chamber room of laser cutting machine with the ventilation system that designed. LEV’s fabricated with rated voltage D.C 10.8V and 1.5 ampere. Its capacity 600 ml, continuously use limit approximately 12-15 minute, overall length LEV’s fabricated is 966 mm with net weight 0.88 kg and maximum airflow is 1.3 meter cubic per minute. Stimulate the air flow inside chamber room of laser cutting machine with the ventilation system that designed and fabricated overall result get 2 main gas vapor which air and carbon dioxide. For air gas which experimented by using anemometer, general duct velocity that produce is same with other gas produce, carbon dioxide which 5 m/s until 10 m/s. Overall result for 5 m/s and 10 m/s as minimum and maximum duct velocity produce for both air and carbon dioxide. The air gas flow velocity that captured by LEV’s fabricated, 3.998 m/s average velocity captured from 5 m/s duct velocity which it efficiency of 79.960% and 7.667 m/s average velocity captured from 10 m/s duct velocity with efficiency of 76.665%. For carbon dioxide gas flow velocity that captured by LEV’s fabricated, 3.674 m/s average velocity captured from 5 m/s duct velocity which it efficiency of 73.480% and 8.255 m/s average velocity captured from 10 m/s duct velocity with efficiency of 82.545%.
4p-5s transitions in In XIII, In XIV and In XV
International Nuclear Information System (INIS)
Carroll, P.K.; Costello, J.T.; O'Sullivan, G.
1986-01-01
The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)
Radiative transitions from Υ(5S) to molecular bottomonium
International Nuclear Information System (INIS)
Voloshin, M. B.
2011-01-01
The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.
Y-chromosome STR haplotypes in Somalis
DEFF Research Database (Denmark)
Hallenberg, Charlotte; Simonsen, Bo; Sanchez Sanchez, Juan Jose
2005-01-01
A total of 201 males from Somalia were typed for the Y-chromosome STRs DYS19, DYS385a/b, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438 and DYS439 with the PowerPlex Y kit (Promega). A total of 96 different haplotypes were observed and the haplotype diversity was 0.9715. The ......A total of 201 males from Somalia were typed for the Y-chromosome STRs DYS19, DYS385a/b, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438 and DYS439 with the PowerPlex Y kit (Promega). A total of 96 different haplotypes were observed and the haplotype diversity was 0...
296-B-5 Stack monitoring and sampling system annual system assessment report
International Nuclear Information System (INIS)
Ridge, T.M.
1995-02-01
The B Plant Administration Manual requires an annual system assessment to evaluate and report the present condition of the sampling and monitoring system associated with Stack 296-B-5 at B Plant. The sampling and monitoring system associated with stack 296-B-5 is functional and performing satisfactorily. This document is an annual assessment report of the systems associated with the 296-B-5 stack
Directory of Open Access Journals (Sweden)
Cristina eMiguelez
2014-03-01
Full Text Available The neurotransmitter serotonin (5-HT has a multifaceted function in the modulation of information processing through the activation of multiple receptor families, including G-protein-coupled receptor subtypes (5-HT1, 5-HT2, 5-HT4-7 and ligand-gated ion channels (5-HT3. The largest population of serotonergic neurons is located in the midbrain, specifically in the raphe nuclei. Although the medial and dorsal raphe nucleus (DRN share common projecting areas, in the basal ganglia (BG nuclei serotonergic innervations come mainly from the DRN. The BG are a highly organized network of subcortical nuclei composed of the striatum (caudate and putamen, subthalamic nucleus (STN, internal and external globus pallidus (or entopeduncular nucleus in rodents, GPi/EP and GPe and substantia nigra (pars compacta, SNc, and pars reticulata, SNr. The BG are part of the cortico-BG-thalamic circuits, which play a role in many functions like motor control, emotion, and cognition and are critically involved in diseases such as Parkinson’s disease. This review provides an overview of serotonergic modulation of the BG at the functional level and a discussion of how this interaction may be relevant to treating Parkinson’s disease and the motor complications induced by chronic treatment with L-DOPA.
Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA
International Nuclear Information System (INIS)
Hirose, Yutaka; Harada, Fumio
2008-01-01
4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus
Scale invariance of the η-deformed AdS5×S5 superstring, T-duality and modified type II equations
Directory of Open Access Journals (Sweden)
G. Arutyunov
2016-02-01
Full Text Available We consider the ABF background underlying the η-deformed AdS5×S5 sigma model. This background fails to satisfy the standard IIB supergravity equations which indicates that the corresponding sigma model is not Weyl invariant, i.e. does not define a critical string theory in the usual sense. We argue that the ABF background should still define a UV finite theory on a flat 2d world-sheet implying that the η-deformed model is scale invariant. This property follows from the formal relation via T-duality between the η-deformed model and the one defined by an exact type IIB supergravity solution that has 6 isometries albeit broken by a linear dilaton. We find that the ABF background satisfies candidate type IIB scale invariance conditions which for the R–R field strengths are of the second order in derivatives. Surprisingly, we also find that the ABF background obeys an interesting modification of the standard IIB supergravity equations that are first order in derivatives of R–R fields. These modified equations explicitly depend on Killing vectors of the ABF background and, although not universal, they imply the universal scale invariance conditions. Moreover, we show that it is precisely the non-isometric dilaton of the T-dual solution that leads, after T-duality, to modification of type II equations from their standard form. We conjecture that the modified equations should follow from κ-symmetry of the η-deformed model. All our observations apply also to η-deformations of AdS3×S3×T4and AdS2×S2×T6models.
Lineament systems indentification in Banten site using Spot 5 satellite image
International Nuclear Information System (INIS)
Yuliastuti; Heni Susiati; Yunus Daud; A-Sarwiyana Sastratenaya
2013-01-01
Lineament systems identification in Banten site using SPOT 5 satellite image has been performed. Based on regional site survey in Java Island, Banten is one of the potential candidate sites. The objective of this study was to determine direction and chronology of regional lineament morphology which was consider as fault or faulting in Banten site. The methodology used this study covered satellite image cropping, band selection, edge enhancement filtering, lineament extraction and lineament analysis. Result of the study showed that there were three dominant lineament groups, namely N-S, NW-SE, and E-W. Based on the forming chronology of the lineament, N-S group was the oldest one, followed by E-W group and NW-SE as the youngest group. These lineament groups have been confirmed as a manifestation of fault system structure. (author)
International Nuclear Information System (INIS)
Moon, Han Seb; Noh, Heung-Ryoul
2011-01-01
The polarization dependence of double-resonance optical pumping (DROP) in the ladder-type electromagnetically induced transparency (EIT) of the 5S 1/2 -5P 3/2 -5D 5/2 transition of 87 Rb atoms is studied. The transmittance spectra in the 5S 1/2 (F=2)-5P 3/2 (F'=3)-5D 5/2 (F''=2,3,4) transition were observed as caused by EIT, DROP, and saturation effects in the various polarization combinations between the probe and coupling lasers. The features of the double-structure transmittance spectra in the 5S 1/2 (F=2)-5P 3/2 (F'=3)-5D 5/2 (F''=4) cycling transition were attributed to the difference in saturation effect according to the transition routes between the Zeeman sublevels and the EIT according to the two-photon transition probability.
Charged bottomoniumlike states Zb(10610) and Zb(10650) and the Υ(5S)→Υ(2S)π+π- decay
International Nuclear Information System (INIS)
Chen Dianyong; Liu Xiang; Zhu Shilin
2011-01-01
Inspired by the newly observed two charged bottomoniumlike states, we consider the possible contribution from the intermediate Z b (10610) and Z b (10650) states to the Υ(5S)→Υ(2S)π + π - decay process, which naturally explains Belle's previous observation of the anomalous Υ(2S)π + π - production near the peak of Υ(5S) at √(s)=10.87 GeV [K. F. Chen et al. (Belle Collaboration), Phys. Rev. Lett. 100, 112001 (2008)]. The resulting dΓ(Υ(5S)→Υ(2S)π + π - )/dm π + π - and dΓ(Υ(5S)→Υ(2S)π + π - )/dcosθ distributions agree with Belle's measurement after inclusion of these Z b states. This formalism also reproduces the Belle observation of the double-peak structure and its reflection in the Υ(2S)π + invariant mass spectrum of the Υ(5S)→Υ(2S)π + π - decay.
(3R,6S,7aS-3-Phenyl-6-(phenylsulfanylperhydropyrrolo[1,2-c]oxazol-5-one
Directory of Open Access Journals (Sweden)
Anthony D. Woolhouse
2009-05-01
Full Text Available Molecules of the title compound [systematic name: (2R,5S,7S-2-phenyl-7-phenylsulfanyl-1-aza-3-oxabicyclo[3.3.0]octan-8-one], C18H17NO2S, form high quality crystals even though they are only packed using C—H...O(carbonyl and weak C—H...S interactions. The dihedral angle between the aromatic rings is 85.53 (5°. The fused rings adopt envelope and twist conformations.
RELAP5/MOD2 code assessment for the Semiscale Mod-2C Test S-LH-1
International Nuclear Information System (INIS)
Fineman, C.P.
1986-01-01
RELAP5/MOD2, Cycle 36.02, was assessed using data from Semiscale Mod-2C experiment S-LH-1. The major phenomena that occurred during the experiment were calculated by RELAP5/MOD2, although the duration and the magnitude of their effect on the transient were not always well calculated. Areas defined where further work was needed to improve the RELAP5 calculation include: (1) the system energy balance, (2) core interfacial drag, and 3) the heat transfer logic rod dryout criterion
Summary of EPA’s Review of Comments on the National Electric Energy Data System (NEEDS) v.5.15
This document summarizes EPA’s review of comments on inputs to the IPM, including the National Electric Energy Data System (NEEDS) database. and highlights common comment types and how EPA generally reviewed and acted on those comments.
LuxS-independent formation of AI-2 from ribulose-5-phosphate
Directory of Open Access Journals (Sweden)
Hardie Kim R
2008-06-01
Full Text Available Abstract Background In many bacteria, the signal molecule AI-2 is generated from its precursor S-ribosyl-L-homocysteine in a reaction catalysed by the enzyme LuxS. However, generation of AI-2-like activity has also been reported for organisms lacking the luxS gene and the existence of alternative pathways for AI-2 formation in Escherichia coli has recently been predicted by stochastic modelling. Here, we investigate the possibility that spontaneous conversion of ribulose-5-phosphate could be responsible for AI-2 generation in the absence of luxS. Results Buffered solutions of ribulose-5-phosphate, but not ribose-5-phosphate, were found to contain high levels of AI-2 activity following incubation at concentrations similar to those reported in vivo. To test whether this process contributes to AI-2 formation by bacterial cells in vivo, an improved Vibrio harveyi bioassay was used. In agreement with previous studies, culture supernatants of E. coli and Staphylococcus aureus luxS mutants were found not to contain detectable levels of AI-2 activity. However, low activities were detected in an E. coli pgi-eda-edd-luxS mutant, a strain which degrades glucose entirely via the oxidative pentose phosphate pathway, with ribulose-5-phosphate as an obligatory intermediate. Conclusion Our results suggest that LuxS-independent formation of AI-2, via spontaneous conversion of ribulose-5-phosphate, may indeed occur in vivo. It does not contribute to AI-2 formation in wildtype E. coli and S. aureus under the conditions tested, but may be responsible for the AI-2-like activities reported for other organisms lacking the luxS gene.
Directory of Open Access Journals (Sweden)
R. Nesci
2012-01-01
Full Text Available We report on our optical monitoring of the BL Lac object S5 1803+78 from 1996 to 2011. The source showed no clear periodicity, but a time scale of about 1 300 days between major flares is possibly present. No systematic trend of the color index with flux variations is evident, at variance with other BL Lacs. In one flare, however, the source was bluer in the rising phase and redder in the falling one. Two ?-ray flares were detected by Fermi-GST during our monitoring: on the occasion of only one of them we found simultaneous optical brightening. A one-zone Synchrotron Self Compton (SSC model appears too simple to explain the source behavior.
International Nuclear Information System (INIS)
Blazina, Z.; Drasner, A.; Ban, Z.; Zagreb Univ.
1981-01-01
X-ray powder diffraction studies and metallographic examinations in the systems UNi 5 sub(-)sub(x)Msub(x) and ZrNi 5 sub(-)sub(x)Msub(x) (M = In, Sn, Zn) revealed the existence of single phase regions up to the composition 1 : 4 : 1, i.e. up to UNi 4 M and ZrNi 4 M, respectively. Comparison between calculated and observed intensity values showed that nickel atoms, in the crystallographic positions 4(c) of the isostructural binary compounds UNi 5 or ZrNi 5 (UNi 5 -type, S.G. F43m), are substituted by M atoms. Vegard's rule is obeyed in the single phase regions of all investigated systems. The crystal structures of UNi 4 M and ZrNi 4 M are superlattice structures of the MgSnCu 4 -type (S.G. F43m). Structural correlations of these phases with corresponding binary prototypes are made in terms of stacking sequences. (orig.)
Compernolle, Steven; Lambert, Jean-Christopher; Langerock, Bavo; Granville, José; Hubert, Daan; Keppens, Arno; Rasson, Olivier; De Mazière, Martine; Fjæraa, Ann Mari; Niemeijer, Sander
2017-04-01
Sentinel-5 Precursor (S5P), to be launched in 2017 as the first atmospheric composition satellite of the Copernicus programme, carries as payload the TROPOspheric Monitoring Instrument (TROPOMI) developed by The Netherlands in close cooperation with ESA. Designed to measure Earth radiance and solar irradiance in the ultraviolet, visible and near infrared, TROPOMI will provide Copernicus with observational data on atmospheric composition at unprecedented geographical resolution. The S5P Mission Performance Center (MPC) provides an operational service-based solution for various QA/QC tasks, including the validation of S5P Level-2 data products and the support to algorithm evolution. Those two tasks are to be accomplished by the MPC Validation Data Analysis Facility (VDAF), one MPC component developed and operated at BIRA-IASB with support from S[&]T and NILU. The routine validation to be ensured by VDAF is complemented by a list of validation AO projects carried out by ESA's S5P Validation Team (S5PVT), with whom interaction is essential. Here we will introduce the general architecture of VDAF, its relation to the other MPC components, the generic and specific validation strategies applied for each of the official TROPOMI data products, and the expected output of the system. The S5P data products to be validated by VDAF are diverse: O3 (vertical profile, total column, tropospheric column), NO2 (total and tropospheric column), HCHO (tropospheric column), SO2 (column), CO (column), CH4 (column), aerosol layer height and clouds (fractional cover, cloud-top pressure and optical thickness). Starting from a generic validation protocol meeting community-agreed standards, a set of specific validation settings is associated with each data product, as well as the appropriate set of Fiducial Reference Measurements (FRM) to which it will be compared. VDAF collects FRMs from ESA's Validation Data Centre (EVDC) and from other sources (e.g., WMO's GAW, NDACC and TCCON). Data
Phenomenology with F-theory S U (5 )
Leontaris, George K.; Shafi, Qaisar
2017-09-01
We explore the low-energy phenomenology of an F-theory-based S U (5 ) model which, in addition to the known quarks and leptons, contains Standard Model (SM) singlets and vectorlike color triplets and S U (2 ) doublets. Depending on their masses and couplings, some of these new particles may be observed at the LHC and future colliders. We discuss the restrictions by Cabibbo-Kobayashi-Maskawa matrix constraints on their mixing with the ordinary down quarks of the three chiral families. The model is consistent with gauge coupling unification at the usual supersymmetric GUT scale; dimension-five proton decay is adequately suppressed, while dimension-six decay mediated by the superheavy gauge bosons is enhanced by a factor of 5-7. The third generation charged fermion Yukawa couplings yield the corresponding low-energy masses in reasonable agreement with observations. The hierarchical nature of the masses of lighter generations is accounted for via nonrenormalizable interactions, with the perturbative vacuum expectation values (VEVs) of the SM singlet fields playing an essential role.
Qiu, Jianhao; Zhang, Xiong-Fei; Zhang, Xingguang; Feng, Yi; Li, Yuxin; Yang, Lvye; Lu, Haiqiang; Yao, Jianfeng
2018-05-05
A novel and highly efficient photocatalyst of Cd 0.5 Zn 0.5 S@ZIF-8 nanocomposite has been developed by a facile self-assembly strategy. This is the first report on the application of Cd x Zn 1-x S and metal-organic framework (MOF) nanocomposite as photocatalysts for the reduction of Cr(VI). The resulting Cd 0.5 Zn 0.5 S@ZIF-8 exhibited higher photocatalytic activity than that of pristine Cd 0.5 Zn 0.5 S and ZIF-8. Particularly, the CZS@Z60 composite with 60 wt% of ZIF-8 exhibited a photocatalytic activity that is about 1.6 times as high as that of Cd 0.5 Zn 0.5 S. The dominant reason for the improved photocatalytic reduction potential is proved to be the newly-formed interfacial SZn bonds that firmly connect Cd 0.5 Zn 0.5 S and ZIF-8 and substantially improve the separation efficiency of photo-excited electrons and holes. The newly-formed chemical bonds are confirmed by XPS analyses, and the prolonged lifetime of photo-excited electrons is evidenced by the electrochemical measurement of photocurrent, which shows that the photocurrent on Cd 0.5 Zn 0.5 S@ZIF-8 is much higher than that of Cd 0.5 Zn 0.5 S and ZIF-8. This study clearly demonstrates that the MOF-based composite nanomaterials hold great promises for applications in the field of environmental remediation and for design of novel photocatalytic materials. Copyright © 2018 Elsevier B.V. All rights reserved.
Yin; Ye; Yu; Liu
2010-01-01
A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
Yin, Bo; Ye, Dong-Nai; Yu, Kai-Hui; Liu, Liang-Xian
2010-04-16
A general approach to (4S,5S)-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl) amides 10 based on a diastereoselective reduction of (5S,6RS)-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 degrees C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes
International Nuclear Information System (INIS)
Schubert, I.; Baeumlein, H.; Wobus, U.
1978-01-01
In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)
Influence of lanthanum on the physico-chemical properties of solid solutions GeS0.5Se0.5
International Nuclear Information System (INIS)
Murquzov, M.I.; Alekperov, A.S.; Bayramov, R.B.
2010-01-01
By the methods of physical-chemical analysis (X-ray, MSA, as well as measurement of microhardness and density determination) the influence of La on the physico-chemical properties of solid solutions (GeS 0 .5Se 0 .5) 1 -x(La) x was studied and its microdiagram was plotted. At room temperature the GeS 0 .5Se 0 .5 based solid solution extent 4 at. percent of La. The dependence of lanthane microhardness was studied
The S4-S5 linker acts as a signal integrator for HERG K+ channel activation and deactivation gating.
Directory of Open Access Journals (Sweden)
Chai Ann Ng
Full Text Available Human ether-à-go-go-related gene (hERG K(+ channels have unusual gating kinetics. Characterised by slow activation/deactivation but rapid inactivation/recovery from inactivation, the unique gating kinetics underlie the central role hERG channels play in cardiac repolarisation. The slow activation and deactivation kinetics are regulated in part by the S4-S5 linker, which couples movement of the voltage sensor domain to opening of the activation gate at the distal end of the inner helix of the pore domain. It has also been suggested that cytosolic domains may interact with the S4-S5 linker to regulate activation and deactivation kinetics. Here, we show that the solution structure of a peptide corresponding to the S4-S5 linker of hERG contains an amphipathic helix. The effects of mutations at the majority of residues in the S4-S5 linker of hERG were consistent with the previously identified role in coupling voltage sensor movement to the activation gate. However, mutations to Ser543, Tyr545, Gly546 and Ala548 had more complex phenotypes indicating that these residues are involved in additional interactions. We propose a model in which the S4-S5 linker, in addition to coupling VSD movement to the activation gate, also contributes to interactions that stabilise the closed state and a separate set of interactions that stabilise the open state. The S4-S5 linker therefore acts as a signal integrator and plays a crucial role in the slow deactivation kinetics of the channel.
Castro, Beatriz; Sánchez, Pilar; Torres, Jesús M; Ortega, Esperanza
2015-10-01
Early-life exposure to the endocrine disruptor bisphenol A (BPA) affects brain function and behavior, which might be attributed to its interference with hormonal steroid signaling and/or neurotransmitter systems. Alternatively, the use of structural analogs of BPA, mainly bisphenol F (BPF) and bisphenol S (BPS), has increased recently. However, limited in vivo toxicity data exist. We investigated the effects of BPA, BPF and BPS on 5α-reductase (5α-R), a key enzyme involved in neurosteroidogenesis, as well as on dopamine (DA)- and serotonin (5-HT)-related genes, in the prefrontal cortex (PFC) of juvenile female rats. Gestating Wistar rats were treated with either vehicle or 10 μg/kg/day of BPA, BPF or BPS from gestational day 12 to parturition. Then, female pups were exposed from postnatal day 1 through day 21 (PND21), when they were euthanized and RT-PCR, western blot and quantitative PCR-array experiments were performed. BPA decreased 5α-R2 and 5α-R3 mRNA and protein levels, while both BPF and BPS decreased 5α-R3 mRNA levels in PFC at PND21. Further, BPA, BPF and BPS significantly altered, respectively, the transcription of 25, 56 and 24 genes out of the 84 DA and 5-HT-related genes assayed. Of particular interest was the strong induction by all these bisphenols of Cyp2d4, implicated in corticosteroids synthesis. Our results demonstrate for the first time that BPA, BPF and BPS differentially affect 5α-R and genes related to DA/5-HT systems in the female PFC. In vivo evidence of the potential adverse effects of BPF and BPS in the brain of mammals is provided in this work, raising questions about the safety of these chemicals as substitutes for BPA. Copyright © 2015 Elsevier Inc. All rights reserved.
Newman-Tancredi, A; Gavaudan, S; Conte, C; Chaput, C; Touzard, M; Verrièle, L; Audinot, V; Millan, M J
1998-08-21
Recombinant human (h) 5-HT1A receptor-mediated G-protein activation was characterised in membranes of transfected Chinese hamster ovary (CHO) cells by use of guanosine-5'-O-(3-[35S]thio)-triphosphate ([35S]GTPgammaS binding). The potency and efficacy of 21 5-HT receptor agonists and antagonists was determined. The agonists, 5-CT (carboxamidotryptamine) and flesinoxan displayed high affinity (subnanomolar Ki values) and high efficacy (Emax > 90%, relative to 5-HT = 100%). In contrast, ipsapirone, zalospirone and buspirone displayed partial agonist activity. EC50s for agonist stimulation of [35S]GTPgammaS binding correlated well with Ki values from competition binding (r = +0.99). Among the compounds tested for antagonist activity, methiothepin and (+)butaclamol exhibited 'inverse agonist' behaviour, inhibiting basal [35S]GTPgammaS binding. The actions of 17 antipsychotic agents were investigated. Clozapine and several putatively 'atypical' antipsychotic agents, including ziprasidone, quetiapine and tiospirone, exhibited partial agonist activity and marked affinity at h5-HT1A receptors, similar to their affinity at hD2 dopamine receptors. In contrast, risperidone and sertindole displayed low affinity at h5-HT1A receptors and behaved as 'neutral' antagonists, inhibiting 5-HT-stimulated [35S]GTPgammaS binding. Likewise the 'typical' neuroleptics, haloperidol, pimozide, raclopride and chlorpromazine exhibited relatively low affinity and 'neutral' antagonist activity at h5-HT1A receptors with Ki values which correlated with their respective Kb values. The present data show that (i) [35S]GTPgammaS binding is an effective method to evaluate the efficacy and potency of agonists and antagonists at recombinant human 5-HT1A receptors. (ii) Like clozapine, several putatively 'atypical' antipsychotic drugs display balanced serotonin h5-HT1A/dopamine hD2 receptor affinity and partial agonist activity at h5-HT1A receptors. (iii) Several 'typical' and some putatively 'atypical
Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions
International Nuclear Information System (INIS)
Meng Ce; Chao Kuangta
2008-01-01
We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.
5 CFR 10.2 - Accountability systems.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Accountability systems. 10.2 Section 10.2 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE RULES AGENCY ACCOUNTABILITY SYSTEMS; OPM AUTHORITY TO REVIEW PERSONNEL MANAGEMENT PROGRAMS (RULE X) § 10.2 Accountability systems. The Director of...
4 CFR 5.5 - Travel, transportation, and subsistence.
2010-01-01
... 4 Accounts 1 2010-01-01 2010-01-01 false Travel, transportation, and subsistence. 5.5 Section 5.5 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM COMPENSATION § 5.5 Travel, transportation, and subsistence. The provisions of chapter 57 of title 5, U.S. Code and the implementing regulations for the...
CHARACTERIZATION AND MODELING OF SOLITON TRANSMISSION AT 2.5 GB/S OVER 200 KM
Directory of Open Access Journals (Sweden)
KHALID A. S. AL-KHATEEB
2010-09-01
Full Text Available Soliton characteristics and soliton transmission have been simulated using a VPI simulator. Simulation was also used to construct and study a soliton communication system. Near soliton pulses emitted by an actively mode-locked laser is then compressed in a dispersion-compensating fiber (DCF to produce solitons. The effects of non-linearity and active pre-chirping of mode-locked laser diode sources were also investigated. Assessment on a modeled system using real data shows that propagation over 250 km at 2.5 Gb/s in standard fibers with 20 ps pulse widths is possible in the 1550 nm wavelength range.
Demonstration of micro-projection enabled short-range communication system for 5G.
Chou, Hsi-Hsir; Tsai, Cheng-Yu
2016-06-13
A liquid crystal on silicon (LCoS) based polarization modulated image (PMI) system architecture using red-, green- and blue-based light-emitting diodes (LEDs), which offers simultaneous micro-projection and high-speed data transmission at nearly a gigabit, serving as an alternative short-range communication (SRC) approach for personal communication device (PCD) application in 5G, is proposed and experimentally demonstrated. In order to make the proposed system architecture transparent to the future possible wireless data modulation format, baseband modulation schemes such as multilevel pulse amplitude modulation (M-PAM), M-ary phase shift keying modulation (M-PSK) and M-ary quadrature amplitude modulation (M-QAM) which can be further employed by more advanced multicarrier modulation schemes (such as DMT, OFDM and CAP) were used to investigate the highest possible data transmission rate of the proposed system architecture. The results demonstrated that an aggregative data transmission rate of 892 Mb/s and 900 Mb/s at a BER of 10^(-3) can be achieved by using 16-QAM baseband modulation scheme when data transmission were performed with and without micro-projection simultaneously.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Directory of Open Access Journals (Sweden)
Bo Yin
2010-04-01
Full Text Available A general approach to (4S,5S-4-benzyloxy-5-hydroxy-N-(4-methoxybenzyl amides 10 based on a diastereoselective reduction of (5S,6RS-6-alkyl-5-benzyloxy-6-hydroxy-2-piperidinones 6 and their tautomeric ring-opened keto amides 7 is described. The reduction with L-Selectride at -20 °C to room temperature afforded the products 10 in excellent yields and moderate to high syn-diastereoselectivities.
(1S,3S,4S-tert-Butyl N-[1-benzyl-3-hydroxy-5-phenyl-4-(picolinamidopentyl]carbamate
Directory of Open Access Journals (Sweden)
Jian-Feng Zheng
2008-07-01
Full Text Available The title compound, C29H35N3O4, was obtained by the reaction of (2S,4S,5S-tert-butyl N-(4-amino-1-benzyl-3-hydroxy-5-phenylpentylcarbamate and picolinic acid using oxalyl chloride as a chlorinating reagent to activate the carboxyl group. In the crystal structure there are two molecules in the asymmetric unit, which are aligned edge-to-face. In one molecule, the pyridyl ring forms a dihedral angle of 22.0 (1° with the phenyl ring of the terminal benzyl group and 14.3 (1° with the other phenyl ring; in the other molecule, the corresponding angles are 12.1 (1 and 10.6 (1°, respectively. The packing is stabilized by intermolecular hydrogen bonds and C—H...π interactions.
V.S.O.P. (99/05) computer code system
International Nuclear Information System (INIS)
Ruetten, H.J.; Haas, K.A.; Brockmann, H.; Scherer, W.
2005-11-01
V.S.O.P. is a computer code system for the comprehensive numerical simulation of the physics of thermal reactors. It implies the setup of the reactor and of the fuel element, processing of cross sections, neutron spectrum evaluation, neutron diffusion calculation in two or three dimensions, fuel burnup, fuel shuffling, reactor control, thermal hydraulics and fuel cycle costs. The thermal hydraulics part (steady state and time-dependent) is restricted to HTRs and to two spatial dimensions. The code can simulate the reactor operation from the initial core towards the equilibrium core. V.S.O.P.(99 / 05) represents the further development of V.S.O.P. (99). Compared to its precursor, the code system has been improved in many details. Major improvements and extensions have been included concerning the neutron spectrum calculation, the 3-d neutron diffusion options, and the thermal hydraulic section with respect to 'multi-pass'-fuelled pebblebed cores. This latest code version was developed and tested under the WINDOWS-XP - operating system. The storage requirement for the executables and the basic libraries associated with the code amounts to about 15 MB. Another 5 MB are required - if desired - for storage of the source code (∼65000 Fortran statements). (orig.)
V.S.O.P. (99/05) computer code system
Energy Technology Data Exchange (ETDEWEB)
Ruetten, H.J.; Haas, K.A.; Brockmann, H.; Scherer, W.
2005-11-01
V.S.O.P. is a computer code system for the comprehensive numerical simulation of the physics of thermal reactors. It implies the setup of the reactor and of the fuel element, processing of cross sections, neutron spectrum evaluation, neutron diffusion calculation in two or three dimensions, fuel burnup, fuel shuffling, reactor control, thermal hydraulics and fuel cycle costs. The thermal hydraulics part (steady state and time-dependent) is restricted to HTRs and to two spatial dimensions. The code can simulate the reactor operation from the initial core towards the equilibrium core. V.S.O.P.(99 / 05) represents the further development of V.S.O.P. (99). Compared to its precursor, the code system has been improved in many details. Major improvements and extensions have been included concerning the neutron spectrum calculation, the 3-d neutron diffusion options, and the thermal hydraulic section with respect to 'multi-pass'-fuelled pebblebed cores. This latest code version was developed and tested under the WINDOWS-XP - operating system. The storage requirement for the executables and the basic libraries associated with the code amounts to about 15 MB. Another 5 MB are required - if desired - for storage of the source code ({approx}65000 Fortran statements). (orig.)
A novel drug delivery of 5-fluorouracil device based on TiO{sub 2}/ZnS nanotubes
Energy Technology Data Exchange (ETDEWEB)
Mendonça Faria, Henrique Antonio, E-mail: henrique.fisica@ifsc.usp.br [Institute of Physics and Chemistry, Federal University of Itajubá (UNIFEI), Av. BPS, 1303, Pinheirinho, Itajubá, MG, PO Box 50, CEP: 37500-903 (Brazil); Nanomedicine and Nanotoxicology Laboratory, São Carlos Institute of Physics, University of São Paulo. Av. Trabalhador São-carlense, 400, Arnold Schimidt, São Carlos, SP CEP: 13566-590 (Brazil); Alencar de Queiroz, Alvaro Antonio, E-mail: alencar@unifei.edu.br [Institute of Physics and Chemistry, Federal University of Itajubá (UNIFEI), Av. BPS, 1303, Pinheirinho, Itajubá, MG, PO Box 50, CEP: 37500-903 (Brazil)
2015-11-01
The structural and electronic properties of titanium oxide nanotubes (TiO{sub 2}) have attracted considerable attention for the development of therapeutic devices and imaging probes for nanomedicine. However, the fluorescence response of TiO{sub 2} has typically been within ultraviolet spectrum. In this study, the surface modification of TiO{sub 2} nanotubes with ZnS quantum dots was found to produce a red shift in the ultra violet emission band. The TiO{sub 2} nanotubes used in this work were obtained by sol–gel template synthesis. The ZnS quantum dots were deposited onto TiO{sub 2} nanotube surface by a micelle-template inducing reaction. The structure and morphology of the resulting hybrid TiO{sub 2}/ZnS nanotubes were investigated by scanning electron microscopy, transmission electron microscopy and X-ray diffraction techniques. According to the results of fluorescence spectroscopy, pure TiO{sub 2} nanotubes exhibited a high emission at 380 nm (3.26 eV), whereas TiO{sub 2}/ZnS exhibited an emission at 410 nm (3.02 eV). The TiO{sub 2}/ZnS nanotubes demonstrated good bio-imaging ability on sycamore cultured plant cells. The biocompatibility against mammalian cells (Chinese Hamster Ovarian Cells—CHO) suggesting that TiO{sub 2}/ZnS may also have suitable optical properties for use as biological markers in diagnostic medicine. The drug release characteristic of TiO{sub 2}/ZnS nanotubes was explored using 5-fluorouracil (5-FU), an anticancer drug used in photodynamic therapy. The results show that the TiO{sub 2}/ZnS nanotubes are a promising candidate for anticancer drug delivery systems. - Highlights: • TiO{sub 2}/ZnS nanotubes showed a redshift in fluorescence spectrum. • Cytotoxicity against mammalian cells revealed biocompatibility of the nanotubes. • TiO{sub 2}/ZnS proved an efficient delivery system for anti-tumor 5-fluorouracil.
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Real-time 2.5 Gbit/s spatial circuit switching on W-band wireless links
DEFF Research Database (Denmark)
Rodríguez, Sebastián; Morales Vicente, Alvaro; Gallardo, Omar
2017-01-01
A spatial circuit switching system based on a beam steering application for W-band wireless links is proposed and experimentally demonstrated. The system enables two simultaneous transmissions of a 2.5 Gbit∕s data signal over a carrier of 81 GHz, while allowing the receiver to dynamically switch...... between them. The performance of the system is tested with the real-time measurements of the BER, achieving values below the FEC limit for 7% of overhead and serving to prove the viability of wireless spatial circuit switching in the next generation of wireless access networks....
International Nuclear Information System (INIS)
Alonso-Medina, A.
2010-01-01
Transition probabilities for 30 spectral lines, arising from the 5d 10 6s{8s, 7p, 5f, 5g} electronic configurations of Pb III (20 measured for the first time), have been experimentally determined from measurements of emission line intensities in a plasma lead induced by ablation with a Nd:YAG laser. The line intensities were obtained with the target placed in molecular argon at 6 Torr, recorded at a 400 ns delay from the laser pulse, which provides appropriate measurement conditions, and analysed between 200 and 700 nm. They are measured when the plasma reaches local thermodynamic equilibrium (LTE). The plasma under study had an electron temperature (T) of 21,400 K and an electron number density (N e ) of 7x10 16 cm -3 . The influence of self-absorption has been estimated for every line, and plasma homogeneity has been checked. The values obtained were compared with previous experimental values and theoretical estimates where possible.
The 5S lean method as a tool of industrial management performances
Filip, F. C.; Marascu-Klein, V.
2015-11-01
Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.
Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo
2013-01-01
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
Directory of Open Access Journals (Sweden)
Stefanie Gerstberger
2017-10-01
Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
Ethical and psychological factors in 5S and total productive maintenance
Energy Technology Data Exchange (ETDEWEB)
Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin
2017-07-01
The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.
Ethical and psychological factors in 5S and total productive maintenance
International Nuclear Information System (INIS)
Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin
2017-01-01
The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.
14 CFR 60.5 - Quality management system.
2010-01-01
... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Quality management system. 60.5 Section 60... requirement of this chapter unless the sponsor has established and follows a quality management system (QMS...) AIRMEN FLIGHT SIMULATION TRAINING DEVICE INITIAL AND CONTINUING QUALIFICATION AND USE § 60.5 Quality...
Fine 5 sõidab ühelt festivalilt teisele
2004-01-01
Tantsuteatri Fine 5 lavastus "Püha kevad" on kutsutud kolmele rahvusvahelisele festivalile. Läinud nädalal osaleti Riias Balti balletifestivalil, täna astutakse üles Kaliningradis festivalil "Tants-transiit" ja juuni algul sõidetakse Moskvasse vene teatri festivalile
Response of 45S5 Bioglasss foams to tensile loading
Czech Academy of Sciences Publication Activity Database
Řehořek, Lukáš; Chlup, Zdeněk; Meng, D.; Yunos, D. M.; Boccaccini, A. R.; Dlouhý, Ivo
2013-01-01
Roč. 39, č. 7 (2013), s. 8015-8020 ISSN 0272-8842 R&D Projects: GA ČR GA101/09/1821 Institutional support: RVO:68081723 Keywords : 45S5 Bioglasss * Scaffolds * Foams * Openporosity * Tensilestrength Subject RIV: JH - Ceramic s, Fire-Resistant Materials and Glass Impact factor: 2.086, year: 2013
9 CFR 102.5 - U.S. Veterinary Biological Product License.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false U.S. Veterinary Biological Product... BIOLOGICAL PRODUCTS § 102.5 U.S. Veterinary Biological Product License. (a) Authorization to produce each biological product shall be specified on a U.S. Veterinary Biological Product License, issued by the...
Development of socketed foundations for S3X5.7 posts.
2015-04-01
The objective of this study was to develop a socketed foundation for use with the S3x5.7 (S76x8.5) weak : post. The design focused on cylindrical, reinforced concrete foundations with a steel tube placed in the center for : use as the socket. The fou...
Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon
International Nuclear Information System (INIS)
Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.
1997-01-01
The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society
International Nuclear Information System (INIS)
Kaschek, K.; Ernst, G.K.; Boetticher, W.
1984-01-01
Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)
Assessment of application of 5S practices in ceramic industry
Directory of Open Access Journals (Sweden)
Danel Kleszcz
2017-10-01
Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.
Optimization Study of Small-Scale Solar Membrane Distillation Desalination Systems (s-SMDDS
Directory of Open Access Journals (Sweden)
Hsuan Chang
2014-11-01
Full Text Available Membrane distillation (MD, which can utilize low-grade thermal energy, has been extensively studied for desalination. By incorporating solar thermal energy, the solar membrane distillation desalination system (SMDDS is a potential technology for resolving energy and water resource problems. Small-scale SMDDS (s-SMDDS is an attractive and viable option for the production of fresh water for small communities in remote arid areas. The minimum cost design and operation of s-SMDDS are determined by a systematic method, which involves a pseudo-steady-state approach for equipment sizing and dynamic optimization using overall system mathematical models. Two s-SMDDS employing an air gap membrane distillation module with membrane areas of 11.5 m2 and 23 m2 are analyzed. The lowest water production costs are $5.92/m3 and $5.16/m3 for water production rates of 500 kg/day and 1000 kg/day, respectively. For these two optimal cases, the performance ratios are 0.85 and 0.91; the recovery ratios are 4.07% and 4.57%. The effect of membrane characteristics on the production cost is investigated. For the commercial membrane employed in this study, the increase of the membrane mass transfer coefficient up to two times is beneficial for cost reduction.
Pharmacokinetics of a 5-fluorouracil liposomal delivery system.
Simmons, S T; Sherwood, M B; Nichols, D A; Penne, R B; Sery, T; Spaeth, G L
1988-01-01
A liposomal delivery system was developed in an attempt to prolong ocular levels of 5-fluorouracil for glaucoma filtering surgery. The pharmacokinetics of the 5-fluorouracil liposomal delivery system were studied in normal pigmented rabbits with 5-fluorouracil labelled with carbon-14 (C-14). 14C 5-fluorouracil was incorporated into the liposomes at a concentration of 10 g/l and injected subconjunctivally in doses of 5 and 10 mg. Concentrations of 5-fluorouracil were assayed at 10 time intervals from 0.5 to 96 hours in cornea, sclera, and conjunctiva and at six time intervals from 0.5 to 12 hours in aqueous. Two peak concentrations were noted at approximately one and eight hours, with measurable levels present at 96 hours. This study demonstrates the ability of this liposomal delivery system to prolong levels of 5-fluorouracial in normal pigmented rabbits. PMID:3179257
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?
Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo
2017-04-15
Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.
Optimization of the thermodynamic properties and phase diagrams of P2O5-containing systems
Hudon, Pierre; Jung, In-Ho
2014-05-01
P2O5 is an important oxide component in the late stage products of numerous igneous rocks such as granites and pegmatites. Typically, P2O5 combines with CaO and crystallizes in the form of apatite, while in volatile-free conditions, Ca-whitlockite is formed. In spite of their interest, the thermodynamic properties and phase diagrams of P2O5-containg systems are not well known yet. In the case of the pure P2O5 for example, no experimental thermodynamic data are available for the liquid and the O and O' solid phases. As a result, we re-evaluated all the thermodynamic and phase diagram data of the P2O5 unary system [1]. Optimization of the thermodynamic properties and phase diagrams of the binary P2O5 systems was then performed including the Li2O-, Na2O-, MgO-, CaO-, BaO-, MnO-, FeO-, Fe2O3-, ZnO-, Al2O3-, and SiO2-P2O5 [2] systems. All available thermodynamic and phase equilibrium data were simultaneously reproduced in order to obtain a set of model equations for the Gibbs energies of all phases as functions of temperature and composition. In particular, the Gibbs energy of the liquid solution was described using the Modified Quasichemical Model [3-5] implemented in the FactSage software [6]. Thermodynamic modeling of the Li2O-Na2O-K2O-MgO-CaO-FeO-Fe2O3-Al2O3-SiO2 system, which include many granite-forming minerals such as nepheline, leucite, pyroxene, melilite, feldspar and spinel is currently in progress. [1] Jung, I.-H., Hudon, P. (2012) Thermodynamic assessment of P2O5. J. Am. Ceram. Soc., 95 (11), 3665-3672. [2] Rahman, M., Hudon, P. and Jung, I.-H. (2013) A coupled experimental study and thermodynamic modeling of the SiO2-P2O5 system. Metall. Mater. Trans. B, 44 (4), 837-852. [3] Pelton, A.D. and Blander, M. (1984) Computer-assisted analysis of the thermodynamic properties and phase diagrams of slags. Proc. AIME Symp. Metall. Slags Fluxes, TMS-AIME, 281-294. [4] Pelton, A.D. and Blander, M. (1986) Thermodynamic analysis of ordered liquid solutions by a modified
Structural, Electrical and Magnetic Properties in the System {Na}_{0.5} {CoO}_{3} Na 0.5 CoO 3
Estrada Rodriguez, C. A.; Pimentel, J. L.; Turatti, A. M.; Lopes, L. F.; Lopes, R. F.; Parra Vargas, C. A.
2018-03-01
The present study reports the structural, magnetic and electrical properties of the Na_{0.5}CoO3 system produced by the conventional solid state reaction method. The X-ray diffraction analysis allows to infer that the compound crystallizes in a monoclinic system with spatial group it{C2/m} and network parameters: a = 5.55 (8) Å, b = 4.87 (3) Å y c = 2.85 (8) Å. It is found that the mean grain size of the stoichiometric of system amounts approximately to 76 nm. Below 40 K, an antiferromagnetic behavior with {T}_{N }≈ 40 K was observed, while in the region between 80 and 190 K the system obeys the law of Curie-Weiss, and the effective magnetic moment was determined experimentally of 5.62{μ }B, indicating a high spin configuration for the Co^{2+ }ion ( S = 3/2) in the fundamental state 4T_{1g}. The system shows cluster spin glass properties with low temperatures, the temperature of magnetic moment freezing from ˜ 40 K. The behavior of the resistivity under absence of magnetic field and the presence of an insulating state between two different metallic states was observed. The metal-insulator transition occurred at two temperatures, the first around 170 K, and the second around 40 K, the latter in accordance with the magnetic transition temperature.
Ethical and psychological factors in 5S and total productive maintenance
Directory of Open Access Journals (Sweden)
Jamal Ahmed Hama Kareem
2017-08-01
Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.
Genetic selection and DNA sequences of 4.5S RNA homologs
DEFF Research Database (Denmark)
Brown, S; Thon, G; Tolentino, E
1989-01-01
A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
22 CFR 212.42 - Exemption from 5 U.S.C. 552.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Exemption from 5 U.S.C. 552. 212.42 Section 212.42 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT PUBLIC INFORMATION Exemptions From Disclosure § 212.42 Exemption from 5 U.S.C. 552. Whenever a request is made which involves access to records...
Pharmacokinetics of a 5-fluorouracil liposomal delivery system.
Simmons, S T; Sherwood, M B; Nichols, D A; Penne, R B; Sery, T; Spaeth, G L
1988-01-01
A liposomal delivery system was developed in an attempt to prolong ocular levels of 5-fluorouracil for glaucoma filtering surgery. The pharmacokinetics of the 5-fluorouracil liposomal delivery system were studied in normal pigmented rabbits with 5-fluorouracil labelled with carbon-14 (C-14). 14C 5-fluorouracil was incorporated into the liposomes at a concentration of 10 g/l and injected subconjunctivally in doses of 5 and 10 mg. Concentrations of 5-fluorouracil were assayed at 10 time interva...
46 CFR 58.60-5 - Industrial systems: Locations.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Industrial systems: Locations. 58.60-5 Section 58.60-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND RELATED SYSTEMS Industrial Systems and Components on Mobile Offshore Drilling Units (MODU...
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry
DEFF Research Database (Denmark)
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-01-01
RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....
Alekseeva, O. S.; Devdariani, A. Z.; Grigorian, G. M.; Lednev, M. G.; Zagrebin, A. L.
2017-02-01
This study is devoted to the theoretical investigation of the quasimolecular emission of Xe*-He and Kr*-He collision pairs near the Xe (5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance atomic lines. The potential curves of the quasimolecules Xe(5p 56s) + He and Kr(4p 55s) + He have been obtained with the use of the effective Hamiltonian and pseudopotential methods. Based on these potential curves the processes of quasimolecular emission of Xe*+He and Kr*+He mixtures have been considered and the spectral distributions I(ħΔω) of photons emitted have been obtained in the framework of quasistatic approximation.
Unique dielectric features of a ceramic-semiconductor nanocomposite MgNb2O6 + 0.25Zn0.5Cd0.5S
Pukazhselvan, D.; Selvaraj, Nivas Babu; Bdikin, Igor; Saravanan, R. Sakthi Sudar; Jakka, Suresh Kumar; Soares, M. J.; Fagg, Duncan Paul
2017-12-01
The present communication deals with the optical/dielectric characteristics of MgNb2O6 + 0.25Zn0.5Cd0.5S nanocomposite (10-30 nm) mixture. Zn0.5Cd0.5S (size ∼10 nm) was synthesized by microwave assisted solvo-thermal method. Monophase magnesium niobate (MN) nanoparticles (10-20 nm) were synthesized in a single step by mechanochemical treatment of MgO + Nb2O5 under dry N2 atmosphere. The nanocomposite, MgNb2O6 + 0.25Zn0.5Cd0.5S, was prepared by mechanical admixing of MgNb2O6 and Zn0.5Cd0.5S taken in 4:1 molar ratio. The photoluminescence study shows violet, yellow and orange-red emissions by the MgNb2O6 + 0.25Zn0.5Cd0.5S composite. The observed dielectric constant value (ε) for MgNb2O6 + 0.25Zn0.5Cd0.5S is only 4.7, which is ∼5 times smaller than the ε value of MgNb2O6 while a dielectric loss for the composite being closer to zero ensures promising commercial applications.
Naktinytė, Eglė
2007-01-01
Jaunesniojo paauglio psichologinė savijauta - neabejotinai aktualus klausimas šiandieną ugdant sveiką visuomenę. Svarbiausias paauglio asmenybės ir psichologinės savijautos aspektas yra sveikatos kontrolės lokusas, kuris parodo, kaip žmogus suvokia savo sveikatą bei priežastis, nuo kurių priklauso jo sveikata, ir savęs vertinimas. Šio magistro darbo tikslas - ištirti 5-12 klasių mokinių savęs vertinimo ir sveikatos kontrolės lokuso ypatumus sąryšyje su sveikata ir mokymosi sėkme. Siekiama nus...
Photoionization of gallium at 3d-4p and 4s-np (n = 5,6) resonances
International Nuclear Information System (INIS)
Caldwell, C.D.; Krause, M.O.; Jimenez-Mier, J.
1988-01-01
The simplest atoms having nonspherical symmetry are those with a single p electron in a valence shell. Of these, the group IIIB elements are excellent examples. As such, they form test cases for photoionization from open-shell systems. Through photoelectron-spectroscopy techniques, we have examined both partial cross sections and angular-distribution parameters for autoionization corresponding to promotion of a 3d electron to the 4p shell of gallium. The resulting dp 2 configuration gives rise to a complicated multiplet structure across which the angular-distribution parameter varies considerably. We have also looked at the simpler structure resulting from promotion of one s electron to an np level, n = 5,6. For these cases, the multiplet structure is simpler, but the influence of the resonance on the cross section and the angular distribution is pronounced. For the 4s4p( 3 P)5p resonance we find a value of β = -1 at the cross-section minimum. No calculations have been performed for this system, so we attempt a qualitative interpretation of our results based on an angular-momentum-transfer analysis
The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π
International Nuclear Information System (INIS)
Huo, Wen-Sheng; Chen, Guo-Ying
2016-01-01
With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)
Influence of lanthanium atoms on the physico-chemical properties of GeS0,5Se0,5 solid solutions
International Nuclear Information System (INIS)
Murguzov, M.I.; Alakbarov, A.S.; Bayramov, R.B.
2010-01-01
By the methods of physical-chemical analysis (DTA, X-ray, MSA, as well as measurement of microhardness and density determination) the influence of La on the physico-chemical properties of solid solutions (GeS 0 ,5Se 0 ,5) 1 -x(La) x was studied and its microdiagram was plotted. At room temperature the GeS 0 ,5Se 0 ,5 based solid solid solution extent to 4 at. percent La. The dependence of lanthane microhardness was studied
Zimmermann, Katharina; Lennerz, Jochen K; Hein, Alexander; Link, Andrea S; Kaczmarek, J Stefan; Delling, Markus; Uysal, Serdar; Pfeifer, John D; Riccio, Antonio; Clapham, David E
2011-11-01
Detection and adaptation to cold temperature is crucial to survival. Cold sensing in the innocuous range of cold (>10-15 °C) in the mammalian peripheral nervous system is thought to rely primarily on transient receptor potential (TRP) ion channels, most notably the menthol receptor, TRPM8. Here we report that TRP cation channel, subfamily C member 5 (TRPC5), but not TRPC1/TRPC5 heteromeric channels, are highly cold sensitive in the temperature range 37-25 °C. We found that TRPC5 is present in mouse and human sensory neurons of dorsal root ganglia, a substantial number of peripheral nerves including intraepithelial endings, and in the dorsal lamina of the spinal cord that receives sensory input from the skin, consistent with a potential TRPC5 function as an innocuous cold transducer in nociceptive and thermosensory nerve endings. Although deletion of TRPC5 in 129S1/SvImJ mice resulted in no temperature-sensitive behavioral changes, TRPM8 and/or other menthol-sensitive channels appear to underpin a much larger component of noxious cold sensing after TRPC5 deletion and a shift in mechanosensitive C-fiber subtypes. These findings demonstrate that highly cold-sensitive TRPC5 channels are a molecular component for detection and regional adaptation to cold temperatures in the peripheral nervous system that is distinct from noxious cold sensing.
Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.
Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab
2017-09-01
Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.
Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.
Energy Technology Data Exchange (ETDEWEB)
Linebarger, John Michael; Maffitt, S. Louise (New Mexico Institute of Mining and Technology, Albuquerque, NM); Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy
2011-10-01
Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.
Test result of 5 GHz, 500 kW CW prototype klystron for KSTAR LHCD system
Energy Technology Data Exchange (ETDEWEB)
Do, H., E-mail: heejindo@nfri.re.kr [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Park, S. [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Jeong, J.H.; Bae, Y.S.; Yang, H.L. [National Fusion Research Institute, Daejeon 350-333 (Korea, Republic of); Delpech, L.; Magne, R.; Hoang, G.T. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Park, H.; Cho, M.H.; Namkung, W. [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of)
2011-10-15
A 5 GHz LHCD system is being designed for current drive and profile modification necessary for AT mode and steady-state operation of the KSTAR tokamak. A prototype 500 kW CW klystron operating at 5 GHz was developed for the steady-state RF source. In this klystron, a multi-cell cavity is introduced to reduce cavity voltage and ohmic power loss. The klystron is designed with a triode system for optimization of gain, efficiency and beam control. The high voltage for the cathode is turned by using a thyristor switching system at the low voltage transformer unit. For anode voltage control, a mod-anode voltage divider system is used which utilize the parallel-circuit of the FET switch and Zener diodes. The RF output power of the klystron was 300 kW for 800 s and 450 kW for 20 s. The maximal temperature at collector top surface was 83 deg. C and power loss at the tube body did not exceed 10 kW, the interlock level for the protection of the klystron. Detailed results of the klystron system test and commissioning are presented.
ŽAMPA’S SYSTEMS THEORY: A COMPREHENSIVE THEORY OF MEASUREMENT IN DYNAMIC SYSTEMS
Directory of Open Access Journals (Sweden)
Renata Rychtáriková
2018-04-01
Full Text Available The article outlines in memoriam Prof. Pavel Žampa’s concepts of system theory which enable us to devise a measurement in dynamic systems independently of the particular system behaviour. From the point of view of Žampa’s theory, terms like system time, system attributes, system link, system element, input, output, sub-systems, and state variables are defined. In Conclusions, Žampa’s theory is discussed together with another mathematical approaches of qualitative dynamics known since the 19th century. In Appendices, we present applications of Žampa’s technical approach to measurement of complex dynamical (chemical and biological systems at the Institute of Complex Systems, University of South Bohemia in České Budějovice.
Energy Technology Data Exchange (ETDEWEB)
Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)
2011-02-10
The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.
Adaptation of the S-5-S Pendulím Seismometer for Measurement of Rotational Ground Motion
Czech Academy of Sciences Publication Activity Database
Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk
2012-01-01
Roč. 16, č. 4 (2012), s. 649-656 ISSN 1383-4649 Institutional support: RVO:68145535 Keywords : rotation al ground motion * experimental measurement * mining induced seismicity * S-5-S seismometer Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.388, year: 2012 http://link.springer.com/article/10.1007%2Fs10950-012-9279-6
Electrochemical behavior of 45S5 bioactive ceramic coating on Ti6Al4V alloy for dental applications
Machado López, M. M.; Espitia Cabrera, M. I.; Faure, J.; Contreras García, M. E.
2016-04-01
Titanium and its alloys are widely used as implant materials because of their mechanical properties and non-toxic behavior. Unfortunately, they are not bioinert, which means that they can release ions and can only fix the bone by mechanical anchorage, this can lead to the encapsulation of dense fibrous tissue in the body. The bone fixation is required in clinical conditions treated by orthopedic and dental medicine. The proposal is to coat metallic implants with bioactive materials to establish good interfacial bonds between the metal substrate and bone by increasing bioactivity. Bioactive glasses, ceramics specifically 45 S5 Bioglass, have drawn attention as a serious functional biomaterial because osseointegration capacity. The EPD method of bioglass gel precursor was proposed in the present work as a new method to obtain 45S5/Ti6A14V for dental applications. The coatings, were thermally treated at 700 and 800°C and presented the 45 S5 bioglass characteristic phases showing morphology and uniformity with no defects, quantification percentages by EDS of Si, Ca, Na, P and O elements in the coating scratched powders, showed a good proportional relationship demonstrating the obtention of the 45S5 bioglass. The corrosion tests were carried out in Hank's solution. By Tafel extrapolation, Ti6Al4V alloy showed good corrosion resistance in Hank's solution media, by the formation of a passivation layer on the metal surface, however, in the system 45S5/Ti6Al4V there was an increase in the corrosion resistance; icon-, Ecorr and corrosion rate decreased, the mass loss and the rate of release of ions, were lower in this system than in the titanium alloy without coating.
Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.
Roa, Fernando; Guerra, Marcelo
2015-01-01
5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Garcia Sònia
2012-06-01
Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.
Space shuttle/food system study. Package feasibility study, modifications 3S, 4C and 5S
1974-01-01
An optimum feeding system for the space shuttle was presented. This system consisted of all rehydratable type foods which were enclosed in a 4 in. x 4 in. x 1 in. flexible package. A feasibility follow-on study was conducted, and two acceptable, feasible prototypes for this package are described.
Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.
Energy Technology Data Exchange (ETDEWEB)
Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael
2011-08-01
Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.
Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe
2018-04-30
The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.
A Congruence Theorem for Minimal Surfaces in $S^{5}$ with Constant Contact Angle
Montes, Rodrigo Ristow; Verderesi, Jose A.
2006-01-01
We provide a congruence theorem for minimal surfaces in $S^5$ with constant contact angle using Gauss-Codazzi-Ricci equations. More precisely, we prove that Gauss-Codazzi-Ricci equations for minimal surfaces in $S^5$ with constant contact angle satisfy an equation for the Laplacian of the holomorphic angle. Also, we will give a characterization of flat minimal surfaces in $S^5$ with constant contact angle.
Analysis of glow curve of GaS{sub 0.5}Se{sub 0.5} single crystals
Energy Technology Data Exchange (ETDEWEB)
Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Delice, Serdar [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)
2015-12-15
Characterization of shallow trapping centers in GaS{sub 0.5}Se{sub 0.5} crystals grown by a Bridgman method was carried out in the present work using thermoluminescence (TL) measurements performed in the low temperature range of 10–300 K. The activation energies of the trapping centers were obtained under the light of results of various analysis methods. The presence of three trapping centers located at 6, 30 and 72 meV was revealed. The analysis of the experimental glow curve gave reasonable results under the model that assumes slow retrapping which states the order of kinetics as b=1. Heating rate dependence of the observed TL peaks was studied for the rates between 0.4 and 1.0 K/s. Distribution of the traps was also investigated using an experimental technique based on the thermal cleaning of centers giving emission at lower temperatures. The distributed levels with activation energies increasing from 6 to 136 meV were revealed by increasing the stopping temperature from 10 to 52 K. - Highlights: • TL measurements were performed in the 10–300 K range on GaS{sub 0.5}Se{sub 0.5} crystals. • Atomic composition ratio of the elements was found. • Three trapping centers located at 6, 30 and 72 meV were revealed. • Distribution of trapping centers was studied on as-grown crystal.
Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs
International Nuclear Information System (INIS)
Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.
1986-01-01
5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)
International Nuclear Information System (INIS)
Oesterberg, R.; Garrett, A.
1977-01-01
The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Expert systems: A 5-year perspective
International Nuclear Information System (INIS)
MacAllister, D.J.; Day, R.; McCormack, M.D.
1996-01-01
This paper gives an overview of a major integrated oil company's experience with artificial intelligence (AI) over the last 5 years, with an emphasis on expert systems. The authors chronicle the development of an AI group, including details on development tool selection, project selection strategies, potential pitfalls, and descriptions of several completed expert systems. Small expert systems produced by teams of petroleum technology experts and experienced expert system developers that are focused in well-defined technical areas have produced substantial benefits and accelerated petroleum technology transfer
Cloning and characterization of cDNA encoding xyloglucan ...
African Journals Online (AJOL)
Jane
2011-08-22
Aug 22, 2011 ... plays important role in growth and development of plants. XETs are a family of enzymes .... cloned into pGEM-T Easy vector (Promega Corporation, WI, USA). The recombinant ..... wall modification in the poaceae. Protein Sci.
Adaptive Antenna System for Both 4G LTE and 5G Cellular Systems
Henderson, Kendrick Q. T.
Given the steep increase in the use of mobile communication systems, the current 4G/LTE (Long Term Evolution), cellular system will not be able to handle the increase in data. It is estimated that by 2020 the bandwidth requirements will be 10 times greater than what LTE can sustain. A new 5th generation (5G) communication system has been proposed to meet this demand. The physical layer or the antenna is the most critical part of any wireless communication systems as it is the interface between the free space medium and an electrical circuit. It sets the margin for almost all design parameters in the system such as the system noise and bandwidth. Several interactions of antennas have been proposed over the years for cellular services. These antennas are of various geometries, bandwidths, and radiation patterns with almost all having linear polarization. This thesis attempts to solve the multiple LTE antenna problem by creating a simple antenna that covers most of the LTE bands (850-2700 MHz) as well as introducing an antenna system at the 28 GHz 5G band. This allows for a greater educated hypothesis into what 5G can offer at the physical layer. The proposed concept will provide a solution to the co-existence problem of upcoming 5G wireless systems to be interoperable with existing 4G/LTE system.
How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?
International Nuclear Information System (INIS)
Pelczar, P.; Fiett, J.; Bartnik, E.
1994-01-01
We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig
Shock wave collisions and thermalization in AdS5
International Nuclear Information System (INIS)
Kovchegov, Yuri V.
2011-01-01
We study heavy ion collisions at strong 't Hooft coupling using AdS/CFT correspondence. According to the AdS/CFT dictionary heavy ion collisions correspond to gravitational shock wave collisions in AdS 5 . We construct the metric in the forward light cone after the collision perturbatively through expansion of Einstein equations in graviton exchanges. We obtain an analytic expression for the metric including all-order graviton exchanges with one shock wave, while keeping the exchanges with another shock wave at the lowest order. We read off the corresponding energy-momentum tensor of the produced medium. Unfortunately this energy-momentum tensor does not correspond to ideal hydrodynamics, indicating that higher order graviton exchanges are needed to construct the full solution of the problem. We also show that shock waves must completely stop almost immediately after the collision in AdS 5 , which, on the field theory side, corresponds to complete nuclear stopping due to strong coupling effects, likely leading to Landau hydrodynamics. Finally, we perform trapped surface analysis of the shock wave collisions demonstrating that a bulk black hole, corresponding to ideal hydrodynamics on the boundary, has to be created in such collisions, thus constructing a proof of thermalization in heavy ion collisions at strong coupling. (author)
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
The account system for students school‘s attendance
Birgėlienė, Raminta
2007-01-01
SUMMARY The account system for students school‘s attendance The purpose of the created students school‘s attendance account system is to assist teachers in registering, observing and making reports on students school‘s attendance. This work presents the of secondary school students���result attendance account transferred to the informatics system. The system includes the analysis, separable processes, adjustable structured analysis and projections‘methods, which allow dealing with a real prob...
Expression of the innate defense receptor S5D-SRCRB in the urogenital tract
DEFF Research Database (Denmark)
Miro-Julia, C.; Escoda-Ferran, C.; Carrasco, E.
2014-01-01
S5D-SRCRB is a novel mouse secretory glycoprotein belonging to the ancient and highly conserved scavenger receptor cysteine-rich superfamily of protein receptors. Available evidence indicates that S5D-SRCRB interacts with conserved microbial cell wall components, as well as with some endogenous...... proteins, and presents a restricted tissue expression pattern. This study further analyzes the expression of S5D-SRCRB along the mouse urogenital tract. Immunohistochemical staining for S5D-SRCRB was observed in spermatocytes from seminiferous tubules and in the epithelial surface from urethra and bladder......-SRCRB was observed in the apical border of terminally differentiated IC. Colocalization of S5D-SRCRB with galectin-3 (Gal-3) was also observed in kidney and bladder, but not in testis, supporting concurrent biochemical studies demonstrating the carbohydrate-dependent interaction of Gal-3 and S5D-SRCRB. Furthermore...
U.S.-China trade growth and America’s transportation system
2008-04-01
The growth in U.S.- China trade over the last two decades has impacted the U.S. transportation system by increasing traffic at air cargo hubs and seaports. The highway and rail infrastructure that supports the movement of cargo to and from these faci...
System Simulation of Nuclear Power Plant by Coupling RELAP5 and Matlab/Simulink
International Nuclear Information System (INIS)
Meng Lin; Dong Hou; Zhihong Xu; Yanhua Yang; Ronghua Zhang
2006-01-01
Since RELAP5 code has general and advanced features in thermal-hydraulic computation, it has been widely used in transient and accident safety analysis, experiment planning analysis, and system simulation, etc. So we wish to design, analyze, verify a new Instrumentation And Control (I and C) system of Nuclear Power Plant (NPP) based on the best-estimated code, and even develop our engineering simulator. But because of limited function of simulating control and protection system in RELAP5, it is necessary to expand the function for high efficient, accurate, flexible design and simulation of I and C system. Matlab/Simulink, a scientific computation software, just can compensate the limitation, which is a powerful tool in research and simulation of plant process control. The software is selected as I and C part to be coupled with RELAP5 code to realize system simulation of NPPs. There are two key techniques to be solved. One is the dynamic data exchange, by which Matlab/Simulink receives plant parameters and returns control results. Database is used to communicate the two codes. Accordingly, Dynamic Link Library (DLL) is applied to link database in RELAP5, while DLL and S-Function is applied in Matlab/Simulink. The other problem is synchronization between the two codes for ensuring consistency in global simulation time. Because Matlab/Simulink always computes faster than RELAP5, the simulation time is sent by RELAP5 and received by Matlab/Simulink. A time control subroutine is added into the simulation procedure of Matlab/Simulink to control its simulation advancement. Through these ways, Matlab/Simulink is dynamically coupled with RELAP5. Thus, in Matlab/Simulink, we can freely design control and protection logic of NPPs and test it with best-estimated plant model feedback. A test will be shown to illuminate that results of coupling calculation are nearly the same with one of single RELAP5 with control logic. In practice, a real Pressurized Water Reactor (PWR) is
Performance Evaluation of an Enhanced Uplink 3.5G System for Mobile Healthcare Applications
Directory of Open Access Journals (Sweden)
Dimitris Komnakos
2008-01-01
Full Text Available The present paper studies the prospective and the performance of a forthcoming high-speed third generation (3.5G networking technology, called enhanced uplink, for delivering mobile health (m-health applications. The performance of 3.5G networks is a critical factor for successful development of m-health services perceived by end users. In this paper, we propose a methodology for performance assessment based on the joint uplink transmission of voice, real-time video, biological data (such as electrocardiogram, vital signals, and heart sounds, and healthcare records file transfer. Various scenarios were concerned in terms of real-time, nonreal-time, and emergency applications in random locations, where no other system but 3.5G is available. The accomplishment of quality of service (QoS was explored through a step-by-step improvement of enhanced uplink system's parameters, attributing the network system for the best performance in the context of the desired m-health services.
Performance Evaluation of an Enhanced Uplink 3.5G System for Mobile Healthcare Applications.
Komnakos, Dimitris; Vouyioukas, Demosthenes; Maglogiannis, Ilias; Constantinou, Philip
2008-01-01
The present paper studies the prospective and the performance of a forthcoming high-speed third generation (3.5G) networking technology, called enhanced uplink, for delivering mobile health (m-health) applications. The performance of 3.5G networks is a critical factor for successful development of m-health services perceived by end users. In this paper, we propose a methodology for performance assessment based on the joint uplink transmission of voice, real-time video, biological data (such as electrocardiogram, vital signals, and heart sounds), and healthcare records file transfer. Various scenarios were concerned in terms of real-time, nonreal-time, and emergency applications in random locations, where no other system but 3.5G is available. The accomplishment of quality of service (QoS) was explored through a step-by-step improvement of enhanced uplink system's parameters, attributing the network system for the best performance in the context of the desired m-health services.
International Nuclear Information System (INIS)
Hagedorn, Claudia; King, Stephen F.; Luhn, Christoph
2012-01-01
Following the recent results from Daya Bay and RENO, which measure the lepton mixing angle θ 13 l ≈0.15, we revisit a supersymmetric (SUSY) S 4 ×SU(5) model, which predicts tri-bimaximal (TB) mixing in the neutrino sector with θ 13 l being too small in its original version. We show that introducing one additional S 4 singlet flavon into the model gives rise to a sizable θ 13 l via an operator which leads to the breaking of one of the two Z 2 symmetries preserved in the neutrino sector at leading order (LO). The results of the original model for fermion masses, quark mixing and the solar mixing angle are maintained to good precision. The atmospheric and solar mixing angle deviations from TB mixing are subject to simple sum rule bounds.
Isolating silkworm genomic DNA without liquid nitrogen suitable for ...
African Journals Online (AJOL)
Administrator
2011-09-21
Sep 21, 2011 ... *DNA diluted a thousand times to measure OD. silkworms are raised .... using gel extraction kit (Hi Media) and cloned into pGEMT easy vector (Promega) ..... Laboratory Press, Cold Spring Harbor, New York. Sharma J, Yadav ...
TRANSIENT EXPRESSION OF β-GLUCURONIDASE IN ...
African Journals Online (AJOL)
ACSS
2014-08-28
Aug 28, 2014 ... times. The vines were then each cut into one or two nodes and established on sweetpotato ... following antibiotics were added after the media .... plasmid extraction kit provided by Promega. A ..... New York Inc., USA. Kreuze ...
Structure of Staphylococcus aureus 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase
International Nuclear Information System (INIS)
Siu, Karen K. W.; Lee, Jeffrey E.; Smith, G. David; Horvatin-Mrakovcic, Cathy; Howell, P. Lynne
2008-01-01
The crystal structure of S. aureus 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase has been determined at 1.7 Å resolution in complex with formycin A. 5′-Methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) catalyzes the irreversible cleavage of the glycosidic bond in 5′-methylthioadenosine (MTA) and S-adenosylhomocysteine (SAH) and plays a key role in four metabolic processes: biological methylation, polyamine biosynthesis, methionine recycling and bacterial quorum sensing. The absence of the nucleosidase in mammalian species has implicated this enzyme as a target for antimicrobial drug design. MTAN from the pathogenic bacterium Staphylococcus aureus (SaMTAN) has been kinetically characterized and its structure has been determined in complex with the transition-state analogue formycin A (FMA) at 1.7 Å resolution. A comparison of the SaMTAN–FMA complex with available Escherichia coli MTAN structures shows strong conservation of the overall structure and in particular of the active site. The presence of an extra water molecule, which forms a hydrogen bond to the O4′ atom of formycin A in the active site of SaMTAN, produces electron withdrawal from the ribosyl group and may explain the lower catalytic efficiency that SaMTAN exhibits when metabolizing MTA and SAH relative to the E. coli enzyme. The implications of this structure for broad-based antibiotic design are discussed
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Distraction manipulation reduction of an L5-S1 disk herniation.
Cox, J M; Hazen, L J; Mungovan, M
1993-06-01
A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.
Ceyhanli, K T; Kamaci, A; Taner, M; Erdilek, N; Celik, D
2015-01-01
The aim of this study was to evaluate the shaping effects of two M-wire and two traditional nickel-titanium (NiTi) rotary systems in simulated S-shaped resin canals. Forty simulated S-shaped canals in resin blocks were instrumented with two traditional (ProTaper, Sendoline S5) and two M-wire (WaveOne, GT series X) NiTi systems according to the manufacturers' instructions. Ten resin blocks were used for each system. Pre- and post-instrumentation images were captured using a stereomicroscope and superimposed with an image program. Canal transportation, material removal, and aberrations were evaluated and recorded as numeric parameters. Data were analyzed using one-way ANOVA and post-hoc Tukey tests with a 95% confidence interval. There were significant differences between systems in terms of transportation and material removal (Pwire or traditional NiTi) and kinematics (rotary or reciprocating motion) did not affect the shaping abilities of the systems. The extended file designs of highly tapered NiTi systems (ProTaper, WaveOne) resulted in greater deviations from the original root canal trace and more material removal when compared to less tapered systems (Sendoline S5, GT series X).
National Ignition Facility sub-system design requirements computer system SSDR 1.5.1
International Nuclear Information System (INIS)
Spann, J.; VanArsdall, P.; Bliss, E.
1996-01-01
This System Design Requirement document establishes the performance, design, development and test requirements for the Computer System, WBS 1.5.1 which is part of the NIF Integrated Computer Control System (ICCS). This document responds directly to the requirements detailed in ICCS (WBS 1.5) which is the document directly above
Integrable systems from membranes on AdS4 x S7
International Nuclear Information System (INIS)
Bozhilov, P.
2008-01-01
We describe how Neumann and Neumann-Rosochatius type integrable systems, as well as the continuous limit of the SU(2) integrable spin chain, can be obtained from membranes on AdS 4 x S 7 background, in the framework of AdS/CFT correspondence. (Abstract Copyright [2008], Wiley Periodicals, Inc.)
Mixed-symmetry fields in AdS(5), conformal fields, and AdS/CFT
Energy Technology Data Exchange (ETDEWEB)
Metsaev, R.R. [Department of Theoretical Physics, P.N. Lebedev Physical Institute,Leninsky prospect 53, Moscow 119991 (Russian Federation)
2015-01-15
Mixed-symmetry arbitrary spin massive, massless, and self-dual massive fields in AdS(5) are studied. Light-cone gauge actions for such fields leading to decoupled equations of motion are constructed. Light-cone gauge formulation of mixed-symmetry anomalous conformal currents and shadows in 4d flat space is also developed. AdS/CFT correspondence for normalizable and non-normalizable modes of mixed-symmetry AdS fields and the respective boundary mixed-symmetry anomalous conformal currents and shadows is studied. We demonstrate that the light-cone gauge action for massive mixed-symmetry AdS field evaluated on solution of the Dirichlet problem amounts to the light-cone gauge 2-point vertex of mixed-symmetry anomalous shadow. Also we show that UV divergence of the action for mixed-symmetry massive AdS field with some particular value of mass parameter evaluated on the Dirichlet problem amounts to the action of long mixed-symmetry conformal field, while UV divergence of the action for mixed-symmetry massless AdS field evaluated on the Dirichlet problem amounts to the action of short mixed-symmetry conformal field. We speculate on string theory interpretation of a model which involves short low-spin conformal fields and long higher-spin conformal fields.
CERN’s Computing rules updated to include policy for control systems
IT Department
2008-01-01
The use of CERN’s computing facilities is governed by rules defined in Operational Circular No. 5 and its subsidiary rules of use. These rules are available from the web site http://cern.ch/ComputingRules. Please note that the subsidiary rules for Internet/Network use have been updated to include a requirement that control systems comply with the CNIC(Computing and Network Infrastructure for Control) Security Policy. The security policy for control systems, which was approved earlier this year, can be accessed at https://edms.cern.ch/document/584092 IT Department
Directory of Open Access Journals (Sweden)
Juliano S. Cabral
2006-01-01
Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.
Coat protein sequence shows that Cucumber mosaic virus isolate ...
Indian Academy of Sciences (India)
Madhu
A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the .... DNA was cloned in p-GEM Teasy vector (Promega, USA) as per the ... M. persicae and A. gossypii transmitted the virus in non persistent manner ...
Synthesis of ZSM-5 and Co-ZSM-5 starting from inorganic systems
International Nuclear Information System (INIS)
Zapata N, Mauren; Montes Consuelo; Villa Aida Luz
1995-01-01
ZSM-5 was obtained in a completely inorganic system. Besides, several experiments were carried out to introduce Co+2 in the Framework of inorganic ZSM-5. The addition of a cobalt source to the precursor gel increased the time to obtain ZSM-5 crystals compared to the gel without a cobalt source. Furthermore, thermal stability over 500 was lower in Co-ZSM-5. Chemical analysis suggests that some cobalt was in the channels, since it was removed by ion exchange
High Temperature NMR Studies of the Glass-Crystal Transition in the Cs2S2O7-V2O5 System
DEFF Research Database (Denmark)
Lapina, Olga B.; Terskikh, Viktor V.; Shubin, Aleksander A.
1997-01-01
133Cs and 51V NMR spectra have been recorded of Cs2S2O7 and the catalytically important Cs2S2O7-V2O5 mixtures in the temperature range 20 - 550 C. A high mobility of Cs+ in the solid Cs2S2O7 was observed. The transformation from glassy state to crystalline state was investigated for the compositi...
Xiao, Yinglong; Li, Deng; Chen, Lei; Xu, Yaoting; Zhang, Dingguo; Shao, Yi; Lu, Jun
2017-11-21
To establish and internally validate an innovative R.I.R.S. scoring system that allows urologists to preoperatively estimate the stone-free rate (SFR) after retrograde intrarenal surgery (RIRS). This study included 382 eligible samples from a total 573 patients who underwent RIRS from January 2014 to December 2016. Four reproducible factors in the R.I.R.S. scoring system, including renal stone density, inferior pole stone, renal infundibular length and stone burden, were measured based on preoperative computed tomography of urography to evaluate the possibility of stone clearance after RIRS. The median cumulative diameter of the stones was 14 mm, and the interquartile range was 10 to 21. The SFR on postoperative day 1 in the present cohort was 61.5% (235 of 382), and the final SFR after 1 month was 73.6% (281 of 382). We established an innovative scoring system to evaluate SFR after RIRS using four preoperative characteristics. The range of the R.I.R.S. scoring system was 4 to 10. The overall score showed a great significance of stone-free status (p R.I.R.S. scoring system was 0.904. The R.I.R.S. scoring system is associated with SFR after RIRS. This innovative scoring system can preoperatively assess treatment success after intrarenal surgery and can be used for preoperative surgical arrangement and comparisons of outcomes among different centers and within a center over time.
Zitterbewegung in Bogoliubov's System
International Nuclear Information System (INIS)
Li Yan; Su Hong-Yi; Chen Jing-Ling; Zhang Fu-Lin; Wu Chun-Feng; Leong-Chuan Kwek
2015-01-01
We show that Bogoliubov's quasiparticle in superfluid 3 He-B undergoes the Zitterbewegung, as a free relativistic Dirac's electron does. The expectation value of position, as well as spin, of the quasiparticle is obtained and compared with that of the Dirac's electron. In particular, the Zitterbewegung of Bogoliubov's quasiparticle has a frequency approximately 10 5 lower than that of an electron, rendering a more promising experimental observation. (general)
N-[(2S-4-Chloro-2-(l-menthyloxy-5-oxo-2,5-dihydro-3-furyl]-l-alanine
Directory of Open Access Journals (Sweden)
Kai Yang
2009-05-01
Full Text Available The title compound, C17H26ClNO5, was prepared via a tandem asymmetric Michael addition–elimination reaction of (5S-3,4-dichloro-5-(l-menthyloxyfuran-2(5H-one and l-alanine in the presence of potassium hydroxide. The five-membered furanone ring is approximately planar while the six-membered menthyloxy ring adopts a chair conformation. The crystal packing is stabilized by intermolecular O—H...O and N—H...O hydrogen bonds.
Directory of Open Access Journals (Sweden)
Hamidreza Karkehabadi
2013-06-01
Full Text Available Productivity improvement plays essential role on cost reduction and production planning in many organizations. There are literally various methods for measuring productivity and improving systems’ capabilities such as total quality management, 5S, etc. In this paper, we perform an empirical investigation to find out whether implementing 5S could reduce interruptions in production systems in one of pipe and profile manufacturing units located in province of Semnan, Iran. The proposed study compares the mean and standard deviations of waste materials before and after the implementation of 5-S in three different lines and statistical tests indicate that 5-S have made the necessary change on production planning and it could reduce waste materials, significantly.
International Nuclear Information System (INIS)
Dobranich, D.
1985-11-01
The TRAC-PF1/MOD1 independent assessment project at Sandia is part of an overall effort funded by the NRC to determine the ability of various systems codes to predict the detailed thermal/hydraulic response of LWRs during accident and off-normal conditions. As part of this effort, calculations for Semiscale Mod-2A test S-SF-3, a feedwater-line break test, and S-SF-5, a steam-line break test, were performed with TRAC-PF1/MOD1. Most aspects of both the S-SF-3 and S-SF-5 steady-state calculations were found to be in good agreement with data. However, the need for a better steam separator model was identified from the S-SF-3 calculation. Overall, the qualitative behavior of both transients was calculated reasonably well; however, there were some discrepancies in the prediction of the quantitative behavior. The results for the S-SF-3 transient calculation indicate that the primary-to-secondary heat transfer degradation began too early. This was possibly due to overprediction of entrainment in the steam generator boiler, leading to an incorrect calculation of the secondary-side fluid distribution during the steady state. However, there was insufficient data to verify this. Results for the S-SF-5 transient calculation indicate that the primary-side fluid temperature response to a steam-line break was in reasonable agreement with data but the pressure response did not coincide with the data. Uncertainties in the data are sufficient to prevent us from determining the exact cause of this discrepancy, but there is indirect evidence that the calculated rate of phase change in the pressurizer was incorrect. 16 refs., 73 figs., 13 tabs
Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.
Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz
2014-12-16
5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chen, Ming; He, Jing; Tang, Jin; Wu, Xian; Chen, Lin
2014-07-28
In this paper, a FPGAs-based real-time adaptively modulated 256/64/16QAM-encoded base-band OFDM transceiver with a high spectral efficiency up to 5.76bit/s/Hz is successfully developed, and experimentally demonstrated in a simple intensity-modulated direct-detection optical communication system. Experimental results show that it is feasible to transmit a raw signal bit rate of 7.19Gbps adaptively modulated real-time optical OFDM signal over 20km and 50km single mode fibers (SMFs). The performance comparison between real-time and off-line digital signal processing is performed, and the results show that there is a negligible power penalty. In addition, to obtain the best transmission performance, direct-current (DC) bias voltage for MZM and launch power into optical fiber links are explored in the real-time optical OFDM systems.
Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei
2016-06-01
The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.
Computing Optical Variable Periods of BL Lac Object S5 0716+714 ...
Indian Academy of Sciences (India)
2016-01-27
Jan 27, 2016 ... From a large volume of literature, we have collected effective observation of BL Lac object S5 0716+714 in the optical band, and constructed its long-term light curve from 1994 to 2006 AD. The light curve shows that S5 0716+714 is very active and exhibits very complicated non-sinusoidal variations.
MCNP5 CRITICALITY VALIDATION AND BIAS FOR INTERMEDIATE ENRICHED URANIUM SYSTEMS
International Nuclear Information System (INIS)
Finfrock, S.H.
2009-01-01
The purpose of this analysis is to validate the Monte Carlo N-Particle 5 (MCNP5) code Version 1.40 (LA-UR-03-1987, 2005) and its cross-section database for k-code calculations of intermediate enriched uranium systems on INTEL(reg s ign) processor based PC's running any version of the WINDOWS operating system. Configurations with intermediate enriched uranium were modeled with the moderator range of 39 (le) H/Fissile (le) 1438. See Table 2-1 for brief descriptions of selected cases and Table 3-1 for the range of applicability for this validation. A total of 167 input cases were evaluated including bare and reflected systems in a single body or arrays. The 167 cases were taken directly from the previous (Version 4C [Lan 2005]) validation database. Section 2.0 list data used to calculate k-effective (k eff ) for the 167 experimental criticality benchmark cases using the MCNP5 code v1.40 and its cross section database. Appendix B lists the MCNP cross-section database entries validated for use in evaluating the intermediate enriched uranium systems for criticality safety. The dimensions and atom densities for the intermediate enriched uranium experiments were taken from NEA/NSC/DOC(95)03, September 2005, which will be referred to as the benchmark handbook throughout the report. For these input values, the experimental benchmark k eff is approximately 1.0. The MCNP validation computer runs ran to an accuracy of approximately ± 0.001. For the cases where the reported benchmark k eff was not equal to 1.0000 the MCNP calculational results were normalized. The difference between the MCNP validation computer runs and the experimentally measured k eff is the MCNP5 v1.40 bias. The USLSTATS code (ORNL 1998) was utilized to perform the statistical analysis and generate an acceptable maximum k eff limit for calculations of the intermediate enriched uranium type systems.
Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Garrett, R A
1981-01-01
The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....
5-Gb/s 0.18-{mu}m CMOS 2:1 multiplexer with integrated clock extraction
Energy Technology Data Exchange (ETDEWEB)
Zhang Changchun; Wang Zhigong; Shi Si; Miao Peng [Institute of RF- and OE-ICs, Southeast University, Nanjing 210096 (China); Tian Ling, E-mail: zgwang@seu.edu.c [School of Science and Engineering, Southeast University, Nanjing 210096 (China)
2009-09-15
A 5-Gb/s 2:1 MUX (multiplexer) with an on-chip integrated clock extraction circuit which possesses the function of automatic phase alignment (APA), has been designed and fabricated in SMIC's 0.18 {mu}m CMOS technology. The chip area is 670 x 780 {mu}m{sup 2}. At a single supply voltage of 1.8 V, the total power consumption is 112 mW with an input sensitivity of less than 50 mV and an output single-ended swing of above 300 mV. The measurement results show that the IC can work reliably at any input data rate between 1.8 and 2.6 Gb/s with no need for external components, reference clock, or phase alignment between data and clock. It can be used in a parallel optic-fiber data interconnecting system.
Directory of Open Access Journals (Sweden)
Raffaele Scala
2015-01-01
Full Text Available Amyloidosis may involve the respiratory system with different clinical-radiological-functional patterns which are not always easy to be recognized. A good level of knowledge of the disease, an active integration of the pulmonologist within a multidisciplinary setting and a high level of clinical suspicion are necessary for an early diagnosis of respiratory amyloidosis. The aim of this retrospective study was to evaluate the number and the patterns of amyloidosis involving the respiratory system. We searched the cases of amyloidosis among patients attending the multidisciplinary rare and diffuse lung disease outpatients′ clinic of Pulmonology Unit of the Hospital of Arezzo from 2007 to 2012. Among the 298 patients evaluated during the study period, we identified three cases of amyloidosis with involvement of the respiratory system, associated or not with other extra-thoracic localizations, whose diagnosis was histo-pathologically confirmed after the pulmonologist, the radiologist, and the pathologist evaluation. Our experience of a multidisciplinary team confirms that intra-thoracic amyloidosis is an uncommon disorder, representing 1.0% of the cases of rare and diffuse lung diseases referred to our center. The diagnosis of the disease is not always easy and quick as the amyloidosis may involve different parts of the respiratory system (airways, pleura, parenchyma. It is therefore recommended to remind this orphan disease in the differential diagnosis of the wide clinical scenarios the pulmonologist may intercept in clinical practice.
Nanostructured Titanium-10 wt% 45S5 Bioglass-Ag Composite Foams for Medical Applications
Directory of Open Access Journals (Sweden)
Karolina Jurczyk
2015-03-01
Full Text Available The article presents an investigation on the effectiveness of nanostructured titanium-10 wt% 45S5 Bioglass-1 wt% Ag composite foams as a novel class of antibacterial materials for medical applications. The Ti-based composite foams were prepared by the combination of mechanical alloying and a “space-holder” sintering process. In the first step, the Ti-10 wt% 45S5 Bioglass-1 wt% Ag powder synthesized by mechanical alloying and annealing mixed with 1.0 mm diameter of saccharose crystals was finally compacted in the form of pellets. In the next step, the saccharose crystals were dissolved in water, leaving open spaces surrounded by metallic-bioceramic scaffold. The sintering of the scaffold leads to foam formation. It was found that 1:1 Ti-10 wt% 45S5 Bioglass-1 wt% Ag/sugar ratio leads to porosities of about 70% with pore diameter of about 0.3–1.1 mm. The microstructure, corrosion resistance in Ringer’s solution of the produced foams were investigated. The value of the compression strength for the Ti-10 wt% 45S5 Bioglass-1 wt% Ag foam with 70% porosity was 1.5 MPa and the Young’s modulus was 34 MPa. Silver modified Ti-10 wt% 45S5 Bioglass composites possess excellent antibacterial activities against Staphylococcus aureus. Porous Ti-10 wt% 45S5 Bioglass-1 wt% foam could be a possible candidate for medical implants applications.
Tucker, Valerie C; Kirkham, Amanda J; Hopwood, Andrew J
2012-05-01
We describe the forensic validation of Promega's PowerPlex® European Standard Investigator 16 (ESI 16) multiplex kit and compare results generated with the AmpFlSTR® SGM Plus® (SGM+) multiplex. ESI 16 combines the loci contained within the SGM+ multiplex with five additional loci: D2S441, D10S1248, D22S1045, D1S1656, and D12S391. A relative reduction in amplicon size of the SGM+ loci facilitates an increased robustness and amplification success of these amplicons with degraded DNA samples. Tests performed herein supplement ESI 16 data published previously with sensitivity, profile quality, mock casework, inhibitor and mixture study data collected in our laboratories in alignment with our internal technical and quality guidelines and those issued by the Scientific Working Group on DNA Analysis Methods (SWGDAM), the DNA Advisory Board (DAB) and the DNA working group (DNAWG) of the European Network of Forensic Science Institutes (ENFSI). Full profiles were routinely generated from a fully heterozygous single source DNA template using 62.5 pg for ESI 16 and 500 pg for SGM+. This increase in sensitivity has a consequent effect on mixture analyses and the detection of minor mixture components. The improved PCR chemistry confers enhanced tolerance to high levels of laboratory prepared inhibitors compared with SGM+ results. In summary, our results demonstrate that the ESI 16 multiplex kit is more robust and sensitive compared with SGM+ and will be a suitable replacement system for the analysis of forensic DNA samples providing compliance with the European standard set of STR loci.
HAL/S-FC compiler system specifications
1976-01-01
This document specifies the informational interfaces within the HAL/S-FC compiler, and between the compiler and the external environment. This Compiler System Specification is for the HAL/S-FC compiler and its associated run time facilities which implement the full HAL/S language. The HAL/S-FC compiler is designed to operate stand-alone on any compatible IBM 360/370 computer and within the Software Development Laboratory (SDL) at NASA/JSC, Houston, Texas.
The equilibrium diagram and some properties of alloys Gd5Sb3-Tb5Sb3 system
International Nuclear Information System (INIS)
Azizov, Yu.S.; Abulkhaev, V.D.; Ganiev, I.N.
2001-01-01
The purpose of present work is investigation equilibrium diagram of Gd 5 Sb 3 -Tb 5 Sb 3 system in total range of concentrations. Equilibrium diagram of Gd 5 Sb 3 -Tb 5 Sb 3 system investigated by methods of difference-thermal, roentgen-phase and metallographic analyses. For the first time on the base of difference-thermal, roentgen-phase and metallographic analyses was formed the equilibrium diagram of Gd 5 Sb 3 -Tb 5 Sb 3 system. Was determined the cristal-chemical parameters of solid solutions with general formula Gd x Tb 5 - x Sb 3
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
5'S implementation in warehouse and improving stock management using MRP
Silva, Pedro Miguel Menino
2016-01-01
A presente dissertação, intitulada “Implementação dos 5’S no armazém de peças e do MRP na gestão de stocks”, decorreu no âmbito do estágio curricular do 5º ano do Mestrado em Engenharia e Gestão Industrial da Universidade de Coimbra. O projeto, proposto pela Sociedade da Água de Luso (SAL), consiste na implementação da metodologia dos 5’S, no armazém de peças de apoio à manutenção das linhas de enchimento e, posteriormente, na implementação do Material Requirement Planning (MRP), na ajuda ...
Energy Technology Data Exchange (ETDEWEB)
Iyer, Abishek K. [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Yin, Wenlong [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Institute of Chemical Materials, China Academy of Engineering Physics, Mianyang 621900 (China); Lee, Emma J. [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada); Lin, Xinsong [Centre for Oil Sands Sustainability, Northern Alberta Institute of Technology, Edmonton, Alberta, Canada T6N 1E5 (Canada); Mar, Arthur, E-mail: arthur.mar@ualberta.ca [Department of Chemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2G2 (Canada)
2017-06-15
The two metal-deficient series of quaternary Ge-containing sulfides RE{sub 3}M{sub 0.5}GeS{sub 7} (RE = La–Nd, Sm; M = Co, Ni), as well as the related Si-containing sulfide Y{sub 3}Pd{sub 0.5}SiS{sub 7}, were prepared by reactions of the elements at 1050 °C. Single-crystal X-ray diffraction analysis performed on all compounds confirmed noncentrosymmetric hexagonal structures (space group P6{sub 3}, Z =2) with cell parameters in the ranges of a =10.0–10.3 Å and c =5.7–5.8 Å for RE{sub 3}Co{sub 0.5}GeS{sub 7} and RE{sub 3}Ni{sub 0.5}GeS{sub 7}, or a =9.7891(3) Å and c =5.6840(4) Å for Y{sub 3}Pd{sub 0.5}SiS{sub 7}. They are classified as La{sub 3}Mn{sub 0.5}SiS{sub 7}-type structures, with M atoms centred within octahedra (in contrast to La{sub 3}CuSiS{sub 7}-type structures in which M atoms occupy trigonal planar sites) and Ge atoms centred within tetrahedra, both types of polyhedra being arranged in one-dimensional stacks aligned along the c-direction. Charge balance requirements dictate half-occupancy of the M sites. However, bond valence sum arguments indicated that the M atoms are somewhat underbonded within these octahedral sites, so that there is evidence that in some compounds, they can also enter the trigonal planar site at low occupancy (~5%). Magnetic measurements on RE{sub 3}Co{sub 0.5}GeS{sub 7} (RE = Ce, Pr, Sm) revealed paramagnetic behaviour for the Ce and Pr members and apparent antiferromagnetic ordering (T{sub N} =14 K) for the Sm member; fitting to the Curie-Weiss law gave effective magnetic moments consistent with the presence of RE{sup 3+} and Co{sup 2+} species. Band structure calculations on ordered models of La{sub 3}M{sub 0.5}GeS{sub 7} (M = Co, Ni) showed that the Fermi level cuts through M 3d states in the DOS curve and supported the presence of strong M–S and Ge–S bonding interactions. - Graphical abstract: RE{sub 3}M{sub 0.5}GeS{sub 7} (M = Co, Ni) and Y{sub 3}Pd{sub 0.5}SiS{sub 7} contain M atoms partially occupying
Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.
Energy Technology Data Exchange (ETDEWEB)
Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy
2012-01-01
Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS
A critical role for noncoding 5S rRNA in regulating Mdmx stability.
Li, Muyang; Gu, Wei
2011-09-16
Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.
6 CFR 5.31 - Security of systems of records.
2010-01-01
... 6 Domestic Security 1 2010-01-01 2010-01-01 false Security of systems of records. 5.31 Section 5.31 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY DISCLOSURE OF RECORDS AND INFORMATION Privacy Act § 5.31 Security of systems of records. (a) In general. Each component...
Hybrid Intrusion Detection System for DDoS Attacks
Directory of Open Access Journals (Sweden)
Özge Cepheli
2016-01-01
Full Text Available Distributed denial-of-service (DDoS attacks are one of the major threats and possibly the hardest security problem for today’s Internet. In this paper we propose a hybrid detection system, referred to as hybrid intrusion detection system (H-IDS, for detection of DDoS attacks. Our proposed detection system makes use of both anomaly-based and signature-based detection methods separately but in an integrated fashion and combines the outcomes of both detectors to enhance the overall detection accuracy. We apply two distinct datasets to our proposed system in order to test the detection performance of H-IDS and conclude that the proposed hybrid system gives better results than the systems based on nonhybrid detection.
Experimental study and thermodynamic assessment of the ZrO2-DyO1.5 system
International Nuclear Information System (INIS)
Wang, Chong; Zinkevich, M.; Aldinger, F.; Stuttgart Univ.
2007-01-01
The phase equilibria and thermodynamic properties in the ZrO 2 -DyO 1.5 system have been studied using the experimental methods of X-ray diffraction, scanning electron microscopy, energy dispersive X-ray spectroscopy, differential thermal analysis and high temperature drop calorimetry. The tetragonal + fluorite and fluorite + C-Dy 2 O 3 phase equilibria between 1400 C and 1700 C have been determined, together with the enthalpy increments of the materials with 30 mol.% and 50 mol.% DyO 1.5 in the temperature range 200-1400 C. Furthermore, the martensitic transformation temperatures (A s ,M s ) have been measured for the samples with 1 and 2 mol.% DyO 1.5 . Finally, thermodynamic assessment has been carried out using the experimental results obtained and literature data. (orig.)
Efficacy of RTS,S/AS01E Vaccine against Malaria in Children 5 to 17 Months of Age
Bejon, Philip; Lusingu, John; Olotu, Ally; Leach, Amanda; Lievens, Marc; Vekemans, Johan; Mshamu, Salum; Lang, Trudie; Gould, Jayne; Dubois, Marie-Claude; Demoitié, Marie-Ange; Stallaert, Jean-Francois; Vansadia, Preeti; Carter, Terrell; Njuguna, Patricia; Awuondo, Ken O.; Malabeja, Anangisye; Abdul, Omar; Gesase, Samwel; Mturi, Neema; Drakeley, Chris J.; Savarese, Barbara; Villafana, Tonya; Ballou, W. Ripley; Cohen, Joe; Riley, Eleanor M.; Lemnge, Martha M.; Marsh, Kevin; von Seidlein, Lorenz
2009-01-01
BACKGROUND Plasmodium falciparum malaria is a pressing global health problem. A previous study of the malaria vaccine RTS,S (which targets the circumsporozoite protein), given with an adjuvant system (AS02A), showed a 30% rate of protection against clinical malaria in children 1 to 4 years of age. We evaluated the efficacy of RTS,S given with a more immunogenic adjuvant system (AS01E) in children 5 to 17 months of age, a target population for vaccine licensure. METHODS We conducted a double-blind, randomized trial of RTS,S/AS01E vaccine as compared with rabies vaccine in children in Kilifi, Kenya, and Korogwe, Tanzania. The primary end point was fever with a falciparum parasitemia density of more than 2500 parasites per microliter, and the mean duration of follow-up was 7.9 months (range, 4.5 to 10.5). RESULTS A total of 894 children were randomly assigned to receive the RTS,S/AS01E vaccine or the control (rabies) vaccine. Among the 809 children who completed the study procedures according to the protocol, the cumulative number in whom clinical malaria developed was 32 of 402 assigned to receive RTS,S/AS01E and 66 of 407 assigned to receive the rabies vaccine; the adjusted efficacy rate for RTS,S/AS01E was 53% (95% confidence interval [CI], 28 to 69; P<0.001) on the basis of Cox regression. Overall, there were 38 episodes of clinical malaria among recipients of RTS,S/AS01E, as compared with 86 episodes among recipients of the rabies vaccine, with an adjusted rate of efficacy against all malarial episodes of 56% (95% CI, 31 to 72; P<0.001). All 894 children were included in the intention-to-treat analysis, which showed an unadjusted efficacy rate of 49% (95% CI, 26 to 65; P<0.001). There were fewer serious adverse events among recipients of RTS,S/AS01E, and this reduction was not only due to a difference in the number of admissions directly attributable to malaria. CONCLUSIONS RTS,S/AS01E shows promise as a candidate malaria vaccine. (ClinicalTrials.gov number, NCT
Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V
2018-04-06
Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.
B =5 Skyrmion as a two-cluster system
Gudnason, Sven Bjarke; Halcrow, Chris
2018-06-01
The classical B =5 Skyrmion can be approximated by a two-cluster system in which a B =1 Skyrmion is attached to a core B =4 Skyrmion. We quantize this system, allowing the B =1 to freely orbit the core. The configuration space is 11 dimensional but simplifies significantly after factoring out the overall spin and isospin degrees of freedom. We exactly solve the free quantum problem and then include an interaction potential between the Skyrmions numerically. The resulting energy spectrum is compared to the corresponding nuclei—the helium-5/lithium-5 isodoublet. We find approximate parity doubling not seen in the experimental data. In addition, we fail to obtain the correct ground-state spin. The framework laid out for this two-cluster system can readily be modified for other clusters and in particular for other B =4 n +1 nuclei, of which B =5 is the simplest example.
q-Poincaré supersymmetry in AdS5/CFT4
Borsato, Riccardo; Torrielli, Alessandro
2018-03-01
We consider the exact S-matrix governing the planar spectral problem for strings on AdS5 ×S5 and N = 4 super Yang-Mills, and we show that it is invariant under a novel "boost" symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu (2 | 2) symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct) that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory) and weak-coupling (spin-chain description of the gauge theory) limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq (sl2 ˆ) in Drinfeld's second realisation.
q-Poincaré supersymmetry in AdS5/CFT4
Directory of Open Access Journals (Sweden)
Riccardo Borsato
2018-03-01
Full Text Available We consider the exact S-matrix governing the planar spectral problem for strings on AdS5×S5 and N=4 super Yang–Mills, and we show that it is invariant under a novel “boost” symmetry, which acts as a differentiation with respect to the particle momentum. This generator leads us also to reinterpret the usual centrally extended psu(2|2 symmetry, and to conclude that the S-matrix is invariant under a q-Poincaré supersymmetry algebra, where the deformation parameter is related to the 't Hooft coupling. We determine the two-particle action (coproduct that turns out to be non-local, and study the property of the new symmetry under crossing transformations. We look at both the strong-coupling (large tension in the string theory and weak-coupling (spin-chain description of the gauge theory limits; in the former regime we calculate the cobracket utilising the universal classical r-matrix of Beisert and Spill. In the eventuality that the boost has higher partners, we also construct a quantum affine version of 2D Poincaré symmetry, by contraction of the quantum affine algebra Uq(sl2ˆ in Drinfeld's second realisation.
Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA
International Nuclear Information System (INIS)
Barciszewska, M.Z.
1994-01-01
In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab
Giant magnons in the D1-D5 system
International Nuclear Information System (INIS)
David, Justin R.; Sahoo, Bindusar
2008-01-01
We study giant magnons in the the D1-D5 system from both the boundary CFT and as classical solutions of the string sigma model in AdS 3 x S 3 x T 4 . Re-examining earlier studies of the symmetric product conformal field theory we argue that giant magnons in the symmetric product are BPS states in a centrally extended SU(1|1) x SU(1|1) superalgebra with two more additional central charges. The magnons carry these additional central charges locally but globally they vanish. Using a spin chain description of these magnons and the extended superalgebra we show that these magnons obey a dispersion relation which is periodic in momentum. We then identify these states on the string theory side and show that here too they are BPS in the same centrally extended algebra and obey the same dispersion relation which is periodic in momentum. This dispersion relation arises as the BPS condition for the extended algebra and is similar to that of magnons in N = 4 Yang-Mills
Structural and practical identifiability analysis of S-system.
Zhan, Choujun; Li, Benjamin Yee Shing; Yeung, Lam Fat
2015-12-01
In the field of systems biology, biological reaction networks are usually modelled by ordinary differential equations. A sub-class, the S-systems representation, is a widely used form of modelling. Existing S-systems identification techniques assume that the system itself is always structurally identifiable. However, due to practical limitations, biological reaction networks are often only partially measured. In addition, the captured data only covers a limited trajectory, therefore data can only be considered as a local snapshot of the system responses with respect to the complete set of state trajectories over the entire state space. Hence the estimated model can only reflect partial system dynamics and may not be unique. To improve the identification quality, the structural and practical identifiablility of S-system are studied. The S-system is shown to be identifiable under a set of assumptions. Then, an application on yeast fermentation pathway was conducted. Two case studies were chosen; where the first case is based on a larger state trajectories and the second case is based on a smaller one. By expanding the dataset which span a relatively larger state space, the uncertainty of the estimated system can be reduced. The results indicated that initial concentration is related to the practical identifiablity.
Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets.
Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina
2018-02-02
Ni 2 P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H 2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd 0.5 Zn 0.5 S quantum dots (QDs) on thin Ni 2 P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H 2 generation. The porous Ni 2 P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni 2 P nanoparticles, allowed the uniform loading of 7 nm-sized Cd 0.5 Zn 0.5 S QDs and the loading density being controllable. By tuning the content of Ni 2 P, H 2 generation rates of 43.3 μM h - 1 (1 mg photocatalyst) and 700 μM h - 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni 2 P-Cd 0.5 Zn 0.5 S composites. The effect of Ni 2 P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni 2 P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.
Enhanced Photocatalytic Hydrogen Evolution by Loading Cd0.5Zn0.5S QDs onto Ni2P Porous Nanosheets
Xiao, Lingfeng; Su, Tong; Wang, Zhuo; Zhang, Kun; Peng, Xiaoniu; Han, Yibo; Li, Quan; Wang, Xina
2018-02-01
Ni2P has been decorated on CdS nanowires or nanorods for efficient photocatalytic H2 production, whereas the specific surface area remains limited because of the large size. Here, the composites of Cd0.5Zn0.5S quantum dots (QDs) on thin Ni2P porous nanosheets with high specific surface area were constructed for noble metal-free photocatalytic H2 generation. The porous Ni2P nanosheets, which were formed by the interconnection of 15-30 nm-sized Ni2P nanoparticles, allowed the uniform loading of 7 nm-sized Cd0.5Zn0.5S QDs and the loading density being controllable. By tuning the content of Ni2P, H2 generation rates of 43.3 μM h- 1 (1 mg photocatalyst) and 700 μM h- 1 (100 mg photocatalyst) and a solar to hydrogen efficiency of 1.5% were achieved for the Ni2P-Cd0.5Zn0.5S composites. The effect of Ni2P content on the light absorption, photoluminescence, and electrochemical property of the composite was systematically studied. Together with the band structure calculation based on density functional theory, the promotion of Ni2P in charge transfer and HER activity together with the shading effect on light absorption were revealed. Such a strategy can be applied to other photocatalysts toward efficient solar hydrogen generation.
M and S supporting unmanned autonomous systems (UAxS) concept development and experimentation
Biagini, Marco; Scaccianoce, Alfio; Corona, Fabio; Forconi, Sonia; Byrum, Frank; Fowler, Olivia; Sidoran, James L.
2017-05-01
The development of the next generation of multi-domain unmanned semi and fully autonomous C4ISR systems involves a multitude of security concerns and interoperability challenges. Conceptual solutions to capability shortfalls and gaps can be identified through Concept Development and Experimentation (CD and E) cycles. Modelling and Simulation (M and S) is a key tool in supporting unmanned autonomous systems (UAxS) CD and E activities and addressing associated security challenges. This paper serves to illustrate the application of M and S to UAxS development and highlight initiatives made by the North Atlantic Treaty Organization (NATO) M and S Centre of Excellence (CoE) to facilitate interoperability. The NATO M and S CoE collaborates with other NATO and Nations bodies in order to develop UAxS projects such as the Allied Command for Transformation Counter Unmanned Autonomous Systems (CUAxS) project or the work of Science and Technology Organization (STO) panels. Some initiatives, such as Simulated Interactive Robotics Initiative (SIRI) made the baseline for further developments and to study emerging technologies in M and S and robotics fields. Artificial Intelligence algorithm modelling, Robot Operating Systems (ROS), network operations, cyber security, interoperable languages and related data models are some of the main aspects considered in this paper. In particular, the implementation of interoperable languages like C-BML and NIEM MilOps are discussed in relation to a Command and Control - Simulation Interoperability (C2SIM) paradigm. All these technologies are used to build a conceptual architecture to support UAxS CD and E.In addition, other projects that the NATO M and S CoE is involved in, such as the NATO Urbanization Project could provide credible future operational environments and benefit UAxS project development, as dual application of UAxS technology in large urbanized areas.In conclusion, this paper contains a detailed overview regarding how applying
International Nuclear Information System (INIS)
Chumpradit, Sumalee; Meiping Kung; Vessotskie, Janet; Kung, H.F.
1995-01-01
A new dopamine D2-like receptor ligand, (R,S)trans-5-hydroxy-2-[N-n0propyl-N-(3'-iodo-2'-propeny)amino]tet ralin ((R,S)trans-5-OH-PIPAT,3), based on high affinity dopamine receptor agonist 5-hydroxy-2-[N,N-(di-n-propyl)-2-amino]tetralin (5-OH-DPAT,1), was prepared. The synthesis was achieved by a reductive amination of 5-methoxy-2-tetralone with n-propylamine, followed by N-alkylation, to afford 5-methoxy-N-propyl-N-2'-aminotetralin,7. Reduction of 7 with tributyltin hydride gave the tri-n-butyl tin derivative,8, which was converted to 9 by an iododemetalation reaction. Demethylation of 9 gave the desired compound, (R,S)trans-5-OH-PIPAT,3. The resolved (R) and (S)trans-5-OH-PIPAT,3 were also quantitatively prepared. (author)
An Archaea 5S rRNA analog is stably expressed in Escherichia coli
Yang, Y.; Fox, G. E.
1996-01-01
Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
Beam-foil lifetime measurements for some 5d10 nl and 5d96s6p levels of Pb IV
International Nuclear Information System (INIS)
Pinnington, E.H.; Ansbacher, W.; Tauheed, A.; Kernahan, J.A.
1991-01-01
The beam-foil technique was used to measure the lifetimes of the 5d 10 5f, 5g, 6d, 6h, 7p, 7d, 8s and 5d 9 6s6p (2) 0 , (3) 0 , (6) 0 , (14) 0 , (17) 0 levels of Pb IV. Correlated decay-curve analyses were used to correct for the effects of cascading in the case of the 5d 10 5f, 5g, 6d, and 7p levels. The numerical Coulomb approximation was used to calculate comparison values for the 5d 10 nl levels. The need for a more rigorous calculation for specific levels is discussed. (12 refs., fig., tab.)
Quantum mechanically guided design of Co43Fe20Ta5.5X31.5 (X=B, Si, P, S) metallic glasses
International Nuclear Information System (INIS)
Hostert, C; Music, D; Schneider, J M; Bednarcik, J; Keckes, J
2012-01-01
A systematic ab initio molecular dynamics study was carried out to identify valence electron concentration and size induced changes on structure, elastic and magnetic properties for Co 43 Fe 20 Ta 5.5 X 31.5 (X=B, Si, P, S). Short range order, charge transfer and the bonding nature are analyzed by means of density of states, Bader decomposition and pair distribution function analysis. A clear trend of a decrease in density and bulk modulus as well as a weaker cohesion was observed as the valence electron concentration is increased by replacing B with Si and further with P and S. These changes may be understood based on increased interatomic distances, variations in coordination numbers and the electronic structure changes; as the valence electron concentration of X is increased the X bonding becomes more ionic, which disrupts the overall metallic interactions, leading to lower cohesion and stiffness. The highest magnetic moments for the transition metals are identified for X=S, despite the fact that the presence of X generally reduces the magnetic moment of Co. Furthermore, this study reveals an extended diagonal relationship between B and P within these amorphous alloys. Based on quantum mechanical data we identify composition induced changes in short range order, charge transfer and bonding nature and link them to density, elasticity and magnetism. The interplay between transition metal d band filling and s-d hybridization was identified to be a key materials design criterion. (paper)
21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic acid...
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
International Nuclear Information System (INIS)
Nishiyama, Shogo; Nagata, Tetsuya; Tamura, Motohide; Hatano, Hirofumi; Kato, Daisuke; Tanabe, Toshihiko; Sugitani, Koji
2009-01-01
We have determined interstellar extinction law toward the Galactic center (GC) at the wavelength from 1.2 to 8.0 μm, using point sources detected in the IRSF/SIRIUS near-infrared (NIR) survey and those in the Two Micron All Sky Survey (2MASS) and Spitzer/IRAC/GLIMPSE II catalogs. The central region |l | ∼ 0 0 and |b | ∼ 0 0 has been surveyed in the J, H, and K S bands with the IRSF telescope and the SIRIUS camera whose filters are similar to the Mauna Kea Observatories (MKO) NIR photometric system. Combined with the GLIMPSE II point source catalog, we made K S versus K S - λ color-magnitude diagrams (CMDs) where λ=3.6, 4.5, 5.8, and 8.0 μm. The K S magnitudes of bulge red clump stars and the K S - λ colors of red giant branches are used as a tracer of the reddening vector in the CMDs. From these magnitudes and colors, we have obtained the ratios of total-to-selective extinction A K S /E K S -λ for the four IRAC bands. Combined with A λ /A K S for the J and H bands derived by Nishiyama et al., we obtain A J :A H :A K S :A [3.6] :A [4.5] :A [5.8] :A [8.0] = 3.02:1.73:1:0.50:0.39:0.36:0.43 for the line of sight toward the GC. This confirms the flattening of the extinction curve at λ ∼> 3 μm from a simple extrapolation of the power-law extinction at shorter wavelengths, in accordance with recent studies. The extinction law in the 2MASS J, H, and K S bands has also been calculated, and good agreement with that in the MKO system is found. Thus, it is established that the extinction in the wavelength range of J, H, and K S is well fitted by a power law of steep decrease A λ ∝ λ -2.0 toward the GC. In nearby molecular clouds and diffuse interstellar medium, the lack of reliable measurements of the total-to-selective extinction ratios hampers unambiguous determination of the extinction law; however, observational results toward these lines of sight cannot be reconciled with a single extinction law.
Directory of Open Access Journals (Sweden)
Hong Gu
Full Text Available We investigated the thermal properties of few-layer Mo0.5W0.5S2 using a series of samples with different kinds of capping layers. Temperature-dependent Raman measurements were conducted in the range of 300–500 K, with power-dependent measurements also carried out. It indicated, for the few-layer Mo0.5W0.5S2, the temperature coefficients of the WS2-like E12g mode, MoS2-like E12g mode and A1g mode were −0.0155 cm−1/K, −0.0146 cm−1/K, and −0.0130 cm−1/K, respectively. And the thermal conductivity was estimated to be 44.8 W/mK. Moreover, the Mo0.5W0.5S2 samples coated with capping layers (ZrO2, HfO2 both showed a better thermal stability and a larger thermal conductivity than the one without. The results revealed that the capping layer should be an important factor in the thermal property. Keywords: Mo0.5W0.5S2, TMDs, Thermal properties, High temperature, Capping layers, Raman
A DoS/DDoS Attack Detection System Using Chi-Square Statistic Approach
Directory of Open Access Journals (Sweden)
Fang-Yie Leu
2010-04-01
Full Text Available Nowadays, users can easily access and download network attack tools, which often provide friendly interfaces and easily operated features, from the Internet. Therefore, even a naive hacker can also launch a large scale DoS or DDoS attack to prevent a system, i.e., the victim, from providing Internet services. In this paper, we propose an agent based intrusion detection architecture, which is a distributed detection system, to detect DoS/DDoS attacks by invoking a statistic approach that compares source IP addresses' normal and current packet statistics to discriminate whether there is a DoS/DDoS attack. It first collects all resource IPs' packet statistics so as to create their normal packet distribution. Once some IPs' current packet distribution suddenly changes, very often it is an attack. Experimental results show that this approach can effectively detect DoS/DDoS attacks.
Torosyan, David
2012-01-01
Just as important as the engineering that goes into building a robot is the method of interaction, or how human users will use the machine. As part of the Human-System Interactions group (Conductor) at JPL, I explored using a web interface to interact with ATHLETE, a prototype lunar rover. I investigated the usefulness of HTML 5 and Javascript as a telemetry viewer as well as the feasibility of having a rover communicate with a web server. To test my ideas I built a mobile-compatible website and designed primarily for an Android tablet. The website took input from ATHLETE engineers, and upon its completion I conducted a user test to assess its effectiveness.
Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong
2016-03-01
Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Zhou, Xiaolong; Wang, Xina; Feng, Xi; Zhang, Kun; Peng, Xiaoniu; Wang, Hanbin; Liu, Chunlei; Han, Yibo; Wang, Hao; Li, Quan
2017-07-12
Carbon dots (C dots, size < 10 nm) have been conventionally decorated onto semiconductor matrixes for photocatalytic H 2 evolution, but the efficiency is largely limited by the low loading ratio of the C dots on the photocatalyst. Here, we propose an inverse structure of Cd 0.5 Zn 0.5 S quantum dots (QDs) loaded onto the onionlike carbon (OLC) matrix for noble metal-free photocatalytic H 2 evolution. Cd 0.5 Zn 0.5 S QDs (6.9 nm) were uniformly distributed on an OLC (30 nm) matrix with both upconverted and downconverted photoluminescence property. Such an inverse structure allows the full optimization of the QD/OLC interfaces for effective energy transfer and charge separation, both of which contribute to efficient H 2 generation. An optimized H 2 generation rate of 2018 μmol/h/g (under the irradiation of visible light) and 58.6 μmol/h/g (under the irradiation of 550-900 nm light) was achieved in the Cd 0.5 Zn 0.5 S/OLC composite samples. The present work shows that using the OLC matrix in such a reverse construction is a promising strategy for noble metal-free solar hydrogen production.
2017-01-26
10 mM KCl, 1 mM dithiothreitol (DTT), 0.1 mg/ml bovine serum albumin (BSA), 0.2 U/µl RNasin Plus RNase inhibitor (Promega),4 ng/µl sshRNA, 5 mM...for 90 min at 30 °C. After 90 min, 10 µl of the reaction mixture was spotted on DE81 anion exchange paper (Whatman, United Kingdom), which was then...washed with 3× Na2HPO4 (125 mM [pH 9]), 1× water, and 1× ethyl alcohol (EtOH). The filter paper was air-dried and exposed to the phosphorimager
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-02-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Ba 5s photoionization in the region of the second Cooper minimum
International Nuclear Information System (INIS)
Whitfield, S B; Wehlitz, R; Dolmatov, V K
2011-01-01
We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.
Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA
DEFF Research Database (Denmark)
Ostergaard, P; Phan, H; Johansen, L B
1998-01-01
The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....
DEFF Research Database (Denmark)
Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke
2013-01-01
the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...
Effects of PDE5 Inhibitors and sGC Stimulators in a Rat Model of Artificial Ureteral Calculosis.
Directory of Open Access Journals (Sweden)
Peter Sandner
Full Text Available Urinary colics from calculosis are frequent and intense forms of pain whose current pharmacological treatment remains unsatisfactory. New and more effective drugs are needed to control symptoms and improve stone expulsion. Recent evidence suggested that the Nitric Oxide (NO / cyclic guanosine monophosphate (cGMP/phosphodiesterase type 5 (PDE5 system may contribute to ureteral motility influencing stone expulsion. We investigated if PDE5 inhibitors and sGC stimulators influence ureteral contractility, pain behaviour and stone expulsion in a rat model of ureteral calculosis. We investigated: a the sex-specific PDE5 distribution in the rat ureter; b the functional in vitro effects of vardenafil and sildenafil (PDE5 inhibitors and BAY41-2272 (sGC stimulator on induced ureteral contractility in rats and c the in vivo effectiveness of vardenafil and BAY41-2272, alone and combined with ketoprofen, vs hyoscine-N-butylbromide alone or combined with ketoprofen, on behavioural pain indicators and stone expulsion in rats with artificial calculosis in one ureter. PDE5 was abundantly expressed in male and female rats' ureter. In vitro, both vardenafil and BAY41-2272 significantly relaxed pre-contracted ureteral strips. In vivo, all compounds significantly reduced number and global duration of "ureteral crises" and post-stone lumbar muscle hyperalgesia in calculosis rats. The highest level of reduction of the pain behaviour was observed with BAY41-2272 among all spasmolytics administered alone, and with the combination of ketoprofen with BAY41-2272. The percentage of stone expulsion was maximal in the ketoprofen+BAY41-2272 group. The NO/cGMP/PDE5 pathway is involved in the regulation of ureteral contractility and pain behaviour in urinary calculosis. PDE5 inhibitors and sGC stimulators could become a potent new option for treatment of urinary colic pain.
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae
Directory of Open Access Journals (Sweden)
Victor Manuel Gomez-Rodriguez
2013-08-01
Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
UniSat-5: a space-based optical system for space debris monitoring
Di Roberto, Riccardo; Cappelletti, Chantal
2012-07-01
Micro-satellite missions, thanks to the miniaturization process of electronic components, now have a broader range of applications. Gauss Group at School of Aerospace Engineering has been a pioneer in educational micro-satellites, namely with UNISAT and EDUSAT missions. Moreover it has been long involved in space debris related studies, such as optical observations as well as mitigation. A new project is under development for a compact digital imaging system. The purpose will be in situ observation of space debris on board Unisat-5 micro-satellite. One of the key elements of observing on orbit is that many atmospheric phenomena would be avoided, such as diffraction and EM absorption. Hence images would gain more contrast and solar spectral irradiance would be higher for the whole visible spectrum Earlier limitations of power and instrument size prevented the inclusion of these payloads in educational satellite missions. The system is composed of an optical tube, a camera, C band and S band transceivers and two antennas. The system is independent from the rest of the spacecraft. The optical tube is a Schmidt-Cassegrain reflector, and the magnitude limit is 13. The camera is equipped with a panchromatic 5Mpix sensor, capable of direct video streaming, as well as local storage of recorded images. The transceivers operate on ISM 2.4GHz and 5 GHz Wi-Fi bands, and they provide stand-alone communication capabilities to the payload, and Unisat-5 OBDH can switch between the two. Both transceivers are connected to their respective custom-designed patch antenna. The ground segment is constituted of a high gain antenna dish, which will use the same transceiver on board the spacecraft as the feed, in order to establish a TCP/IP wireless link. Every component of this system is a consumer grade product. Therefore price reduction of cutting edge imaging technology now allows the use of professional instruments, that combined with the new wireless technology developed for
Distribution of photonically generated 5 Gbits=s impulse radio ultrawideband signals over fiber
DEFF Research Database (Denmark)
Yu, Xianbin; Tafur Monroy, Idelfonso
2011-01-01
We propose an approach to generate ultrawideband (UWB) pulses with tunable high-speed modulation based on pulse compression. Flexible generation of up to a record 5 Gbits=s on-off keying impulse radio UWB signals are successfully demonstrated as well. We also investigate 5 Gbits=s on-off keying bit...
McCarthy, K. J.; Tamura, N.; Combs, S. K.; García, R.; Hernández Sánchez, J.; Navarro, M.; Panadero, N.; Pastor, I.; Soleto, A.; the TJ-II Team
2018-03-01
43 spectral emission lines from F-like to Li-like sulphur ions have been identified in the wavelength range from 17.5 to 50 nm in spectra obtained following tracer injection into plasmas created in a magnetically confined plasma device, the stellarator TJ-II. Plasmas created and maintained in this heliac device with electron cyclotron resonance heating achieve central electron temperatures and densities up to 1.5 keV and 8 × 1018 m-3, respectively. Tracer injections were performed with ≤6 × 1016 atoms of sulphur contained within ˜300 μm diameter polystyrene capsules, termed tracer encapsulated solid pellets, using a gas propulsion system to achieve velocities between 250 and 450 m s-1. Once ablation of the exterior polystyrene shell by plasma particles is completed, the sulphur is deposited in the plasma core where it is ionized up to S+13 and transported about the plasma. In order to aid line identification, which is made using a number of atomic line emission databases, spectra are collected before and after injection using a 1 m focal length normal incidence spectrometer equipped with a CCD camera. This work is motivated by the need to clearly identify sulphur emission lines in the vacuum ultraviolet range of magnetically confined plasmas, as sulphur x-ray emission lines are regularly observed in both tokamak and stellarator plasmas.
Experiment S-5: Synoptic Terrain Photography
Lowman, Paul D., Jr.
1966-01-01
The Synoptic Terrain Photography Experiment (S-5) was successfully conducted during the Gemini V mission, the second of the Gemini flights on which it was carried. This report summarizes briefly the methods and results of the experiment. Interpretation of the many excellent pictures obtained is in progress, and a full report is not possible at this time; instead, representative pictures will be presented and described. The purpose of the experiment was to obtain a large number of high-quality color photographs of selected land areas from geologic and geographic study. Southern Mexico, eastern Africa, and Australia were given high priority, but it was stressed that good pictures of any cloud-free land area would be useful. The same camera (Hasselblad 500 C) and film (Ektachrome MS) used on the Gemini III and IV missions were carried on the Gemini V flight.
Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni
2012-03-20
For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r
Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Balagura, Vladislav; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brambach, Tobias; van den Brand, Johannes; Bressieux, Joël; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Brown, Henry; Bursche, Albert; Busetto, Giovanni; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carranza-Mejia, Hector; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Ciba, Krzystof; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Giani', Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gordon, Hamish; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hartmann, Thomas; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hunt, Philip; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jezabek, Marek; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kaballo, Michael; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kozlinskiy, Alexandr; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanciotti, Elisa; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leo, Sabato; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Guoming; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lopez-March, Neus; Lowdon, Peter; Lu, Haiting; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Manca, Giulia; Mancinelli, Giampiero; Manzali, Matteo; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martens, Aurelien; Martín Sánchez, Alexandra; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Moran, Dermot; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Muresan, Raluca; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Oggero, Serena; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pazos Alvarez, Antonio; Pearce, Alex; Pellegrino, Antonio; Pepe Altarelli, Monica; Perazzini, Stefano; Perez Trigo, Eliseo; Perret, Pascal; Perrin-Terrin, Mathieu; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Powell, Andrew; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Alexander; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Roa Romero, Diego; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruffini, Fabrizio; Ruiz, Hugo; Ruiz Valls, Pablo; Sabatino, Giovanni; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sapunov, Matvey; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Savrie, Mauro; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Seco, Marcos; Semennikov, Alexander; Senderowska, Katarzyna; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Sparkes, Ailsa; Spinella, Franco; Spradlin, Patrick; Stagni, Federico; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Subbiah, Vijay Kartik; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szilard, Daniela; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; Voss, Helge; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wicht, Jean; Wiedner, Dirk; Wilkinson, Guy; Williams, Matthew; Williams, Mike; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wu, Suzhi; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Feng; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zvyagin, Alexander
2014-01-01
Production of $\\Upsilon$ mesons in proton-lead collisions at a nucleon-nucleon centre-of-mass energy $\\sqrt{s_{NN}}=5 \\mathrm{TeV}$ is studied with the LHCb detector. The analysis is based on a data sample corresponding to an integrated luminosity of $1.6 \\mathrm{nb}^{-1}$. The $\\Upsilon$ mesons of transverse momenta up to $15 \\mathrm{GeV}/c$ are reconstructed in the dimuon decay mode. The rapidity coverage in the centre-of-mass system is $1.5
Directory of Open Access Journals (Sweden)
Frank S Choveau
2012-07-01
Full Text Available Voltage-gated potassium (Kv channels are tetramers, each subunit presenting six transmembrane segments (S1-S6, with each S1-S4 segments forming a voltage-sensing domain (VSD and the four S5-S6 forming both the conduction pathway and its gate. S4 segments control the opening of the intracellular activation gate in response to changes in membrane potential. Crystal structures of several voltage-gated ion channels in combination with biophysical and mutagenesis studies highlighted the critical role of the S4-S5 linker (S4S5L and of the S6 C-terminal part (S6T in the coupling between the VSD and the activation gate. Several mechanisms have been proposed to describe the coupling at a molecular scale. This review summarizes the mechanisms suggested for various voltage-gated ion channels, including a mechanism that we described for KCNQ1, in which S4S5L is acting like a ligand binding to S6T to stabilize the channel in a closed state. As discussed in this review, this mechanism may explain the reverse response to depolarization in HCN-like channels. As opposed to S4S5L, the phosphoinositide, phosphatidylinositol 4,5-bisphosphate (PIP2, stabilizes KCNQ1 channel in an open state. Many other ion channels (not only voltage-gated require PIP2 to function properly, confirming its crucial importance as an ion channel co-factor. This is highlighted in cases in which an altered regulation of ion channels by PIP2 leads to channelopathies, as observed for KCNQ1. This review summarizes the state of the art on the two regulatory mechanisms that are critical for KCNQ1 and other voltage-gated channels function (PIP2 and S4-S5L, and assesses their potential physiological and pathophysiological roles.
Rutt, Oliver J; Hill, Timothy L; Gál, Zoltán A; Hayward, Michael A; Clarke, Simon J
2003-12-01
Potassium intercalation into the cation-deficient n = 2 Ruddlesden-Popper oxysulfide Y(2)Ti(2)O(5)S(2) to form KY(2)Ti(2)O(5)S(2) has been carried out by reaction of the oxysulfide with potassium vapor in sealed metal tubes at 400 degrees C, potassium naphthalide in THF at 50 degrees C, or potassium in liquid ammonia at temperatures as low as -78 degrees C. Insertion of potassium is topotactic, and although a site 12-coordinate by oxide ions is vacant in the perovskite-type oxide slabs of the structure, potassium is too large to enter this site via the 4-coordinate window, and instead enters the rock-salt-type sulfide layers of the structure which necessitates a 30% increase in the lattice parameter c normal to the layers. In contrast with one of the sodium intercalates of Y(2)Ti(2)O(5)S(2) (beta-NaY(2)Ti(2)O(5)S(2)) in which sodium occupies a tetrahedral site in the sulfide layers, potassium favors an 8-coordinate site which necessitates a relative translation of adjacent oxide slabs. KY(2)Ti(2)O(5)S(2) is tetragonal: P4/mmm, a = 3.71563(4) A, c = 14.8682(2) A (at 298 K), Z = 1. Although the resistivity (3.4(1) x 10(3) Omega cm) is larger than would be expected for a metal, temperature independent paramagnetism dominates the magnetic susceptibility, and the material is electronically very similar to the analogous sodium intercalate beta-NaY(2)Ti(2)O(5)S(2) which features reduced-titanium-containing oxide layers of very similar geometry and electron count.
The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX
International Nuclear Information System (INIS)
Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.
1976-01-01
With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)
Mechanical Loads Test Report for the U.S. Department of Energy 1.5-Megawatt Wind Turbine
Energy Technology Data Exchange (ETDEWEB)
Santos, Rick [Santos Wind Engineering Technologies, Inc., Portland, ME (United States); van Dam, Jeroen [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2015-07-16
The objective of the test was to obtain a baseline characterization of the mechanical loads of the DOE 1.5 wind turbine located at NREL. The test was conducted in accordance with the International Electrotechnical Commission (IEC) Technical Specification, IEC 61400-13 Wind Turbine Generator Systems – Part 13: Measurement of mechanical loads; First Edition 2001-06 [1]. The National Wind Technology Center (NWTC) at NREL conducted this test in accordance with its quality system procedures so that the final test report meets the full requirements of its accreditation by the American Association for Laboratory Accreditation (A2LA). NREL’s quality system requires that all applicable requirements specified by A2LA and International Standards Organization/IEC 17025 be met or to note any exceptions in the test report.
The S-matrix for abstract scattering systems
International Nuclear Information System (INIS)
Amrein, W.O.; Pearson, D.B.
1979-01-01
Let S(lambda) be the S-matrix at energy lambda for an abstract scattering system. A bound is derived in terms of the interaction, on integrals of the form ∫ h(lambda)/S(lambda) - I/ 2 sub(HS) dlambda, where /./sub(HS) denotes the Hilbert-Schmidt norm. (Auth.)
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.
Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen
2017-01-01
Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of
Twistor methods for AdS{sub 5}
Energy Technology Data Exchange (ETDEWEB)
Adamo, Tim; Skinner, David; Williams, Jack [Department of Applied Mathematics & Theoretical Physics, University of Cambridge,Wilberforce Road, Cambridge, CB3 0WA United Kingdom (United Kingdom)
2016-08-30
We consider the application of twistor theory to five-dimensional anti-de Sitter space. The twistor space of AdS{sub 5} is the same as the ambitwistor space of the four-dimensional conformal boundary; the geometry of this correspondence is reviewed for both the bulk and boundary. A Penrose transform allows us to describe free bulk fields, with or without mass, in terms of data on twistor space. Explicit representatives for the bulk-to-boundary propagators of scalars and spinors are constructed, along with twistor action functionals for the free theories. Evaluating these twistor actions on bulk-to-boundary propagators is shown to produce the correct two-point functions.
RELAP/MOD3 code manual: User`s guidelines. Volume 5, Revision 1
Energy Technology Data Exchange (ETDEWEB)
Fletcher, C.D.; Schultz, R.R. [Lockheed Idaho Technologies Co., Idaho Falls, ID (United States)
1995-08-01
The RELAP5 code has been developed for best estimate transient simulation of light water reactor coolant systems during postulated accidents. The code models the coupled behavior of the reactor coolant system and the core for loss-of-coolant accidents, and operational transients, such as anticipated transient without scram, loss of offsite power, loss of feedwater, and loss of flow. A generic modeling approach is used that permits simulating a variety of thermal hydraulic systems. Control system and secondary system components are included to permit modeling of plant controls, turbines, condensers, and secondary feedwater systems. Volume V contains guidelines that have solved over the past several years through the use of the RELAP5 code.
Magnetic and electrical properties of (FeIn2S4)1−x(CuIn5S8)x solid solutions
International Nuclear Information System (INIS)
Trukhanov, S.V.; Bodnar, I.V.; Zhafar, M.A.
2015-01-01
In this study, single crystals of FeIn 2 S 4 and CuIn 5 S 8 compounds, and (FeIn 2 S 4 ) 1−x (CuIn 5 S 8 ) x solid solutions were grown using the Bridgman method. The magnetic and electrical properties of the samples obtained were investigated at temperatures of 5–300 K and in a magnetic field range of 0–14 T. It was established that all of the solid solutions were paramagnets down to low temperatures of ~10 K. It was shown that the ground state of the magnetic phase of the samples was a spin glass state, where the freezing temperature increased monotonically with the increase in the concentration of Fe 2+ cations. All of the samples exhibited semiconductor characteristics in terms of electrical resistivity. The concentration-dependent critical magnetic temperatures, magnetic moment, and activation energy were plotted, which are probably explained by the magnetic state formation of the (FeIn 2 S 4 ) 1−x (CuIn 5 S 8 ) x solid solution single crystals based on the empirical Goodenough–Kanamori rules
Magnetron based high energy S-band linac system
International Nuclear Information System (INIS)
Tiwari, T.; Krishnan, R.; Phatangare, Manoj
2012-01-01
This paper deals with the study of magnetron based high energy S-band linear accelerator (linac) system operating at spot frequency 2.998 GHz. The energy and dose are two important parameters of linac system which depend on input power of microwave source and length of linac tube. Here the author has studied how these parameters can be improved for side coupled standing wave S-band linac system
Protein S-sulfhydration by hydrogen sulfide in cardiovascular system.
Meng, Guoliang; Zhao, Shuang; Xie, Liping; Han, Yi; Ji, Yong
2018-04-01
Hydrogen sulfide (H 2 S), independently of any specific transporters, has a number of biological effects on the cardiovascular system. However, until now, the detailed mechanism of H 2 S was not clear. Recently, a novel post-translational modification induced by H 2 S, named S-sulfhydration, has been proposed. S-sulfhydration is the chemical modification of specific cysteine residues of target proteins by H 2 S. There are several methods for detecting S-sulfhydration, such as the modified biotin switch assay, maleimide assay with fluorescent thiol modifying regents, tag-switch method and mass spectrometry. H 2 S induces S-sulfhydration on enzymes or receptors (such as p66Shc, phospholamban, protein tyrosine phosphatase 1B, mitogen-activated extracellular signal-regulated kinase 1 and ATP synthase subunit α), transcription factors (such as specific protein-1, kelch-like ECH-associating protein 1, NF-κB and interferon regulatory factor-1), and ion channels (such as voltage-activated Ca 2+ channels, transient receptor potential channels and ATP-sensitive K + channels) in the cardiovascular system. Although significant progress has been achieved in delineating the role of protein S-sulfhydration by H 2 S in the cardiovascular system, more proteins with detailed cysteine sites of S-sulfhydration as well as physiological function need to be investigated in further studies. This review mainly summarizes the role and possible mechanism of S-sulfhydration in the cardiovascular system. The S-sulfhydrated proteins may be potential novel targets for therapeutic intervention and drug design in the cardiovascular system, which may accelerate the development and application of H 2 S-related drugs in the future. This article is part of a themed section on Spotlight on Small Molecules in Cardiovascular Diseases. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.8/issuetoc. © 2017 The British Pharmacological Society.
Development of multi-frequency ESR system for high-pressure measurements up to 2.5 GPa
Sakurai, T.; Fujimoto, K.; Matsui, R.; Kawasaki, K.; Okubo, S.; Ohta, H.; Matsubayashi, K.; Uwatoko, Y.; Tanaka, H.
2015-10-01
A new piston-cylinder pressure cell for electron spin resonance (ESR) has been developed. The pressure cell consists of a double-layer hybrid-type cylinder with internal components made of the ZrO2-based ceramics. It can generate a pressure of 2 GPa repeatedly and reaches a maximum pressure of around 2.5 GPa. A high-pressure ESR system using a cryogen-free superconducting magnet up 10 T has also been developed for this hybrid-type pressure cell. The frequency region is from 50 GHz to 400 GHz. This is the first time a pressure above 2 GPa has been achieved in multi-frequency ESR system using a piston-cylinder pressure cell. We demonstrate its potential by showing the results of the high-pressure ESR of the S = 1 system with the single ion anisotropy NiSnCl6 · 6H2O and the S = 1 / 2 quantum spin system CsCuCl3. We performed ESR measurements of these systems above 2 GPa successfully.
AdS5 magnetized solutions in minimal gauged supergravity
Directory of Open Access Journals (Sweden)
Jose Luis Blázquez-Salcedo
2017-08-01
Full Text Available We construct a generalization of the AdS charged rotating black holes with two equal magnitude angular momenta in five-dimensional minimal gauged supergravity. In addition to the mass, electric charge and angular momentum, the new solutions possess an extra-parameter associated with a non-zero magnitude of the magnetic potential at infinity. In contrast with the known cases, these new black holes possess a non-trivial zero-horizon size limit which describes a one parameter family of spinning charged solitons. All configurations reported in this work approach asymptotically an AdS5 spacetime in global coordinates and are free of pathologies.
Energy Technology Data Exchange (ETDEWEB)
Bower, W.
2002-02-15
This report for the International Energy Agency (IEA) made by Task 5 of the Photovoltaic Power Systems (PVPS) programme presents a guideline for the certification of photovoltaic system components and grid-connected systems. The mission of the Photovoltaic Power Systems Programme is to enhance the international collaboration efforts which accelerate the development and deployment of photovoltaic solar energy. Task 5 deals with issues concerning grid-interconnection and distributed PV power systems. This generic international guideline for the certification of photovoltaic system components and complete grid-connected photovoltaic systems describes a set of recommended methods and tests that may be used to verify the integrity of hardware and installations, compliance with applicable standards/codes and can be used to provide a measure of the performance of components or of entire systems. The guideline is to help ensure that photovoltaic installations are both safe for equipment as well as for personnel when used according to the applicable installation standards and codes. The guideline may be used in any country using the rules stipulated by the applicable standards and codes and by applying them to the guideline's recommended tests. This document uses examples for some tests but does not specify exact test set-ups, equipment accuracy, equipment manufacturers or calibration procedures.
Directory of Open Access Journals (Sweden)
Arezoo Shafieyoun
2016-05-01
Full Text Available The real pathophysiology of Crohn’s disease is unknown. The higher prevalence of Crohn’s disease in Caucasian and Jewish ethnicities, as well as its familial aggregation and higher concordance among monozygotic twins, suggest some roles for genes in its development, clinical progression, and outcome. Recent original studies have indicated DLG5113G/A gene polymorphism as a risk factor for Crohn’s disease. Meanwhile, the results of these studies are not consistent. We performed the current meta-analysis to understand whether there is any association between DLG5 gene polymorphism and the risk of Crohn’s disease. PubMed was searched to find the case-control studies on DLG5 gene polymorphisms and Crohn’s disease. This search compiled 65 articles and based on our criteria. 11 articles were included in this meta-analysis. The association between the DLG5 113G/A polymorphism and the risk of disease was assessed using odds ratio (OR and 95% confidence interval (95% CI. Heterogeneity was evaluated based on I2 values. Random and fixed-effect models were used when I2>50% and I2≤50%, respectively. Eleven studies with a total of 4648 cases and 5677 controls were pooled. Based on our meta-analysis, DLG5113G/A gene polymorphism both at genotypic and allelic levels were not associated with the risk of Crohn’s disease. Pooled data indicated no significant association between DLG5113G/A gene polymorphism and the development of Crohn’s disease. In order to achieve a superior conclusion, multicenter studies on larger number of patients are recommended.
HAL/S-FC compiler system functional specification
1974-01-01
Compiler organization is discussed, including overall compiler structure, internal data transfer, compiler development, and code optimization. The user, system, and SDL interfaces are described, along with compiler system requirements. Run-time software support package and restrictions and dependencies are also considered of the HAL/S-FC system.
Gill, Iqbal; Patel, Ramesh
2006-02-01
An efficient biocatalytic method has been developed for the conversion of (5S)-4,5-dihydro-1H-pyrrole-1,5-dicarboxylic acid, 1-(1,1-dimethylethyl)-5-ethyl ester (1) into the corresponding amide (5S)-5-aminocarbonyl-4,5-dihydro-1H-pyrrole-1-carboxylic acid, 1-(1,1-dimethylethyl)ester (2), which is a critical intermediate in the synthesis of the dipeptidyl peptidase IV (DPP4) inhibitor Saxagliptin (3). Candida antartica lipase B mediates ammonolysis of the ester with ammonium carbamate as ammonia donor to yield up to 71% of the amide. The inclusion of Ascarite and calcium chloride as adsorbents for carbon dioxide and ethanol byproducts, respectively, increases the yield to 98%, thereby offering an efficient and practical alternative to chemical routes which yield 57-64%.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).
Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao
2017-01-01
In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.
Interactive Model-Centric Systems Engineering (IMCSE) Phase 5
2018-02-28
Interactive Model-Centric Systems Engineering (IMCSE) Phase 5 Technical Report SERC-2018-TR-104 Feb 28, 2018 Principal Investigator...Date February 28, 2018 Copyright © 2018 Stevens Institute of Technology, Systems Engineering ...Research Center The Systems Engineering Research Center (SERC) is a federally funded University Affiliated Research Center managed by Stevens
Energy Technology Data Exchange (ETDEWEB)
Yuan, Dongxia; Wang, Xuxu; Yin, Dongming [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, CAS, Changchun, 130022 (China); University of Chinese Academy of Sciences, Beijing, 100049 (China); Liang, Fei [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, CAS, Changchun, 130022 (China); Wang, Limin, E-mail: lmwang@ciac.ac.cn [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, CAS, Changchun, 130022 (China)
2017-08-31
Highlights: • Bimetallic nickel cobalt sulfide (Ni{sub 1.5}Co{sub 1.5}S{sub 4}) was prepared by an ultrafast microwave-assisted hydrothermal method. • The Ni{sub 1.5}Co{sub 1.5}S{sub 4} was studied as cathode materials for lithium ion batteries in the ether-based electrolyte in the voltage range of 1.0–3.0 V,. • Compared with its corresponding single metal sulfides, the Ni{sub 1.5}Co{sub 1.5}S{sub 4} exhibits superior electrochemical performance for lithium storage. - Abstract: Bimetallic nickel cobalt sulfide (Ni{sub 1.5}Co{sub 1.5}S{sub 4}) is successfully fabricated by an ultrafast and cost-effective microwave assisted hydrothermal method. When used as electrode material for lithium-ion batteries, Ni{sub 1.5}Co{sub 1.5}S{sub 4} exhibits the remarkable electrochemical performance in terms of superior cycling stability, excellent specific capacity and good rate capability. A high specific capacity of 443 mA h g{sup −1} after 200 charge-discharge cycles at a current density of 0.5 A g{sup −1} is achieved. Even at 1 A g{sup −1}, the sample still delivers a discharge capacity of 386 mA h g{sup −1} with a high columbic efficiency of 99.6% after 500 cycles.
FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).
Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro
2016-03-01
We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.
Extensive numerical study of a D-brane, anti-D-brane system in AdS5/CFT4
International Nuclear Information System (INIS)
Hegedűs, Árpád
2015-01-01
In this paper the hybrid-NLIE approach of http://dx.doi.org/10.1007/JHEP08(2012)022 is extended to the ground state of a D-brane anti-D-brane system in AdS/CFT. The hybrid-NLIE equations presented in the paper are finite component alternatives of the previously proposed TBA equations and they admit an appropriate framework for the numerical investigation of the ground state of the problem. Straightforward numerical iterative methods fail to converge, thus new numerical methods are worked out to solve the equations. Our numerical data confirm the previous TBA data. In view of the numerical results the mysterious L=1 case is also commented in the paper.
Fernandez, Camila; González, Maria Lorena; Muñoz, Claudia; Molina, Veronica; Farias, Laura
2015-05-01
Although N2 fixation could represent a supplementary source of bioavailable nitrogen in coastal upwelling areas and underlying oxygen minimum zones (OMZs), the limited data available prevent assessing its variability and biogeochemical significance. Here we report the most extensive N2 fixation data set gathered to date in the upwelling area off central Chile (36°S). It covers interannual to high frequency time scales in an area of about 82,500 km2 in the eastern South Pacific (ESP). Because heterotrophic N2 fixation may be regulated by DOM availability in the ESP, we conducted experiments at different oxygen conditions and included DOM amendments in order to test diazotrophic activity. Rates in the euphotic zone showed strong temporal variability which resulted in values reaching 0.5 nmol L-1 d-1 in 2006 (average 0.32 ± 0.17 nmol L-1 d-1) and up to 126.8 nmol L-1 d-1 (average 24.75 ± 37.9 nmol L-1 d-1) in 2011. N2 fixation in subsurface suboxic conditions (1.5 ± 1.16 nmol L-1 d-1) also occurred mainly during late summer and autumn while virtually absent in winter. The diversity of diazotrophs was dominated by heterotrophs, with higher richness in surface compared to OMZ waters. Rates in oxygen depleted conditions could exceed values obtained in the euphotic layer, but rates were not dependent on the availability of dissolved organic matter. N2 fixation also showed a positive correlation with total chlorophyll and the C:N ratio of phytoplankton, but not to the P excess compared to N. We conclude that the diazotrophic community responds to the composition of phytoplankton rather than the extent of N deficiency and the availability of bulk DOM in this system.
5th International Symposium on Positive Systems
Farina, Lorenzo; Setola, Roberto; Germani, Alfredo
2017-01-01
This book presents high-quality original contributions on positive systems, including topics such as: monotone dynamical systems in mathematical biology and game theory; mathematical developments for networked systems in biology, chemistry and the social sciences; linear and nonlinear positive operators; dynamical analysis, observation and control of positive distributed parameter systems; stochastic realization theory; biological systems with positive variables and positive controls; iterated function systems; nonnegative dynamic processes; and dimensioning problems for collaborative systems. The book comprises a selection of the best papers presented at the POSTA 2016, the 5th International Symposium on Positive Systems, which was held in Rome, Italy, in September 2016. This conference series represents a targeted response to the growing need for research that reports on and critically discusses a wide range of topics concerning the theory and applications of positive systems.
Functional Analysis Of A Selected Airport’s System
Directory of Open Access Journals (Sweden)
Dudek Ewa
2015-11-01
Full Text Available In this paper two selected airport’s systems (Flight Information System and Public Address Voice Annunciation are defined and described. Then they are used to create an integrated unit, with the presentation of its way of functioning and a schematic picture. The author names main purposes of the integration process, serving to counteract negative consequences arising from implementation of the increasing number of systems on transport objects. In the following part of the article functional analysis of the integrated unit is carried out, defining system’s possible states of work and relations between them. Utilization of mathematical apparatus allows to calculate probabilities of system staying in the respective states, as well as system’s time indexes. Presented results are a fundament for the further analysis of this matter.
Characterization of 5-hydroxytryptamine receptors in the cardiovascular system
A.H.A. Bom (Anton)
1990-01-01
textabstractUntil recently, mainly rats, guinea pigs, rabbits, cats and dogs were used to study the cardiovascular effects of 5-HT. From these studies it was clear that for some effects of 5-HT (e.g. 5-HT-induced tachycardia) there exists a large heterogeneity with respect to receptor subtype(s)
Balloon-assisted coiling through a 5-French system
International Nuclear Information System (INIS)
White, J. Bradley; Layton, Kennith F.; Kallmes, David F.; Cloft, Harry J.
2007-01-01
We present a catheter technique that utilizes a 5F system for the purpose of balloon-assisted coiling in the setting of intracranial aneurysms. A standard 5F short sheath is placed in the common femoral artery, and a 5F diagnostic catheter is placed through the sheath and used for selective vessel angiography. When endovascular intervention is pursued, the diagnostic catheter is placed in the appropriate vessel and systemic heparinization is ensured. Over an exchange length wire, the 5F vertebral catheter and 5F short sheath are exchanged for a 5F Shuttle (Cook) sheath. We then routinely place a 10, 14 or 18 microcatheter over an appropriately gauged microguidewire into the aneurysm. As needed, balloon catheters are then placed across the neck of the aneurysm for remodeling purposes. During the course of the procedure, control angiography is performed through the Shuttle sheath. Following the placement of coils, the microcatheter and balloon catheter are removed and a final biplane image is obtained via the 5F Shuttle sheath. This technique has been employed in 15 patients who required balloon-assisted coiling of an intracranial aneurysm. There were no technical difficulties or arterial access site complications from the procedures. Catheter mobility and torque were not affected, nor was the quality of our imaging. We conclude that this small-diameter system provides ample ''room'' for catheter placement and interventional treatment while reducing the known risks of postprocedural complications. Angiographic images remain excellent and are comparable to those obtained by larger catheters. (orig.)
ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV
Douet , Julien
2008-01-01
In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...
Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-04-07
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
(5S,6R-5-Methyl-6-phenyl-4-propyl-1,3,4-oxadiazinane-2-thione
Directory of Open Access Journals (Sweden)
Joshua L. Kocher
2009-06-01
Full Text Available The title molecule, C13H18N2OS, is an oxadiazinanthione derived from (1R,2S-norephedrine. There are two molecules in the asymmetric. Both adopt roughly half-chair conformations; however, the 5-position carbon orients out of opposite faces of the oxadiazinanthiones plane in the two molecules. In the crystal structure, they are oriented as a dimer linked by a pair of N—H...S hydrogen bonds. The absolute configuration has been established from anomalous dispersion and confirms the known stereochemistry based on the synthetic procedure.
The fabrication and analysis of a PbS nanocrystal:C{sub 60} bilayer hybrid photovoltaic system
Energy Technology Data Exchange (ETDEWEB)
Dissanayake, D M N M [Solid State Electronics Laboratory, University of Michigan, Ann Arbor, MI 48109-2122 (United States); Hatton, R A [Department of Chemistry, University of Warwick, Coventry CV4 7AL (United Kingdom); Lutz, T [Department of Chemistry, Imperial College, London SW7 2AY (United Kingdom); Curry, R J; Silva, S R P [Advanced Technology Institute, University of Surrey, Guildford GU2 7XH (United Kingdom)], E-mail: ndissa@umich.edu
2009-06-17
A near-infrared sensitive hybrid photovoltaic system between PbS nanocrystals (PbS-NCs) and C{sub 60} is demonstrated. Up to 0.44% power conversion efficiency is obtained under AM1.5G with a short circuit current density (J{sub sc}) of 5 mA cm{sup -2} when the PbS-NC layer is treated in anhydrous methanol. The observed J{sub sc} is found be approximately one-third of the maximum expected from this hybrid configuration, indicating the potential for further optimization. Crucial for device operation, a smooth film of nanocrystals is seen to form on the hole transporting poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) layer deposited on the transparent electrode, facilitated through an ionic interaction between nanocrystal capping ligands and the PEDOT:PSS. The formation of the open circuit voltage in this system is seen to be influenced by an interfacial dipole formed at the hole-extracting electrode, providing insights for further optimization.
On N=8 supergravity in AdS5 and N=4 superconformal Yang-Mills theory
International Nuclear Information System (INIS)
Ferrara, S.; Zaffaroni, A.; Froensdal, C.
1998-01-01
We discuss the spectrum of states of IIB supergravity on AdS 5 x S 5 in a manifest SU(2,2/4) invariant setting. The boundary fields are described in terms of N=4 superconformal Yang-Mills theory and the proposed correspondence between supergravity in AdS 5 and superconformal invariant singleton theory at the boundary is formulated in a N=4 superfield covariant language. (orig.)
Long-term conversion of 45S5 bioactive glass-ceramic microspheres in aqueous phosphate solution.
Fu, Hailuo; Rahaman, Mohamed N; Day, Delbert E; Huang, Wenhai
2012-05-01
The conversion of 45S5 glass and glass-ceramics to a hydroxyapatite (HA)-like material in vitro has been studied extensively, but only for short reaction times (typically glass-ceramic microspheres (designated 45S5c) in an aqueous phosphate solution. Microspheres of 45S5c (75-150 μm) were immersed for 10 years at room temperature (~25 °C) in K(2)HPO(4) solution with a concentration of 0.01 M or 1.0 M, and with a starting pH of 7.0 or 9.5. The reacted 45S5c microspheres and solutions were analyzed using structural and analytical techniques. Only 25-45 vol% of the 45S5c microspheres were converted to an HA-like material after the 10 year reaction. In solutions with a starting pH of 9.5, an increase in the K(2)HPO(4) concentration from 0.01 to 1.0 M resulted in a doubling of the volume of the microspheres converted to an HA-like material but had little effect on the composition of the HA-like product. In comparison, reaction of the 45S5c microspheres in the solution with a starting pH of 7.0 resulted in an HA-like product in the 0.01 M K(2)HPO(4) solution but a calcium pyrophosphate product, Ca(10)K(4)(P(2)O(7))(6).9H(2)O, in the 1.0 M solution. The consequences of these results for the long-term use of 45S5 glass-ceramics in biomedical applications are discussed.
Y(5S): What has been learned and what can be learned
International Nuclear Information System (INIS)
Blusk, S.R.
2007-01-01
We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future
International Nuclear Information System (INIS)
Horvatic, V.; Vadla, C.; Movre, M.
1993-01-01
The collisional excitation transfer for the processes Rb * (5P 3/2 ) + K(4S 1/2 ) → Rb(5S 1/2 ) + K * (4P J ), J = 1/2, 3/2, was investigated using two-photon laser excitation techniques with a thermionic heat-pipe diode as a detector. The population densities of the K 4P J levels induced by collisions with excited Rb atoms as well as those produced by direct laser excitation of the potassium atoms were probed through the measurement of the thermionic signals generated due to the ionization of the potassium atoms emerging from the K(4P J ) → K(7S 1/2 ) excitation channel. (orig./WL)
Efficacy of RTS,S/AS01E vaccine against malaria in children 5 to 17 months of age
DEFF Research Database (Denmark)
Bejon, Philip; Lusingu, John; Olotu, Ally
2008-01-01
. We evaluated the efficacy of RTS,S given with a more immunogenic adjuvant system (AS01E) in children 5 to 17 months of age, a target population for vaccine licensure. METHODS: We conducted a double-blind, randomized trial of RTS,S/AS01E vaccine as compared with rabies vaccine in children in Kilifi...... vaccine or the control (rabies) vaccine. Among the 809 children who completed the study procedures according to the protocol, the cumulative number in whom clinical malaria developed was 32 of 402 assigned to receive RTS,S/AS01E and 66 of 407 assigned to receive the rabies vaccine; the adjusted efficacy...... rate for RTS,S/AS01E was 53% (95% confidence interval [CI], 28 to 69; Prabies vaccine, with an adjusted rate of efficacy...
The Earth System Prediction Suite: Toward a Coordinated U.S. Modeling Capability
Theurich, Gerhard; DeLuca, C.; Campbell, T.; Liu, F.; Saint, K.; Vertenstein, M.; Chen, J.; Oehmke, R.; Doyle, J.; Whitcomb, T.;
2016-01-01
The Earth System Prediction Suite (ESPS) is a collection of flagship U.S. weather and climate models and model components that are being instrumented to conform to interoperability conventions, documented to follow metadata standards, and made available either under open source terms or to credentialed users.The ESPS represents a culmination of efforts to create a common Earth system model architecture, and the advent of increasingly coordinated model development activities in the U.S. ESPS component interfaces are based on the Earth System Modeling Framework (ESMF), community-developed software for building and coupling models, and the National Unified Operational Prediction Capability (NUOPC) Layer, a set of ESMF-based component templates and interoperability conventions. This shared infrastructure simplifies the process of model coupling by guaranteeing that components conform to a set of technical and semantic behaviors. The ESPS encourages distributed, multi-agency development of coupled modeling systems, controlled experimentation and testing, and exploration of novel model configurations, such as those motivated by research involving managed and interactive ensembles. ESPS codes include the Navy Global Environmental Model (NavGEM), HYbrid Coordinate Ocean Model (HYCOM), and Coupled Ocean Atmosphere Mesoscale Prediction System (COAMPS); the NOAA Environmental Modeling System (NEMS) and the Modular Ocean Model (MOM); the Community Earth System Model (CESM); and the NASA ModelE climate model and GEOS-5 atmospheric general circulation model.
Origin of the solar system s-process abundances
International Nuclear Information System (INIS)
Malaney, R.A.; Boothroyd, A.I.
1987-01-01
In the search for the origin of the solar system s-process abundances much attention has been focused on the intershell zones of thermally pulsing asymptotic giant branch (AGB) stars. It has recently been suggested that, relative to the poor fits obtained from intermediate-mass AGB models, low-mass AGB models may result in much better fits to the observed solar system abundances. This suggestion was motivated by the high intershell base temperatures indicated by recent low-mass AGB calculations. Using new data, presented for the peak intershell base temperature in such stars, the s-process enhancements occurring in the intershell zones of low-mass AGB stars are calculated. A nonsolar distribution of s-process abundances is reported for all realistic AGB models studied. Other possible astrophysical sites for the origin of the solar system s-process abundances are discussed. 35 references
BASIN-CENTERED GAS SYSTEMS OF THE U.S.
Energy Technology Data Exchange (ETDEWEB)
Marin A. Popov; Vito F. Nuccio; Thaddeus S. Dyman; Timothy A. Gognat; Ronald C. Johnson; James W. Schmoker; Michael S. Wilson; Charles Bartberger
2000-11-01
The USGS is re-evaluating the resource potential of basin-centered gas accumulations in the U.S. because of changing perceptions of the geology of these accumulations, and the availability of new data since the USGS 1995 National Assessment of United States oil and gas resources (Gautier et al., 1996). To attain these objectives, this project used knowledge of basin-centered gas systems and procedures such as stratigraphic analysis, organic geochemistry, modeling of basin thermal dynamics, reservoir characterization, and pressure analysis. This project proceeded in two phases which had the following objectives: Phase I (4/1998 through 5/1999): Identify and describe the geologic and geographic distribution of potential basin-centered gas systems, and Phase II (6/1999 through 11/2000): For selected systems, estimate the location of those basin-centered gas resources that are likely to be produced over the next 30 years. In Phase I, we characterize thirty-three (33) potential basin-centered gas systems (or accumulations) based on information published in the literature or acquired from internal computerized well and reservoir data files. These newly defined potential accumulations vary from low to high risk and may or may not survive the rigorous geologic scrutiny leading towards full assessment by the USGS. For logistical reasons, not all basins received the level of detail desired or required.
The 4.5 S RNA gene of Escherichia coli is essential for cell growth
DEFF Research Database (Denmark)
Brown, S; Fournier, M J
1984-01-01
The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
Directory of Open Access Journals (Sweden)
Morteza Shojaei Moghadam
2010-01-01
Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Expression and purification of recombinant Shiga toxin 2B from ...
African Journals Online (AJOL)
sunny t
2016-05-25
May 25, 2016 ... MATERIALS AND METHODS. Bacterial strains, plasmid and media ... toxin 2B gene after purified by wizard genomic DNA purification kit. (Promega, USA) ..... This result was approximately two times higher compared to Halo .... manual, 3rd Eds. New York: Cold Spring Harbor Laboratory Press,. Cold Spring ...
Masses of T/sub z/ = +5/2 nuclei in the s--d shell from β--decay measurements
International Nuclear Information System (INIS)
Alburger, D.E.; Goosman, D.R.; Davids, C.N.; Hardy, J.C.
1975-01-01
In this work the existence of five new T/sub z/ = + 5 / 2 nuclides, 23 F, 29 Mg, 31 Al, 33 Si, and 35 P, was established; their properties, including mass values, were determined, along with those of 25 Ne and 27 Na. Two experimental techniques were used, the ''rabbit'' transfer of a solid target and the gas transfer system; some novel features of these are described. A β spectrum of 33 Si observed in coincidence with 1848-keV γ rays is shown; a mass excess of -20569 +- 50 keV was derived for 33 Si. Attempts to produce 21 O were unsuccessful. Comparisons of the measured masses of the T/sub z/ = + 5 / 2 nuclides in the 2s--1d shell with predictions of the Garvey--Kelson mass formulation and with shell-model calculations are shown. The latter produce considerably better agreement with experiment. (3 figures, 1 table) (U.S.)
Observation of superconductivity in BaNb2S5
Smith, M. G.; Neumeier, J. J.
2018-06-01
Bulk superconductivity is reported in BaNb2S5 at the transition temperature Tc = 0.85(1) K. The electrical resistivity ρ versus T is metallic with ρ(2 K) = 42.4 μΩ cm. The magnetic susceptibility is paramagnetic, with temperature-independent contributions due to diamagnetism, Pauli paramagnetism, and Van Vleck paramagnetism; a Curie-Weiss contribution appears to be impurity related. Hall effect measurements show that the majority charge carriers are electrons with charge-carrier concentration n(3 K) = 2.40(2) × 1021 cm-3. Specific heat measurements reveal an electronic specific heat coefficient γ = 11.2(1) mJ/mol K2, a Debye temperature ΘD = 126.4(8) K, and an energy gap associated with the superconducting state of Eg = 0.184(4) meV. Measurements of ρ(T) in magnetic field provide the upper critical magnetic field of about 3055(74) Oe as T → 0 K, which was used to estimate the coherence length ξ = 6.21(15) nm. The results allow classification of BaNb2S5 as a Type II, BCS superconductor in the dirty limit.
5-Gb/s 0.18-μm CMOS 2:1 multiplexer with integrated clock extraction
International Nuclear Information System (INIS)
Zhang Changchun; Wang Zhigong; Shi Si; Miao Peng; Tian Ling
2009-01-01
A 5-Gb/s 2:1 MUX (multiplexer) with an on-chip integrated clock extraction circuit which possesses the function of automatic phase alignment (APA), has been designed and fabricated in SMIC's 0.18 μm CMOS technology. The chip area is 670 x 780 μm 2 . At a single supply voltage of 1.8 V, the total power consumption is 112 mW with an input sensitivity of less than 50 mV and an output single-ended swing of above 300 mV. The measurement results show that the IC can work reliably at any input data rate between 1.8 and 2.6 Gb/s with no need for external components, reference clock, or phase alignment between data and clock. It can be used in a parallel optic-fiber data interconnecting system.
5-Gb/s 0.18-μm CMOS 2:1 multiplexer with integrated clock extraction
Changchun, Zhang; Zhigong, Wang; Si, Shi; Peng, Miao; Ling, Tian
2009-09-01
A 5-Gb/s 2:1 MUX (multiplexer) with an on-chip integrated clock extraction circuit which possesses the function of automatic phase alignment (APA), has been designed and fabricated in SMIC's 0.18 μm CMOS technology. The chip area is 670 × 780 μm2. At a single supply voltage of 1.8 V, the total power consumption is 112 mW with an input sensitivity of less than 50 mV and an output single-ended swing of above 300 mV. The measurement results show that the IC can work reliably at any input data rate between 1.8 and 2.6 Gb/s with no need for external components, reference clock, or phase alignment between data and clock. It can be used in a parallel optic-fiber data interconnecting system.
5 CFR 9701.405 - Performance management system requirements.
2010-01-01
... feedback, and developing, rating, and rewarding performance; and (6) Specify the criteria and procedures to... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Performance management system... HOMELAND SECURITY HUMAN RESOURCES MANAGEMENT SYSTEM Performance Management § 9701.405 Performance...
Cyber Security on Nuclear Power Plant's Computer Systems
Energy Technology Data Exchange (ETDEWEB)
Shin, Ick Hyun [Korea Institute of Nuclear Nonproliferation and Control, Daejeon (Korea, Republic of)
2010-10-15
Computer systems are used in many different fields of industry. Most of us are taking great advantages from the computer systems. Because of the effectiveness and great performance of computer system, we are getting so dependable on the computer. But the more we are dependable on the computer system, the more the risk we will face when the computer system is unavailable or inaccessible or uncontrollable. There are SCADA, Supervisory Control And Data Acquisition, system which are broadly used for critical infrastructure such as transportation, electricity, water management. And if the SCADA system is vulnerable to the cyber attack, it is going to be nation's big disaster. Especially if nuclear power plant's main control systems are attacked by cyber terrorists, the results may be huge. Leaking of radioactive material will be the terrorist's main purpose without using physical forces. In this paper, different types of cyber attacks are described, and a possible structure of NPP's computer network system is presented. And the paper also provides possible ways of destruction of the NPP's computer system along with some suggestions for the protection against cyber attacks
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Mahmoudvand, Zahra; Kamkar, Mehran; Shahmoradi, Leila; Nejad, Ahmadreza Farzaneh
2016-01-01
Background: Determination of minimum data set (MDS) in echocardiography reports is necessary for documentation and putting information in a standard way, and leads to the enhancement of electrocardiographic studies through having access to precise and perfect reports and also to the development of a standard database for electrocardiographic reports. Aim: to determine the minimum data set of echocardiography reporting system to exchange with Iran’s electronic health record (EHR) system. Methods: First, a list of minimum data set was prepared after reviewing texts and studying cardiac patients’ records. Then, to determine the content validity of the prepared MDS, the expert views of 10 cardiologists and 10 health information management (HIM) specialists were obtained; to estimate the reliability of the set, test-retest method was employed. Finally, the data were analyzed using SPSS software. Results: The highest degree of consensus was found for the following MDSs: patient’s name and family name (5), accepting doctor’s name and family name, familial death records due to cardiac disorders, the image identification code, mitral valve, aortic valve, tricuspid valve, pulmonary valve, left ventricle, hole, atrium valve, Doppler examination of ventricular and atrial movement models and diagnoses with an average of. Conclusions: To prepare a model of echocardiography reporting system to exchange with EHR system, creation a standard data set is the vital point. Therefore, based on the research findings, the minimum reporting system data to exchange with Iran’s electronic health record system include information on entity, management, medical record, carried-out acts, and the main content of the echocardiography report, which the planners of reporting system should consider. PMID:27147803