WorldWideScience

Sample records for s28 ribosomal binding

  1. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  2. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  3. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  4. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  5. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  6. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  7. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  8. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  9. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  10. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  11. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    Science.gov (United States)

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  12. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  13. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  14. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  15. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

    2013-10-22

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

  16. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  17. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  18. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  20. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  1. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  2. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  3. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Buck, M.; Cooperman, B.S.

    1990-01-01

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  4. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  5. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  6. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  7. Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

    Energy Technology Data Exchange (ETDEWEB)

    deLivron, M.; Robinson, V

    2008-01-01

    BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

  8. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  9. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  10. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  11. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  12. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  13. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  14. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  15. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J

    2012-07-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.

  16. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    Science.gov (United States)

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.

  17. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  18. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  19. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  20. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  1. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    OpenAIRE

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

  2. Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes

    Science.gov (United States)

    Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V

    1971-01-01

    Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558

  3. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  4. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  5. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  6. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  7. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  8. DISCRIMINATION 28S RIBOSOMAL GENE OF TREMATODE CERCARIAE IN SNAILS FROM CHIANG MAI PROVINCE, THAILAND.

    Science.gov (United States)

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil

    2016-03-01

    Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys.

  9. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  10. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  11. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  12. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  13. Structural Basis for Linezolid Binding Site Rearrangement in the Staphylococcus aureus Ribosome.

    Science.gov (United States)

    Belousoff, Matthew J; Eyal, Zohar; Radjainia, Mazdak; Ahmed, Tofayel; Bamert, Rebecca S; Matzov, Donna; Bashan, Anat; Zimmerman, Ella; Mishra, Satabdi; Cameron, David; Elmlund, Hans; Peleg, Anton Y; Bhushan, Shashi; Lithgow, Trevor; Yonath, Ada

    2017-05-09

    An unorthodox, surprising mechanism of resistance to the antibiotic linezolid was revealed by cryo-electron microscopy (cryo-EM) in the 70S ribosomes from a clinical isolate of Staphylococcus aureus This high-resolution structural information demonstrated that a single amino acid deletion in ribosomal protein uL3 confers linezolid resistance despite being located 24 Å away from the linezolid binding pocket in the peptidyl-transferase center. The mutation induces a cascade of allosteric structural rearrangements of the rRNA that ultimately results in the alteration of the antibiotic binding site. IMPORTANCE The growing burden on human health caused by various antibiotic resistance mutations now includes prevalent Staphylococcus aureus resistance to last-line antimicrobial drugs such as linezolid and daptomycin. Structure-informed drug modification represents a frontier with respect to designing advanced clinical therapies, but success in this strategy requires rapid, facile means to shed light on the structural basis for drug resistance (D. Brown, Nat Rev Drug Discov 14:821-832, 2015, https://doi.org/10.1038/nrd4675). Here, detailed structural information demonstrates that a common mechanism is at play in linezolid resistance and provides a step toward the redesign of oxazolidinone antibiotics, a strategy that could thwart known mechanisms of linezolid resistance. Copyright © 2017 Belousoff et al.

  14. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  15. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  16. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  17. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  18. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  19. A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

    Directory of Open Access Journals (Sweden)

    Andrea Ciammaruconi

    2008-01-01

    Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

  20. Bacterial effector binding to ribosomal protein s3 subverts NF-kappaB function.

    Directory of Open Access Journals (Sweden)

    Xiaofei Gao

    2009-12-01

    Full Text Available Enteric bacterial pathogens cause food borne disease, which constitutes an enormous economic and health burden. Enterohemorrhagic Escherichia coli (EHEC causes a severe bloody diarrhea following transmission to humans through various means, including contaminated beef and vegetable products, water, or through contact with animals. EHEC also causes a potentially fatal kidney disease (hemolytic uremic syndrome for which there is no effective treatment or prophylaxis. EHEC and other enteric pathogens (e.g., enteropathogenic E. coli (EPEC, Salmonella, Shigella, Yersinia utilize a type III secretion system (T3SS to inject virulence proteins (effectors into host cells. While it is known that T3SS effectors subvert host cell function to promote diarrheal disease and bacterial transmission, in many cases, the mechanisms by which these effectors bind to host proteins and disrupt the normal function of intestinal epithelial cells have not been completely characterized. In this study, we present evidence that the E. coli O157:H7 nleH1 and nleH2 genes encode T3SS effectors that bind to the human ribosomal protein S3 (RPS3, a subunit of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kappaB transcriptional complexes. NleH1 and NleH2 co-localized with RPS3 in the cytoplasm, but not in cell nuclei. The N-terminal region of both NleH1 and NleH2 was required for binding to the N-terminus of RPS3. NleH1 and NleH2 are autophosphorylated Ser/Thr protein kinases, but their binding to RPS3 is independent of kinase activity. NleH1, but not NleH2, reduced the nuclear abundance of RPS3 without altering the p50 or p65 NF-kappaB subunits or affecting the phosphorylation state or abundance of the inhibitory NF-kappaB chaperone IkappaBalpha NleH1 repressed the transcription of a RPS3/NF-kappaB-dependent reporter plasmid, but did not inhibit the transcription of RPS3-independent reporters. In contrast, NleH2 stimulated RPS3-dependent transcription, as well

  1. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  2. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  3. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  5. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... protein S28 gene (RPS28) from the Giant Panda. Wan-ru Hou1* .... Materials. Skeletal muscle was collected from a dead Giant Panda at the Wo- ... synthesis. ... 72°C for 3 min in the first cycle and the anneal temperature decea- ..... laboratory manual 2nd ed., Cold Spring Harbor Laboratory Press, Cold.

  6. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  7. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  8. Impact of ribosomal modification on the binding of the antibiotic telithromycin using a combined grand canonical monte carlo/molecular dynamics simulation approach.

    Directory of Open Access Journals (Sweden)

    Meagan C Small

    Full Text Available Resistance to macrolide antibiotics is conferred by mutation of A2058 to G or methylation by Erm methyltransferases of the exocyclic N6 of A2058 (E. coli numbering that forms the macrolide binding site in the 50S subunit of the ribosome. Ketolides such as telithromycin mitigate A2058G resistance yet remain susceptible to Erm-based resistance. Molecular details associated with macrolide resistance due to the A2058G mutation and methylation at N6 of A2058 by Erm methyltransferases were investigated using empirical force field-based simulations. To address the buried nature of the macrolide binding site, the number of waters within the pocket was allowed to fluctuate via the use of a Grand Canonical Monte Carlo (GCMC methodology. The GCMC water insertion/deletion steps were alternated with Molecular Dynamics (MD simulations to allow for relaxation of the entire system. From this GCMC/MD approach information on the interactions between telithromycin and the 50S ribosome was obtained. In the wild-type (WT ribosome, the 2'-OH to A2058 N1 hydrogen bond samples short distances with a higher probability, while the effectiveness of telithromycin against the A2058G mutation is explained by a rearrangement of the hydrogen bonding pattern of the 2'-OH to 2058 that maintains the overall antibiotic-ribosome interactions. In both the WT and A2058G mutation there is significant flexibility in telithromycin's imidazole-pyridine side chain (ARM, indicating that entropic effects contribute to the binding affinity. Methylated ribosomes show lower sampling of short 2'-OH to 2058 distances and also demonstrate enhanced G2057-A2058 stacking leading to disrupted A752-U2609 Watson-Crick (WC interactions as well as hydrogen bonding between telithromycin's ARM and U2609. This information will be of utility in the rational design of novel macrolide analogs with improved activity against methylated A2058 ribosomes.

  9. Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

    1977-01-01

    The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  11. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

    Science.gov (United States)

    Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

    2004-12-01

    Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

  12. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  13. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    Science.gov (United States)

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  14. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  15. Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.

    2008-01-01

    The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

  16. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

    2017-08-28

    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  17. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  18. Development of a Single-Step Subtraction Method for Eukaryotic 18S and 28S Ribonucleic Acids

    Directory of Open Access Journals (Sweden)

    Marie J. Archer

    2011-01-01

    Full Text Available The abundance of mammalian 18S and 28S ribosomal RNA can decrease the detection sensitivity of bacterial or viral targets in complex host-pathogen mixtures. A method to capture human RNA in a single step was developed and characterized to address this issue. For this purpose, capture probes were covalently attached to magnetic microbeads using a dendrimer linker and the solid phase was tested using rat thymus RNA (mammalian components with Escherichia coli RNA (bacterial target as a model system. Our results indicated that random capture probes demonstrated better performance than specific ones presumably by increasing the number of possible binding sites, and the use of a tetrame-thylammonium-chloride (TMA-Cl- based buffer for the hybridization showed a beneficial effect in the selectivity. The subtraction efficiency determined through real-time RT-PCR revealed capture-efficiencies comparable with commercially available enrichment kits. The performance of the solid phase can be further fine tuned by modifying the annealing time and temperature.

  19. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  20. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  1. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  2. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  3. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  4. Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

    Science.gov (United States)

    Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

    2017-05-27

    Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

    Science.gov (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

    2016-09-01

    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  6. Filogenia de hongos roya (Uredinales en la zona andina colombiana mediante el uso de secuencias del ADN ribosomal 28S

    Directory of Open Access Journals (Sweden)

    Catalina Zuluaga

    2011-06-01

    Full Text Available Los hongos roya (Uredinales, Basidiomycetes representan uno de los grupos de fitoparásitos más diversos y con mayor importancia económica agrícola mundial. Su taxonomía se ha basado en el estudio de caracteres morfológicos, que resulta en muchos casos en la formación de taxones polifiléticos. Sin embargo, en los últimos años se han tratado de incorporar herramientas moleculares que conduzcan a la generación de sistemas de clasificación basados en afinidades evolutivas. Este trabajo pretendió aumentar la base del conocimiento sobre la uredobiota tropical, mediante el estudio de características morfológicas y filogenéticas de un grupo de royas de los Andes de Colombia. Para esto se secuenció parte de la región 28S del ADNr y se realizó un análisis de agrupamiento mediante Máxima parsimonia. Los resultados confirmaron la validez de las familias Pucciniaceae, Phakopsoraceae, Phragmidiaceae, Pileolariaceae, Mikronegeriaceae, Coleosporiaceae y Cronartiaceae, mientras que Pucciniosiraceae es un taxón redundante con Pucciniaceae. Por su parte, Uropyxidaceae, Raveneliaceae, Chaconiaceae y Pucciniastraceae se muestran como familias polifiléticas. Aparentemente Melampsoraceae se presenta como un taxón basal al grupo. La información que se deriva de este estudio se espera sea incorporada en los estudios mundiales que buscan redefinir el sistema taxonómico de los hongos roya.Phylogenetic analysis of rust fungi (Uredinales from the Colombian Andean region using 28S ribosomal DNA sequences. Rust fungi (Uredinales, Basidiomycetes are one of the most diverse and economically important plant-obligated parasites. Taxonomy of this group has been under revision during the last years using molecular techniques to define phylogenetic relationships. In this study we evaluated the phylogenetic affinities of a group of 40 rust fungi obtained from different plants in the Colombian Andean region using sequence analysis of the 28S ribosomal DNA

  7. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

    Science.gov (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

    2018-04-21

    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  8. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  9. Phylogenetic relationships of click beetles (Coleoptera: Elateridae) inferred from 28S ribosomal DNA: insights into the evolution of bioluminescence in Elateridae.

    Science.gov (United States)

    Sagegami-Oba, Reiko; Oba, Yuichi; Ohira, Hitoo

    2007-02-01

    Although the taxonomy of click beetles (family Elateridae) has been studied extensively, inconsistencies remain. We examine here the relationships between species of Elateridae based on partial sequences of nuclear 28S ribosomal DNA. Specimens were collected primarily from Japan, while luminous click beetles were also sampled from Central and South America to investigate the origins of bioluminescence in Elateridae. Neighbor-joining, maximum-parsimony, and maximum-likelihood analyses produced a consistent basal topology with high statistical support that is partially congruent with the results of previous investigations based on the morphological characteristics of larvae and adults. The most parsimonious reconstruction of the "luminous" and "nonluminous" states, based on the present molecular phylogeny, indicates that the ancestral state of Elateridae was nonluminous. This suggests that the bioluminescence in click beetle evolved independent of that of other luminous beetles, such as Lampyridae, despite their common mechanisms of bioluminescence.

  10. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  11. Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

    International Nuclear Information System (INIS)

    Gross, M.; Redman, R.; Kaplansky, D.A.

    1985-01-01

    The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

  12. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  13. 11C-PBR28 binding to translocator protein increases with progression of Alzheimer’s disease

    OpenAIRE

    Kreisl, William C.; Lyoo, Chul Hyoung; Liow, Jeih-San; Wei, Monica; Snow, Joseph; Page, Emily; Jenko, Kimberly J.; Morse, Cheryl L.; Zoghbi, Sami S.; Pike, Victor W.; Turner, R. Scott; Innis, Robert B.

    2016-01-01

    This longitudinal study sought to determine whether the 18 kDa translocator protein (TSPO), a marker of neuroinflammation, increases over time in Alzheimer’s disease. Positron emission tomography (PET) imaging with the TSPO radioligand 11C-PBR28 imaging was performed at baseline and after a median follow-up of 2.7 years in 14 amyloid-positive patients and eight amyloid-negative controls. Patients had a greater increase in TSPO binding than controls in inferior parietal lobul...

  14. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  15. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  18. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.

    Science.gov (United States)

    Mustafi, Mainak; Weisshaar, James C

    2018-01-16

    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  20. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  1. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  2. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  3. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  4. Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

    International Nuclear Information System (INIS)

    Nowotny, V.; Nierhaus, K.H.

    1988-01-01

    A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

  5. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  6. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  7. The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.

    Science.gov (United States)

    Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco

    2014-12-18

    Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  9. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  11. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  12. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  13. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  15. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  16. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  17. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Radioautographic localization of somatostatin-14 and somatostatin-28 binding sites in the rat brain

    International Nuclear Information System (INIS)

    Leroux, P.; Pelletier, G.

    1984-01-01

    Somatostatin-14 (S14) and its precursor, somatostatin-28 (S28), are widely distributed throughout the rat brain, suggesting that they could act as neurotransmitter or neuromodulator in the central nervous system. The present study was undertaken to study the localization of S14 and S28 receptors in the rat brain determined by ''in vitro'' radioautography. The study performed on slide mounted frozen brain section with iodinated S14 and S28 analogs revealed an identical distribution of binding sites for the two forms of somatostatin. A good correlation could be observed between receptor distribution and immunohistologically localized neuropeptides except for striatum and hypothalamus. However, receptors were not detectable in the hypothalamus and were found in low concentration in the caudate-putamen nucleus, two regions containing high amounts of S28 and S14, suggesting a high occupancy of receptors in these areas by endogenous peptides or an inverse correlation between receptor and peptide concentrations

  19. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  20. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  1. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  2. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  3. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  4. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  5. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  6. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  7. Systematic relationships among Lutzomyia sand flies (Diptera: Psychodidae) of Peru and Colombia based on the analysis of 12S and 28S ribosomal DNA sequences.

    Science.gov (United States)

    Beati, Lorenza; Cáceres, Abraham G; Lee, Jamie A; Munstermann, Leonard E

    2004-02-01

    Lutzomyia spp. are New World phlebotomine sand flies, many of which are involved in the transmission of human diseases, such as leishmaniases and bartonellosis. The systematic classification of the approximately 400 species in the genus has been based on morphological characters, but the relationships within the genus are still very much in question. We have inferred phylogenies of 32 species of phlebotomine sand flies belonging to seven sub-genera and two species groups, by using fragments of the mitochondrial small subunit (12SrRNA) and of the nuclear large subunit (28SrRNA) ribosomal gene sequences. The subgenus Helcocyrtomyia and the Verrucarum species group, prominent representatives of the Peruvian sand fly fauna, were represented by 11 and 7 species, respectively. Although based on a limited number of taxa, the resulting phylogenies, based on 837 characters, provide an initial phylogenetic backbone for the progressive reconstruction of infrageneric relationships within Lutzomyia.

  8. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  9. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  10. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

    Science.gov (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

    2010-08-01

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  12. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  15. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  16. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  17. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    Science.gov (United States)

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  18. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  19. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

    Science.gov (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

    2003-09-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  20. Beyond Ribosomal Binding: The Increased Polarity and Aberrant Molecular Interactions of 3-epi-deoxynivalenol

    Directory of Open Access Journals (Sweden)

    Yousef I. Hassan

    2016-09-01

    Full Text Available Deoxynivalenol (DON is a secondary fungal metabolite and contaminant mycotoxin that is widely detected in wheat and corn products cultivated around the world. Bio-remediation methods have been extensively studied in the past two decades and promising ways to reduce DON-associated toxicities have been reported. Bacterial epimerization of DON at the C3 carbon was recently reported to induce a significant loss in the bio-toxicity of the resulting stereoisomer (3-epi-DON in comparison to the parental compound, DON. In an earlier study, we confirmed the diminished bio-potency of 3-epi-DON using different mammalian cell lines and mouse models and mechanistically attributed it to the reduced binding of 3-epi-DON within the ribosomal peptidyl transferase center (PTC. In the current study and by inspecting the chromatographic behavior of 3-epi-DON and its molecular interactions with a well-characterized enzyme, Fusarium graminearum Tri101 acetyltransferase, we provide the evidence that the C3 carbon epimerization of DON influences its molecular interactions beyond the abrogated PTC binding.

  1. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  2. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  3. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  4. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Wang Yuzhen; Chen Ling; Liu Xinrong; Cheng Dengfeng; Liu Guozheng; Liu Yuxia; Dou Shuping; Hnatowich, Donald J.; Rusckowski, Mary

    2013-01-01

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99m Tc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99m Tc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99m Tc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99m Tc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99m Tc-AGEN and 99m Tc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99m Tc labeled MORF probes AGEN

  5. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  8. Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

    Science.gov (United States)

    Martínez, Fernando; Daròs, José-Antonio

    2014-09-01

    The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

  9. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  10. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  11. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  12. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  13. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  14. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  15. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  16. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  18. Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

    Science.gov (United States)

    Srikant, C B; Dahan, A; Craig, C

    1990-02-04

    The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2

  19. Further biochemical characterization of Mycobacterium leprae laminin-binding proteins

    Directory of Open Access Journals (Sweden)

    M.A.M. Marques

    2001-04-01

    Full Text Available It has been demonstrated that the alpha2 chain of laminin-2 present on the surface of Schwann cells is involved in the process of attachment of Mycobacterium leprae to these cells. Searching for M. leprae laminin-binding molecules, in a previous study we isolated and characterized the cationic proteins histone-like protein (Hlp and ribosomal proteins S4 and S5 as potential adhesins involved in M. leprae-Schwann cell interaction. Hlp was shown to bind alpha2-laminins and to greatly enhance the attachment of mycobacteria to ST88-14 Schwann cells. In the present study, we investigated the laminin-binding capacity of the ribosomal proteins S4 and S5. The genes coding for these proteins were PCR amplified and their recombinant products were shown to bind alpha2-laminins in overlay assays. However, when tested in ELISA-based assays and in adhesion assays with ST88-14 cells, in contrast to Hlp, S4 and S5 failed to bind laminin and act as adhesins. The laminin-binding property and adhesin capacity of two basic host-derived proteins were also tested, and only histones, but not cytochrome c, were able to increase bacterial attachment to ST88-14 cells. Our data suggest that the alanine/lysine-rich sequences shared by Hlp and eukaryotic H1 histones might be involved in the binding of these cationic proteins to laminin.

  20. Subcellular localization of Bombyx mori ribosomal protein S3a and ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... In the present study, using a BV/PH-Bms3a-EGFP, we found that Bombyx mori ribosomal protein S3a. (BmS3a) with EGFP fused to its C-terminal, was predominantly localized in the cytoplasm of B. mori cells. Subsequently, to investigate the effect of BmS3a over-expression on BmNPV infection both at the.

  1. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  2. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.

    1979-01-01

    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  3. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  5. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  6. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr

    2016-03-25

    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

  7. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

    International Nuclear Information System (INIS)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill

    2016-01-01

    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

  8. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  9. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  10. Distribution of protein and RNA in the 30S ribosomal subunit

    International Nuclear Information System (INIS)

    Ramakrishnan, V.

    1986-01-01

    In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

  11. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  12. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  13. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola

    2004-04-01

    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  14. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  15. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  16. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  17. Redox Behavior of the S-Adenosylmethionine (SAM)-Binding Fe-S Cluster in Methylthiotransferase RimO, toward Understanding Dual SAM Activity.

    Science.gov (United States)

    Molle, Thibaut; Moreau, Yohann; Clemancey, Martin; Forouhar, Farhad; Ravanat, Jean-Luc; Duraffourg, Nicolas; Fourmond, Vincent; Latour, Jean-Marc; Gambarelli, Serge; Mulliez, Etienne; Atta, Mohamed

    2016-10-18

    RimO, a radical-S-adenosylmethionine (SAM) enzyme, catalyzes the specific C 3 methylthiolation of the D89 residue in the ribosomal S 12 protein. Two intact iron-sulfur clusters and two SAM cofactors both are required for catalysis. By using electron paramagnetic resonance, Mössbauer spectroscopies, and site-directed mutagenesis, we show how two SAM molecules sequentially bind to the unique iron site of the radical-SAM cluster for two distinct chemical reactions in RimO. Our data establish that the two SAM molecules bind the radical-SAM cluster to the unique iron site, and spectroscopic evidence obtained under strongly reducing conditions supports a mechanism in which the first molecule of SAM causes the reoxidation of the reduced radical-SAM cluster, impeding reductive cleavage of SAM to occur and allowing SAM to methylate a HS - ligand bound to the additional cluster. Furthermore, by using density functional theory-based methods, we provide a description of the reaction mechanism that predicts the attack of the carbon radical substrate on the methylthio group attached to the additional [4Fe-4S] cluster.

  18. Generation and characterization of polyclonal antibodies specific to N-terminal extension of p85 isoform of ribosomal protein S6 kinase 1 (p85 S6K1

    Directory of Open Access Journals (Sweden)

    Savinska L. O.

    2015-08-01

    Full Text Available Aim. Generation of polyclonal antibodies specific to the ribosomal protein S6 kinase isoform – p85S6K1 and directed to the N-terminal (1–23 aa extension of p85S6K1. Methods. Animal immunization with synthetic (1–23 aa peptide, ELISA, Western blot, Immunoprecipitation, immunofluorescent analysis. Results. Polyclonal antibodies have been generated, which specifically recognize only p85 but not p70 isoform of S6K1 in western blot, immunoprecipitation and immunofluorescence analysis. Conclusions. The obtained antibodies can be recommended for studies on the p85S6K1 and other S6K1 isoforms possessing the N-terminal extension – the identification of binding protein partners, analysis of subcellular localization under different physiological conditions, elucidation of the signal transduction pathways involving different S6K1 isoforms.

  19. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  20. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  1. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  2. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  3. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  4. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  6. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10

    International Nuclear Information System (INIS)

    Pereira, Larissa Miranda

    2009-01-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813 Q M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by β- sheet feature. (author)

  7. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  8. Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Elena eIlina

    2013-07-01

    Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.

  9. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  10. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    International Nuclear Information System (INIS)

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-01-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  11. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: daves@strubi.ox.ac.uk [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  12. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within...... in the latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop...... the sequence Cm-C-U-C-G-m2A-psi-G2505 are important for pristinamycin IA binding and/or the antibiotic-dependent modification of 23S rRNA....

  13. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics. The Structures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.

    2009-01-01

    Structures have been obtained for the complexes tiamulin, homoharringtonine and bruceatin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.8 to 3.2 Å. They show that these inhibitors all block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl transferase center, which is universally conserved. In addition these structures support the hypothesis that the species-specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (E. coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms. PMID:19362093

  14. Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

    Science.gov (United States)

    Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

    2017-06-20

    The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    Directory of Open Access Journals (Sweden)

    Seema Dharni

    2014-01-01

    Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

  16. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

    Science.gov (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

    2012-07-13

    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  17. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  18. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  19. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  20. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  1. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  2. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  3. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  4. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  5. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  6. UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

    Energy Technology Data Exchange (ETDEWEB)

    Rao, K.N.; Swaminathan, S.; Burley, S. K.

    2008-12-11

    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  7. Insulin receptors mediate growth effects in cultured fetal neurons. II. Activation of a protein kinase that phosphorylates ribosomal protein S6

    International Nuclear Information System (INIS)

    Heidenreich, K.A.; Toledo, S.P.

    1989-01-01

    As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons

  8. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  9. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    Science.gov (United States)

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  10. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

    Science.gov (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

    2017-12-01

    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  11. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Science.gov (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  12. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  13. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  14. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  16. Small-molecule inhibitor leads of ribosome-inactivating proteins developed using the doorstop approach.

    Directory of Open Access Journals (Sweden)

    Yuan-Ping Pang

    2011-03-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxic because they bind to 28S rRNA and depurinate a specific adenine residue from the α-sarcin/ricin loop (SRL, thereby inhibiting protein synthesis. Shiga-like toxins (Stx1 and Stx2, produced by Escherichia coli, are RIPs that cause outbreaks of foodborne diseases with significant morbidity and mortality. Ricin, produced by the castor bean plant, is another RIP lethal to mammals. Currently, no US Food and Drug Administration-approved vaccines nor therapeutics exist to protect against ricin, Shiga-like toxins, or other RIPs. Development of effective small-molecule RIP inhibitors as therapeutics is challenging because strong electrostatic interactions at the RIP•SRL interface make drug-like molecules ineffective in competing with the rRNA for binding to RIPs. Herein, we report small molecules that show up to 20% cell protection against ricin or Stx2 at a drug concentration of 300 nM. These molecules were discovered using the doorstop approach, a new approach to protein•polynucleotide inhibitors that identifies small molecules as doorstops to prevent an active-site residue of an RIP (e.g., Tyr80 of ricin or Tyr77 of Stx2 from adopting an active conformation thereby blocking the function of the protein rather than contenders in the competition for binding to the RIP. This work offers promising leads for developing RIP therapeutics. The results suggest that the doorstop approach might also be applicable in the development of other protein•polynucleotide inhibitors as antiviral agents such as inhibitors of the Z-DNA binding proteins in poxviruses. This work also calls for careful chemical and biological characterization of drug leads obtained from chemical screens to avoid the identification of irrelevant chemical structures and to avoid the interference caused by direct interactions between the chemicals being screened and the luciferase reporter used in screening assays.

  17. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  18. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  19. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

    1982-01-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  20. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  1. Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

    International Nuclear Information System (INIS)

    Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

    2004-01-01

    We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

  2. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  3. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  4. Epstein-Barr virus-encoded EBNA-5 binds to Epstein-Barr virus-induced Fte1/S3a protein

    International Nuclear Information System (INIS)

    Kashuba, Elena; Yurchenko, Mariya; Szirak, Krisztina; Stahl, Joachim; Klein, George; Szekely, Laszlo

    2005-01-01

    Epstein-Barr virus (EBV) transforms resting human B cells into immortalized immunoblasts. EBV-encoded nuclear antigens EBNA-5 (also called EBNA-LP) is one of the earliest viral proteins expressed in freshly infected B cells. We have recently shown that EBNA-5 binds p14ARF, a nucleolar protein that regulates the p53 pathway. Here, we report the identification of another protein with partially nucleolar localization, the v-fos transformation effector Fte-1 (Fte-1/S3a), as an EBNA-5 binding partner. In transfected cells, Fte-1/S3a and EBNA-5 proteins showed high levels of colocalization in extranucleolar inclusions. Fte-1/S3a has multiple biological functions. It enhances v-fos-mediated cellular transformation and is part of the small ribosomal subunit. It also interacts with the transcriptional factor CHOP and apoptosis regulator poly(ADP-ribose) polymerase (PARP). Fte-1/S3a is regularly expressed at high levels in both tumors and cancer cell lines. Its high expression favors the maintenance of malignant phenotype and undifferentiated state, whereas its down-regulation is associated with cellular differentiation and growth arrest. Here, we show that EBV-induced B cell transformation leads to the up-regulation of Fte-1/S3a. We suggest that EBNA-5 through binding may influence the growth promoting, differentiation inhibiting, or apoptosis regulating functions of Fte-1/S3a

  5. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  6. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  8. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  9. HuR and Ago2 Bind the Internal Ribosome Entry Site of Enterovirus 71 and Promote Virus Translation and Replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available EV71 (enterovirus 71 RNA contains an internal ribosomal entry site (IRES that directs cap-independent initiation of translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs. We reported recently that mRNA decay factor AUF1 is a negative-acting ITAF that binds IRES stem-loop II. We also reported that the small RNA-processing enzyme Dicer produces at least four small RNAs (vsRNAs from the EV71 IRES. One of these, vsRNA1, derived from IRES stem-loop II, reduces IRES activity and virus replication. Since its mechanism of action is unknown, we hypothesized that it might control association of ITAFs with the IRES. Here, we identified the mRNA stability factor HuR and the RISC subunit Argonaute 2 (Ago2 as two ITAFs that bind stem-loop II. In contrast to AUF1, HuR and Ago2 promote EV71 IRES activity and virus replication. In vitro RNA-binding assays revealed that vsRNA1 can alter association of Ago2, HuR, and AUF1 with stem-loop II. This presents a possible mechanism by which vsRNA1 could control viral translation and replication.

  10. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  11. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  12. Influence of alcoholism and cholesterol on TSPO binding in brain: PET [11C]PBR28 studies in humans and rodents.

    Science.gov (United States)

    Kim, Sung Won; Wiers, Corinde E; Tyler, Ryan; Shokri-Kojori, Ehsan; Jang, Yeon Joo; Zehra, Amna; Freeman, Clara; Ramirez, Veronica; Lindgren, Elsa; Miller, Gregg; Cabrera, Elizabeth A; Stodden, Tyler; Guo, Min; Demiral, Şükrü B; Diazgranados, Nancy; Park, Luke; Liow, Jeih-San; Pike, Victor; Morse, Cheryl; Vendruscolo, Leandro F; Innis, Robert B; Koob, George F; Tomasi, Dardo; Wang, Gene-Jack; Volkow, Nora D

    2018-05-03

    Neuroinflammation appears to contribute to neurotoxicity observed with heavy alcohol consumption. To assess whether chronic alcohol results in neuroinflammation we used PET and [ 11 C]PBR28, a ligand that binds to the 18-kDa translocator protein (TSPO), to compare participants with an alcohol use disorder (AUD: n = 19) with healthy controls (HC: n = 17), and alcohol-dependent (n = 9) with -nondependent rats (n = 10). Because TSPO is implicated in cholesterol's transport for steroidogenesis, we investigated whether plasma cholesterol levels influenced [ 11 C]PBR28 binding. [ 11 C]PBR28 binding did not differ between AUD and HC. However, when separating by TSPO genotype rs6971, we showed that medium-affinity binders AUD participants showed lower [ 11 C]PBR28 binding than HC in regions of interest (whole brain, gray and white matter, hippocampus, and thalamus), but no group differences were observed in high-affinity binders. Cholesterol levels inversely correlated with brain [ 11 C]PBR28 binding in combined groups, due to a correlation in AUD participants. In rodents, we observed no differences in brain [ 11 C]PBR28 uptake between alcohol-dependent and -nondependent rats. These findings, which are consistent with two previous [ 11 C]PBR28 PET studies, may indicate lower activation of microglia in AUD, whereas failure to observe alcohol effects in the rodent model indicate that species differences do not explain the discrepancy with prior rodent autoradiographic studies reporting increases in TSPO binding with chronic alcohol. However, reduced binding in AUD participants could also reflect competition from endogenous TSPO ligands such as cholesterol; and since the rs6971 polymorphism affects the cholesterol-binding domain of TSPO this could explain why differences were observed only in medium-affinity binders.

  13. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    Science.gov (United States)

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Measurement of the Dissociation-Equilibrium Constants for Low Affinity Antibiotic Binding Interaction with Bacterial Ribosomes by the T2 (CPMG) and Line-Broadening Methods

    Science.gov (United States)

    Verdier, L.; Gharbi-Benarous, J.; Bertho, G.; Mauvais, P.; Girault, J.-P.

    1999-10-01

    In this study the dissociation constants of the low antibiotic-ribosomes interaction were determined by the T2 (CPMG), the Carr-Purcell-Meiboom-Gill spin-echo decay rate and the line-broadening methods. Three MLSB antibiotics were studied, a macrolide roxithromycin, a ketolide HMR 3647 and a lincosamide clindamycin for their weak interaction with three bacterial ribosomes, E. coli, Staphylococcus aureus sensitive and resistant to erythromycin. Nous avons mesuré la constante de dissociation, Kd correspondant à l'interaction faible antibiotique-ribosome bactérien pour des antibiotiques de différentes classes, un macrolide (roxithromycine), un kétolide (HMR 3647) et une lincosamide (clindamycine) avec des ribosomes de différentes souches bactériennes (E. coli, Staphylococcus aureus sensible ou résistant à l'erythromycin) par deux méthodes : l'une basée sur la variation des largeurs de raies et l'autre sur les temps de relaxation transversaux T2 en utilisant une séquence CPMG.

  15. RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins

    International Nuclear Information System (INIS)

    Hoffman, D.W.; Query, C.C.; Golden, B.L.; White, S.W.; Keene, J.D.

    1991-01-01

    An RNA recognition motif (RRM) of ∼80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel β-strands and two α-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent β-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface to the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins

  16. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  17. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  18. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    Science.gov (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  19. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  20. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  1. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  2. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  3. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  6. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    Science.gov (United States)

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

    2013-01-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  7. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics: The sStructures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gurel, G.; Blaha, G; Moore, P; Steitz,

    2009-01-01

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  8. Emergence of Tetracycline Resistance in Helicobacter pylori: Multiple Mutational Changes in 16S Ribosomal DNA and Other Genetic Loci

    Science.gov (United States)

    Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.

    2002-01-01

    Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699

  9. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  10. Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

    Science.gov (United States)

    Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

    2016-08-26

    Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  12. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  13. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...

  14. An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben

    2018-01-04

    sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  16. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  17. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  18. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  19. Biophysical characterization and functional studies on calbindin-D28K: A vitamin D-induced calcium-binding protein

    International Nuclear Information System (INIS)

    Leathers, V.L.

    1989-01-01

    Vitamin D dependent calcium binding protein, or calbindin-D, is the principal protein induced in the intestine in response to the steroid hormone 1,25(OH) 2 -vitamin D 3 . A definitive role for calbindin-D in vitamin D 3 mediated biological responses remains unclear. Biophysical and functional studies on chick intestinal calbindin-D 28K (CaBP) were initiated so that some insight might be gained into its relevance to the process of intestinal calcium transport. Calbindin-D belongs to a class of high affinity calcium binding proteins which includes calmodulin, parvalbumin and troponin C. The Ca 2+ binding stoichiometry and binding constants for calbindin-D 28K were quantitated by Quin 2 titration analysis. The protein was found to bind 5-6 Ca 2+ ions with a K D on the order of 10 -8 , in agreement with the 6 domains identified from the amino acid sequence. A slow Ca 2+ exchange rate (80 s -1 ) as assessed by 43 Ca NMR and extensive calcium dependent conformational changes in 1 H NMR spectra were also observed. Functional studies on chick intestinal CaBP were carried out by two different methods. Interactions between CaBP and intestinal cellular components were assessed via photoaffinity labeling techniques. Specific calcium dependent complexes for CaBP were identified with bovine intestinal alkaline phosphatase and brush border membrane proteins of 60 and 150 kD. CaBP was also found to co-migrate with the alkaline phosphatase activity of chick intestinal brush border membranes as evaluated by gel filtration chromatography. The second procedure for evaluating CaBP functionality has involved the quantitation of CaBP association with vesicular transport components as assessed by ELISA. CaBP, immunoreactivity was observed in purified lysosomes, microsomes and microtubules

  20. [Protein kinase A inhibitor H-89 blocks polyploidization of SP600125-induced CMK cells by regulating phosphorylation of ribosomal protein S6 kinase 1].

    Science.gov (United States)

    Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu

    2016-10-01

    Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.

  1. Characterization of Anti-Citrinin Specific ScFvs Selected from Non-Immunized Mouse Splenocytes by Eukaryotic Ribosome Display.

    Directory of Open Access Journals (Sweden)

    Haiwei Cheng

    Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.

  2. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  3. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  4. Mutations in the Bacterial Ribosomal Protein L3 and Their Association with Antibiotic Resistance

    Science.gov (United States)

    Klitgaard, Rasmus N.; Ntokou, Eleni; Nørgaard, Katrine; Biltoft, Daniel; Hansen, Lykke H.; Trædholm, Nicolai M.; Kongsted, Jacob

    2015-01-01

    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild-type genes with mutated L3 genes in a chromosomal L3 deletion strain. In this way, the essential L3 gene is available for the bacteria while allowing replacement of the wild type with mutated L3 genes. This enables investigation of the effect of single mutations in Escherichia coli without a wild-type L3 background. Ten plasmid-carried mutated L3 genes were constructed, and their effect on growth and antibiotic susceptibility was investigated. Additionally, computational modeling of the impact of L3 mutations in E. coli was used to assess changes in 50S structure and antibiotic binding. All mutations are placed in the loops of L3 near the PTC. Growth data show that 9 of the 10 mutations were well accepted in E. coli, although some of them came with a fitness cost. Only one of the mutants exhibited reduced susceptibility to linezolid, while five exhibited reduced susceptibility to tiamulin. PMID:25845869

  5. Chlamydia abortus YhbZ, a truncated Obg family GTPase, associates with the Escherichia coli large ribosomal subunit.

    Science.gov (United States)

    Polkinghorne, Adam; Vaughan, Lloyd

    2011-01-01

    The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.

    Directory of Open Access Journals (Sweden)

    Harry F Heijnen

    Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.

  7. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  8. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  9. Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

    1981-01-01

    The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

  10. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  11. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  12. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

    2017-01-01

    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  13. A pulse radiolysis investigation of the interactions of drugs and dyes with macromolecules and ribosomes

    International Nuclear Information System (INIS)

    Phillips, G.O.; Power, D.M.; Davies, J.V.

    1975-01-01

    The reactions of hydrated electrons produced during pulse radiolysis have been utilized to investigate the binding of eleven penicillins and four cephalosporins to bovine serum albumin. A primary binding site exists in the serum albumin molecule, which results indicate to be a hydrophobic cleft in the surface of the molecule separated by a distance > 0.5 mm from a cationic amino acid residue, probably lysine. Interaction of drugs with this binding site leads to a conformational change in the protein resulting in a decrease in reactivity towards hydrated electrons. Interaction of cephalosporin C and 6-amino penicillanic acid with serum albumin involves another site which consists of a cationic amino acid residue separted from anionic residue by a distance >0.7nm. Drug binding at this site induces a conformational change in serum albumin leading to greatly increased reactivity towards hydrated electrons. This increase is associated with an increased availability of disulphide bridges. Cephalosporin C also binds hydrophobically to serum a;lbumin resulting in a decrease in reactivity towards esub(aq)sup(-); such binding can be prevented by palmitic acid. Recent data clearly indicate that the pulse radiolysis technique can be further extended to investigate the nature of the interactions of bacterial ribosome suspensions with amino-acridines. Ion binding between benzoflavine and ribosomes has been examined over a wide temperature range and the thermodynamic parameters governing the interaction have been evaluated. (author)

  14. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Science.gov (United States)

    Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca

    2018-01-01

    Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829

  15. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Directory of Open Access Journals (Sweden)

    Sofia Mazzoleni

    2018-01-01

    Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.

  16. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  17. Test-retest reproducibility of [{sup 11}C]PBR28 binding to TSPO in healthy control subjects

    Energy Technology Data Exchange (ETDEWEB)

    Collste, K.; Forsberg, A.; Varrone, A.; Amini, N.; Halldin, C.; Farde, L.; Cervenka, S. [Karolinska Institutet, Department of Clinical Neuroscience, Centre for Psychiatry Research, Stockholm (Sweden); Aeinehband, S. [Karolinska Institutet, Department of Clinical Neuroscience, Neuroimmunology Unit, Stockholm (Sweden); Yakushev, I. [Karolinska Institutet, Department of Clinical Neuroscience, Centre for Psychiatry Research, Stockholm (Sweden); Technische Universitaet Muenchen, Department of Nuclear Medicine and TUM Neuroimaging Center (TUM-NIC), Munich (Germany)

    2016-01-15

    The PET radioligand [{sup 11}C]PBR28 binds to the translocator protein (TSPO), a marker of brain immune activation. We examined the reproducibility of [{sup 11}C]PBR28 binding in healthy subjects with quantification on a regional and voxel-by-voxel basis. In addition, we performed a preliminary analysis of diurnal changes in TSPO availability. Twelve subjects were examined using a high-resolution research tomograph and [{sup 11}C]PBR28, six in the morning and afternoon of the same day, and six in the morning on two separate days. Regional volumes of distribution (V{sub T}) were derived using a region-of-interest based two-tissue compartmental analysis (2TCM), as well as a parametric approach. Metabolite-corrected arterial plasma was used as input function. For the whole sample, the mean absolute variability in V{sub T} in the grey matter (GM) was 18.3 ± 12.7 %. Intraclass correlation coefficients in GM regions ranged from 0.90 to 0.94. Reducing the time of analysis from 91 to 63 min yielded a variability of 16.9 ± 14.9 %. There was a strong correlation between the parametric and 2TCM-derived GM values (r = 0.99). A significant increase in GM V{sub T} was observed between the morning and afternoon examinations when using secondary methods of quantification (p = 0.028). In the subjects examined at the same time of the day, the absolute variability was 15.9 ± 12.2 % for the 91-min 2TCM data. V{sub T} of [{sup 11}C]PBR28 binding showed medium reproducibility and high reliability in GM regions. Our findings support the use of parametric approaches for determining [{sup 11}C]PBR28 V{sub T} values, and indicate that the acquisition time could be shortened. Diurnal changes in TSPO binding in the brain may be a potential confounder in clinical studies and should be investigated further. (orig.)

  18. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  19. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  20. Halogenated benzimidazole inhibitors of phosphorylation, ''in vitro'' and ''in vivo'', of the surface acidic proteins of the yeast ribosomal 60S subunit by endogenous protein kinases CK-II and PK60S

    International Nuclear Information System (INIS)

    Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David

    1996-01-01

    Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs

  1. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  3. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  4. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  5. Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

    Science.gov (United States)

    Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

    2014-11-01

    Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  6. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  7. The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

    Science.gov (United States)

    Ponti, Donatella; Bellenchi, Gian Carlo; Puca, Rosa; Bastianelli, Daniela; Maroder, Marella; Ragona, Giuseppe; Roussel, Pascal; Thiry, Marc; Mercola, Dan; Calogero, Antonella

    2014-01-01

    EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF) leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

  8. The transcription factor EGR1 localizes to the nucleolus and is linked to suppression of ribosomal precursor synthesis.

    Directory of Open Access Journals (Sweden)

    Donatella Ponti

    Full Text Available EGR1 is an immediate early gene with a wide range of activities as transcription factor, spanning from regulation of cell growth to differentiation. Numerous studies show that EGR1 either promotes the proliferation of stimulated cells or suppresses the tumorigenic growth of transformed cells. Upon interaction with ARF, EGR1 is sumoylated and acquires the ability to bind to specific targets such as PTEN and in turn to regulate cell growth. ARF is mainly localized to the periphery of nucleolus where is able to negatively regulate ribosome biogenesis. Since EGR1 colocalizes with ARF under IGF-1 stimulation we asked the question of whether EGR1 also relocate to the nucleolus to interact with ARF. Here we show that EGR1 colocalizes with nucleolar markers such as fibrillarin and B23 in the presence of ARF. Western analysis of nucleolar extracts from HeLa cells was used to confirm the presence of EGR1 in the nucleolus mainly as the 100 kDa sumoylated form. We also show that the level of the ribosomal RNA precursor 47S is inversely correlated to the level of EGR1 transcripts. The EGR1 iseffective to regulate the synthesis of the 47S rRNA precursor. Then we demonstrated that EGR1 binds to the Upstream Binding Factor (UBF leading us to hypothesize that the regulating activity of EGR1 is mediated by its interaction within the transcriptional complex of RNA polymerase I. These results confirm the presence of EGR1 in the nucleolus and point to a role for EGR1 in the control of nucleolar metabolism.

  9. Complex long-distance effects of mutations that confer linezolid resistance in the large ribosomal subunit

    Science.gov (United States)

    Fulle, Simone; Saini, Jagmohan S.; Homeyer, Nadine; Gohlke, Holger

    2015-01-01

    The emergence of multidrug-resistant pathogens will make current antibiotics ineffective. For linezolid, a member of the novel oxazolidinone class of antibiotics, 10 nucleotide mutations in the ribosome have been described conferring resistance. Hypotheses for how these mutations affect antibiotics binding have been derived based on comparative crystallographic studies. However, a detailed description at the atomistic level of how remote mutations exert long-distance effects has remained elusive. Here, we show that the G2032A-C2499A double mutation, located > 10 Å away from the antibiotic, confers linezolid resistance by a complex set of effects that percolate to the binding site. By molecular dynamics simulations and free energy calculations, we identify U2504 and C2452 as spearheads among binding site nucleotides that exert the most immediate effect on linezolid binding. Structural reorganizations within the ribosomal subunit due to the mutations are likely associated with mutually compensating changes in the effective energy. Furthermore, we suggest two main routes of information transfer from the mutation sites to U2504 and C2452. Between these, we observe cross-talk, which suggests that synergistic effects observed for the two mutations arise in an indirect manner. These results should be relevant for the development of oxazolidinone derivatives that are active against linezolid-resistant strains. PMID:26202966

  10. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  11. Inhibition of eukaryotic translation elongation by the antitumor natural product Mycalamide B.

    Science.gov (United States)

    Dang, Yongjun; Schneider-Poetsch, Tilman; Eyler, Daniel E; Jewett, John C; Bhat, Shridhar; Rawal, Viresh H; Green, Rachel; Liu, Jun O

    2011-08-01

    Mycalamide B (MycB) is a marine sponge-derived natural product with potent antitumor activity. Although it has been shown to inhibit protein synthesis, the molecular mechanism of action by MycB remains incompletely understood. We verified the inhibition of translation elongation by in vitro HCV IRES dual luciferase assays, ribosome assembly, and in vivo [(35)S]methinione labeling experiments. Similar to cycloheximide (CHX), MycB inhibits translation elongation through blockade of eEF2-mediated translocation without affecting the eEF1A-mediated loading of tRNA onto the ribosome, AUG recognition, or dipeptide synthesis. Using chemical footprinting, we identified the MycB binding site proximal to the C3993 28S rRNA residue on the large ribosomal subunit. However, there are also subtle, but significant differences in the detailed mechanisms of action of MycB and CHX. First, MycB arrests the ribosome on the mRNA one codon ahead of CHX. Second, MycB specifically blocked tRNA binding to the E-site of the large ribosomal subunit. Moreover, they display different polysome profiles in vivo. Together, these observations shed new light on the mechanism of inhibition of translation elongation by MycB.

  12. Lin28a uses distinct mechanisms of binding to RNA and affects miRNA levels positively and negatively.

    Science.gov (United States)

    Nowak, Jakub Stanislaw; Hobor, Fruzsina; Downie Ruiz Velasco, Angela; Choudhury, Nila Roy; Heikel, Gregory; Kerr, Alastair; Ramos, Andres; Michlewski, Gracjan

    2017-03-01

    Lin28a inhibits the biogenesis of let-7 miRNAs by triggering the polyuridylation and degradation of their precursors by terminal uridylyltransferases TUT4/7 and 3'-5' exoribonuclease Dis3l2, respectively. Previously, we showed that Lin28a also controls the production of neuro-specific miRNA-9 via a polyuridylation-independent mechanism. Here we reveal that the sequences and structural characteristics of pre-let-7 and pre-miRNA-9 are eliciting two distinct modes of binding to Lin28a. We present evidence that Dis3l2 controls miRNA-9 production. Finally, we show that the constitutive expression of untagged Lin28a during neuronal differentiation in vitro positively and negatively affects numerous other miRNAs. Our findings shed light on the role of Lin28a in differentiating cells and on the ways in which one RNA-binding protein can perform multiple roles in the regulation of RNA processing. © 2017 Nowak et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  14. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  15. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    International Nuclear Information System (INIS)

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-01-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21

  16. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  17. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  18. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  19. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris (Hemiptera, Aphidiae.

    Directory of Open Access Journals (Sweden)

    Chunxiao Yang

    Full Text Available To facilitate gene expression study and obtain accurate qRT-PCR analysis, normalization relative to stable expressed housekeeping genes is required. In this study, expression profiles of 11 candidate reference genes, including actin (Actin, elongation factor 1 α (EF1A, TATA-box-binding protein (TATA, ribosomal protein L12 (RPL12, β-tubulin (Tubulin, NADH dehydrogenase (NADH, vacuolar-type H+-ATPase (v-ATPase, succinate dehydrogenase B (SDHB, 28S ribosomal RNA (28S, 16S ribosomal RNA (16S, and 18S ribosomal RNA (18S from the pea aphid Acyrthosiphon pisum, under different developmental stages and temperature conditions, were investigated. A total of four analytical tools, geNorm, Normfinder, BestKeeper, and the ΔCt method, were used to evaluate the suitability of these genes as endogenous controls. According to RefFinder, a web-based software tool which integrates all four above-mentioned algorithms to compare and rank the reference genes, SDHB, 16S, and NADH were the three most stable house-keeping genes under different developmental stages and temperatures. This work is intended to establish a standardized qRT-PCR protocol in pea aphid and serves as a starting point for the genomics and functional genomics research in this emerging insect model.

  20. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    Science.gov (United States)

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.

  1. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  2. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  3. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  4. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  5. Binding of superantigen toxins into the CD28 homodimer interface is essential for induction of cytokine genes that mediate lethal shock.

    Directory of Open Access Journals (Sweden)

    Gila Arad

    2011-09-01

    Full Text Available Bacterial superantigens, a diverse family of toxins, induce an inflammatory cytokine storm that can lead to lethal shock. CD28 is a homodimer expressed on T cells that functions as the principal costimulatory ligand in the immune response through an interaction with its B7 coligands, yet we show here that to elicit inflammatory cytokine gene expression and toxicity, superantigens must bind directly into the dimer interface of CD28. Preventing access of the superantigen to CD28 suffices to block its lethality. Mice were protected from lethal superantigen challenge by short peptide mimetics of the CD28 dimer interface and by peptides selected to compete with the superantigen for its binding site in CD28. Superantigens use a conserved β-strand/hinge/α-helix domain of hitherto unknown function to engage CD28. Mutation of this superantigen domain abolished inflammatory cytokine gene induction and lethality. Structural analysis showed that when a superantigen binds to the T cell receptor on the T cell and major histocompatibility class II molecule on the antigen-presenting cell, CD28 can be accommodated readily as third superantigen receptor in the quaternary complex, with the CD28 dimer interface oriented towards the β-strand/hinge/α-helix domain in the superantigen. Our findings identify the CD28 homodimer interface as a critical receptor target for superantigens. The novel role of CD28 as receptor for a class of microbial pathogens, the superantigen toxins, broadens the scope of pathogen recognition mechanisms.

  6. Transduced PEP-1-ribosomal protein S3 (rpS3) ameliorates 12-O-tetradecanoylphorbol-13-acetate-induced inflammation in mice

    International Nuclear Information System (INIS)

    Ahn, Eun Hee; Kim, Dae Won; Kang, Hye Won; Shin, Min Jae; Won, Moo Ho; Kim, Joon; Kim, Dong Joon; Kwon, Oh-Shin; Kang, Tae-Cheon; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2010-01-01

    This study investigated the preventive effect of ribosomal protein S3 (rpS3) on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in mice. A cell permeable expression vector PEP-1-rpS3 was constructed. Topical application of the vector markedly inhibited TPA-induced expression levels of cyclooxygenase-2 (COX-2) and pro-inflammatory cytokines. Application of PEP-1-rpS3 also resulted in a significant reduction in the activation of nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) in TPA-treated ears. These results indicate that PEP-1-rpS3 inhibits inflammatory response cytokines and enzymes by blocking NF-kB and MAPK, prompting the suggestion that PEP-1-rpS3 can be used as a therapeutic agent against skin inflammation.

  7. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  8. Genetic and physiological studies of antibiotic resistance in a clinical isolate of Streptococcus faecalis

    International Nuclear Information System (INIS)

    Sharma, V.K.

    1987-01-01

    An erythromycin-sensitive clinical isolate of Streptococcus faecalis (CS-4B) generated intermediate-level erythromycin-resistant isolates ([CS-4B(S)] at a frequency of 4 x 10 -8 per cell. CS-4B(S) produces high-level erythromycin-resistant isolates [CS-4B(L)] at a very high frequency. The erythromycin-resistance is non-transferable, chromosomally located, and distinct from the well described erythromycin-resistance of the MLS type. The erythromycin-resistance of CS-4B(S) and CS-4B(L) is not due to an in vitro or in vivo alteration or inactivation of erythromycin. 14 C-erythromycin binds in vitro, as evaluated with sucrose gradients, to 70S ribosomes and 50S ribosomal subunits in CS-4B. Binding to CS-4B(L) ribosomes was barely detectable whereas CS-4B(S) ribosomes retained binding capacity. The binding studies on filter membranes revealed a substantial reduction of 14 C-erythromycin binding to CS-4B(S) ribosomes when compared to CS-4B ribosomes. The in vivo accumulation of 14 C-erythromycin in CS-4B and CS-4B(S) parallel the in vitro binding capacity of ribosomes indicating the apparent absence of a permeability barrier to erythromycin in CS-4B

  9. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  10. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  11. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  12. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

    Science.gov (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

    2015-08-18

    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Cloning, periplasmic expression, purification and structural characterization of human ribosomal protein L10; Clonagem, expressao, purificacao e caracterizacao estrutural da proteina ribossomal L10 humana recombinante

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Larissa Miranda

    2009-07-01

    The ribosomal protein L10 (RP L10) is a strong candidate to be included in the class of tumor suppressor proteins. This protein, also denominated as QM, is known to participate in the binding of ribosomal subunits 60S and 40S and the translation of mRNAs. It has a molecular weight that varies between 24 and 26 kDa and an isoelectric point of (pI) 10.5. The sequence of the protein QM is highly conserved in mammals, plants, invertebrates, insects and yeast which indicates its critical functions in a cell. As a tumor suppressor, RP L10 has been studied in strains of Wilm's tumor (WT-1) and tumor cells in the stomach, where was observed a decrease in the amount of its mRNA. More recently, the RP L10 was found in low amounts in the early stages of prostate adenoma and showed some mutation in ovarian cancer, what indicates its role as a suppressor protein in the development of these diseases. It has also been described that this protein interacts with c-Jun and c-Yes inhibiting growth factors and consequently, cell division. This work has an important role on the establishment of soluble expression of QM to give base information for further studies on expression that aim to evaluate the specific regions where it acts binding the 60S and 40S ribosomal subunits and translation, as well as its binding to proto-oncogenes. The cDNA for QM protein was amplified by PCR and cloned into periplasmic expression vector p3SN8. The QM protein was expressed in E. coli BL21 (DE3) in the region of cytoplasm and periplasm, the best condition was obtained from the expression of the recombinant plasmid QM p1813{sub Q}M at 25 degree C or 30 degree C, the soluble protein was obtained with small amounts of contaminants. The assays of secondary structure showed that the QM protein is predominantly alpha-helix, but when it loses the folding, this condition changes and the protein is replaced by {beta}- sheet feature. (author)

  14. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Science.gov (United States)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  15. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  16. Trans-acting translational regulatory RNA binding proteins.

    Science.gov (United States)

    Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E

    2018-05-01

    The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.

  17. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  18. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O

    2000-01-01

    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  19. β-delayed proton decay of 28S

    International Nuclear Information System (INIS)

    Pougheon, F.; Borrel, V.; Jacmart, J.C.; Bazin, D.; Del Moral, R.; Dufour, J.P.; Hubert, F.; Pravikoff, M.S.; Brown, B.A.

    1989-01-01

    β-delayed proton radioactivity has been observed for the 28 S isotope (T x = -2), produced by projectile fragmentation of 85 MeV/u 36 Ar. The measured half-life of 28 S is 125 ± 10 ms. Energy spectra of β-delayed protons have been measured. The lowest T = 2 state in the daughter nucleus 28 P has been located at an excitation energy of 5900 ± 21 keV. A comparison of the experimental data to the quadratic form of the isobaric multiplet mass equation shows that the energies of the five T = 2 states of the A = 28 quintet are well represented by that relation. Shell-model predictions for the half-life, location and decay properties of the lowest T = 2 state of 28 P are in good agreement with experimental data

  20. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  1. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)

    2015-08-07

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.

  2. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    International Nuclear Information System (INIS)

    Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted

  3. Plant Ribosome-Inactivating Proteins: Progesses, Challenges and Biotechnological Applications (and a Few Digressions

    Directory of Open Access Journals (Sweden)

    Maria Serena Fabbrini

    2017-10-01

    Full Text Available Plant ribosome-inactivating protein (RIP toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric and type II (dimeric as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA, they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications.

  4. Genetic analyses of ribosomal loci of Anopheles minimus species from north east India.

    Science.gov (United States)

    Dutta, P; Khan, S A; Topno, R; Chowdhury, P; Baishya, M; Prakash, A; Bhattacharyya, D R; Mahanta, J

    2013-09-01

    Anopheles minimus is one of the major vectors for transmission of malaria disease in north eastern (NE) region of India. The minimus species complex of Minimus subgroup of Myzomyia series of anophelines were studied in malaria affected states--Assam and Arunachal Pradesh (AP) of NE India. Ribosomal DNA markers--second internal transcribed spacer (ITS2) and third domain (D3) of 28S gene were used to characterize An. minimus species. Sequence homogeneity was observed in D3 sequences of An.minimus specimens throughout both the states. However, a transversion in ITS2 sequence of single specimen collected from Assam-Meghalaya border areas illustrates possibility of intra population polymorphism in ITS2 sequence within the geographical region.

  5. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  6. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

    2016-01-01

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  7. Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice.

    Science.gov (United States)

    Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi

    2018-01-01

    We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Over-expression of 60s ribosomal L23a is associated with cellular proliferation in SAG resistant clinical isolates of Leishmania donovani.

    Directory of Open Access Journals (Sweden)

    Sanchita Das

    Full Text Available Sodium antimony gluconate (SAG unresponsiveness of Leishmania donovani (Ld had effectively compromised the chemotherapeutic potential of SAG. 60s ribosomal L23a (60sRL23a, identified as one of the over-expressed protein in different resistant strains of L.donovani as observed with differential proteomics studies indicates towards its possible involvement in SAG resistance in L.donovani. In the present study 60sRL23a has been characterized for its probable association with SAG resistance mechanism.The expression profile of 60s ribosomal L23a (60sRL23a was checked in different SAG resistant as well as sensitive strains of L.donovani clinical isolates by real-time PCR and western blotting and was found to be up-regulated in resistant strains. Ld60sRL23a was cloned, expressed in E.coli system and purified for raising antibody in swiss mice and was observed to have cytosolic localization in L.donovani. 60sRL23a was further over-expressed in sensitive strain of L.donovani to check its sensitivity profile against SAG (Sb V and III and was found to be altered towards the resistant mode.This study reports for the first time that the over expression of 60sRL23a in SAG sensitive parasite decreases the sensitivity of the parasite towards SAG, miltefosine and paramomycin. Growth curve of the tranfectants further indicated the proliferative potential of 60sRL23a assisting the parasite survival and reaffirming the extra ribosomal role of 60sRL23a. The study thus indicates towards the role of the protein in lowering and redistributing the drug pressure by increased proliferation of parasites and warrants further longitudinal study to understand the underlying mechanism.

  9. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  10. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

    2015-01-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  11. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  12. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-02-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

  13. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    Science.gov (United States)

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  14. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor.

    Science.gov (United States)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill

    2016-03-25

    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  16. 16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

    Science.gov (United States)

    Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

    2001-01-01

    Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

  17. Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

    DEFF Research Database (Denmark)

    Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S

    2009-01-01

    Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

  18. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  19. Isolation of eukaryotic ribosomal proteins. Purification and characterization of 60 S ribosomal subunit proteins L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37'.

    Science.gov (United States)

    Tsurugi, K; Collatz, E; Todokoro, K; Wool, I G

    1977-06-10

    The proteins of the large subunit of rat liver ribosomes were separated into seven groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (L3, L6, L7', L8, L10, L15, L17, L18, L19, L23', L25, L27', L28, L29, L31, L32, L34, L35, L36, L36', and L37') were isolated from three groups (C60, E60, and F60) by ion exchange chromatography on carboxymethycellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.3 to 25 mg. Nine of the proteins (L6, L8, L18, L27', L28, L29, L34, L36, and L36') had no detectable contamination: the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  20. A distinct group of hepacivirus/pestivirus-like internal ribosomal entry sites in members of diverse picornavirus genera: evidence for modular exchange of functional noncoding RNA elements by recombination.

    Science.gov (United States)

    Hellen, Christopher U T; de Breyne, Sylvain

    2007-06-01

    The 5' untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5' UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5' UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently.

  1. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  2. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  3. Lin28a uses distinct mechanisms of binding to RNA and affects miRNA levels positively and negatively

    OpenAIRE

    Nowak, Jakub Stanislaw; Hobor, Fruzsina; Downie Ruiz Velasco, Angela; Choudhury, Nila Roy; Heikel, Gregory; Kerr, Alastair; Ramos, Andres; Michlewski, Gracjan

    2017-01-01

    Lin28a inhibits the biogenesis of let-7 miRNAs by triggering the polyuridylation and degradation of their precursors by terminal uridylyltransferases TUT4/7 and 3’-5’ exoribonuclease Dis3l2, respectively. Previously, we showed that Lin28a also controls the production of neuro-specific miRNA-9 via a polyuridylation-independent mechanism. Here we reveal that the sequences and structural characteristics of pre-let-7 and pre-miRNA-9 are eliciting two distinct modes of binding to Lin28a. We presen...

  4. Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

    Directory of Open Access Journals (Sweden)

    Yanan Sun

    Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

  5. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag.

    Science.gov (United States)

    Li, Junhua; Zhang, Yang; Yang, Yanjun

    2013-03-01

    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  6. The C-terminal helix of ribosomal P stalk recognizes a hydrophobic groove of elongation factor 2 in a novel fashion.

    Science.gov (United States)

    Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min

    2018-04-06

    Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.

  7. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  8. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  9. Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum

    International Nuclear Information System (INIS)

    Graham-Lorence, S.E.

    1987-01-01

    In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding

  10. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  11. A Distinct Group of Hepacivirus/Pestivirus-Like Internal Ribosomal Entry Sites in Members of Diverse Picornavirus Genera: Evidence for Modular Exchange of Functional Noncoding RNA Elements by Recombination▿ †

    Science.gov (United States)

    Hellen, Christopher U. T.; de Breyne, Sylvain

    2007-01-01

    The 5′ untranslated regions (UTRs) of the RNA genomes of Flaviviridae of the Hepacivirus and Pestivirus genera contain internal ribosomal entry sites (IRESs) that are unrelated to the two principal classes of IRESs of Picornaviridae. The mechanism of translation initiation on hepacivirus/pestivirus (HP) IRESs, which involves factor-independent binding to ribosomal 40S subunits, also differs fundamentally from initiation on these picornavirus IRESs. Ribosomal binding to HP IRESs requires conserved sequences that form a pseudoknot and the adjacent IIId and IIIe domains; analogous elements do not occur in the two principal groups of picornavirus IRESs. Here, comparative sequence analysis was used to identify a subset of picornaviruses from multiple genera that contain 5′ UTR sequences with significant similarities to HP IRESs. They are avian encephalomyelitis virus, duck hepatitis virus 1, duck picornavirus, porcine teschovirus, porcine enterovirus 8, Seneca Valley virus, and simian picornavirus. Their 5′ UTRs are predicted to form several structures, in some of which the peripheral elements differ from the corresponding HP IRES elements but in which the core pseudoknot, domain IIId, and domain IIIe elements are all closely related. These findings suggest that HP-like IRESs have been exchanged between unrelated virus families by recombination and support the hypothesis that RNA viruses consist of modular coding and noncoding elements that can exchange and evolve independently. PMID:17392358

  12. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  13. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  14. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  15. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  16. Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

    Science.gov (United States)

    Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

    2013-08-01

    Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

  17. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  18. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  19. Alpha-momorcharin: a ribosome-inactivating protein from Momordica charantia, possessing DNA cleavage properties.

    Science.gov (United States)

    Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi

    2013-11-01

    Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.

  20. Optical signal processing up to 1.28 Tbits/s

    DEFF Research Database (Denmark)

    Mulvad, Hans Christian Hansen; Oxenløwe, Leif Katsuo; Galili, Michael

    2009-01-01

    Techniques for 640 Gbit/s optical signal processing are described, including demultiplexing, clock recovery, transmission, wavelength conversion, add-drop multiplexing, and timing-jitter tolerance. Demultiplexing at 1.28 Tbit/s is presented, with preliminary results for 1.28 Tbit/s transmission....

  1. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-07

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.

  2. Higher-order structure in the 3'-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

    DEFF Research Database (Denmark)

    Garrett, R A; Christensen, A; Douthwaite, S

    1984-01-01

    An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3' end of the RNAs, consists of two large ...

  3. AoS28D, a proline-Xaa carboxypeptidase secreted by Aspergillus oryzae.

    Science.gov (United States)

    Salamin, Karine; Eugster, Philippe J; Jousson, Olivier; Waridel, Patrice; Grouzmann, Eric; Monod, Michel

    2017-05-01

    Prolyl peptidases of the MEROPS S28 family are of particular interest because they are key enzymes in the digestion of proline-rich peptides. A BLAST analysis of the Aspergillus oryzae genome revealed sequences coding for four proteases of the S28 family. Three of these proteases, AoS28A, AoS28B, and AoS28C, were previously characterized as acidic prolyl endopeptidases. The fourth protease, AoS28D, showed high sequence divergence with other S28 proteases and belongs to a phylogenetically distinct cluster together with orthologous proteases from other Aspergillus species. The objective of the present paper was to characterize AoS28D protease in terms of substrate specificity and activity. AoS28D produced by gene overexpression in A. oryzae and in Pichia pastoris was a 70-kDa glycoprotein with a 10-kDa sugar moiety. In contrast with other S28 proteases, AoS28D did not hydrolyze internal Pro-Xaa bonds of several tested peptides. Similarly, to human lysosomal Pro-Xaa carboxypeptidase, AoS28D demonstrated selectivity for cleaving C-terminal Pro-Xaa bonds which are resistant to carboxypeptidases of the S10 family concomitantly secreted by A. oryzae. Therefore, AoS28D could act in synergy with these enzymes during sequential degradation of a peptide from its C-terminus.

  4. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  5. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  6. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  7. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  8. A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2-D3 expansion segments of 28S ribosomal RNA genes and morphological characters.

    Science.gov (United States)

    Subbotin, Sergei A; Ragsdale, Erik J; Mullens, Teresa; Roberts, Philip A; Mundo-Ocampo, Manuel; Baldwin, James G

    2008-08-01

    The root lesion nematodes of the genus Pratylenchus Filipjev, 1936 are migratory endoparasites of plant roots, considered among the most widespread and important nematode parasites in a variety of crops. We obtained gene sequences from the D2 and D3 expansion segments of 28S rRNA partial and 18S rRNA from 31 populations belonging to 11 valid and two unidentified species of root lesion nematodes and five outgroup taxa. These datasets were analyzed using maximum parsimony and Bayesian inference. The alignments were generated using the secondary structure models for these molecules and analyzed with Bayesian inference under the standard models and the complex model, considering helices under the doublet model and loops and bulges under the general time reversible model. The phylogenetic informativeness of morphological characters is tested by reconstruction of their histories on rRNA based trees using parallel parsimony and Bayesian approaches. Phylogenetic and sequence analyses of the 28S D2-D3 dataset with 145 accessions for 28 species and 18S dataset with 68 accessions for 15 species confirmed among large numbers of geographical diverse isolates that most classical morphospecies are monophyletic. Phylogenetic analyses revealed at least six distinct major clades of examined Pratylenchus species and these clades are generally congruent with those defined by characters derived from lip patterns, numbers of lip annules, and spermatheca shape. Morphological results suggest the need for sophisticated character discovery and analysis for morphology based phylogenetics in nematodes.

  9. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  10. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  11. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C

    2012-10-01

    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  12. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  13. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  14. Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

    Directory of Open Access Journals (Sweden)

    Rhoads Daniel D

    2012-11-01

    Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

  15. Memory binding and white matter integrity in familial Alzheimer’s disease

    Science.gov (United States)

    Saarimäki, Heini; Bastin, Mark E.; Londoño, Ana C.; Pettit, Lewis; Lopera, Francisco; Della Sala, Sergio; Abrahams, Sharon

    2015-01-01

    Binding information in short-term and long-term memory are functions sensitive to Alzheimer’s disease. They have been found to be affected in patients who meet criteria for familial Alzheimer’s disease due to the mutation E280A of the PSEN1 gene. However, only short-term memory binding has been found to be affected in asymptomatic carriers of this mutation. The neural correlates of this dissociation are poorly understood. The present study used diffusion tensor magnetic resonance imaging to investigate whether the integrity of white matter structures could offer an account. A sample of 19 patients with familial Alzheimer’s disease, 18 asymptomatic carriers and 21 non-carrier controls underwent diffusion tensor magnetic resonance imaging, neuropsychological and memory binding assessment. The short-term memory binding task required participants to detect changes across two consecutive screens displaying arrays of shapes, colours, or shape-colour bindings. The long-term memory binding task was a Paired Associates Learning Test. Performance on these tasks were entered into regression models. Relative to controls, patients with familial Alzheimer’s disease performed poorly on both memory binding tasks. Asymptomatic carriers differed from controls only in the short-term memory binding task. White matter integrity explained poor memory binding performance only in patients with familial Alzheimer’s disease. White matter water diffusion metrics from the frontal lobe accounted for poor performance on both memory binding tasks. Dissociations were found in the genu of corpus callosum which accounted for short-term memory binding impairments and in the hippocampal part of cingulum bundle which accounted for long-term memory binding deficits. The results indicate that white matter structures in the frontal and temporal lobes are vulnerable to the early stages of familial Alzheimer’s disease and their damage is associated with impairments in two memory binding

  16. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  17. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

    Science.gov (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

    2017-05-01

    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  18. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena

    2015-05-12

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways that control cell proliferation, oxidative phosphorylation, cellular respiration, and other redox reactions were activated in the immortalized cells. Here we report that, upon overexpression of S18-2 protein, primary rat skin fibroblasts underwent cell transformation. Cells passed more than 300 population doublings, and two out of three tested clones gave rise to tumors in experimental animals. Transformed cells showed anchorage-independent growth and loss of contact inhibition; they expressed epithelial markers, such as E-cadherin and β-catenin. Transformed cells showed increased telomerase activity, disturbance of the cell cycle, and chromosomal instability. Taken together, our data suggest that S18-2 is a newly identified oncoprotein that may be involved in cancerogenesis.

  19. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  20. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

    Science.gov (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

    2011-01-01

    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  1. Cell Death-Associated Ribosomal RNA Cleavage in Postmortem Tissues and Its Forensic Applications.

    Science.gov (United States)

    Kim, Ji Yeon; Kim, Yunmi; Cha, Hyo Kyeong; Lim, Hye Young; Kim, Hyungsub; Chung, Sooyoung; Hwang, Juck-Joon; Park, Seong Hwan; Son, Gi Hoon

    2017-06-30

    Estimation of postmortem interval (PMI) is a key issue in the field of forensic pathology. With the availability of quantitative analysis of RNA levels in postmortem tissues, several studies have assessed the postmortem degradation of constitutively expressed RNA species to estimate PMI. However, conventional RNA quantification as well as biochemical and physiological changes employed thus far have limitations related to standardization or normalization. The present study focuses on an interesting feature of the subdomains of certain RNA species, in which they are site-specifically cleaved during apoptotic cell death. We found that the D8 divergent domain of ribosomal RNA (rRNA) bearing cell death-related cleavage sites was rapidly removed during postmortem RNA degradation. In contrast to the fragile domain, the 5' terminal region of 28S rRNA was remarkably stable during the postmortem period. Importantly, the differences in the degradation rates between the two domains in mammalian 28S rRNA were highly proportional to increasing PMI with a significant linear correlation observed in mice as well as human autopsy tissues. In conclusion, we demonstrate that comparison of the degradation rates between domains of a single RNA species provides quantitative information on postmortem degradation states, which can be applied for the estimation of PMI.

  2. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  3. The basic tilted helix bundle domain of the prolyl isomerase FKBP25 is a novel double-stranded RNA binding module

    Science.gov (United States)

    Dilworth, David; Bonnafous, Pierre; Edoo, Amiirah Bibi; Bourbigot, Sarah; Pesek-Jardim, Francy; Gudavicius, Geoff; Serpa, Jason J.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.

    2017-01-01

    Abstract Prolyl isomerases are defined by a catalytic domain that facilitates the cis–trans interconversion of proline residues. In most cases, additional domains in these enzymes add important biological function, including recruitment to a set of protein substrates. Here, we report that the N-terminal basic tilted helix bundle (BTHB) domain of the human prolyl isomerase FKBP25 confers specific binding to double-stranded RNA (dsRNA). This binding is selective over DNA as well as single-stranded oligonucleotides. We find that FKBP25 RNA-association is required for its nucleolar localization and for the vast majority of its protein interactions, including those with 60S pre-ribosome and early ribosome biogenesis factors. An independent mobility of the BTHB and FKBP catalytic domains supports a model by which the N-terminus of FKBP25 is anchored to regions of dsRNA, whereas the FKBP domain is free to interact with neighboring proteins. Apart from the identification of the BTHB as a new dsRNA-binding module, this domain adds to the growing list of auxiliary functions used by prolyl isomerases to define their primary cellular targets. PMID:29036638

  4. Human tRNALys3UUU Is Pre-Structured by Natural Modifications for Cognate and Wobble Codon Binding through Keto-Enol Tautomerism

    Energy Technology Data Exchange (ETDEWEB)

    Vendeix, Franck A.P.; Murphy, IV, Frank V.; Cantara, William A.; Leszczy,; #324; ska, Gra; #380; yna,; Gustilo, Estella M.; Sproat, Brian; Malkiewicz, Andrzej; Agris, Paul F. [Cornell; (NCSU); (Poland); (Integrated DNA); (SUNYA)

    2013-09-27

    Human tRNALys3UUU (htRNALys3UUU) decodes the lysine codons AAA and AAG during translation and also plays a crucial role as the primer for HIV-1 (human immunodeficiency virus type 1) reverse transcription. The posttranscriptional modifications 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U34), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A37), and pseudouridine (Ψ39) in the tRNA's anticodon domain are critical for ribosomal binding and HIV-1 reverse transcription. To understand the importance of modified nucleoside contributions, we determined the structure and function of this tRNA's anticodon stem and loop (ASL) domain with these modifications at positions 34, 37, and 39, respectively (hASLLys3UUU-mcm5s2U34;ms2t6A3739). Ribosome binding assays in vitro revealed that the hASLLys3UUU-mcm5s2U34;ms2t6A3739 bound AAA and AAG codons, whereas binding of the unmodified ASLLys3UUU was barely detectable. The UV hyperchromicity, the circular dichroism, and the structural analyses indicated that Ψ39 enhanced the thermodynamic stability of the ASL through base stacking while ms2t6A37 restrained the anticodon to adopt an open loop conformation that is required for ribosomal binding. The NMR-restrained molecular-dynamics-derived solution structure revealed that the modifications provided an open, ordered loop for codon binding. The crystal structures of the hASLLys3UUU-mcm5s2U34;ms2t6A3739 bound to the 30S ribosomal subunit with each codon in the A site showed that the

  5. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  6. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  7. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  8. Mammalian poly(A)-binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms.

    Science.gov (United States)

    Kahvejian, Avak; Svitkin, Yuri V; Sukarieh, Rami; M'Boutchou, Marie-Noël; Sonenberg, Nahum

    2005-01-01

    Translation initiation is a multistep process involving several canonical translation factors, which assemble at the 5'-end of the mRNA to promote the recruitment of the ribosome. Although the 3' poly(A) tail of eukaryotic mRNAs and its major bound protein, the poly(A)-binding protein (PABP), have been studied extensively, their mechanism of action in translation is not well understood and is confounded by differences between in vivo and in vitro systems. Here, we provide direct evidence for the involvement of PABP in key steps of the translation initiation pathway. Using a new technique to deplete PABP from mammalian cell extracts, we show that extracts lacking PABP exhibit dramatically reduced rates of translation, reduced efficiency of 48S and 80S ribosome initiation complex formation, and impaired interaction of eIF4E with the mRNA cap structure. Supplementing PABP-depleted extracts with wild-type PABP completely rectified these deficiencies, whereas a mutant of PABP, M161A, which is incapable of interacting with eIF4G, failed to restore translation. In addition, a stronger inhibition (approximately twofold) of 80S as compared to 48S ribosome complex formation (approximately 65% vs. approximately 35%, respectively) by PABP depletion suggests that PABP plays a direct role in 60S subunit joining. PABP can thus be considered a canonical translation initiation factor, integral to initiation complex formation at the 5'-end of mRNA.

  9. Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

    DEFF Research Database (Denmark)

    Issinger, O G; Beier, H

    1978-01-01

    Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

  10. TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

    Directory of Open Access Journals (Sweden)

    Abhishek Ghosh

    2014-10-01

    Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

  11. Identification and characterization of a nuclear localization signal of TRIM28 that overlaps with the HP1 box

    International Nuclear Information System (INIS)

    Moriyama, Tetsuji; Sangel, Percival; Yamaguchi, Hiroki; Obuse, Chikashi; Miyamoto, Yoichi; Oka, Masahiro; Yoneda, Yoshihiro

    2015-01-01

    Tripartite motif-containing 28 (TRIM28) is a transcription regulator, which forms a repressor complex containing heterochromatin protein 1 (HP1). Here, we report identification of a nuclear localization signal (NLS) within the 462-494 amino acid region of TRIM28 that overlaps with its HP1 binding site, HP1 box. GST-pulldown experiments revealed the interaction of the arginine-rich TRIM28 NLS with various importin α subtypes (α1, α2 and α4). In vitro transport assay demonstrated that nuclear localization of GFP-TRIM28 NLS is mediated by importin αs, in conjunction with importin β1 and Ran. Further, we demonstrated that HP1 and importin αs compete for binding to TRIM28. Together, our findings suggest that importin α has an essential role in the nuclear delivery and preferential HP1 interaction of TRIM28. - Highlights: • TRIM28 contains an NLS within the 462-494 amino acid region. • The nuclear import of TRIM28 is mediated by importin α/importin β1. • TRIM28 NLS overlaps with HP1 Box. • HP1 and importin α compete for binding to TRIM28

  12. Identification and characterization of a nuclear localization signal of TRIM28 that overlaps with the HP1 box

    Energy Technology Data Exchange (ETDEWEB)

    Moriyama, Tetsuji; Sangel, Percival [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Yamaguchi, Hiroki [School of Medicine, Osaka University, Osaka 565-0871 (Japan); Obuse, Chikashi [Graduate School of Life Science, Hokkaido University, Sapporo 001-0021 (Japan); Miyamoto, Yoichi [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Oka, Masahiro, E-mail: moka@nibiohn.go.jp [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Laboratory of Biomedical Innovation, Graduate School of Pharmaceutical Sciences, Osaka University, Osaka 565-0871 (Japan); Yoneda, Yoshihiro, E-mail: y-yoneda@nibiohn.go.jp [National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Laboratory of Biomedical Innovation, Graduate School of Pharmaceutical Sciences, Osaka University, Osaka 565-0871 (Japan)

    2015-07-03

    Tripartite motif-containing 28 (TRIM28) is a transcription regulator, which forms a repressor complex containing heterochromatin protein 1 (HP1). Here, we report identification of a nuclear localization signal (NLS) within the 462-494 amino acid region of TRIM28 that overlaps with its HP1 binding site, HP1 box. GST-pulldown experiments revealed the interaction of the arginine-rich TRIM28 NLS with various importin α subtypes (α1, α2 and α4). In vitro transport assay demonstrated that nuclear localization of GFP-TRIM28 NLS is mediated by importin αs, in conjunction with importin β1 and Ran. Further, we demonstrated that HP1 and importin αs compete for binding to TRIM28. Together, our findings suggest that importin α has an essential role in the nuclear delivery and preferential HP1 interaction of TRIM28. - Highlights: • TRIM28 contains an NLS within the 462-494 amino acid region. • The nuclear import of TRIM28 is mediated by importin α/importin β1. • TRIM28 NLS overlaps with HP1 Box. • HP1 and importin α compete for binding to TRIM28.

  13. Pattern of morphological diversification in the Leptocarabus ground beetles (Coleoptera: Carabidae) as deduced from mitochondrial ND5 gene and nuclear 28S rDNA sequences.

    Science.gov (United States)

    Kim, C G; Zhou, H Z; Imura, Y; Tominaga, O; Su, Z H; Osawa, S

    2000-01-01

    Most of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and a part of nuclear 28S ribosomal RNA gene were sequenced for 14 species of ground beetles belonging to the genus Leptocarabus. In both the ND5 and the 28S rDNA phylogenetic trees of Leptocarabus, three major lineages were recognized: (1) L. marcilhaci/L. yokoael/Leptocarabus sp. from China, (2) L. koreanus/L. truncaticollis/L. seishinensis/L. semiopacus/L. canaliculatus/L. kurilensis from the northern Eurasian continent including Korea and Hokkaido, Japan, and (3) all of the Japanese species except L. kurilensis. Clustering of the species in the trees is largely linked to their geographic distribution and does not correlate with morphological characters. The species belonging to different species groups are clustered in the same lineages, and those in the same species group are scattered among the different lineages. One of the possible interpretations of the present results would be that morphological transformations independently took place in the different lineages, sometimes with accompanying parallel morphological evolution, resulting in the occurrence of the morphological species belonging to the same species group (= type) in the different lineages.

  14. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  15. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    Science.gov (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    OpenAIRE

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the ...

  17. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  18. H3K27 methylation and H3S28 phosphorylation-dependent transcriptional regulation by INHAT subunit SET/TAF-Iβ.

    Science.gov (United States)

    Kim, Ji-Young; Kim, Kee-Beom; Son, Hye-Ju; Chae, Yun-Cheol; Oh, Si-Taek; Kim, Dong-Wook; Pak, Jhang Ho; Seo, Sang-Beom

    2012-09-21

    Significant progress has been made in understanding the relationship between histone modifications and 'reader' molecules and their effects on transcriptional regulation. A previously identified INHAT complex subunit, SET/TAF-Iβ, binds to histones and inhibits histone acetylation. To investigate the binding specificities of SET/TAF-Iβ to various histone modifications, we employed modified histone tail peptide array analyses. SET/TAF-Iβ strongly recognized PRC2-mediated H3K27me1/2/3; however, the bindings were completely disrupted by H3S28 phosphorylation. We have demonstrated that SET/TAF-Iβ is sequentially recruited to the target gene promoter ATF3 after the PRC2 complex via H3K27me recognition and may offer additive effects in the repression of the target gene. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. Internal ribosomal entry site-mediated translation is important for rhythmic PERIOD1 expression.

    Directory of Open Access Journals (Sweden)

    Kyung-Ha Lee

    Full Text Available The mouse PERIOD1 (mPER1 plays an important role in the maintenance of circadian rhythm. Translation of mPer1 is directed by both a cap-dependent process and cap-independent translation mediated by an internal ribosomal entry site (IRES in the 5' untranslated region (UTR. Here, we compared mPer1 IRES activity with other cellular IRESs. We also found critical region in mPer1 5'UTR for heterogeneous nuclear ribonucleoprotein Q (HNRNPQ binding. Deletion of HNRNPQ binding region markedly decreased IRES activity and disrupted rhythmicity. A mathematical model also suggests that rhythmic IRES-dependent translation is a key process in mPER1 oscillation. The IRES-mediated translation of mPer1 will help define the post-transcriptional regulation of the core clock genes.

  20. The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Rakwalska, Magdalena; Rospert, Sabine

    2004-10-01

    The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

  1. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  2. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation

    Science.gov (United States)

    Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A

    2011-01-01

    The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

  3. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  4. Crystal Structures and Thermodynamic Analysis Reveal Distinct Mechanisms of CD28 Phosphopeptide Binding to the Src Homology 2 (SH2) Domains of Three Adaptor Proteins*

    Science.gov (United States)

    Inaba, Satomi; Numoto, Nobutaka; Ogawa, Shuhei; Morii, Hisayuki; Ikura, Teikichi; Abe, Ryo; Ito, Nobutoshi; Oda, Masayuki

    2017-01-01

    Full activation of T cells and differentiation into effector T cells are essential for many immune responses and require co-stimulatory signaling via the CD28 receptor. Extracellular ligand binding to CD28 recruits protein-tyrosine kinases to its cytoplasmic tail, which contains a YMNM motif. Following phosphorylation of the tyrosine, the proteins growth factor receptor-bound protein 2 (Grb2), Grb2-related adaptor downstream of Shc (Gads), and p85 subunit of phosphoinositide 3-kinase may bind to pYMNM (where pY is phosphotyrosine) via their Src homology 2 (SH2) domains, leading to downstream signaling to distinct immune pathways. These three adaptor proteins bind to the same site on CD28 with variable affinity, and all are important for CD28-mediated co-stimulatory function. However, the mechanism of how these proteins recognize and compete for CD28 is unclear. To visualize their interactions with CD28, we have determined the crystal structures of Gads SH2 and two p85 SH2 domains in complex with a CD28-derived phosphopeptide. The high resolution structures obtained revealed that, whereas the CD28 phosphopeptide bound to Gads SH2 is in a bent conformation similar to that when bound to Grb2 SH2, it adopts a more extended conformation when bound to the N- and C-terminal SH2 domains of p85. These differences observed in the peptide-protein interactions correlated well with the affinity and other thermodynamic parameters for each interaction determined by isothermal titration calorimetry. The detailed insight into these interactions reported here may inform the development of compounds that specifically inhibit the association of CD28 with these adaptor proteins to suppress excessive T cell responses, such as in allergies and autoimmune diseases. PMID:27927989

  5. Crystal Structures and Thermodynamic Analysis Reveal Distinct Mechanisms of CD28 Phosphopeptide Binding to the Src Homology 2 (SH2) Domains of Three Adaptor Proteins.

    Science.gov (United States)

    Inaba, Satomi; Numoto, Nobutaka; Ogawa, Shuhei; Morii, Hisayuki; Ikura, Teikichi; Abe, Ryo; Ito, Nobutoshi; Oda, Masayuki

    2017-01-20

    Full activation of T cells and differentiation into effector T cells are essential for many immune responses and require co-stimulatory signaling via the CD28 receptor. Extracellular ligand binding to CD28 recruits protein-tyrosine kinases to its cytoplasmic tail, which contains a YMNM motif. Following phosphorylation of the tyrosine, the proteins growth factor receptor-bound protein 2 (Grb2), Grb2-related adaptor downstream of Shc (Gads), and p85 subunit of phosphoinositide 3-kinase may bind to pYMNM (where pY is phosphotyrosine) via their Src homology 2 (SH2) domains, leading to downstream signaling to distinct immune pathways. These three adaptor proteins bind to the same site on CD28 with variable affinity, and all are important for CD28-mediated co-stimulatory function. However, the mechanism of how these proteins recognize and compete for CD28 is unclear. To visualize their interactions with CD28, we have determined the crystal structures of Gads SH2 and two p85 SH2 domains in complex with a CD28-derived phosphopeptide. The high resolution structures obtained revealed that, whereas the CD28 phosphopeptide bound to Gads SH2 is in a bent conformation similar to that when bound to Grb2 SH2, it adopts a more extended conformation when bound to the N- and C-terminal SH2 domains of p85. These differences observed in the peptide-protein interactions correlated well with the affinity and other thermodynamic parameters for each interaction determined by isothermal titration calorimetry. The detailed insight into these interactions reported here may inform the development of compounds that specifically inhibit the association of CD28 with these adaptor proteins to suppress excessive T cell responses, such as in allergies and autoimmune diseases. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Hypervariability of ribosomal DNA at multiple chromosomal sites in lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Zhuo, L; Reed, K M; Phillips, R B

    1995-06-01

    Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.

  7. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  8. S28 peptidases: lessons from a seemingly 'dysfunctional' family of two

    Directory of Open Access Journals (Sweden)

    Kozarich John W

    2010-06-01

    Full Text Available Abstract A recent paper in BMC Structural Biology reports the crystal structure of human prolylcarboxypeptidase (PRCP, one of the two members of the S28 peptidase family. Comparison of the substrate-binding site of PRCP with that of its family partner, dipeptidyl dipeptidase 7 (DPP7, helps to explain the different enzymatic activities of these structurally similar proteins, and also reveals a novel apparent charge-relay system in PRCP involving the active-site catalytic histidine. See research article: http://www.biomedcentral.com/1472-6807/10/16/ Commentary The S28 serine peptidase family is something of an enzymatic odd couple. While showing low sequence similarity to all proteins except each other, the two known family members appear to be at odds functionally; one, prolylcarboxypeptidase (PRCP, is a carboxypeptidase that cleaves single hydrophobic residues from the carboxyl termini of proteins that end with a Pro-X motif (where X is any hydrophobic amino acid, while the other, human dipeptidyl peptidase (DPP7, is an aminopeptidase that cleaves amino-terminal X-Pro dipeptides. The structural basis of this orthogonal specificity would undoubtedly be interesting, and a recent report in BMC Structural Biology from the Merck Global Structural Biology group (Soisson et al. 1 has now met that expectation. In addition they reveal a new wrinkle to the iconic catalytic triad common to most serine hydrolases. The practical pharmaceutical interest in both these enzymes as potential drug targets is at present speculative. PRCP can inactivate a number of peptide hormones, such as angiotensin II, III and prekallikrein, implicating a role for the enzyme in hypertension, tissue proliferation and smooth-muscle growth. These properties suggest that this enzyme may well be a useful target for hypertension and anti-inflammatory therapy 2. Another (non-S28 family dipeptidyl dipeptidase (DPP4 is a major drug target in type 2 diabetes, and Merck has already

  9. Multiple-Site Trimethylation of Ribosomal Protein L11 by the PrmA Methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2008-01-01

    Ribosomal protein L11 is a universally conserved component of the large subunit, and plays a significant role during initiation, elongation, and termination of protein synthesis. In Escherichia coli, the lysine methyltransferase PrmA trimethylates the N-terminal a-amino group and the -amino groups of Lys3 and Lys39. Here, we report four PrmA-L11 complex structures in different orientations with respect to the PrmA active site. Two structures capture the L11 N-terminal a-amino group in the active site in a trimethylated postcatalytic state and in a dimethylated state with bound S-adenosyl-L-homocysteine. Two other structures show L11 in a catalytic orientation to modify Lys39 and in a noncatalytic orientation. The comparison of complex structures in different orientations with a minimal substrate recognition complex shows that the binding mode remains conserved in all L11 orientations, and that substrate orientation is brought about by the unusual interdomain flexibility of PrmA.

  10. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  11. Ultrastructural autoradiographic localization of somatostatin-28 in the rat pituitary gland

    International Nuclear Information System (INIS)

    Morel, G.; Leroux, P.; Pelletier, G.

    1985-01-01

    To identify the anterior pituitary cell type(s) containing somatostatin-28 (SS-28)-binding sites and to study the internalization processes of this peptide by the target cells, autoradiography was performed on rat anterior pituitaries removed at specific intervals (2-60 min) after iv injection of the [ 125 I]iodo-SS-28 agonist [Leu8,D-Trp22,Tyr25]SS-28 into intact, adrenalectomized, or castrated male rats. At the light microscopic level, the silver grains were found in 75% of cells. Concomitant injection of an excess of unlabeled peptide prevented the binding of label, verifying the specificity of binding. No specific labeling could be detected in the adrenocorticotrophs of adrenalectomized rats or gonadotrophs (castration cells) of castrated rats. At the electron microscopic level, three cell types (somatotrophs, thyrotrophs, and mammotrophs) appear to contain radiolabeled SS-28. The time-course study in somatotrophs of intact animals showed that 2 min after injection, most silver grains were associated with the plasma membrane. Five to 15 min after injection, label was found over both the plasma membrane and cytoplasmic organelles, especially the Golgi apparatus, lysosomes, and secretory granules. At the longest time interval (60 min), labeling was mostly associated with the cytoplasmic organelles. These results indicate that SS-28-binding sites are present only in those cell types in which somatostatin is known to regulate secretory functions. The present data also show that a rapid internalization of the radiolabeled peptide occurs

  12. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  13. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  14. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  15. The occurrence of gibberellin-binding protein(s) in pea

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Z.H.

    1988-01-01

    In vitro gibberellin (GA) binding properties of a cytosol fraction from epicotyls of dwarf pea (Pisum sativum L. cv. Progress No. 9) and tall pea (Pisum sativum L. cv. Alaska) were investigated using ({sup 3}H)GA{sub 4} in a DEAE filter paper assay at 0-3 C. The binding obtained is saturable, reversible, and temperature labile in dwarf pea, and has a half-life of dissociation of 5-6 min. By varying the concentration of ({sup 3}H)GA{sub 4} in the incubation medium the Kd was estimated to be 120-140 nM in dwarf pea and 70 nM in tall pea. The number of binding sites (n) was estimated to be 0.66 and 0.43 pmole mg{sup {minus}1} soluble protein in dwarf pea and in tall pea, respectively. In competition binding assays, biologically active GAs, such as GA{sub 3} and GA{sub 4} could reduce the level of ({sup 3}H)GA{sub 4} binding much more than the biologically inactive GA{sub 4} methyl ester and epi-GA{sub 4}. Changes in gibberellin-binding protein(s) were studied during seed germination. While the Kd of the binding protein(s) for ({sup 3}H)GA{sub 4} remained the same, there was a marked increase in the number of binding sites from 24 h soaked seed to 8-day old seedlings. Also, the Kd and the number of binding sites in the GA-responsive apical part and in the nonresponsive basal part in the epicotyl were similar. The effect of light on gibberellin-binding protein in dwarf pea was also studied. The GA-binding protein in dwarf pea was partially purified by gel filtration and ion exchange chromatography.

  16. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  17. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  18. A simple ligand-binding assay for thyroxine-binding globulin on reusable Sephadex columns

    International Nuclear Information System (INIS)

    Bastomsky, C.H.; Kalloo, H.; Frenkel-Leith, D.B.; McGill Univ., Montreal, Quebec

    1977-01-01

    A method for the assay of thyroxine-binding globulin on reusable Sephadex G-25 columns is described. It depends upon elution by diluted iodothyronine-free serum of protein-bound [ 125 I]thyroxine from the columns under conditions where binding to thyroxine-binding prealbumin and albumin are abolished. It is simple, rapid and precise, and permits determinations inlarge numbers of samples. Values (mg/l; mean +- S.D.) were: normals 31.6+-5.4, hyperthyroid 28.3+-4.8, hypothyroid 40.6+-7.5, oral contraceptives 40.1+-6.8, pregnant 50.3+-5.4, cirrhotics 20.7+-4.3. Concentrations were reduced in serum heated at 56degC, while the uptake of [ 125 I]triiodothyronine was increased. There was a significant negative correlation between thyroxine-binding globulin concentration and triiodothyronine uptake in the heated serum samples and in euthyroid subjects

  19. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  20. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  1. The NS1 Protein from Influenza Virus Stimulates Translation Initiation by Enhancing Ribosome Recruitment to mRNAs.

    Science.gov (United States)

    Panthu, Baptiste; Terrier, Olivier; Carron, Coralie; Traversier, Aurélien; Corbin, Antoine; Balvay, Laurent; Lina, Bruno; Rosa-Calatrava, Manuel; Ohlmann, Théophile

    2017-10-27

    The non-structural protein NS1 of influenza A viruses exerts pleiotropic functions during infection. Among these functions, NS1 was shown to be involved in the control of both viral and cellular translation; however, the mechanism by which this occurs remains to be determined. Thus, we have revisited the role of NS1 in translation by using a combination of influenza infection, mRNA reporter transfection, and in vitro functional and biochemical assays. Our data show that the NS1 protein is able to enhance the translation of virtually all tested mRNAs with the exception of constructs bearing the Dicistroviruses Internal ribosome entry segment (IRESes) (DCV and CrPV), suggesting a role at the level of translation initiation. The domain of NS1 required for translation stimulation was mapped to the RNA binding amino-terminal motif of the protein with residues R38 and K41 being critical for activity. Although we show that NS1 can bind directly to mRNAs, it does not correlate with its ability to stimulate translation. This activity rather relies on the property of NS1 to associate with ribosomes and to recruit them to target mRNAs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  3. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  4. Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor

    Science.gov (United States)

    Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane

    2013-01-01

    We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118

  5. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  6. Identification of cross-linked amino acids in the protein pair HmaL23-HmaL29 from the 50S ribosomal subunit of the archaebacterium Haloarcula marismortui.

    Science.gov (United States)

    Bergmann, U; Wittmann-Liebold, B

    1993-03-23

    50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.

  7. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  8. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  9. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Specific binding component of the 'inactive' stereoisomer (S,S)-[125I]IQNB to rat brain muscarinic receptors in vivo

    International Nuclear Information System (INIS)

    Boulay, Sheila F.; McRee, R. Carter; Cohen, Victor I.; Sood, Virendar K.; Zeeberg, Barry R.; Reba, Richard C.

    1996-01-01

    In vivo nonspecific binding can be estimated using the inactive stereoisomer of a receptor radioligand. However, the binding of the inactive stereoisomer may be partially specific. Specific binding of the inactive (S,S)-[ 125 I]IQNB was estimated from the inhibition induced by a competing nonradioactive ligand. This technique differed from the usual approach, since it was used to study the inactive rather than the active stereoisomer. The results indicate that there is substantial specific binding for (S,S)-[ 125 I]IQNB

  11. Lead inhibition of DNA-binding mechanism of Cys(2)His(2) zinc finger proteins.

    Science.gov (United States)

    Hanas, J S; Rodgers, J S; Bantle, J A; Cheng, Y G

    1999-11-01

    The association of lead with chromatin in cells suggests that deleterious metal effects may in part be mediated through alterations in gene function. To elucidate if and how lead may alter DNA binding of cysteine-rich zinc finger proteins, lead ions were analyzed for their ability to alter the DNA binding mechanism of the Cys(2)His(2) zinc finger protein transcription factor IIIA (TFIIIA). As assayed by DNase I protection, the interaction of TFIIIA with the 50-bp internal control region of the 5S ribosomal gene was partially inhibited by 5 microM lead ions and completely inhibited by 10 to 20 microM lead ions. Preincubation of free TFIIIA with lead resulted in DNA-binding inhibition, whereas preincubation of a TFIIIA/5S RNA complex with lead did not result in DNA-binding inhibition. Because 5S RNA binds TFIIIA zinc fingers, this result is consistent with an inhibition mechanism via lead binding to zinc fingers. The complete loss of DNase I protection on the 5S gene indicates the mechanism of inhibition minimally involves the N-terminal fingers of TFIIIA. Inhibition was not readily reversible and occurred in the presence of an excess of beta-mercaptoethanol. Inhibition kinetics were fast, progressing to completion in approximately 5 min. Millimolar concentrations of sulfhydryl-specific arsenic ions were not inhibitory for TFIIIA binding. Micromolar concentrations of lead inhibited DNA binding by Sp1, another Cys(2)His(2) finger protein, but not by the nonfinger protein AP2. Inhibition of Cys(2)His(2) zinc finger transcription factors by lead ions at concentrations near those known to have deleterious physiological effects points to new molecular mechanisms for lead toxicity in promoting disease.

  12. Comparative sequence analysis of the complete set of 40S ribosomal proteins in the Senegalese sole (Solea senegalensis Kaup) and Atlantic halibut (Hippoglossus hippoglossus L.) (Teleostei: Pleuronectiformes): phylogeny and tissue- and development-specific expression.

    Science.gov (United States)

    Manchado, Manuel; Infante, Carlos; Asensio, Esther; Cañavate, Jose Pedro; Douglas, Susan E

    2007-07-03

    Ribosomal proteins (RPs) are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. The development of large-scale genomics of Senegalese sole (Solea senegalensis) and Atlantic halibut (Hippoglossus hippoglossus), two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S) ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29) in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.

  13. Comparative sequence analysis of the complete set of 40S ribosomal proteins in the Senegalese sole (Solea senegalensis Kaup and Atlantic halibut (Hippoglossus hippoglossus L. (Teleostei: Pleuronectiformes: phylogeny and tissue- and development-specific expression

    Directory of Open Access Journals (Sweden)

    Cañavate Jose

    2007-07-01

    Full Text Available Abstract Background Ribosomal proteins (RPs are key components of ribosomes, the cellular organelle responsible for protein biosynthesis in cells. Their levels can vary as a function of organism growth and development; however, some RPs have been associated with other cellular processes or extraribosomal functions. Their high representation in cDNA libraries has resulted in the increase of RP sequences available from different organisms and their proposal as appropriate molecular markers for phylogenetic analysis. Results The development of large-scale genomics of Senegalese sole (Solea senegalensis and Atlantic halibut (Hippoglossus hippoglossus, two commercially important flatfish species, has made possible the identification and systematic analysis of the complete set of RP sequences for the small (40S ribosome subunit. Amino acid sequence comparisons showed a high similarity both between these two flatfish species and with respect to other fish and human. EST analysis revealed the existence of two and four RPS27 genes in Senegalese sole and Atlantic halibut, respectively. Phylogenetic analysis clustered RPS27 in two separate clades with their fish and mammalian counterparts. Steady-state transcript levels for eight RPs (RPS2, RPS3a, RPS15, RPS27-1, RPS27-2, RPS27a, RPS28, and RPS29 in sole were quantitated during larval development and in tissues, using a real-time PCR approach. All eight RPs exhibited different expression patterns in tissues with the lowest levels in brain. On the contrary, RP transcripts increased co-ordinately after first larval feeding reducing progressively during the metamorphic process. Conclusion The genomic resources and knowledge developed in this survey will provide new insights into the evolution of Pleuronectiformes. Expression data will contribute to a better understanding of RP functions in fish, especially the mechanisms that govern growth and development in larvae, with implications in aquaculture.

  14. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  15. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  16. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  17. Mitochondrial 12S ribosomal RNA A1555G mutation associated with cardiomyopathy and hearing loss following high-dose chemotherapy and repeated aminoglycoside exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... of febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  18. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  20. Molecular Dynamics Simulations Suggest Ligand’s Binding to Nicotinamidase/Pyrazinamidase

    Science.gov (United States)

    Zhang, Ji-Long; Zheng, Qing-Chuan; Li, Zheng-Qiang; Zhang, Hong-Xing

    2012-01-01

    The research on the binding process of ligand to pyrazinamidase (PncA) is crucial for elucidating the inherent relationship between resistance of Mycobacterium tuberculosis and PncA’s activity. In the present study, molecular dynamics (MD) simulation methods were performed to investigate the unbinding process of nicotinamide (NAM) from two PncA enzymes, which is the reverse of the corresponding binding process. The calculated potential of mean force (PMF) based on the steered molecular dynamics (SMD) simulations sheds light on an optimal binding/unbinding pathway of the ligand. The comparative analyses between two PncAs clearly exhibit the consistency of the binding/unbinding pathway in the two enzymes, implying the universality of the pathway in all kinds of PncAs. Several important residues dominating the pathway were also determined by the calculation of interaction energies. The structural change of the proteins induced by NAM’s unbinding or binding shows the great extent interior motion in some homologous region adjacent to the active sites of the two PncAs. The structure comparison substantiates that this region should be very important for the ligand’s binding in all PncAs. Additionally, MD simulations also show that the coordination position of the ligand is displaced by one water molecule in the unliganded enzymes. These results could provide the more penetrating understanding of drug resistance of M. tuberculosis and be helpful for the development of new antituberculosis drugs. PMID:22761821

  1. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  2. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Energy Technology Data Exchange (ETDEWEB)

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  3. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    International Nuclear Information System (INIS)

    Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.

    1994-01-01

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  4. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

    Science.gov (United States)

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

    2017-07-01

    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  5. Binding and functional effects of atrial natriuretic factor in isolated rat kidney

    International Nuclear Information System (INIS)

    Suzuki, M.; Almeida, F.A.; Nussenzveig, D.R.; Sawyer, D.; Maack, T.

    1987-01-01

    A new methodological approach was developed to study the relationship between specific binding and dose-response curves of the renal effects of atrial natriuretic factor (ANF) in isolated perfused rat kidneys (IK). IK were perfused with 125 I-labeled and unlabeled ANF 1-28 to determine the following: (1) distribution, capacity (C max ), and apparent affinity (S 50 ) of specific binding of ANF 1-28 in cortex, outer medulla, and papilla and (2) dose-response curves of the effects of ANF 1-28 on renal hemodynamics and excretion of fluid and electrolytes. The kidney had a very high density of high-affinity binding sites for ANF. Cortex had >90% of total binding sites whereas papilla had <2% of total binding sites with a 10-fold lower apparent affinity than in cortex. ANF-induced increases in glomerular filtration rate and excretion of fluid and electrolytes were detectable at 10-100 pM and maximal effects occurred at 1-10 nM ANF. Below 1 nM there was no dissociation between the renal hemodynamic and natriuretic effects of ANF. There was a close agreement between dose-response and binding curves of ANF to cortex. Results demonstrates that binding site occupancy in kidney cortex and renal effects of ANF occur at near physiological concentrations of the hormone

  6. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  7. Antibodies to ribosomal P proteins of Trypanosoma cruzi in Chagas disease possess functional autoreactivity with heart tissue and differ from anti-P autoantibodies in lupus.

    Science.gov (United States)

    Kaplan, D; Ferrari, I; Bergami, P L; Mahler, E; Levitus, G; Chiale, P; Hoebeke, J; Van Regenmortel, M H; Levin, M J

    1997-09-16

    Anti-P antibodies present in sera from patients with chronic Chagas heart disease (cChHD) recognize peptide R13, EEEDDDMGFGLFD, which encompasses the C-terminal region of the Trypanosoma cruzi ribosomal P1 and P2 proteins. This peptide shares homology with the C-terminal region (peptide H13 EESDDDMGFGLFD) of the human ribosomal P proteins, which is in turn the target of anti-P autoantibodies in systemic lupus erythematosus (SLE), and with the acidic epitope, AESDE, of the second extracellular loop of the beta1-adrenergic receptor. Anti-P antibodies from chagasic patients showed a marked preference for recombinant parasite ribosomal P proteins and peptides, whereas anti-P autoantibodies from SLE reacted with human and parasite ribosomal P proteins and peptides to the same extent. A semi-quantitative estimation of the binding of cChHD anti-P antibodies to R13 and H13 using biosensor technology indicated that the average affinity constant was about 5 times higher for R13 than for H13. Competitive enzyme immunoassays demonstrated that cChHD anti-P antibodies bind to the acidic portions of peptide H13, as well as to peptide H26R, encompassing the second extracellular loop of the beta1 adrenoreceptor. Anti-P antibodies isolated from cChHD patients exert a positive chronotropic effect in vitro on cardiomyocytes from neonatal rats, which resembles closely that of anti-beta1 receptor antibodies isolated from the same patient. In contrast, SLE anti-P autoantibodies have no functional effect. Our results suggest that the adrenergic-stimulating activity of anti-P antibodies may be implicated in the induction of functional myocardial impairments observed in cChHD.

  8. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  9. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    Science.gov (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  10. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    DEFF Research Database (Denmark)

    Xiong, L; Kloss, P; Douthwaite, S

    2000-01-01

    Oxazolidinone antibiotics inhibit bacterial protein synthesis by interacting with the large ribosomal subunit. The structure and exact location of the oxazolidinone binding site remain obscure, as does the manner in which these drugs inhibit translation. To investigate the drug-ribosome interaction......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis...

  11. Release of newly synthesized nucleoplasmic ribosomal subunits or their precursor particles from isolated nuclei of regenerating rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine

    1930-06-16

    The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.

  12. A tandem sequence motif acts as a distance-dependent enhancer in a set of genes involved in translation by binding the proteins NonO and SFPQ

    Directory of Open Access Journals (Sweden)

    Roepcke Stefan

    2011-12-01

    Full Text Available Abstract Background Bioinformatic analyses of expression control sequences in promoters of co-expressed or functionally related genes enable the discovery of common regulatory sequence motifs that might be involved in co-ordinated gene expression. By studying promoter sequences of the human ribosomal protein genes we recently identified a novel highly specific Localized Tandem Sequence Motif (LTSM. In this work we sought to identify additional genes and LTSM-binding proteins to elucidate potential regulatory mechanisms. Results Genome-wide analyses allowed finding a considerable number of additional LTSM-positive genes, the products of which are involved in translation, among them, translation initiation and elongation factors, and 5S rRNA. Electromobility shift assays then showed specific signals demonstrating the binding of protein complexes to LTSM in ribosomal protein gene promoters. Pull-down assays with LTSM-containing oligonucleotides and subsequent mass spectrometric analysis identified the related multifunctional nucleotide binding proteins NonO and SFPQ in the binding complex. Functional characterization then revealed that LTSM enhances the transcriptional activity of the promoters in dependency of the distance from the transcription start site. Conclusions Our data demonstrate the power of bioinformatic analyses for the identification of biologically relevant sequence motifs. LTSM and the here found LTSM-binding proteins NonO and SFPQ were discovered through a synergistic combination of bioinformatic and biochemical methods and are regulators of the expression of a set of genes of the translational apparatus in a distance-dependent manner.

  13. Residues 28 to 39 of the Extracellular Loop 1 of Chicken Na+/H+ Exchanger Type I Mediate Cell Binding and Entry of Subgroup J Avian Leukosis Virus.

    Science.gov (United States)

    Guan, Xiaolu; Zhang, Yao; Yu, Mengmeng; Ren, Chaoqi; Gao, Yanni; Yun, Bingling; Liu, Yongzhen; Wang, Yongqiang; Qi, Xiaole; Liu, Changjun; Cui, Hongyu; Zhang, Yanping; Gao, Li; Li, Kai; Pan, Qing; Zhang, Baoshan; Wang, Xiaomei; Gao, Yulong

    2018-01-01

    Chicken Na + /H + exchanger type I (chNHE1), a multispan transmembrane protein, is a cellular receptor of the subgroup J avian leukosis virus (ALV-J). To identify the functional determinants of chNHE1 responsible for the ALV-J receptor activity, a series of chimeric receptors was created by exchanging the extracellular loops (ECL) of human NHE1 (huNHE1) and chNHE1 and by ECL replacement with a hemagglutinin (HA) tag. These chimeric receptors then were used in binding and entry assays to map the minimal ALV-J gp85-binding domain of chNHE1. We show that ECL1 of chNHE1 (chECL1) is the critical functional ECL that interacts directly with ALV-J gp85; ECL3 is also involved in ALV-J gp85 binding. Amino acid residues 28 to 39 of the N-terminal membrane-proximal region of chECL1 constitute the minimal domain required for chNHE1 binding of ALV-J gp85. These residues are sufficient to mediate viral entry into ALV-J nonpermissive cells. Point mutation analysis revealed that A30, V33, W38, and E39 of chECL1 are the key residues mediating the binding between chNHE1 and ALV-J gp85. Further, the replacement of residues 28 to 39 of huNHE1 with the corresponding chNHE1 residues converted the nonfunctional ALV-J receptor huNHE1 to a functional one. Importantly, soluble chECL1 and huECL1 harboring chNHE1 residues 28 to 39 both could effectively block ALV-J infection. Collectively, our findings indicate that residues 28 to 39 of chNHE1 constitute a domain that is critical for receptor function and mediate ALV-J entry. IMPORTANCE chNHE1 is a cellular receptor of ALV-J, a retrovirus that causes infections in chickens and serious economic losses in the poultry industry. Until now, the domains determining the chNHE1 receptor function remained unknown. We demonstrate that chECL1 is critical for receptor function, with residues 28 to 39 constituting the minimal functional domain responsible for chNHE1 binding of ALV-J gp85 and efficiently mediating ALV-J cell entry. These residues are

  14. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  15. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  16. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  17. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  18. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  19. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    Science.gov (United States)

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  20. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller

    2014-09-01

    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  1. Electronic structure of C28, Pa at sign C28, and U at sign C28

    International Nuclear Information System (INIS)

    Zhao, K.; Pitzer, R.M.

    1996-01-01

    Electronic structure calculations, including relativistic core potentials and the spin-orbit interaction, have been carried out on the C 28 , Pa at sign C 28 , and U at sign C 28 species. Excitation energies, spin-orbit splittings, the electron affinity, and the ionization potential are computed for C 28 . The ground state of C 28 is described well by the Hartree-Fock wave functions, but other states are not. The computed electron affinity and ionization potential are similar to those of C 60 . Strong metal-cage binding is found for Pa at sign C 28 and U at sign C 28 , similar to that in U(C 8 H 8 ) 2 . The ground electronic states depend on the order of the lowest-energy cage π * and metal 5f orbitals, with (π * ) 1 and (π * ) 1 (5f) 1 found to be the ground electronic configurations for the two complexes. U at sign C 28 is found to be diamagnetic. 30 refs., 1 fig., 13 tabs

  2. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  3. Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

    Directory of Open Access Journals (Sweden)

    Igor Ruvinsky

    Full Text Available BACKGROUND: Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-, are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. METHODOLOGY/PRINCIPAL FINDINGS: A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/- muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG in the muscle. CONCLUSIONS/SIGNIFICANCE: This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar

  4. p56Lck and p59Fyn Regulate CD28 Binding to Phosphatidylinositol 3-Kinase, Growth Factor Receptor-Bound Protein GRB-2, and T Cell-Specific Protein-Tyrosine Kinase ITK: Implications for T-Cell Costimulation

    Science.gov (United States)

    Raab, Monika; Cai, Yun-Cai; Bunnell, Stephen C.; Heyeck, Stephanie D.; Berg, Leslie J.; Rudd, Christopher E.

    1995-09-01

    T-cell activation requires cooperative signals generated by the T-cell antigen receptor ξ-chain complex (TCRξ-CD3) and the costimulatory antigen CD28. CD28 interacts with three intracellular proteins-phosphatidylinositol 3-kinase (PI 3-kinase), T cell-specific protein-tyrosine kinase ITK (formerly TSK or EMT), and the complex between growth factor receptor-bound protein 2 and son of sevenless guanine nucleotide exchange protein (GRB-2-SOS). PI 3-kinase and GRB-2 bind to the CD28 phosphotyrosine-based Tyr-Met-Asn-Met motif by means of intrinsic Src-homology 2 (SH2) domains. The requirement for tyrosine phosphorylation of the Tyr-Met-Asn-Met motif for SH2 domain binding implicates an intervening protein-tyrosine kinase in the recruitment of PI 3-kinase and GRB-2 by CD28. Candidate kinases include p56Lck, p59Fyn, ξ-chain-associated 70-kDa protein (ZAP-70), and ITK. In this study, we demonstrate in coexpression studies that p56Lck and p59Fyn phosphorylate CD28 primarily at Tyr-191 of the Tyr-Met-Asn-Met motif, inducing a 3- to 8-fold increase in p85 (subunit of PI 3-kinase) and GRB-2 SH2 binding to CD28. Phosphatase digestion of CD28 eliminated binding. In contrast to Src kinases, ZAP-70 and ITK failed to induce these events. Further, ITK binding to CD28 was dependent on the presence of p56Lck and is thus likely to act downstream of p56Lck/p59Fyn in a signaling cascade. p56Lck is therefore likely to be a central switch in T-cell activation, with the dual function of regulating CD28-mediated costimulation as well as TCR-CD3-CD4 signaling.

  5. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  6. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  7. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  8. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Electrostatics, structure prediction, and the energy landscapes for protein folding and binding.

    Science.gov (United States)

    Tsai, Min-Yeh; Zheng, Weihua; Balamurugan, D; Schafer, Nicholas P; Kim, Bobby L; Cheung, Margaret S; Wolynes, Peter G

    2016-01-01

    While being long in range and therefore weakly specific, electrostatic interactions are able to modulate the stability and folding landscapes of some proteins. The relevance of electrostatic forces for steering the docking of proteins to each other is widely acknowledged, however, the role of electrostatics in establishing specifically funneled landscapes and their relevance for protein structure prediction are still not clear. By introducing Debye-Hückel potentials that mimic long-range electrostatic forces into the Associative memory, Water mediated, Structure, and Energy Model (AWSEM), a transferable protein model capable of predicting tertiary structures, we assess the effects of electrostatics on the landscapes of thirteen monomeric proteins and four dimers. For the monomers, we find that adding electrostatic interactions does not improve structure prediction. Simulations of ribosomal protein S6 show, however, that folding stability depends monotonically on electrostatic strength. The trend in predicted melting temperatures of the S6 variants agrees with experimental observations. Electrostatic effects can play a range of roles in binding. The binding of the protein complex KIX-pKID is largely assisted by electrostatic interactions, which provide direct charge-charge stabilization of the native state and contribute to the funneling of the binding landscape. In contrast, for several other proteins, including the DNA-binding protein FIS, electrostatics causes frustration in the DNA-binding region, which favors its binding with DNA but not with its protein partner. This study highlights the importance of long-range electrostatics in functional responses to problems where proteins interact with their charged partners, such as DNA, RNA, as well as membranes. © 2015 The Protein Society.

  10. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.

    Science.gov (United States)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B; Steitz, Thomas A

    2009-05-29

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 A. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  11. U2504 Determines the Species Specificity of the A-Site Cleft Antibiotics: The Structures of Tiamulin, Homoharringtonine, and Bruceantin Bound to the Ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.; Steitz, Thomas A.; Yale

    2009-06-30

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In the ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.

  12. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  13. Modeling of the structure of ribosomal protein L1 from the archaeon Haloarcula marismortui

    Science.gov (United States)

    Nevskaya, N. A.; Kljashtorny, V. G.; Vakhrusheva, A. V.; Garber, M. B.; Nikonov, S. V.

    2017-07-01

    The halophilic archaeon Haloarcula marismortui proliferates in the Dead Sea at extremely high salt concentrations (higher than 3 M). This is the only archaeon, for which the crystal structure of the ribosomal 50S subunit was determined. However, the structure of the functionally important side protuberance containing the abnormally negatively charged protein L1 (HmaL1) was not visualized. Attempts to crystallize HmaL1 in the isolated state or as its complex with RNA using normal salt concentrations (≤500 mM) failed. A theoretical model of HmaL1 was built based on the structural data for homologs of the protein L1 from other organisms, and this model was refined by molecular dynamics methods. Analysis of this model showed that the protein HmaL1 can undergo aggregation due to the presence of a cluster of positive charges unique for proteins L1. This cluster is located at the RNA-protein interface, which interferes with the crystallization of HmaL1 and the binding of the latter to RNA.

  14. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  15. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  16. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Definition of IgG- and albumin-binding regions of streptococcal protein G.

    Science.gov (United States)

    Akerström, B; Nielsen, E; Björck, L

    1987-10-05

    Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

  18. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars

    2018-01-01

    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  19. Structure of a yeast 40S-eIF1-eIF1A-eIF3-eIF3j initiation complex.

    Science.gov (United States)

    Aylett, Christopher H S; Boehringer, Daniel; Erzberger, Jan P; Schaefer, Tanja; Ban, Nenad

    2015-03-01

    Eukaryotic translation initiation requires cooperative assembly of a large protein complex at the 40S ribosomal subunit. We have resolved a budding yeast initiation complex by cryo-EM, allowing placement of prior structures of eIF1, eIF1A, eIF3a, eIF3b and eIF3c. Our structure highlights differences in initiation-complex binding to the ribosome compared to that of mammalian eIF3, demonstrates a direct contact between eIF3j and eIF1A and reveals the network of interactions between eIF3 subunits.

  20. Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans.

    Science.gov (United States)

    Chowdhury, Tahmeena; Köhler, Julia R

    2015-10-01

    TOR and PKA signaling pathways control eukaryotic cell growth and proliferation. TOR activity in model fungi, such as Saccharomyces cerevisiae, responds principally to nutrients, e.g., nitrogen and phosphate sources, which are incorporated into the growing cell mass; PKA signaling responds to the availability of the cells' major energy source, glucose. In the fungal commensal and pathogen, Candida albicans, little is known of how these pathways interact. Here, the signal from phosphorylated ribosomal protein S6 (P-S6) was defined as a surrogate marker for TOR-dependent anabolic activity in C. albicans. Nutritional, pharmacologic and genetic modulation of TOR activity elicited corresponding changes in P-S6 levels. The P-S6 signal corresponded to translational activity of a GFP reporter protein. Contributions of four PKA pathway components to anabolic activation were then examined. In high glucose concentrations, only Tpk2 was required to upregulate P-S6 to physiologic levels, whereas all four tested components were required to downregulate P-S6 in low glucose. TOR was epistatic to PKA components with respect to P-S6. In many host niches inhabited by C. albicans, glucose is scarce, with protein being available as a nitrogen source. We speculate that PKA may modulate TOR-dependent cell growth to a rate sustainable by available energy sources, when monomers of anabolic processes, such as amino acids, are abundant. © 2015 John Wiley & Sons Ltd.

  1. Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

    OpenAIRE

    Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

    2005-01-01

    In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious mi...

  2. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  3. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  4. Properties of Folate Binding Protein Purified from Cow’s Milk

    Directory of Open Access Journals (Sweden)

    SUBANDRATE

    2012-09-01

    Full Text Available Folic acid played an important role in the metabolism of the body. To measure the serum folic acid levels could use the folate binding protein (FBP from cow’s milk with a technique analogous to ELISA. The aims of this study were to identify characteristics of FBP from cow’s milk and binding capacity of FBP to folic acid and to purify FBP from other whey protein passed through DEAE-cellulose chromatography column. Each of DEAE-cellulose peaks was passed in affinity chromatography column. FBP was released from affinity column with sodium acetate buffer pH 3.5. The purity of obtained FBP was demonstrated by a single spot in SDS-PAGE analysis and the estimated molecular weight of FBP was around 31 kDa. Our study indicated that 1 mol FBP bound 1 mol folic acid. Alkylation with iodoacetic acid decreased the binding capacity of FBP which suggested the presence of a–SH or imidazol group in its active site. The importance of disulfide bridge was proven by decreasing of folate binding capacity of FBP after -mercaptoethanol treatment. In contrary, the folate binding didn need Ca2+ ion, as indicated by EDTA test which gave the same result as control.

  5. The FasX Small Regulatory RNA Negatively Regulates the Expression of Two Fibronectin-Binding Proteins in Group A Streptococcus.

    Science.gov (United States)

    Danger, Jessica L; Makthal, Nishanth; Kumaraswami, Muthiah; Sumby, Paul

    2015-12-01

    The group A Streptococcus (GAS; Streptococcus pyogenes) causes more than 700 million human infections each year. The success of this pathogen can be traced in part to the extensive arsenal of virulence factors that are available for expression in temporally and spatially specific manners. To modify the expression of these virulence factors, GAS use both protein- and RNA-based regulators, with the best-characterized RNA-based regulator being the small regulatory RNA (sRNA) FasX. FasX is a 205-nucleotide sRNA that contributes to GAS virulence by enhancing the expression of the thrombolytic secreted virulence factor streptokinase and by repressing the expression of the collagen-binding cell surface pili. Here, we have expanded the FasX regulon, showing that this sRNA also negatively regulates the expression of the adhesion- and internalization-promoting, fibronectin-binding proteins PrtF1 and PrtF2. FasX posttranscriptionally regulates the expression of PrtF1/2 through a mechanism that involves base pairing to the prtF1 and prtF2 mRNAs within their 5' untranslated regions, overlapping the mRNA ribosome-binding sites. Thus, duplex formation between FasX and the prtF1 and prtF2 mRNAs blocks ribosome access, leading to an inhibition of mRNA translation. Given that FasX positively regulates the expression of the spreading factor streptokinase and negatively regulates the expression of the collagen-binding pili and of the fibronectin-binding PrtF1/2, our data are consistent with FasX functioning as a molecular switch that governs the transition of GAS between the colonization and dissemination stages of infection. More than half a million deaths each year are a consequence of infections caused by GAS. Insights into how this pathogen regulates the production of proteins during infection may facilitate the development of novel therapeutic or preventative regimens aimed at inhibiting this activity. Here, we have expanded insight into the regulatory activity of the GAS small

  6. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  7. Structural and functional analysis of the human spliceosomal DEAD-box helicase Prp28

    Energy Technology Data Exchange (ETDEWEB)

    Möhlmann, Sina [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany); Mathew, Rebecca [Max-Planck-Institute for Biophysical Chemistry, Am Fassberg, 37077 Göttingen (Germany); Neumann, Piotr; Schmitt, Andreas [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany); Lührmann, Reinhard [Max-Planck-Institute for Biophysical Chemistry, Am Fassberg, 37077 Göttingen (Germany); Ficner, Ralf, E-mail: rficner@uni-goettingen.de [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany)

    2014-06-01

    The crystal structure of the helicase domain of the human spliceosomal DEAD-box protein Prp28 was solved by SAD. The binding of ADP and ATP by Prp28 was studied biochemically and analysed with regard to the crystal structure. The DEAD-box protein Prp28 is essential for pre-mRNA splicing as it plays a key role in the formation of an active spliceosome. Prp28 participates in the release of the U1 snRNP from the 5′-splice site during association of the U5·U4/U6 tri-snRNP, which is a crucial step in the transition from a pre-catalytic spliceosome to an activated spliceosome. Here, it is demonstrated that the purified helicase domain of human Prp28 (hPrp28ΔN) binds ADP, whereas binding of ATP and ATPase activity could not be detected. ATP binding could not be observed for purified full-length hPrp28 either, but within an assembled spliceosomal complex hPrp28 gains ATP-binding activity. In order to understand the structural basis for the ATP-binding deficiency of isolated hPrp28, the crystal structure of hPrp28ΔN was determined at 2.0 Å resolution. In the crystal the helicase domain adopts a wide-open conformation, as the two RecA-like domains are extraordinarily displaced from the productive ATPase conformation. Binding of ATP is hindered by a closed conformation of the P-loop, which occupies the space required for the γ-phosphate of ATP.

  8. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  9. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  10. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  11. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  12. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    The nucleolus is the site of ribosomal RNA (rRNA) and ribosome production. In the bovine primordial follicle oocyte, this organelle is inactive, but in the secondary follicle an active fibrillo-granular nucleolus develops and proteins involved in rDNA transcription (topoisomerase I, RNA polymerase...... I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...... fertilization, structures resembling the nucleolar remnant, now referred to as nucleolus precursor bodies (NPBs), are established in the pronuclei. These entities are engaged in the re-establishment of fibrilo-granular nucleoli at the major activation of the embryonic genome. This nucleolar formation can...

  13. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  14. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  15. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  17. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  18. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  19. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  20. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

    Directory of Open Access Journals (Sweden)

    Mark A. Smith

    2015-04-01

    Full Text Available Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC and agouti-related protein (AgRP neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons.