
Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker (Acari in response the different kinds of food  

Directory of Open Access Journals (Sweden)

Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez Ferla



Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento / Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including dif [...] ferent species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius concordis (Chant, 1959) and Neoseiulus anonymus (Chant & Baker, 1965), both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921), Polyphagotarsonemus latus (Banks, 1904), Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950), and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day). Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available The rubber tree (Hevea brasiliensis Muell. Arg. (Euphorbiaceae is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae on rubber trees, associated with the mite Tenuipalpus heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

Noeli Juarez Ferla



Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae) / Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english The rubber tree (Hevea brasiliensis Muell. Arg.) (Euphorbiaceae) is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae) on rubber trees, associated with the mite Tenuipalpu [...] s heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm) is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da Silva



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.


Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Viçosa, Minas Gerais State, Brazil / Similaridade genética entre Agistemus pallinii Matioli et al (Acari: Stigmaeidae) encontrados em pomares de citros em Viçosa, MG  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Stigmaeidae são importantes predadores de ácaros e insetos pragas em várias culturas no Brasil. Essa família é considerada a segunda mais importante de ácaros predadores em citros no Brasil. Entretanto, o status taxonômico desses ácaros, principalmente do gênero Agistemus, é difícil de ser analisado [...] com base em caracteres morfológicos. Assim, este trabalho descreve o uso de marcadores polimórfi cos amplificados ao acaso (PCR-RAPD) para investigar a similaridade genética de uma população de Agistemus pallinii Matioli et al encontrada em 2004 em pomar de citros em Viçosa, MG, predando Panonychus citri (McGregor). As amplificações foram realizadas com 12 iniciadores randômicos (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 e OPAE17), os quais geraram 119 bandas, sendo 53,8% polimórficas. Os coeficientes de similaridade genética entre os indivíduos variaram de 0,68 a 0,99, indicando alta similaridade entre eles. A análise de projeção gráfica 3D mostrou que a maioria dos indivíduos analisados formou um único grupo, confirmando a alta similaridade genética entre os mesmos. Assim, mesmo considerando o pequeno tamanho de A. pallinii (± 360 µm), a técnica de PCR-RAPD pode ser utilizada para a sua identificação, em suporte às análises morfológicas ou em comparações de populações coletadas em diferentes regiões geográficas. O presente trabalho representa o primeiro estudo molecular realizado com ácaros da família Stigmaeidae. Abstract in english Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult b [...] ased only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Viçosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifi cations were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 µm long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the first molecular study carried out with stigmaeid mites.

André L, Matioli; Angelo, Pallini; Mara G, Tavares.



Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Viçosa, Minas Gerais State, Brazil / Similaridade genética entre Agistemus pallinii Matioli et al (Acari: Stigmaeidae) encontrados em pomares de citros em Viçosa, MG  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Stigmaeidae são importantes predadores de ácaros e insetos pragas em várias culturas no Brasil. Essa família é considerada a segunda mais importante de ácaros predadores em citros no Brasil. Entretanto, o status taxonômico desses ácaros, principalmente do gênero Agistemus, é difícil de ser analisado [...] com base em caracteres morfológicos. Assim, este trabalho descreve o uso de marcadores polimórfi cos amplificados ao acaso (PCR-RAPD) para investigar a similaridade genética de uma população de Agistemus pallinii Matioli et al encontrada em 2004 em pomar de citros em Viçosa, MG, predando Panonychus citri (McGregor). As amplificações foram realizadas com 12 iniciadores randômicos (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 e OPAE17), os quais geraram 119 bandas, sendo 53,8% polimórficas. Os coeficientes de similaridade genética entre os indivíduos variaram de 0,68 a 0,99, indicando alta similaridade entre eles. A análise de projeção gráfica 3D mostrou que a maioria dos indivíduos analisados formou um único grupo, confirmando a alta similaridade genética entre os mesmos. Assim, mesmo considerando o pequeno tamanho de A. pallinii (± 360 µm), a técnica de PCR-RAPD pode ser utilizada para a sua identificação, em suporte às análises morfológicas ou em comparações de populações coletadas em diferentes regiões geográficas. O presente trabalho representa o primeiro estudo molecular realizado com ácaros da família Stigmaeidae. Abstract in english Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult b [...] ased only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Viçosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifi cations were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 µm long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the first molecular study carried out with stigmaeid mites.

André L, Matioli; Angelo, Pallini; Mara G, Tavares.


Biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) e sua potencialidade de predação sobre Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) / Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O presente trabalho objetivou estudar a biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira nas temperaturas de 15; 20; 25; 30 e 35°C, alimentada com Brevipalpus phoenicis (Geijskes) e pólen de Thypha sp. em condições de laboratório. Tabelas de vida de fertilidade foram calculadas para [...] determinar os parâmetros biológicos. A temperatura ideal para o desenvolvimento de A. brasiliensis foi 29°C. Os valores de T (ciclo de vida - dias), R0 e r m, na temperatura de 30°C, foram de 13,95; 16,25 e 0,20, respectivamente. A potencialidade de predação de A. brasiliensis foi estudada para as densidades populacionais de 5; 10; 20; 40 e 60 adultos de B. phoenicis a 29°C, em arenas de 3 cm de diâmetro, sobre frutos de laranja-pêra. A densidade de 20 ácaros foi suficiente para que o predador consumisse seu número máximo de presas (7,6 ácaros por dia). Densidades acima de 40 ácaros da leprose proporcionaram 4,7 ovos por dia, em comparação aos 2,5 ovos por dia obtidos na densidade de 20 ácaros da leprose. Abstract in english The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35°C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biolog [...] ical parameters. The optimal development of A. brasiliensis took place at 29°C. The values of T (time of generation - days), R0 and r m at 30°C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29°C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage.

André L., Matioli; Carlos A.L. de, Oliveira.


Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos / Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 200 [...] 2. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor), e três espécies de predadores, Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus. Abstract in english This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tre [...] e commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor), and three species of predator mites Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

Alfredo de, Gouvea; Carla Felicita, Zanella; Sergio Miguel, Mazaro; Joel, Donazzolo; Luis Francisco Angeli, Alves.


Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou na ausência de ácaros fitófagos Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without the presence of phytophagous mites  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 2002. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor, e três espécies de predadores, Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus.This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tree commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor, and three species of predator mites Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

Alfredo de Gouvea



Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil  

Energy Technology Data Exchange (ETDEWEB)

Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute ({+-} 360 {mu}m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

Matioli, Andre L. [Instituto Biologico, Campinas, SP (Brazil). Lab. de Entomologia Economica], e-mail:; Pallini, Angelo [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal], e-mail:; Tavares, Mara G. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral], e-mail:



Comparative residual toxicities of pesticides to the predator Agistemus industani (Acari: Stigmaeidae) on citrus in Florida. (United States)

Residual toxicities of registered and selected experimental pesticides used on citrus against Agistemus industani Gonzalez (Acari: Stigmaeidae) were compared. Pesticides considered highly toxic to A. industani were: abamectin 0.15 EC at 731 ml/ha + FC 435-66 petroleum oil at 46.8 l/ha, pyridaben 75 WP at 469 g/ha, ethion 4 EC at 7.01 l/ha + FC 435-66 petroleum oil at 46.8 l/ha, propargite 6.55 EC at 3.51 l/ha, chlorfenapyr 2 SC at 1.46 l/ha applied alone or in combination with FC 435-66 petroleum oil at 46.8 l/ha, sulphur 80 DF at 16.81 kg/ha. dicofol 4EC at 7.01 l/ha, fenbutatin oxide 50 WP at 2.24 kg/ha, benomyl 50 WP at 2.24 kg/ha, benomyl 50 WP at 1.68 kg/ha + ferbam 76 GF at 5.60 kg/ha, ferbam 76 GF at 11.21 kg/ha, neem oil 90 EC at 46.8 l/ha, and copper hydroxide DF (40% metallic copper) at 4.48 kg metallic copper/ha + FC 435-66 petroleum oil at 46.8 l/ha. Pesticides that were moderately to slightly toxic included: copper sulphate 98% at 4.48 kg metallic copper/ha + FC 435-66 petroleum oil at 46.8 l/ha, fenbuconazole 2 F at 280 ml/ha + FC 435-66 petroleum oil at 46.8 l/ha, FC 435-66 petroleum oil applied alone at 46.8 l/ha or 23.41/ha, and diflubenzuron 25 WP at 1.40 kg/ha. Pesticides that were non-toxic included: fenbuconazole 2 F at 585 ml/ha, malathion 57 EC at 5.85 l/ha, FC 435-66 petroleum oil at 46.8 l/ha, carbaryl 80 S at 3.36 kg/ha. chlorpyrifos 4 EC at 4.68 l/ha, and formetanate 92 SP at 1.12 kg/ha. Understanding the toxic effects of field weathered pesticides against key predacious mite species is important for effective IPM. The results of this study provide a comparison of direct and indirect toxic effects of various pesticides to A. industani under field conditions. PMID:11697784

Childers, C C; Villanueva, R; Aguilar, H; Chewning, R; Michaud, J P



SEM Observations on the Predation Behavior of Agistemus terminalis (Quayle (Acari: Stigmaeidae and Amblyseius sojaensis Ehara (Acari: Phytoseiidae on Panonychus citri (Mcgregor (Acari: Tetranychidae  

Directory of Open Access Journals (Sweden)

Full Text Available The predation behavior of Agistemus terminalis and Amblyseius sojaensis on Panonychus citri was studied under scanning electron microscope. Agistemus terminalis grasped egg stalk by claws and sensory organ of palpi and direct attack on eggs was done by needle-shaped stylets extruded from the rostrum. A distinct hole was found on the egg surface produced by the penetration and successive withdrawn of the rostrum and stylets. Finally, the hole became wide by the further attack of rostrum and palpi. Amblyseius sojaensis predated on the larvae and adults of P. citri. It grasped the anterior portion of the prey body by palpi and legs. Several sharply pointed and bent setae of palpi invaded into the cuticle of the prey. The prey was then attacked by the chelicerae and the cuticle was lacerated. The drawing of body fluid occurred by the extended malae which were positioned between the corniculi and the chelicerae.

Abdul Razaq



[Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)]. (United States)

The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35 degrees C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biological parameters. The optimal development of A. brasiliensis took place at 29 degrees C. The values of T (time of generation - days), R0 and r m at 30 degrees C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29 degrees C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage. PMID:17934624

Matioli, André L; de Oliveira, Carlos A L



Predadores asociados a panonychus citri mcgregor (acari: tetranychidae) en la costa central del Perú  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus t...

Norberta Martínez; Alberto Daniel Guanilo



Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum infection in invasive Eastern Cottontail Rabbits Sylvilagus floridanus in Northwestern Italy. (United States)

Sylvilagus floridanus is a lagomorph introduced for hunting purposes from North America to Europe where, in certain areas like Northern Italy, its population reached high densities. Brain, kidney and skeletal muscle of 144 Eastern Cottontail Rabbits S. floridanus were examined by PCR for Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum. DNA of E. cuniculi was found with a prevalence of 9.72% (CI 95% 0.058-0.156). T. gondii and N. caninum DNA was detected in 2.08% (CI 95% 0.0071-0.0595) and 2.78% (CI 95% 0.0109-0.0692) of the samples examined, respectively. This is the first report of E. cuniculi infection in a lagomorph species other than in its natural host Oryctolagus cuniculus, and this is also the first time N. caninum is found to naturally infect S. floridanus. E. cuniculi, T. gondii and N. caninum infect S. floridanus at low but relevant prevalences, considered the important role that these pathogens could play in both animal and human health. PMID:23747104

Zanet, S; Palese, V; Trisciuoglio, A; Cantón Alonso, C; Ferroglio, E



Predadores asociados a panonychus citri mcgregor (acari: tetranychidae en la costa central del Perú  

Directory of Open Access Journals (Sweden)

Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor, Typhlodromus (Anthoseius evectus (Schuster, Typhlodromus (Anthoseius transvaalensis (Nesbitt, Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A. evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados

Alberto Daniel Guanilo



Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R...

Silveira Luís Cláudio Paterno; Bueno Vanda Helena Paes; Pierre Leonardo Santa Rosa; Mendes Simome Martins



Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera: Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larv...

Santos Terezinha Monteiro dos; Figueira Liliane Karla; Boiça Júnior Arlindo Leal; Lara Fernando Mesquita; Cruz Ivan



Efeito do peso corporal na fecundidade e na longevidade do percevejo predador Podisus rostralis  

Directory of Open Access Journals (Sweden)

Full Text Available Considerando a importância dos percevejos predadores como agentes de controle biológico e a necessidade de se otimizar sua produção massal, realizou-se o presente trabalho para avaliar a influência do peso corporal sobre a sobrevivência e a reprodução de fêmeas de Podisus rostralis (Stål (Hemiptera: Pentatomidae. Os tratamentos foram constituídos por fêmeas desse predador com peso médio de: 39,5 mg, 45,5 mg, 51,5 mg, 57,5 mg e 63,5 mg. O período de preoviposição foi menor nas fêmeas mais pesadas, enquanto o número de ovos e de ninfas por dia apresentou relação linear positiva com o peso das fêmeas de P. rostralis. A longevidade das fêmeas desse predador foi semelhante entre tratamentos, porém não apresentou tendência de variação em razão do seu peso corporal. Como o objetivo de uma criação massal é produzir o maior número possível de ninfas por dia, recomenda-se o uso de fêmeas de P. rostralis com peso acima de 60,0 mg.

Zanuncio José Cola



Caracterización del comportamiento y las señales vibratorias en Euthyrhynchus floridanus (Hemiptera: Pentatomidae) durante el cortejo y la cópula / Characterization of the behavioral and vibrational signals in Euthyrhynchus floridanus (Hemiptera: Pentatomidae) during courtship and copulation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) es una especie neotropical perteneciente a la familia Pentatomidae con más de 4 000 especies descritas, y se distribuye desde la Florida hasta Brasil. Este estudio describe el comportamiento sexual y reporta por primera vez la producción [...] de vibraciones de sustrato por machos y hembras durante el comportamiento precopulatorio y la cópula. Se grabó tanto el comportamiento de cortejo y de cópula como las diversas señales producidas utilizando un cartucho fonográfico, conectado a una cámara de video. Posteriormente se reprodujo las vibraciones de las hembras en ausencia de estas y se registró las respuestas de los machos. Se distinguieron al menos tres vibraciones de sustrato distintas para los machos y una para las hembras, y se caracterizaron por ser señales de baja frecuencia que van desde los 127 hasta 180Hz. Las sonidos de los machos en E. floridianus fueron significativamente diferentes en la frecuencia, duración y número de pulsos tanto en el cortejo como en la cópula para los sonidos de ronroneo y tamborileo. La producción de sonidos en esta especie se asoció principalmente con comportamientos estimulatorios- mecánicos durante el cortejo y copula. Patrones de comportamiento y su relación con las vibraciones del sustrato sugiere que estas señales pueden ser importantes para los machos en el contexto de la localización de su compañera y la selección sexual. Abstract in english Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) is a neotropical species belonging to the family Pentatomidae with over 4 000 species described, and is distributed from Florida to Brazil. This study describes the sexual behavior and reported for the first time the production of substra [...] te vibrations by males and females during copulatory behavior and mating. Courtship and copulatory behavior, as well as the diverse signals, were recorded with a phonographic cartridge connected to a video camera. Female vibrations were reproduced in the absence of females and the responses by males were recorded. At least three types of substrate vibrations were distinguished in males and one in females, and these signals were characterized by their low frequency, varying from 127 to 180Hz. The sounds of E. floridianus males were significantly different in frequency, duration and number of pulses, both in courtship and in copulation, for the purring and drumming sounds. The production of sounds in this species is associated principally with mechanical, stimulatory behavior during courtship and copulation. Patterns of behavior and their relation to substrate vibrations suggest that these signals are important for the males in the context of mate location and sexual selection.

R. Daniel, Briceño.


Caracterización del comportamiento y las señales vibratorias en Euthyrhynchus floridanus (Hemiptera: Pentatomidae) durante el cortejo y la cópula / Characterization of the behavioral and vibrational signals in Euthyrhynchus floridanus (Hemiptera: Pentatomidae) during courtship and copulation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) es una especie neotropical perteneciente a la familia Pentatomidae con más de 4 000 especies descritas, y se distribuye desde la Florida hasta Brasil. Este estudio describe el comportamiento sexual y reporta por primera vez la producción [...] de vibraciones de sustrato por machos y hembras durante el comportamiento precopulatorio y la cópula. Se grabó tanto el comportamiento de cortejo y de cópula como las diversas señales producidas utilizando un cartucho fonográfico, conectado a una cámara de video. Posteriormente se reprodujo las vibraciones de las hembras en ausencia de estas y se registró las respuestas de los machos. Se distinguieron al menos tres vibraciones de sustrato distintas para los machos y una para las hembras, y se caracterizaron por ser señales de baja frecuencia que van desde los 127 hasta 180Hz. Las sonidos de los machos en E. floridianus fueron significativamente diferentes en la frecuencia, duración y número de pulsos tanto en el cortejo como en la cópula para los sonidos de ronroneo y tamborileo. La producción de sonidos en esta especie se asoció principalmente con comportamientos estimulatorios- mecánicos durante el cortejo y copula. Patrones de comportamiento y su relación con las vibraciones del sustrato sugiere que estas señales pueden ser importantes para los machos en el contexto de la localización de su compañera y la selección sexual. Abstract in english Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) is a neotropical species belonging to the family Pentatomidae with over 4 000 species described, and is distributed from Florida to Brazil. This study describes the sexual behavior and reported for the first time the production of substra [...] te vibrations by males and females during copulatory behavior and mating. Courtship and copulatory behavior, as well as the diverse signals, were recorded with a phonographic cartridge connected to a video camera. Female vibrations were reproduced in the absence of females and the responses by males were recorded. At least three types of substrate vibrations were distinguished in males and one in females, and these signals were characterized by their low frequency, varying from 127 to 180Hz. The sounds of E. floridianus males were significantly different in frequency, duration and number of pulses, both in courtship and in copulation, for the purring and drumming sounds. The production of sounds in this species is associated principally with mechanical, stimulatory behavior during courtship and copulation. Patterns of behavior and their relation to substrate vibrations suggest that these signals are important for the males in the context of mate location and sexual selection.

R. Daniel, Briceño.



Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA, em Lavras, MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC.





Directory of Open Access Journals (Sweden)

Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies




Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação  

Directory of Open Access Journals (Sweden)

Full Text Available Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol, na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum. A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p<0,05, quando comparado ao apresentado pelos fungos congelados com DMSO 10 % ou água. A produção de esporos foi maior (p< 0,05 no fungo M. appendiculatum preservado a 4masculineC em geladeira.

Campos Artur Kanadani



Organization of the olfactory pathway and odor processing in the antennal lobe of the ant Camponotus floridanus. (United States)

Ants rely heavily on olfaction for communication and orientation. Here we provide the first detailed structure-function analyses within an ant's central olfactory system asking whether in the carpenter ant, Camponotus floridanus, the olfactory pathway exhibits adaptations to processing many pheromonal and general odors. Using fluorescent tracing, confocal microscopy, and 3D-analyses we demonstrate that the antennal lobe (AL) contains up to approximately 460 olfactory glomeruli organized in seven distinct clusters innervated via seven antennal sensory tracts. The AL is divided into two hemispheres regarding innervation of glomeruli by either projection neurons (PNs) with axons leaving via the medial (m) or lateral (l) antennocerebral tract (ACT). M- and l-ACT PNs differ in their target areas in the mushroom-body calyx and lateral horn. Three additional ACTs project to the lateral protocerebrum only. We analyzed odor processing in AL glomeruli by retrograde loading of PNs with Fura-2 dextran and fluorimetric calcium imaging. Odor responses were reproducible and comparable across individuals. Calcium responses to pheromonal and nonpheromonal odors were very sensitive (10(-11) dilution) and patterns were partly overlapping, indicating that processing of both odor classes is not spatially segregated within the AL. Response patterns to the main trail-pheromone component nerolic acid remained stable over a wide range of intensities (7-8 log units), while response durations increased indicating that odor quality is maintained by a stable pattern and intensity is mainly encoded in response durations. The structure-function analyses contribute new insights into important aspects of odor processing in a highly advanced insect olfactory system. PMID:18041786

Zube, Christina; Kleineidam, Christoph Johannes; Kirschner, Sebastian; Neef, Jakob; Rössler, Wolfgang



Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensi...

Bruce Veronez; Mário Eidi Sato; Roberto Lomba Nicastro



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus car...

Gonçalves Paulo Antonio de Souza; Silva Carlos Roberto, Sousa E.



Densità di Lepre (Lepus europaeus e Silvilago (Sylvilagus floridanus in ambienti planiziali  

Directory of Open Access Journals (Sweden)

Full Text Available Il silvilago (Sylvilagus floridanus è un leporide d?origine nordamericana, introdotto in Italia a partire dal 1966 a scopo venatorio. Attualmente la specie è diffusa soprattutto in Piemonte e nella parte occidentale della Lombardia. Il silvilago potrebbe interferire con l?autoctona lepre comune (Lepus europaeus, anche se i dati al riguardo sono limitati. Nell?autunno-inverno 2002-2003 abbiamo condotto dei censimenti notturni con faro in alcune aree protette lungo il fiume Po (Breme, Fontanetto Po, Pobietto e il torrente Orba (Predosa, Monferrino. I censimenti erano effettuati percorrendo con automezzo itinerari prefissati. Il territorio ai lati del percorso era illuminato con faro alogeno (100 W, segnando periodicamente l?ampiezza della fascia illuminata. L?area effettivamente censita è stata in seguito verificata mediante GIS ArcView, usando una cartografia informatizzata d?uso del suolo (1:10.000. L?uso reale del suolo al momento del censimento (esempio: arato, grano o stoppie è stato verificato durante sopralluoghi diurni. Per ogni area sono state condotte tre repliche del censimento. Di seguito sono riportate per ogni località le densità rilevate (individui/Km² rispettivamente di lepre comune e silvilago. Breme (1,7; 32,8, Fontanetto Po (0; 4,4, Pobietto (0,3; 13,9, Predosa (1,1; 19,5, Monferrino (29,6; 110,4. Solo l?area di Monferrino è risultata ospitare una popolazione di lepri con densità corrispondente a territori ad alta vocazionalità. La zona censita si trova a cavallo tra una riserva regionale e una ZRC della Provincia di Alessandria. Nella stessa area il silvilago presenta una densità elevata, ma comunque inferiore ai valori massimi riportati negli Stati Uniti. Nelle altre aree sono state osservate pochissime lepri. Tale scarsità è probabilmente legata alla presenza di popolazioni relitte e habitat non sempre idonei. Il silvilago, per quanto non abbondante come a Monferrino, è presente con popolazioni discrete almeno a Breme e Pobietto. I risultati ottenuti, oltre a confermare il declino della lepre comune, indicano una fase di espansione territoriale e demografica del silvilago lungo le aste fluviali considerate.

Sandro Bertolino



Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

Marcos Rafael, Gusmão; Marcelo, Picanço; Germano L.D., Leite; Marcelo F., Moura.



Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

Marcos Rafael Gusmão



Efeitos da queima do canavial sobre insetos predadores / Effects of sugarcane burning on predator insects  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Para avaliar os efeitos da queima da cana-de-açúcar na pré-colheita sobre as populações de insetos predadores, uma área de 2º. corte de cana-de-açúcar foi submetida, por dois anos consecutivos (92/93 e 93/94), a dois sistemas de colheita, como segue: metade da área foi queimada, cana queimada (CQ), [...] enquanto a outra metade não foi queimada, cana crua (CC), antes da colheita mecanizada. Na área CQ, as sobras de palhiço após a colheita também foram queimadas. Depois da colheita 92/93, durante dois anos, foram coletados insetos através de armadilhas luminosa e de fossa e a predação em ovos de D.saccharalis foi avaliada em ambas as áreas. A entomofauna coletada foi identificada e submetida a análise faunística (freqüência, constância, diversidade e eqüitatividade). Na área CC foram coletados 14,25 e 61,84% mais insetos pelas armadilhas luminosa e de fossa, respectivamente, em relação à área CQ e a predação de ovos foi significativamente superior na área CC. As populações de insetos predadores são, portanto, maiores em número de espécies e indivíduos, e têm melhor distribuição durante o desenvolvimento da lavoura em área de CC do que em área de CQ. Abstract in english To evaluate the effects of pre-harvest sugarcane burning on predator insects, a second ratoon of sugarcane area were studied, for two consecutive seasons (92/93 and 93/94), as follows: a half of the sugarcane area was burned (CQ), while another half was not burned (CC), before mechanical harvesting. [...] In CQ all trash remainder in the field after harvesting was also burned. After the 92/93 harvesting, during two years, collects of insects by light and pitfall traps, as well, evaluation of sugarcane borer eggs predation were carried out on both areas. Faunistic analyses (frequence, constancy, diversity and equitativity) were applied on the collected and identified entomofauna, from both areas. In CC area 14.25% and 61.84% more insects were collected, by light and pitfall traps, respectively, than in CQ area. Egg predation was significantly higher in CC area than in CQ area. Populations of predator insects are, therefore, higher in number of species and individuals, and they have a better distribution during crop development in CC area than in CQ area.

Newton, Macedo; José R., Araújo.




Directory of Open Access Journals (Sweden)

Full Text Available Panonychus citri (McGregor es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencial de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR. El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día.

Alberto Daniel Guanilo



Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for popula

Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.



Local feeding specialization of the red fox (Vulpes vulpes in response to eastern cottontail (Sylvilagus floridanus introduction (NW Italy  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus on the food habits of the red fox (Vulpes vulpes, between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115 in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989. Comparison included also the diet of badgers (Meles meles, considered as potential competitors for food resources. Alien lagomorphs (mean percent volume, Vm% = 68% represented by far the most exploited resource, only three other food items reaching values of mean percent volume barely higher than 5%. Cottontails frequency of occurrence did not vary according either to season or to their reproductive cycle (II-IX vs. X-I, whilst diet niche breadth varied inversely proportional to the use of this key-resource. Overall fox trophic niche breadth varied from 0.64 in 1988-89 to 0.31 in 1998-00 (B, Levin’s index. These findings led us to consider the feeding habits of the fox in the study area as a result of local specialization of a typical generalist carnivore, according to the predictions of optimal foraging theory. No variation occurred in the badger niche breadth since cottontail introduction, whilst niche overlap between foxes and badgers decreased from 0.59 to 0.13 (O, Pianka’s index, possibly reducing competition for food in summer. Riassunto Specializzazione alimentare a livello locale della Volpe Vulpes vulpes in risposta all’introduzione del Silvilago Sylvilagus floridanus (Italia nord occidentale. Per valutare gli effetti dell’introduzione del Silvilago (Sylvilagus floridanus sul comportamento alimentare della volpe (Vulpes vulpes, nel periodo giugno 1998-febbraio 2000, la dieta del carnivoro è stata definita tramite l’analisi di 115 feci raccolte nella Riserva Naturale “Garzaia di Valenza” (Provincia di Alessandria, Italia nord occidentale di circa 250 ha. I risultati ottenuti sono stati confrontati con quelli conseguiti nella medesima area prima dell’introduzione del Silvilago, oltre che con quelli disponibili sulla dieta del Tasso (Meles meles, che può essere ritenuto un potenziale competitore per le risorse alimentari. I lagomorfi sono risultati la categoria alimentare maggiormente consumata (volume medio percentuale, Vm% = 68%, mentre solo tre altre categorie hanno raggiunto valori di Vm di poco superiori al 5%. Non sono emerse variazioni stagionali o relative al periodo riproduttivo (febbraio-settembre vs. ottobre-gennaio del Silvilago, anche se l’ampiezza di nicchia complessiva è risultata inversamente proporzionale al consumo di lagomorfi. L’ampiezza di nicchia della Volpe è scesa da 0,64 nel 1988-89 a 0,31 nel 1998-00. Nel complesso, la dieta della Volpe nell’area di studio può essere considerata l’espressione di una specializzazione a livello locale, così come previsto dalla teoria del foraggiamento ottimale. Non è emersa alcuna variazione per l’ampiezza di nicchia del Tasso, mentre il grado di sovrapposizione (indice di Pianka tra il mustelide e la Volpe è nettamente diminuito (da 0,59 a 0,13. In questi termini la specializzazione della Volpe potrebbe rendere minima la competizione alimentare con il Tasso, in particolar modo in estate, quando la siccità limita la disponibilità di lombrichi.

Alessandro Balestrieri



Ácaros predadores associados ao ácaro-da-erinose da lichia / Predator mites associated with the litchi erinose mite  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, [...] da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%), seguida por Phytoseius intermedius (31,2%), Euseius concordis (14,1%), Amblyseius herbicolus (8,8%) e Iphiseiodes zuluagai (3,3%). O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação. Abstract in english The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal var [...] iety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%), followed by Phytoseius intermedius (31.2%), Euseius concordis (14.1%), Amblyseius herbicolus (8.8%) and Iphiseiodes zuluagai (3.3%). Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira, Picoli; Marineide Rosa, Vieira; Eloisa Aparecida da, Silva; Max Sander de Oliveira da, Mota.



Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal variety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%, followed by Phytoseius intermedius (31.2%, Euseius concordis (14.1%, Amblyseius herbicolus (8.8% and Iphiseiodes zuluagai (3.3%. Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira Picoli



Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R...

Luís Cláudio Paterno Silveira; Vanda Helena Paes Bueno; Leonardo Santa Rosa Pierre; Simome Martins Mendes



Predadores asociados a panonychus citri mcgregor (acari: Tetranychidae) en la costa central del Perú / Predators associated to panonychus citri Mcgregor (acari: Tetranychidae) in the central coast of Peru  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthosei [...] us) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A.) evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados. Abstract in english In the central coast of Peru, fifteen predators associated to Panonychus citri were identified: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias-Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbi [...] tt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. and Armascirus sp. Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider and Aeolothrips sp. were the acarophagous insects found. Most abundant species were: A. chungas, T.(A.) evectus and N. californicus. Furthermore, both Stethorus tridens and Stethorus histrio were frequent in fields where predator mites were absent.

Alberto Daniel, Guanilo; Norberta, Martínez.


Predadores asociados a panonychus citri mcgregor (acari: Tetranychidae) en la costa central del Perú / Predators associated to panonychus citri Mcgregor (acari: Tetranychidae) in the central coast of Peru  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthosei [...] us) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A.) evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados. Abstract in english In the central coast of Peru, fifteen predators associated to Panonychus citri were identified: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias-Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbi [...] tt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. and Armascirus sp. Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider and Aeolothrips sp. were the acarophagous insects found. Most abundant species were: A. chungas, T.(A.) evectus and N. californicus. Furthermore, both Stethorus tridens and Stethorus histrio were frequent in fields where predator mites were absent.

Alberto Daniel, Guanilo; Norberta, Martínez.



Domácias do cafeeiro beneficiam o ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)? / Do coffee domatia benefit the predatory mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os cafeeiros apresentam domácias em suas folhas que abrigam ácaros, inclusive ácaros predadores que podem também fazer uso dessas estruturas. Neste estudo foi avaliado o efeito das domácias sobre o predador Iphiseiodes zuluagai Denmark & Muma, através da manipulação dessas estruturas em folhas de Co [...] ffea arabica L. var. Catuaí. Os testes foram realizados em arenas constituídas por folhas de cafeeiro com a face abaxial voltada para cima. Foi avaliada a sobrevivência de I. zuluagai em folhas com domácias fechadas (T1); domácias abertas contendo alimento (T2) e domácias abertas vazias (T3). Foram feitas observações a cada 24h, contabilizando-se o número de adultos vivos, local de oviposição e quantidade de ovos de I. zuluagai / tratamento. Foram observadas diferenças significativas entre os tratamentos. Nas folhas com domácias abertas (T2 e T3) foram encontrados ácaros vivos até o final do experimento, não ocorrendo o mesmo nas folhas com domácias fechadas (T1). No que se refere à oviposição de I. zuluagai, nos tratamentos em que as domácias se encontravam abertas (T2 e T3), o ácaro ovipositou preferencialmente dentro destas estruturas, enquanto nas folhas com domácias fechadas a oviposição foi feita preponderantemente à margem das folhas em contato com o algodão úmido. Os resultados indicam a importância das domácias como fonte de sobrevivência para os ácaros predadores nas plantas, sugerindo uma interação mutualística planta-predador. No café, o mutualismo planta-predador intermediado por domácias poderia ser explorado em estratégias de controle biológico natural, ao se selecionarem espécies de cafeeiro com domácias que favoreçam a presença dos ácaros predadores nas mesmas, protegendo-as contra o ataque de ácaros herbívoros nocivos. Abstract in english Coffee plants have domatia on their leaves harboring mites, and the predatory mites can also use such structures. Here we evaluated the effect of the domatia on the predatory mite Iphiseiodes zuluagai Denmark & Muma, manipulating these structures on the leaves of Coffea arabica L. var. Catuaí. The t [...] ests were done using arenas made of coffee leaves placed up side down inside petri dishes. The survivorship of I. zuluagai was evaluated when released on leaves with closed domatia (T1); leaves with open domatia plus prey (T2) and leaves with open domatia without prey (T3). The experiment was checked every 24h, measuring the number of alive adults, oviposition site and the number of I. zuluagai eggs/treatment. Significant difference was found between treatments. Mites were alive until the end of the experiments on leaves with open domatia (T2 and T3), which did not happen on leaves with closed domatia (T1). The predators oviposited preferentially inside the domatia on treatments with open domatia, and on the edge of the leaves, next to the moist cotton bordering the leaves, on the treatment with closed domatia. The results indicate the role of domatia on the survivorship of the predators on the coffee plants, suggesting a possible mutualist interactions plant-predator. On coffee crops, a mutualistic plant-predator interaction mediated by domatia could be used in practices of natural biological control, selecting coffee plants with domatia to harbor predatory mites and thereby protecting plants against harmful herbivore mites.

Cláudia H.C., Matos; Angelo, Pallini; Fredson F., Chaves; Carla, Galbiati.


Diversidade de predadores em coentro, endro e funcho sob manejo orgânico / Diversity of predators in coriander, dill and fennel under organic management  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Espécies vegetais da família Apiaceae podem proporcionar recursos vitais para insetos predadores de pragas agrícolas, promovendo sua eficiência como agentes de controle biológico devido à oferta de recursos como sítios de refúgio, proteção e alimentação. Assim, o objetivo deste trabalho foi avaliar [...] a atração de insetos predadores pelas apiáceas coentro (Coriandrum sativum L.), endro (Anethum graveolens L.) e funcho (Foeniculum vulgare Mill.). O experimento foi conduzido no campus da Universidade Federal de Lavras (UFLA), Lavras, MG, em blocos completos ao acaso, com três tratamentos e quatro repetições. Coletas semanais foram realizadas por meio de batida das plantas em bandejas, sendo os predadores aspirados e acondicionados em frascos com álcool 70%. Determinaram-se a curva do coletor, a riqueza de espécies, o índice de diversidade de Shannon-Wienner e o índice de similaridade (análise de Cluster). O funcho apresentou maior índice de Shannon-Wienner (H' = 1,104) e riqueza, enquanto o coentro mostrou maior abundância, sobretudo para a espécie Orius insidiosus (Hemiptera: Anthocoridae), um importante predador de tripes em hortaliças. Outras espécies predadoras de pragas de hortaliças foram encontradas, de maneira geral, em todas as apiáceas, destacando-se os adultos e larvas de coccinelídeos, importantes predadores de pulgões. A análise de Cluster indicou maior similaridade entre funcho e endro (55,03%). O período de floração promoveu considerável aumento na abundância de predadores, sobretudo no coentro. Abstract in english Species of plants of the Apiaceae family can provide vital resources for predators of agricultural pests, boosting their efficiency as biological control agents, because they allow their maintenance in the environment by offering features such as sites of refuge, protection and food. The present stu [...] dy was aimed to evaluate the attraction of predator insects by 3 Apiaceae species, namely coriander (Coriandrum sativum L.), dill (Anethum graveolens L.) and fennel (Foeniculum vulgare Mill.). The bioassay was conducted on the campus of UFLA (MG) in a randomized block design with 3 treatments and 4 replications. Weekly collections were carried out by beating the plants on white plastic trays, aspirating the predators and packing them into bottles with 70% alcohol. Determinations were made of the collector curve, the species richness, the Shannon-Wienner diversity index and the index of similarity (cluster analysis). The fennel had a higher richness and Shannon-Wienner index (H' = 1.104), while the coriander was more abundant, especially for the species Orius insidiosus (Hemiptera: Anthocoridae), a major predator of thrips in vegetables. Other predatory species of vegetable pests were found, generally, on all Apiaceae, especially adults and larvae of coccinellids, which are important predators of aphids. Cluster analysis indicated a greater similarity between fennel and dill (55.03%), and a lower value for the other pairs. The flowering period increased the abundance of predators, especially the coriander.

A.L.S., Resende; M.M. de, Haro; V.F. da, Silva; B., Souza; L.C.P., Silveira.


Diversidade de predadores em coentro, endro e funcho sob manejo orgânico / Diversity of predators in coriander, dill and fennel under organic management  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Espécies vegetais da família Apiaceae podem proporcionar recursos vitais para insetos predadores de pragas agrícolas, promovendo sua eficiência como agentes de controle biológico devido à oferta de recursos como sítios de refúgio, proteção e alimentação. Assim, o objetivo deste trabalho foi avaliar [...] a atração de insetos predadores pelas apiáceas coentro (Coriandrum sativum L.), endro (Anethum graveolens L.) e funcho (Foeniculum vulgare Mill.). O experimento foi conduzido no campus da Universidade Federal de Lavras (UFLA), Lavras, MG, em blocos completos ao acaso, com três tratamentos e quatro repetições. Coletas semanais foram realizadas por meio de batida das plantas em bandejas, sendo os predadores aspirados e acondicionados em frascos com álcool 70%. Determinaram-se a curva do coletor, a riqueza de espécies, o índice de diversidade de Shannon-Wienner e o índice de similaridade (análise de Cluster). O funcho apresentou maior índice de Shannon-Wienner (H' = 1,104) e riqueza, enquanto o coentro mostrou maior abundância, sobretudo para a espécie Orius insidiosus (Hemiptera: Anthocoridae), um importante predador de tripes em hortaliças. Outras espécies predadoras de pragas de hortaliças foram encontradas, de maneira geral, em todas as apiáceas, destacando-se os adultos e larvas de coccinelídeos, importantes predadores de pulgões. A análise de Cluster indicou maior similaridade entre funcho e endro (55,03%). O período de floração promoveu considerável aumento na abundância de predadores, sobretudo no coentro. Abstract in english Species of plants of the Apiaceae family can provide vital resources for predators of agricultural pests, boosting their efficiency as biological control agents, because they allow their maintenance in the environment by offering features such as sites of refuge, protection and food. The present stu [...] dy was aimed to evaluate the attraction of predator insects by 3 Apiaceae species, namely coriander (Coriandrum sativum L.), dill (Anethum graveolens L.) and fennel (Foeniculum vulgare Mill.). The bioassay was conducted on the campus of UFLA (MG) in a randomized block design with 3 treatments and 4 replications. Weekly collections were carried out by beating the plants on white plastic trays, aspirating the predators and packing them into bottles with 70% alcohol. Determinations were made of the collector curve, the species richness, the Shannon-Wienner diversity index and the index of similarity (cluster analysis). The fennel had a higher richness and Shannon-Wienner index (H' = 1.104), while the coriander was more abundant, especially for the species Orius insidiosus (Hemiptera: Anthocoridae), a major predator of thrips in vegetables. Other predatory species of vegetable pests were found, generally, on all Apiaceae, especially adults and larvae of coccinellids, which are important predators of aphids. Cluster analysis indicated a greater similarity between fennel and dill (55.03%), and a lower value for the other pairs. The flowering period increased the abundance of predators, especially the coriander.

A.L.S., Resende; M.M. de, Haro; V.F. da, Silva; B., Souza; L.C.P., Silveira.



Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.


Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyroximate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%; and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce Veronez



Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.



First record of native predators on the invasive species Thaumastocoris peregrinus (Hemiptera:Thaumastocoridae) in Eucalyptus in Argentina / Primer registro de predadores nativos de la especie invasora Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae) en Eucalyptus en la Argentina  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: English Abstract in spanish Se han observado, repetidamente, a dos predadores nativos consumiendo a Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae), chinche del eucaliptus. Para identificar a estos predadores y corroborar si estas especies pueden utilizar a T. peregrinus como alimento aceptable, se [...] obtuvieron muestras de huevos de ambas especies de predadores del arboretum de la Universidad Nacional de Luján. Las ninfas fueron criadas por separado en condiciones de laboratorio y alimentadas ad libitum con ninfas y adultos de T. peregrinus. Se registró el número de presas consumidas diariamente y el tiempo de desarrollo. Las especies de predadores fueron identificadas como Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) y Podisus australis Berg (Hemiptera: Pentatomidae). Este trabajo presenta el primer registro de predadores nativos utilizando a esta especie invasora como fuente de alimento sobre Eucalyptus camaldulensis en la provincia de Buenos Aires, Argentina. Abstract in english Two native predators have been repeatedly observed consuming the bronze bug, Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae). To identify these predators and to corroborate whether these species can use T. peregrinus as a suitable food item, egg samples of both predator [...] species were collected from the arboretum at the Universidad Nacional de Luján. Nymphs were reared individually under laboratory conditions and fed ad libitum with nymphs and adults of T. peregrinus. The number of prey consumed daily and the development time were recorded. The predator species were identified as Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) and Podisus australis Berg (Hemiptera: Pentatomidae). This research presents the first report of native predators using this invasive species as a food resource in Eucalyptus camaldulensis forest in Buenos Aires province, Argentina.

Marina V., Santadino; María B., Riquelme Virgala; Carlos E., Coviella.


Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor / Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), [...] uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural. Abstract in english Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae) have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae), in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae), one of the m [...] ost damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

Harley Nonato de, Oliveira; Dirceu, Pratissoli; Eder Pin, Pedruzzi; Marcelo Curitiba, Espindula.


Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Directory of Open Access Journals (Sweden)

Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

Harley Nonato de Oliveira



Coenosia attenuata (Dptera: Muscidae), um predador em estudo para utilização em culturas protegidas / Coenosia attenuata (Dptera: Muscidae), a predator being studied for use in greenhouses greenhouses  

Scientific Electronic Library Online (English)

Full Text Available SciELO Portugal | Language: Portuguese Abstract in portuguese Coenosia attenuata Stein, ou “mosca tigre”, predador polífago de importantes pragas agrícolas, enquanto larva e adulto, foi detectado em Portugal, pela primeira vez, em 2002, no Oeste. Para optimização da sua criação em massa, alteraram-se metodologias descritas na bibliografia. Ocorreu maior número [...] de emergências em substratos com maior número de larvas de esciarídeos e em substrato de terra misturado com fibra de coco. Estudou-se, em laboratório, o seu comportamento e capacidade de predação sobre várias espécies, incluindo parasitóides e predadores importantes em culturas protegidas, tendo predado todas as espécies testadas: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta e algumas espécies de Psycodidae. Observaram-se indícios de preferência alimentar das fêmeas de mosca tigre por moscas brancas e larvas mineiras, em relação a diglifos, e diferenças no comportamento de predação sobre moscas brancas em presença de larvas mineiras ou drosófilas. Abstract in english Coenosia attenuata Stein, or “tiger-fly”, a polyphagous predator of important agricultural pests, as larva and adult, was detected for the first time, in Portugal, in 2002, in the “Oeste” region. For mass rearing optimization, the methodologies described in literature were changed. A higher number o [...] f emergences occurred on substrates with higher number of sciarids larvae and on the substrate with soil mixed with coconut fiber. The predation capacity and behaviour of C. attenuata was studied in laboratory in relation to several species, including parasitoids and predators with an important role in protected crops. All species tested were predated: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta and some Psycodidae species. There was evidence of female preference for whiteflies and leafminers in relation to Diglyphus isaea, as well as predation behaviour differences over whiteflies when leafminers or drosophilids were present.

Joana, Martins; Cíntia, Domingos; Raquel, Nunes; André, Garcia; Cristina, Ramos; Célia, Mateus; Elisabete, Figueiredo.



Ácaros predadores (Acari) em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil / Predators mites (Acari) in native and cultivated plants of the State of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the famili [...] es Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species), was met in Morus spp. (Moraceae) and Tabebuia spp. (Bignoniaceae); Phaseolus vulgaris (Papilionaceae); only one species of the mite was met in Campomanesia spp. (Myrtaceae), Phaseolus vulgaris (Papilionaceae) and Rosa spp. (Rosaceae). In Alamanda spp.(Apocinaceae), Ficus spp. (Moraceae), Jacaranda mimosifolia (Bignoniaceae) and Solanum spp. (Solanaceae) were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Ácaros predadores (Acari em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil Predators mites (Acari in native and cultivated plants of the State of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species, was met in Morus spp. (Moraceae and Tabebuia spp. (Bignoniaceae; Phaseolus vulgaris (Papilionaceae; only one species of the mite was met in Campomanesia spp. (Myrtaceae, Phaseolus vulgaris (Papilionaceae and Rosa spp. (Rosaceae. In Alamanda spp.(Apocinaceae, Ficus spp. (Moraceae, Jacaranda mimosifolia (Bignoniaceae and Solanum spp. (Solanaceae were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

Noeli Juarez Ferla



Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina...

Mariana Oliveira Breda; José Vargas Oliveira; Edmilson Jacinto Marques; Rachel Gonçalves Ferreira; Mauricéa Fidelis de Santana



Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae) e ácaros predadores da família Phytoseiidae Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae) and mites predators from the family Phytoseiidae  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks), foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L.) DC. também em dilui...

Hilda Maria Brito; Manoel Guedes Corrêa Gondim Junior; José Vargas Oliveira; Cláudio Augusto Gomes da Câmara



Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera: Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larv...

Terezinha Monteiro dos Santos; Liliane Karla Figueira; Arlindo Leal Boiça Júnior; Fernando Mesquita Lara; Ivan Cruz



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus car...

Paulo Antonio de Souza Gonçalves; Silva, Carlos Roberto Sousa E.



Insetos predadores em copas de Citrus deliciosa (Rutaceae) sob manejo orgânico no sul do Brasil / Predatory insects in canopies of Citrus deliciosa (Rutaceae) under organic management in southern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 [...] espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae) (16,87%) e Coccidophilus sp. (Coleoptera, Coccinellidae) (11,85%). A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações. Abstract in english The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species fr [...] om ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae) (16.87%) and Coccidophilus sp. (Coleoptera, Coccinellidae) (11.85%). The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

Rosana M. de, Morais; Aline, Barcellos; Luiza R., Redaelli.



Insetos predadores em copas de Citrus deliciosa (Rutaceae sob manejo orgânico no sul do Brasil Predatory insects in canopies of Citrus deliciosa (Rutaceae under organic management in southern Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae (16,87% e Coccidophilus sp. (Coleoptera, Coccinellidae (11,85%. A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações.The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species from ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae (16.87% and Coccidophilus sp. (Coleoptera, Coccinellidae (11.85%. The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

Rosana M. de Morais


Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa / Diversity of aphids and their parasitoids and predators in alfalfa crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA), em Lavras, [...] MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC. Abstract in english This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioa [...] phis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.



Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa / Diversity of aphids and their parasitoids and predators in alfalfa crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA), em Lavras, [...] MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC. Abstract in english This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioa [...] phis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.




Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? / Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das r [...] egiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R), calculado com dados de presença/ausência das espécies (Orius e tripes) no mesmo "habitat". Orius insidiosus (Say) foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin) e negativamente associado a Frankliniella schultzei (Trybom) e Caliothrips phaseoli (Hood). Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter) esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton). Abstract in english The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrip [...] s species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R) (presence/absence of the species in the same habitat). Orius insidiosus (Say) was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin), and negatively associated with Frankliniella schultzei (Trybom) and Caliothrips phaseoli (Hood). Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter) was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton).

Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Júlio Neil Cassa, Louzada; Lívia Mendes, Carvalho.


Diversidade e abundância de artrópodes predadores associados a diferentes cultivares de algodoeiro / Diversity and abundance of predaceous arthropods associated with different cotton cultivars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de estudar a abundância e a diversidade de artrópodes predadores associados à cultura do algodoeiro e analisar a influência de fatores meteorológicos, interações entre inimigos naturais e a dinâmica populacional de coccinelídeos associados à sua principal presa, o pulgão Aphis gossypi [...] i, um experimento foi realizado na região de Ipameri (GO), no Campus da Universidade Estadual de Goiás. O delineamento experimental utilizado foi o de blocos ao acaso, com cinco tratamentos, constituídos pelas cultivares DeltaOPAL, FMX 966, FMX 993, FMX 910 e NuOPAL, em quatro repetições. Dentre os artrópodes observados na cultura do algodoeiro, os coccinelídeos e as aranhas foram os mais abundantes, nas cultivares avaliadas. As aranhas ocorreram em todo o ciclo do algodoeiro. Já os coccinelídeos aumentaram sua população, gradativamente, até 55 DAE, apresentando pico populacional aos 34 DAE, coincidindo com o pico populacional dos pulgões A. gossypii. Dentre os coccinelídeos observados nas cultivares em estudo, verificou-se que Scymnus spp. foi o gênero mais abundante no algodoeiro. Os pentatomídeos e forficulídeos predominaram dos 99 aos 128 dias após a emergência do algodão, período que corresponde à maior densidade de pragas-alvo destes insetos. Verificou-se que não houve influência dos fatores meteorológicos e nem interação negativa entre os artrópodes predadores. Abstract in english With the objective of studying the abundance and diversity of predaceous arthropods associated with cotton crop, and analyze the influence of meteorological factors, interactions between natural enemies and population dynamics of coccinellids associated with their principal prey, the aphid Aphis gos [...] sypii, an experiment was carried out in the region of Ipameri, Goiás State, Brazil, at the Universidade Estadual de Goiás campus. The experimental design was randomized blocks, with five treatments, consisting of the DeltaOPAL, FMX 966, FMX 993, FMX 910, and NuOPAL cultivars, in four replications. Among the arthropods sampled in the cotton crop, the coccinellids and spiders were the most abundant ones in the cultivars evaluated. Spiders occurred throughout the cotton cycle, while the coccinellids population increased gradually until 55 DAE, showing a population peak at 34 DAE, coinciding with the population peak of aphids (Aphis gossypii). Among the coccinellids observed in the cultivars under study, Scymnus spp. was the most abundant in cotton. The pentatomid and forficulid occurred from 99 to 128 days after the emergence of cotton, which corresponds to the highest density of target pest insects. It was not found influence of meteorological factors or negative interactions among predaceous arthropods.

Lílian Lúcia, Costa; Ivan Carlos Fernandes, Martins; Antonio Carlos, Busoli; Francisco Jorge, Cividanes.


Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) / Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar [...] os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), sorgo (Sorghum spp.), feijão (Phaseolus vulgaris L.), girassol (Helianthus annuus L.), alfafa (Medicago sativa L.), soja [Glycine max (L.) Merr.], crisântemo (Chrysanthemum spp.), tango (Solidago canadensis L.) e cartamus (Carthamus tinctorius L.) e nas plantas invasoras picão-preto (Bidens pilosa L.), caruru (Amaranthus sp.), losna-branca (Parthenium hysterophorus L.) e apaga-fogo (Alternanthera ficoidea L.). Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter) e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen. Abstract in english The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identification [...] s of the specimens was done in the laboratory. Orius insidiosus (Say) was collected on the following crops: corn (Zea mays L.), pearl millet (Pennisetum glaucum (L.) R.Br.), sorghum (Sorghum spp.), bean (Phaseolus vulgaris L.), sunflower (Helianthus annuus L.), alfalfa (Medicago sativa L.), soybean (Glycine max (L.) Merr.), chrysanthemum (Chrysanthemum spp.), tango (Solidago canadensis L.) and carthamus (Carthamus tinctorius L.). On weeds, O. insidiosus was found on farmer's friend (Bidens pilosa L.), amaranth (Amaranthus sp.), parthenium weed (Parthenium hysterophorus L.) and Joseph's coat (Alternanthera ficoidea L.). Orius thyestes Herring was found on weed plants farmer's friend, amaranth and Joseph's coat. Orius perpunctatus (Reuter) and Orius sp. were collected mainly on weed plants (farmer's friend, amaranth and Joseph's coat) and corn. Many of these plants are natural hosts for these predators, providing refuge, prey and pollen.

Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Leonardo Santa Rosa, Pierre; Simome Martins, Mendes.


Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? / Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das r [...] egiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R), calculado com dados de presença/ausência das espécies (Orius e tripes) no mesmo "habitat". Orius insidiosus (Say) foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin) e negativamente associado a Frankliniella schultzei (Trybom) e Caliothrips phaseoli (Hood). Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter) esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton). Abstract in english The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrip [...] s species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R) (presence/absence of the species in the same habitat). Orius insidiosus (Say) was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin), and negatively associated with Frankliniella schultzei (Trybom) and Caliothrips phaseoli (Hood). Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter) was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton).

Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Júlio Neil Cassa, Louzada; Lívia Mendes, Carvalho.



Diversidade e abundância de artrópodes predadores associados a diferentes cultivares de algodoeiro / Diversity and abundance of predaceous arthropods associated with different cotton cultivars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de estudar a abundância e a diversidade de artrópodes predadores associados à cultura do algodoeiro e analisar a influência de fatores meteorológicos, interações entre inimigos naturais e a dinâmica populacional de coccinelídeos associados à sua principal presa, o pulgão Aphis gossypi [...] i, um experimento foi realizado na região de Ipameri (GO), no Campus da Universidade Estadual de Goiás. O delineamento experimental utilizado foi o de blocos ao acaso, com cinco tratamentos, constituídos pelas cultivares DeltaOPAL, FMX 966, FMX 993, FMX 910 e NuOPAL, em quatro repetições. Dentre os artrópodes observados na cultura do algodoeiro, os coccinelídeos e as aranhas foram os mais abundantes, nas cultivares avaliadas. As aranhas ocorreram em todo o ciclo do algodoeiro. Já os coccinelídeos aumentaram sua população, gradativamente, até 55 DAE, apresentando pico populacional aos 34 DAE, coincidindo com o pico populacional dos pulgões A. gossypii. Dentre os coccinelídeos observados nas cultivares em estudo, verificou-se que Scymnus spp. foi o gênero mais abundante no algodoeiro. Os pentatomídeos e forficulídeos predominaram dos 99 aos 128 dias após a emergência do algodão, período que corresponde à maior densidade de pragas-alvo destes insetos. Verificou-se que não houve influência dos fatores meteorológicos e nem interação negativa entre os artrópodes predadores. Abstract in english With the objective of studying the abundance and diversity of predaceous arthropods associated with cotton crop, and analyze the influence of meteorological factors, interactions between natural enemies and population dynamics of coccinellids associated with their principal prey, the aphid Aphis gos [...] sypii, an experiment was carried out in the region of Ipameri, Goiás State, Brazil, at the Universidade Estadual de Goiás campus. The experimental design was randomized blocks, with five treatments, consisting of the DeltaOPAL, FMX 966, FMX 993, FMX 910, and NuOPAL cultivars, in four replications. Among the arthropods sampled in the cotton crop, the coccinellids and spiders were the most abundant ones in the cultivars evaluated. Spiders occurred throughout the cotton cycle, while the coccinellids population increased gradually until 55 DAE, showing a population peak at 34 DAE, coinciding with the population peak of aphids (Aphis gossypii). Among the coccinellids observed in the cultivars under study, Scymnus spp. was the most abundant in cotton. The pentatomid and forficulid occurred from 99 to 128 days after the emergence of cotton, which corresponds to the highest density of target pest insects. It was not found influence of meteorological factors or negative interactions among predaceous arthropods.

Lílian Lúcia, Costa; Ivan Carlos Fernandes, Martins; Antonio Carlos, Busoli; Francisco Jorge, Cividanes.



Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

Liliane K., Figueira; Fernando M., Lara.


Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.



Seletividade de inseticidas às diferentes fases de desenvolvimento do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Selectivity of insecticides to different developmental stages of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O predador Doru luteipes (Scudder) é um dos principais reguladores da população de Spodoptera frugiperda (J.E. Smith) e Helicoverpa zea (Boddie) na cultura de milho (Zea mays). O objetivo do trabalho foi estudar a seletividade de cinco inseticidas químicos (deltametrina, lambdacialotrina, permetrina [...] , diflubenzuron e triflumuron) e dois microbianos [Baculovirus e Bacillus thuringiensis (Berliner)] sobre as diferentes fases de desenvolvimento do predador. Ovos e ninfas dos quatro ínstares receberam os inseticidas diretamente através de um pulverizador acoplado a uma esteira rolante. Adultos do predador receberam como alimento posturas de S. frugiperda, que foram pulverizadas com os diferentes inseticidas. Para os ovos, houve um efeito letal pronunciado com os inibidores de crescimento diflubenzuron (81,8% de mortalidade) e triflumuron (78,6%), sendo este também tóxico para os ínstares ninfais (69,6%). Os inseticidas biológicos Baculovirus e B. thuringiensis foram seletivos a todas as fases do predador. A sobrevivência do predador aos inseticidas foi crescente com o instar do inseto (S = 39,5 + 7,79 I, R2² = 0,87). Os adultos foram tolerantes a todos os inseticidas (95,3% de sobrevivência). Abstract in english The earwig Doru luteipes (Scudder) is one the best natural enemies of Spodoptera frugiperda (J. E. Smith) and Helicoverpa zea (Boddie) both pests of maize (Zea mays). The objective of this work was to evaluate the selectivity of five chemical (deltamethrin, lambdacyhalothrin, permethrin, diflubenzur [...] on and triflumuron) and two microbial [Baculovirus and Bacillus thuringiensis (Berliner)] insecticides to the different developmental stages of the predator. Eggs and the four nymphal stages were sprayed using a sprayer connected to a rolling mat. Adults were fed egg masses of S.frugiperda sprayed with insecticides. Eggs of the predator were highly affected by the growth inhibitors diflubenzuron (81.8% mortality) and triflumuron (78.6%), the latter also toxic to the nymphal stages (69.6%). The bioinsecticides Baculovirus and B. thuringiensis were selective to all stages of the predator. The survivorship increased with the increase of the insect's age (S = 39,5 + 7,79 I, R2² = 0,87). Adults were tolerant to all treatments (95.3% survivorship).

Juliana C., Simões; Ivan, Cruz; Luis O., Salgado.


Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

Liliane K., Figueira; Fernando M., Lara.



Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.




Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores / Harmonia axyridis in fruit trees and impact on other predator coccinellids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006), relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinelli [...] dae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais. Abstract in english The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006), to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coc [...] cinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

Julianne, Milléo; Jana Magaly Tesserolli de, Souza; Ivana de Freitas, Barbola; Patrícia Elizabeth, Husch.



Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores / Harmonia axyridis in fruit trees and impact on other predator coccinellids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006), relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinelli [...] dae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais. Abstract in english The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006), to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coc [...] cinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

Julianne, Milléo; Jana Magaly Tesserolli de, Souza; Ivana de Freitas, Barbola; Patrícia Elizabeth, Husch.


Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores Harmonia axyridis in fruit trees and impact on other predator coccinellids  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006, relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinellidae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais.The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006, to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coccinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

Julianne Milléo



Seletividade de inseticidas a Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predador de lagartas desfolhadoras de eucalipto / Selectivity of insecticides to Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predator of eucalyptus-defoliating caterpillars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares) e adultos (fêmeas e machos) do predador Podisus rostralis, empregando-se 50 (subconcentração) e 100% da concentração usada no contro [...] le de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente) do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade) e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente) do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade) e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente) do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade). A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos) e permetrina (a fêmeas) sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina. Abstract in english The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars) and adults (females and males) of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 10 [...] 0% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively). Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality), and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality). Malathion was medially selective to fifth instar nymphs (49.38% of mortality), but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality). Fenitrothion was not selective to any instar of P. rostralis (100% of mortality). The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults) and permethrin (to females) of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

Alfredo Henrique Rocha, Gonring; Marcelo Coutinho, Picanço; Germano Leão Demolin, Leite; Fábio Akiyoshi, Suinaga; José Cola, Zanuncio.


Seletividade de inseticidas a Podisus rostralis (Stal (Heteroptera: Pentatomidae predador de lagartas desfolhadoras de eucalipto Selectivity of insecticides to Podisus rostralis (Stal (Heteroptera: Pentatomidae predator of eucalyptus-defoliating caterpillars  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares e adultos (fêmeas e machos do predador Podisus rostralis, empregando-se 50 (subconcentração e 100% da concentração usada no controle de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade. A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos e permetrina (a fêmeas sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina.The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars and adults (females and males of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 100% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively. Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality, and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality. Malathion was medially selective to fifth instar nymphs (49.38% of mortality, but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality. Fenitrothion was not selective to any instar of P. rostralis (100% of mortality. The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults and permethrin (to females of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

Alfredo Henrique Rocha Gonring



Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.


Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Directory of Open Access Journals (Sweden)

Full Text Available Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae, a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamentos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF, e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar (Coleoptera: Chrysomelidae foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius (Hymenoptera: Apidae foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera bem como o fitófago Cicadellidae (Hemiptera preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos.The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae, the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized blocks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar (Coleoptera: Chrysomelidae was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius (Hymenoptera: Apidae was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera and the phytophagous Cicadellidae (Hemiptera preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin Leite



Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.



Reproductive characteristics of the predator Podisus nigrispinus fed with an insect resistant soybean variety / Características reprodutivas do predador Podisus nigrispinus alimentado com variedade de soja resistente a insetos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo desta pesquisa foi avaliar o efeito do genótipo IAC 17, resistente a insetos, nas características reprodutivas de fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), utilizando o genótipo susceptível UFV 16 como controle. Os tratamentos foram: T1) fêmeas de P. nigrispinus [...] alimentadas com plantas de UFV 16 e lagartas de Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae), criadas em folhas desta cultivar; T2) fêmeas de P. nigrispinus alimentadas com plantas de IAC 17, e lagartas de A. gemmatalis, criadas em folhas desta cultivar. Avaliou-se a longevidade das fêmeas, períodos de pré-oviposição, oviposição e pós-oviposição, número de ovos e de posturas/fêmea, peso dos ovos, intervalo entre posturas, número de ovos/postura, porcentagem de ovos eclodidos, número de ninfas/fêmea e número total de presas mortas/fêmea de P. nigrispinus. A maioria das características avaliadas mostrou resultados semelhantes entre tratamentos, exceto o período de oviposição, que foi mais longo para fêmeas criadas no genótipo resistente que no susceptível, e a porcentagem de fêmeas que ovipositaram antes de morrer, que foi menor na IAC 17. Além disso, o genótipo IAC 17 causou maior mortalidade de fêmeas de P. nigrispinus no início de sua fase adulta e distribuição mais uniforme da produção de ovos ao longo do período adulto desse predador. Por outro lado, os resultados não sugerem efeito desse genótipo na prole do predador. Abstract in english The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1) females of P. [...] nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae) caterpillars reared on leaves of this variety; T2) females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.

Fausto da Costa, Matos Neto; José Cola, Zanuncio; Marcelo Coutinho, Picanço; Ivan, Cruz.


Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) / Biology of the predaceous mite Euseius alatus DeLeon (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius alatus DeLeon é um ácaro predador encontrado em plantas cítricas (Citrus spp.) no Brasil, que apresenta um ciclo de vida semelhante aos demais ácaros do mesmo gênero. O tempo de incubação e a duração das fases de larva, protoninfa e deutoninfa foi de aproximadamente 24 h cada, quando aliment [...] ado com pólen de mamoneira (Ricinus communis), a 25 ± 2 °C, 70 ± 10% UR e 14 h de fotofase. O período médio de oviposição foi de 26,5 dias, e a oviposição média foi de 1,4 ovos/dia. A capacidade inata de crescimento da população (r m) foi estimada em 0,217, crescendo a população 1,2 vezes ao dia e dobrando a cada 3,2 dias. A população de E. alatus pode aumentar 21,4 vezes (Ro) no tempo médio de uma geração (T = 14,1 dias). Abstract in english Euseius alatus DeLeon is a predaceous mite found on citrus plants (Citrus spp.) in Brazil, with a life cycle similar to the species of the same genus. Incubation period, larval, protonymphal and deutonymphal stages lasted ca. 24 h each, when mites were fed castor bean (Ricinus communis ) pollen and [...] kept at 25 ± 2 °C, 70 ± 10% RH and 14 h photophase. Oviposition period lasted 26.5 days, and the oviposition rate was 1.4 eggs/day. The intrinsic rate of increase (r m) was 0.217; population increased 1.2 times a day and double its population every 3.2 days. The population of E. alatus increase 21.4 times (Ro) in the period of one generation (T = 14.1 days).

Paulo R., Reis; Everaldo B., Alves.



Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae) / Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl). Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molit [...] or com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps. Abstract in english The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl). The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius c [...] incticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

Francisco Roberto de, Azevedo; Francisco de Sousa, Ramalho.


Dark clouds and their silver linings: exotic generalist predators in augmentative biological control / Das nuvens escuras um raio de luz: controle biológico por aumento da população de predadores generalistas exóticos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Vários artrópodos predadores polífagos estão disponíveis para uso em controle biológico pelo aumento da população, com o objetivo de controlar ácaros e insetos-praga em ampla variedade de culturas. Muitos desses predadores não são nativos da área onde serão introduzidos. Neste artigo discutem-se os [...] beneficios e os riscos do uso de predadores generalistas exóticos como agentes de biocontrole. O fato de os predadores polífagos serem criados facilmente em alimento não-natural e poderem ser usados contra diferentes espécies de pragas, faz com que eles se tornem atrativos para comercialização. Predadores polífagos ou fitófagos facultativos apresentam menor dificuldade em se manterem na presença de baixas populações das presas e podem ser introduzidos nas culturas antes que a praga-alvo esteja presente, evitando o crescimento de populações de pragas que possam causar danos econômicos. Por outro lado, espécies generalistas podem interferir com outras espécies benéficas na cultura e espécies facultativas podem, excepcionalmente, causar danos às culturas. O uso de inimigos naturais não-nativos pode envolver riscos ambientais. Procedimentos para a avaliação de riscos, enfocando principalmente a amplitude de hospedeiros, têm sido implementados em um número crescente de países. A avaliação da especificidade hospedeira, entretanto, deve ser conduzida em condições reais. Em adição, a adequabilidade do clima, a habilidade de dispersão de um predador importado e a presença de seus inimigos naturais na área de introdução são fatores importantes quando se avaliam os riscos ambientais. As normas reguladoras são essenciais mas não devem dificultar a implementação do controle biológico como alternativa ao controle químico de pragas. Abstract in english Several polyphagous arthropod predators are commercially available for augmentative biological control targeting mite and insect pests in a variety of cropping systems. A number of these predators are not native to the area of release. The current paper discusses benefits and risks of using exotic g [...] eneralist predators as biocontrol agents. The fact that polyphagous predators are easily reared on unnatural foods and can be used against different pest species makes them attractive for commercialization. Polyphagous or facultatively phytophagous predators have less difficulty in maintaining their populations at low prey densities and can sometimes be introduced in the crop before the target pest is present, thus preventing the buildup of pest populations before economic damage is done. On the other hand, generalists may interfere with the action of other beneficials in the crop, and facultative plant feeding by predatory arthropods exceptionally causes crop damage. The use of non-native natural enemies may entail environmental risks. In a growing number of countries, risk assessment procedures are being implemented that are largely focused on host range testing. It is emphasized, however, that the experimental evaluation of host specificity should be done under realistic conditions. Furthermore, climatic matching and dispersal ability of an imported predator and the presence of its natural enemies in the area of introduction are important factors to be considered when assessing environmental risks. Regulation is essential but should not hamper the implementation of biological control as an alternative to chemical pest control.



Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae e ácaros predadores da família Phytoseiidae Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae and mites predators from the family Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks, foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L. DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores.The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L. DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

Hilda Maria Brito



Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do...

Madelaine Venzon; Maria da Consolação Rosado; Angelo Pallini; Amanda Fialho; Célia de Jesus Pereira



Atração do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) por estímulos olfativos de dietas alternativas em laboratório / Attraction of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) by olfactory stimulus of alternative diets in the laboratory  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Doru luteipes consome lagartas de Spodoptera frugiperda, que é atualmente a principal praga da cultura do milho no Brasil. Normalmente, se 70% das plantas tivessem o predador, a praga seria mantida abaixo do nível de dano econômico. Entretanto, o predador ocorre após a praga danificar as plantas. As [...] sim, a disponibilidade de materiais que atraíssem e antecipassem a presença do predador na lavoura poderia reduzir populações da praga. Desta forma, estudou-se em laboratório a atratividade de dietas artificiais para machos e fêmeas do predador D. luteipes. Os tratamentos foram: pupa desidratada e moída do bicho-da-seda; pólen misto, nas quantidades de 0,05; 0,1; 0,2; 0,5 e 1,0g para ambas as dietas. Em olfatômetro, os estímulos da dieta foram comparados à testemunha. Foram realizadas 30 repetições. Os resultados mostraram que houve atratividade tanto para machos quanto para fêmeas. Em geral, a atração foi aumentada com o aumento da quantidade das dietas. Estudos adicionais foram propostos para testar a viabilidade do uso dos materiais como estratégia de manejo da praga no campo. Abstract in english Doru luteipes consumes larvae of Spodoptera frugiperda, which is at this moment the main pest of maize crop in Brazil. In general, if 70% of the plants had this predator the pest would be kept under the threshold of economic damage. However, the predator occurs after the pest damages the plants. Thu [...] s, the availability of materials that would attract and anticipate the presence of predator in the field,could reduce pest populations. In such a way, it was studied in the laboratory the attractiveness of artificial diets for males and females of the D. luteipes. The treatments were: ground dehydrated pupa of the silk worm and pollen mixture in the amounts of 0.05, 0.1, 0.2, 0.5 e 1.0g, for both the diets The diet stimulus were compared to control using a olfactometer. In general, attraction increased with rising amounts of the diets. Further investigations were proposed to test the viability of the usage of the materials to manage the pest in the field.

Mariana Campana, Nonino; Amarildo, Pasini; Maurício Ursi, Ventura.


Alguns dados bioecológicos de Pomacea haustrum (Reeve, 1856), predador-competidor de hospedeiros intermediários de Schistosoma mansoni Sambon, 1907 / Some bioecological data regarding Pomacea haustrum (Reeve, 1856) predator-competitor of intermediate hosts of Schistosoma mansoni Sambon, 1907  

Scientific Electronic Library Online (English)

Full Text Available SciELO Public Health | Language: Portuguese Abstract in portuguese Foram feitas observações no laboratório e no campo, em Belo Horizonte, MG, Brasil, com a finalidade de se obter informações biológicas e ecológicas sobre Pomacea haustrum (Reeve, 1856), molusco pilídeo, competidor-predador de hospedeiros intermediários de Schistosoma mansoni Sambon 1907. [...] Abstract in english Observations carried out in the laboratory and the field (Belo Horizonte, MG, Brazil) offered the following biological and ecological informations Pomacea haustrum (Reeve, 1853), mollusk pilid, predator and competitor of Schistosoma mansoni intermediary host. [...

Roberto, Milward-de-Andrade; Omar dos Santos, Carvalho; Carlos Tito, Guimarães.


Alguns dados bioecológicos de Pomacea haustrum (Reeve, 1856), predador-competidor de hospedeiros intermediários de Schistosoma mansoni Sambon, 1907 / Some bioecological data regarding Pomacea haustrum (Reeve, 1856) predator-competitor of intermediate hosts of Schistosoma mansoni Sambon, 1907  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Foram feitas observações no laboratório e no campo, em Belo Horizonte, MG, Brasil, com a finalidade de se obter informações biológicas e ecológicas sobre Pomacea haustrum (Reeve, 1856), molusco pilídeo, competidor-predador de hospedeiros intermediários de Schistosoma mansoni Sambon 1907. [...] Abstract in english Observations carried out in the laboratory and the field (Belo Horizonte, MG, Brazil) offered the following biological and ecological informations Pomacea haustrum (Reeve, 1853), mollusk pilid, predator and competitor of Schistosoma mansoni intermediary host. [...

Roberto, Milward-de-Andrade; Omar dos Santos, Carvalho; Carlos Tito, Guimarães.


Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae) e ácaros predadores da família Phytoseiidae / Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae) and mites predators from the family Phytoseiidae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks), foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na [...] imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L.) DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores. Abstract in english The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on [...] dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L.) DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

Hilda Maria, Brito; Manoel Guedes Corrêa, Gondim Junior; José Vargas de, Oliveira; Cláudio Augusto Gomes da, Câmara.



Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil / Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a ocorrência do ácaro vermelho do tomateiro (Tetranychus evansi Baker & Pritchard) e de ácaros predadores em quatro das espécies mais abundantes de solanáceas nativas do litoral de Pernambuco. Foram feitas coletas mensais de amostras de plantas de meados de setembro de 2002 a fins de maio [...] de 2003, nos municípios de Aliança, Carpina, Camaragibe, Goiana, Igarassu e Recife. Foram encontrados 5.485 ácaros pertencentes a mais de 27 espécies, das quais as mais numerosas foram as espécies fitófagas T. evansi e Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), e as espécies predadoras Asca sp. (Ascidae), Phytoseius guianensis De Leon e Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (ambos Phytoseiidae). Índices de associação negativos foram determinados entre T. evansi e quatro espécies de fitoseídeos predadores [as três mais numerosas encontradas neste estudo assim como Phytoseiulus macropilis (Banks)]. Foram também realizados testes em laboratório para se avaliar a aceitação de Tetranychus urticae Koch e T. evansi como presas àqueles predadores. Apenas P. macropilis sobreviveu e ovipositou adequadamente quando alimentado com T. urticae. Embora conseguissem se manter vivos por alguns dias quando alimentados com T. evansi, os níveis de reprodução dos quatro predadores foram muito baixos. Esses resultados indicam que embora encontrados comumente sobre solanáceas no campo, aqueles predadores alimentam-se muito pouco ou não se alimentam de T. evansi na natureza. Abstract in english The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Ca [...] maragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), and the predaceous species Asca sp. (Ascidae), Phytoseius guianensis De Leon and Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (both Phytoseiidae). Negative indexes of association were determined between T. evansi and each of four species of predaceous phytoseiids [i.e., the three most numerous species found in this study as well as Phytoseiulus macropilis (Banks)]. Laboratory tests were also conducted to evaluate the acceptability of Tetranychus urticae Koch and T. evansi as prey by the four predatory species. Only P. macropilis survived and oviposited well when fed T. urticae. Although they were able to remain alive for some days when fed T. evansi, the reproduction levels of the four predator species were very low. These results suggest that despite being commonly found on solanaceous plants in the field, these predators feed very little or do not feed at all on T. evansi in nature.

Alexsandra A., Rosa; Manoel G.C., Gondim Jr.; Komi K.M., Fiaboe; Gilberto J. de, Moraes; Markus, Knapp.


A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As hidras são os representantes mais comuns dos cnidários de água doce. Em geral, estes organismos são encontrados em todos os continentes, exceto na Antártica. O presente estudo teve como objetivo obter informações mais aprofundadas sobre aspectos biológicos e ecológicos de duas espécies de Hydra n [...] ativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predação e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espécies. Os resultados indicaram que as duas espécies de Hydra não foram consumidas por nenhum dos predadores testados, os quais são usuais predadores de invertebrados em águas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espécie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de copépodos calanóides e os pequenos cladóceros, e selecionou negativamente as presas grandes, como os adultos de copépodos calanóides e os ostrácodos. Já a espécie H. salmacidis, a qual apresenta um tamanho maior, além de ter preferência pelos náuplios e copepoditos de copépodos calanóides e pequenos cladóceros, também selecionou positivamente os indivíduos adultos dos copépodos calanóides. Os resultados obtidos evidenciaram que as espécies H. viridissima e H. salmacidis provavelmente são pouco ou não são predadas em muitos ambientes naturais, sendo elas próprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos são predadores eficientes e observou-se uma relação positiva entre o tamanho da espécie de Hydra e o tamanho da presa. A seletividade alimentar destas espécies esteve relacionada com o tamanho das presas, assim como com outras características, tais como a espessura da carapaça e a eficiência de natação. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

Fernanda Cristina, Massaro; Natalia Felix, Negreiros; Odete, Rocha.


Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil / Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a ocorrência do ácaro vermelho do tomateiro (Tetranychus evansi Baker & Pritchard) e de ácaros predadores em quatro das espécies mais abundantes de solanáceas nativas do litoral de Pernambuco. Foram feitas coletas mensais de amostras de plantas de meados de setembro de 2002 a fins de maio [...] de 2003, nos municípios de Aliança, Carpina, Camaragibe, Goiana, Igarassu e Recife. Foram encontrados 5.485 ácaros pertencentes a mais de 27 espécies, das quais as mais numerosas foram as espécies fitófagas T. evansi e Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), e as espécies predadoras Asca sp. (Ascidae), Phytoseius guianensis De Leon e Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (ambos Phytoseiidae). Índices de associação negativos foram determinados entre T. evansi e quatro espécies de fitoseídeos predadores [as três mais numerosas encontradas neste estudo assim como Phytoseiulus macropilis (Banks)]. Foram também realizados testes em laboratório para se avaliar a aceitação de Tetranychus urticae Koch e T. evansi como presas àqueles predadores. Apenas P. macropilis sobreviveu e ovipositou adequadamente quando alimentado com T. urticae. Embora conseguissem se manter vivos por alguns dias quando alimentados com T. evansi, os níveis de reprodução dos quatro predadores foram muito baixos. Esses resultados indicam que embora encontrados comumente sobre solanáceas no campo, aqueles predadores alimentam-se muito pouco ou não se alimentam de T. evansi na natureza. Abstract in english The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Ca [...] maragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), and the predaceous species Asca sp. (Ascidae), Phytoseius guianensis De Leon and Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (both Phytoseiidae). Negative indexes of association were determined between T. evansi and each of four species of predaceous phytoseiids [i.e., the three most numerous species found in this study as well as Phytoseiulus macropilis (Banks)]. Laboratory tests were also conducted to evaluate the acceptability of Tetranychus urticae Koch and T. evansi as prey by the four predatory species. Only P. macropilis survived and oviposited well when fed T. urticae. Although they were able to remain alive for some days when fed T. evansi, the reproduction levels of the four predator species were very low. These results suggest that despite being commonly found on solanaceous plants in the field, these predators feed very little or do not feed at all on T. evansi in nature.

Alexsandra A., Rosa; Manoel G.C., Gondim Jr.; Komi K.M., Fiaboe; Gilberto J. de, Moraes; Markus, Knapp.



Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae) em culturas de pepino e morango / Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae) in cucumber and strawberry crops  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fit [...] oseídeos Amblyseius idaeus (Denmark & Muma) e Phytoseudus macropilis (Banks), comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4) para o pepino e 5 tratamentos para o morangueiro (T1-T5): T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae. Abstract in english The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytosei [...] ids Amblyseius idaeus (Denmark & Muma) and Phytoseudus macropilis (Banks), commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4) and 5 treatments for strawberry crops (T1-T5): T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A., Watanabe; G.J. de, Moraes; I., Gastaldo Jr.; G., Nicolella.


Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops  

Directory of Open Access Journals (Sweden)

Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A. Watanabe



Adequabilidade de diferentes substratos à oviposição do predador Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Suitability of different substrates for oviposition of the predator Orius insidiosus (Say) (Hemiptera: Anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fêmeas de Orius insidiosus (Say) colocam seus ovos endofíticamente, em diversas plantas, e um obstáculo para a criação massal desse predador é a seleção de um substrato de oviposição que seja de fácil obtenção e aceito pelo inseto. O objetivo deste estudo foi avaliar a preferência e a adeqüabilidade [...] de diferentes substratos de oviposição para O. insidiosus. Os testes foram conduzidos em câmaras climatizadas reguladas a 25 ± 1°C, UR de 70 ±10% e fotofase de 12h. Os substratos avaliados quanto à preferência e adequabilidade foram caule de caruru (Amaranthus viridis L.), caule e vagem de feijão (Phaseolus vulgaris L.), vagem de feijão-de-vagem (Phaseolus vulgaris L.) e inflorescências de picão-preto (Bidens pilosa L.). Na adequabilidade também foi avaliado o caule de poaia-do-campo (Spermacoce latifola Aubl.). Fêmeas submetidas aos testes com e sem chance de escolha preferiram ovipositar em inflorescências de picão-preto. O período de pré-oviposição foi influenciado pelo tipo de substrato, sendo menor na presença da inflorescência de picão-preto (3,0 dias) e no feijão, tanto no caule (3,1dias) como na vagem (3,7 dias) comparado aos demais substratos. O período de oviposição, bem como a longevidade foram cerca de três a quatro vezes menores na presença do caule de poaia-do-campo (8,9 dias). O número total de ovos/fêmea de O. insidiosus foi maior em inflorescências de picão-preto (163,3 ovos). Os resultados indicam a adeqüabilidade das inflorescências de picão-preto como substrato de oviposição para O. insidiosus, sendo o preferido nos testes, com e sem chance de escolha, e onde as fêmeas apresentaram melhor performance reprodutiva. Abstract in english Orius insidiosus (Say) females lay eggs inside plant tissue. An obstacle for its mass rearing is the selection of a plant that is suitable and well-accept by the female for oviposition. The objectives of this work were to evaluate the preference and the suitability of different plant structures as o [...] vipositional substrates for O. insidiosus. The trials were conducted in climatic chamber at 25 ± 1°C, RH 70 ± 10% and photophase 12h. The plant sites as amaranth stem (Amaranthus virides L.), common bean's stem and pod (Phaseolus vulgaris L.), green bean's pod (Phaseolus vulgaris L.) and farmer's friend inflorescence (Bidens pilosa L.) were evaluated in no-choice and choice tests. The broadleaf button weed stem (Spermacoce latifola Aubl.) was also used to evaluate the suitability on the reproductive parameters. The females of O. insidiosus preferred to oviposit in farmer's friend inflorescence in no-choice and choice tests. The pre-oviposition period was affected by the plant site used as an ovipositional substrate, being shorter in farmer's friend inflorescence (3.0 days) and in common bean (both on stem (3.1 days) and pod (3.7 days) compared to all substrates evaluated. The oviposition period and the longevity were about three or four times shorter on broadleaf button weed stem (8.9 days). The total number of eggs/ female was higher in farmer's friend inflorescence (163.3 eggs). The results indicated the preference and suitability of farmer's friend inflorescence as an ovipositional substrate for O. insidiosus, in which the females showed better reproductive performance.

Simone M., Mendes; Vanda H.P., Bueno; Lívia M., Carvalho.


Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions  

Directory of Open Access Journals (Sweden)

Full Text Available OBJETIVO: Avaliar a competência de peixes na preda??o de larvas de Aedes aegypti, em condições de laborat?rio. MÉTODOS: Foram testados machos e f?meas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada esp?cie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada caixa, e a cada semana acrescentavam-se 100 larvas por caixa/dia, até se obter um máximo de 500 larvas/dia. Comprimento e peso dos peixes foram medidos semanalmente. RESULTADOS: Foram utilizadas 369.000 larvas no total. O Trichogaster trichopteros foi a única espécie em que ambos os sexos predaram 100% das larvas oferecidas. O Betta splendens deixou de predar apenas 15 larvas. Machos do Poecilia reticulata apresentaram baixa capacidade larvófaga quando comparados às fêmeas da mesma espécie. Em relação ao peso e tamanho o Betta splendens mostrou-se capaz de predar 523 larvas/grama/dia. CONCLUSÕES: Fêmeas e machos de Trichogaster trichopteros e de Astyanax fasciatus, e fêmeas de Betta splendens e de Poecillia sphenops foram os peixes que apresentaram maior competência para predar as larvas. Embora com competência menor, machos de Poecillia sphenops e fêmeas de Poecilia reticulata foram capazes de eliminar o número de larvas de Aedes aegypti que possam emergir durante 24 horas num criadouro, em condi??es naturais. Machos de Poecilia reticulata n?o foram predadores eficazes.OBJECTIVE: To evaluate the efficacy of fish as predators of the Aedes aegypti larvae in laboratory conditions. METHODS: The male and female of five different fish were included in the experiment. The tests to measure their consumption ability lasted five weeks for each species. Each trial involved four test tanks and four control tanks. Two control tanks contained just one fish, and the other two just larvae. Each of the test tanks contained one fish and the larvae. During the first week, 100 larvae were placed in the tank, with an additional 100 added every week, up to a maximum daily amount of 500 larvae. The length and weight of the fish were measured at the beginning and end of every week. RESULTS: A total of 369,000 larvae were used. The Trichogaster trichopteros was the only species in which both sexes ate 100% of the available larvae. The Betta splendens failed to eat only 15 larvae. The male Poecilia reticulate showed a strong capacity for larvae eating, compared with the female of the same species. In terms of weight and size, the Betta splendens proved capable of eating 523 larvae per gram of weight per day. CONCLUSIONS: The female and male Trichogaster trichopteros and Astyanax fasciatus, and the female Betta splendens and Poecilia sphenops proved to be the most effective predators of the Aedes aegypti larvae. And although the male Poecilia sphenops and female Poecilia reticulata were less effective, they were also capable of eradicating the total number of Aedes aegypti larvae that could appear over 24 hours in a breeding site under natural conditions. The male Poecilia reticulata, however, proved incapable of doing so.

Luciano Pamplona de Góes Cavalcanti




Directory of Open Access Journals (Sweden)

Full Text Available

With the objective of studying the abundance and diversity of predaceous arthropods associated with cotton crop, and analyze the influence of meteorological factors, interactions between natural enemies and population dynamics of coccinellids associated with their principal prey, the aphid Aphis gossypii, an experiment was carried out in the region of Ipameri, Goiás State, Brazil, at the Universidade Estadual de Goiás campus. The experimental design was randomized blocks, with five treatments, consisting of the DeltaOPAL, FMX 966, FMX 993, FMX 910, and NuOPAL cultivars, in four replications. Among the arthropods sampled in the cotton crop, the coccinellids and spiders were the most abundant ones in the cultivars evaluated. Spiders occurred throughout the cotton cycle, while the coccinellids population increased gradually until 55 DAE, showing a population peak at 34 DAE, coinciding with the population peak of aphids (Aphis gossypii. Among the coccinellids observed in the cultivars under study, Scymnus spp. was the most abundant in cotton. The pentatomid and forficulid occurred from 99 to 128 days after the emergence of cotton, which corresponds to the highest density of target pest insects. It was not found influence of meteorological factors or negative interactions among predaceous arthropods.

KEY-WORDS: Gossypium hirsutum; natural enemies, coccinellids.

Com o objetivo de estudar a abundância e a diversidade de artrópodes predadores associados à cultura do algodoeiro e analisar a influência de fatores meteorológicos, interações entre inimigos naturais e a dinâmica populacional de coccinelídeos associados à sua principal presa, o pulgão Aphis gossypii, um experimento foi realizado na região de Ipameri (GO, no Campus da Universidade Estadual de Goiás. O delineamento experimental utilizado foi o de blocos ao acaso, com cinco tratamentos, constituídos pelas cultivares DeltaOPAL, FMX 966, FMX 993, FMX 910 e NuOPAL, em quatro repetições. Dentre os artrópodes observados na cultura do algodoeiro, os coccinelídeos e as aranhas foram os mais abundantes, nas cultivares avaliadas. As aranhas ocorreram em todo o ciclo do algodoeiro. Já os coccinelídeos aumentaram sua população, gradativamente, até 55 DAE, apresentando pico populacional aos 34 DAE, coincidindo com o pico populacional dos pulgões A. gossypii. Dentre os coccinelídeos observados nas cultivares em estudo, verificou-se que Scymnus spp. foi o gênero mais abundante no algodoeiro. Os pentatomídeos e forficulídeos predominaram dos 99 aos 128 dias após a emergência do algodão, período que corresponde à maior densidade de pragas-alvo destes insetos. Verificou-se que não houve influência dos fatores meteorológicos e nem interaçã

Francisco Jorge Cividanes



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.



Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? / A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? O percevejo Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de contro [...] le natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) e Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior), apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores Abstract in english Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natura [...] l control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae), and Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey) depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.

Rafael Braga da, Silva; Alberto Soares, Corrêa; Terezinha Maria Castro, Della Lucia; Alexandre Igor Azevedo, Pereira; Ivan, Cruz; José Cola, Zanuncio.


Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Directory of Open Access Journals (Sweden)

Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

Maria A Medeiros



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.


Avaliação in vitro do fungo predador de nematoides Duddingtonia flagrans sobre larvas infectantes de ciatostomíneos de equinos (Nematoda: Cyathostominae In vitro evaluation of nematode predacious fungus Duddingtonia flagrans on cyathostomes infective larvae of equines (Nematoda: Cyathostominae  

Directory of Open Access Journals (Sweden)

Full Text Available A capacidade predatória de um isolado de fungo predador de nematoides Duddingtonia flagrans (AC001 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Houve redução significativa (p The predatory capacity of one isolate of nematode-trapping fungus Duddingtonia flagrans (AC001 on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. There was significant reduction (p < 0. 01 of 93.64% in the average of infective larvae of cyathostomes recovered of medium WA 2% at seven day. These results show that the isolated AC001 could be used in the biological control of cyathostomes of horses.

Braga Fabio R.




Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-d [...] os-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies Abstract in english Through the bioassays, it was verified the residual contact, ovicidal and persistence effects of the products chlorfenapyr and fenbutatin-oxide on two species of predaceous mites, Iphiseiodes zuluagai Denmark & Muma and Euseius alatus DeLeon (Acari: Phytoseiidae), associated to the citrus leprosis m [...] ite Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). The adult total effect was studied through the residual spray contact method in glass surface, according to IOBC methodology. Ovicidal effect was evaluated through direct spray on the predators mite eggs, also in glass surface. Persistence of the products was evaluated, in laboratory conditions, in arenas made with sprayed orange leaves in the field at 0, 5, 15 and 30 days after the application. Results showed that chlorfenapyr was noxious to I. zuluagai and E. alatus, and fenbutatin-oxide was slightly harmful to E. alatus and innocuous to I. zuluagai. None of the products presented ovicidal effect. Fenbutatin-oxide presented low persistence to both predators mite species, and chlorfenapyr in the smallest rate (31.3 ml) was of low persistence and in the great one (62.5 ml) moderately persistent. Fenbutatin-oxide was innocuous and slightly harmful to the predaceous mites I. zuluagai and E. alatus, respectively, and of low persistence for both species



Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?  

Directory of Open Access Journals (Sweden)

Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae e Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior, apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores

Rafael Braga da Silva



Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics / Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predat [...] orio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica. Abstract in english Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American s [...] ea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.

M. Florencia, Grandi; Rocío, Loizaga de Castro; Enrique A, Crespo.



Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939) e ácaros predadores (Phytoseiidae) / Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939) and predatory mites (Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939) (AcarirTenuipalpidae) e ácaros predadores (Phytoseiidae), em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0), acrinathrin (0,5); [...] hexythiazox (1,5); amitraz (40,0) e enxofre (225,0). Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização. Abstract in english The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939) (Acari,Tenuipalpidae) and predatory mites (Phytoseiidae) hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0), acrinathrin (0.5), hexythiaz [...] ox (1.5), amitraz (40.0) and sulphur (225.0). The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E., Sato; A., Raga; L.C., Cerávolo; A.C., Cezário; A.C., Rossi.



Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939) e ácaros predadores (Phytoseiidae) / Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939) and predatory mites (Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939) (AcarirTenuipalpidae) e ácaros predadores (Phytoseiidae), em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0), acrinathrin (0,5); [...] hexythiazox (1,5); amitraz (40,0) e enxofre (225,0). Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização. Abstract in english The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939) (Acari,Tenuipalpidae) and predatory mites (Phytoseiidae) hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0), acrinathrin (0.5), hexythiaz [...] ox (1.5), amitraz (40.0) and sulphur (225.0). The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E., Sato; A., Raga; L.C., Cerávolo; A.C., Cezário; A.C., Rossi.


Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939 e ácaros predadores (Phytoseiidae Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939 and predatory mites (Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939 (AcarirTenuipalpidae e ácaros predadores (Phytoseiidae, em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0, acrinathrin (0,5; hexythiazox (1,5; amitraz (40,0 e enxofre (225,0. Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização.The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939 (Acari,Tenuipalpidae and predatory mites (Phytoseiidae hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0, acrinathrin (0.5, hexythiazox (1.5, amitraz (40.0 and sulphur (225.0. The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E. Sato



Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquisa de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93 e percevejos (4/3/93. A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também n??o foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias.A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993 or the stink bug complex (3/4/1993. Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

Ivan Carlos Corso



Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) / Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Bandos mistos de aves incluindo Cypsnagra hirundinacea e Neothraupis fasciata como espécies que vigiam por sentinelas foram estudados em campo-cerrado de março a setembro de 1996. O propósito desse estudo foi verificar a possível relação entre o grau de alerta de uma espécie e a liderança dos bandos [...] . Durante as observações (em média de 2h30) foi quantificado o tempo vigiado por sentinelas de ambas as espécies. Os sentinelas de Cypsnagra hirundinacea realizaram a quase totalidade da vigilância (tempo com sentinela foi em média de 42 ± 17% do tempo, sendo 41 ± 17% vigiado por C. hirundinacea e 1,2% por N. fasciata), além de emitirem todos os chamados de alarme registrados (54% dos encontros com predadores aéreos estimularam chamados de alarme). O tempo vigiado por sentinelas nos bandos apresentou relação significativa com a taxa de encontro entre os predadores aéreos e os bandos (ANOVA, F = 3,0; p Abstract in english Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed fl [...] ocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time with sentinel was on average 42 ± 17%, 41 ± 17% of which by C. hirundinacea, whereas only 1.2 % by N. fasciata) and gave all the alarm calls recorded (54% of the encounters with raptors stimulated alarm calls). A relationship was verified between time with sentinel and the rate of encounters with raptor (ANOVA, F = 3.0, P



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores / Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tr [...] atamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília); cebola + milho (Zea mays L.); cebola + rúcula (Eruca sativa L.) + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento. Abstract in english The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind), and syrphid predators (Toxomerus spp.), population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatm [...] ents were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench) (Poligonaceae); onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.); onion intercropped with carrots (Daucus carota L.) Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.); onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

Paulo Antonio de Souza, Gonçalves; Carlos Roberto, Sousa e Silva.



Initial screening of little known predatory mites in Brazil as potential pest control agents. (United States)

The objective of this study was to evaluate the oviposition rate and the survivorship of some of the most common predators on plants of the natural vegetation of southeastern Brazil, when confined with different food sources. Forty-four laboratory tests were carried out, each corresponding to a different combination of predator species and food source. The predators tested were: Phytoseiidae--Amblyseius acalyphus, Euseius citrifolius, Iphiseiodes zuluagai, Metaseiulus (Metaseiulus) camelliae, Typhlodromips cananeiensis; Stigmaeidae--Agistemus floridanus, Zetzellia malvinae; Tydeidae--Pronematus sp. For most predators, the highest oviposition rate and survivorship were obtained when the prey was one of the tenuipalpid mites, Brevipalpus phoenicis or Tenuipalpus heveae. With the exception of A. floridanus, the predators had low oviposition rate and survivorship on Calacarus heveae relative to their respective rate on other food sources. Predators had also generally low oviposition rate and survivorship when feeding on Tetranychus urticae, Oligonychus gossypii or Frankliniella sp. PMID:16770686

De Vis, R M J; de Moraes, G J; Bellini, M R



Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines, and ground cover plants. (United States)

Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the families Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) in central and south central Florida. Inner and outer canopy leaves, fruit, twigs, and trunk scrapings were sampled monthly between August 1994 and January 1996. Open flowers were sampled in March from five of the sites. Two species of eupalopsellid mites (Exothorhis caudata Summers and Saniosulus harteni (van-Dis and Ueckermann)) were identified from 252 specimens collected within citrus tree canopies within the seven citrus orchards of which 249 were E. caudata. Only two E. caudata were collected from ground cover plants within five of the seven orchards. Eight species of Stigmaeidae were identified from 5,637 specimens: Agistemus floridanus Gonzalez, A. terminalis Gonzalez, Eustigmaeus arcuata (Chandhri), E. sp. near arcuata, E. segnis (Koch), Mediostigmaeus citri (Rakha and McCoy), Stigmaeus seminudus Wood, and Zetzellia languida Gonzalez were collected from within citrus tree canopies from seven orchard sites. Agistemus floridanus was the only species in either family that was abundant with 5,483 collected from within citrus tree canopies compared with only 39 from vine or ground cover plants. A total of 431 samples from one or more of 82 vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards and one or more eupalopsellids or stigmaeids were collected from 19 of these plants. Richardia brasiliensis (Meg.) Gomez had nine A. floridanus from 5 of 25 samples collected from this plant. Solanum sp. had five A. floridanus from three samples taken. Both eupalopsellid and stigmaeid species numbers represented citrus orchards with on-going or recent herbicide programs compared with orchards having well-developed ground cover plants. Agistemus floridanus was most abundant on inner leaves between January and April and again during September through November. Additional collection records of E. caudata, S. harteni, A. terminalis, M. citri, Z. languida, and Zetzellia sp. near silvicola within Florida citrus orchards between 1989 and 2004 are included. Four species of Eupalopsellidae and ten species of Stigmaeidae occur within Florida citrus orchards. PMID:24771254

Childers, Carl C; Ueckermann, Eduard A



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos cons...

Daniele Cristine Hoffmann Schlesener; Adriane Fonseca Duarte; Milton Fernando Cabezas Guerrero; Uemerson Silva da Cunha; Dori Edson Nava



Biologia de Amblyseius largoensis (Muma) (Acari: Phytoseiidae), um potencial predador de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro / Biology of Amblyseius largoensis (Muma) (Acari: Phytoseiidae), a potential predator of Aceria guerreronis Keifer (Acari: Eriophyidae) on coconut trees  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Aceria guerreronis Keifer é considerada uma das principais pragas do coqueiro no mundo. Dentre os Phytoseiidae relatados nessa cultura, Amblyseius largoensis (Muma) tem sido encontrado associado a A. guerreronis. Com o intuito de verificar se A. largoensis se alimenta de A. guerreronis, foi estudada [...] a biologia desse predador com diferentes fontes de alimento, incluindo A. guerreronis. Foram avaliadas três dietas [Tetranychus urticae Koch + pólen de mamona (Ricinus communis L.) + mel a 10%, A. guerreronis + pólen + mel e A. guerreronis isoladamente], avaliando-se o desenvolvimento, sobrevivência, oviposição, razão sexual e longevidade de A. largoensis a 27ºC, 60 ± 5% de umidade relativa e fotofase de 12h. Tabelas de vida de fertilidade foram construídas. A duração da fase imatura foi menor na dieta constituída apenas por A. guerreronis, enquanto que a fecundidade foi maior nas dietas à base de presa + pólen + mel. Não houve diferença entre os valores de sobrevivência das formas imaturas submetidas a diferentes dietas alimentares. Os parâmetros da tabela de vida de fertilidade foram superiores quando a alimentação foi constituída por A. guerreronis ou T. urticae + pólen + mel, embora o predador tenha sido capaz de completar seu ciclo biológico e se reproduzir quando alimentado exclusivamente com A. guerreronis. Os resultados sugerem que A. largoensis seja um predador de A. guerreronis em condições naturais e que possa estar desempenhando algum papel no controle dessa praga. Abstract in english Aceria guerreronis Keifer is considered one of the main pests of coconuts around the world. Amongst the Phytoseiidae recorded on this crop, Amblyseius largoensis (Muma) has been reported in association with A. guerreronis. In order to verify whether A. largoensis feeds on A. guerreronis, the biology [...] of this predator was evaluated on different food sources, including A. guerreronis. Three types of diet were tested [Tetranychus urticae Koch + castor bean (Ricinus communis L.) pollen + honey at 10%, A. guerreronis + pollen + honey, and only A. guerreronis], determining its development, survivorship, oviposition, sex ratio and longevity at 27ºC, 60 ± 5% RH 12 h photophase. Fertility life tables were constructed. The duration of the immature phase was lower when feeding only on A. guerreronis, while fecundity was higher when feeding on a prey + pollen + honey. There was no difference in relation to survivorship of the immature stages between the three diets. Parameters of fertility life tables were higher when the diet included A. guerreronis or T. urticae + pollen + honey, although the predator was able to complete its life cycle and reproduce when feeding exclusively on A. guerreronis. The results suggest that A. largoensis preys upon A. guerreronis under natural condition and that it might play some role in the control of the latter.

Andréia S., Galvão; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; José V. de, Oliveira.


Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.


Effect of prey density on the functional and numerical responses of two species of predaceous mites (Acari: Phytoseiidae) / Efeito da densidade de presa nas respostas funcional e numérica de duas espécies de ácaros predadores (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Ácaros da família Phytoseiidae são os inimigos naturais de ácaros-praga mais importantes e estudados. Uma questão freqüentemente levantada é se os fitoseídeos podem reduzir altas densidades de ácaros fitófagos a baixos níveis. Os estudos da resposta funcional e numérica podem contribuir para respond [...] er essa pergunta. O objetivo deste trabalho foi avaliar o potencial de predação de Iphiseiodes zuluagai Denmark e Muma e Euseius alatus DeLeon (Acari: Phytoseiidae) como agentes de controle biológico do ácaro fitófago Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vetor do vírus da leprose-dos-citros e da mancha-anular do cafeeiro. Bioensaios foram realizados em laboratório. Fêmeas adultas de cada predador foram individualizadas em arenas de folha de citros com 3 cm de diâmetro. Fases imaturas de B. phoenicis foram oferecidas, como presas, nas seguintes quantidades/arena: 1, 2, 5, 10, 20, 30 e 35 (com sete repetições), 45 (quatro repetições), 55 (três repetições) e 70, 100, 125, 200 e 300 (duas repetições). O número de presas mortas e de ovos colocados pelo predador foram avaliados a cada 24h, durante oito dias. As presas mortas foram diariamente substituídas por novas presas. Para ambos os ácaros predadores foi constatada uma correlação positiva e altamente significativa entre o número de presas oferecidas e mortas. A oviposição média diária também aumentou em função do número de presas mortas. Nas densidades mais baixas, E. alatus matou mais B. phoenicis do que I. zuluagai, e o contrário foi observado nas densidades mais altas. É possível que E. alatus possa reduzir a população de B. phoenicis mesmo em baixas densidades do ácaro fitófago, e que I. zuluagai possa fazer o mesmo nas mais altas. O fato de E. alatus necessitar de menos presas que I. zuluagai sugere que sua sobrevivência possa ser maior do que a de I. zuluagai sob baixa densidade de presa. Abstract in english Phytoseiidae mites are the most important and studied natural enemies of pest mites. A question frequently raised is whether phytoseiid may reduce high densities of phytophagous mites. Studies of functional and numerical responses may help to answer this question. The aim of this work was to evaluat [...] e the potential predation success of Iphiseiodes zuluagai Denmark and Muma and Euseius alatus DeLeon (Acari: Phytoseiidae) on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vector of the citrus leprosis and the coffee ringspot viruses. Bioassays were performed in the laboratory. Adult females of each predator were isolated in arenas made with citrus leaves (3-cm diameter). Immature stages of B. phoenicis were offered as prey, at the following numbers/arena: 1, 2, 5, 10, 20, 30 and 35 (seven replicates), 45 (four replicates), 55 (three replicates) and 70, 100, 125, 200 and 300 (two replicates). The number of killed prey and of eggs laid by the predators was evaluated every 24h, during eight days. Killed prey was replaced daily by new prey. For both predatory mites, a positive and highly significant correlation was found between the numbers of prey offered and killed. The average daily oviposition rate also increased with the number of killed prey. At the lower densities, E. alatus killed and ate more B. phoenicis than I. zuluagai. The opposite was observed at the highest densities. It is possible that E. alatus can reduce B. phoenicis population even at low prey densities, and I. zuluagai can do the same also at high densities. The fact that E. alatus requires less prey than I. zuluagai suggests that its survivorship may be higher than that of I. zuluagai at low prey densities.

Paulo R., Reis; Elber O., Sousa; Adenir V., Teodoro; Marçal, Pedro Neto.


Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997 e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas" e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca"]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae e Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] e do feijoeiro [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae e Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae e Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas.This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae and Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] and bean [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae and Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae and Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Cristina Schetino Bastos



Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.


Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa / Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azad [...] iractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1) e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa. Abstract in english The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer) and on its predator Eriopis connexa (Germar). Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin) a [...] t concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1) and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1) and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine, Venzon; Maria da Consolação, Rosado; Angelo, Pallini; Amanda, Fialho; Célia de Jesus, Pereira.



Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado / Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o [...] primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) e Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] e do feijoeiro [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) e Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae) e Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae) e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas. Abstract in english This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 [...] ) and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation) and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation)]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) and Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] and bean [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) and Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae) and Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae) and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Cristina Schetino, Bastos; João Carlos Cardoso, Galvão; Marcelo Coutinho, Picanço; Paulo Roberto, Cecon; Paulo Roberto Gomes, Pereira.


Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil / Dinâmica populacional de Aceria guerreronis Keifer (Acari: Eriophyidae) e predadores associados em frutos de coqueiro no Nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Aceria guerreronis Keifer pode causar danos severos em coqueiro em vários países ao redor do mundo. Raros estudos têm sido conduzidos para determinar os ácaros predadores associados com A. guerreronis no Brasil. O objetivo deste estudo foi avaliar a prevalência de A. guerreronis e dos predadores ass [...] ociados nas brácteas e na superfície dos frutos abaixo delas, durante 12 meses, em frutos de coqueiro adulto ao longo da costa de Alagoas, Paraíba e Pernambuco, no Nordeste do Brasil. Ácaros de 10 famílias foram encontrados, contudo a espécie mais abundante foi A. guerreronis, correspondendo a 99,5% dos ácaros coletados. Dentre as espécies predadoras prevaleceram os ácaros Phytoseiidae Neoseiulus baraki (Athias-Henriot) e Neoseiulus paspalivorus (De Leon). Estes são achatados e possuem pernas curtas, características que lhes permitem invadir o habitat ocupado por A. guerreronis. Outros predadores foram encontrados, mas em número bem menor, provavelmente pela dificuldade que têm em penetrar nas áreas comumente habitadas por A. guerreronis. Contudo, essas espécies têm potencial de predação sobre o ácaro quando este sai de seu habitat preferido para se dispersar. Não se observaram correlações significativas entre os níveis de fatores abióticos e os níveis populacionais de A. guerreronis ou dos fitoseídeos associados a essa espécie. Isso provavelmente se deu devido aos efeitos simultâneo e conflitante daqueles fatores sobre os ácaros no campo, ou a diferenças significativas entre os fatores climáticos medidos no ambiente e aqueles prevalentes no habitat ocupado por A. guerreronis. Abstract in english Aceria guerreronis Keifer can cause severe damage to coconuts in several countries around the world. Rare studies have been conducted to determine the predatory mites associated with A. guerreronis in Brazil. The study evaluated the prevalence of A. guerreronis and associated predators on the bracts [...] and on the surface of the fruits underneath the bracts, for 12 months, on coconut palms grown along the coast of the States of Alagoas, Paraíba and Pernambuco, Northeastern Brazil. Mites of 10 families were found, but by far the most abundant species was A. guerreronis, corresponding to 99.5% of the mites collected. The prevailing species amongst the predators were the Phytoseiidae mites Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon). These are flat mites that have short limbs, characteristics that allow them to invade the main habitat occupied by A. guerreronis. Other predators were found, but in low numbers, due mainly to their difficulty in reaching the fruit areas most inhabited by A. guerreronis. However, these mites could prey on that pest when it leaves its preferred habitat to disperse. No significant correlations were observed between the levels of abiotic factors and the population levels of A. guerreronis or of the phytoseiids associated with it. This probably occurred due to the simultaneous and conflicting effects of those factors on the mites in the field, or to significant differences between the climatic factors measured in the environment and those prevailing in the habitat occupied by A. guerreronis.

Aleuny C., Reis; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; Rachid, Hanna; Peter, Schausberger; Late E., Lawson-Balagbo; Reginaldo, Barros.


Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine Venzon



Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa / Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azad [...] iractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1) e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa. Abstract in english The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer) and on its predator Eriopis connexa (Germar). Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin) a [...] t concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1) and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1) and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine, Venzon; Maria da Consolação, Rosado; Angelo, Pallini; Amanda, Fialho; Célia de Jesus, Pereira.


Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.



Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil / Dinâmica populacional de Aceria guerreronis Keifer (Acari: Eriophyidae) e predadores associados em frutos de coqueiro no Nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Aceria guerreronis Keifer pode causar danos severos em coqueiro em vários países ao redor do mundo. Raros estudos têm sido conduzidos para determinar os ácaros predadores associados com A. guerreronis no Brasil. O objetivo deste estudo foi avaliar a prevalência de A. guerreronis e dos predadores ass [...] ociados nas brácteas e na superfície dos frutos abaixo delas, durante 12 meses, em frutos de coqueiro adulto ao longo da costa de Alagoas, Paraíba e Pernambuco, no Nordeste do Brasil. Ácaros de 10 famílias foram encontrados, contudo a espécie mais abundante foi A. guerreronis, correspondendo a 99,5% dos ácaros coletados. Dentre as espécies predadoras prevaleceram os ácaros Phytoseiidae Neoseiulus baraki (Athias-Henriot) e Neoseiulus paspalivorus (De Leon). Estes são achatados e possuem pernas curtas, características que lhes permitem invadir o habitat ocupado por A. guerreronis. Outros predadores foram encontrados, mas em número bem menor, provavelmente pela dificuldade que têm em penetrar nas áreas comumente habitadas por A. guerreronis. Contudo, essas espécies têm potencial de predação sobre o ácaro quando este sai de seu habitat preferido para se dispersar. Não se observaram correlações significativas entre os níveis de fatores abióticos e os níveis populacionais de A. guerreronis ou dos fitoseídeos associados a essa espécie. Isso provavelmente se deu devido aos efeitos simultâneo e conflitante daqueles fatores sobre os ácaros no campo, ou a diferenças significativas entre os fatores climáticos medidos no ambiente e aqueles prevalentes no habitat ocupado por A. guerreronis. Abstract in english Aceria guerreronis Keifer can cause severe damage to coconuts in several countries around the world. Rare studies have been conducted to determine the predatory mites associated with A. guerreronis in Brazil. The study evaluated the prevalence of A. guerreronis and associated predators on the bracts [...] and on the surface of the fruits underneath the bracts, for 12 months, on coconut palms grown along the coast of the States of Alagoas, Paraíba and Pernambuco, Northeastern Brazil. Mites of 10 families were found, but by far the most abundant species was A. guerreronis, corresponding to 99.5% of the mites collected. The prevailing species amongst the predators were the Phytoseiidae mites Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon). These are flat mites that have short limbs, characteristics that allow them to invade the main habitat occupied by A. guerreronis. Other predators were found, but in low numbers, due mainly to their difficulty in reaching the fruit areas most inhabited by A. guerreronis. However, these mites could prey on that pest when it leaves its preferred habitat to disperse. No significant correlations were observed between the levels of abiotic factors and the population levels of A. guerreronis or of the phytoseiids associated with it. This probably occurred due to the simultaneous and conflicting effects of those factors on the mites in the field, or to significant differences between the climatic factors measured in the environment and those prevailing in the habitat occupied by A. guerreronis.

Aleuny C., Reis; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; Rachid, Hanna; Peter, Schausberger; Late E., Lawson-Balagbo; Reginaldo, Barros.



Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Directory of Open Access Journals (Sweden)

Full Text Available O pulgão Schizaphis graminum (Rondani (Hemiptera: Aphididae é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus (Coleoptera: Coccinellidae. O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo.The aphid Schizaphis graminum (Rondani (Hemiptera: Aphididae is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus (Coleoptera: Coccinellidae. The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

Terezinha Monteiro dos Santos



Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests / Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Com o objetivo de selecionar ácaros predadores com potencial de controle de ácaros fitófagos do mamão, foram realizadas, de janeiro de 1999 a fevereiro de 2000, amostragens bimensais de ácaros em dois pomares, um orgânico (Silva Jardim, RJ) e outro com controle químico de pragas, doenças e invasoras [...] (Linhares, ES). Todas as espécies presentes nas brotações laterais, folhas novas, folhas velhas e botões florais dos mamoeiros e nas folhas das plantas invasoras foram quantificadas e identificadas ao menos até família. Apesar da relativamente diversa fauna de ácaros, somente representantes de uma família de predadores, Phytoseiidae, foram encontrados. Dentre estes, Neoseiulus idaeus Denmark & Muma destacou-se por sua abundância e freqüência nas diferentes épocas do ano no pomar de Linhares, coincidindo principalmente com as flutuações na abundância dos tetraniquídeos. Tal ocorrência em um sistema de produção com grande emprego de acaricidas, aliada às características biológicas favoráveis dessa espécie, recomendam-na como candidata a agente de controle biológico de ácaros pragas do mamão, em especial Tetranychus urticae Koch. Abstract in english This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where p [...] ests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least family level. Despite the relatively diverse mite fauna, we found representatives of only one family of predacious mites, i.e. Phytoseiidae. Among these, Neoseiulus idaeus Denmark & Muma was the most abundant and frequent during all seasons in the Linhares orchard, coinciding mainly with the fluctuations in abundance of tetranychid mites. Such occurrence in a production system with large use of acaricides, together with its favorable biological traits reported in the literature, lead us to recommend this species as a good candidate for biological control of papaya mite pests, especially Tetranychus urticae Koch.

Karin F.S., Collier; Jose O.G. de, Lima; Gilberto S., Albuquerque.


Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido / Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 [...] a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea. Abstract in english The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from [...] 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira, Breda; José Vargas de, Oliveira; Edmilson Jacinto, Marques; Rachel Gonçalves, Ferreira; Mauricéa Fidelis, Santana.



Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea.The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira Breda



Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake / Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD) em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi av [...] aliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade) foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso. Abstract in english The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocer [...] ans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity) were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.

MS., Arcifa; TC., Bunioto; A., Perticarrari; WJ., Minto.



Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea / Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera [...] : Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo. Abstract in english The aphid Schizaphis graminum (Rondani) (Hemiptera: Aphididae) is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus) (Coleo [...] ptera: Coccinellidae). The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

Terezinha Monteiro dos, Santos; Liliane Karla, Figueira; Arlindo Leal, Boiça Júnior; Fernando Mesquita, Lara; Ivan, Cruz.


Survey of cyclopids (Crustacea, Copepoda in Brazil and preliminary screening of their potential as dengue vector predators Levantamento de ciclopídeos (Crustacea, Copepoda no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue  

Directory of Open Access Journals (Sweden)

Full Text Available INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01 of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01 criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido.

Luciana Urbano dos Santos



Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja / Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquis [...] a de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93) e percevejos (4/3/93). A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também não foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias. Abstract in english A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja [...] , located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

Ivan Carlos, Corso; Décio Luiz, Gazzoni; Manoel Eugenio, Nery.


Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea / Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera [...] : Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo. Abstract in english The aphid Schizaphis graminum (Rondani) (Hemiptera: Aphididae) is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus) (Coleo [...] ptera: Coccinellidae). The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

Terezinha Monteiro dos, Santos; Liliane Karla, Figueira; Arlindo Leal, Boiça Júnior; Fernando Mesquita, Lara; Ivan, Cruz.



Desenvolvimento e Reprodução do Predador Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Frente a Doses Subletais de Permetrina / Development and Reproduction of the Predator Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Exposed to Sublethal Doses of Permethrin  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Desenvolvimento e reprodução foram estudados no predador Podisus distinctus (Stal) submetido a doses subletais do inseticida permetrina em condições de laboratório. Ninfas de 3º instar foram submetidas a aplicação tópica de permetrina nas doses de 0; 0,0172; 0,172; 1,72; 17,2 e 172 ppb. O único parâ [...] metro significativamente afetado foi a viabilidade de ovos. Esse parâmetro teve um máximo de estímulo na dose 0,172 ppb provendo evidência do fenômeno de hormese. Abstract in english Development and reproduction were studied in the predator Podisus distinctus (Stal) subjected to sublethal doses of the insecticide permethrin under laboratory conditions. Third instar nymphs were subjected to topical application of permethrin at the doses of 0, 0.0172, 0.172, 1.72, 17.2 e 172 ppb. [...] The only parameter statisticaly different was egg viability. This parameter had the gratest increase at the dose 0.172 ppb provinding evidence for the phenomenon of hormesis.




A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

Andrew P., Gutierrez; Marina A., Pizzamiglio.



A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

Andrew P., Gutierrez; Marina A., Pizzamiglio.


Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål (Heteroptera: Pentatomidae was investigated on ovary activation in this predator. The nymphs received topical application of permethrin in the following concentrations (mg a.i./ml: 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål (Heteroptera: Pentatomidae em sua ativação ovariana. Essas ninfas receberam aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml: 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese.

W. P. Lemos



Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae) / Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) em sua ativação ovariana. Essas ninfas receberam [...] aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml): 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml) a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese. Abstract in english Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) was investigated on ovary activation in this predator. The nymph [...] s received topical application of permethrin in the following concentrations (mg a.i./ml): 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.

W. P., Lemos; R. S., Medeiros; J. C., Zanuncio; J. E., Serrão.



Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.


Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.



Field tests of predaceous pentatomid pheromones and semiochemistry of Podisus and Supputius species (Heteroptera: Pentatomidae: Asopinae) / Testes de campo com feromônios de pentatomídeos predadores e análise semioquímica de espécies dos gêneros Podisus e Supputius (Heteroptera: Pentatomidae: Asopinae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Armadilhas contendo feromônios sintéticos de Podisus nigrispinus (Dallas) e Supputius cincticeps (Stäl) foram testadas no campo, na Universidade Federal de Viçosa, Minas Gerais, Brasil, a partir de 7 de setembro de 1995. Durante a coleta (setembro-outubro/95), não se observou a presença de P. nigris [...] pinus nas armadilhas em teste. No entanto, diversos adultos (machos e fêmeas) de Podisus distinctus (Stäl) foram coletados durante o mesmo período, bem como, alguns adultos de S. cincticeps e dois parasitóides fêmeas de Cylindromyia atra Roeder (Diptera: Tachinidae). Análises químicas do extrato glandular de machos de P. distinctus indicaram que os principais compostos feromonais desta espécie, também são produzidos por P. nigrispinus e S. cincticeps. Devido a este fato, em 6 de novembro, foram colocadas no campo uma série de armadilhas contendo iscas feromonais tanto de P nigrispinus, como de S. cincticeps. As armadilhas foram monitoradas até 6 de fevereiro de 1996. Durante esta segunda etapa do estudo, observou-se que a combinação das duas iscas feromonais aumentou em seis vezes a coleta de adultos de P. distinctus, em comparação com aquelas onde havia somente a isca para P. nigrispinus. Embora a fenologia para estes asopines neotropicais seja semelhante à do predador norte-americano de clima temperado Podisus maculiventris (Say), menos predadores e parasitóides hospedeiros foram coletados. Possíveis feromônios foram identificados para Podisus rostralis (Stäl), em Goiás, Brasil, e Podisus sagitta (Fabricius), de Honduras. Compostos químicos de outras secreções exócrinas destas espécies neotropicais também foram estudados. Abstract in english Traps baited with synthetic pheromones for either Podisus nigrispinus (Dallas) or Supputius cincticeps (Stäl) were field tested at the Universidade Federal de Viçosa, Minas Gerais, Brazil, beginning September 7, 1995. No P. nigrispinus were caught but, in September and October, several adult males a [...] nd females of P. distinctus (Stäl) were caught along with a few adults of S. cincticeps and two females of a tachinid fly parasitoid, Cylindromyia atra Roeder. Chemical analysis of the pheromone gland extract of P. distinctus males indicated that this species produces a pheromone containing the major compounds of P. nigrispinus and S. cincticeps. Therefore, on November 6 a set of traps was baited with the pheromones of both P. nigrispinus and S. cincticeps, and monitored in the field until February 6, 1996. During this second phase of the study, six times more P. distinctus were caught in the combined pheromone treatment than in traps baited only with the P. nigrispinus pheromone. The phenology of these neotropical asopines is like that for P. maculiventris (Say) in temperate North América, although fewer predators and host-seeking parasitoids were caught. Suspected pheromones were also identified for P. rostralis (Stäl) from Goiás, Brazil, and P. sagitta (Fabricius) from Honduras. In addition, the chemistry of other exocrine secretions from these neotropical species was investigated.

Jeffrey R., Aldrich; José C., Zanuncio; Evaldo F., Vilela; Jorge B., Torres; Ronald D., Cave.



Alternative plants hosts of legume aphids and predators in the province of León, Spain / Plantas hospedadoras alternativas de áfidos de leguminosas y sus predadores, en la provincia de León (España)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Durante los meses de primavera, verano y otoño de 1998 y 1999 se observaron al azar cultivos de leguminosas, y las plantas espontáneas marginales e intercalares, en la provincia de León (España). Los cultivos muestreados fueron: Medicago sativa, Phaseolus vulgaris,Pisum sativum, Cicer arietinum, Tri [...] folium repens, Vicia fava, Trifoliumpratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolio y Lens esculenta. Se observaron 23 familias de plantas espontáneas, en ellas y en los cultivos se identificaron los áfidos, su densidad poblacional y de los predadores de las familias Coccinellidae, Syrphidae Chrysopidae. Las familias con mayores registros de los enemigos naturales de los pulgones fueron: Apiaceae, Asteraceae y Chenopodiaceae para Syrphidae y Coccinellidae. Se concluye que el manejo de los agrosistemas, mediante la manipulación de las plantas espontáneas, constituiría un recurso a tener en cuenta para incrementar el potencial de los enemigos naturales de los áfidos plaga de los cultivos de leguminosas. Abstract in english The study was done during the spring, summer and fall of 1998 and 1999. Samples were taken at random from legume crops and spontaneous plants adjacent to them in the province of León (Spain). Observations were made on the following crops: Medicago sativa, Phaseolus vulgaris, Pisum sativum, Cicer ari [...] etinum, Trifolium repens, Vicia fava, Trifolium pratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolius and Lens esculenta. Twenty three families of spontaneous plants were observed. The aphid species and their population densities on the spontaneous plants and crop plants were recorded, as was the presence of members of the families Coccinellidae, Syrphidae and Chrysopidae. The plant families Brassicaceae, Asteraceae and Chenopodiaceae had the greatest numbers of these natural enemies of aphids the manipulation of spontaneous plants in agrosystems is a potential means of increasing populations of natural enemies of aphid pests in legume crops.

Isabel, Bertolaccini; Etelvina, Núñez-Pérez; Emilio Jorge, Tizado.



Alternative plants hosts of legume aphids and predators in the province of León, Spain / Plantas hospedadoras alternativas de áfidos de leguminosas y sus predadores, en la provincia de León (España)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Durante los meses de primavera, verano y otoño de 1998 y 1999 se observaron al azar cultivos de leguminosas, y las plantas espontáneas marginales e intercalares, en la provincia de León (España). Los cultivos muestreados fueron: Medicago sativa, Phaseolus vulgaris,Pisum sativum, Cicer arietinum, Tri [...] folium repens, Vicia fava, Trifoliumpratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolio y Lens esculenta. Se observaron 23 familias de plantas espontáneas, en ellas y en los cultivos se identificaron los áfidos, su densidad poblacional y de los predadores de las familias Coccinellidae, Syrphidae Chrysopidae. Las familias con mayores registros de los enemigos naturales de los pulgones fueron: Apiaceae, Asteraceae y Chenopodiaceae para Syrphidae y Coccinellidae. Se concluye que el manejo de los agrosistemas, mediante la manipulación de las plantas espontáneas, constituiría un recurso a tener en cuenta para incrementar el potencial de los enemigos naturales de los áfidos plaga de los cultivos de leguminosas. Abstract in english The study was done during the spring, summer and fall of 1998 and 1999. Samples were taken at random from legume crops and spontaneous plants adjacent to them in the province of León (Spain). Observations were made on the following crops: Medicago sativa, Phaseolus vulgaris, Pisum sativum, Cicer ari [...] etinum, Trifolium repens, Vicia fava, Trifolium pratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolius and Lens esculenta. Twenty three families of spontaneous plants were observed. The aphid species and their population densities on the spontaneous plants and crop plants were recorded, as was the presence of members of the families Coccinellidae, Syrphidae and Chrysopidae. The plant families Brassicaceae, Asteraceae and Chenopodiaceae had the greatest numbers of these natural enemies of aphids the manipulation of spontaneous plants in agrosystems is a potential means of increasing populations of natural enemies of aphid pests in legume crops.

Isabel, Bertolaccini; Etelvina, Núñez-Pérez; Emilio Jorge, Tizado.


Seletividade de extratos de nim (Azadirachta indica A. Juss.) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) / Selectivity of neem extracts (Azadirachta indica A. Juss.) to the predatory Mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade relativa dos extratos de folha, semente e óleo de torta de Azadirachta indica A. Juss (nim) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) foi estudada em laboratório. Foram determinadas concentrações discriminatórias (CLs99) dos extratos de folha, semente [...] e óleo de torta de nim para fêmeas adultas de Oligonychus ilicis (McGregor) (Acari: Tetranychidae), através de bioensaios de concentração-mortalidade. Arenas com 3,5 cm de diâmetro, confeccionadas com folhas de cafeeiro flutuando em água, foram impregnadas com resíduo seco dos extratos e usadas para se estimar a seletividade ao ácaro I. zuluagai. As concentrações dos extratos de nim que mataram 99% de O. ilicis, após 72h de exposição foram: 277,4; 520,9 e 10,9 mg/ml, para folha, semente e óleo de torta, respectivamente. A concentração discriminatória do extrato de óleo de torta de nim para fêmeas adultas de O. ilicis foi altamente tóxica ao ácaro I. zuluagai, as dos extratos de folha e de semente foram seletivos. Abstract in english The relative toxicity of the leaf, seed and oil neem cake extracts of Azadirachta indica A. Juss (neem) to the predatory mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) was evaluated. To verify the relative toxicity of these extracts on the predatory mite, discriminating concentrati [...] ons of the extracts were determined for adult females of the Oligonychus ilicis (McGregor) (Acari: Tetranychidae), through the method of concentration-mortality. Coffee leaf disks with 3.5 cm of the diameter were put floating on water and impregnated with dry residue of the extracts. Concentrations of neem extracts which caused mortality (99%) of O. ilicis, after 72h of exposition, were 277.4; 520.9 e 10.9 mg/ml for leaf, seed and oil neem cake, respectively. The discriminating concentration of extract of oil neem cake for O. ilicis females was highly toxic to I. zuluagai; while extract of leaf and seed were selective to the predatory mite.

Sheila A., Mourão; Júlio C.T., Silva; Raul N.C., Guedes; Madelaine, Venzon; Gulab N., Jham; Claudinei L., Oliveira; José C., Zanuncio.


Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa / Selectivity of pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas). Os agrotóxicos foram pulverizados direta [...] mente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas) se mostrou inócua (classe 1) a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2) a ovos e pupas de C. externa Abstract in english This research aimed to evaluate the effect of nineteen pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa in bioassays carried under laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase). The pesticides were directly spra [...] yed on eggs and pupae trough a Potter tower using the maximum recommended dosage for peach orchards. It was evaluated eggs and pupae viability, in addition to fecundity and fertility of adults emerged from treated pupae. The pesticides were classified to eggs according to reduction in eggs hatch, and to pupae according to the total effect into IOBC toxicity categories. Most of pesticides evaluated (8 insecticides, 8 fungicides and 2 herbicides) were harmless (category 1) to eggs and pupae, with a reduction in eggs hatch and total effect to pupae lower than 30%, except for the insecticide mineral oil, which reduced eggs hatch in 69.55% and caused a total effect of 36.22% in pupae, being therefore classified as slightly harmful (category 2) to eggs and pupae of C. externa

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Paulo Ricardo Baier, Siqueira; Ítalo Lucas de, Moraes; Cleiton Jair, Gauer.



Seletividade de inseticidas, utilizados no controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) em pêssego, a Vespidae predadores / Seletivity of insecticides used for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach, to predatory Vespidae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudo-se em laboratório a seletividade dos inseticidas carbaril, deltametrina, fenitrotiom, fentiom, malatiom, nalede, paratiom metílico e triclorfom aos predadores Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) e Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) [...] em concentrações que correspondem a 50% (subdose) e 100% (dose) da recomendação para o controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) na cultura do pêssego. Nas doses recomendadas, para controle de G. molesta, os inseticidas fenitrotiom, fentiom, paratiom metílico, nalede e triclorfom não apresentaram seletividade às três espécies de Vespidae, causando 100% de mortalidade a estas, com exceção do triclorfom que matou 96,9% de P. sylveirae. Carbaril e malatiom foram seletivos em favor de P. versicolor versicolor (18,6 e 6,7% de mortalidade, respectivamente), e deltametrina em favor de P. versicolor versicolor (3,7% de mortalidade) e P. exigua (11,9% de mortalidade). P. sylveirae foi mais suscetível a deltametrina que P. exigua e P. versicolor versicolor. Já P. versicolor versicolor foi mais tolerante a malatiom e carbaril que P. sylveirae e P. exigua. Deltametrina, malatiom e nalede causaram menor mortalidade em P. sylveirae quando aplicados em subdose, sendo que o mesmo ocorreu com carbaril e malatiom para P. exigua. Abstract in english The selectivity of the insecticides carbaryl, deltamethrin, fenitrothion, fenthion, malathion, naled, methyl parathion and trichlorfon to the predators Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) and Protopolybia exigua (Saussure) was studied in laboratory using 50 [...] and 100% of the recommended dose for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach orchards. The insecticides fenitrothion, fenthion, methyl parathion, naled, and trichlorfon showed no selectivity in favour of the wasps at the full recommended dose, all of them causing 100% mortality among the predators except for trichlorfon which caused 96.9% mortality to P. sylveirae. Carbaryl and malathion were selective in favour of P. versicolor versicolor (18.6 and 6.7% mortality, respectively), and deltamethrin was selective in favour of P. versicolor versicolor (3.6% mortality) and P. exigua (11.8% mortality). P. sylveirae was more susceptible to deltamethrin than P. exigua and P. versicolor versicolor. P. versicolor versicolor was more tolerant to malathion and carbaryl than P. sylveirae and P. exigua. Deltamethrin, malathion and naled were less lethal to P. sylveirae when applied at the lower dose; while the same happened to carbaryl and malathion for P. exigua.

Alfredo H.R., Gonring; Marcelo, Picanço; Marcelo F. de, Moura; Leandro, Bacci; Cláudio H., Bruckner.



Ácaros predadores (Acari) associados à cultura do morango (Fragaria sp., Rosaceae) e plantas próximas no Estado do Rio Grande do Sul / Predatory mites (Acari) associated with strawberry and neighboring plants in the State of Rio Grande do Sul  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste estudo foi determinar as espécies de ácaros predadores associados à cultura do morango e em plantas associadas, no estado do Rio Grande do Sul. Este estudo foi conduzido nos municípios de Bom Princípio, Capitão e Lajeado em plantações de morango da variedade Oso Grande em túnel baix [...] o. As avaliações foram feitas mensalmente entre agosto de 2002 e março de 2004. Nas plantas de morango, as amostras foram constituídas de três folhas coletadas em cada uma das 15 plantas escolhidas ao acaso, totalizando 45 folhas/campo. Nas plantas associadas, o esforço de amostragem foi de uma hora para cada planta avaliada. Ácaros das famílias Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae e Tydeidae foram observados associados com o ácaro rajado, Tetranychus urticae Koch, 1836, praga importante na região onde este estudo foi conduzido. Vinte espécies foram identificadas, 14 das quais pertencem à família Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) e Neoseiulus californicus (McGregor, 1954) foram as espécies mais comuns. Nas plantas asssociadas, a maior diversidade foi observada em Richardia sp. (seis espécies), Agerantum conyzoides L.(quatro espécies) e Sonchus oleraceus L., Bidens pilosa L.e Rumex sp. (três espécies). Uma chave docotômica é apresentada para a identificação das espécies. Abstract in english The aim of this study was to determine the species predatory mites on strawberry crop and associated plants in the State of Rio Grande do Sul. It was conducted in Bom Princípio, Capitão and Lajeado counties, in crops of strawberry Oso Grande variety in low tunnels. The evaluations were done monthly [...] between August 2002 and March 2004. In the plants of strawberry, the samples were constituted of three leaves collected in each of 15 plants taken randomly, totaling 45 leaves/field. In the associated plants, the sampling effort was of one hour for each plant evaluated. Mites of the families Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae and Tydeidae were observed associated with the two-spotted spider mite, Tetranychus urticae Koch, 1836, important pest of this crop in the region where the study was conducted. Twenty species were identified, 14 of which belong to the family Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) and Neoseiulus californicus (McGregor, 1954) were the most common species. On associated plants, the highest diversity of predatory mites was found on Richardia sp. (six mite species), Agerantum conyzoides L. (four mite species) and Sonchus oleraceus L., Bidens pilosa L. and Rumex sp. (three mite species). A dichotomous key is presented for the separation of the species collected.

Noeli Juarez, Ferla; Marla Maria, Marchetti; Dinarte, Gonçalves.


Seletividade de extratos de nim (Azadirachta indica A. Juss.) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) / Selectivity of neem extracts (Azadirachta indica A. Juss.) to the predatory Mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade relativa dos extratos de folha, semente e óleo de torta de Azadirachta indica A. Juss (nim) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) foi estudada em laboratório. Foram determinadas concentrações discriminatórias (CLs99) dos extratos de folha, semente [...] e óleo de torta de nim para fêmeas adultas de Oligonychus ilicis (McGregor) (Acari: Tetranychidae), através de bioensaios de concentração-mortalidade. Arenas com 3,5 cm de diâmetro, confeccionadas com folhas de cafeeiro flutuando em água, foram impregnadas com resíduo seco dos extratos e usadas para se estimar a seletividade ao ácaro I. zuluagai. As concentrações dos extratos de nim que mataram 99% de O. ilicis, após 72h de exposição foram: 277,4; 520,9 e 10,9 mg/ml, para folha, semente e óleo de torta, respectivamente. A concentração discriminatória do extrato de óleo de torta de nim para fêmeas adultas de O. ilicis foi altamente tóxica ao ácaro I. zuluagai, as dos extratos de folha e de semente foram seletivos. Abstract in english The relative toxicity of the leaf, seed and oil neem cake extracts of Azadirachta indica A. Juss (neem) to the predatory mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) was evaluated. To verify the relative toxicity of these extracts on the predatory mite, discriminating concentrati [...] ons of the extracts were determined for adult females of the Oligonychus ilicis (McGregor) (Acari: Tetranychidae), through the method of concentration-mortality. Coffee leaf disks with 3.5 cm of the diameter were put floating on water and impregnated with dry residue of the extracts. Concentrations of neem extracts which caused mortality (99%) of O. ilicis, after 72h of exposition, were 277.4; 520.9 e 10.9 mg/ml for leaf, seed and oil neem cake, respectively. The discriminating concentration of extract of oil neem cake for O. ilicis females was highly toxic to I. zuluagai; while extract of leaf and seed were selective to the predatory mite.

Sheila A., Mourão; Júlio C.T., Silva; Raul N.C., Guedes; Madelaine, Venzon; Gulab N., Jham; Claudinei L., Oliveira; José C., Zanuncio.



Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.



Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.




Aranhas e ácaros predadores em copas de tangerineiras Montenegrina, mantidas sob manejo orgânico, em Montenegro, RS / Spiders and predatory mites in the canopies of organically managed Montenegrina tangerine trees, in Montenegro County, RS  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O estudo objetivou o levantamento da fauna de aranhas e ácaros com hábito predador, em copas de tangerineiras (Citrus deliciosa var. Montenegrina) em pomar orgânico, situado em Montenegro, RS. Durante um ano, quinzenalmente 24 plantas eram sorteadas e avaliadas em duas regiões da copa, utilizando-se [...] um pano-de-batida (1 m²). Capturou-se o total de 3.129 indivíduos, sendo 2.559 aranhas e 570 ácaros. Em Araneae foram reconhecidas 53 espécies adultas distribuídas em oito famílias, dentre estas, as mais abundantes foram Sphecozone sp. (Linyphiidae) (21,8%) e Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9,9%). No outono observou-se a maior abundância de jovens e adultos (29,2%) e, na primavera, a maior riqueza de espécies (40). Na primavera também se registraram os maiores valores para os índices de Margalef e Shannon-Wiener, este último, porém, não diferiu significativamente dos das demais estações. Os valores de Simpson, em todas as estações foram semelhantes, indicando o mesmo grau de dominância das espécies. Em Acari registraram-se oito espécies, distribuídas em três famílias, as mais abundantes foram Leptus sp.1 (Erythraeidae) (59,4%) e Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). O outono foi a estação mais rica em número de espécies (oito). No inverno observou-se a maior abundância de indivíduos (47%) e, no verão, a menor (0,88%). Entre os ácaros, Phytoseiidae apresentou a maior riqueza. Entre as aranhas, Anyphaenidae foi a que apresentou a maior abundância e Theridiidae, a maior riqueza de espécies, seguindo assim o padrão já observado para o grupo. Abstract in english A survey was conducted to study the spider and predatory mite fauna occurring in the canopies of tangerine trees (Citrus deliciosa Tenore, cultivar Montenegrina) of an organically managed orchard, at Montenegro County, RS. During a year, fortnightly, 24 randomly trees were selected and sampled in tw [...] o canopies areas, by using a sheet of white cloth (1 m²). A total of 3,129 arachnids were collected, being 2,559 spiders and 570 mites. Based on the adults, 53 species of Araneae were recognized, belonging to eight families. Among those, the most abundant were Sphecozone sp. (Linyphiidae) (21.8%) and Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9.9%). Autumn exhibited the greatest abundance of young and adults of Araneae (29.2%) and spring was the season richest in species (40). Margalef and Shannon-Wiener diversity indexes also showed the highest values in spring. The latter index did not show differences among seasons. Simpson complementary index was equal among seasons, reflecting the same degree of species dominance. In Acari, eight species were identified in three families. The most abundant species were the mites Leptus sp.1 (Erythraeidae) (59.4%) and Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). Autumn was the season richest in mite species (eight). The highest abundance (47%) was observed on winter and the lowest (0.88%) on summer. Among mites, Phytoseiidae showed the highest richness. Among the spiders, Anyphaenidae was the most abundant and Theridiidae had the highest species richness, following the patterns observed for the group.

Rosana M. de, Morais; Ricardo, Ott; Ana P., Ott; Luiza R., Redaelli.


Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.


Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.



Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae) em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas / Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae) in residual toxicity persistence tests  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor), são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando expost [...] o a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA), folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus. Abstract in english Phytoseiid mites, mainly Neoseiulus californicus (McGregor), are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the ins [...] ecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA), leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p

Marcelo Gustavo, Ruiz; Gilberto José de, Moraes.



Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

Marcelo Gustavo Ruiz



Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.



Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.




Acão de Inseticidas Organofosforados Utilizados no Controle de Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) Sobre o Ácaro Predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Action of Organophosphate Insecticides Used to Control Leucoptera coffeella (Guérin-Mèneville) (Lepidotera: Lyonetiidae) on the Predator Mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O controle químico apresenta vantagens como economicidade e rapidez de ação, e tem sido preferencialmente usado no controle de pragas pelos agricultores. Em contrapartida, entre as desvantagens destaca-se o largo espectro de ação dos compostos, que atingem espécies não-alvos, como inimigos naturais, [...] além de contaminarem o meio ambiente. O presente trabalho avaliou a ação dos inseticidas clorpirifós, dissulfotom, etiom e paratiom-metílico, normalmente usados para controlar o bicho-mineiro-do-cafeeiro Leucoptera coffeella (Guérin-Mèneville), sobre o ácaro predador Iphiseiodes zuluagai Denmark & Muma, agente de controle dos ácaros fitófagos Oligonychus ilicis (McGregor) e Brevipalpus phoenicis (Geijskes) em agroecossistema cafeeiro. Para verificar o efeito seletivo dos compostos sobre o ácaro predador, concentrações discriminatórias (CLs99) dos quatros inseticidas foram determinadas para o 3º instar larval de L. coffeella, através do método de bioensaios de concentração-mortalidade em papel-filtro, impregnado com resíduo seco de inseticidas. O clorpirifós causou 100% de mortalidade dos ácaros testados; o etiom e o paratiom-metílico causaram 34% e 19% de mortalidade, respectivamente. Dissulfotom foi o mais seletivo em favor do predador, não mostrando ação letal. O efeito diferenciado dos inseticidas foi desta forma verificado, e tal informação possibilita a utilização dos inseticidas seletivos no agroecossistema cafeeiro, preservando populações de I. zuluagai e favorecendo o controle biológico exercido pelo ácaro predador. Abstract in english Chemical control has been preferentially used to suppress pests by farmers mainly due to low price of the products and immediate action on target organisms. However, wide action range of the compounds, undesirable effects on non target organisms and the contamination of the environment are among the [...] disadvantages of this method of control. This study evaluated the action of the insecticides chlorpyrifos, disulfoton, ethion and methyl-parathion, normally used to control the coffee leaf-miner, Leucoptera coffeella (Guérin-Mèneville), on the predaceous mite Iphiseiodes zuluagai Denmark & Muma, a control agent of the phytophagous mites Oligonychus ilicis (McGregor) and Brevipalpus phoenicis (Geijskes) in coffee plantation. Discriminatory concentrations (LC99), established on the 3rd instar of L. coffeella, by means of the method of dry insecticide residues impregnated in filter paper, were used to verify the selectivity of the insecticides on the predaceous mite. The insecticide chlorpyrifos caused 100% of mortality in I. zuluagai. Ethion and methyl-parathion showed mortality of 34% and 19%, respectively. Disulfoton presented the highest selectivity for the mite, with no lethal action on the predator. The different effects found on the insecticides' action show that it is possible to use the selective insecticides in coffee plantation to preserve populations of I. zuluagai, thus favouring the biological control on phytophagous mite.



Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.



Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.


Dinâmica populacional de ácaros (Acari) em erva-mate (Ilex paraguariensis St. Hil.: Aquifoliaceae) / Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi realizado em Dois Vizinhos, PR, com o objetivo de estudar a dinâmica populacional de ácaros fitófagos e seus predadores em plantas de erva-mate (Ilex paraguariensis St. Hil. Aquifoliaceae). Folhas de diferentes partes da planta foram coletadas de agosto de 2001 a julho de 2002, e o [...] s ácaros presentes foram contados sob microscópio estereoscópico. Foram encontradas associadas às plantas de erva-mate duas espécies de ácaros fitófagos Dichopelmus notus Keifer, e Oligonychus yothersi (McGregor), e três espécies de predadores identificados como sendo Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp. O ácaro D. notus ocorreu em maior número na face inferior de folhas, em folhas maduras e em folhas dos estratos inferior e médio. O. yothersi predominou em folhas maduras. A concentração de E. concordis e I. zuluagai sempre foi maior na face inferior de folhas, em folhas maduras, em folhas dos estratos inferior e médio e na região interna da copa. Os ácaros D. notus, O. yothersi, E. concordis e I. zuluagai tiveram picos populacionais em período de temperatura amena e baixa precipitação pluviométrica. A maior densidade populacional de Agistemus sp. ocorreu na face inferior das folhas e seu pico populacional ocorreu em período de alta temperatura e precipitação pluviométrica elevada. Abstract in english The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samp [...] les from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain.

Alfredo de, Gouvea; Luiz C., Boaretto; Carla F., Zanella; Luis F.A., Alves.


Biología y comportamiento de Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) como predador de Panonychus citri (McGregor) (Acari: Tetranychidae) / Biology and behavior of Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) as a predator of Panonychus citri (McGregor) (Acari: Tetranychidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Panonychus citri (McGregor) es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencia [...] l de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR). El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día. Abstract in english Panonychus citri (McGregor) is an important citrus pest in the central coast of Peru. Amblyseius chungas Denmark & Muma was the most frequent and abundant predatory mite during some surveys for natural enemies against P. citri in that region. We studied the duration of P. citri by immature stages of [...] A. chungas and analyzed its predatory behavior when female adults of A. chungas were fed with P. citri nymphs and adults. The experiments were carried out in the laboratory (20-25ºC and 70-80 % RH). Development time from egg to adult was 6.60 ± 0.57 days in females and 6.46 ± 0.44 days in males. Female adults of A. chungas fed with different densities of adults and/or nymphs of P. citri showed a functional response type II according with the classification proposed by Holling. Oviposition of A. chungas ranged from 1 to 3 eggs/day.

Alberto Daniel, Guanilo; Norberta, Martínez.


Primeiro registro de Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) e sua associação com insetos predadores, parasitóides e formigas em couve (Cruciferae) no Brasil / First record of Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) and its association with predator insects, parasitoids and ants in kale (Cruciferae) in Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este estudo descreve a fauna de insetos predadores, parasitóides e formigas associada a pulgões em couve (Brassica oleracea L. var. acephala D.C.), cultivada em sistema orgânico. O pulgão foi identificado como Lipaphis pseudobrassicae Davis, sendo este o primeiro registro da espécie atacando couve n [...] o Brasil. Parasitismo primário por Diaeretiella sp. e Aphidius sp. e hiperparasitismo por Aphydencyrtus sp., Alloxysta sp., Pachyneuron sp. e Syrphophagus sp. foram observados. Vinte espécies de Coccinellidae foram coletadas, sendo que oito delas foram observadas, tanto na fase adulta como larval, atacando o pulgão: Hyperaspis (Hyperaspis) festiva Mulsant, que foi a mais abundante (72,5% do total de insetos predadores obtidos), Cycloneda sanguinea (L.), Eriopis connexa Germar, Coleomegilla maculata DeGeer, Hippodamia convergens Guérin, Heterodiomus sp., Scymnus (Pullus) sp.1 e Scymnus (Pullus) sp.2. Larvas de Syrphidae afidófagas coletadas nas folhas de couve infestadas por L. pseudobrassicae pertencem às espécies Allograpta exotica (Wiedemann) e Ocyptamus gastrostactus (Wiedemann). Larvas e pupas de Syrphidae foram parasitadas por Pachyneuron sp., Syrphophagus sp. e Diplazon laetatorius Fabricius. Larvas de Chrysopodes sp. foram observadas alimentando-se de L. pseudobrassicae. Espécies de formigas associadas às colônias desse pulgão foram Ectatomma quadridens Fabricius e Pheidole sp. Abstract in english This study describes the fauna of predator insects, parasitoids and ants associated with aphids on kale (Brassica oleracea L. var. acephala D.C.) in organic system. The aphid was identified as Lipaphis pseudobrassicae Davis, and this is the first record of the species attacking kale in Brazil. Prima [...] ry parasitism by Diaeretiella sp. and Aphidius sp. and hyperparasitism by Aphydencyrtus sp., Alloxysta sp., Pachyneuron sp. and Syrphophagus sp. were observed. Twenty species of Coccinellidae were collected, and eight of them were observed in adult and larval stages attacking the aphid: Hyperaspis (Hyperaspis) festiva Mulsant, which was the most abundant (72.5% of all predator insects obtained), Cycloneda sanguinea (L.), Eriopis connexa Germar, Coleomegilla maculata DeGeer, Hippodamia convergens Guérin, Heterodiomus sp., Scymnus (Pullus) sp.1 and Scymnus (Pullus) sp.2. Aphidophagous Syrphidae larvae collected on leaves of kale infested by L. pseudobrassicae belong to the species Allograpta exotica (Wiedemann) and Ocyptamus gastrostactus (Wiedemann). Larvae and pupae of Syrphidae were parasitized by Pachyneuron sp., Syrphophagus sp. and Diplazon laetatorius Fabricius. Larvae of Chrysopodes sp. were observed feeding on L. pseudobrassicae. Species of ants associated with the colony of this aphid were Ectatomma quadridens Fabricius and Pheidole sp.

André L.S., Resende; Edmilson E., Silva; Venicio B., Silva; Raul L.D., Ribeiro; José G.M., Guerra; Elen L., Aguiar-Menezes.



Biología y comportamiento de Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) como predador de Panonychus citri (McGregor) (Acari: Tetranychidae) / Biology and behavior of Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) as a predator of Panonychus citri (McGregor) (Acari: Tetranychidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Panonychus citri (McGregor) es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencia [...] l de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR). El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día. Abstract in english Panonychus citri (McGregor) is an important citrus pest in the central coast of Peru. Amblyseius chungas Denmark & Muma was the most frequent and abundant predatory mite during some surveys for natural enemies against P. citri in that region. We studied the duration of P. citri by immature stages of [...] A. chungas and analyzed its predatory behavior when female adults of A. chungas were fed with P. citri nymphs and adults. The experiments were carried out in the laboratory (20-25ºC and 70-80 % RH). Development time from egg to adult was 6.60 ± 0.57 days in females and 6.46 ± 0.44 days in males. Female adults of A. chungas fed with different densities of adults and/or nymphs of P. citri showed a functional response type II according with the classification proposed by Holling. Oviposition of A. chungas ranged from 1 to 3 eggs/day.

Alberto Daniel, Guanilo; Norberta, Martínez.



Effect of neem seed oil aqueous solutions on survival and development of the predator Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) / Efeito de soluções aquosas de óleo de sementes de nim, Azadirachta indica, na sobrevivência e desenvolvimento do predador Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os efeitos de soluções aquosas do óleo de sementes de nim sobre o predador Cycloneda sanguinea (L.), nos estágios de ovo, larva e adulto, foram avaliados em laboratório. Em um primeiro experimento, ovos e larvas de 2º ínstar foram pulverizados com as soluções de nim nas concentrações de 0; 0, 5 e 2, [...] 25 ml/l de água apresentaram mortalidade significativa (P Abstract in english The effects of the neem seed oil aqueous solutions on survival and performance of egg, larva and adult stage of the Coccinelid predator Cycloneda sanguinea (L.) were evaluated under laboratory conditions. In a first trial, eggs and 2nd-instar larvae were sprayed with the neem solutions at 0; 0.5 and [...] 2.25 ml/l and kept at 25 ± 1ºC, 70% RH and 14h photoperiod. Egg viability and duration and larvae and pupae survival were evaluated as well as the predatory capacity of the larvae, adult longevity and reproduction. Egg spraying did not affect egg hatch or larvae survival and development. When the larvae were sprayed, significant mortality was observed only at the higher concentration (P

Flávia A.C. da, Silva; Sueli S., Martinez.




Directory of Open Access Journals (Sweden)

Full Text Available The predatory capacity of three isolates of the nematodes predacious fungi Duddingtonia flagrans (AC001, Monacrosporium thaumasium and Arthrobotrys robusta on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. The isolates AC001, NF34 and I31 had presented significant reduction (p<0.01 de 97.5%, 72.5% e 85% respectively in the average of infective larvae of ciathostomes recovered of the medium WA2% in the end of five days. The results of this assay evidence that these isolates could be used in the biological control of ciathostomes of equines.

KEY WORDS:  Arthrobotrys robusta, Cyathostominae, equine, Duddingtonia flagrans, Monacrosporium thaumasium, Nematophagous fungi.

A capacidade predatória de três isolados de fungos predadores de nematoides Duddingtonia flagrans (AC001, Monacrosporium thaumasium (NF34 e Arthrobotrys robusta (I31 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Os isolados AC001, NF34 e I31 apresentaram redução significativa (p<0,01 de 97,5%, 72,5% e 85%, respectivamente, na média de larvas infectantes de ciatostomíneos recuperadas do meio AA2% ao final de sete dias. Os resultados deste ensaio evidenciam que esses isolados poderão ser utilizados no controle biológico de ciatostomíneos de equinos.
PALAVRAS-CHAVES: Arthrobotrys robusta, ciatostomíneos, equinos, Duddingtonia flagrans, fungos nematófagos, Monacrosporium thaumasium.

André Ricardo Silva



Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil Diversity and population fluctuation of mites (Acari in blackberry (Rubus fruticosus, Rosaceae in the state of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae, raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9% and Tetranychidae (13.9%, composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2.1% and Phytoseiidae (0.4% were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae the most common predaceous species.

Márla Maria Marchetti



Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

Márla Maria, Marchetti; Noeli Juarez, Ferla.



Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

Márla Maria, Marchetti; Noeli Juarez, Ferla.


Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann Schlesener



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) / Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiu [...] lus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.). A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos. Abstract in english The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L) and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L) over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus m [...] acropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.). The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann, Schlesener; Adriane Fonseca, Duarte; Milton Fernando Cabezas, Guerrero; Uemerson Silva da, Cunha; Dori Edson, Nava.



Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) / Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiu [...] lus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.). A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos. Abstract in english The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L) and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L) over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus m [...] acropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.). The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann, Schlesener; Adriane Fonseca, Duarte; Milton Fernando Cabezas, Guerrero; Uemerson Silva da, Cunha; Dori Edson, Nava.


Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez Ferla



Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez, Ferla; Gilberto José de, Moraes.


Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae occurrence in Rio de Janeiro coast, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia.The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia.

Lydia M. S. Oliveira



Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) na costa do Rio de Janeiro, Brasil / Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) occurrence in Rio de Janeiro coast, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia). [...] Abstract in english The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia). [...

Lydia M. S., Oliveira; Lídia M. Y., Oshiro.


Predators impairing the natural biological control of parasitoids / Predadores prejudicando parasitóides no controle biológico natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Foi analisado um caso bem conhecido de insucesso técnico no controle biológico natural: a coexistência enigmática do bicho-mineiro-do-cafeeiro, Leucoptera coffeellum (Guérin-Mèneville), e seus inimigos naturais. Apesar de ser uma presa adequada a oito espécies de parasitóides e três espécies de vesp [...] as predadoras, todas ocorrendo simultaneamente, o bicho-mineiro-do-cafeeiro apresenta, muito frequentemente, populações acima do nível de dano econômico para o cafezal. Foi demonstrado que vespas predadoras e parasitóides interagem negativamente, possivelmente porque vespas matam as lagartas de bicho-mineiro-do-cafeeiro parasitadas. Fazendo assim, vespas predadoras matam parasitóides indiretamente, prejudicando a eficiência do controle biológico natural. Conclui-se que programas de controle biológico deveriam estar baseados em conhecimentos de interações tróficas, ao invés de simplesmente se basearem em estratégias que envolvam a introdução de inimigos naturais exóticos. Abstract in english A well known case of ineffective natural biological control: the puzzling coexistence of the coffee leaf miner, Leucoptera coffeellum (Guérin-Mèneville), and its natural enemies was analyzed. Despite being a suitable prey to eight parasitoid species and three wasp species, all occurring simultaneous [...] ly, the coffee leaf miner too often presents populations far above the damaging level for the coffee plantation. It is demonstrated that predatory wasps and parasitoids interact negatively, possibly because predatory wasps kill parasitized miner's larvae. In doing so, predatory wasps indirectly kill parasitoids, thereby impairing the efficacy of the natural biological control. It is warned that biological control programs should be based on knowledge of food web interactions, rather than simply on strategies involving introduction of exotic natural enemies.

Ronaldo, Reis Jr; Og De, Souza; Evaldo F., Vilela.



Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

Héctor Guerra, Hernández.


Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

Héctor Guerra, Hernández.



Predators impairing the natural biological control of parasitoids / Predadores prejudicando parasitóides no controle biológico natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Foi analisado um caso bem conhecido de insucesso técnico no controle biológico natural: a coexistência enigmática do bicho-mineiro-do-cafeeiro, Leucoptera coffeellum (Guérin-Mèneville), e seus inimigos naturais. Apesar de ser uma presa adequada a oito espécies de parasitóides e três espécies de vesp [...] as predadoras, todas ocorrendo simultaneamente, o bicho-mineiro-do-cafeeiro apresenta, muito frequentemente, populações acima do nível de dano econômico para o cafezal. Foi demonstrado que vespas predadoras e parasitóides interagem negativamente, possivelmente porque vespas matam as lagartas de bicho-mineiro-do-cafeeiro parasitadas. Fazendo assim, vespas predadoras matam parasitóides indiretamente, prejudicando a eficiência do controle biológico natural. Conclui-se que programas de controle biológico deveriam estar baseados em conhecimentos de interações tróficas, ao invés de simplesmente se basearem em estratégias que envolvam a introdução de inimigos naturais exóticos. Abstract in english A well known case of ineffective natural biological control: the puzzling coexistence of the coffee leaf miner, Leucoptera coffeellum (Guérin-Mèneville), and its natural enemies was analyzed. Despite being a suitable prey to eight parasitoid species and three wasp species, all occurring simultaneous [...] ly, the coffee leaf miner too often presents populations far above the damaging level for the coffee plantation. It is demonstrated that predatory wasps and parasitoids interact negatively, possibly because predatory wasps kill parasitized miner's larvae. In doing so, predatory wasps indirectly kill parasitoids, thereby impairing the efficacy of the natural biological control. It is warned that biological control programs should be based on knowledge of food web interactions, rather than simply on strategies involving introduction of exotic natural enemies.

Ronaldo, Reis Jr; Og De, Souza; Evaldo F., Vilela.


Diversidade de ácaros (Arachnida: Acari) em Coffea arabica L. cv. Mundo Novo, nos municípios de Jeriquara e Garça, Estado de São Paulo / Diversity of mites (Arachnida: Acari) on Coffea arabica L. cv. 'Mundo Novo' in Jeriquara and Garça counties, state of São Paulo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O presente estudo teve como objetivo caracterizar a diversidade de ácaros em cafeeiros da cultivar Mundo Novo em duas importantes regiões produtoras (Jeriquara e Garça) do Estado de São Paulo. Para tanto, foram coletadas amostras quinzenais de folhas, ramos e frutos, entre abril de 2001 e junho de 2 [...] 003, do terço médio de 10 plantas tomadas ao acaso em cada campo. De cada planta foram tomadas 12 folhas (cada uma do terceiro ou quarto par a partir da extremidade distal de um ramo), 12 ramos (25 cm apicais) e 100 frutos. Foram coletados no total 13.052 ácaros nos dois locais estudados, sendo 7.155 em Jeriquara e 5.897 em Garça. De um total de 108 espécies de ácaros coletados de plantas de café neste estudo, 45 espécies foram observadas em ambos os locais estudados, que apresentaram similaridade de 56%. O número de espécies encontradas exclusivamente em Jeriquara (47) foi aproximadamente três vezes superior ao número de espécies observadas somente em Garça (16). Em Jeriquara, a diversidade foi maior tanto na superfície das folhas, quanto nas domácias, ramos e frutos. Nos dois locais estudados, Brevipalpus phoenicis (Geijskes, 1939) e Oligonychus ilicis (McGregor 1919) foram as espécies de fitófagos mais abundantes e freqüentes. Os estigmeídeos e fitoseídeos foram os ácaros predadores mais abundantes e freqüentes em ambos locais. As espécies mais abundantes e freqüentes de predadores foram Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970 e Euseius concordis (Chant 1959) em Jeriquara; e Z. malvinae, E. citrifolius e E. concordis em Garça. Abstract in english The objective of this study was to characterize the diversity of mites on coffee plants of the Mundo Novo cultivar in two important coffee producing areas (Jeriquara and Garça) in the state of São Paulo. Samples of leaves, branches and fruits were fortnightly collected, from April 2001 to June 2003, [...] from the middle third of 10 plants randomly taken from each field. Twelve leaves (each leaf from the third or forth pair from the distal part of each branch), 12 branches (apical 25 cm) and 100 fruits. A total of 13,052 specimens were collected in the two studied places, 7,155 in Jeriquara and 5,897 in Garça. From a total of 108 mite species collected from coffee plants in this study, forty five species were collected in both studied fields, which presented 56% of similarity. The number of species found exclusively in Jeriquara (47) was approximately three times higher than the number of species observed only in Garça (16). For Jeriquara, the diversity of mites on surface of leaves, as well as in domatia, and on branches and fruits was higher than for Garça. In both studied areas, Brevipalpus phoenicis (Geijskes, 1939) and Oligonychus ilicis (McGregor 1919) were the most abundant and frequent phytophagous mite species. Stigmaeids and phytoseiids were the most abundant and frequent predaceous mites in both localities. The most abundant and frequent predaceous species were Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970, and Euseius concordis (Chant 1959) in Jeriquara; and Z. malvinae, E. citrifolius and E. concordis in Garça.

Jeferson L. de C., Mineiro; Mário E., Sato; Adalton, Raga; Valter, Arthur; Gilberto J. de, Moraes; Fernando de O., Sarreta; Alex, Carrijo.


Evaluación del uso de cipermetrina para el control de insectos predadores de alevines de peces en cavas de producción acuícola  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Los emprendimientos acuícolas semi-intensivos de cría de peces ornamentales, basan su producción en la siembra de alevines en cavas fertilizadas para el desarrollo de grandes cantidades de zooplancton, alimento de los peces. Los piretroides como la cipermetrina, constituyen una opción económica para combatir distintos insectos que depredan a los alevines. Se utilizaron cuatro cavas las cuales fueron fertilizadas 10 días antes del tratamiento. En ellas, se dispusieron jaulas con alevines...

Plaul, S. E.; Garci?a Romero, N.; Barbeito, Claudio Gustavo



Ocorrência e flutuação populacional de ácaros associados a seringais vizinhos de fragmentos de cerrado / Occurrence and fluctuation of mite populations associated with rubber tree crop neighbor of fragments of cerrado  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O conhecimento básico da ocorrência sazonal dos ácaros pode fornecer dados para elaboração de programas de manejo ecológico a serem implantados com sucesso no futuro. O objetivo deste estudo foi determinar a riqueza de espécies e a sazonalidade da acarofauna presente em dois campos de seringueira vi [...] zinhos de áreas nativas, no município de Itiquira, MT. Ao longo de um ano, foram realizadas 25 coletas quantitativas em seringueiras vizinhas a dois fragmentos de Cerrado (Cerradão e Mata Ripária). Foram registrados 199.380 ácaros, de 48 espécies, pertencentes a 15 famílias. Dessas, 13 espécies são fitófagas, 18 predadoras e 17 micófagas ou de hábito alimentar desconhecido. Três espécies fitófagas representaram mais de 97% dos ácaros coletados: Phyllocoptruta seringueirae Feres (80,8%), Tenuipalpus heveae Baker (12,7%) e Calacarus heveae Feres (3,6%). Entre os predadores, os mais abundantes foram Agistemus sp., Scirula sp. e Euseius concordis (Chant). Vinte e oito espécies foram comuns aos dois cultivos. As famílias que tiveram o maior número de espécies coletadas na área vizinha ao Cerradão foram, Tydeidae (7), Tarsonemidae (6), Eriophyidae e Phytoseiidae (4) e, na área próxima à Mata Ripária, Tydeidae (9) e Phytoseidae (8). A presença de vegetação vizinha aos seringais deve ser a causa do grande número de espécies de ácaros classificadas como acidentais encontradas neste estudo. As maiores abundâncias e riquezas de espécies ocorreram no final do período chuvoso e início da estação seca. Abstract in english The basic knowledge of the seasonal occurrence of mites can supply data for elaboration of programs of ecological management to be implanted with success in the future. The objective of this study was to determine the species richness and the seasonality of mites present in two areas of rubber tree [...] crops neighboring to native areas in Itiquira, MT. Along one year, 25 quantitative samplings were accomplished in rubber tree crop neighboring to two fragments of Cerrado (Cerradão and Mata Ripária). There were registered 199,380 mites, of 48 species, belonging to 15 families. Of those, 13 species are phytophagous, 18 predators and 17 mycophagous or of unknown alimentary habit. Three phytophagous species represented more than 97% of the mites collected: Phyllocoptruta seringueirae Feres (80.8%), Tenuipalpus heveae Baker (12.7%) and Calacarus heveae Feres (3.6%). Among the predators, the most abundant species were Agistemus sp., Scirula sp. and Euseius concordis (Chant). Twenty-eight species were common to both crops. The families that had the largest number of species collected in the neighboring area to Cerradão were Tydeidae (7), Tarsonemidae (6), Eriophyidae and Phytoseiidae (4), and in the area close to Mata Ripária, Tydeidae (9) and Phytoseiidae (8). The presence of vegetation near the crop should explain the great number of species of mites classified as accidental found in this study. The largest abundances and species richness occurred in the end of the rainy season and beginning of the dry season.

Peterson R., Demite; Reinaldo J.F., Feres.


Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro Physiologic selectivity of inseticides to wasps predators of the coffee leafminer  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentrações que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae was studied, in laboratory, using 50% and 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.




Aegla platensis Schmitt, 1942 (Decapoda: Anomura um predador de imaturos de Simuliidae (Diptera: Culicomorpha Aegla platensis Schmitt, 1942 (Decapoda: Anomura a predator of Simuliidae imature stages (Diptera: Culicomorpha  

Directory of Open Access Journals (Sweden)

Full Text Available Observações de campo e de laboratório evidenciaram, pela primeira vez, a predação preferencial, de larvas e pupas de simulídeos pelo crustáceo. Aegla platensis Schmitt, 1942. Foram feitas observações de campo e coletas no arroio Carpintaria, Município de Dois Irmãos, Rio Grande do Sul, Brasil. É ressaltada a possibilidade de ser usado esse caranguejo em manejo integrado no controle de simulídeos.For the first time, preferential predation of larvae and pupae of Simuliidae by the crustacean, Aegla platensis Schmitt, 1942, was observed in the field and in the laboratory. Field observations and collections were done in the Carpintaria stream, Dois Irmãos, Country Rio Grande do Sul, Brazil. The possibility of using this freshwater crab in an integrated control of Simuliidae is discussed.

Sandra Tonetti Magni



Ácaros predadores em pomares de maçã no Rio Grande do Sul / Predaceous mites in apple orchads in Rio Grande do Sul  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english A survey of predaceous mites in apple (Prunus malus L.) orchards in central part of Rio Grande do Sul state (Serio and Capitão counties) was conducted from September 1993 to May 1994. The majority of the predators collected belonged to the Phytoseiidae family. The most common species were Neoseiulus [...] tunus (DeLeon), Euseius alatus DeLeon, and Euseius brazilli (El-Benhawy). In Capitão, Euseius spp. were the predominant phytoseiids from the beginning of December 1993 to mid March 1994. In Serio, Euseius spp. were more abundant than N. tunus only at the end of January. The number of phytoseiids increased from the end of December 1993 to mid February 1994. The highest levels of Stigmaeidae and Cunaxidae occurred from the end of February to mid May, after the reduction of phytoseiids.

Noeli J., Ferla; Gilberto J., Moraes.



Seletividade de agroquímicos ao ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Testes de efeito adverso de agroquímicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratório, utilizando o método residual de contato com pulverização em superfície de vidro. Foram testados 42 produtos químicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reprodução do ácaro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao ácaro (combinação da mortalidade e efeito na reprodução) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram inócuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidróxido de cobre, naled, oxicloreto de cobre, óxido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao ácaro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, óleo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.


Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.




Inducers of resistance in potato and its effects on defoliators and predatory insects Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Directory of Open Access Journals (Sweden)

Full Text Available The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised complete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM; and 4 - 1.15% diatomaceous earth (DE. Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM, y 4 - 1,15% tierra de diatomeas (DE. Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo.




Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.



In vitro evaluation of nematophagous fungi patogenicity against nematode of domestic animals/ Avaliação in vitro da patogenicidade de fungos predadores de nematóides parasitos de animais domésticos  

Directory of Open Access Journals (Sweden)

Full Text Available Biological control is a promising alternative for the control of pre-parasitic stages through the action of nematophagous fungi’s. The present study evaluated in vitro the patogenicity of both Arthrobotrys musiformis and A. conoides fungi on “infective larvae (or L3 state larvae” of Haemonchus contortus, L3 larvae of Ancylostoma spp. And larvated eggs of the nematode Ascaridia galli. Nine groups were formed: six treated groups (G1A and G2A: L3 of H. contortus; G1B and G2B: L3 of Ancylostoma spp.; G1C and G2C: larvated eggs of A. galli, being that G1 with A. musiformis and G2 with A. conoides and three untreated groups (G3A, G3B and G3C: larvae of H. contortus, Ancylostoma spp. And eggs of A. galli, respectively, without fungi. Each treatment had ten repetitions (ten Petri dishes with an average of 120 larvae of H. contortus and 200 larvae of Ancylostoma spp. and, approximately, 100 larvated A. galli eggs. The results showed A. musiformis plundered 66% and 94% of Ancylostoma spp. L3 larvae and H. contortus L3 larvae, respectively. While that A. conoides plundered 51,7% and 89,4% at the same larvae. The nematophagous fungi evaluated have not presented any predation type on A. galli larvated eggs. Afterwards, both are promising fungi as to their use for biological control of parasitic helminths of animal hosts.O controle biológico é uma alternativa promissora no controle dos estágios pré-parasitários de helmintos, por meio da ação de fungos nematófagos. Com este propósito, o presente estudo avaliou in vitro a patogenicidade dos fungos Arthrobotrys musiformis e A. conoides sobre larvas infectantes de Haemonchus contortus, Ancylostoma spp. e ovos larvados de Ascaridia galli. Foram utilizados nove grupos: seis tratamentos (G1A e G2A: L3 de H. contortus; G1B e G2B: L3 de Ancylostoma spp.; G1C e G2C: ovos larvados de A. galli, com A. musiformis (G1 e A. conoides (G2, respectivamente e três testemunhos (G3A, G3B e G3C: larvas de H. contortus, Ancylostoma spp. e ovos de A. galli, respectivamente, na ausência do fungo. Cada tratamento constou de dez repetições (placas de Petri, de 90mm de diâmetro, com média de 120 larvas de H. contortus, 200 larvas de Ancylostoma spp. e média de 100 ovos de A. galli. Os resultados demostraram que A. musiformis predou 66,33% e 94,44% das larvas infectantes de Ancylostoma spp. e H. contortus, respectivamente. Enquanto que A. conoides predou 51,76% e 89,39% das mesmas larvas. Os fungos nematófagos avaliados não apresentaram predação sobre ovos larvados de A. galli. Portanto, ambos os fungos mostraram-se promissores quanto a sua utilização no biocontrole desses helmintos parasitos de animais domésticos.

Alvimar José da Costa



Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.



Influência da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseídeos predadores associados / Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O.ilicis on [...] its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark & Muma, Euseius citrifolius Denmark & Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O.ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I.zuluagai and eggs and larvae by E.citrifolius was lower. For A.herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O.ilicis altogether, webbing reduced the predation potential of I.zuluagai and E. citrifolius, but not of A. herbicolus.

Renato A, Franco; Paulo R, Reis; Mauricio S, Zacarias; Daniel C, Oliveira.


Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 inócuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.



Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.


Stomach content analysis of potential predators of Simuliidae (Diptera: Nematocera) in two lowland forest streams, Central Amazonia, Brazil / Análise do conteúdo estomacal de possíveis predadores de Simuliidae (Diptera: Nematocera), em dois igarapés de terra firme na Amazônia Central, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O conteúdo estomacal de insetos (Plecoptera e Odonata), crustáceos e peixes foi analisado por meio de dissecção para se verificar a predação sobre imaturos de simulídeos e identificação dos outros itens alimentares. O trabalho foi realizado em dois igarapés da Reserva Florestal Adolpho Ducke (Sabiá- [...] I), Manaus - AM, pertencente ao Instituto Nacional de Pesquisas da Amazônia (INPA), com espécimes coletados mensalmente no período de abril de 1992 a maio de 1993 e nos meses de novembro de 1993 e junho de 1994. As coletas foram realizadas por meio de cestas-armadilhas (contendo folhas de jambeiro, Eugenia malaccensis L., Myrtaceae) e rapiché. Constatou-se a predação de imaturos de Simuliidae por um exemplar de peixe (Microcharacidium gnomus, Characidae), Plecoptera (Perlidae) e Odonata (Gomphidae, Agrionidae, Libellulidae, Dicteriadidae e Coenagrionidae). Outros itens alimentares observados nos organismos analisados foram Diptera (Chironomidae), Trichoptera (Hydropsychidae, Hydroptilidae), Coleoptera (Elmidae), Hymenoptera (Formicidae), Ephemeroptera (Baetidae, Leptophlebidae), outros insetos, ovos de insetos, Hydracarina, Crustacea, Nematoda, detritos e restos vegetais. Abstract in english [...

Yamile B., Alencar; Neusa, Hamada; Sandra, Magni-Darwich.


Miridae (Heteroptera fitófagos e predadores de Minas Gerais, Brasil, com ênfase em espécies com potencial econômico Phytophagous and predaceous Miridae (Heteroptera of Minas Gerais, Brazil, with emphasis on potential pest species  

Directory of Open Access Journals (Sweden)

Full Text Available A total of 296 species of Miridae belonging to 17 tribes were recorded from State of Minas Gerais, Brazil. New host plant records include 141 species of 43 orders and 69 families. Of this total, 98.5% of plants have some agricultural, pharmacological or ornamental importance; 29 orders and families of host plants have two or more mirid species.

Paulo S. F. Ferreira


Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river, at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were samp...

Marcos Callisto; Goulart, Michael D. C.; Pablo Moreno; Martins, Roge?rio P.



Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae  

Directory of Open Access Journals (Sweden)

Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

Rodolfo Vargas Castilhos



Evaluación del interés de productores ganaderos en el control selectivo y eficiente de predadores en la Patagonia Austral / Evaluation of the interest of southern Patagonian ranchers toward selective and efficient predator control methods  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: Spanish Abstract in spanish Elaboramos una encuesta con el fin de evaluar el interés de los productores ganaderos por incorporar prácticas selectivas de control basándonos en la caracterización del sistema de producción ganadera de Santa Cruz y su relación con la predación por el zorro colorado (Lycalopex culpaeus). Para los e [...] ncuestados (n = 90) la carga ovina actual está por debajo de la óptima, lo que es consistente con el hecho de que para la mayoría (73%) la ganadería sólo representa una parte de sus ingresos. El nivel de pérdida de corderos por predación de zorros colorados varía entre el 5% y el 50% de la producción anual y esta tasa se ha mantenido en los últimos años, a pesar de que el 56% de los encuestados percibe un aumento en la abundancia de zorros en sus campos en los últimos 10 años. Las actitudes negativas de los productores hacia el zorro colorado se reflejaron en el hecho de que su control continúa siendo una práctica habitual para el 73% de los encuestados incluso en establecimientos sin producción. El uso de veneno es o ha sido utilizado por la mayoría de los productores (74%) a pesar de su prohibición. Sin embargo, el 91% de los encuestados estaría dispuesto a reemplazar sus prácticas por métodos de control selectivos y eficientes. Este es un punto importante para incentivar el uso de métodos alternativos de control, como cebos tóxicos administrados selectivamente, lo que permitiría el abandono de las prácticas tradicionales tan nocivas para la conservación de la biodiversidad. Abstract in english Sheep ranchers (n = 90) were surveyed to evaluate their interest in the incorporation of predator selective control methods. We based our survey on the characterization of the sheep ranching system of Santa Cruz province and its relationship with culpeo fox (Lycalopex culpaeus) predation. For a larg [...] e percentage of producers (73%), the carrying capacity at present is under the optimal, which is consistent with the fact that sheep ranching represents only a part of their income. Lamb losses due to culpeo foxes predation vary between 5% and 50% of the annual lamb production, and these percentages did not vary during the last years in spite of the perceiving, by 53% of ranchers, of an increment in foxes abundance. Ranchers tend to exaggerate real losses of their lambs due to predation, although they recognize that there are other causes that could facilitate it. Nevertheless, fox control, including poisoning as a method, is still a current practice even in those ranches without sheep. The 90% of the sheep ranchers showed a good willingness to replace their current practices by selective and efficient control methods. This is an important point to encourage the use of selective control methods, like toxic baits delivered in a selective way, which would allow the abandonment of the traditional practices so dangerous to biodiversity conservation.

Arantxa, GARCÍA BREA; Sonia Cristina, ZAPATA; Diego Esteban, PROCOPIO; Rolando, MARTÍNEZ PECK; Alejandro, TRAVAINI.



Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae  

Directory of Open Access Journals (Sweden)

Full Text Available O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperaturas, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879. O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70±10% e fotofase de 12horas. Efeito deletério da temperatura em O. thyestes foi obtido a 16ºC, na qual apenas 40% das ninfas atingiram a fase adulta, e destes apenas 19% não apresentaram deformações morfológicas. O maior período de pré-oviposição foi observado a 19ºC (17,8 dias. Os maiores valores para a fecundidade média total foram registrados a 25 e 28ºC, com 109,2 e 128,2 ovos/fêmea, respectivamente, e o menor a 19ºC, com 22,8 ovos/fêmea. A 22 e 31ºC as fêmeas viveram mais que os machos, sendo que a 19ºC a longevidade foi maior, independente do sexo. As baixas temperaturas influenciaram a reprodução e longevidade de O. thyestes sugerindo que esta espécie poderá ter melhor performance reprodutiva em temperaturas mais elevadas, como aquelas de regiões tropicais e ou subtropicais.The development time and the fecundity of Orius species are strongly influenced by a wide range of factors, like environmental conditions and in particular temperature. This work aimed to evaluate the reproduction and adult longevity of Orius thyestes Herring, 1966 in different temperatures. Eggs of Anagasta kuehniella (Zeller, 1879 was provide as food supply. The experiment was carried out in climatic chambers at temperatures 16, 19, 22, 25, 28 and 31 ± 1°C, RH 70 ±10% and photophase 12h. A deleterious effect of the temperature on O. thyestes was found at 16°C, in which only 40% of the nymphs reached adulthood, of which only 19% presented normal morphological characteristics, without any alterations. The longest pre-oviposition period was found at 19°C (17.8 days. The highest fecundities were found at 25 and 28°C (109.2 and 128.2 eggs/female, respectively and the lowest at 19 °C (22.8 eggs/female. At 22 and 31°C, females lived longer than the males. The low temperatures affected the reproduction and longevity of O. thyestes, suggesting that this species would have better reproductive performance under high temperatures, as it occur in tropical and or subtropical regions.

Lívia Mendes Carvalho



Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados  

Energy Technology Data Exchange (ETDEWEB)

Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail:; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail:; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail:; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)



Efeito do intervalo de alimentação na reprodução e na longevidade do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of feeding intervals on reproduction and longevity of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O efeito do intervalo de alimentação em fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), foi estudado a 24 ± 3ºC, UR de 70 ± 10 % e fotofase de 12 horas. Os tratamentos consistiram no fornecimento de larvas de Musca domestica L. (Diptera: Muscidae), durante 24 horas a cada um, doi [...] s, quatro, oito ou 16 dias. Fêmeas de P. nigrispinus, alimentadas a cada um, dois e quatro dias, produziram maior número de ovos (225,4; 184,6 e 135,3 ovos, respectivamente), que aquelas alimentadas à cada oito ou 16 dias (8,3 e 0,0 ovos, respectivamente). A longevidade das fêmeas que receberam presa a cada quatro dias (43,0 dias), foi maior do que aquelas alimentadas a cada oito ou 16 dias (27,3 e 10,6 dias). Abstract in english The effect of feeding intervals on Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females was studied. Females were fed during 24 hours after either one, two, four, eight or 16 days with Musca domestica L. (Diptera: Muscidae) larvae at 24 ± 3º C, 70 ± 10% RH and photophase of 12 hours. Fem [...] ales of P. nigrispinus fed every one, two and four days produced higher number of eggs (225.4, 184.6 and 135.3 eggs, respectively) than those fed every eight or 16 days (8.3 and 0.0 eggs, respectively). Females fed every four days lived longer (43.0 days) than those fed every eight or 16 days (27.3 and 10.6 days).

Adrián J., Molina-Rugama; José C., Zanuncio; Dirceu, Pratissoli; Ivan, Cruz.



Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae), em três presas alternativas / Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae), in three alternative preys  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae) were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae) catterpilars; T2 - Musca domestica (Diptera, Muscidae) larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae) larva. Longevity [...] and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

José Cola, Zanuncio; Joaquim Efigênio M, Leite; João Batista, Alves; Germi Porto, Santos.


Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae) em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae) in cucumber and strawberry crops  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma) e Phytoseudus macropilis (Banks), comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utiliz...

Watanabe, M. A.; Moraes, G. J.; Gastaldo Jr, I.; Nicolella, G.



Influência da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseídeos predadores associados / Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O.ilicis on [...] its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark & Muma, Euseius citrifolius Denmark & Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O.ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I.zuluagai and eggs and larvae by E.citrifolius was lower. For A.herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O.ilicis altogether, webbing reduced the predation potential of I.zuluagai and E. citrifolius, but not of A. herbicolus.

Renato A, Franco; Paulo R, Reis; Mauricio S, Zacarias; Daniel C, Oliveira.



Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests; Efeito de doses e de refugio sobre a seletividade de inseticidas a predadores e parasitoides de pragas de soja  

Energy Technology Data Exchange (ETDEWEB)

A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the EMBRAPA-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvet bean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed. (author)

Corso, Ivan Carlos; Gazzoni, Decio Luiz; Nery, Manoel Eugenio [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja]. E-mail:



Evaluación del interés de productores ganaderos en el control selectivo y eficiente de predadores en la Patagonia Austral / Evaluation of the interest of southern Patagonian ranchers toward selective and efficient predator control methods  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: Spanish Abstract in spanish Elaboramos una encuesta con el fin de evaluar el interés de los productores ganaderos por incorporar prácticas selectivas de control basándonos en la caracterización del sistema de producción ganadera de Santa Cruz y su relación con la predación por el zorro colorado (Lycalopex culpaeus). Para los e [...] ncuestados (n = 90) la carga ovina actual está por debajo de la óptima, lo que es consistente con el hecho de que para la mayoría (73%) la ganadería sólo representa una parte de sus ingresos. El nivel de pérdida de corderos por predación de zorros colorados varía entre el 5% y el 50% de la producción anual y esta tasa se ha mantenido en los últimos años, a pesar de que el 56% de los encuestados percibe un aumento en la abundancia de zorros en sus campos en los últimos 10 años. Las actitudes negativas de los productores hacia el zorro colorado se reflejaron en el hecho de que su control continúa siendo una práctica habitual para el 73% de los encuestados incluso en establecimientos sin producción. El uso de veneno es o ha sido utilizado por la mayoría de los productores (74%) a pesar de su prohibición. Sin embargo, el 91% de los encuestados estaría dispuesto a reemplazar sus prácticas por métodos de control selectivos y eficientes. Este es un punto importante para incentivar el uso de métodos alternativos de control, como cebos tóxicos administrados selectivamente, lo que permitiría el abandono de las prácticas tradicionales tan nocivas para la conservación de la biodiversidad. Abstract in english Sheep ranchers (n = 90) were surveyed to evaluate their interest in the incorporation of predator selective control methods. We based our survey on the characterization of the sheep ranching system of Santa Cruz province and its relationship with culpeo fox (Lycalopex culpaeus) predation. For a larg [...] e percentage of producers (73%), the carrying capacity at present is under the optimal, which is consistent with the fact that sheep ranching represents only a part of their income. Lamb losses due to culpeo foxes predation vary between 5% and 50% of the annual lamb production, and these percentages did not vary during the last years in spite of the perceiving, by 53% of ranchers, of an increment in foxes abundance. Ranchers tend to exaggerate real losses of their lambs due to predation, although they recognize that there are other causes that could facilitate it. Nevertheless, fox control, including poisoning as a method, is still a current practice even in those ranches without sheep. The 90% of the sheep ranchers showed a good willingness to replace their current practices by selective and efficient control methods. This is an important point to encourage the use of selective control methods, like toxic baits delivered in a selective way, which would allow the abandonment of the traditional practices so dangerous to biodiversity conservation.

Arantxa, GARCÍA BREA; Sonia Cristina, ZAPATA; Diego Esteban, PROCOPIO; Rolando, MARTÍNEZ PECK; Alejandro, TRAVAINI.


Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 inócuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.


Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da Silva



77 FR 7599 - Receipt of Applications for Endangered Species Permits (United States)

...requests authorization to take Florida grasshopper sparrows (Ammodramus savannarum floridanus) by netting...New Jersey Applicant requests authorization to take Cape Sable seaside sparrows (Ammodramus maritimus mirabilis) by netting,...



ClEST cluster :Cl_singleton1654 [ClEST  

Full Text Available Cl_singleton1654 zinc ... transporter zip11-like Cimex lectularius nuclear gene 411 TTAAATGTCAACAGCG ... GGCCATATGCATTCATTCCAGCCTGTGTTGGGTTTCTACT fw20018 1 Zinc ... transporter ZIP11 [Camponotus floridanus] EFN60394 ...


ClEST cluster :Cl_singleton0672 [ClEST  

Full Text Available Cl_singleton0672 bhlhzip transcription factor bigmax ... Cimex ... lectularius nuclear gene 273 GAACAGAG ... GCAGAAGCGAAGGGATGCTATTAAAAAGGGCTACGATT fs03092 1 Max -like protein X ... [Camponotus floridanus] EFN65369 4. ...


ClEST cluster :Cl_singleton2329 [ClEST  

Full Text Available Cl_singleton2329 long-chain fatty acid ... transport protein 4 Cimex lectularius nuclear gene 469 CT ... TAGCACAAGTGTTCCATAATGCT mb23072 1 Long-chain fatty acid ... transport protein 4 [Camponotus floridanus] EFN719 ...


ClEST cluster :Cl_singleton1794 [ClEST  

Full Text Available Cl_singleton1794 adam ... 17-like protease Cimex lectularius nuclear gene 267 CCATGCATACACGGGTTTTGTA ... CTATCCGGGGAGTACATATCGGATAATCAATGATGAATTA fw24084 1 ADAM ... 17-like protease [Camponotus floridanus] EFN73099 ...


ClEST cluster :Cl_singleton2242 [ClEST  

Full Text Available Cl_singleton2242 ubiquitin carboxyl-terminal ... hydrolase 7 Cimex lectularius nuclear gene 439 ATGA ... CTCTATCCTAATAAAGGTGCA mb20048 1 Ubiquitin carboxyl-terminal ... hydrolase 7 [Camponotus floridanus] EFN60413 1.462 ...


ClEST cluster :Cl_singleton0472 [ClEST  

Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...


Introdução de Harmonia axyridis PALLAS (Col., Coccinellidae) na Ilha de Santa Maria.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A modificação das práticas culturais e o emprego indiscriminado de pesticidas levaram ao desaparecimento de numerosos predadores afidífagos nos Açores e consequentemente ao aparecimento de desiquilíbrios ecológicos (praga/predador). A fim de atenuar esta situação, desde há 3 anos (1988/1990), que vimos introduzindo na Ilha de Santa Maria (Açores) uma joaninha exótica de origem asiática Harmonia axyridis PALLAS. A escolha deste predador deve-se à sua grande capacidade de...

Schanderl, Henrique; Almeida, Jose? M.



O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.


Morfologia dos imaturos e do adulto de Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predador de cochonilhas-de-carapaça (Hemiptera, Diaspididae) de citros Morphology of immatures and adult of Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predator of citrus armored scales (Hemiptera, Diaspididae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Imaturos e adultos de Coccidophilus citricola Brèthes, 1905 são descritos e ilustrados com auxílio de microscopia eletrônica de varredura. A larva é comparada com as de Microweisea Cockerel e outras espécies de Coccinellidae, e o adulto com duas espécies norte-americanas de Coccidophilus Brèthes.Immatures and adults of Coccidophilus citricola Brèthes, 1905 are described and illustrated, using scanning electron microscopy. The larva is compared to those of Microweisea Cockerel and...

Ricardo Adaime da Silva; Lúcia Massutti de Almeida; Antonio Carlos Busoli



Morfologia dos imaturos e do adulto de Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predador de cochonilhas-de-carapaça (Hemiptera, Diaspididae) de citros / Morphology of immatures and adult of Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predator of citrus armored scales (Hemiptera, Diaspididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Imaturos e adultos de Coccidophilus citricola Brèthes, 1905 são descritos e ilustrados com auxílio de microscopia eletrônica de varredura. A larva é comparada com as de Microweisea Cockerel e outras espécies de Coccinellidae, e o adulto com duas espécies norte-americanas de Coccidophilus Brèthes. [...] Abstract in english Immatures and adults of Coccidophilus citricola Brèthes, 1905 are described and illustrated, using scanning electron microscopy. The larva is compared to those of Microweisea Cockerel and other species of Coccinellidae, and the adults with two North American species of the Genus Coccidophilus Brèthe [...] s.

Ricardo Adaime da, Silva; Lúcia Massutti de, Almeida; Antonio Carlos, Busoli.



Morfologia dos imaturos e do adulto de Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae, predador de cochonilhas-de-carapaça (Hemiptera, Diaspididae de citros Morphology of immatures and adult of Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae, predator of citrus armored scales (Hemiptera, Diaspididae  

Directory of Open Access Journals (Sweden)

Full Text Available Imaturos e adultos de Coccidophilus citricola Brèthes, 1905 são descritos e ilustrados com auxílio de microscopia eletrônica de varredura. A larva é comparada com as de Microweisea Cockerel e outras espécies de Coccinellidae, e o adulto com duas espécies norte-americanas de Coccidophilus Brèthes.Immatures and adults of Coccidophilus citricola Brèthes, 1905 are described and illustrated, using scanning electron microscopy. The larva is compared to those of Microweisea Cockerel and other species of Coccinellidae, and the adults with two North American species of the Genus Coccidophilus Brèthes.

Ricardo Adaime da Silva



Comportamento de oviposição de Bruchidae (Coleoptera predadores de sementes de Cassia leptophylla Vogel (Caesalpinaceae, morfologia dos ovos e descrição de uma nova espécie Oviposition behavior of Bruchidae (Coleoptera seed predators of Cassia leptophylla Vogel (Caesalpinaceae, egg rnorphology and description of a new species  

Directory of Open Access Journals (Sweden)

Full Text Available Sennius leptophyllicola sp. nov. is described from Paraná, Brazil and reported to feed in seeds of Cassia leptophylla Vogel with Pygiopachymerus lineola (Chevrolat, 1871. Both species attach their eggs to the outside of the fruit valves of the host. Their oviposition behavior places them in oviposition guild A of JOHNSON (1981. Eggs were described based upon scanning electron micrographs.

Cibele Stramare Ribeiro-Costa



O valor de Mabea fistulifera Mart. (Euphorbiaceae, planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae The value of Mabea fistulifera Mart. (Euphorbiaceae, indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para comparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I; de 15 a 26 dias (Pólen II e de 30 a 41 dias (Pólen III. A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of their known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I; from 15 to 26 days old (Pollen II and from 30 to 41 days old (Pollen III. The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p < 0.0001 between some treatments: mites fed pollen III of M. fistulifera had higher oviposition than those fed Pollen I and R. communis Pollen III. Mites fed Pollen II of T. angustifolia had higher oviposition rates than those fed pollen III of R. communis. Only females fed pollen of R. communis had negative correlation between oviposition rates and the periods of storage of pollen. The results showed that M. fistulifera pollen is used by E. citrifolius as food and comparable with pollen from T. angustifolia, futhermore, showed great durability when storage at 10ºC.

Rodrigo Damasco Daud



Ocorrência de moscas brancas (Hemiptera: Aleyrodidae) e do predador Delphastus pusillus (LeConte) (Coleoptera: Coccinellidae) em mamoeiro (Carica papaya L.) sob cultivo em ambiente protegido / Whiteflies (Hemiptera: Aleyrodidae) and the predator Delphastus pusillus (Le Conte) (Coleoptera: Coccinellidae) on papaya tree (Carica papaya L.) grown under screened conditions  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Em fevereiro e outubro de 1998, na área experimental da Fazenda de Ensino e Pesquisa da UNESP no município de Selvíria-MS (latitude 20° 22' S, longitude 51° 22' W, altitude 335 m), foi constatada a presença de mosca branca em mamoeiro cultivar Baixinho de Santa Amália, plantado no interior de um tel [...] ado com malha de 2 x 2 mm. Essa área fazia parte de um experimento visando determinar o efeito do cultivo em ambiente protegido sobre o desenvolvimento das plantas, a produção de frutos e a ocorrência do mosaico do mamoeiro. Nas duas ocasiões os insetos foram enviados ao Centro de Recursos Genéticos e Biotecnologia (CENARGEN) da EMBRAPA para identificação. Na primeira infestação o material foi identificado como Trialeurodes sp. e na infestação de outubro como Bemisia tabaci biótipo B . Nos dois casos havia grande quantidade de ninfas nas folhas maduras e de adultos nas folhas novas. Para Trialeurodes sp. foi realizada uma contagem de ninfas em dezoito folhas, em cinco áreas de 1 cm² por folha, distribuídas ao acaso, encontrando-se a média de 7,6 ninfas por cm². Como conseqüência da presença das duas espécies, o único dano observado foi um intenso desenvolvimento de fumagina recobrindo completamente a superfície das folhas, que acabaram por secar e cair. A infestação de B. tabaci biótipo B foi controlada pela presença de larvas e adultos do coccinelídeo Delphastus pusillus (LeConte) que alimentavam-se vorazmente das ninfas presentes. Abstract in english We report the presence of whitefly species at the Experimental Farm of UNESP, located in Selvíria, state of Mato Grosso do Sul, Brazil ( 20°22' latitude S, 51°22' longitude W, altitude 335 m), in February and October 1998. These insects were found on papaya trees cultivar Baixinho de Santa Amália, g [...] rown under screened conditions (2 mm x 2 mm mash). The goal of the original experiment was to determine the effect of growing the cultivar under a protected environment on the development of the trees, fruit production and incidence of the "papaya ringspot virus". Whitefly specimens were sent to the Center of Genetic Resources and Biotechnology (CENARGEN) of EMBRAPA, for identification. The specimens collected in February were identified as Trialeurodes sp. and those collected in October were recognized as Bemisia tabaci biotype B. In both ocasions there were great numbers of nymphs on mature leaves and of adults on young leaves. We counted the number of Trialeurodes nymphs in eighteen leaves, in five areas of 1 cm² per leaf, distributed at random, where we found an average of 7.6 nymphs/cm². The only damage associated with the presence of whitefly of both species was the intense development of `sooty molds', covering completely the leaves, which wilted and fell. The infestation of B. tabaci biotype B was controlled by larvae and adults of the coccinellid Delphastus pusillus (LeConte), which fed avidly on the whitefly nymphs.

Marineide R., Vieira; Luiz S., Correa.



First record of Aspergillus flavus as a fungal pathogen of reduviid predator, Rhynocoris marginatus (Fab. (Hemiptera: Reduviidae  

Directory of Open Access Journals (Sweden)

Resumo. O fungo entomófago, Aspergillus flavus Raper and Fennell é registrado como um patógeno do reduviídeo predador Rhynocoris marginatus (Fab. (Hemiptera: Reduviidae, em agroecossistema natural do distrito de Tirunelveli, Tamil Nadu pela primeira vez.

Kitherian Sahayaraj



NUEVOS REGISTROS DE CANGREJOS DEL GÉNERO PALICUS (PHILIPPI, 1838)(CRUSTACEA: DECAPODA: BRACHYURA: PALICIDAE) PARA EL MAR CARIBE COLOMBIANO / New records of the crabs of the genus Palicus (Philippi, 1838) (Crustacea: Decapoda: Brachyura: Palicidae) from the Caribbean coast of Colombia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish Se amplía el ámbito geográfico para Palicus floridanus y se registran por primera vez cinco especies de la familia Palicidae colectadas en el mar Caribe colombiano durante el crucero INVEMAR-Macrofauna I, entre 1998 y 1999, a lo largo de la franja superior del talud continental (300 y 500 m de profu [...] ndidad). Con las de este trabajo, en el área se han reportado seis especies: P. alternatus Rathbun, 1897; P. cursor A. Milne-Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, y P. sicus A. Milne-Edwards, 1880. En la costa caribe colombiana el único registro previo para la familia era P. alternatus. Abstract in english A new range extension of Palicus floridanus and five new records of Palicidae are presented, the samples are collected from the Colombian Caribbean coast during the cruise of INVEMAR-Macrofauna I between 1998 and 1999, along the upper continental Slope (300 and 500 m deep). Six species have now been [...] recorded from the area: P. alternatus Rathbun, 1897; P. cursor A. Milne- Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, and P. sicus A. Milne-Edwards, 1880. Previously, P. alternatus was the only member of the family reported for this area before this study.

Adriana, Bermúdez; Norella, Cruz; Gabriel R, Navas S; Hernando, Campos.



ClEST cluster :Cl_contig0301 [ClEST  

Full Text Available Cl_contig0301 transcription initiation factor iia subunit 2 ... Cimex lectularius nuclear gene 596 T ... GTTGTACACACCAAACTAAAGTTTCATTTTGTTT fw04077 mb18045 2 ... Transcription initiation factor IIA subunit 2 ... [Cam ... ponotus floridanus] EFN74357 2 .9E-61 GO:0003743 GO:0006413 GO:0006357 GO:0006367 ... GO:0005672 ... GO:0003702 ...


ClEST cluster :Cl_singleton1907 [ClEST  

Full Text Available Cl_singleton1907 26s proteasome non-atpase regulatory subunit 12 ... Cimex lectularius nuclear gene ... AAATGGTTCAGCAATGCTGCGAGTACGTTGACCAGATGCCTA mb06054 1 2 6S proteasome non-ATPase regulatory subunit 12 ... [Ca ... mponotus floridanus] EFN66912 ... 5.60276E-49 GO:0000502 GO:0051436 GO:0051437 GO:00 ...


Biologia de Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) predando Plutella xylostella (L.) (Lepidoptera: Plutellidae) Biology of Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) Preying on Plutella x ylostella (L.) (Lepidoptera: Plutellidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) é um predador encontrado em vários agroecossistemas, predando insetos pequenos e de tegumento mole. Seu alto potencial reprodutivo e elevada capacidade de busca o tornam capazes de predar ovos e larvas de Plutella xylostella (L.) (Lepidoptera: Plutellidae) nas partes mais internas da cabeça do repolho, onde outros inimigos naturais não conseguem. Essas características podem favorecer a utilização desse predador no controle biológic...

Mauricélia Ferreira Almeida; Reginaldo Barros; Manoel Guedes Corrêa Gondim Júnior; Sérgio de Freitas; Antônio Lourenço Bezerra




Digital Repository Infrastructure Vision for European Research (DRIVER)

Besouros predadores da família Histeridae foram coletados através do uso de armadilhas "pitfall" iscadas com massa fecal fresca de bovinos instaladas em área de pastagem em Piracicaba, SP. Coletaram-se durante o período de 15 de abril de 1995 a 17 de fevereiro de 1996, quatro espécies identificadas como Hister punctifer, Phelister panamensis, P. haemorrhous e P. rufinotus. A espécie P. panamensis é um importante predador de ovos e larvas de Haematobia irritans e representou 72,93% do t...

Rodrigues, S. R.; Marchini, L. C.



Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae  

Directory of Open Access Journals (Sweden)

Full Text Available Attack behavior of the predator Podisus rostralis (Stäl (Heteroptera: Pentatomidae adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack behavior: (1 Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2 Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl (Heteroptera: Pentatomidae tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae. Dez adultos do predador, com 24 horas de idade, foram observados durante duas horas acompanhando-se os seguintes comportamentos de ataque: (1 Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2 Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas.

Walkymário Paulo Lemos



Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade) adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl) (Heteroptera: Pentatomidae) tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae). Dez adultos do predador, com 24 horas de idade, foram observados durante duas hor [...] as acompanhando-se os seguintes comportamentos de ataque: (1) Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2) Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas. Abstract in english Attack behavior of the predator Podisus rostralis (Stäl) (Heteroptera: Pentatomidae) adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae) caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack b [...] ehavior: (1) Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2) Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.

Walkymário Paulo, Lemos; José Cola, Zanuncio; José Eduardo, Serrão.


Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Wernegreen Jennifer J



Clinal variation of some mammals during the Holocene in Missouri (United States)

Eastern cottontail ( Sylvilagus floridanus), fox squirrel ( Sciurus niger), and gray squirrel ( Sciurus carolinensis) were examined for clinal variation during the Holocene. Modern samples of all three species displayed strong east-west patterns along the western edge of the eastern deciduous forest: S. floridanus and S. niger decrease and S. carolinensis increases in size. Archeological samples of S. carolinensis from Rodgers Shelter (23BE125), Benton County, Missouri, and Graham Cave (23MT2), Montgomery County, Missouri, indicated an increase in size from early to middle Holocene. Sylvilagus floridanus from Rodgers Shelter decreased in size from early to middle Holocene and then increased during the late Holocene to modern proportions. A literature survey reveals that clinal variation is a common phenomenon among modern homeotherms. In introduced species, clinal variation has developed after relatively few generations, indicating rapid adaptations to environmental conditions; often winter climatic variables are implicated. Morphological variation in the study species during the Holocene is interpreted as a response to changing climates. Studies of morphological clines may lead to another valuable data source for reconstructing past ecologies.

Purdue, James R.



Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.)], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.)], in Presidente Prudente, State of São Paulo, Brazil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 d...

Sônia Maria Nalesso Marangoni Montes; Adalton Raga; Aparecida Conceição Boliani; Jeferson Luiz Carvalho Mineiro; Pedro César dos Santos




Directory of Open Access Journals (Sweden)

Full Text Available Besouros predadores da família Histeridae foram coletados através do uso de armadilhas "pitfall" iscadas com massa fecal fresca de bovinos instaladas em área de pastagem em Piracicaba, SP. Coletaram-se durante o período de 15 de abril de 1995 a 17 de fevereiro de 1996, quatro espécies identificadas como Hister punctifer, Phelister panamensis, P. haemorrhous e P. rufinotus. A espécie P. panamensis é um importante predador de ovos e larvas de Haematobia irritans e representou 72,93% do total de insetos coletados.




Seletividade fisiológica de inseticidas aos inimigos naturais de Plutella xylostella (L.) (Lepidoptera: Plutellidae) em brássicas Insecticide physiological selectivity to natural enemies of Plutella xylostella (L.) (Lepidoptera: Plutellidae) in Brassicae  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A conservação de inimigos naturais é um componente fundamental no manejo integrado de pragas. Neste trabalho, estudou-se a seletividade de sete inseticidas usados no manejo de Plutella xylostella (L.) (Lepidoptera: Plutellidae) ao parasitóide Oomyzus sokolowskii (Kurdjumov) (Hymenoptera: Eulophidae) e aos predadores Discodon sp. (Coleoptera: Cantharidae) e Lasiochilus sp. (Hemiptera: Anthocoridae). Os organofosforados metamidofós e paratiom metílico e o carbamato carbaril foram altament...

Leandro Bacci; Marcelo Coutinho Picanço; Ézio Marques da Silva; Júlio Cláudio Martins; Mateus Chediak; Maria Elisa Sena




Directory of Open Access Journals (Sweden)

Full Text Available En este artículo se muestra la disipatividad en una clase de sistema dinámico que modela la competencia entre n especies de predadores por una presa singular que se regenera. Este resultado es una generalización de la prueba presentada en [1] para modelos n-dimensiónales con respuesta funcional tipo Holling II.




Predation on Leptinopterus Hope species (Coleoptera, Lucanidae by three species of Reduviidae (Hemiptera, Heteroptera in the Atlantic Forest, Brazil  

Directory of Open Access Journals (Sweden)

Resumo. Relata-se a ocorrência de predação natural de Leptinopterus burmeisteri Arrow e Leptinopterus femoratus (Olivier (Coleoptera, Lucanidae, Lucaninae por Zelurus angularis (Stål (Reduviinae, Apiomerus mutabilis Costa Lima, Seabra & Hathaway e Apiomerus nigricollis Stål (Apiomerinae (Hemiptera, Reduviidae no Estado de São Paulo, Brasil. Dados adicionais sobre hábitos predadores de A. nigricollis são apresentados também.

Paschoal Grossi



Zoophytophagy in predatory Hemiptera  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sob [...] re enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase) e percevejos fitófagos alimentarem de presas (peptidase). Abstract in english Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variabilit [...] y in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase) and herbivores taking prey (peptidase).

Jorge Braz, Torres; David W., Boyd.


Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impala [...] tabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto), somente pistas químicas (experimento de risco indireto) e ausência completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

Renan N., Costa; Fausto, Nomura.


Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impala [...] tabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto), somente pistas químicas (experimento de risco indireto) e ausência completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

Renan N., Costa; Fausto, Nomura.



Effect of insecticides and fungicides on the interaction between members of the mite families Phytoseiidae and Stigmaeidae on citrus. (United States)

The study was carried out to evaluate the effect of some insecticides and fungicides on the interaction between predacious mites of the families Phytoseiidae and Stigmaeidae on citrus. Euseius citrifolius Denmark and Muma, Euseius concordis (Chant) (Phytoseiidae), and Agistemus aff. bakeri (Stigmaeidae) were the most abundant species of predacious mites. No significant reduction of the population of stigmaeids was detected following the pesticide treatment. On the contrary, the population of those mites increased after the application of methidathion, petroleum oil, deltamethrin, cupric oxychloride and cuprous oxide, as compared to the population of those mites in the control plots. The chemicals promoting increased stigmaeid populations are some of those that promoted reduction of phytoseiid populations. A significant negative correlation was found between the numbers of phytoseiids and stigmaeids on citrus leaves immediately before treatments, and 33, 50, 83 and 105 days after treatment. A clear negative linear correlation between the number of predacious mites from both families was detected for benomyl, cupric oxychloride, cuprous oxide, thiophanate methyl, and control. Phytoseiid-stigmaeid interaction on citrus orchard is discussed. PMID:12455872

Sato, M E; Raga, A; Cerávolo, L C; De Souza Filho, M F; Rossi, A C; De Moraes, G J



A olfactometria como método de selecção de coccinelídeos afidífagos  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Um olfactómetro de difusão usado para testar duas espécies de Coccinelídeos afidífagos, Coccinella septempunctata e Adonia variegata, revelou-se eficaz. Foram oferecidas aos predadores três presas diferentes: Acyrtosiphon pisum, Megoura viciae e Aphis fabae. Os dados foram tratados estatisticamente. As conclusões mostram que existe uma preferência nítida pelas plantas infestadas com afídeos, quando comparadas com plantas não-infestadas. O aparelho também ajuda a escolha do afí...

Garcia, Vasco; Ribeiro, Jose? A.



Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera) na Serra dos Carajás, Pará, Brasil / Legume seed damage by bruchids (Insecta: Coleoptera) in Serra dos Carajás, Pará state, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae), Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae) e Phaseolus linearis H.B.K. (Fabaceae) para investigar a taxa de predação e a existência de defesas contra a ação de predadores. F [...] oi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas. Abstract in english Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae), Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae) and Phaseolus linearis H.B.K. (Fabaceae), was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by [...] bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

Cecília, Lomônaco.


Entomofauna em capítulos de picão-preto Entomofauna in floyer heads of common blackjack  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A ocorrência de insetos fitófagos e de himenópteros parasitóides a eles associados, presentes em capítulos de Bidens pilosa são descritas para as condições do município de Botucatu, SP. Foram encontrados predadores de sementes da ordem Diptera, pertencentes aos gêneros Dioxyna, Melanagromysa e outro não identificado. As moscas Dioxyna depositam seus ovos no interior dos aquênios em estágios iniciais de desenvolvimento, permanecendo no interior do fruto até a emergência do adult...

Maimoni-rodella, Rita C. S.; Neder, Lucia T. C.; Fidalgo, Adriana O.; Yanagizawa, Yuriko A. N. P.



Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-ov...

Walter Santos Evangelista Júnior; Manoel Guedes Correa Gondim Junior; Jorge Braz Torres; Edmilson Jacinto Marques



New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries  

Digital Repository Infrastructure Vision for European Research (DRIVER)

New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries. Feeding by Exoplectra miniata (Germar) on extrafloral nectaries of Inga edulis Mart. was observed in Nova Friburgo, Rio de Janeiro, Brazil. This is the first record of this behavior for Exoplectrini.Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae) alimentando-se de nectário extrafloral. A alimentação de Exoplectra miniata (Germar) em nectários extraflorais de Ing...

Almeida, Lu?cia M.; Corre?a, Geovan H.; Giorgi, Jose? A.; Grossi, Paschoal C.



Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) no combate à Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarandá Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002,...

Ana Paula Félix; António Miguel Franquinho Aguiar; Celestina Brazão; Paula Rocha



Monitorização do coelho-bravo na Reserva Natural da Serra da Malcata : 1998-2007  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O Coelho-bravo, Oryctolagus cuniculus, é uma espécie chave nos ecossistemas mediterrâneos ibéricos, desempenhando uma multiplicidade de papéis na dinâmica dos mesmos, dos quais de destaca o facto de ser principal “espécie presa” de um largo espectro de predadores, como por exemplo o Lince-ibérico e a Águia-imperial, e ser uma das principais espécies cinegéticas em Portugal. Na Reserva Natural da Serra da Malcata – RNSM, as suas populações têm sofrido um a...

Paula, Anabela Salvado



Avaliação do impacto de métodos florestais e de seca severa na população de coelho-bravo na mata nacional de Quiaios  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O papel determinante na cadeia trófica, faz do coelho-bravo (Oryctolagus cuniculus) uma espécie chave dos ecossistemas ibéricos onde constitui a principal presa de um vasto leque de predadores, alguns dos quais de elevado valor de conservação. Este factor confere uma relevância ainda maior ao acentuado declínio que esta espécie tem sofrido, na generalidade dos ecossistemas mediterrânicos, provocado pela perda e fragmentação do seu habitat, por doenças, predação...

Morgado, Rui Guilherme Da Costa



Influencia del ayuno sobre el comportamiento natatorio crítico del lenguado senegalés Solea senegalensis y su relación con el cociente RNA/DNA durante la ontogenia  

Digital Repository Infrastructure Vision for European Research (DRIVER)

[ES] Influencia del ayuno sobre el comportamiento natatorio crítico del lenguado senegalés Solea senegalensis y su relación con el cociente RNA/DNA durante la ontogenia. – La disponibilidad de comida puede afectar la supervivencia larvaria directamente a través del ayuno e indirectamente a través de los efectos sobre la tasa de crecimiento larvario, actividad natatoria y vulnerabilidad a los predadores. En el presente estudio evaluamos los efectos del ayuno sobre el crecimiento, condic...

Faria, Ana M.; Muha, Teja; Morote, Elvira; Chi?charo, M. Alexandra



Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera na Serra dos Carajás, Pará, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajás, Pará state, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predação e a existência de defesas contra a ação de predadores. Foi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

Cecília Lomônaco



Influência da densidade de Myzus persicae (Sulzer) sobre alguns aspectos biológicos e capacidade predatória de Chrysoperla externa (Hagen) = Influence of the density of Myzus persicae (Sulzer) on the biological aspects and predatory capacity of Chrysoperla externa (Hagen)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Avaliou-se a influência de diferentes densidades de Myzus persicae criados em folhas de pimentão, Capsicum annum L. sobre os aspectos biológicos e a capacidade predatória de Chrysoperla externa (Hagen). Larvas recém-eclodidas do predador foram alimentadas com ninfas do pulgão, oferecidas nas densidades de 50% abaixo do consumo médio, o consumo médio diário e 50% acima desse consumo, sobre discos foliares de pimentão mantidos em placas de Petri à 25 ± 1ºC, UR de 70 ± 10% e fotofa...

Leonardo Rodrigues Barbosa; César Freire Carvalho; Brigida Souza; Alexander Machado Auad



Controle biológico de Culicidae (Díptera por Copelatus SP. N. (Coleóptera Dytiscidae na floresta amazônica  

Directory of Open Access Journals (Sweden)

Full Text Available Many literature citations state that Coleóptera of the family Dytiscidae are predators of larvae of Culicidae. In an area of primative forest, small receptacles of water were introduced in order to study ecology of Dytiscidae. A new species of the genus Copelatus was discovered and found to be a predator of mosquito larvae. Field observations of behavior colonization of receptacles and aspects of the controle of mosquito population were made. In the laboratory were studied resistance to dessication, dispersion, aquatic respiration, relationship with other predators and its influence upon development of Culicidae larvae. Copelatus appears to be an efficient agent of biological control of larva of Culicidae in small reservatories of water. Existem na literatura inúmeras citações, referentes a Coleópteras da família Dytiscidae, incriminando-os como predador de larvas de Culicidae. Foi introduzido em uma área de mata primaria recipiente contendo água, com o objetivo de identificar um predador para as larvas de mosquito. Coletou-se um Dytiscidae, espécie nova do gênero Copelatus que exerce ação predatória sobre as larvas de mosquito. Estudou-se seu comportamento em campo observando-se a colonização dos recipientes e sua atuação positiva no controle de Culicidae. Em laboratório foi estudado Fatores de Resist?ncia a dessecação, dispersão, respiração aquática, comportamento frente a outro predador e influência sobre o desenvolvimento das larvas de Culicidae. Copelatus mostrou-se eficiente agente de controle biológico das larvas de Culicidae em pequenos reservatórios de água.

José Lopes



Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato  

Directory of Open Access Journals (Sweden)

Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.

Canteras Newton Sabino



Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen) juveniles exposed to waterborne ammonia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferent [...] es concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie. Abstract in english Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predatio [...] n. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.

Paula, Weber; Carina, Vogel; Carla, Lang; Bernardo, Baldisserotto.


Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.

Mueller Martin J



When can ants discriminate the sex of brood? A new aspect of queen-worker conflict. (United States)

The stage in preimaginal ontogeny at which the sexes can first be distinguished has important implications for queen-worker conflict in social insects. If workers are unable to sex larvae at an early instar, their opportunity to control colony reproductive strategies may be limited. In addition, by concealing the sex of her sons for some portion of development, the queen could protect them from the workers' attempts to substitute their own sons or to skew the numerical sex ratio. In a series of choice experiments, workers of the carpenter ant, Camponotus floridanus, failed to discriminate the sex of several stages of larvae but did retrieve female pupae significantly more rapidly than male pupae. Our results suggest that in this species, sex may not become detectable until pupation, which is consistent with sexual deception as an aspect of queen control. PMID:11607136

Nonacs, P; Carlin, N F



Diversidad y microestructura de quitones (Mollusca: Polyplacophora) del Caribe de Costa Rica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la do [...] cumentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon, 1886); S. purpurascens (C.B. Adams, 1845); Acanthopleura granulata (Gmelin, 1791); Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893). Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889). Abstract in english Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four coll [...] ection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulate (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). Rev. Biol. Trop. 59 (1): 129-136. Epub 2011 March 01.

Cedar I, García-Ríos; Migdalia, Álvarez-Ruiz.



Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica  

Directory of Open Access Journals (Sweden)

Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la documentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.Diversity and microstructure of quitons (Mollusca: Polyplacophora from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon 1886; S. purpurascens (C.B. Adams 1845; Acanthopleura granulate (Gmelin 1791; Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893. This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889. Rev. Biol. Trop. 59 (1: 129-136. Epub 2011 March 01.

Cedar I García-Ríos



Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação  

Directory of Open Access Journals (Sweden)

Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

Cristiano S. de Azevedo



Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

Cristiano S. de, Azevedo; Robert J., Young.


Fish ladders: safe fish passage or hotspot for predation?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results sugge

Angelo Antonio, Agostinho; Carlos Sergio, Agostinho; Fernando Mayer, Pelicice; Elineide Eugênio, Marques.



Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

Cristiano S. de, Azevedo; Robert J., Young.




Directory of Open Access Journals (Sweden)

Full Text Available Têm-se buscado alternativas para o controle de pragas no setor florestal. Uma possibilidade é a utilização do controle biológico com predadores e parasitóides. O objetivo deste trabalho foi avaliar o parasitismo de diferentes espécies de Trichogramma em ovos de P. nigrispinus. Foram colados em retângulos de cartolina azul celeste 15 ovos, de P. nigrispinus, com um dia de idade. Foram utilizados ovos de uma mesma postura em cada tratamento. As cartelas contendo os ovos do predador foram expostas ao parasitismo de fêmeas de cinco espécies de Trichogramma por 24 horas. Como testemunha, foram utilizados ovos de P. nigrispinus que não foi submetido a presença do parasitóide. Não houve emergência de adultos do parasitóide oriundos desses ovos e a viabilidade não foi afetada por nenhuma das cinco espécies utilizadas. O predador P. nigrispinus e o parasitóide Trichogramma podem ser utilizados em programas de controle biológico.Alternatives for the control of pests in forest sectors have been searched. A possibility is the use of the biological control with predators and parasitoids. The objective of this work was to evaluate the parasitism of different Trichogramma species in P. nigrispinus egges. For each treatment fifteen P. nigrispinus egges, of the same posture, with one day of age, were agglutinated in rectangles of celestial blue cardboard. They were exposed to the parasitism of 5 female Trichogramma species for 24 hours. Besides those that underwent the tests, P. nigrispinus egges that were not submitted to the parasitoid presence were used. There were parasitoid adults’ that originated from of those eggs born and the viability of all of the five species used was not affected. The predator P. nigrispinus and the parasitoid Trichogramma can be used in programs of biological control.

Anderson Mathias Holtz



Predation Tactics of Trumpetfish in Midwater  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Predadores são conhecidos por modificar táticas de caça em resposta às condições locais para explorar presas de diferentes espécies, densidades ou posição dentro dos habitats. Descrevo três táticas de predação não usuais utilizadas pelo peixe-trombeta (Aulostomus maculatus) à meia água sobre os reci [...] fes de Bonaire, Antilhas Holandesas, na porção sul do mar do Caribe. Comportamentos de caça foram direcionados para densas agregações de forrageamento de mulatas (Chromis multilineata) e foram categorizados como: (1) perseguição horizontal lenta, (2) pairando verticalmente ou à deriva, e (3) encontros cruzados diagonais, onde o peixe-trombeta desce diagonalmente através da água enquanto ajusta a sua trajetória para interceptar a presa almejada. A compreensão do comportamento do predador e seus domínios, neste caso a dimensão vertical, contribui para o conhecimento de como predadores se adaptam a condições locais particulares de exploração de presas. Abstract in english Predators are known to modify hunting tactics in response to local conditions to exploit prey of different species, densities or position within habitat patches. I describe three unusual prey hunting tactics used by trumpetfish (Aulostomus maculatus) distributed in midwater above reefs off Bonaire, [...] Netherlands Antilles, in the southern Caribbean Sea. Hunting behaviors were focused on dense feeding aggregations of brown chromis (Chromis multilineata) and were categorized as: (1) slow horizontal following, (2) vertical hovering or drift, and (3) diagonal cross encounters where trumpetfish descended diagonally through the water while adjusting trajectory to encounter target prey. Understanding variation in predator behavior and ambit, in this case vertical ambit, adds to our knowledge of how predators adapt to unique local opportunities to exploit prey.

Peter J., Auster.


Predation Tactics of Trumpetfish in Midwater  

Directory of Open Access Journals (Sweden)

Full Text Available Predators are known to modify hunting tactics in response to local conditions to exploit prey of different species, densities or position within habitat patches. I describe three unusual prey hunting tactics used by trumpetfish (Aulostomus maculatus distributed in midwater above reefs off Bonaire, Netherlands Antilles, in the southern Caribbean Sea. Hunting behaviors were focused on dense feeding aggregations of brown chromis (Chromis multilineata and were categorized as: (1 slow horizontal following, (2 vertical hovering or drift, and (3 diagonal cross encounters where trumpetfish descended diagonally through the water while adjusting trajectory to encounter target prey. Understanding variation in predator behavior and ambit, in this case vertical ambit, adds to our knowledge of how predators adapt to unique local opportunities to exploit prey.Predadores são conhecidos por modificar táticas de caça em resposta às condições locais para explorar presas de diferentes espécies, densidades ou posição dentro dos habitats. Descrevo três táticas de predação não usuais utilizadas pelo peixe-trombeta (Aulostomus maculatus à meia água sobre os recifes de Bonaire, Antilhas Holandesas, na porção sul do mar do Caribe. Comportamentos de caça foram direcionados para densas agregações de forrageamento de mulatas (Chromis multilineata e foram categorizados como: (1 perseguição horizontal lenta, (2 pairando verticalmente ou à deriva, e (3 encontros cruzados diagonais, onde o peixe-trombeta desce diagonalmente através da água enquanto ajusta a sua trajetória para interceptar a presa almejada. A compreensão do comportamento do predador e seus domínios, neste caso a dimensão vertical, contribui para o conhecimento de como predadores se adaptam a condições locais particulares de exploração de presas.

Peter J. Auster



Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.], in Presidente Prudente, State of São Paulo, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas.This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni Montes



Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.)], em Presidente Prudente, estado de São Paulo / Mite diversity in peach cultivars [Prunus persica (L.)], in Presidente Prudente, State of São Paulo, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram colet [...] adas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas. Abstract in english This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talism [...] ã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni, Montes; Adalton, Raga; Aparecida Conceição, Boliani; Jeferson Luiz Carvalho, Mineiro; Pedro César dos, Santos.


Mites and leaf domatia: no evidence of mutualism in Coffea arabica plants / Ácaros e domácias foliares: sem evidências de mutualismo em plantas de Coffea arabica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Domácias são pequenas estruturas presentes na junção entre as nervuras principal e secundárias das folhas de muitas espécies de plantas, que podem mediar interações mutualísticas entre ácaros e plantas. Em experimento, nós bloqueamos as domácias em formato de covas de folhas novas e velhas de Coffea [...] arabica L. com gotas de resina, a fim de investigar o seu papel i) na abundância de ácaros na comunidade e ii) nos danos foliares. Mais de 77% dos ácaros coletados são predadores, enquanto 19 e 3,3% são onívoros e fitófagos, respectivamente. Não houve influência do bloqueio das domácias tanto na abundância quanto nos danos foliares. Entretanto, os ácaros predadores e micófagos foram mais abundantes nas folhas novas do que nas velhas; os ácaros fitófagos ocorreram em pequena densidade e ocuparam somente as plantas com domácias abertas. A ausência de mutualismo entre os ácaros e plantas de C. arabica pode ter ocorrido porque as entradas das domácias analisadas eram muito pequenas, não permitindo a entrada dos predadores fitoseídeos nessas estruturas. Abstract in english We conducted experiments by blocking off pit-like domatia from old and new leaves of Coffea arabica L., using tiny resin drops, to investigate the role of domatia on i) mite abundance at the community level and on ii) leaf damages. More than 77% of the mites collected were predators, whereas 19 and [...] 3.3% were omnivores and phytophages, respectively. Domatia blockage treatment had no influence either on mite abundances or leaf damages. However, predatory and omnivorous mites were more abundant on new than on the old leaves; phytophagous mites occurred at very low density and occupied only plants having open domatia. The absence of mutualism between mites and C. arabica probably occurred because the entrances of domatia were too small and did not enable the entry of fitoseid predators in these structures.

Gustavo Quevedo, Romero; Rodrigo Damasco, Daud; Adriana Trevizoli, Salomão; Luiz Fernando, Martins; Reinaldo José Fazzio, Feres; Woodruff Whitman, Benson.


Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.)], em Presidente Prudente, estado de São Paulo / Mite diversity in peach cultivars [Prunus persica (L.)], in Presidente Prudente, State of São Paulo, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram colet [...] adas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas. Abstract in english This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talism [...] ã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni, Montes; Adalton, Raga; Aparecida Conceição, Boliani; Jeferson Luiz Carvalho, Mineiro; Pedro César dos, Santos.



Head triangulation as anti-predatory mechanism in snakes / Triangulação da cabeça como mecanismo anti-predação em serpentes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Mecanismos anti-predação em serpentes são diversos e complexos, incluindo comportamentos miméticos. Algumas serpentes triangulam a cabeça, possivelmente mimetizando outras serpentes mais perigosas. No entanto, são escassos os estudos demonstrando a eficiência deste comportamento frente a predadores [...] naturais. O objetivo deste estudo foi verificar, utilizando serpentes artificiais, se os indivíduos com cabeça triangular são menos suscetíveis ao ataque de predadores e, se o ataque predatório é direcionado à cabeça das serpentes. Serpentes artificiais foram dispostas sistematicamente na margem de uma estrada. A taxa de modelos atacados foi 48,71%. O número de ataques em modelos de cabeça arredondada foi significativamente maior do que nos modelos com cabeça triangular. Houve diferença significativa entre as partes atacadas nas serpentes quando comparados aos diferentes formatos de cabeça. Portanto, as serpentes que possuem triangulação da cabeça podem ser um alvo menos frequente de ataques por predadores do que as que não possuem esse tipo de comportamento. Abstract in english Anti-predator mechanisms in snakes are diverse and complex, including mimetic behavior. Some snakes triangulate their head, probably mimicking other more dangerous snakes. However, there is a lack of studies that demonstrate the effectiveness of this behavior with natural predators. The aim of this [...] study was to verify, using artificial snakes, if snakes with triangular heads are less susceptible to attack by predators, and if predatory attack is targeted to the head of serpents. Artificial snakes were systematically arranged on a road border. The rate of attacked models was 48.71%. Number of attacks on models with rounded head was significantly higher than in models with triangular head. There was a significant difference between the places of attack on the snakes in relation to different head shapes. Therefore, snakes that have head triangulation may be a less frequent target of attacks by predators than those without such behavior.

Denise Dalbosco, Dell' Aglio; Tiago Shizen Pacheco, Toma; Adriane Esquivel, Muelbert; Anne Gomes, Sacco; Alexandro Marques, Tozetti.


Aspectos biológicos de Coccidophilus citricola Brèthes, 1905 (Coleoptera: Coccinellidae) Biological aspects of Coccidophilus citricola Brèthes, 1905 (Coleoptera: Coccinellidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os aspectos biológicos do predador Coccidophilus citricola foram estudados sob condições controladas (temperatura de 24±2ºC, 70±10% de UR e 12 horas de fotofase), utilizando como alimento a cochonilha Aspidiotus nerii. Os valores registrados para duração e viabilidade foram: período embrionário (9,54 dias e 78,33%); 1º estádio larval (4,22 dias e 90,00%); 2º estádio larval (2,85 dias e 100,00%); 3º estádio larval (2,94 dias e 97,22%); 4° estádi...

Ricardo Adaime da Silva; Antonio Carlos Busoli; Norton Rodrigues Chagas Filho



New record of predatory ladybird beetle (Coleoptera, Coccinellidae feeding on extrafloral nectaries  

Directory of Open Access Journals (Sweden)

Full Text Available New record of predatory ladybird beetle (Coleoptera, Coccinellidae feeding on extrafloral nectaries. Feeding by Exoplectra miniata (Germar on extrafloral nectaries of Inga edulis Mart. was observed in Nova Friburgo, Rio de Janeiro, Brazil. This is the first record of this behavior for Exoplectrini.Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae alimentando-se de nectário extrafloral. A alimentação de Exoplectra miniata (Germar em nectários extraflorais de Inga edulis Mart. foi observada em Nova Friburgo, Rio de Janeiro, Brasil. Este é o primeiro registro deste comportamento para Exoplectrini.

Lúcia M. Almeida



New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae) alimentando-se de nectário extrafloral. A alimentação d