
Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker (Acari in response the different kinds of food  

Directory of Open Access Journals (Sweden)

Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez Ferla



Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento / Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including dif [...] ferent species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius concordis (Chant, 1959) and Neoseiulus anonymus (Chant & Baker, 1965), both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921), Polyphagotarsonemus latus (Banks, 1904), Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950), and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day). Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez, Ferla; Gilberto José de, Moraes.


Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae) / Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in english The rubber tree (Hevea brasiliensis Muell. Arg.) (Euphorbiaceae) is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae) on rubber trees, associated with the mite Tenuipalpu [...] s heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm) is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

Ferla, Noeli Juarez; Moraes, Gilberto José de.


Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available The rubber tree (Hevea brasiliensis Muell. Arg. (Euphorbiaceae is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae on rubber trees, associated with the mite Tenuipalpus heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

Noeli Juarez Ferla



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.


Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da Silva



Sarcocysts in the Florida bobcat (Felis rufus floridanus). (United States)

Sarcocysts were found in the tongue, diaphragm, heart, intestinal tunica muscularis, and skeletal muscle of bobcats (Felis rufus floridanus) collected in Florida (USA). The tongue was found to be the best indicator tissue for sarcocysts (P less than 0.005). Thirty of 60 bobcats screened were found to contain sarcocysts in at least one of the muscle tissues examined. Of the positive bobcats, 28 of 28 tongues contained sarcocysts, while only 10 of 27 (37%), and 8 of 26 (31%) contained sarcocysts in the diaphragm or cardiac muscle, respectively. Although immune suppression has been suggested as a possible reason for formation of sarcocysts in some carnivores, no such correlation was evident in the bobcats. Comparisons of prey species taken by the panther and bobcat, and overlap of geographical range by the two species leave questions as to the source of infection, and the species of Sarcocystis that is infecting both felids. PMID:1548790

Anderson, A J; Greiner, E C; Atkinson, C T; Roelke, M E



Bacteriocyte dynamics during development of a holometabolous insect, the carpenter ant Camponotus floridanus  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Abstract Background The carpenter ant Camponotus floridanus harbors obligate intracellular mutualistic bacteria (Blochmannia floridanus) in specialized cells, the bacteriocytes, intercalated in their midgut tissue. The diffuse distribution of bacteriocytes over the midgut tissue is in contrast to many other insects carrying endosymbionts in specialized tissues which are often connected to the midgut but form a distinct organ, the bacteriome. C. floridanu...

Stoll Sascha; Feldhaar Heike; Fraunholz Martin J; Gross Roy



Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background There is an increasing interest to better understand endosymbiont capabilities in insects both from an ecological point of view and for pest control. Blochmannia floridanus provides important nutrients for its host, the ant Camponotus, while the bacterium in return is provided with a niche to proliferate. Blochmannia floridanus proteins and metabolites are difficult to study due to its endosymbiontic life style; however, its complete genome sequence became recently available. Results Improved sequence analysis algorithms, databanks and gene and pathway context methods allowed us to reveal new information on various enzyme and pathways from the Blochmannia floridanus genome sequence [EMBL-ID BX248583]. Furthermore, these predictions are supported and linked to experimental data for instance from structural genomics projects (e.g. Bfl341, Bfl 499 or available biochemical data on proteins from other species which we show here to be related. We were able to assign a confirmed or at least a putative molecular function for 21 from 27 previously conserved hypothetical proteins. For 48 proteins of 66 with a previous putative assignment the function was further clarified. Several of these proteins occur in many proteobacteria and are found to be conserved even in the compact genome of this endosymbiont. To extend and re-test predictions and links to experimentally verified protein functions, functional clusters and interactions were assembled. These included septum initiation and cell division (Bfl165, Bfl303, Bfl248 et al.; translation; transport; the ubiquinone (Bfl547 et al., the inositol and nitrogen pathways. Conclusion Taken together, our data allow a better and more complete description of the pathway capabilities and life style of this typical endosymbiont.

Moya Andres



SEM Observations on the Predation Behavior of Agistemus terminalis (Quayle (Acari: Stigmaeidae and Amblyseius sojaensis Ehara (Acari: Phytoseiidae on Panonychus citri (Mcgregor (Acari: Tetranychidae  

Directory of Open Access Journals (Sweden)

Full Text Available The predation behavior of Agistemus terminalis and Amblyseius sojaensis on Panonychus citri was studied under scanning electron microscope. Agistemus terminalis grasped egg stalk by claws and sensory organ of palpi and direct attack on eggs was done by needle-shaped stylets extruded from the rostrum. A distinct hole was found on the egg surface produced by the penetration and successive withdrawn of the rostrum and stylets. Finally, the hole became wide by the further attack of rostrum and palpi. Amblyseius sojaensis predated on the larvae and adults of P. citri. It grasped the anterior portion of the prey body by palpi and legs. Several sharply pointed and bent setae of palpi invaded into the cuticle of the prey. The prey was then attacked by the chelicerae and the cuticle was lacerated. The drawing of body fluid occurred by the extended malae which were positioned between the corniculi and the chelicerae.

Abdul Razaq



Trypsin inhibitor from edible mushroom Pleurotus floridanus active against proteases of microbial origin. (United States)

Protease inhibitors can be versatile tools mainly in the fields of medicine, agriculture and food preservative applications. Fungi have been recognized as sources of protease inhibitors, although there are only few such reports on mushrooms. This work reports the purification and characterization of a trypsin inhibitor from the fruiting body of edible mushroom Pleurotus floridanus (PfTI) and its effect on the activity of microbial proteases. The protease inhibitor was purified up to 35-fold by DEAE-Sepharose ion exchange column, trypsin-Sepharose column and Sephadex G100 column. The isoelectric point of the inhibitor was 4.4, and its molecular mass was calculated as 37 kDa by SDS-PAGE and 38.3 kDa by MALDI-TOF. Inhibitory activity confirmation was by dot-blot analysis and zymographic activity staining. The specificity of the inhibitor toward trypsin was with Ki of 1.043?×?10(-10) M. The inhibitor was thermostable up to 90 °C with maximal stability at 30 °C, active over a pH range of 4-10 against proteases from Aspergillus oryzae, Bacillus licheniformis, Bacillus sp. and Bacillus amyloliquefaciens. Results indicate the possibility of utilization of protease inhibitor from P. floridanus against serine proteases. PMID:24615526

Ali, P P Manzur; Sapna, K; Mol, K R Rekha; Bhat, Sarita G; Chandrasekaran, M; Elyas, K K



Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

Theron, Pieter; Fernandez, Nestor; Leiva, Sergio; Rollard, Christine



Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina. (United States)

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included. PMID:23825448

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine



Organization of the olfactory pathway and odor processing in the antennal lobe of the ant Camponotus floridanus  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Ants rely heavily on olfaction for communication and orientation. Here we provide the first detailed structure–function analyses within an ant’s central olfactory system asking whether in the carpenter ant, Camponotus floridanus, the olfactory pathway exhibits adaptations to processing many pheromonal and general odors. Using fluorescent tracing, confocal microscopy, and 3D-analyses we demonstrate that the antennal lobe (AL) contains up to 460 olfactory glomeruli organized in seven distin...



Optimization and kinetic studies on treatment of textile dye wastewater using Pleurotus floridanus (United States)

Treatment of textile dye wastewater was carried using Pleurotus floridanus in a batch reactor. Response surface methodology (RSM) was used to optimize the process parameters like pH, temperature, agitation speed and dye wastewater concentration for the decolorization of textile dye wastewater. The optimum conditions for the maximum decolorization was: pH 6.6, temperature 28.8 °C, agitation speed 183 rpm and dye wastewater concentration 1:2. From the results it was found that, the linear effect of agitation speed and initial textile dye wastewater concentration were more significant than other factors for the textile dye wastewater treatment. At these optimized conditions, the maximum decolorization and COD reduction was found to be 71.2 and 80.5 %, respectively. Kinetics of textile dye degradation process was studied by various models like first order, diffusional and Singh model. From the results it was found that the degradation follows first order model with R 2 value of 0.9550.

Sathian, S.; Radha, G.; Shanmugapriya, V.; Rajasimman, M.; Karthikeyan, C.



Efeito de inseticidas em insetos predadores em culturas de algodão  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 60...



Efeito de inseticidas em insetos predadores em culturas de algodão  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório.




Predadores asociados a panonychus citri mcgregor (acari: tetranychidae en la costa central del Perú  

Directory of Open Access Journals (Sweden)

Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor, Typhlodromus (Anthoseius evectus (Schuster, Typhlodromus (Anthoseius transvaalensis (Nesbitt, Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A. evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados

Norberta Martínez



Effect of Temperature on the Biology and Life Tables of Agistemus exsertus Fed Tetranychus urticae (Acari: Stigmaeidae: Tetranychidae) in Hail, Saudi Arabia  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Agistemus exsertus Gonzalez, as a biological control agent of two- spotted spider mite in Saudi Arabia, the effect of temperatures on A. exsertus was studied in laboratory. Predator and prey mite individuals were collected from egg plant leaves growing in a private farm at Hail province in 2010. Immature stages and adult predatory mites were divided into four groups and subjected to 20, 25, 30 and 35C wit...

Al-shammary, Koloud A.



Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator  

DEFF Research Database (Denmark)

Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferases and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator.

Bonasio, Roberto; Li, Qiye



Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metiocarbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram...



Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff (Heteroptera: anthocoridae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say foi coletado nas culturas de milho (Zea mays L., milheto (Pennisetum glaucum (L. R.Br., sorgo (Sorghum spp., feijão (Phaseolus vulgaris L., girassol (Helianthus annuus L., alfafa (Medicago sativa L., soja [Glycine max (L. Merr.], crisântemo (Chrysanthemum spp., tango (Solidago canadensis L. e cartamus (Carthamus tinctorius L. e nas plantas invasoras picão-preto (Bidens pilosa L., caruru (Amaranthus sp., losna-branca (Parthenium hysterophorus L. e apaga-fogo (Alternanthera ficoidea L.. Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen.

Silveira Luís Cláudio Paterno



Local feeding specialization of the red fox (Vulpes vulpes in response to eastern cottontail (Sylvilagus floridanus introduction (NW Italy  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus on the food habits of the red fox (Vulpes vulpes, between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115 in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989. Comparison included also the diet of badgers (Meles meles, considered as potential competitors for food resources. Alien lagomorphs (mean percent volume, Vm% = 68% represented by far the most exploited resource, only three other food items reaching values of mean percent volume barely higher than 5%. Cottontails frequency of occurrence did not vary according either to season or to their reproductive cycle (II-IX vs. X-I, whilst diet niche breadth varied inversely proportional to the use of this key-resource. Overall fox trophic niche breadth varied from 0.64 in 1988-89 to 0.31 in 1998-00 (B, Levin’s index. These findings led us to consider the feeding habits of the fox in the study area as a result of local specialization of a typical generalist carnivore, according to the predictions of optimal foraging theory. No variation occurred in the badger niche breadth since cottontail introduction, whilst niche overlap between foxes and badgers decreased from 0.59 to 0.13 (O, Pianka’s index, possibly reducing competition for food in summer. Riassunto Specializzazione alimentare a livello locale della Volpe Vulpes vulpes in risposta all’introduzione del Silvilago Sylvilagus floridanus (Italia nord occidentale. Per valutare gli effetti dell’introduzione del Silvilago (Sylvilagus floridanus sul comportamento alimentare della volpe (Vulpes vulpes, nel periodo giugno 1998-febbraio 2000, la dieta del carnivoro è stata definita tramite l’analisi di 115 feci raccolte nella Riserva Naturale “Garzaia di Valenza” (Provincia di Alessandria, Italia nord occidentale di circa 250 ha. I risultati ottenuti sono stati confrontati con quelli conseguiti nella medesima area prima dell’introduzione del Silvilago, oltre che con quelli disponibili sulla dieta del Tasso (Meles meles, che può essere ritenuto un potenziale competitore per le risorse alimentari. I lagomorfi sono risultati la categoria alimentare maggiormente consumata (volume medio percentuale, Vm% = 68%, mentre solo tre altre categorie hanno raggiunto valori di Vm di poco superiori al 5%. Non sono emerse variazioni stagionali o relative al periodo riproduttivo (febbraio-settembre vs. ottobre-gennaio del Silvilago, anche se l’ampiezza di nicchia complessiva è risultata inversamente proporzionale al consumo di lagomorfi. L’ampiezza di nicchia della Volpe è scesa da 0,64 nel 1988-89 a 0,31 nel 1998-00. Nel complesso, la dieta della Volpe nell’area di studio può essere considerata l’espressione di una specializzazione a livello locale, così come previsto dalla teoria del foraggiamento ottimale. Non è emersa alcuna variazione per l’ampiezza di nicchia del Tasso, mentre il grado di sovrapposizione (indice di Pianka tra il mustelide e la Volpe è nettamente diminuito (da 0,59 a 0,13. In questi termini la specializzazione della Volpe potrebbe rendere minima la competizione alimentare con il Tasso, in particolar modo in estate, quando la siccità limita la disponibilità di lombrichi.

Alessandro Balestrieri



Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação  

Directory of Open Access Journals (Sweden)

Full Text Available Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol, na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum. A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p<0,05, quando comparado ao apresentado pelos fungos congelados com DMSO 10 % ou água. A produção de esporos foi maior (p< 0,05 no fungo M. appendiculatum preservado a 4masculineC em geladeira.

Campos Artur Kanadani



Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae) Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae) alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae) em la...



Seletividade de oito inseticidas a predadores de lagartas em citros Selectivity of eight insecticides to predators of citrus caterpillars  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure e Protopolybia exigua (Saussure (Hymenoptera: Vespidae em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom.The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure and Protopolybia exigua (Saussure (Hymenoptera: Vespidae was evaluated using insecticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

Tederson Luiz Galvan



Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

Gusmão, Marcos Rafael; Picanço, Marcelo; Leite, Germano L.D.; Moura, Marcelo F..


Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

Marcos Rafael Gusmão



Efeito de inseticidas em insetos predadores em culturas de algodão Effect of insecticides on predator insects associated with cotton  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 60...



Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for popula

Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.


Ácaros predadores associados ao ácaro-da-erinose da lichia / Predator mites associated with the litchi erinose mite  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, [...] da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%), seguida por Phytoseius intermedius (31,2%), Euseius concordis (14,1%), Amblyseius herbicolus (8,8%) e Iphiseiodes zuluagai (3,3%). O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação. Abstract in english The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal var [...] iety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%), followed by Phytoseius intermedius (31.2%), Euseius concordis (14.1%), Amblyseius herbicolus (8.8%) and Iphiseiodes zuluagai (3.3%). Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira, Picoli; Marineide Rosa, Vieira; Eloisa Aparecida da, Silva; Max Sander de Oliveira da, Mota.


Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal variety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%, followed by Phytoseius intermedius (31.2%, Euseius concordis (14.1%, Amblyseius herbicolus (8.8% and Iphiseiodes zuluagai (3.3%. Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira Picoli



Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de indivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um ...



Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispin...



Efeito de inseticidas em insetos predadores em culturas de algodão / Effect of insecticides on predator insects associated with cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); F [...] ipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.). Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare) no campo, e a Cycloneda sanguinea (L.), em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb.), e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs) no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório. Abstract in english To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L.) crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.); Fipronil 800 WDG (64, [...] 80 and 100 g/ha of a.i.); Endosulfan 350 EC (700 g/ha of a.i.); and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare) under field condition and to Cycloneda sanguinea (L.) under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb.), and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L.) and Doru lineare (Eschs) under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.



Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metiocarbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram...



First record of native predators on the invasive species Thaumastocoris peregrinus (Hemiptera:Thaumastocoridae) in Eucalyptus in Argentina / Primer registro de predadores nativos de la especie invasora Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae) en Eucalyptus en la Argentina  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: English Abstract in spanish Se han observado, repetidamente, a dos predadores nativos consumiendo a Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae), chinche del eucaliptus. Para identificar a estos predadores y corroborar si estas especies pueden utilizar a T. peregrinus como alimento aceptable, se [...] obtuvieron muestras de huevos de ambas especies de predadores del arboretum de la Universidad Nacional de Luján. Las ninfas fueron criadas por separado en condiciones de laboratorio y alimentadas ad libitum con ninfas y adultos de T. peregrinus. Se registró el número de presas consumidas diariamente y el tiempo de desarrollo. Las especies de predadores fueron identificadas como Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) y Podisus australis Berg (Hemiptera: Pentatomidae). Este trabajo presenta el primer registro de predadores nativos utilizando a esta especie invasora como fuente de alimento sobre Eucalyptus camaldulensis en la provincia de Buenos Aires, Argentina. Abstract in english Two native predators have been repeatedly observed consuming the bronze bug, Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae). To identify these predators and to corroborate whether these species can use T. peregrinus as a suitable food item, egg samples of both predator [...] species were collected from the arboretum at the Universidad Nacional de Luján. Nymphs were reared individually under laboratory conditions and fed ad libitum with nymphs and adults of T. peregrinus. The number of prey consumed daily and the development time were recorded. The predator species were identified as Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) and Podisus australis Berg (Hemiptera: Pentatomidae). This research presents the first report of native predators using this invasive species as a food resource in Eucalyptus camaldulensis forest in Buenos Aires province, Argentina.

Marina V., Santadino; María B., Riquelme Virgala; Carlos E., Coviella.


Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyroximate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%; and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce Veronez



Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor / Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), [...] uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural. Abstract in english Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae) have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae), in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae), one of the m [...] ost damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

Harley Nonato de, Oliveira; Dirceu, Pratissoli; Eder Pin, Pedruzzi; Marcelo Curitiba, Espindula.


Coenosia attenuata (Dptera: Muscidae), um predador em estudo para utilização em culturas protegidas / Coenosia attenuata (Dptera: Muscidae), a predator being studied for use in greenhouses greenhouses  

Scientific Electronic Library Online (English)

Full Text Available SciELO Portugal | Language: Portuguese Abstract in portuguese Coenosia attenuata Stein, ou “mosca tigre”, predador polífago de importantes pragas agrícolas, enquanto larva e adulto, foi detectado em Portugal, pela primeira vez, em 2002, no Oeste. Para optimização da sua criação em massa, alteraram-se metodologias descritas na bibliografia. Ocorreu maior número [...] de emergências em substratos com maior número de larvas de esciarídeos e em substrato de terra misturado com fibra de coco. Estudou-se, em laboratório, o seu comportamento e capacidade de predação sobre várias espécies, incluindo parasitóides e predadores importantes em culturas protegidas, tendo predado todas as espécies testadas: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta e algumas espécies de Psycodidae. Observaram-se indícios de preferência alimentar das fêmeas de mosca tigre por moscas brancas e larvas mineiras, em relação a diglifos, e diferenças no comportamento de predação sobre moscas brancas em presença de larvas mineiras ou drosófilas. Abstract in english Coenosia attenuata Stein, or “tiger-fly”, a polyphagous predator of important agricultural pests, as larva and adult, was detected for the first time, in Portugal, in 2002, in the “Oeste” region. For mass rearing optimization, the methodologies described in literature were changed. A higher number o [...] f emergences occurred on substrates with higher number of sciarids larvae and on the substrate with soil mixed with coconut fiber. The predation capacity and behaviour of C. attenuata was studied in laboratory in relation to several species, including parasitoids and predators with an important role in protected crops. All species tested were predated: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta and some Psycodidae species. There was evidence of female preference for whiteflies and leafminers in relation to Diglyphus isaea, as well as predation behaviour differences over whiteflies when leafminers or drosophilids were present.

Joana, Martins; Cíntia, Domingos; Raquel, Nunes; André, Garcia; Cristina, Ramos; Célia, Mateus; Elisabete, Figueiredo.


Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina...



Insetos predadores em copas de Citrus deliciosa (Rutaceae sob manejo orgânico no sul do Brasil Predatory insects in canopies of Citrus deliciosa (Rutaceae under organic management in southern Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae (16,87% e Coccidophilus sp. (Coleoptera, Coccinellidae (11,85%. A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações.The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species from ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae (16.87% and Coccidophilus sp. (Coleoptera, Coccinellidae (11.85%. The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

Rosana M. de Morais


Insetos predadores em copas de Citrus deliciosa (Rutaceae) sob manejo orgânico no sul do Brasil / Predatory insects in canopies of Citrus deliciosa (Rutaceae) under organic management in southern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 [...] espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae) (16,87%) e Coccidophilus sp. (Coleoptera, Coccinellidae) (11,85%). A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações. Abstract in english The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species fr [...] om ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae) (16.87%) and Coccidophilus sp. (Coleoptera, Coccinellidae) (11.85%). The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

Morais, Rosana M. de; Barcellos, Aline; Redaelli, Luiza R..


Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21% e a de atividade de postura, à 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

Evaldo Martins Pires



Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae) / Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi e [...] studar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae) alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae) em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21%) e a de atividade de postura, à 0 h (50,56% dos ovos depositados), enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%), seguido das 00 h (29,65%), 18 h (22,36%) e 6 h (16,60%). Abstract in english Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductiv [...] e behavior and predation rate of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21%) and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited) while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58%) followed by those at 12:00 AM (29.65%) 06:00 PM (22.36%) and 06:00 AM (16.60%).

Evaldo Martins, Pires; Rosenilson, Pinto; Mabio Chrisley, Lacerda; José Cola, Zanuncio; Maria do Carmo Queiroz, Fialho.


Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) / Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar [...] os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), sorgo (Sorghum spp.), feijão (Phaseolus vulgaris L.), girassol (Helianthus annuus L.), alfafa (Medicago sativa L.), soja [Glycine max (L.) Merr.], crisântemo (Chrysanthemum spp.), tango (Solidago canadensis L.) e cartamus (Carthamus tinctorius L.) e nas plantas invasoras picão-preto (Bidens pilosa L.), caruru (Amaranthus sp.), losna-branca (Parthenium hysterophorus L.) e apaga-fogo (Alternanthera ficoidea L.). Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter) e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen. Abstract in english The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identification [...] s of the specimens was done in the laboratory. Orius insidiosus (Say) was collected on the following crops: corn (Zea mays L.), pearl millet (Pennisetum glaucum (L.) R.Br.), sorghum (Sorghum spp.), bean (Phaseolus vulgaris L.), sunflower (Helianthus annuus L.), alfalfa (Medicago sativa L.), soybean (Glycine max (L.) Merr.), chrysanthemum (Chrysanthemum spp.), tango (Solidago canadensis L.) and carthamus (Carthamus tinctorius L.). On weeds, O. insidiosus was found on farmer's friend (Bidens pilosa L.), amaranth (Amaranthus sp.), parthenium weed (Parthenium hysterophorus L.) and Joseph's coat (Alternanthera ficoidea L.). Orius thyestes Herring was found on weed plants farmer's friend, amaranth and Joseph's coat. Orius perpunctatus (Reuter) and Orius sp. were collected mainly on weed plants (farmer's friend, amaranth and Joseph's coat) and corn. Many of these plants are natural hosts for these predators, providing refuge, prey and pollen.

Silveira, Luís Cláudio Paterno; Bueno, Vanda Helena Paes; Pierre, Leonardo Santa Rosa; Mendes, Simome Martins.


Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? / Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das r [...] egiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R), calculado com dados de presença/ausência das espécies (Orius e tripes) no mesmo "habitat". Orius insidiosus (Say) foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin) e negativamente associado a Frankliniella schultzei (Trybom) e Caliothrips phaseoli (Hood). Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter) esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton). Abstract in english The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrip [...] s species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R) (presence/absence of the species in the same habitat). Orius insidiosus (Say) was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin), and negatively associated with Frankliniella schultzei (Trybom) and Caliothrips phaseoli (Hood). Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter) was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton).

Silveira, Luís Cláudio Paterno; Bueno, Vanda Helena Paes; Louzada, Júlio Neil Cassa; Carvalho, Lívia Mendes.


Percevejos predadores (Orius spp. (Hemiptera: Anthocoridade e tripes (Thysanoptera: interação no mesmo habitat? Species of Orius (Hemiptera, Anthocoridae and thrips (Thysanoptera: interaction in the same habitat?  

Directory of Open Access Journals (Sweden)

Full Text Available O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das regiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R, calculado com dados de presença/ausência das espécies (Orius e tripes no mesmo "habitat". Orius insidiosus (Say foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin e negativamente associado a Frankliniella schultzei (Trybom e Caliothrips phaseoli (Hood. Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton.The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrips species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R (presence/absence of the species in the same habitat. Orius insidiosus (Say was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin, and negatively associated with Frankliniella schultzei (Trybom and Caliothrips phaseoli (Hood. Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton.

Luís Cláudio Paterno Silveira



Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa Diversity of aphids and their parasitoids and predators in alfalfa crop  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA, em Lavras, MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC.This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.




Ácaros predadores (Acari) em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil / Predators mites (Acari) in native and cultivated plants of the State of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the famili [...] es Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species), was met in Morus spp. (Moraceae) and Tabebuia spp. (Bignoniaceae); Phaseolus vulgaris (Papilionaceae); only one species of the mite was met in Campomanesia spp. (Myrtaceae), Phaseolus vulgaris (Papilionaceae) and Rosa spp. (Rosaceae). In Alamanda spp.(Apocinaceae), Ficus spp. (Moraceae), Jacaranda mimosifolia (Bignoniaceae) and Solanum spp. (Solanaceae) were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

Noeli Juarez, Ferla; Gilberto José de, Moraes.


Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.



Seletividade de Inseticidas a Brevicoryne brassicae (L.) (Hemiptera: Aphididae) e ao Predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Insecticide Selectivity to Brevicoryne brassicae (L.) (Hemiptera: Aphididae) and the Predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve por objetivo estudar a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Brevicoryne brassicae (L.) (Hemiptera: Aphididae), em relação a adultos e ninfas de primeiro, segundo e terceiro estádio [...] s do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe e deltametrina foram altamente seletivos em favor de todos os estádios de desenvolvimento de D. luteipes, sendo que o mesmo ocorreu para o acefato, com exceção de ninfas de primeiro estádio do predador às quais ele é medianamente seletivo. Dimetoato foi, em geral, medianamente seletivo enquanto metamidofós e paratiom metílico foram pouco seletivos em favor do predador. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade do dimetoato (para adultos, ninfas de primeiro e segundo estádios do predador) e metamidofós (para ninfas de terceiro estádio) apresentaram as maiores inclinações, indicando que os estádios estudados apresentam resposta homogênea a esses inseticidas. Abstract in english The objective of this work was to study the selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb to first, second, and third instar nymphs and adults of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) in comparison with l [...] ast instar nymphs of the prey Brevicoryne brassicae (L.) (Hemiptera: Aphididae). Pirimicarb and deltamethrin were highly selective to all developmental stages of D. luteipes; the same was observed with acephate except for first instar nymphs to whom it showed median selectivity. Dimethoate showed median selectivity, but methamidophos and methyl parathion were low selective to the predator. Second and third instar nymphs and adults of D. luteipes were more tolerant to acephate, methyl parathion and pirimicarb than first instar nymphs. First and second instar nymphs showed similar tolerance to deltamethrin, dimethoate and methamidophos. Concentration-response curves for dimethoate (to adults and first and second instar nymphs) and methamidophos (to third instar nymphs) showed steeper slopes indicating an homogeneous response of these developmental stages to these insecticides.



Seletividade de inseticidas às diferentes fases de desenvolvimento do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Selectivity of insecticides to different developmental stages of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O predador Doru luteipes (Scudder) é um dos principais reguladores da população de Spodoptera frugiperda (J.E. Smith) e Helicoverpa zea (Boddie) na cultura de milho (Zea mays). O objetivo do trabalho foi estudar a seletividade de cinco inseticidas químicos (deltametrina, lambdacialotrina, permetrina [...] , diflubenzuron e triflumuron) e dois microbianos [Baculovirus e Bacillus thuringiensis (Berliner)] sobre as diferentes fases de desenvolvimento do predador. Ovos e ninfas dos quatro ínstares receberam os inseticidas diretamente através de um pulverizador acoplado a uma esteira rolante. Adultos do predador receberam como alimento posturas de S. frugiperda, que foram pulverizadas com os diferentes inseticidas. Para os ovos, houve um efeito letal pronunciado com os inibidores de crescimento diflubenzuron (81,8% de mortalidade) e triflumuron (78,6%), sendo este também tóxico para os ínstares ninfais (69,6%). Os inseticidas biológicos Baculovirus e B. thuringiensis foram seletivos a todas as fases do predador. A sobrevivência do predador aos inseticidas foi crescente com o instar do inseto (S = 39,5 + 7,79 I, R2² = 0,87). Os adultos foram tolerantes a todos os inseticidas (95,3% de sobrevivência). Abstract in english The earwig Doru luteipes (Scudder) is one the best natural enemies of Spodoptera frugiperda (J. E. Smith) and Helicoverpa zea (Boddie) both pests of maize (Zea mays). The objective of this work was to evaluate the selectivity of five chemical (deltamethrin, lambdacyhalothrin, permethrin, diflubenzur [...] on and triflumuron) and two microbial [Baculovirus and Bacillus thuringiensis (Berliner)] insecticides to the different developmental stages of the predator. Eggs and the four nymphal stages were sprayed using a sprayer connected to a rolling mat. Adults were fed egg masses of S.frugiperda sprayed with insecticides. Eggs of the predator were highly affected by the growth inhibitors diflubenzuron (81.8% mortality) and triflumuron (78.6%), the latter also toxic to the nymphal stages (69.6%). The bioinsecticides Baculovirus and B. thuringiensis were selective to all stages of the predator. The survivorship increased with the increase of the insect's age (S = 39,5 + 7,79 I, R2² = 0,87). Adults were tolerant to all treatments (95.3% survivorship).

Juliana C., Simões; Ivan, Cruz; Luis O., Salgado.


Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae) / Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl). Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molit [...] or com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps. Abstract in english The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl). The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius c [...] incticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

Francisco Roberto de, Azevedo; Francisco de Sousa, Ramalho.


Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl (Heteroptera:Pentatomidae Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl (Heteroptera:Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl. Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molitor com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps.The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl. The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius cincticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

Francisco Roberto de Azevedo



Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.


Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae.  

Directory of Open Access Journals (Sweden)

Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e afertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto.

Anderson Mathias Holtz




Directory of Open Access Journals (Sweden)

Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espéciesThrough the bioassays, it was verified the residual contact, ovicidal and persistence effects of the products chlorfenapyr and fenbutatin-oxide on two species of predaceous mites, Iphiseiodes zuluagai Denmark & Muma and Euseius alatus DeLeon (Acari: Phytoseiidae, associated to the citrus leprosis mite Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. The adult total effect was studied through the residual spray contact method in glass surface, according to IOBC methodology. Ovicidal effect was evaluated through direct spray on the predators mite eggs, also in glass surface. Persistence of the products was evaluated, in laboratory conditions, in arenas made with sprayed orange leaves in the field at 0, 5, 15 and 30 days after the application. Results showed that chlorfenapyr was noxious to I. zuluagai and E. alatus, and fenbutatin-oxide was slightly harmful to E. alatus and innocuous to I. zuluagai. None of the products presented ovicidal effect. Fenbutatin-oxide presented low persistence to both predators mite species, and chlorfenapyr in the smallest rate (31.3 ml was of low persistence and in the great one (62.5 ml moderately persistent. Fenbutatin-oxide was innocuous and slightly harmful to the predaceous mites I. zuluagai and E. alatus, respectively, and of low persistence for both species




Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) / Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de i [...] ndivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um dos fungos Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 e 1189) e Beauveria bassiana (Bals.) Vuill. (604, 634 e 561) sobre ninfas e adultos de P. nigrispinus pelas vias de contato, residual seco e ingestão de presas contaminadas, em laboratório. M. anisopliae ocasionou maior mortalidade do predador que B. bassiana, tanto por contato como por resíduo seco do fungo. Entre as vias de infecção dos fungos o contato causou maior mortalidade do predador. Não houve confirmação de mortalidade de adultos em nenhuma das vias de infecção pelos isolados testados. A predação de larvas de Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminadas com os fungos afetou a produção de ovos das fêmeas adultas, porém o mesmo não foi constatado quando adultos alimentaram-se de presas contaminadas. Os resultados sugerem que isolados de M. anisopliae podem causar mortalidade de ninfas de P. nigrispinus por contato, enquanto os isolados de B. bassiana foram de menor impacto em todas as vias de infecção estudadas, comparados aos isolados de M. anisopliae. Abstract in english Entomopathogenic fungi and the predatory stinkbug Podisus nigrispinus (Dallas) can target simultaneously the same or different pests in agroecosystems. Topical contact during fungal dispersion or spraying, walking on plant surfaces and ingestion of contaminated prey are some of possible ways of inte [...] ractions between fungi and the predatory stinkbug. The impact of three isolates of Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 and 1189) and Beauveria bassiana (Bals.) Vuill. (604, 634 and 561) against nymphs and adults of P. nigrispinus was investigated under laboratory conditions. M. anisopliae caused higher mortality compared to B. bassiana either by topical application or by dry residue on cotton leaves. Topic contact with both fungi caused higher mortality to the predator. No mortality confirmation was reported for the adults. Nymphs fed with cotton leafworm larvae Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminated by the fungi had their reproduction affected, but this was not observed when adult predators fed on contaminated larvae. These findings suggest that isolates of M. anisopliae can cause mortality of P. nigrispinus nymphs by topical contact, while isolates of B. bassiana were less harmful by all ways of infection as compared to M. anisopliae.

Ítalo W.B., França; Edmilson J., Marques; Jorge B., Torres; José V., Oliveira.


Atração do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) por estímulos olfativos de dietas alternativas em laboratório / Attraction of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) by olfactory stimulus of alternative diets in the laboratory  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Doru luteipes consome lagartas de Spodoptera frugiperda, que é atualmente a principal praga da cultura do milho no Brasil. Normalmente, se 70% das plantas tivessem o predador, a praga seria mantida abaixo do nível de dano econômico. Entretanto, o predador ocorre após a praga danificar as plantas. As [...] sim, a disponibilidade de materiais que atraíssem e antecipassem a presença do predador na lavoura poderia reduzir populações da praga. Desta forma, estudou-se em laboratório a atratividade de dietas artificiais para machos e fêmeas do predador D. luteipes. Os tratamentos foram: pupa desidratada e moída do bicho-da-seda; pólen misto, nas quantidades de 0,05; 0,1; 0,2; 0,5 e 1,0g para ambas as dietas. Em olfatômetro, os estímulos da dieta foram comparados à testemunha. Foram realizadas 30 repetições. Os resultados mostraram que houve atratividade tanto para machos quanto para fêmeas. Em geral, a atração foi aumentada com o aumento da quantidade das dietas. Estudos adicionais foram propostos para testar a viabilidade do uso dos materiais como estratégia de manejo da praga no campo. Abstract in english Doru luteipes consumes larvae of Spodoptera frugiperda, which is at this moment the main pest of maize crop in Brazil. In general, if 70% of the plants had this predator the pest would be kept under the threshold of economic damage. However, the predator occurs after the pest damages the plants. Thu [...] s, the availability of materials that would attract and anticipate the presence of predator in the field,could reduce pest populations. In such a way, it was studied in the laboratory the attractiveness of artificial diets for males and females of the D. luteipes. The treatments were: ground dehydrated pupa of the silk worm and pollen mixture in the amounts of 0.05, 0.1, 0.2, 0.5 e 1.0g, for both the diets The diet stimulus were compared to control using a olfactometer. In general, attraction increased with rising amounts of the diets. Further investigations were proposed to test the viability of the usage of the materials to manage the pest in the field.

Nonino, Mariana Campana; Pasini, Amarildo; Ventura, Maurício Ursi.


Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae e ácaros predadores da família Phytoseiidae Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae and mites predators from the family Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks, foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L. DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores.The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L. DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

Hilda Maria Brito



Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae) e ácaros predadores da família Phytoseiidae / Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae) and mites predators from the family Phytoseiidae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks), foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na [...] imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L.) DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores. Abstract in english The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on [...] dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L.) DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

Brito, Hilda Maria; Gondim Junior, Manoel Guedes Corrêa; Oliveira, José Vargas de; Câmara, Cláudio Augusto Gomes da.


Ácaros predadores e o fungo Neozygites floridana associados a tetraniquídeos em soja no Rio Grande do Sul / Predatory mites and the fungus Neozygites floridana associated with spider mites on soybean, in Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi verificar a ocorrência de ácaros predadores e do fungo Neozygites floridana, associados a ácaros tetraniquídeos, em soja (Glycine max L.), no Estado do Rio Grande do Sul. Entre 2003 e 2005, foram avaliadas amostras de folhas de soja das principais regiões produtoras do [...] Estado. Essas amostras foram coletadas de diferentes posições da planta e aleatoriamente na lavoura. As espécies de ácaros predadores encontradas foram: Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis e Galendromus annectens. O fungo N. floridana apresentou ampla distribuição e ocorreu em todas as espécies de tetraniquídeos encontradas: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni e T. urticae. Abstract in english The objective of this work was to verify the occurrence of predatory mites and the fungus Neozygites floridana, associated with spider mites in soybean (Glycine max L.), in Rio Grande do Sul, Brazil. From 2003 to 2005, samples of soybean leaves from the most important soybean producing regions of th [...] e state were evaluated. These samples were collected from different positions of the plant and randomly in the field. The predatory mite species found were Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis, and Galendromus annectens. The fungus N. floridana was widely distributed and occurred in all the spider mite species found: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni and T. urticae.

Roggia, Samuel; Guedes, Jerson Vanderei Carús; Kuss Roggia, Rejane Cristina Roppa; Vasconcelos, Geraldo José Nascimento de; Navia, Denise; Delalibera Junior, Italo.


Ácaros predadores e o fungo Neozygites floridana associados a tetraniquídeos em soja no Rio Grande do Sul Predatory mites and the fungus Neozygites floridana associated with spider mites on soybean, in Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi verificar a ocorrência de ácaros predadores e do fungo Neozygites floridana, associados a ácaros tetraniquídeos, em soja (Glycine max L., no Estado do Rio Grande do Sul. Entre 2003 e 2005, foram avaliadas amostras de folhas de soja das principais regiões produtoras do Estado. Essas amostras foram coletadas de diferentes posições da planta e aleatoriamente na lavoura. As espécies de ácaros predadores encontradas foram: Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis e Galendromus annectens. O fungo N. floridana apresentou ampla distribuição e ocorreu em todas as espécies de tetraniquídeos encontradas: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni e T. urticae.The objective of this work was to verify the occurrence of predatory mites and the fungus Neozygites floridana, associated with spider mites in soybean (Glycine max L., in Rio Grande do Sul, Brazil. From 2003 to 2005, samples of soybean leaves from the most important soybean producing regions of the state were evaluated. These samples were collected from different positions of the plant and randomly in the field. The predatory mite species found were Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis, and Galendromus annectens. The fungus N. floridana was widely distributed and occurred in all the spider mite species found: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni and T. urticae.

Samuel Roggia



A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As hidras são os representantes mais comuns dos cnidários de água doce. Em geral, estes organismos são encontrados em todos os continentes, exceto na Antártica. O presente estudo teve como objetivo obter informações mais aprofundadas sobre aspectos biológicos [...] e ecológicos de duas espécies de Hydra nativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predação e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espécies. Os resultados indicaram que as duas espécies de Hydra não foram consumidas por nenhum dos predadores testados, os quais são usuais predadores de invertebrados em águas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espécie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de copépodos calanóides e os pequenos cladóceros, e selecionou negativamente as presas grandes, como os adultos de copépodos calanóides e os ostrácodos. Já a espécie H. salmacidis, a qual apresenta um tamanho maior, além de ter preferência pelos náuplios e copepoditos de copépodos calanóides e pequenos cladóceros, também selecionou positivamente os indivíduos adultos dos copépodos calanóides. Os resultados obtidos evidenciaram que as espécies H. viridissima e H. salmacidis provavelmente são pouco ou não são predadas em muitos ambientes naturais, sendo elas próprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos são predadores eficientes e observou-se uma relação positiva entre o tamanho da espécie de Hydra e o tamanho da presa. A seletividade alimentar destas espécies esteve relacionada com o tamanho das presas, assim como com outras características, tais como a espessura da carapaça e a eficiência de natação. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

Massaro, Fernanda Cristina; Negreiros, Natalia Felix; Rocha, Odete.


Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil / Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a ocorrência do ácaro vermelho do tomateiro (Tetranychus evansi Baker & Pritchard) e de ácaros predadores em quatro das espécies mais abundantes de solanáceas nativas do litoral de Pernambuco. Foram feitas coletas mensais de amostras de plantas de meados de setembro de 2002 a fins de maio [...] de 2003, nos municípios de Aliança, Carpina, Camaragibe, Goiana, Igarassu e Recife. Foram encontrados 5.485 ácaros pertencentes a mais de 27 espécies, das quais as mais numerosas foram as espécies fitófagas T. evansi e Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), e as espécies predadoras Asca sp. (Ascidae), Phytoseius guianensis De Leon e Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (ambos Phytoseiidae). Índices de associação negativos foram determinados entre T. evansi e quatro espécies de fitoseídeos predadores [as três mais numerosas encontradas neste estudo assim como Phytoseiulus macropilis (Banks)]. Foram também realizados testes em laboratório para se avaliar a aceitação de Tetranychus urticae Koch e T. evansi como presas àqueles predadores. Apenas P. macropilis sobreviveu e ovipositou adequadamente quando alimentado com T. urticae. Embora conseguissem se manter vivos por alguns dias quando alimentados com T. evansi, os níveis de reprodução dos quatro predadores foram muito baixos. Esses resultados indicam que embora encontrados comumente sobre solanáceas no campo, aqueles predadores alimentam-se muito pouco ou não se alimentam de T. evansi na natureza. Abstract in english The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Ca [...] maragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), and the predaceous species Asca sp. (Ascidae), Phytoseius guianensis De Leon and Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (both Phytoseiidae). Negative indexes of association were determined between T. evansi and each of four species of predaceous phytoseiids [i.e., the three most numerous species found in this study as well as Phytoseiulus macropilis (Banks)]. Laboratory tests were also conducted to evaluate the acceptability of Tetranychus urticae Koch and T. evansi as prey by the four predatory species. Only P. macropilis survived and oviposited well when fed T. urticae. Although they were able to remain alive for some days when fed T. evansi, the reproduction levels of the four predator species were very low. These results suggest that despite being commonly found on solanaceous plants in the field, these predators feed very little or do not feed at all on T. evansi in nature.

Alexsandra A., Rosa; Manoel G.C., Gondim Jr.; Komi K.M., Fiaboe; Gilberto J. de, Moraes; Markus, Knapp.


Impacto da temperatura e da defesa da presa na utilização de Tenebrio molitor L. por ninfas do predador Supputius cincticeps (Heteroptera:Pentatomidae) / Impact of the temperature and of the prey defense on the utilization of Tenebrio molitor L. by nymphs of the predator Supputius cincticeps (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudaram-se os efeitos da temperatura e da defesa da presa na utilização de larvas de Tenebrio molitor L. pelas ninfas do predador Supputius cincticeps (Stäl). Constatou-se que o crescimento de S. cincticeps ocorreu em função da defesa da presa e/ou da temperatura. A taxa de consumo relativo de lar [...] vas de T. molitor pelo S. cincticeps dependeu do ínstar do predador e da temperatura ambiente e também do comportamento de defesa da presa. A eficiência de conversão das larvas de T. molitor ingeridas por ninfas de S. cincticeps dependeu do ínstar do predador, da temperatura e da defesa apresentada pela presa. A taxa de crescimento relativo de S. cincticeps dependeu do ínstar do predador e da temperatura do ambiente, e do ínstar do predador e da defesa da presa. Abstract in english The effects of the temperature and of the prey defense on the utilization of Tenebrio molitor L. larvae by the nymphs of the predator Supputius cincticeps (Stäl) were studied. Growth of S. cincticeps was function of the prey defense and/or temperature. The relative consumption rate of T. molitor lar [...] vae by S. cincticeps depended on the instar of the predator and on the temperature, and also on the defense behavior of the prey. The efficiency of conversion of T. molitor larvae ingested by nymphs of S. cincticeps depended upon the predator instar, temperature and defense of the prey. The relative growth rate of S. cincticeps was related to predator instar and temperature, and predator instar and defense of the prey.

Francisco R. de, Azevedo; Francisco S., Ramalho.


Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae) em culturas de pepino e morango / Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae) in cucumber and strawberry crops  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fit [...] oseídeos Amblyseius idaeus (Denmark & Muma) e Phytoseudus macropilis (Banks), comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4) para o pepino e 5 tratamentos para o morangueiro (T1-T5): T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae. Abstract in english The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytosei [...] ids Amblyseius idaeus (Denmark & Muma) and Phytoseudus macropilis (Banks), commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4) and 5 treatments for strawberry crops (T1-T5): T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A., Watanabe; G.J. de, Moraes; I., Gastaldo Jr.; G., Nicolella.


Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops  

Directory of Open Access Journals (Sweden)

Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A. Watanabe



Consumo alimentar e crescimento do predador Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae) alimentando-se de lagartas de curuquerê-do-algodoeiro / Food consumption and growth of the predator Supputius cincticeps (Stäl)(Heteroptera:Pentatomidae) fed larvae of cotton leafworm  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Determinou-se a quantidade de alimento consumido por ninfas de Supputius cincticeps (Stäl) em relação à quantidade disponível de presa, e as relações entre o consumo de alimento pelas ninfas do predador e seu crescimento e desenvolvimento, tendo como alimento lagartas de 2°, 3°, 4° e 5° ínstares de [...] Alabama argillacea (Huebner). Para o 2° ínstar do predador, a regressão entre o crescimento diário de ninfas e o consumo de alimento foi quadrática e para os demais estádios foi linear. Ninfas que se alimentaram de presas pequenas (4,71 mg), tiveram seu crescimento reduzido em 75,3%. A taxa de desenvolvimento foi relacionada linearmente com o consumo diário de alimento, em cada um dos instares do predador. No 4° e 5° ínstares, o período de desenvolvimento foi prolongado em 418,4 e 196,7%, respectivamente, quando as ninfas se alimentaram de presas pequenas. A quantidade de alimento consumido em função de sua maior ou menor disponibilidade, influenciou as taxas de crescimento e de desenvolvimento e a sobrevivência ninfal de S. cincticeps. Abstract in english The amount of food consumed by nymphs of Supputius cincticeps (Stäl) and the relationship between food intake and growth and development rates using larvae of cotton leafworm Alabama argillacea (Huebner) as food was evaluated. The regression analysis indicated a quadratic function between daily grow [...] th of 2nd-instar nymphs of S. cincticeps and food consumption, but for the 3rd - 5th instars this function was linear. Nymphs fed with small preys (4.71 mg) had their growth reduced (75.3%). The rate of development showed a linear relationship with the daily food consumption for each instar of the predator. For the 4th and 5th instars, the period of development increased (418.4 e 196.7%, respectively) when small preys were supplied to the predator. The amount of food consumed in function of its availability, influenced the rates of growth and development, and the nymphal survival of S. cincticeps.

Evandro N., Silva; Terezinha M., Santos; Francisco S., Ramalho.


Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions  

Directory of Open Access Journals (Sweden)

Full Text Available OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada caixa, e a cada semana acrescentavam-se 100 larvas por caixa/dia, até se obter um máximo de 500 larvas/dia. Comprimento e peso dos peixes foram medidos semanalmente. RESULTADOS: Foram utilizadas 369.000 larvas no total. O Trichogaster trichopteros foi a única espécie em que ambos os sexos predaram 100% das larvas oferecidas. O Betta splendens deixou de predar apenas 15 larvas. Machos do Poecilia reticulata apresentaram baixa capacidade larvófaga quando comparados às fêmeas da mesma espécie. Em relação ao peso e tamanho o Betta splendens mostrou-se capaz de predar 523 larvas/grama/dia. CONCLUSÕES: Fêmeas e machos de Trichogaster trichopteros e de Astyanax fasciatus, e fêmeas de Betta splendens e de Poecillia sphenops foram os peixes que apresentaram maior competência para predar as larvas. Embora com competência menor, machos de Poecillia sphenops e fêmeas de Poecilia reticulata foram capazes de eliminar o número de larvas de Aedes aegypti que possam emergir durante 24 horas num criadouro, em condições naturais. Machos de Poecilia reticulata não foram predadores eficazes.OBJECTIVE: To evaluate the efficacy of fish as predators of the Aedes aegypti larvae in laboratory conditions. METHODS: The male and female of five different fish were included in the experiment. The tests to measure their consumption ability lasted five weeks for each species. Each trial involved four test tanks and four control tanks. Two control tanks contained just one fish, and the other two just larvae. Each of the test tanks contained one fish and the larvae. During the first week, 100 larvae were placed in the tank, with an additional 100 added every week, up to a maximum daily amount of 500 larvae. The length and weight of the fish were measured at the beginning and end of every week. RESULTS: A total of 369,000 larvae were used. The Trichogaster trichopteros was the only species in which both sexes ate 100% of the available larvae. The Betta splendens failed to eat only 15 larvae. The male Poecilia reticulate showed a strong capacity for larvae eating, compared with the female of the same species. In terms of weight and size, the Betta splendens proved capable of eating 523 larvae per gram of weight per day. CONCLUSIONS: The female and male Trichogaster trichopteros and Astyanax fasciatus, and the female Betta splendens and Poecilia sphenops proved to be the most effective predators of the Aedes aegypti larvae. And although the male Poecilia sphenops and female Poecilia reticulata were less effective, they were also capable of eradicating the total number of Aedes aegypti larvae that could appear over 24 hours in a breeding site under natural conditions. The male Poecilia reticulata, however, proved incapable of doing so.

Luciano Pamplona de Góes Cavalcanti



Adequabilidade de diferentes substratos à oviposição do predador Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Suitability of different substrates for oviposition of the predator Orius insidiosus (Say) (Hemiptera: Anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fêmeas de Orius insidiosus (Say) colocam seus ovos endofíticamente, em diversas plantas, e um obstáculo para a criação massal desse predador é a seleção de um substrato de oviposição que seja de fácil obtenção e aceito pelo inseto. O objetivo deste estudo foi avaliar a preferência e a adeqüabilidade [...] de diferentes substratos de oviposição para O. insidiosus. Os testes foram conduzidos em câmaras climatizadas reguladas a 25 ± 1°C, UR de 70 ±10% e fotofase de 12h. Os substratos avaliados quanto à preferência e adequabilidade foram caule de caruru (Amaranthus viridis L.), caule e vagem de feijão (Phaseolus vulgaris L.), vagem de feijão-de-vagem (Phaseolus vulgaris L.) e inflorescências de picão-preto (Bidens pilosa L.). Na adequabilidade também foi avaliado o caule de poaia-do-campo (Spermacoce latifola Aubl.). Fêmeas submetidas aos testes com e sem chance de escolha preferiram ovipositar em inflorescências de picão-preto. O período de pré-oviposição foi influenciado pelo tipo de substrato, sendo menor na presença da inflorescência de picão-preto (3,0 dias) e no feijão, tanto no caule (3,1dias) como na vagem (3,7 dias) comparado aos demais substratos. O período de oviposição, bem como a longevidade foram cerca de três a quatro vezes menores na presença do caule de poaia-do-campo (8,9 dias). O número total de ovos/fêmea de O. insidiosus foi maior em inflorescências de picão-preto (163,3 ovos). Os resultados indicam a adeqüabilidade das inflorescências de picão-preto como substrato de oviposição para O. insidiosus, sendo o preferido nos testes, com e sem chance de escolha, e onde as fêmeas apresentaram melhor performance reprodutiva. Abstract in english Orius insidiosus (Say) females lay eggs inside plant tissue. An obstacle for its mass rearing is the selection of a plant that is suitable and well-accept by the female for oviposition. The objectives of this work were to evaluate the preference and the suitability of different plant structures as o [...] vipositional substrates for O. insidiosus. The trials were conducted in climatic chamber at 25 ± 1°C, RH 70 ± 10% and photophase 12h. The plant sites as amaranth stem (Amaranthus virides L.), common bean's stem and pod (Phaseolus vulgaris L.), green bean's pod (Phaseolus vulgaris L.) and farmer's friend inflorescence (Bidens pilosa L.) were evaluated in no-choice and choice tests. The broadleaf button weed stem (Spermacoce latifola Aubl.) was also used to evaluate the suitability on the reproductive parameters. The females of O. insidiosus preferred to oviposit in farmer's friend inflorescence in no-choice and choice tests. The pre-oviposition period was affected by the plant site used as an ovipositional substrate, being shorter in farmer's friend inflorescence (3.0 days) and in common bean (both on stem (3.1 days) and pod (3.7 days) compared to all substrates evaluated. The oviposition period and the longevity were about three or four times shorter on broadleaf button weed stem (8.9 days). The total number of eggs/ female was higher in farmer's friend inflorescence (163.3 eggs). The results indicated the preference and suitability of farmer's friend inflorescence as an ovipositional substrate for O. insidiosus, in which the females showed better reproductive performance.

Mendes, Simone M.; Bueno, Vanda H.P.; Carvalho, Lívia M..



Directory of Open Access Journals (Sweden)

Full Text Available

The cotton plant hosts a complex of pests that can damage plant structures. Its supported development, in this agroecosystem, demands the implementation of an integrated pest management (IPM system. The goal of this research was to study the selectivity of pesticides over predators of cotton plant pests. The experimental design was randomized blocks, with 9 treatments (84 days after the emergence and 4 replicates. The sampling involved the beat cloth method, with 5 beats per plot, allowing to identify and count the living predators. Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1,000 g ha-1, Thiamethoxam 250 WG (200 g ha-1, and Acetamiprid 200 SP (150 g ha-1 were not selective for the complex of the predators identified, with mortality percentages ranging from moderately toxic to toxic. Etofenprox 300 EC (450 mL ha-1 was the most toxic pesticide, when compared to the others treatments. The Flonicamid 500 WG (150 g ha-1 treatment was selective, with average of predators similar to the control, until 8 days after spraying. Among the pesticides evaluated, only Flonicamid 500 WG was considered selective, according to the IOBC classification, because it showed the lowest mortality percentage for the complex of predators identified.

KEY-WORDS: Gossypium hirsutum L.; insecta; pesticides; cotton plant; predators.

O algodoeiro é hospedeiro de um complexo de pragas, que podem ocasionar danos às estruturas das plantas. Para o desenvolvimento sustentado, neste agroecossistema, há necessidade da implementação do Manejo Integrado das Pragas (MIP. O objetivo deste trabalho foi estudar a seletividade de inseticidas aos predadores das pragas do algodoeiro. O delineamento experimental utilizado foi o de blocos ao acaso, com nove tratamentos e quatro repetições. Os tratamentos foram aplicados aos 84 dias após a emergência. As amostragens foram feitas através do método de batida de pano, com cinco batidas ao acaso, por parcela

Izidro dos Santos de Lima Júnior



Avaliação in vitro do fungo predador de nematoides Duddingtonia flagrans sobre larvas infectantes de ciatostomíneos de equinos (Nematoda: Cyathostominae) / In vitro evaluation of nematode predacious fungus Duddingtonia flagrans on cyathostomes infective larvae of equines (Nematoda: Cyathostominae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A capacidade predatória de um isolado de fungo predador de nematoides Duddingtonia flagrans (AC001) sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%). Houve redução significativa (p [...] vas infectantes de ciatostomíneos recuperadas do meio AA2%, ao final de sete dias. Os resultados desse ensaio evidenciam que o isolado fúngico AC001 poderia ser utilizado no controle biológico de ciatostomíneos de equinos. Abstract in english The predatory capacity of one isolate of nematode-trapping fungus Duddingtonia flagrans (AC001) on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%). There was significant reduction (p [...] athostomes recovered of medium WA 2% at seven day. These results show that the isolated AC001 could be used in the biological control of cyathostomes of horses.

Fabio R., Braga; Araújo, Jackson V.; Araujo, Juliana M.; Silva, André R.; Carvalho, Rogério O.; Campos, Artur K..


Avaliação in vitro do fungo predador de nematoides Duddingtonia flagrans sobre larvas infectantes de ciatostomíneos de equinos (Nematoda: Cyathostominae In vitro evaluation of nematode predacious fungus Duddingtonia flagrans on cyathostomes infective larvae of equines (Nematoda: Cyathostominae  

Directory of Open Access Journals (Sweden)

Full Text Available A capacidade predatória de um isolado de fungo predador de nematoides Duddingtonia flagrans (AC001 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Houve redução significativa (p The predatory capacity of one isolate of nematode-trapping fungus Duddingtonia flagrans (AC001 on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. There was significant reduction (p < 0. 01 of 93.64% in the average of infective larvae of cyathostomes recovered of medium WA 2% at seven day. These results show that the isolated AC001 could be used in the biological control of cyathostomes of horses.

Braga Fabio R.



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Directory of Open Access Journals (Sweden)

Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

Maria A Medeiros



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.


Initial screening of little known predatory mites in Brazil as potential pest control agents. (United States)

The objective of this study was to evaluate the oviposition rate and the survivorship of some of the most common predators on plants of the natural vegetation of southeastern Brazil, when confined with different food sources. Forty-four laboratory tests were carried out, each corresponding to a different combination of predator species and food source. The predators tested were: Phytoseiidae--Amblyseius acalyphus, Euseius citrifolius, Iphiseiodes zuluagai, Metaseiulus (Metaseiulus) camelliae, Typhlodromips cananeiensis; Stigmaeidae--Agistemus floridanus, Zetzellia malvinae; Tydeidae--Pronematus sp. For most predators, the highest oviposition rate and survivorship were obtained when the prey was one of the tenuipalpid mites, Brevipalpus phoenicis or Tenuipalpus heveae. With the exception of A. floridanus, the predators had low oviposition rate and survivorship on Calacarus heveae relative to their respective rate on other food sources. Predators had also generally low oviposition rate and survivorship when feeding on Tetranychus urticae, Oligonychus gossypii or Frankliniella sp. PMID:16770686

De Vis, R M J; de Moraes, G J; Bellini, M R



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores / Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tr [...] atamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília); cebola + milho (Zea mays L.); cebola + rúcula (Eruca sativa L.) + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento. Abstract in english The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind), and syrphid predators (Toxomerus spp.), population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatm [...] ents were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench) (Poligonaceae); onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.); onion intercropped with carrots (Daucus carota L.) Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.); onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

Gonçalves, Paulo Antonio de Souza; Sousa e Silva, Carlos Roberto.


Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Directory of Open Access Journals (Sweden)

Full Text Available Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench; cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.; cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília; cebola + milho (Zea mays L.; cebola + rúcula (Eruca sativa L. + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento.The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind, and syrphid predators (Toxomerus spp., population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatments were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench (Poligonaceae; onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.; onion intercropped with carrots (Daucus carota L. Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.; onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

Paulo Antonio de Souza Gonçalves



Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepi...



Primeiro registro de Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) e sua associação com insetos predadores, parasitóides e formigas em couve (Cruciferae) no Brasil First record of Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) and its association with predator insects, parasitoids and ants in kale (Cruciferae) in Brazil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este estudo descreve a fauna de insetos predadores, parasitóides e formigas associada a pulgões em couve (Brassica oleracea L. var. acephala D.C.), cultivada em sistema orgânico. O pulgão foi identificado como Lipaphis pseudobrassicae Davis, sendo este o primeiro registro da espécie atacando couve no Brasil. Parasitismo primário por Diaeretiella sp. e Aphidius sp. e hiperparasitismo por Aphydencyrtus sp., Alloxysta sp., Pachyneuron sp. e Syrphophagus sp. foram observados. Vinte espécie...



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos cons...



Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado / Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o [...] primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) e Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] e do feijoeiro [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) e Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae) e Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae) e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas. Abstract in english This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 [...] ) and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation) and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation)]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) and Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] and bean [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) and Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae) and Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae) and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Bastos, Cristina Schetino; Galvão, João Carlos Cardoso; Picanço, Marcelo Coutinho; Cecon, Paulo Roberto; Pereira, Paulo Roberto Gomes.


Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997 e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas" e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca"]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae e Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] e do feijoeiro [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae e Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae e Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas.This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae and Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] and bean [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae and Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae and Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Cristina Schetino Bastos



Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.


Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Directory of Open Access Journals (Sweden)

Full Text Available O pulgão Schizaphis graminum (Rondani (Hemiptera: Aphididae é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus (Coleoptera: Coccinellidae. O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo.The aphid Schizaphis graminum (Rondani (Hemiptera: Aphididae is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus (Coleoptera: Coccinellidae. The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

Terezinha Monteiro dos Santos



Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests / Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Com o objetivo de selecionar ácaros predadores com potencial de controle de ácaros fitófagos do mamão, foram realizadas, de janeiro de 1999 a fevereiro de 2000, amostragens bimensais de ácaros em dois pomares, um orgânico (Silva Jardim, RJ) e outro com controle químico de pragas, doenças e invasoras [...] (Linhares, ES). Todas as espécies presentes nas brotações laterais, folhas novas, folhas velhas e botões florais dos mamoeiros e nas folhas das plantas invasoras foram quantificadas e identificadas ao menos até família. Apesar da relativamente diversa fauna de ácaros, somente representantes de uma família de predadores, Phytoseiidae, foram encontrados. Dentre estes, Neoseiulus idaeus Denmark & Muma destacou-se por sua abundância e freqüência nas diferentes épocas do ano no pomar de Linhares, coincidindo principalmente com as flutuações na abundância dos tetraniquídeos. Tal ocorrência em um sistema de produção com grande emprego de acaricidas, aliada às características biológicas favoráveis dessa espécie, recomendam-na como candidata a agente de controle biológico de ácaros pragas do mamão, em especial Tetranychus urticae Koch. Abstract in english This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where p [...] ests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least family level. Despite the relatively diverse mite fauna, we found representatives of only one family of predacious mites, i.e. Phytoseiidae. Among these, Neoseiulus idaeus Denmark & Muma was the most abundant and frequent during all seasons in the Linhares orchard, coinciding mainly with the fluctuations in abundance of tetranychid mites. Such occurrence in a production system with large use of acaricides, together with its favorable biological traits reported in the literature, lead us to recommend this species as a good candidate for biological control of papaya mite pests, especially Tetranychus urticae Koch.

Karin F.S., Collier; Jose O.G. de, Lima; Gilberto S., Albuquerque.


Survey of cyclopids (Crustacea, Copepoda) in Brazil and preliminary screening of their potential as dengue vector predators / Levantamento de ciclopídeos (Crustacea, Copepoda) no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de [...] água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01) criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido. Abstract in english INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. lo [...] ngisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01) of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.

Santos, Luciana Urbano dos; Andrade, Carlos Fernando S. de.


Survey of cyclopids (Crustacea, Copepoda) in Brazil and preliminary screening of their potential as dengue vector predators / Levantamento de ciclopídeos (Crustacea, Copepoda) no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue  

Scientific Electronic Library Online (English)

Full Text Available SciELO Public Health | Language: English Abstract in portuguese INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de [...] água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01) criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido. Abstract in english INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. lo [...] ngisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01) of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.

Santos, Luciana Urbano dos; Andrade, Carlos Fernando S. de.


Survey of cyclopids (Crustacea, Copepoda in Brazil and preliminary screening of their potential as dengue vector predators Levantamento de ciclopídeos (Crustacea, Copepoda no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue  

Directory of Open Access Journals (Sweden)

Full Text Available INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01 of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01 criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido.

Luciana Urbano dos Santos



Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical  

Directory of Open Access Journals (Sweden)

Full Text Available The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocerans and copepods were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi avaliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso.

MS. Arcifa



Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido / Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 [...] a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea. Abstract in english The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from [...] 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira, Breda; José Vargas de, Oliveira; Edmilson Jacinto, Marques; Rachel Gonçalves, Ferreira; Mauricéa Fidelis, Santana.


Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea.The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira Breda



Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação / Predatory activity, radial growth and esporulation of nematode-trapping fungus Monacrosporium spp, submitted to cryopreservation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos [...] predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p Abstract in english In vitro tests were performed to evaluate the effect of cryopreservation with or without addition of cryoprotectants (DMSO or glycerol) in the predatory activity on Cooperia sp and Haemonchus sp infective larvae, radial growth and conidial production of two isolates of nematode-trapping fungus (Mona [...] crosporium sinense and M. appendiculatum). The predatory activity on Cooperia and Haemonchus sp infective larvae of the fungus submitted to the different preservations methods did not affected. The radial growth of the fungus cryopreserved with glycerol was higher (p

Campos, Artur Kanadani; Mota, Marcelo de Andrade; Araújo, Jackson Victor de; Cecon, Paulo Roberto.


Ovary development, egg production and oviposition for mated and virgin females of the predator Podisus nigrispinus (Heteroptera: Pentatomidae) / Desenvolvimento ovariano, produção de ovos e oviposição de fêmeas virgens ou acasaladas do predador Podisus nigrispinus (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Insetos Asopinae são predadores generalistas e Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) é a espécie mais estudada desse grupo no Brasil. O objetivo foi avaliar o desenvolvimento ovariano, a produção de ovos e a oviposição de fêmeas de P. nigrispinus virgens ou acasaladas. Cinco fêmea [...] s com 24 horas de idade foram dissecadas e os ovários foram analisados. Quinze fêmeas desse predador foram acasaladas (T1) e outras 15 foram individualizadas sem acasalamento (T2). Os ovários de cinco fêmeas por tratamento foram dissecados e os ovos maduros e em formação foram contados. Cinco fêmeas virgens de P. nigrispinus com 20 dias de idade foram também analisadas. Fêmeas de P. nigrispinus com 24 horas de idade apresentaram baixo desenvolvimento ovariano, sem evidencia de produção de ovócitos. As fêmeas do tratamento T1 apresentaram ovários completamente desenvolvidos, com 22,67 ± 7,26 ovos maduros e 31,33 ± 1,33 ovos em processo de maturação. Ovários de fêmeas do tratamento T2 apresentaram uma quantidade baixa de ovos nos primeiros estágios de maturação (15 ± 1,73). Fêmeas do tratamento T2, dissecadas aos 20 dias, apresentaram 28,33 ± 2,31 e 15 ± 1,96 ovos maduros e imaturos, respectivamente. Fêmeas de P. nigrispinus iniciam a ovogênese e a maturação dos ovos logo após a emergência, porém o acasalamento é importante para manter a produção dos ovos e a oviposição. Abstract in english The Asopinae insects are generalist predators, and Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is the most studied species of this group in Brazil. The objective was to study ovarian development, egg production and oviposition of mated and virgin P. nigrispinus females. Five 24-hours-ol [...] d females were dissected and the ovaries were analyzed. Fifteen females of this predator were mated (T1), and another fifteen were individualized without mating (T2). The ovaries of five females per treatment were dissected and mature and immature eggs were counted. Five virgin females of P. nigrispinus at twenty days old were also analyzed. Twenty-four-hours-old P. nigrispinus females had low ovary development without the evidence of oocyte production. The females of the T1 had completely developed ovaries, with 22.67 ± 7.26 mature eggs and 31.33 ± 1.33 oocytes in the maturation process. Ovaries of females of T2 had a lower quantity of eggs in the early maturation stage (15 ± 1.73). Females of T2 that were dissected at day 20 had 28.33 ± 2.31 and 15 ± 1.96 mature and immature eggs, respectively. Podisus nigrispinus females begin oogenesis and egg maturation soon after their emergence but mating is important to maintain egg production and oviposition.

Marcus Alvarenga, Soares; Joana Darc, Batista; José Cola, Zanuncio; José, Lino-Neto; José Eduardo, Serrão.


Field tests of predaceous pentatomid pheromones and semiochemistry of Podisus and Supputius species (Heteroptera: Pentatomidae: Asopinae) / Testes de campo com feromônios de pentatomídeos predadores e análise semioquímica de espécies dos gêneros Podisus e Supputius (Heteroptera: Pentatomidae: Asopinae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Armadilhas contendo feromônios sintéticos de Podisus nigrispinus (Dallas) e Supputius cincticeps (Stäl) foram testadas no campo, na Universidade Federal de Viçosa, Minas Gerais, Brasil, a partir de 7 de setembro de 1995. Durante a coleta (setembro-outubro/95), não se observou a presença de P. nigris [...] pinus nas armadilhas em teste. No entanto, diversos adultos (machos e fêmeas) de Podisus distinctus (Stäl) foram coletados durante o mesmo período, bem como, alguns adultos de S. cincticeps e dois parasitóides fêmeas de Cylindromyia atra Roeder (Diptera: Tachinidae). Análises químicas do extrato glandular de machos de P. distinctus indicaram que os principais compostos feromonais desta espécie, também são produzidos por P. nigrispinus e S. cincticeps. Devido a este fato, em 6 de novembro, foram colocadas no campo uma série de armadilhas contendo iscas feromonais tanto de P nigrispinus, como de S. cincticeps. As armadilhas foram monitoradas até 6 de fevereiro de 1996. Durante esta segunda etapa do estudo, observou-se que a combinação das duas iscas feromonais aumentou em seis vezes a coleta de adultos de P. distinctus, em comparação com aquelas onde havia somente a isca para P. nigrispinus. Embora a fenologia para estes asopines neotropicais seja semelhante à do predador norte-americano de clima temperado Podisus maculiventris (Say), menos predadores e parasitóides hospedeiros foram coletados. Possíveis feromônios foram identificados para Podisus rostralis (Stäl), em Goiás, Brasil, e Podisus sagitta (Fabricius), de Honduras. Compostos químicos de outras secreções exócrinas destas espécies neotropicais também foram estudados. Abstract in english Traps baited with synthetic pheromones for either Podisus nigrispinus (Dallas) or Supputius cincticeps (Stäl) were field tested at the Universidade Federal de Viçosa, Minas Gerais, Brazil, beginning September 7, 1995. No P. nigrispinus were caught but, in September and October, several adult males a [...] nd females of P. distinctus (Stäl) were caught along with a few adults of S. cincticeps and two females of a tachinid fly parasitoid, Cylindromyia atra Roeder. Chemical analysis of the pheromone gland extract of P. distinctus males indicated that this species produces a pheromone containing the major compounds of P. nigrispinus and S. cincticeps. Therefore, on November 6 a set of traps was baited with the pheromones of both P. nigrispinus and S. cincticeps, and monitored in the field until February 6, 1996. During this second phase of the study, six times more P. distinctus were caught in the combined pheromone treatment than in traps baited only with the P. nigrispinus pheromone. The phenology of these neotropical asopines is like that for P. maculiventris (Say) in temperate North América, although fewer predators and host-seeking parasitoids were caught. Suspected pheromones were also identified for P. rostralis (Stäl) from Goiás, Brazil, and P. sagitta (Fabricius) from Honduras. In addition, the chemistry of other exocrine secretions from these neotropical species was investigated.

Jeffrey R., Aldrich; José C., Zanuncio; Evaldo F., Vilela; Jorge B., Torres; Ronald D., Cave.


A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

Gutierrez, Andrew P.; Pizzamiglio, Marina A..


Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.



Ácaros predadores (Acari) associados à cultura do morango (Fragaria sp., Rosaceae) e plantas próximas no Estado do Rio Grande do Sul / Predatory mites (Acari) associated with strawberry and neighboring plants in the State of Rio Grande do Sul  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste estudo foi determinar as espécies de ácaros predadores associados à cultura do morango e em plantas associadas, no estado do Rio Grande do Sul. Este estudo foi conduzido nos municípios de Bom Princípio, Capitão e Lajeado em plantações de morango da variedade Oso Grande em túnel baix [...] o. As avaliações foram feitas mensalmente entre agosto de 2002 e março de 2004. Nas plantas de morango, as amostras foram constituídas de três folhas coletadas em cada uma das 15 plantas escolhidas ao acaso, totalizando 45 folhas/campo. Nas plantas associadas, o esforço de amostragem foi de uma hora para cada planta avaliada. Ácaros das famílias Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae e Tydeidae foram observados associados com o ácaro rajado, Tetranychus urticae Koch, 1836, praga importante na região onde este estudo foi conduzido. Vinte espécies foram identificadas, 14 das quais pertencem à família Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) e Neoseiulus californicus (McGregor, 1954) foram as espécies mais comuns. Nas plantas asssociadas, a maior diversidade foi observada em Richardia sp. (seis espécies), Agerantum conyzoides L.(quatro espécies) e Sonchus oleraceus L., Bidens pilosa L.e Rumex sp. (três espécies). Uma chave docotômica é apresentada para a identificação das espécies. Abstract in english The aim of this study was to determine the species predatory mites on strawberry crop and associated plants in the State of Rio Grande do Sul. It was conducted in Bom Princípio, Capitão and Lajeado counties, in crops of strawberry Oso Grande variety in low tunnels. The evaluations were done monthly [...] between August 2002 and March 2004. In the plants of strawberry, the samples were constituted of three leaves collected in each of 15 plants taken randomly, totaling 45 leaves/field. In the associated plants, the sampling effort was of one hour for each plant evaluated. Mites of the families Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae and Tydeidae were observed associated with the two-spotted spider mite, Tetranychus urticae Koch, 1836, important pest of this crop in the region where the study was conducted. Twenty species were identified, 14 of which belong to the family Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) and Neoseiulus californicus (McGregor, 1954) were the most common species. On associated plants, the highest diversity of predatory mites was found on Richardia sp. (six mite species), Agerantum conyzoides L. (four mite species) and Sonchus oleraceus L., Bidens pilosa L. and Rumex sp. (three mite species). A dichotomous key is presented for the separation of the species collected.

Ferla, Noeli Juarez; Marchetti, Marla Maria; Gonçalves, Dinarte.


Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

Marcelo Gustavo Ruiz



Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae) em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas / Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae) in residual toxicity persistence tests  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor), são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando expost [...] o a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA), folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus. Abstract in english Phytoseiid mites, mainly Neoseiulus californicus (McGregor), are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the ins [...] ecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA), leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p

Marcelo Gustavo, Ruiz; Gilberto José de, Moraes.


Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.


Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.



Acão de Inseticidas Organofosforados Utilizados no Controle de Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) Sobre o Ácaro Predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Action of Organophosphate Insecticides Used to Control Leucoptera coffeella (Guérin-Mèneville) (Lepidotera: Lyonetiidae) on the Predator Mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O controle químico apresenta vantagens como economicidade e rapidez de ação, e tem sido preferencialmente usado no controle de pragas pelos agricultores. Em contrapartida, entre as desvantagens destaca-se o largo espectro de ação dos compostos, que atingem espécies não-alvos, como inimigos naturais, [...] além de contaminarem o meio ambiente. O presente trabalho avaliou a ação dos inseticidas clorpirifós, dissulfotom, etiom e paratiom-metílico, normalmente usados para controlar o bicho-mineiro-do-cafeeiro Leucoptera coffeella (Guérin-Mèneville), sobre o ácaro predador Iphiseiodes zuluagai Denmark & Muma, agente de controle dos ácaros fitófagos Oligonychus ilicis (McGregor) e Brevipalpus phoenicis (Geijskes) em agroecossistema cafeeiro. Para verificar o efeito seletivo dos compostos sobre o ácaro predador, concentrações discriminatórias (CLs99) dos quatros inseticidas foram determinadas para o 3º instar larval de L. coffeella, através do método de bioensaios de concentração-mortalidade em papel-filtro, impregnado com resíduo seco de inseticidas. O clorpirifós causou 100% de mortalidade dos ácaros testados; o etiom e o paratiom-metílico causaram 34% e 19% de mortalidade, respectivamente. Dissulfotom foi o mais seletivo em favor do predador, não mostrando ação letal. O efeito diferenciado dos inseticidas foi desta forma verificado, e tal informação possibilita a utilização dos inseticidas seletivos no agroecossistema cafeeiro, preservando populações de I. zuluagai e favorecendo o controle biológico exercido pelo ácaro predador. Abstract in english Chemical control has been preferentially used to suppress pests by farmers mainly due to low price of the products and immediate action on target organisms. However, wide action range of the compounds, undesirable effects on non target organisms and the contamination of the environment are among the [...] disadvantages of this method of control. This study evaluated the action of the insecticides chlorpyrifos, disulfoton, ethion and methyl-parathion, normally used to control the coffee leaf-miner, Leucoptera coffeella (Guérin-Mèneville), on the predaceous mite Iphiseiodes zuluagai Denmark & Muma, a control agent of the phytophagous mites Oligonychus ilicis (McGregor) and Brevipalpus phoenicis (Geijskes) in coffee plantation. Discriminatory concentrations (LC99), established on the 3rd instar of L. coffeella, by means of the method of dry insecticide residues impregnated in filter paper, were used to verify the selectivity of the insecticides on the predaceous mite. The insecticide chlorpyrifos caused 100% of mortality in I. zuluagai. Ethion and methyl-parathion showed mortality of 34% and 19%, respectively. Disulfoton presented the highest selectivity for the mite, with no lethal action on the predator. The different effects found on the insecticides' action show that it is possible to use the selective insecticides in coffee plantation to preserve populations of I. zuluagai, thus favouring the biological control on phytophagous mite.



Identification of plant families associated with the predators Chrysoperla externa (Hagen (Neuroptera: Chrysopidae and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae using pollen grain as a natural marker Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen (Neuroptera: Chrysopidae e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae usando o pólen como marcador natural  

Directory of Open Access Journals (Sweden)

Full Text Available The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae and Chrysoperla externa (Hagen (Neuroptera: Chrysopidae, are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when predators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals and H. convergens (43 individuals were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.Os predadores Chrysoperla externa (Hagen (Neuroptera: Chrysopidae e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os predadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos e H. convergens (43 indivíduos foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo.

MA Medeiros



Toxicidade de produtos fitossanitários utilizados na cultura do cafeeiro a larvas de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e efeitos sobre as fases subseqüentes do desenvolvimento do predador / Toxicity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and their effects on subsequent stages of the predator  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a seletividade fisiológica de alguns produtos fitossanitários utilizados em cafeeiro a larvas de Chrysoperla externa (Hagen) e seus reflexos nas fases subseqüentes do desenvolvimento do predador. Os tratamentos avaliados, em g i.a./L de água foram: 1- endosulfam (Thiodan 350 CE - 1,75), 2 [...] - clorpirifós (Lorsban 480 CE - 1,2), 3- betaciflutrina (Turbo 50 CE - 0,013), 4- enxofre (Kumulus 800 PM - 4,0), 5- azociclotina (Peropal 250 PM - 0,31), 6- oxicloreto de cobre (Cuprogarb 500 PM - 5,0) e 7- testemunha (água). As pulverizações foram realizadas em larvas de primeiro, segundo e terceiro ínstares de C. externa, por meio de torre de Potter. Em seguida, as larvas foram individualizadas em tubos de vidro e mantidas em câmara climatizada regulada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12h. A toxicidade dos produtos foi calculada em função do seu efeito total (E) e categorizada conforme escala proposta pela IOBC. Clorpirifós e betaciflutrina foram nocivos a larvas de primeiro ínstar (E > 99%) e os demais foram seletivos. Clorpirifós foi também tóxico a larvas de segundo e terceiro ínstares, sendo os demais compostos inócuos ao predador (E Abstract in english The objective was to evaluate the selectivity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) and their effects on the subsequent developmental stages of the predator. The treatments in g a.i./L of water were: 1 - endosulfan (Thiodan 350 CE - 1.75), 2 - chlorpyrifos (Lors [...] ban 480 CE - 1.2), 3 - betacyfluthrin (Turbo 50 CE - 0.013), 4 - sulphur (Kumulus 800 PM - 4.0), 5 - azocyclotin (Peropal 250 PM - 0.31), 6 - copper oxichloride (Cuprogarb 500 PM - 5.0) and 7 - control (water). The products were sprayed on first, second and third-instar larvae using a Potter's tower. The larvae were individualized in glass tubes and maintained at 25 ± 2ºC, RH of 70 ± 10% and 12h photophase. The toxicity of the pesticides was calculated based in their total effect (E) and classified according to recommendations of IOBC. Chlorpyrifos and betacyfluthrin were harmful to first-instar larvae (E > 99%). Endosulfan, sulphur, azocyclotin and copper oxichloride were harmless to first-instar larvae and the others were selective. Chlorpyrifos was also toxic to second and third-instar larvae, and the other compounds were selective (E

Rogério A., Silva; Geraldo A., Carvalho; César F., Carvalho; Paulo R., Reis; Antônio M.A.R., Pereira; Luciano V., Cosme.


Effect of neem seed oil aqueous solutions on survival and development of the predator Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) / Efeito de soluções aquosas de óleo de sementes de nim, Azadirachta indica, na sobrevivência e desenvolvimento do predador Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os efeitos de soluções aquosas do óleo de sementes de nim sobre o predador Cycloneda sanguinea (L.), nos estágios de ovo, larva e adulto, foram avaliados em laboratório. Em um primeiro experimento, ovos e larvas de 2º ínstar foram pulverizados com as soluções de nim nas concentrações de 0; 0, 5 e 2, [...] 25 ml/l de água apresentaram mortalidade significativa (P Abstract in english The effects of the neem seed oil aqueous solutions on survival and performance of egg, larva and adult stage of the Coccinelid predator Cycloneda sanguinea (L.) were evaluated under laboratory conditions. In a first trial, eggs and 2nd-instar larvae were sprayed with the neem solutions at 0; 0.5 and [...] 2.25 ml/l and kept at 25 ± 1ºC, 70% RH and 14h photoperiod. Egg viability and duration and larvae and pupae survival were evaluated as well as the predatory capacity of the larvae, adult longevity and reproduction. Egg spraying did not affect egg hatch or larvae survival and development. When the larvae were sprayed, significant mortality was observed only at the higher concentration (P

Flávia A.C. da, Silva; Sueli S., Martinez.


Efeito das plantas do algodoeiro e do tomateiro, como complemento alimentar, no desenvolvimento e na reprodução do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of cotton and tomato plants as complementary food on development and reproduction of the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A alimentação em plantas pelo percevejo predador Podisus nigrispinus (Dallas) tem produzido efeitos na sua biologia que variam com a espécie de planta utilizada. Este estudo foi conduzido com o objetivo de avaliar o desenvolvimento e a reprodução de P. nigrispinus confinado sobre as folhas de algodo [...] eiro Gossypium hirsutum cv. Precoce CNPA1 e tomateiro industrial Lycopersicum esculentum cv. IPA5, e alimentados com pupas de Tenebrio molitor (L.). Ninfas e adultos de P. nigrispinus foram confinados com presa sobre algodoeiro, presa sobre tomateiro, com presa e água, e somente presa. O acesso às plantas foi obtido confinando os predadores nas folhas das plantas cultivadas em vasos. Ninfas confinadas em algodoeiro e tomateiro mais presa apresentaram menor duração no segundo e quinto ínstares. No entanto, o menor período ninfal foi observado para ninfas confinadas em algodoeiro mais presa. A sobrevivência de ninfas em cada ínstar e em todo o estágio ninfal foi menor para ninfas mantidas somente com presa comparado com aquelas com presa mais água e com presa sobre a planta. A disponibilidade do algodoeiro juntamente com a presa produziu ninfas de quinto ínstar mais pesadas, quando comparado com o tomateiro mais presa, água mais presa, e somente presa. O peso de adultos na emergência foi menor apenas quando os insetos tiveram acesso somente à presa. No entanto, fêmeas de P. nigrispinus confinadas sobre folhas de algodoeiro com presa ou mantidas com presa e água apresentaram significativo aumento de peso ao iniciar a reprodução, enquanto fêmeas confinadas sobre folhas de tomateiro ou somente com presa não variaram seu peso. A disponibilidade do algodoeiro e do tomateiro proporcionou aumento na produção de ovos e longevidade de P. nigrispinus. Além disso, as fêmeas mantidas com presa sobre as folhas de algodoeiro apresentaram maior taxa de oviposição. Baseado nos parâmetros populacionais taxa reprodutiva, taxa intrínseca de crescimento populacional e tempo médio de geração, conclui-se que o crescimento populacional de P. nigrispinus pode ser melhorado de acordo com o tipo de planta disponível, apresentando melhores resultados quando os insetos foram confinados sobre folhas de algodoeiro, seguido pelo confinamento dos adultos sobre o tomateiro. Além disso, a disponibilidade de água juntamente com a presa também propiciou melhor desenvolvimento da espécie. Abstract in english The occasional feeding on plants by Podisus nigrispinus (Dallas) has produced different responses on its biology according to the plant species available. This study was undertaken to determine the development and reproduction of P. nigrispinus when confined on Gossypium hirsutum cv. Precocious CNPA [...] 1 and processing tomato Lycopersicum esculentum cv. IPA5 plants, using Tenebrio molitor (L.) pupa as prey. Nymphs and adults of P. nigrispinus were provided with prey and plants of cotton, prey and plant of tomato, prey and water, and only the prey. The predator could access the plants by caging nymphs and prey on plant leaves cultivated in pots. Nymphs caged on cotton or tomato plants with prey showed shorter duration of second and fifth ínstars. However, the shortest development period was observed for nymphs caged on cotton plants with prey. Nymphs fed on prey alone had lower survival within each ínstar and for the whole stage when compared to nymphs accessing plant, prey and water. The availability of cotton plants to nymphs produced heavier individuals compared to tomato plants, prey and water, and only prey. The adult weight at emergence was similar between plants and prey plus water, and superior to the treatment with prey alone. However, females of P. nigrispinus with access to the prey and cotton plant and prey and water showed significant body weight increase at the beginning of the reproductive activity, while females confined on tomato plants and only on prey did not range their weight during their lives. The availabilit



Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker / Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os p [...] redadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos) e H. convergens (43 indivíduos) foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo. Abstract in english The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when p [...] redators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals) and H. convergens (43 individuals) were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.

MA, Medeiros; PA, Ribeiro; HC, Morais; M, Castelo Branco; ER, Sujii; ML., Salgado-Laboriau.



Directory of Open Access Journals (Sweden)

Full Text Available The predatory capacity of three isolates of the nematodes predacious fungi Duddingtonia flagrans (AC001, Monacrosporium thaumasium and Arthrobotrys robusta on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. The isolates AC001, NF34 and I31 had presented significant reduction (p<0.01 de 97.5%, 72.5% e 85% respectively in the average of infective larvae of ciathostomes recovered of the medium WA2% in the end of five days. The results of this assay evidence that these isolates could be used in the biological control of ciathostomes of equines.

KEY WORDS:  Arthrobotrys robusta, Cyathostominae, equine, Duddingtonia flagrans, Monacrosporium thaumasium, Nematophagous fungi.

A capacidade predatória de três isolados de fungos predadores de nematoides Duddingtonia flagrans (AC001, Monacrosporium thaumasium (NF34 e Arthrobotrys robusta (I31 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Os isolados AC001, NF34 e I31 apresentaram redução significativa (p<0,01 de 97,5%, 72,5% e 85%, respectivamente, na média de larvas infectantes de ciatostomíneos recuperadas do meio AA2% ao final de sete dias. Os resultados deste ensaio evidenciam que esses isolados poderão ser utilizados no controle biológico de ciatostomíneos de equinos.
PALAVRAS-CHAVES: Arthrobotrys robusta, ciatostomíneos, equinos, Duddingtonia flagrans, fungos nematófagos, Monacrosporium thaumasium.

André Ricardo Silva



Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil Diversity and population fluctuation of mites (Acari in blackberry (Rubus fruticosus, Rosaceae in the state of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae, raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9% and Tetranychidae (13.9%, composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2.1% and Phytoseiidae (0.4% were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae the most common predaceous species.

Márla Maria Marchetti



Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

Márla Maria, Marchetti; Noeli Juarez, Ferla.


Ocorrência de Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae e do predador Pentilia egena (Mulsant (Coleoptera, Coccinelidae em Myrtus communis L. (Myrtaceae, em Pinheiral, RJ Occurrence of Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae and of the predator Pentilia egena (Mulsant (Coleoptera, Coccinelidae on Myrtus communis L. (Myrtaceae, in Pinheiral County, Rio de Janeiro, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1 M. communis pode ser indicada como planta isca; (2 esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3 a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4 a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação, com diferenças significativas em PThe evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 965 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1 M. communis may be indicated as plant bait; (2 this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3 the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4 the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases and 1.03.76 and 1.0-3.98 (in blooming/fructification, with significant differences at P< 0.01.

Edson Henrique de Azeredo



Efeito da suplementação de folhas de Eucalyptus urophylla no desenvolvimento e reprodução do predador Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) / Effect of supplementary feeding on Eucalyptus urophylla leaves in the development and reproduction of the predatory bug Supputius cincticeps (Stal) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se o efeito da alimentação suplementar de folhas de Eucalyptus urophylla, no desenvolvimento e reprodução de Supputius cincticeps (Stal) em laboratório. S. cincticeps foi alimentado com Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) ou T. molitor mais mudas de E. urophylla. A inclusão da [...] planta na alimentação de S. cincticeps, aumentou sua taxa líquida de reprodução Ro (de 7,15 para 24,05), a razão infinitesimal rm (de 0,034 para 0,052), e a razão finita de aumento populacional 1 (de 1,035 para 1,053), em relação ao uso isolado da presa. Conseguiu-se, ainda, aumentar os índices de sobrevivência, a longevidade e a expectativa de vida média para metade da população (ex50), sendo 50,8 e 64,9 dias para os percevejos alimentados com presa e com presa e planta, respectivamente. O predador S. cincticeps apresentou hábitos alimentares que incluem fitofagia e a inclusão da planta na sua dieta, foi vantajosa para a sua criação massal. Abstract in english The effect of supplementary feeding of Supputius cincticeps (Stal) on Eucalyptus urophylla leaves was evaluated in the laboratory. S. cincticeps was fed with Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) larvae or T. molitor larvae plus E. urophylla. The inclusion of this plant for S. cincticeps [...] feeding increased its net reproductive rate (Ro) from 7.15 to 24.05, its infinitesimal ratio (rm) from 0.034 to 0.052, and the finite population increase (1) from 1.035 to 1.053, compared to feeding only with the prey. S. cincticeps fed both plant and prey showed higher survival rate, longevity, and life span for half of the population (ex50), which was 50.8 and 64.9 for bugs fed the prey, and prey and plant, respectively. The inclusion of the plant also increased the reproduction rate of S. cincticeps, thus being recommended for mass rearing of this predator.

Sebastião L., Assis Jr.; Teresinha V., Zanuncio; Germi P., Santos; José C., Zanuncio.


Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.


Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann Schlesener



Ocorrência de Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) e do predador Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) em Myrtus communis L. (Myrtaceae), em Pinheiral, RJ / Occurrence of Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) and of the predator Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) on Myrtus communis L. (Myrtaceae), in Pinheiral County, Rio de Janeiro, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O) da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um [...] total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1) M. communis pode ser indicada como planta isca; (2) esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3) a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4) a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo) e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação), com diferenças significativas em P Abstract in english The evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W) of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 96 [...] 5 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1) M. communis may be indicated as plant bait; (2) this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3) the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4) the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases) and 1.03.76 and 1.0-3.98 (in blooming/fructification), with significant differences at P

Edson Henrique de, Azeredo; William Costa, Rodrigues; Paulo Cesar Rodrigues, Cassino.


Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez Ferla



Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez, Ferla; Gilberto José de, Moraes.


Exigências térmicas e potencial de desenvolvimento dos parasitóides Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) em ovos do percevejo predador Podisus nigrispinus (Dallas) / Thermal requirements and development of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) on the predator stinkbug Podisus nigrispinus (Dallas)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O desenvolvimento e a viabilidade dos parasitóides de ovos Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) foram estudados em cinco temperaturas constantes de 17 a 32°C, em seu hospedeiro, o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatom [...] idae). A duração do período ovo-adulto das fêmeas foi de 10,8 dias (32°C) a 48,6 dias (17°C) para T. podisi e de 10,2 dias (32°C) a 35,4 dias (17°C) para T. brochymenae. A viabilidade, em todas as temperaturas, manteve-se entre 89,0 e 92,7% para T. brochymenae, com redução significativa da viabilidade de T. podisi nas temperaturas extremas de 17 e 32°C. A temperatura base e a constante térmica, para o desenvolvimento das fêmeas foram de 11,1°C e 9,5°C e de 205,3 e 214,7 graus dias, para T. podisi e T. brochymenae, respectivamente. O número de gerações por ano, para os parasitóides e o hospedeiro, estimado com base nas temperaturas de áreas de cultivo de eucalipto, foram de 22,6; 23,9 e 10,2, para T. podisi, T. brochymenae e P. nigrispinus, respectivamente. Essas observações indicam que T. brochymenae é melhor adaptado a variações de temperaturas que T. podisi, no entanto, as duas espécies parasitam com sucesso P. nigrispinus. Abstract in english Development and viability of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) were studied at five constant temperatures ranging from 17°C to 32°C on its host, the predatory bug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae). Fema [...] le development from egg to adult ranged from 10.8 days (32°C) to 48.6 days (17°C) for T. podisi, and from 10.2 days (32°C) to 35.4 days (17°C) for T. brochymenae. Parasitism viability ranged from 89.0 to 92.7% for T. brochymenae. However, T. podisi viability decreased in lower and higher temperatures. Lower threshold temperatures for egg to adult female development was estimated at 11.1°C for T. podisi and 9.5°C for T. brochymenae. Thermal requirements for this period was 205.3 and 214.7 degree-days for T. podisi and T. brochymenae, respectively. Number of generations per year of these parasitoids and its host, considering the temperature conditions of eucalyptus areas, were estimated to be 22.6, 23.9 and 10.2 for T. podisi, T. brochymenae and P. nigrispinus, respectively. These results indicate that T. brochymenae is better adapted to temperature variations than T. podisi, however, both species can successfully parasitize P. nigrispinus.

Jorge B., Torres; Dirceu, Pratissoli; José C., Zanuncio.


Effect of air humidity on the egg viability of predatory mites (Acari: Phytoseiidae, Stigmaeidae) common on rubber trees in Brazil. (United States)

Rubber pest mites, Calacarus heveae and Tenuipalpus heveae, reach economic damage levels at the end of the rainy season and the beginning of the dry season in Brazil. Therefore, low humidity adaptation might be an important characteristic for predatory mites to successfully control pest organisms. This study determined the effect of the relative humidity (RH) levels of 30-100% on the hatching of larvae of Amblyseius acalyphus, Euseius citrifolius, Iphiseiodes zuluagai, Metaseiulus camelliae, Agistemus floridanus and Zetzellia malvinae at 25 +/- 0.5 degrees C. These predatory mites are common on rubber trees in the state of São Paulo and might be used for introduction in the major rubber tree production regions in the state of Mato Grosso. At 70% RH or higher, viability was 70% or higher for all species, indicating that their performance might be higher during the rainy season than during the dry season. Eggs of E. citrifolius and M. camelliae presented higher viability at the lower relative humidity levels than those of other species, indicating that these species might have higher chance to persist in the dry season. It is suggested that M. camelliae should be further evaluated for introduction in the state of Mato Grosso, considering that this mite is not yet present in that area. PMID:16550332

de Vis, Raf Michaël Julien; de Moraes, Gilberto José; Bellini, Marcos Roberto



Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae occurrence in Rio de Janeiro coast, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia.The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia.

Lydia M. S. Oliveira



Contribuição ao conhecimento de alguns Ithomiidae brasileiros, predadores de Solanáceas (Lep., Rhopalocera)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in english This paper is a small contribution to the knowledge of some species of brazilian Ithomiidae (Lep., Rhop.). The Author, during the year 1950, had an oportunity to study the development of the following species: Mechanitis lysimnia Fabr. Mechanitis polymnia casabranca Hsch. Dircenna dero Hübn. Methona [...] themisto (Hübn.) The three first species live, in Piracicaba (State of São Paulo, Brasil), on Solanum variabile Mart., damaging its leaves, Mechanitis polymnia casàbranca being a serious enemy of this medicinal plant. The Author presents some notes on the biological cycle of M. lysimnia, which confirm D'Almeida's observations. Methona themisto is an old pest of Brunfelsia hopeana Benth. In Argentine, according to Hayward's observations, it occurs on Brunfelsia pauciflora Benth. The biology of this species previously has been studied by Figueiredo (1939). In Piracicaba it is not an enemy of B. hopeana on which it is reported to be so harmful elsewhere. The Author's observations were made in the Laboratory of Zoology of the Escola Superior de Agricultura "Luiz de Queiroz" in order to protect the larvae from the attack of their possible natural enemies. Notwithstanding, the Mechanitis polymnia casabranca caterpillars were attacked by an interesting Salticidae, identified by Hélio Camargo as Hasarius adan-soni (Audouin, 1827).

Lordello, Luiz Gonzaga E..


Predators impairing the natural biological control of parasitoids / Predadores prejudicando parasitóides no controle biológico natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Foi analisado um caso bem conhecido de insucesso técnico no controle biológico natural: a coexistência enigmática do bicho-mineiro-do-cafeeiro, Leucoptera coffeellum (Guérin-Mèneville), e seus inimigos naturais. Apesar de ser uma presa adequada a oito espécies de parasitóides e três espécies de vesp [...] as predadoras, todas ocorrendo simultaneamente, o bicho-mineiro-do-cafeeiro apresenta, muito frequentemente, populações acima do nível de dano econômico para o cafezal. Foi demonstrado que vespas predadoras e parasitóides interagem negativamente, possivelmente porque vespas matam as lagartas de bicho-mineiro-do-cafeeiro parasitadas. Fazendo assim, vespas predadoras matam parasitóides indiretamente, prejudicando a eficiência do controle biológico natural. Conclui-se que programas de controle biológico deveriam estar baseados em conhecimentos de interações tróficas, ao invés de simplesmente se basearem em estratégias que envolvam a introdução de inimigos naturais exóticos. Abstract in english A well known case of ineffective natural biological control: the puzzling coexistence of the coffee leaf miner, Leucoptera coffeellum (Guérin-Mèneville), and its natural enemies was analyzed. Despite being a suitable prey to eight parasitoid species and three wasp species, all occurring simultaneous [...] ly, the coffee leaf miner too often presents populations far above the damaging level for the coffee plantation. It is demonstrated that predatory wasps and parasitoids interact negatively, possibly because predatory wasps kill parasitized miner's larvae. In doing so, predatory wasps indirectly kill parasitoids, thereby impairing the efficacy of the natural biological control. It is warned that biological control programs should be based on knowledge of food web interactions, rather than simply on strategies involving introduction of exotic natural enemies.

Ronaldo, Reis Jr; Og De, Souza; Evaldo F., Vilela.


Efeito da escassez de presa na sobrevivência e reprodução do predador Supputius cincticeps (Stål) (Heteroptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O efeito da escassez de presas no desempenho de fêmeas de Supputius cincticeps (Stål) foi estudado a 24,6 ± 0,7ºC, umidade relativa de 80 ± 4% e fotoperíodo de 12h. Larvas de Tenebrio molitor L. foram fornecidas às fêmeas durante 24h, a cada um, dois, quatro, seis ou oito dias; pedaços de vagem de feijão (Phaseolus vulgaris L.) foram fornecidos em todos os tratamentos de forma contínua. A porcentagem de fêmeas com posturas, o período de oviposição e o número de posturas, de ov...



Interactions mediated by predators in arthropod food webs Interações mediadas por predadores em teias alimentares de artrópodes  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic cascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in ...

Madelaine Venzon; Angelo Pallini; Arne Janssen



Ocorrência e flutuação populacional de ácaros associados a seringais vizinhos de fragmentos de cerrado / Occurrence and fluctuation of mite populations associated with rubber tree crop neighbor of fragments of cerrado  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O conhecimento básico da ocorrência sazonal dos ácaros pode fornecer dados para elaboração de programas de manejo ecológico a serem implantados com sucesso no futuro. O objetivo deste estudo foi determinar a riqueza de espécies e a sazonalidade da acarofauna presente em dois campos de seringueira vi [...] zinhos de áreas nativas, no município de Itiquira, MT. Ao longo de um ano, foram realizadas 25 coletas quantitativas em seringueiras vizinhas a dois fragmentos de Cerrado (Cerradão e Mata Ripária). Foram registrados 199.380 ácaros, de 48 espécies, pertencentes a 15 famílias. Dessas, 13 espécies são fitófagas, 18 predadoras e 17 micófagas ou de hábito alimentar desconhecido. Três espécies fitófagas representaram mais de 97% dos ácaros coletados: Phyllocoptruta seringueirae Feres (80,8%), Tenuipalpus heveae Baker (12,7%) e Calacarus heveae Feres (3,6%). Entre os predadores, os mais abundantes foram Agistemus sp., Scirula sp. e Euseius concordis (Chant). Vinte e oito espécies foram comuns aos dois cultivos. As famílias que tiveram o maior número de espécies coletadas na área vizinha ao Cerradão foram, Tydeidae (7), Tarsonemidae (6), Eriophyidae e Phytoseiidae (4) e, na área próxima à Mata Ripária, Tydeidae (9) e Phytoseidae (8). A presença de vegetação vizinha aos seringais deve ser a causa do grande número de espécies de ácaros classificadas como acidentais encontradas neste estudo. As maiores abundâncias e riquezas de espécies ocorreram no final do período chuvoso e início da estação seca. Abstract in english The basic knowledge of the seasonal occurrence of mites can supply data for elaboration of programs of ecological management to be implanted with success in the future. The objective of this study was to determine the species richness and the seasonality of mites present in two areas of rubber tree [...] crops neighboring to native areas in Itiquira, MT. Along one year, 25 quantitative samplings were accomplished in rubber tree crop neighboring to two fragments of Cerrado (Cerradão and Mata Ripária). There were registered 199,380 mites, of 48 species, belonging to 15 families. Of those, 13 species are phytophagous, 18 predators and 17 mycophagous or of unknown alimentary habit. Three phytophagous species represented more than 97% of the mites collected: Phyllocoptruta seringueirae Feres (80.8%), Tenuipalpus heveae Baker (12.7%) and Calacarus heveae Feres (3.6%). Among the predators, the most abundant species were Agistemus sp., Scirula sp. and Euseius concordis (Chant). Twenty-eight species were common to both crops. The families that had the largest number of species collected in the neighboring area to Cerradão were Tydeidae (7), Tarsonemidae (6), Eriophyidae and Phytoseiidae (4), and in the area close to Mata Ripária, Tydeidae (9) and Phytoseiidae (8). The presence of vegetation near the crop should explain the great number of species of mites classified as accidental found in this study. The largest abundances and species richness occurred in the end of the rainy season and beginning of the dry season.

Demite, Peterson R.; Feres, Reinaldo J.F..


ClEST cluster :Cl_singleton2400  

Full Text Available Cl_singleton2400 suppressor protein Cimex lectularius nuclear gene 521 AGATTTATAATCAGTTTTGTAAGTA ATTTTCCGACGACTGATGAAGATCTAGCAGGCTT mb27005 1 Disks large -associated protein 1 [Camponotus floridanus] EFN74


Gluttonous predators: how to estimate prey size when there are too many prey / Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O tamanho das presas é uma importante dimensão do nicho trófico. Em estudos de ecologia alimentar, os itens alimentares são geralmente medidos individualmente com o uso de paquímetro ou ocular micrométrica. Entre os anfíbios e répteis, há espécies que consomem grande número de itens alimentares pequ [...] enos (e.g. formigas, cupins). Esse grande número, por sua vez, torna a estimativa do tamanho das presas consumidas uma tarefa difícil. Desenvolvemos um método para colher subamostras dos conteúdos estomacais desses animais com o objetivo de obter estimativas de tamanho das presas. Especificamente, desenvolvemos um protocolo baseado em uma rotina de bootstrap que permite a obtenção de subamostras com erro de precisão de no máximo 5% e confiança de 95%. Esse método deve diminuir o esforço amostral e facilitar estudos futuros sobre os hábitos alimentares de anfíbios e répteis, além de fornecer um meio de obter estimativas precisas de tamanho de presas. Abstract in english Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high int [...] ake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

MS., Araújo; A., Pinheiro; SF., Reis.


Downeshela oliveirai, a new neotropical predaceous midge from northern Brazil (Diptera, Ceratopogonidae) Downeshela oliveirai, uma nova espécie neotropical de ceratopogonídeo predador para a região norte do Brasil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A new species of Downeshelea Wirth & Grogan, 1988, D. oliveirai, is described and illustrated based on male and female characteristics. The specimens were collected in Rondônia and Pará states, northern Brazil.Uma nova espécie de Downeshelea Wirth & Grogan, 1988, D. oliveirai, é descrita e ilustrada baseada nas características dos machos e fêmeas. Os espécimes foram coletados nos estados de Rondônia e Pará, região norte do Brasil.

Felippe-bauer, Maria L.; Silva, Cristiane S.



Downeshela oliveirai, a new neotropical predaceous midge from northern Brazil (Diptera, Ceratopogonidae Downeshela oliveirai, uma nova espécie neotropical de ceratopogonídeo predador para a região norte do Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available A new species of Downeshelea Wirth & Grogan, 1988, D. oliveirai, is described and illustrated based on male and female characteristics. The specimens were collected in Rondônia and Pará states, northern Brazil.Uma nova espécie de Downeshelea Wirth & Grogan, 1988, D. oliveirai, é descrita e ilustrada baseada nas características dos machos e fêmeas. Os espécimes foram coletados nos estados de Rondônia e Pará, região norte do Brasil.

Maria L. Felippe-Bauer



Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro / Physiologic selectivity of inseticides to wasps predators of the coffee leafminer  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) em concentrações que corresp [...] ondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem. Abstract in english The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) was studied, in laboratory, using 50% and [...] 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.



In vitro evaluation of nematophagous fungi patogenicity against nematode of domestic animals/ Avaliação in vitro da patogenicidade de fungos predadores de nematóides parasitos de animais domésticos  

Directory of Open Access Journals (Sweden)

Full Text Available Biological control is a promising alternative for the control of pre-parasitic stages through the action of nematophagous fungi’s. The present study evaluated in vitro the patogenicity of both Arthrobotrys musiformis and A. conoides fungi on “infective larvae (or L3 state larvae” of Haemonchus contortus, L3 larvae of Ancylostoma spp. And larvated eggs of the nematode Ascaridia galli. Nine groups were formed: six treated groups (G1A and G2A: L3 of H. contortus; G1B and G2B: L3 of Ancylostoma spp.; G1C and G2C: larvated eggs of A. galli, being that G1 with A. musiformis and G2 with A. conoides and three untreated groups (G3A, G3B and G3C: larvae of H. contortus, Ancylostoma spp. And eggs of A. galli, respectively, without fungi. Each treatment had ten repetitions (ten Petri dishes with an average of 120 larvae of H. contortus and 200 larvae of Ancylostoma spp. and, approximately, 100 larvated A. galli eggs. The results showed A. musiformis plundered 66% and 94% of Ancylostoma spp. L3 larvae and H. contortus L3 larvae, respectively. While that A. conoides plundered 51,7% and 89,4% at the same larvae. The nematophagous fungi evaluated have not presented any predation type on A. galli larvated eggs. Afterwards, both are promising fungi as to their use for biological control of parasitic helminths of animal hosts.O controle biológico é uma alternativa promissora no controle dos estágios pré-parasitários de helmintos, por meio da ação de fungos nematófagos. Com este propósito, o presente estudo avaliou in vitro a patogenicidade dos fungos Arthrobotrys musiformis e A. conoides sobre larvas infectantes de Haemonchus contortus, Ancylostoma spp. e ovos larvados de Ascaridia galli. Foram utilizados nove grupos: seis tratamentos (G1A e G2A: L3 de H. contortus; G1B e G2B: L3 de Ancylostoma spp.; G1C e G2C: ovos larvados de A. galli, com A. musiformis (G1 e A. conoides (G2, respectivamente e três testemunhos (G3A, G3B e G3C: larvas de H. contortus, Ancylostoma spp. e ovos de A. galli, respectivamente, na ausência do fungo. Cada tratamento constou de dez repetições (placas de Petri, de 90mm de diâmetro, com média de 120 larvas de H. contortus, 200 larvas de Ancylostoma spp. e média de 100 ovos de A. galli. Os resultados demostraram que A. musiformis predou 66,33% e 94,44% das larvas infectantes de Ancylostoma spp. e H. contortus, respectivamente. Enquanto que A. conoides predou 51,76% e 89,39% das mesmas larvas. Os fungos nematófagos avaliados não apresentaram predação sobre ovos larvados de A. galli. Portanto, ambos os fungos mostraram-se promissores quanto a sua utilização no biocontrole desses helmintos parasitos de animais domésticos.

Alvimar José da Costa



In vitro evaluation of nematophagous fungi patogenicity against nematode of domestic animals/
Avaliação in vitro da patogenicidade de fungos predadores de nematóides parasitos de animais domésticos

Digital Repository Infrastructure Vision for European Research (DRIVER)

Biological control is a promising alternative for the control of pre-parasitic stages through the action of nematophagous fungi’s. The present study evaluated in vitro the patogenicity of both Arthrobotrys musiformis and A. conoides fungi on “infective larvae (or L3 state larvae)” of Haemonchus contortus, L3 larvae of Ancylostoma spp. And larvated eggs of the nematode Ascaridia galli. Nine groups were formed: six treated groups (G1A and G2A: L3 of H. contortus; G1B and G2B: L3 of Ancylo...



Hypoxic environments as refuge against predatory fish in the Amazonian floodplains Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pressure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxi...

Mb, Anjos; Rr, Oliveira; Zuanon, J.



Hypoxic environments as refuge against predatory fish in the Amazonian floodplains Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas  

Directory of Open Access Journals (Sweden)

Full Text Available Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pressure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1 but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação, devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1, mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p < 0,001; gl = 1. Isto indica que ambientes com baixa concentração de oxigênio dissolvido podem de fato funcionar como locais de refúgio contra peixes piscívoros nas várzeas amazônicas.

MB. Anjos



Hypoxic environments as refuge against predatory fish in the Amazonian floodplains / Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação [...] , devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1), mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p Abstract in english Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pr [...] essure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1) but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p

MB., Anjos; RR., De Oliveira; J., Zuanon.


Inducers of resistance in potato and its effects on defoliators and predatory insects Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised complete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were...




Contribuição para o conhecimento da Mimosicerya hempeli (Cockerell, 1899) (Homoptera. Margarodidae) e de seu predador Exoplectra erythrogasfer Mulsant, 1851 (Coleoptera, Coccinellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This paper deals with Mimosicerya hempeli (Cock., 1899) (Homoptera, Margarodidae) and its predator, the ladybeetle Exo-plectra erythrogaster Muls., 1851 (Coleoptews, Coccinellidae), which were found to occur at Piracicaba, State of São Paulo, Brasil. The first is a pest of "cássia imperial" (Cassia [...] fistula L.), and several other trees. As those insects are little known, a few bionomical notes and descriptions of some of their stages are presented. The adult scales proved to be very resistant to an application of mineral oil plus malathion. Methyl Demeton applied with irrigation water showed no control. The same insecticide injected into the trunk gave very poor results.

Francisco A. M., Mariconi; Adiei P. L., Zamith.


Compatibilidade entre Beauveria bassiana e o predador Chrysoperla externa em laboratório Compatibility between Beauveria bassiana and the predator Chrysoperla externa in laboratory  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar os efeitos do fungo Beauveria bassiana sobre ovos e larvas de Chrysoperla externa. Ovos com até 24 horas de idade e insetos no 1º, 2º e 3º ínstares foram imersos em suspensões fúngicas de 1,0x10(4 a 1,0x10(8 conídios mL-1. Não houve efeito do fungo sobre a viabilidade dos ovos. Larvas de terceiro ínstar foram afetadas por B. bassiana, e as suspensões de 1,0x10(7 e 1,0x10(8 conídios mL-1 interferiram nos parâmetros avaliados.The objective of this work was to evaluate the effect of the fungus Beauveria bassiana on eggs and larvae of Chrysoperla externa. Eggs with 24 hours and insects on 1st, 2nd and 3rd instar were immersed in fungal suspensions at 1,0x10(4 to 1,0x10(8 conidia mL-1 . There was no fungal effect on the eggs viability. Third instar larvae were affected by B. bassiana, and the suspensions with 1,0x10(7 and 1,0x10(8 conidia mL-1 interfered in the evaluated parameters.

Luis Gustavo Amorim Pessoa



Uso de serologia na identificação de predadores de Orphulella punctata (De Geer) (Orthoptera: Acrididae) / Use of serology to identify predators of Orphulella punctata (De Geer) (Orthoptera: Acrididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Serological techniques were used to study Orphulella punctata (De Geer) predators. For preparation of antiserum, rabbits were immunized by the limphonodule injection method with antigens obtained from O. punctata male. Serological tests were performed using double diffusion in agar gel. Specific ser [...] ological reactions were obtained 13 days after the 1st inoculation. After the 2nd inoculation 5 precipitation lines were observed. In the reactions with female antigens there were 2-4 lines, while egg antigens showed 2 lines. These variations in the number of lines were attributed to different physiological states and to ontogeny. Positive reactions were observed for spiders and chrysopids captured in the field.

José E., Serrão; Marta da, Silva; Carlos R., Sousa-Silva; Josué M., Pacheco.


Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.



Gluttonous predators: how to estimate prey size when there are too many prey Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in ...

Ms, Arau?jo; Pinheiro, A.; Sf, Reis



ClEST cluster :Cl_singleton2329  

Full Text Available Cl_singleton2329 long-chain fatty acid transport protein 4 Cimex lectularius nuclear gene 469 CT TAGCACAAGTGTTCCATAATGCT mb23072 1 Long-chain fatty acid transport protein 4 [Camponotus floridanus] EFN719


ClEST cluster :Cl_singleton0672  

Full Text Available Cl_singleton0672 bhlhzip transcription factor bigmax Cimex lectularius nuclear gene 273 GAACAGAG GAGCAGAAGCGAAGGGATGCTATTAAAAAGGGCTACGATT fs03092 1 Max -like protein X [Camponotus floridanus] EFN65369 4.


ClEST cluster :Cl_singleton0146  

Full Text Available Cl_singleton0146 enhancer of rudimentary homolog Cimex lectularius nuclear gene 692 CAGAATCCAAAC TTGTTAAATACATGTACATTTTGACTTAAAAGGAAAAAAA fb08017 1 Enhancer of rudimentary-like protein [Camponotus floridanus


ClEST cluster :Cl_singleton0472  

Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus


Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae  

Directory of Open Access Journals (Sweden)

Full Text Available Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A, Monacrosporium sinense (isolado SF 470, Monacrosporium appendiculatum (isolado CGI, Arthrobotrys robusta (isolado I 31, Arthrobotrys cladodes (isolado CG 719 e Duddingtonia flagrans (isolado CG 768 foram avaliados em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05 durante os cinco dias do ensaio. Estruturas reprodutivas (conídios foram encontradas em todos os isolados no quinto dia. Todos os fungos testados são promissores para serem utilizados no controle biológico de Cooperia sp. e Oesophagostomum sp., parasitos de bovinos.Six isolates of nematophagous fungi Monacrosporium thaumasium (isolate NF 34A, Monacrosporium sinense (isolate SF 470, Monacrosporium appendiculatum (isolate CGI, Arthrobotrys robusta (isolate I 31, Arthrobotrys cladodes (isolate CG 719 and Duddingtonia flagrans (isolate CG 768 were evaluated under laboratory conditions regarding the capacity to entrap infective Cooperia sp. and Oesophagostomum sp. larvae. In the in vitro tests the fungi tested were equally efficient to prey the nematodes (P<0.05 during the five days of the experiment. Reproductive structures (conidia from all isolates were visualized in 5th day. All fungal isolates were efficient in the control of bovine Cooperia sp. and Oesophagostomum sp. parasites.

J.V. Araújo



Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. / Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A), Monacrosporium sinense (isolado SF 470), Monacrosporium appendiculatum (isolado CGI), Arthrobotrys robusta (isolado I 31), Arthrobotrys cladodes (isolado CG 719) e Duddingtonia flagrans (isolado CG 768) foram avaliados [...] em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05) durante os cinco dias do ensaio. Estruturas reprodutivas (conídios) foram encontradas em todos os isolados no quinto dia. Todos os fungos testados são promissores para serem utilizados no controle biológico de Cooperia sp. e Oesophagostomum sp., parasitos de bovinos. Abstract in english Six isolates of nematophagous fungi Monacrosporium thaumasium (isolate NF 34A), Monacrosporium sinense (isolate SF 470), Monacrosporium appendiculatum (isolate CGI), Arthrobotrys robusta (isolate I 31), Arthrobotrys cladodes (isolate CG 719) and Duddingtonia flagrans (isolate CG 768) were evaluated [...] under laboratory conditions regarding the capacity to entrap infective Cooperia sp. and Oesophagostomum sp. larvae. In the in vitro tests the fungi tested were equally efficient to prey the nematodes (P

Araújo, J.V.; Assis, R.C.L.; Campos, A.K.; Mota, M.A..


Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos  

Digital Repository Infrastructure Vision for European Research (DRIVER)

This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where pests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least fami...

Collier, Karin F. S.; Lima, Jose O. G.; Albuquerque, Gilberto S.



Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river, at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were samp...

Marcos Callisto; Goulart, Michael D. C.; Pablo Moreno; Martins, Roge?rio P.



Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937 no controle de nematóides de bovinos Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937  

Directory of Open Access Journals (Sweden)

Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937 foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001. No grupo B (controle, as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (PThe viability of a formulation of the fungus Monacrosporium thaumasium (Drechsler, 1937 was evaluated for the biological control of bovine gastrointestinal nematode parasites. Two groups of seven female calves each, Holstein ´ Zebu crossbred, four to six months of age, were placed in Cynodon dactilon pastures. In group A, each animal received via oral 20g of pellets of M. thaumasium twice a week during a four-month period that began with the onset of the rainy season (October, 2001. In group B (control, the calves did not receive any treatment. The counts of eggs per gram of faeces (EPG for animals of the group B were significantly greater (P<0.05 than those for animals from group A and the difference of the EPG between the animals from groups A and B at the end of the experimental period was 88.8%. Cooperia was the most prevalent genus. It is concluded that the use of this dose and the periodicity of application of M. thaumasium pellets were efficient in the control of bovine gastrointestinal nematode parasites.

P.H. Alves



Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos / Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de C [...] ynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001). No grupo B (controle), as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG) e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P Abstract in english The viability of a formulation of the fungus Monacrosporium thaumasium (Drechsler, 1937) was evaluated for the biological control of bovine gastrointestinal nematode parasites. Two groups of seven female calves each, Holstein ´ Zebu crossbred, four to six months of age, were placed in Cynodon dactil [...] on pastures. In group A, each animal received via oral 20g of pellets of M. thaumasium twice a week during a four-month period that began with the onset of the rainy season (October, 2001). In group B (control), the calves did not receive any treatment. The counts of eggs per gram of faeces (EPG) for animals of the group B were significantly greater (P

P.H., Alves; J.V., Araújo; M.P., Guimarães; R.C. L., Assis; P., Sarti; A.K., Campos.


Stomach content analysis of potential predators of Simuliidae (Diptera: Nematocera) in two lowland forest streams, Central Amazonia, Brazil / Análise do conteúdo estomacal de possíveis predadores de Simuliidae (Diptera: Nematocera), em dois igarapés de terra firme na Amazônia Central, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O conteúdo estomacal de insetos (Plecoptera e Odonata), crustáceos e peixes foi analisado por meio de dissecção para se verificar a predação sobre imaturos de simulídeos e identificação dos outros itens alimentares. O trabalho foi realizado em dois igarapés da Reserva Florestal Adolpho Ducke (Sabiá- [...] I), Manaus - AM, pertencente ao Instituto Nacional de Pesquisas da Amazônia (INPA), com espécimes coletados mensalmente no período de abril de 1992 a maio de 1993 e nos meses de novembro de 1993 e junho de 1994. As coletas foram realizadas por meio de cestas-armadilhas (contendo folhas de jambeiro, Eugenia malaccensis L., Myrtaceae) e rapiché. Constatou-se a predação de imaturos de Simuliidae por um exemplar de peixe (Microcharacidium gnomus, Characidae), Plecoptera (Perlidae) e Odonata (Gomphidae, Agrionidae, Libellulidae, Dicteriadidae e Coenagrionidae). Outros itens alimentares observados nos organismos analisados foram Diptera (Chironomidae), Trichoptera (Hydropsychidae, Hydroptilidae), Coleoptera (Elmidae), Hymenoptera (Formicidae), Ephemeroptera (Baetidae, Leptophlebidae), outros insetos, ovos de insetos, Hydracarina, Crustacea, Nematoda, detritos e restos vegetais. Abstract in english [...

Yamile B., Alencar; Neusa, Hamada; Sandra, Magni-Darwich.


Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed flocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time wit...

Ragusa-netto, J.



Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima, respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável.

JMF. Penha



Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil / Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima [...] , respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável. Abstract in english Fishery is an important economic activity in the Pantanal. Among the region?s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and se [...] venth largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.

Penha, JMF.; Mateus, LAF..


Survey of cyclopids (Crustacea, Copepoda) in Brazil and preliminary screening of their potential as dengue vector predators Levantamento de ciclopídeos (Crustacea, Copepoda) no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue  

Digital Repository Infrastructure Vision for European Research (DRIVER)

INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were...



Efeito da escassez de presa na sobrevivência e reprodução do predador Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) Effect of prey shortage on the reproduction and longevity of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O efeito da escassez de presas no desempenho de fêmeas de Supputius cincticeps (Stål) foi estudado a 24,6 ± 0,7ºC, umidade relativa de 80 ± 4% e fotoperíodo de 12h. Larvas de Tenebrio molitor L. foram fornecidas às fêmeas durante 24h, a cada um, dois, quatro, seis ou oito dias; pedaços de vagem de feijão (Phaseolus vulgaris L.) foram fornecidos em todos os tratamentos de forma contínua. A porcentagem de fêmeas com posturas, o período de oviposição e o número de posturas, de ov...



Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae) = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae).  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this...



Efeito da escassez de presa na sobrevivência e reprodução do predador Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) / Effect of prey shortage on the reproduction and longevity of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O efeito da escassez de presas no desempenho de fêmeas de Supputius cincticeps (Stål) foi estudado a 24,6 ± 0,7ºC, umidade relativa de 80 ± 4% e fotoperíodo de 12h. Larvas de Tenebrio molitor L. foram fornecidas às fêmeas durante 24h, a cada um, dois, quatro, seis ou oito dias; pedaços de vagem de f [...] eijão (Phaseolus vulgaris L.) foram fornecidos em todos os tratamentos de forma contínua. A porcentagem de fêmeas com posturas, o período de oviposição e o número de posturas, de ovos e de ninfas diminuíram com o aumento do intervalo sem presa. Entretanto, os períodos de pré-oviposição e de pós-oviposição aumentaram à medida que o alimento tornou-se menos freqüente, enquanto a longevidade e o número de ovos por postura não foram afetados pelo regime de presas. Os resultados sugerem uma compensação entre a longevidade e a fecundidade (redução da segunda para manter a primeira), o que pode contribuir para o estabelecimento e a sobrevivência de S. cincticeps em condições de escassez de presa. Abstract in english The effect of prey shortage on the performance of Supputius cincticeps (Stål) females was evaluated at 24.6 ± 0.7ºC, 80 ± 4% RH and 12h photophase. Larvae of Tenebrio molitor L. were offered to the females during 24h every one, two, four, six or eight days; pieces of green bean (Phaseolus vulgaris L [...] .) were offered continuously. The percentage of females with egg masses, oviposition period, and the number of egg masses, eggs and nymphs decreased with the increase in the interval without prey, whereas the periods of pre- and pos-oviposition increased. On the other hand, longevity and number of eggs per egg mass were not affected by the prey regimen. The results suggest a trade-off between longevity and fecundity (reduction of fecundity to maintain longevity), which could contribute to the establishment and survival of S. cincticeps during periods of prey scarcity.

Sheila A., Mourão; José C., Zanuncio; Adrián J., Molina-Rugama; Evaldo F., Vilela; Mábio C., Lacerda.


Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae), em três presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae), in three alternative preys  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae) were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae) catterpilars; T2 - Musca domestica (Diptera, Muscidae) larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae) larva. Longevity and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Compa...



Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocerans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not ...

Ms, Arcifa; Tc, Bunioto; Perticarrari, A.; Wj, Minto



Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Camaragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijsk...

Rosa, Alexsandra A.; Gondim Jr, Manoel G. C.; Fiaboe, Komi K. M.; Moraes, Gilberto J.; Markus Knapp



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was ...

Medeiros, Maria A.; Sujii, Edison R.; Morais, Helena C.



Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests; Efeito de doses e de refugio sobre a seletividade de inseticidas a predadores e parasitoides de pragas de soja  

Energy Technology Data Exchange (ETDEWEB)

A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the EMBRAPA-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvet bean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed. (author)

Corso, Ivan Carlos; Gazzoni, Decio Luiz; Nery, Manoel Eugenio [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja]. E-mail:



Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae) / Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperatura [...] s, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879). O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70±10% e fotofase de 12horas. Efeito deletério da temperatura em O. thyestes foi obtido a 16ºC, na qual apenas 40% das ninfas atingiram a fase adulta, e destes apenas 19% não apresentaram deformações morfológicas. O maior período de pré-oviposição foi observado a 19ºC (17,8 dias). Os maiores valores para a fecundidade média total foram registrados a 25 e 28ºC, com 109,2 e 128,2 ovos/fêmea, respectivamente, e o menor a 19ºC, com 22,8 ovos/fêmea. A 22 e 31ºC as fêmeas viveram mais que os machos, sendo que a 19ºC a longevidade foi maior, independente do sexo. As baixas temperaturas influenciaram a reprodução e longevidade de O. thyestes sugerindo que esta espécie poderá ter melhor performance reprodutiva em temperaturas mais elevadas, como aquelas de regiões tropicais e ou subtropicais. Abstract in english The development time and the fecundity of Orius species are strongly influenced by a wide range of factors, like environmental conditions and in particular temperature. This work aimed to evaluate the reproduction and adult longevity of Orius thyestes Herring, 1966 in different temperatures. Eggs of [...] Anagasta kuehniella (Zeller, 1879) was provide as food supply. The experiment was carried out in climatic chambers at temperatures 16, 19, 22, 25, 28 and 31 ± 1°C, RH 70 ±10% and photophase 12h. A deleterious effect of the temperature on O. thyestes was found at 16°C, in which only 40% of the nymphs reached adulthood, of which only 19% presented normal morphological characteristics, without any alterations. The longest pre-oviposition period was found at 19°C (17.8 days). The highest fecundities were found at 25 and 28°C (109.2 and 128.2 eggs/female, respectively) and the lowest at 19 °C (22.8 eggs/female). At 22 and 31°C, females lived longer than the males. The low temperatures affected the reproduction and longevity of O. thyestes, suggesting that this species would have better reproductive performance under high temperatures, as it occur in tropical and or subtropical regions.

Carvalho, Lívia Mendes; Bueno, Vanda Helena Paes; Mendes, Simone Martins.


Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae  

Directory of Open Access Journals (Sweden)

Full Text Available O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperaturas, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879. O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70±10% e fotofase de 12horas. Efeito deletério da temperatura em O. thyestes foi obtido a 16ºC, na qual apenas 40% das ninfas atingiram a fase adulta, e destes apenas 19% não apresentaram deformações morfológicas. O maior período de pré-oviposição foi observado a 19ºC (17,8 dias. Os maiores valores para a fecundidade média total foram registrados a 25 e 28ºC, com 109,2 e 128,2 ovos/fêmea, respectivamente, e o menor a 19ºC, com 22,8 ovos/fêmea. A 22 e 31ºC as fêmeas viveram mais que os machos, sendo que a 19ºC a longevidade foi maior, independente do sexo. As baixas temperaturas influenciaram a reprodução e longevidade de O. thyestes sugerindo que esta espécie poderá ter melhor performance reprodutiva em temperaturas mais elevadas, como aquelas de regiões tropicais e ou subtropicais.The development time and the fecundity of Orius species are strongly influenced by a wide range of factors, like environmental conditions and in particular temperature. This work aimed to evaluate the reproduction and adult longevity of Orius thyestes Herring, 1966 in different temperatures. Eggs of Anagasta kuehniella (Zeller, 1879 was provide as food supply. The experiment was carried out in climatic chambers at temperatures 16, 19, 22, 25, 28 and 31 ± 1°C, RH 70 ±10% and photophase 12h. A deleterious effect of the temperature on O. thyestes was found at 16°C, in which only 40% of the nymphs reached adulthood, of which only 19% presented normal morphological characteristics, without any alterations. The longest pre-oviposition period was found at 19°C (17.8 days. The highest fecundities were found at 25 and 28°C (109.2 and 128.2 eggs/female, respectively and the lowest at 19 °C (22.8 eggs/female. At 22 and 31°C, females lived longer than the males. The low temperatures affected the reproduction and longevity of O. thyestes, suggesting that this species would have better reproductive performance under high temperatures, as it occur in tropical and or subtropical regions.

Lívia Mendes Carvalho



Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae, em três presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae, in three alternative preys  

Directory of Open Access Journals (Sweden)

Full Text Available Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae catterpilars; T2 - Musca domestica (Diptera, Muscidae larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae larva. Longevity and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

José Cola Zanuncio



Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae), em três presas alternativas / Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae), in three alternative preys  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae) were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae) catterpilars; T2 - Musca domestica (Diptera, Muscidae) larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae) larva. Longevity [...] and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

José Cola, Zanuncio; Joaquim Efigênio M, Leite; João Batista, Alves; Germi Porto, Santos.


Efeito do intervalo de alimentação na reprodução e na longevidade do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of feeding intervals on reproduction and longevity of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O efeito do intervalo de alimentação em fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), foi estudado a 24 ± 3ºC, UR de 70 ± 10 % e fotofase de 12 horas. Os tratamentos consistiram no fornecimento de larvas de Musca domestica L. (Diptera: Muscidae), durante 24 horas a cada um, doi [...] s, quatro, oito ou 16 dias. Fêmeas de P. nigrispinus, alimentadas a cada um, dois e quatro dias, produziram maior número de ovos (225,4; 184,6 e 135,3 ovos, respectivamente), que aquelas alimentadas à cada oito ou 16 dias (8,3 e 0,0 ovos, respectivamente). A longevidade das fêmeas que receberam presa a cada quatro dias (43,0 dias), foi maior do que aquelas alimentadas a cada oito ou 16 dias (27,3 e 10,6 dias). Abstract in english The effect of feeding intervals on Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females was studied. Females were fed during 24 hours after either one, two, four, eight or 16 days with Musca domestica L. (Diptera: Muscidae) larvae at 24 ± 3º C, 70 ± 10% RH and photophase of 12 hours. Fem [...] ales of P. nigrispinus fed every one, two and four days produced higher number of eggs (225.4, 184.6 and 135.3 eggs, respectively) than those fed every eight or 16 days (8.3 and 0.0 eggs, respectively). Females fed every four days lived longer (43.0 days) than those fed every eight or 16 days (27.3 and 10.6 days).

Adrián J., Molina-Rugama; José C., Zanuncio; Dirceu, Pratissoli; Ivan, Cruz.


Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control), the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rai...

Jackson Victor Araújo; Marcos Pezzi Guimarães; Artur Kanadani Campos; Nilo Chaves de Sá; Priscilla Sarti; Rafaela Carolina Lopes Assis



Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebr...

Rafael Braga da Silva; Alberto Soares Corrêa; Terezinha Maria Castro Della Lucia; Alexandre Igor de Azevedo Pereira; Ivan Cruz; José Cola Zanuncio



Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, M...

Jmf, Penha; Laf, Mateus



Tempo and mode of early gene loss in endosymbiotic bacteria from insects  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Abstract Background Understanding evolutionary processes that drive genome reduction requires determining the tempo (rate) and the mode (size and types of deletions) of gene losses. In this study, we analysed five endosymbiotic genome sequences of the gamma-proteobacteria (three different Buchnera aphidicola strains, Wigglesworthia glossinidia, Blochmannia floridanus) to test if gene loss could be driven by the selective importance of genes. We used...

Delmotte F; Rispe C; Schaber J; Fj, Silva; Moya A



ClEST cluster :Cl_contig0419  

Full Text Available Cl_contig0419 vacuolar atp synthase subunit e Cime x le ctularius nucle ar ge ne 450 GGGCACTCGCAGTTA ACC fs20066 fw20016 2 Vacuolar proton pump subunit E [Camponotus floridanus] E FN63114 2.4E -37 GO:004277


ClEST cluster :Cl_singleton1907  

Full Text Available Cl_singleton1907 26s proteasome non-atpase regulatory subunit 12 Cimex lectularius nuclear gene AAATGGTTCAGCAATGCTGCGAGTACGTTGACCAGATGCCTA mb06054 1 2 6S proteasome non-ATPase regulatory subunit 12 [Ca mponotus floridanus] EFN66912 5.60276E-49 GO:0000502 GO:0051436 GO:0051437 GO:00


77 FR 60749 - Endangered and Threatened Wildlife and Plants; Proposed Endangered Species Status for the Florida... (United States)

...1313), the floridanus-glaucinus complex presented a unique opportunity to study...volume ratios and large, naked flight membranes (wings), the potential for loss of...release of biological control agents that attack any life stage of this taxon. (6)...



Toxicity of indoxacarb to two species of predacious mites and a predacious mirid. (United States)

Indoxacarb is a novel oxadiazine pro-insecticide that has no toxic effects on the adults, fecundity and eclosion of Amblyseius fallacis (Garman), a predacious phytoseiid, or Agistemus fleschneri Summers, a predacious stigmaeid. It is toxic to Hyaliodes vitripennis (Say), a predacious mirid that has been reported from several Quebec orchards where IPM programs are used. The LC50 for this mirid is about one-half of the recommended dose (0.054 g AI litre(-1)) of indoxacarb for apple orchards. Following an application, the intoxicated mirids remained motionless as their prolegs and posterior had paralyzed. Twenty-four hours later, they appeared smaller, shrunken and severely desiccated. PMID:15154516

Bostanian, Noubar J; Vincent, Charles; Hardman, John M; Larocque, Nancy



Comportamento de oviposição de Bruchidae (Coleoptera predadores de sementes de Cassia leptophylla Vogel (Caesalpinaceae, morfologia dos ovos e descrição de uma nova espécie Oviposition behavior of Bruchidae (Coleoptera seed predators of Cassia leptophylla Vogel (Caesalpinaceae, egg rnorphology and description of a new species  

Directory of Open Access Journals (Sweden)

Full Text Available Sennius leptophyllicola sp. nov. is described from Paraná, Brazil and reported to feed in seeds of Cassia leptophylla Vogel with Pygiopachymerus lineola (Chevrolat, 1871. Both species attach their eggs to the outside of the fruit valves of the host. Their oviposition behavior places them in oviposition guild A of JOHNSON (1981. Eggs were described based upon scanning electron micrographs.

Cibele Stramare Ribeiro-Costa



O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.


O valor de Mabea fistulifera Mart. (Euphorbiaceae, planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae The value of Mabea fistulifera Mart. (Euphorbiaceae, indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para comparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I; de 15 a 26 dias (Pólen II e de 30 a 41 dias (Pólen III. A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of their known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I; from 15 to 26 days old (Pollen II and from 30 to 41 days old (Pollen III. The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p < 0.0001 between some treatments: mites fed pollen III of M. fistulifera had higher oviposition than those fed Pollen I and R. communis Pollen III. Mites fed Pollen II of T. angustifolia had higher oviposition rates than those fed pollen III of R. communis. Only females fed pollen of R. communis had negative correlation between oviposition rates and the periods of storage of pollen. The results showed that M. fistulifera pollen is used by E. citrifolius as food and comparable with pollen from T. angustifolia, futhermore, showed great durability when storage at 10ºC.

Rodrigo Damasco Daud



Effect of neem seed oil aqueous solutions on survival and development of the predator Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) Efeito de soluções aquosas de óleo de sementes de nim, Azadirachta indica, na sobrevivência e desenvolvimento do predador Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The effects of the neem seed oil aqueous solutions on survival and performance of egg, larva and adult stage of the Coccinelid predator Cycloneda sanguinea (L.) were evaluated under laboratory conditions. In a first trial, eggs and 2nd-instar larvae were sprayed with the neem solutions at 0; 0.5 and 2.25 ml/l and kept at 25 ± 1ºC, 70% RH and 14h photoperiod. Egg viability and duration and larvae and pupae survival were evaluated as well as the predatory capacity of the larvae, adult l...

Da Silva, Fla?via A. C.; Martinez, Sueli S.



Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when predators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens a...



Ocorrência de moscas brancas (Hemiptera: Aleyrodidae) e do predador Delphastus pusillus (LeConte) (Coleoptera: Coccinellidae) em mamoeiro (Carica papaya L.) sob cultivo em ambiente protegido / Whiteflies (Hemiptera: Aleyrodidae) and the predator Delphastus pusillus (Le Conte) (Coleoptera: Coccinellidae) on papaya tree (Carica papaya L.) grown under screened conditions  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Em fevereiro e outubro de 1998, na área experimental da Fazenda de Ensino e Pesquisa da UNESP no município de Selvíria-MS (latitude 20° 22' S, longitude 51° 22' W, altitude 335 m), foi constatada a presença de mosca branca em mamoeiro cultivar Baixinho de Santa Amália, plantado no interior de um tel [...] ado com malha de 2 x 2 mm. Essa área fazia parte de um experimento visando determinar o efeito do cultivo em ambiente protegido sobre o desenvolvimento das plantas, a produção de frutos e a ocorrência do mosaico do mamoeiro. Nas duas ocasiões os insetos foram enviados ao Centro de Recursos Genéticos e Biotecnologia (CENARGEN) da EMBRAPA para identificação. Na primeira infestação o material foi identificado como Trialeurodes sp. e na infestação de outubro como Bemisia tabaci biótipo B . Nos dois casos havia grande quantidade de ninfas nas folhas maduras e de adultos nas folhas novas. Para Trialeurodes sp. foi realizada uma contagem de ninfas em dezoito folhas, em cinco áreas de 1 cm² por folha, distribuídas ao acaso, encontrando-se a média de 7,6 ninfas por cm². Como conseqüência da presença das duas espécies, o único dano observado foi um intenso desenvolvimento de fumagina recobrindo completamente a superfície das folhas, que acabaram por secar e cair. A infestação de B. tabaci biótipo B foi controlada pela presença de larvas e adultos do coccinelídeo Delphastus pusillus (LeConte) que alimentavam-se vorazmente das ninfas presentes. Abstract in english We report the presence of whitefly species at the Experimental Farm of UNESP, located in Selvíria, state of Mato Grosso do Sul, Brazil ( 20°22' latitude S, 51°22' longitude W, altitude 335 m), in February and October 1998. These insects were found on papaya trees cultivar Baixinho de Santa Amália, g [...] rown under screened conditions (2 mm x 2 mm mash). The goal of the original experiment was to determine the effect of growing the cultivar under a protected environment on the development of the trees, fruit production and incidence of the "papaya ringspot virus". Whitefly specimens were sent to the Center of Genetic Resources and Biotechnology (CENARGEN) of EMBRAPA, for identification. The specimens collected in February were identified as Trialeurodes sp. and those collected in October were recognized as Bemisia tabaci biotype B. In both ocasions there were great numbers of nymphs on mature leaves and of adults on young leaves. We counted the number of Trialeurodes nymphs in eighteen leaves, in five areas of 1 cm² per leaf, distributed at random, where we found an average of 7.6 nymphs/cm². The only damage associated with the presence of whitefly of both species was the intense development of `sooty molds', covering completely the leaves, which wilted and fell. The infestation of B. tabaci biotype B was controlled by larvae and adults of the coccinellid Delphastus pusillus (LeConte), which fed avidly on the whitefly nymphs.

Marineide R., Vieira; Luiz S., Correa.


Predation risk versus pesticide exposure: effects of fear and loathing on aquatic invertebrates  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os organismos aquáticos apresentam respostas plásticas à presença de predadores que são induzidas por pistas químicas presentes na água. Estas respostas além de minimizar os efeitos de predação, têm também custos associados que podem incluir alterações na tolerância às variações ambientais tais como contaminação por pesticidas. Os efeitos dos pesticidas em sistemas naturais resultam assim da toxicidade mas também do efeito nas interacções predador-presa. Apesar de...

Pestana, Joa?o Lui?s Teixeira



Thermocouple design for measuring temperatures of small insects. (United States)

Contact thermocouples often are used to measure surface body temperature changes of insects during cold exposure. However, small temperature changes of minute insects can be difficult to detect, particularly during the measurement of supercooling points. We developed two thermocouple designs, which use 0.51 mm diameter or 0.127 mm diameter copper-constantan wires, to improve our ability to resolve insect exotherms. We tested the designs with adults from three parasitoid species: Tetrastichus planipennisi, Spathius agrili, and S. floridanus. These species are thermocouples than thick-gauge thermocouples for the smallest species tested, T. planipennisi. This difference was not apparent for larger species S. agrili and S. floridanus. Thermocouple design did not affect the mean supercooling point for any of the species. The cradle thermocouple design developed with the fine gauge wire was reusable and allowed for easy insect recovery after cold exposure. PMID:23812316

Hanson, A A; Venette, R C



Distribuição vertical de Teredinidae (Mollusca, Bivalvia em Portogallo, Angra dos Reis, Rio de Janeiro, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available Para estudar a distribuição vertical de Teredinidae em Angras dos Reis, RJ, foram construídos 30 coletores de laminado de pinho (Araucária sp., submersos (10 de cada a profundidades de 0,2, 2 e 4 m, respectivamente. Das espécies coletadas, Lyrodus floridanus foi a única a diminuir em abundância com a profundidade. As outras espécies não apresentaram diferenças significantes no número de indivíduos em relação às três profundidades ensaiadas.In order to study the vertical distribution of Teredinidae at Angra dos Reis, State of Rio de Janeiro, Brazil, 30 collectors of wood sheets (Araucária sp. were submerged (10 at each depth at 0,2, 2 and 4 m, respectively. Among the species collected, Lyrodus floridanus was the only one that did not whow significant variation in number of individuals in relation to depth. All the other species were unaffected, in number of individuals, by the different depths tested.

Maria Júlia Martins Silva



Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Wernegreen Jennifer J



First Isolation and Cultivation of Borrelia burgdorferi Sensu Lato from Missouri  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Five Borrelia burgdorferi sensu lato isolates from Missouri are described. This represents the first report and characterization of such isolates from that state. The isolates were obtained from either Ixodes dentatus or Amblyomma americanum ticks that had been feeding on cottontail rabbits (Sylvilagus floridanus) from a farm in Bollinger County, Mo., where a human case of Lyme disease had been reported. All isolates were screened immunologically by indirect immunofluorescence by using monocl...



Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB) after Fungal and Phosphoric Acid Pretreatment  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydra...

Isroi; Ishola, Mofoluwake M.; Ria Millati; Siti Syamsiah; Cahyanto, Muhammad N.; Claes Niklasson; Taherzadeh, Mohammad J.




Digital Repository Infrastructure Vision for European Research (DRIVER)

Archived serum samples, from 95 eastern cottontail rabbits (Sylvilagus floridanus) captured in New York, New York, USA and Millbrook, New York, USA, during 1985–86, were analyzed in solid-phase enzyme-linked immunosorbent assays (ELISA) for total and class-specific immunoglobulin (Ig) M antibodies to whole-cell or recombinant antigens of Borrelia burgdorferi sensu stricto. Using a polyvalent conjugate, rabbit sera contained antibodies to whole-cell and recombinant antigens (protein [p]35, p...

Magnarelli, Louis A.; Norris, Steven J.; Fikrig, Erol



Genome sequence of Blochmannia pennsylvanicus indicates parallel evolutionary trends among bacterial mutualists of insects  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The distinct lifestyle of obligately intracellular bacteria can alter fundamental forces that drive and constrain genome change. In this study, sequencing the 792-kb genome of Blochmannia pennsylvanicus, an obligate endosymbiont of Camponotus pennsylvanicus, enabled us to trace evolutionary changes that occurred in the context of a bacterial–ant association. Comparison to the genome of Blochmannia floridanus reveals differential loss of genes involved in cofactor biosynthesis, the compositi...

Degnan, Patrick H.; Lazarus, Adam B.; Wernegreen, Jennifer J.



Pathogenesis of Herpesvirus sylvilagus infection in cottontail rabbits.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Experimental infection with Herpesvirus sylvilagus produces clinical and histopathologic changes in its natural host, the cottontail rabbit (Sylvilagus floridanus), similar to those observed in humans acutely infected with Epstein-Barr virus (EBV). Twenty-seven seronegative cottontail rabbits were infected with Herpesvirus sylvilagus and all developed antibodies within 10 days. Neutralizing antibody was detected as early as 7 days after infection. Virus was isolated from blood mononuclear cel...

Hesselton, R. M.; Yang, W. C.; Medveczky, P.; Sullivan, J. L.



Circumvention of prey defense by a predator: ant lion vs. ant.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The pit-dwelling ant lion Myrmeleon carolinus, although topically sensitive to formic acid, is able to prey on formic acid-spraying ants (Camponotus floridanus). It kills the ants without inducing them to spray, and it sucks out the ant's body contents without puncturing the acid sac. Ordinarily, when Camponotus is attacked it retaliates by simultaneously biting and spraying, but it usually refrains from spraying until it has secured a grip with the mandibles. When Myrmeleon pulls Camponotus ...

Eisner, T.; Baldwin, I. T.; Conner, J.



Discovery of Defense- and Neuropeptides in Social Ants by Genome-Mining  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant), Camponotus floridanus (carpenter ant) and Harpegnathos saltator (basal genus). Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulato...

Gruber, Christian W.; Muttenthaler, Markus



Toxicidade de lufenurom para Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este trabalho investigou a suscetibilidade do percevejo predador Podisus nigrispinus (Dallas) ao lufenurom usando diferentes concentrações e métodos de exposição. Em laboratório, ninfas de 5º ínstar e adultos foram expostos a 0, 25, 50, 100, 150 e 200 mg i.a./l de lufenurom via tratamento tópico e ingestão de solução inseticida. Em casa telada, ninfas de 5º ínstar e adultos do predador foram confinados em plantas pulverizadas com as doses (10 e 50 g i.a./ha) recomendadas do lufe...



Toxicidade de lufenurom para Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) Toxicity of lufenuron to Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este trabalho investigou a suscetibilidade do percevejo predador Podisus nigrispinus (Dallas) ao lufenurom usando diferentes concentrações e métodos de exposição. Em laboratório, ninfas de 5º ínstar e adultos foram expostos a 0, 25, 50, 100, 150 e 200 mg i.a./l de lufenurom via tratamento tópico e ingestão de solução inseticida. Em casa telada, ninfas de 5º ínstar e adultos do predador foram confinados em plantas pulverizadas com as doses (10 e 50 g i.a./ha) recomendadas do lufe...



Estudos anatômicos e histológicos sôbre a subfamília Triatominae (Heteroptera, reduviidae): XIX parte: estudo comparado das mandíbulas de vários Triatominae e outros Reduviidae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Descreve-se, nesta publicação, as mandíbulas de 8 espécies de Triatominae e de 8 de outros Heteroptera, do grupo dos predadores, focalizando a forma e a armação da parte apical. Os caracteres permitem diferenciar entre um tipo hematófago e um predador. Nos hematófagos conseguimos diferenciar os 3 gê [...] neros estudados pela forma e armação das mandíbulas; não é possível, porém, a classificação das espécies pelas mandíbulas, porque as diferenças, sendo mesmo específicas, não são suficientemente significativas. Forma e armação dos estiletes dos dois tipos estão relacionadas, diretamente, com os costumes dos animais no ato de alimentação.

Rudolf, Barth.


Metabolic Changes in Broad Bean Infected by Botrytis fabae in Response to Mushroom Spent Straw  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Spent wheat straw (after cultivation of oyster mushroom, Pleurotus floridanus) was infested into the soil at different concentrations (1, 2, 5% w/w) to study its effect on the growth of broad bean (Vicia faba) susceptible to Botrytis fabae. In addition, the effect of spraying the plant with its water extract was also studied. In seedling stage, the non infected broad bean plants treated with 1 and 2% spent straw (ss) showed an increase in shoot length and at 5% ss as well...

Amira; El-fallal, A.; Fatma; Migahed, F.



Dummies versus air puffs: efficient stimulus delivery for low-volatile odors. (United States)

Aiming to unravel how animals perceive odors, a variety of neurophysiological techniques are used today. For olfactory stimulation, odors are commonly incorporated into a constant airstream that carries odor molecules to the receptor organ (air-delivered stimulation). Such odor delivery works well for odors of high volatility (naturally effective over long distances) but less or not at all for low-volatile odors (usually only received at short range). We developed a new odor stimulation technique especially suited for low-volatile odors and compared it with conventional air-delivered stimulation using 2 neurophysiological approaches. Odor-loaded dummies were moved into close vicinity of the receptor organs on the antenna of the Florida carpenter ant Camponotus floridanus (dummy-delivered stimulation). Neuronal activity was monitored either at receptor neuron level using electroantennography or in the first olfactory neuropile, the antennal lobes, using calcium imaging. We tested 3 odors of different volatility: C. floridanus' highly volatile alarm pheromone undecane, its low-volatile trail pheromone nerolic acid, and an even less volatile, behaviorally active C23 alkene, cis-9-tricosene. For low-volatile odors, dummy-delivered stimulation was particularly efficient. We conclude that dummy-delivered stimulation is advantageous compared to the commonly used air-delivered stimulation when studying an animal's detection and processing of low-volatile odors. PMID:20212009

Brandstaetter, Andreas Simon; Rössler, Wolfgang; Kleineidam, Christoph Johannes



Descubrimiento de mamíferos fósiles de edad Lujanense (Pleistoceno tardío en el "Desierto" de La Tatacoa (Huila, Colombia Descubrimiento de mamíferos fósiles de edad Lujanense (Pleistoceno tardío en el "Desierto" de La Tatacoa (Huila, Colombia  

Directory of Open Access Journals (Sweden)

Full Text Available A small sedimentary basin, at the Los Hoyos locality, has been discovered with in the Tatacoa "desert". Taxonomic studies are not yet complete but at least two forms related to living species have been identified: Sylvilagus aff. floridanus and Tayassu aft. tajacu. A third form is referred to family Gomphotheriidae. Based on this small fauna, the locality can be correlated with the Lujanian Land Mammal "Age". Aspects of the paleoecology and paleogeography of the locality are also brieflydiscussed. Se da a conocer el descubrimiento de una pequeña cuenca sedimentaria con mamíferos fósiles, en el lugar denominado Los Hoyos, dentro del ámbito del "desierto" de La Tatacoa. Aunque los estudios taxonómicos de los fósiles no están aún completos, no cabe duda de que se trata, de dos formas afines a especies vivientes, identificadas como Sylvilagus aff. floridanus y Tayassu aff. tajacu , y una tercera forma, referida a la familia Gomphotheriidae. Con base en esta pequeña fauna, se data el yacimiento como de edad Lujanense, además se anotan brevemente aspectos paleoecológicos y paleogeográficos.

Villaroel A. Carlos



Interações predatórias entre Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) e Loxosceles intermedia Mello-Leitão (Araneae, Sicariidae) Predatory interactions between Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) and Loxosceles intermedia Mello-Leitão (Araneae, Sicariidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A co-ocorrência de Pholcus phalangioides (Fuesslin, 1775) e de Loxosceles intermedia Mello-Leitão, 1934 no intra e no peridomicílio somada à natureza araneofágica e invasora de teias de P.phalangioides sugere que ambas as espécies tenham desenvolvido algum padrão de interação interespecífica. Assim, objetivou-se caracterizar essa interação e avaliar a eficiência de P.phalangioides como predador de L.intermedia. Foram realizados cinco experimentos laboratoriais visando quantificar...



A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae) from dry forest in Brazil and new occurrence records for other Heimbrinae Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae) de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The geographic ranges of Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil) of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) is described, illust...

Daniell Rodrigo Rodrigues Fernandes; Rogéria Inês Rosa Lara; Nelson Wanderley Perioto



Espécies de formigas que interagem com as sementes de Mabea fistulifera Mart. (Euphorbiaceae) Interaction between ant species and seeds of Mabea fistulifera Mart. (Euphorbiaceae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

As formigas, quando atraídas por um apêndice nutritivo, produzido na semente de certas plantas, podem exercer o papel de agente predador ou dispersor das sementes. No processo de dispersão, grande número desses insetos pode interagir com sementes de determinada planta. O objetivo deste trabalho foi identificar as espécies de formigas em contato com sementes de Mabea fistulifera Mart. - uma espécie arbórea e colonizadora em áreas antrópicas no Brasil - e o tipo de interação desses i...



A low-cost GPS-GPRS telemetry system for otters: field tests and preliminary data on wild otters  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Os rios europeus, particularmente os do sul da Europa representam um dos habitats com maior riqueza de espécies que, contudo, continuam a sofrer um acentuado declínio, quase sempre devido a actividades humanas. No que diz respeito às populações de lontraeuropeia (Lutra lutra, Linnaeus 1758), sendo um predador de topo destes ecossistemas e com grandes requisitos ecológicos, o impacto sentido nas suas populações, essencialmente pela destruição do seu habitat e consequente diminuição...

Martins, Bruno Herlander Mira



Cost and benefits of the morphological defences in larvae of Scymnus nubilus Mulsant (Coleoptera: Coccinellidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Diferentes mecanismos de defesa contra a predação e parasitismo evoluíram entre os insectos. Estes podem ser químicos, comportamentais ou estruturais. As larvas do pequeno coccinelídeo Scymnus nubilus estão cobertas por uma camada de ceras que podem actuar como um mecanismo defensivo contra formigas e outros predadores. No entanto, o grau de protecção conferido pelas ceras às larvas de Scymnus não é bem conhecido. O objectivo deste estudo foi avaliar alguns dos custos e benefícios...

Pacheco, Paulo Alexandre Botelho



Abundância e sazonalidade de histerídeos (Coleoptera) associados ao esterco de granja aviária da Região Nordeste do Estado de São Paulo, Brasil Abundance and seasonality of Histeridae (Coleoptera) associated to brooding hen excrement in the northeast region of the state of São Paulo, Brazil  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Programas que visam o controle biológico precisam ser embasados principalmente em liberações de predadores e parasitóides para tentar minimizar efeitos adversos para o ambiente. Os coleópteros da família Histeridae como predam larvas de dípteros sinantrópicos podem auxiliar no controle das moscas que se desenvolvem em fezes acumuladas. Este trabalho teve como objetivo realizar um levantamento das espécies de histerídeos em granja avícola no município de São João da Boa Vista, es...



Predação de sementes de plantas daninhas em áreas cultivadas  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Na investigação das relações ecológicas entre as espécies, observou-se que certos animais, principalmente insetos, alimentavam-se de sementes de plantas daninhas antes e depois da sua deiscência, reduzindo a entrada de sementes no banco de sementes do solo e, portanto, a quantidade total de propágulos disponíveis à germinação. Em situações favoráveis à atividade dos predadores, o consumo de sementes pode ser significativo, chegando a 90% do total de sementes produzidas. Esse p...



Food webs of Mediterranean coastal wetlands  

Digital Repository Infrastructure Vision for European Research (DRIVER)

En aquesta tesi doctoral s'han estudiat els efectes directes i indirectes de dos tipus d'espècies claus de la comunitat aquàtica dels aiguamolls de l'Empordà (aiguamolls costaners mediterranis amb una xarxa tròfica senzilla). S'han realitzat experiments al camp utilitzant microcosmos i mesocosmos i els resultats han estat analitzats mitjançant tres aproximacions: la taxonòmica, la funcional i la de mides. S'ha comprovat que en situacions amb absència de predadors i dominància d'una ú...

Compte Ciurana, Jordi



Potencial reprodutivo de Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) influenciado pelo peso do corpo da fêmea - DOI: 10.4025/actascibiolsci.v25i1.2081 Reproductive potential of the predator Supputius cincticeps (Heteroptera: Pentatomidae) affected by female body weight - DOI: 10.4025/actascibiolsci.v25i1.2081  

Digital Repository Infrastructure Vision for European Research (DRIVER)

O potencial reprodutivo de fêmeas de Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) de duas classes de peso foi avaliado. Machos e fêmeas desse predador foram obtidos de ninfas alimentadas com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). Foram analisadas fêmeas com peso inferior a 45 mg (fêmeas leves) e superior a 60 mg (fêmeas pesadas). A longevidade e os períodos de pré-oviposição, oviposição e pós-oviposição foram semelhantes entre fêm...




Digital Repository Infrastructure Vision for European Research (DRIVER)

Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador carnívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación.The diet of Orestias agassii from fresh water springs associated to El Huasco Sal...



Ciclo biológico e predação de três espécies de coccinelídeos (Coleoptera, Coccinellidae) sobre o pulgão-gigante-do-pinus Cinara atlantica (Wilson) (Hemiptera, Aphididae) Biological cycle and predation of three coccinellid species (Coleoptera, Coccinellidae) on giant conifer aphid Cinara atlantica (Wilson) (Hemiptera, Aphididae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Afídeos do gênero Cinara Curtis são importantes pragas de coníferas em vários países. No Brasil Cinara atlantica (Wilson, 1919) tem causado danos em plantações comerciais de Pinus spp. e o controle biológico com predadores pode ser uma opção melhor que o controle químico. Este trabalho teve por objetivo estudar a biologia e a capacidade de predação dos coccinelídeos Hippodamia convergens Guérin-Méneville, 1842, Cycloneda sanguinea (Linnaeus, 1763) e Eriopis connexa (German, 1...



The relationship between field-determined putative territorial strategies and spatial and non-spatial learning in males of Carbonell's wall lizard, Podarcis Carbonelli berlengensis  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A maioria dos animais poderá demonstrar uma aprendizagem espacial quando procuram refúgio, parceiros, forrageiam ou mesmo quando fogem de predadores. No seu ambiente natural, os répteis demonstram que conseguem aprender e recordar tarefas espaciais. Foi sugerido que o contexto social poderá funcionar como uma vantagem selectiva para mecanismos espaciais cognitivos e desta forma seria de esperar que uma variação intrasexual pudesse influenciar uma cognição espacial.

Baptista, Rita Gomes



Biologia de Podisus nigrispinus predando lagartas de Alabama argillacea em campo Biology of Podisus nigrispinus preying on Alabama argillacea caterpillars in field  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este trabalho estudou o desenvolvimento ninfal, a reprodução e a taxa de predação de Podisus nigrispinus (Dallas) alimentados ou não com lagartas de Alabama argillacea (Huebner) em plantas de algodão no campo. Ninfas e adultos do predador foram confinadas em folhas de algodão sem alimentação ou alimentadas com duas lagartas de 70±10 mg oferecidas em intervalos de 1, 3 e 6 dias. O desenvolvimento ninfal de P. nigrispinus, exceto no terceiro ínstar, aumentou com o intervalo de alimen...



Biologia de Podisus nigrispinus predando lagartas de Alabama argillacea em campo  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este trabalho estudou o desenvolvimento ninfal, a reprodução e a taxa de predação de Podisus nigrispinus (Dallas) alimentados ou não com lagartas de Alabama argillacea (Huebner) em plantas de algodão no campo. Ninfas e adultos do predador foram confinadas em folhas de algodão sem alimentação ou alimentadas com duas lagartas de 70±10 mg oferecidas em intervalos de 1, 3 e 6 dias. O desenvolvimento ninfal de P. nigrispinus, exceto no terceiro ínstar, aumentou com o intervalo de alimen...



Efeito da Densidade de Presas e do Acasalamento na Taxa de Predação de Fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em Condições de Laboratório e Campo Effect of Prey Density and Mating Status on Predation Rate of Females of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) in Laboratory and Field Conditions  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Avaliou-se a taxa de predação de fêmeas virgens ou acasaladas de Podisus nigrispinus (Dallas) em diferentes densidades de lagartas de Alabama argillacea (Huebner) em condições de laboratório e de campo. Em laboratório, empregaram-se potes plásticos de 500 ml contendo fêmeas do predador, uma folha de algodão e lagartas de A. argillacea (50 ± 10 mg) nas densidades de uma, duas, quatro, oito e 16 lagartas. No campo, algodoeiros na fase de florescimento foram engaiolados, sendo emprega...



Efeito da Densidade de Presas e do Acasalamento na Taxa de Predação de Fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em Condições de Laboratório e Campo  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Avaliou-se a taxa de predação de fêmeas virgens ou acasaladas de Podisus nigrispinus (Dallas) em diferentes densidades de lagartas de Alabama argillacea (Huebner) em condições de laboratório e de campo. Em laboratório, empregaram-se potes plásticos de 500 ml contendo fêmeas do predador, uma folha de algodão e lagartas de A. argillacea (50 ± 10 mg) nas densidades de uma, duas, quatro, oito e 16 lagartas. No campo, algodoeiros na fase de florescimento foram engaiolados, sendo emprega...



Toxicidade Diferencial de Agroquímicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroquímicos a populações de ácaros das espécies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fêmeas adultas de N. californicus foram tratadas através de pulverização direta utilizando torre de Potter. O ácaro predador N. californicus mostrou tolerância igual ou superior a T. urticae a diver...



Aspectos biológicos da fase adulta de Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) oriunda de larvas alimentadas com Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) Biological aspects of the adult stage of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) originating from the larvae fed Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae)  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Objetivou-se estudar alguns aspectos biológicos da fase adulta de Chrysoperla externa (Hagen) quando as larvas desse predador foram alimentadas com ninfas e fêmeas adultas de Planococcus citri (Risso). O experimento foi conduzido em câmara climatizada regulada a 25 ± 1 ºC, 70 ± 10% de UR e fotofase de 12 horas. Os adultos de C. externa cujas larvas foram alimentadas com ninfas nos três ínstares e fêmeas adultas da cochonilha, foram separados por sexo e 25 casais foram individualizado...



Victimización y nuevas tecnologías : un análisis transcultural de los riesgos de vivir en la era digital  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Introducción: En los últimos años las nuevas tecnologías se convirtieron en parte de la vida cuotidiana de los jóvenes y constituyen un valioso recurso para su desarrollo. El actual uso intensivo de las nuevas tecnologías y el anonimato que ellos ofrecen han creado un tema nuevo de interés para la protección de los niños, ya que los expone a una multitud de riesgos: violencia, bullying, predadores sexuales, entre otros. La falta de supervisión de estas actividades, la escasa legisla...



Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.

Mueller Martin J



Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen) juveniles exposed to waterborne ammonia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferent [...] es concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie. Abstract in english Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predatio [...] n. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.

Paula, Weber; Carina, Vogel; Carla, Lang; Bernardo, Baldisserotto.


Syllidae (Annelida, Polychaeta from the Caribbean coast of Venezuela  

Directory of Open Access Journals (Sweden)

Full Text Available Venezuela possesses a great variety of coastal environments allowing for a high diversity of marine species. However, systematic studies on marine invertebrates are scarce, especially on polychaetes. The family Syllidae is poorly known, and only 14 genera and 42 species have been reported from this country. A total of 13 genera and 26 species the Syllidae were identified from benthic samples collected on different substrata of the northeastern coast of Venezuela. Of these, seven genera and 16 species constitute new records for Venezuela: Odontosyllis guillermoi, Syllides floridanus, Salvatoria clavata, S. limbata, Sphaerosyllis longicauda, Parapionosyllis longicirrata, Trypanosyllis parvidentata, T. vittigera, Opisthosyllis sp., Syllis amica, S. armillaris, S. gracilis, S. pseudoarmillaris, S. vittata, Parasphaerosyllis indica and Myrianida convoluta.  

Oscar Díaz-Díaz



Syllidae (Annelida, Polychaeta) from the Caribbean coast of Venezuela. (United States)

Venezuela possesses a great variety of coastal environments allowing for a high diversity of marine species. However, systematic studies on marine invertebrates are scarce, especially on polychaetes. The family Syllidae is poorly known, and only 14 genera and 42 species have been reported from this country. A total of 13 genera and 26 species the Syllidae were identified from benthic samples collected on different substrata of the northeastern coast of Venezuela. Of these, seven genera and 16 species constitute new records for Venezuela: Odontosyllis guillermoi, Syllides floridanus, Salvatoria clavata, Salvatoria limbata, Sphaerosyllis longicauda, Parapionosyllis longicirrata, Trypanosyllis parvidentata, Trypanosyllis vittigera, Opisthosyllis sp., Syllis amica, Syllis armillaris, Syllis gracilis, Syllis pseudoarmillaris, Syllis vittata, Parasphaerosyllis indica and Myrianida convoluta. PMID:21998503

Liñero-Arana, Ildefonso; Díaz Díaz, Oscarn



Dicty_cDB: Contig-U03373-1  

Full Text Available Contig-U03373-1 no gap 459 M 2177 1718 MINUS 3 2 U03373 1 0 0 0 0 0 0 0 0 0 0 0 1 1 Show Contig- romosome 9; s... 38 0.008 9 ( CR940347 ) Theileria ann ulata genomic DNA chromosome 1 part 1. 32 0.008 16 one CH73-329L6 in l... 42 3.8 3 ( BX248583 ) Blochmann ia floridanus complete genome. 30 3.8 13 ( DE575291 e R3-5N23, WORK... 38 8.8 4 ( CR940353 ) Theileria ann ulata genomic DNA chromosome 4. 32 8.8 16 ( AL92935 5 6e-10 AJ409120_1( AJ409120 |pid:none) Lycopodium ann otinum mitochondrial... 65 6e-10 AF110138_9( AF1101


Interspecies transmission of Cytauxzoon felis. (United States)

The causative agent of feline cytauxzoonosis was experimentally inoculated into 4 species of domestic farm animals, 9 species of laboratory animals, and 17 wildlife species. The inoculum consisted of freshly collected or deep-frozen blood and/or tissue homogenates from domestic cats euthanatized in extremis with experimentally transmitted feline cytauxzoonosis. A bobcat, Lynx rufus floridanus (Florida bobcat), developed cytauxzoonosis typical of the disease observed in domestic cats and died of the disease 2 weeks after inoculation. A persistent parasitemia, but no overt signs of illness, developed in another bobcat, Lynx rufus rufus (eastern bobcat). The sheep developed a low persistent parasitemia, but no clinical signs of illness. There was no clear evidence of cytauxzoonosis demonstrated by necropsy or histopathologic or blood smear examinations in all other species. Additionally, freshly collected blood and/or tissue homogenates from animals of various species, except bobcats, failed to produce evidence of cytauxzoonosis when subinoculated into domestic cats. PMID:6807139

Kier, A B; Wightman, S R; Wagner, J E



Trombiculiasis in the Florida black bear. (United States)

We found trombiculid mite (Trombiculidae) infestations in 32 of 101 (32%) freeranging Florida black bears (Ursus americanus floridanus) live-captured or necropsied in Florida from January 1999 to April 2000. Prevalence of chigger infestation was greatest in June with no infestations seen October to March. Chigger infestations were recognized as accumulations of bright orange granular material usually associated with hair shafts. Mites were found in clusters of one to 102 (mean +/- SD = 8.5+/-19.5) and were distributed primarily over the ventral abdomen and thorax, inguinal and axillary regions, and proximal medial aspect of the extremities. Mites were identified as larval Eutrombicula splendens. Cutaneous lesions were seen in two of 32 (6%) infested bears. PMID:11504241

Cunningham, M W; Phillips, L A; Wellbourn, C



Dicty_cDB: Contig-U15390-1  

Full Text Available Contig-U15390-1 no gap 1343 2 3402185 3403501 PLUS 5 4 U15390 0 3 0 0 0 0 0 0 0 0 0 1 1 0 Show C NA clone:ddc50k09, 5' ... 46 0.056 2 ( BX248583 ) Bloc hmannia floridanus complete genome. 34 0.077 17 ( C e cDNA clone:FC-IC0... 42 2.4 2 ( CP000253 ) Staphyloc occus aureus subsp. aureus NCTC 8325, co... 40 2.6 DNA, complete gen... 32 2.7 11 ( AP009351 ) Staphyloc occus aureus subsp. aureus str. Newman D... 40 2.9 omosome 1, comple... 34 4.3 10 ( AC176879 ) Strongyloc entrotus purpuratus clone R3-1110D11, W... 36 4.6 6


Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia ao longo da costa do estado do Rio de Janeiro, Brasil Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia along the coast of Rio de Janeiro State, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is characterized by the dominance of Lyrodus floridanus (Bartsch, 1922; Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917 and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

Andrea de O. R. Junqueira



Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia) ao longo da costa do estado do Rio de Janeiro, Brasil / Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia) along the coast of Rio de Janeiro State, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in english In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is c [...] haracterized by the dominance of Lyrodus floridanus (Bartsch, 1922); Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917) and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

Junqueira, Andrea de O. R.; Silva, Sergio Henrique G. da; Silva, Maria Júlia M..


The effect of low salinity on teredinids  

Directory of Open Access Journals (Sweden)

Full Text Available Teredinids survival in low salinities was determined in aquaria. Panels previously immersed in Ponta de Leste, Ilha Grande Bay, Rio de Janeiro, were transferred to aquaria with salinities ranging from 5.0 to 15.0 Practical Salinity Unities (PSU. The waters of Ilha Grande Bay receive a large amount of wood from the marginal rainforest vegetation, being suitable for the development of teredinids. The coastal areas of the bay are subjected to wide salinity fluctuations due to strong and sudden tropical storms. Eleven different species of teredinids were found in the panels. The critical salinity concentration for the survival of the two most common species was 11.93 PSU for Lyrodus floridanus and 12.90 PSU for Teredo furcifera. The effect of time on the mortality of teredinids at low salinities is also discussed.A sobrevivência de moluscos bivalves perfurantes de madeira da família Teredinidae foi avaliada a partir de sua manutenção em aquários de baixa salinidade. Painéis de madeira previamente imersos em Ponta de Leste, Baía da Ilha Grande, RJ, foram transferidos para aquários, contendo água do mar, cujas concentrações salinas variaram de 5,0 a 15,0 PSU. A Baía da Ilha Grande recebe uma grande quantidade de madeira da vegetação marginal de Mata Atlântica, o que torna o ambiente particularmente favorável ao desenvolvimento de teredinídeos. As áreas costeiras da baía estão sujeitas a grandes variações salinas decorrentes de tempestades tropicais que ocorrem súbita e intensamente. A salinidade crítica à sobrevivência das duas espécies mais comuns nos painéis foi de 11,93, para Lyrodus floridanus e 12,90 para Teredo furcifera. O efeito do tempo na mortalidade dos teredinídeos, quando sujeitos a baixas salinidades, foi discutido.

Cristine C. Barreto



The effect of low salinity on teredinids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A sobrevivência de moluscos bivalves perfurantes de madeira da família Teredinidae foi avaliada a partir de sua manutenção em aquários de baixa salinidade. Painéis de madeira previamente imersos em Ponta de Leste, Baía da Ilha Grande, RJ, foram transferidos para aquários, contendo água do mar, cujas [...] concentrações salinas variaram de 5,0 a 15,0 PSU. A Baía da Ilha Grande recebe uma grande quantidade de madeira da vegetação marginal de Mata Atlântica, o que torna o ambiente particularmente favorável ao desenvolvimento de teredinídeos. As áreas costeiras da baía estão sujeitas a grandes variações salinas decorrentes de tempestades tropicais que ocorrem súbita e intensamente. A salinidade crítica à sobrevivência das duas espécies mais comuns nos painéis foi de 11,93, para Lyrodus floridanus e 12,90 para Teredo furcifera. O efeito do tempo na mortalidade dos teredinídeos, quando sujeitos a baixas salinidades, foi discutido. Abstract in english Teredinids survival in low salinities was determined in aquaria. Panels previously immersed in Ponta de Leste, Ilha Grande Bay, Rio de Janeiro, were transferred to aquaria with salinities ranging from 5.0 to 15.0 Practical Salinity Unities (PSU). The waters of Ilha Grande Bay receive a large amount [...] of wood from the marginal rainforest vegetation, being suitable for the development of teredinids. The coastal areas of the bay are subjected to wide salinity fluctuations due to strong and sudden tropical storms. Eleven different species of teredinids were found in the panels. The critical salinity concentration for the survival of the two most common species was 11.93 PSU for Lyrodus floridanus and 12.90 PSU for Teredo furcifera. The effect of time on the mortality of teredinids at low salinities is also discussed.

Barreto, Cristine C.; Junqueira, Andrea O. R.; Silva, Sérgio Henrique G. da.


Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação  

Directory of Open Access Journals (Sweden)

Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

Cristiano S. de Azevedo



Fish ladders: safe fish passage or hotspot for predation?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results sugge

Agostinho, Angelo Antonio; Agostinho, Carlos Sergio; Pelicice, Fernando Mayer; Marques, Elineide Eugênio.


Predation Tactics of Trumpetfish in Midwater  

Directory of Open Access Journals (Sweden)

Full Text Available Predators are known to modify hunting tactics in response to local conditions to exploit prey of different species, densities or position within habitat patches. I describe three unusual prey hunting tactics used by trumpetfish (Aulostomus maculatus distributed in midwater above reefs off Bonaire, Netherlands Antilles, in the southern Caribbean Sea. Hunting behaviors were focused on dense feeding aggregations of brown chromis (Chromis multilineata and were categorized as: (1 slow horizontal following, (2 vertical hovering or drift, and (3 diagonal cross encounters where trumpetfish descended diagonally through the water while adjusting trajectory to encounter target prey. Understanding variation in predator behavior and ambit, in this case vertical ambit, adds to our knowledge of how predators adapt to unique local opportunities to exploit prey.Predadores são conhecidos por modificar táticas de caça em resposta às condições locais para explorar presas de diferentes espécies, densidades ou posição dentro dos habitats. Descrevo três táticas de predação não usuais utilizadas pelo peixe-trombeta (Aulostomus maculatus à meia água sobre os recifes de Bonaire, Antilhas Holandesas, na porção sul do mar do Caribe. Comportamentos de caça foram direcionados para densas agregações de forrageamento de mulatas (Chromis multilineata e foram categorizados como: (1 perseguição horizontal lenta, (2 pairando verticalmente ou à deriva, e (3 encontros cruzados diagonais, onde o peixe-trombeta desce diagonalmente através da água enquanto ajusta a sua trajetória para interceptar a presa almejada. A compreensão do comportamento do predador e seus domínios, neste caso a dimensão vertical, contribui para o conhecimento de como predadores se adaptam a condições locais particulares de exploração de presas.

Peter J. Auster



Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.], in Presidente Prudente, State of São Paulo, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas.This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni Montes



Presencia de Gambusia affinis (Baird & Girard, 1853 en un humedal boscoso del Sur de Chile. Posibles implicancias sobre la fauna local de invertebrados.  

Directory of Open Access Journals (Sweden)

Full Text Available Las especies invasoras son la principal causa de pérdida debiodiversidad del planeta, producto de la depredación que afecta a la faunalocal mediante competencia, hibridación, alteración del hábitat y transmisiónde enfermedades. En este estudio se describe la posible implicancia del pezmosquito sobre la fauna de invertebrados en un humedal boscoso presente en laregión de la Araucanía, Chile. Los resultados nos indican la presencia de Gambusia affinis en todos los sitios demuestreo, destacándose su gran adaptabilidad a la temperatura y pH. El roldepredador de Gambusia affinis sobremosquitos, puede favorecer al desarrollo de sus larvas, al consumirinvertebrados predadores de éstas, influyendo en la estructura trófica de lascomunidades.

L. Parra-Coloma



Dieta de Liolaemus ruibali Donoso Barros(Iguania:Liolaeminae en la Reserva de Usos Múltiples Don Carmelo, San Juan, Argentina  

Directory of Open Access Journals (Sweden)

Full Text Available Se estudió la dieta de Liolaemus ruibali en la reserva de Usos Múltiples Don Carmelo, Provincia de San Juan. Se analizaron los estómagos e intestinos de 12 individuos, determinando el rol de cada presa mediante el cálculo del índice de importancia relativa y la amplitud trófica mediante el índice de Levins. Hemíptera fue la categoría alimentaria más importante. Otra categoría alimentaria importante fue Formicidae. La dieta está constituida además por vegetales (Lycium chanar y Ephedra breana. El análisis indica que Liolaemus ruibali es un predador pasivo y omnívoro.

Héctor J. Villavicencio



Influência de tricomas glandulares de Solanum berthaultii na predação de Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) em Myzus persicae (Sulzer) (Homoptera: Aphididae) / Influence of glandular trichomes of Solanum berthaultii on the predation of Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) on Myzus persicae (Sulzer) (Homoptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a influência dos tricomas glandulares da batata Solanum berthaultii no desenvolvimento larval, mortalidade e capacidade de predação de Scymnus (Pullus) argentinicus (Weise) sobre o pulgão Myzus persicae (Sulzer). Verificou-se que o desenvolvimento larval do predador foi interrompido pela [...] alta mortalidade (89%) no 1° ínstar, provavelmente pela ação dos tricomas glandulares de S. berthaultii. Quando o predador foi liberado nos diferentes ínstares e adultos, observou-se mortalidade larval no 1°, 2° e 3° ínstares em S. berthaultii pela ação dos tricomas glandulares, sendo que o 4° ínstar e adulto não foram afetados. Em S. tuberosum não foi observada mortalidade do predador. A capacidade de predação de S. (Pullus) argentinicus foi significativamente superior na batata S. tuberosum em relação a S. berthaultii em todos os ínstares e adultos. A mortalidade de M. persicae foi superior em S. tuberosum (por predação) em relação aos valores observados em S. berthaultii (pela ação combinada do predador e tricomas glandulares). Abstract in english The effect of glandular trichomes of wild potato plant Solanum berthaultii, on larval development, survival and prey capacity of Scymnus (Pullus) argentinicus (Weise) on the aphid Myzus persicae (Sulzer) was studied. The larval development of the predator was interrupted due the high mortality (89%) [...] on the 1st instar, probably due to the action of glandular trichomes of S. berthaultii. It was observed also mortality of 1st, 2nd and 3rd instars when S. argentinicus was liberated on S. berthaultii. The 4th instar and the adult stage of the predator were not affected by the glandular trichomes. It was not observed mortality of S. argentinicus on S. tuberosum and the prey capacity of S. (Pullus) argentinicus was significantly higher on S. tuberosum when compared to S. berthaultii, in all instars and adult. The mortality of M. persicae was higher in S. tuberosum (by predation) when compared to S. berthaultii (by the combined action of predator and glandular trichomes).

Daniel C., Gamarra; Vanda H. P., Bueno; Jair C., Moraes; Alexander M., Auad.


Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas). O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus ( [...] Dallas) (Hemiptera, Pentatomidae), é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae) e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume) durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%). Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão. Abstract in english Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas). Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the inter [...] action of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas) (Hemiptera, Pentatomidae) has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v) during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20%) ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.

Walter S., Evangelista Junior; Roberta L., Santos; Jorge B., Torres; José C., Zanuncio.


Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas  

Directory of Open Access Journals (Sweden)

Full Text Available Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas. Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the interaction of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20% ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas. O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae, é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%. Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão.

Walter S. Evangelista Junior



Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predação  

Directory of Open Access Journals (Sweden)

Full Text Available Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per feeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae. We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.Plantas em frutificação atraem visitas freqüentes de aves que comem frutos e tendem a ser manchas previsíveis para um predador. Conseqüentemente, o risco de ataque de um predador aumenta com o tempo de permanência de uma ave frugívora em uma planta com frutos. Neste estudo, testamos se espécies de aves grandes e crípticas passam mais tempo por visita de alimentação em plantas em frutificação que espécies pequenas e conspícuas. Obtivemos dados da literatura para oito espécies de plantas do Cerrado e também de observações em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae. Procuramos por uma relação positiva entre o tempo médio de visita e o comprimento total das espécies de aves, considerando a cor das espécies como uma co-variável. A duração das visitas de espécies grandes e crípticas foi maior que a duração de visitas de aves pequenas e conspícuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes são menos comuns. Aves crípticas, por sua vez, devem ser difíceis de serem detectadas por predadores e, conseqüentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provêm apoio à hipótese de que espécies de aves vulneráveis passam menos tempo forrageando em plantas com frutos.

Igor Aurélio Silva



Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model / Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Plantas em frutificação atraem visitas freqüentes de aves que comem frutos e tendem a ser manchas previsíveis para um predador. Conseqüentemente, o risco de ataque de um predador aumenta com o tempo de permanência de uma ave frugívora em uma planta com frutos. Neste estudo, testamos se espécies de a [...] ves grandes e crípticas passam mais tempo por visita de alimentação em plantas em frutificação que espécies pequenas e conspícuas. Obtivemos dados da literatura para oito espécies de plantas do Cerrado e também de observações em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae). Procuramos por uma relação positiva entre o tempo médio de visita e o comprimento total das espécies de aves, considerando a cor das espécies como uma co-variável. A duração das visitas de espécies grandes e crípticas foi maior que a duração de visitas de aves pequenas e conspícuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes são menos comuns. Aves crípticas, por sua vez, devem ser difíceis de serem detectadas por predadores e, conseqüentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provêm apoio à hipótese de que espécies de aves vulneráveis passam menos tempo forrageando em plantas com frutos. Abstract in english Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per f [...] eeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae). We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.

Silva, Igor Aurélio; Figueiredo, Rodolfo Antônio de; Matos, Dalva Maria da Silva.


Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae) em plantas hospedeiras / Feeding preference and performance of Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) among host plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae), caruru, Amaranthus lividus L. (Amaranthaceae) e [...] feijão, Phaseolus vulgaris L. (Fabaceae). Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos) e ganho de peso (28 a 30% do peso vivo) foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas. Abstract in english The choice between cotton, Gossypium hirsutum L. (Malvaceae), green bean, Phaseolus vulgaris L. (Fabaceae) and pigweed, Amaranthus lividus L. (Amaranthaceae) and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret) (Hemiptera, Penta [...] tomidae) adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes) and weight gain (28 to 30% of body weight) were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

Roberta R., Coelho; Antônio F. S. L., Veiga; Jorge B., Torres.


Apuntes sobre la alimentación de la población prehispánica de la Cordillera Oriental de Colombia  

Directory of Open Access Journals (Sweden)

Full Text Available Desde sus orígenes, la afanosa búsqueda de alimentos, agua, techo y calor ha representado gran parte del quehacer del hombre, que orientó sus esfuerzos, diseñó estrategias e instrumentos; desarrolló relaciones sociales y adaptaciones ecológicas específicas con el fin de satisfacer estas necesidades primarias, con el menor gasto de energía posible. La salud del hombre, al igual que la de todas las criaturas vivas, depende de la adecuada satisfacción de estas necesidades primarías, como de evitar el riesgo de los predadores y accidentes ocupacionales.

José Vicente Rodríguez Cuenca



Genetically modified corn on fall armyworm and earwig populations under field conditions / Milho geneticamente modificado e sua ação sobre a lagarta-do-cartucho e tesourinha em condições de campo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se o efeito do milho geneticamente modificado MON810 sobre o inseto praga Spodoptera frugiperda (J.E. Smith) e o seu predador Doru luteipes (Scudder) em condições de campo no Brasil. As avaliações foram conduzidas em campos de milho MON810, comparadas com milho convencional com e sem aplicaç [...] ão de inseticidas, em quatro safras na região de Barretos, SP. Foram avaliados os danos de S. frugiperda em plantas e a contagem do número de lagartas de S. frugiperda e de adultos e ninfas do predador D. luteipes em plantas de milho. Verificou-se uma menor porcentagem de danos de S. frugiperda e os menores números médios de lagartas (pequenas e grandes) no milho MON810. Não foram observadas diferenças (P>0,05) entre os tratamentos na abundância do predador D. luteipes em plantas de milho. A segunda época de plantio apresentou as maiores porcentagens de danos de S. frugiperda e as menores médias do número de tesourinhas coletadas. O milho MON810 foi efetivo no controle de S. frugiperda e a abundância do predador D. luteipes foi similar nos três tratamentos, em condições de campo. Abstract in english The effects of corn MON810 on the Spodoptera frugiperda (J.E. Smith) and the earwig Doru luteipes (Scudder) were tested under field conditions in Brazil. Results from MON810 corn fields were compared with those fields of conventional corn with and without the application of insecticides in four harv [...] ests in the region of Barretos, SP. It was assessed the damage to S. frugiperda via direct counts of the number of fall armyworms and adults and nymphs of the predator D. luteipes on corn plants. The rate of S. frugiperda damage and the average numbers of larvae (large and small) were lower in the MON810 corn field relative to the control plot. There were no differences (P>0.05) between treatments regarding the predator abundance in corn plants. The second crop season ("safrinha") showed the greatest extent of S. frugiperda damage and the lowest average abundance of earwigs. MON810 was effective in controlling S. frugiperda and abundance of predator D. luteipes was similar in the three treatments under field conditions.

Frizzas, Marina Regina; Silveira Neto, Sinval; Oliveira, Charles Martins de; Omoto, Celso.


Fat body morphology of Eriopis connexa (coleoptera, coccinelidae) in function of two alimentary sources  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Joaninhas são eficazes predadores de artrópodes atuando diretamente sobre certas pragas e alimentando-se de parte ou de todo o corpo da presa. Dentre os coccinelídeos, Eriopis connexa possui uma posição de destaque no controle de pulgões. Os coccinelídeos por serem predadores generalistas, apresenta [...] m uma variabilidade na escolha de presas, alimentando-se também de ácaros. No Brasil, trabalhos realizados com E. connexa, apenas relatam a sua ocorrência, sendo assim este trabalho objetivou investigar a influência de duas fontes alimentares: pulgões e ácaros, na morfologia do corpo gorduroso de E. connexa. Os resultados mostraram que as células do corpo gorduroso dos indivíduos alimentados com pulgões apresentaram áreas mais de três vezes superiores (511 ± 98,7µm²) que as das células do corpo gorduroso de indivíduos alimentados com ácaros (162 ± 34,9µm²). Além disso, testes histoquímicos demonstraram que a quantidade de nutrientes estocados no corpo gorduroso também foi superior em indivíduos alimentados com pulgões. Abstract in english This work investigated the influence of two alimentary sources: aphids and mites, in the morphology of the fat body of E. connexa. Results showed that fat body cells of individuals fed with aphids presented areas more than three folds higher (511 ± 98,7µm²) than those of beetles fed with mites (162 [...] ± 34,9µm²). Histochemical tests showed that nutrient amount stored in fat body was higher in lady-beetles fed on aphids.

Renato de Almeida, Sarmento; Hamilton Gomes de, Oliveira; Anderson Mathias, Holtz; Solange Marques da, Silva; José Eduardo, Serrão; Ângelo, Pallini.


Fat body morphology of Eriopis connexa (coleoptera, coccinelidae in function of two alimentary sources  

Directory of Open Access Journals (Sweden)

Full Text Available This work investigated the influence of two alimentary sources: aphids and mites, in the morphology of the fat body of E. connexa. Results showed that fat body cells of individuals fed with aphids presented areas more than three folds higher (511 ± 98,7µm² than those of beetles fed with mites (162 ± 34,9µm². Histochemical tests showed that nutrient amount stored in fat body was higher in lady-beetles fed on aphids.Joaninhas são eficazes predadores de artrópodes atuando diretamente sobre certas pragas e alimentando-se de parte ou de todo o corpo da presa. Dentre os coccinelídeos, Eriopis connexa possui uma posição de destaque no controle de pulgões. Os coccinelídeos por serem predadores generalistas, apresentam uma variabilidade na escolha de presas, alimentando-se também de ácaros. No Brasil, trabalhos realizados com E. connexa, apenas relatam a sua ocorrência, sendo assim este trabalho objetivou investigar a influência de duas fontes alimentares: pulgões e ácaros, na morfologia do corpo gorduroso de E. connexa. Os resultados mostraram que as células do corpo gorduroso dos indivíduos alimentados com pulgões apresentaram áreas mais de três vezes superiores (511 ± 98,7µm² que as das células do corpo gorduroso de indivíduos alimentados com ácaros (162 ± 34,9µm². Além disso, testes histoquímicos demonstraram que a quantidade de nutrientes estocados no corpo gorduroso também foi superior em indivíduos alimentados com pulgões.

Renato de Almeida Sarmento



Efeitos do plantio direto e da consorciação soja-milho sobre inimigos naturais e pragas  

Directory of Open Access Journals (Sweden)

Full Text Available Procurou-se avaliar os efeitos do plantio direto e da consorciação soja (Glycine max (L. Merrill e milho (Zea mays L. sobre pragas e inimigos naturais. Os tratamentos constituíram um fatorial 3 x 2 (monocultura de soja, monocultura de milho, consorciação soja-milho x plantio direto, plantio convencional, em blocos casualizados. Os insetos foram amostrados pelo método do pano, rede entomológica, procura visual e armadilha de sucção. Entre os insetos-pragas do milho, Maecolaspis assimilis ocorreu em maior número no sistema de plantio convencional; o mesmo ocorreu com os predadores Cycloneda sanguinea e Doru sp. Por outro lado, M. assimilis e o predador Toxomerus sp. foram mais numerosos na monocultura de milho em relação à cultura do milho consorciado com soja. Dos insetos-pragas da soja, destacaram-se pelo maior número Anticarsia gemmatalis e Diabrotica gracilenta, no sistema de plantio convencional, e o mesmo aconteceu com a espécie da família Trichogrammatidae, enquanto as espécies da família Eulophidae foram mais numerosas na soja sob sistema de plantio direto. Na soja consorciada com milho foi maior o número de insetos-pragas Megalotomus sp. e Maecolaspis sp. e dos inimigos naturais Geocoris sp., Lebia concina, Orius sp., Braconidae e Scelionidae.

Cividanes Francisco Jorge



Caracterização da microfauna em estação de tratamento de esgotos do tipo lodos ativados: um instrumento de avaliação e controle do processo Microfauna characterization in activated sludge wastewater treatment plant: an instrument of assessment and control of process  

Directory of Open Access Journals (Sweden)

Full Text Available A microfauna presente em uma ETE por lodos ativados foi caracterizada, correlacionada com parâmetros físico-químicos e utilizada em modelos existentes de avaliação de sistemas. Durante 351 dias o lodo ativado manteve-se estável com flocos compactos, pequenos e com poucos filamentos. Os protozoários predominantes no lodo foram as tecamebas e os ciliados predadores de flocos, indicando estabilidade do sistema. Os métodos propostos em literatura, baseados no IBL, na densidade total da microfauna e na relação entre ciliados predadores de flocos e ciliados fixos, mostraram-se eficientes para o diagnóstico das condições depurativas do sistema. A análise qualitativa do lodo, englobando o tamanho, quantidade de filamentos, compactação e a identificação das espécies dominantes, foi suficiente para uma caracterização imediata das condições depurativas do sistema de tratamento.Microfauna found in an activated sludge WTP was characterized, correlated to the physical-chemical parameters and used in existing assessment models. During 351 days, the activated sludge remained stable with compacted and small poorly filamentous flocs. It was composed mainly by testate amoebas and crawling ciliates that indicated the stability of the system. The application of the existent system evaluation models to microfauna (SBI, crawling ciliate/attached ciliate relation and total density was found to be efficient for the assessment of the system depurative conditions. The sludge qualitative analysis, which included the flocs size, amount of filaments, compacting and the identification of the dominant microfauna species, was enough to an immediate diagnosis of the treatment system depurative conditions.

Alessandra Pellizzaro Bento



Energy density of freshwater Patagonian organisms / Densidad energética de los organismos Patagónicos de agua dulce  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: English Abstract in spanish La densidad energética de los organismos puede ser utilizada con distintos fines como evaluar la calidad de la dieta, comparar la importancia de distintas presas para un predador, corregir las tasas de evacuación gástrica de modelos, explicar el comportamiento de forrajeo de ciertos predadores o det [...] erminar su estado fisiológico. Consiste en un parámetro fundamental para el modelado bioenergético de ecosistemas. En este trabajo estimamos la densidad energética de los principales grupos de los ecosistemas de agua dulce de la Patagonia, incluyendo peces, crustáceos, gasterópodos, oligoquetos e insectos. Encontramos que los peces (5048-5789 Cal/g) es el grupo energéticamente más denso seguido de los insectos (5062-5232), crustáceos (3364-3994), oligoquetos (3471) y finalmente los gasterópodos (1143). Abstract in english We assessed by using a bomb calorimeter the energy density of the main species of Patagonian freshwater ecosystems, including fish, crustaceans, gastropods, oligochaetes, and insects. Fish (5048-5789 Cal/g) were the most energy density group, followed by insects (5062- 5232), crustaceans (3364-3994) [...] , oligochaetes (3471) and gastropods (1143). These data consist on the first direct energy density estimations of freshwater species and are intended as a baseline information for modelling the energy fluxes in Patagonian freshwater ecosystems.

Ciancio, Javier; Pascual, Miguel.


Corn: risk associated with contamination by F. Verticillioides and fumonisins/ Milho: riscos associados à contaminação por Fusarium verticillioides e fumonisinas  

Directory of Open Access Journals (Sweden)

Full Text Available The corn (Zea mays L. is the main culture of food productive chain with annual production of 583 million tons, where Brazil accounts with approximately 7% of total. Concerning the nutritional properties, the corn is attacked by several predadors, with emphasis on fumonisin producing Fusarium verticillioides Sacc. Niremberg (F. moniliforme Sheldon, which predominate in corn micoflora. The deleterious effects extend from field to consumption stage worldwide, affecting every corn exporter countries. The overcoming of losses requires the domain on basic knowledges about infection/mycotoxicology, for further adequate preventive directions. The importance of corn, with emphasis on the impact of F. verticillioides/fumonisin contamination in food safety is reviewed.O milho (Zea mays L. é uma cultura relevante na cadeia produtiva de alimentos com produção anual de 583 milhões de toneladas, onde o Brasil participa com aproximadamente 7% do total. Devido a propriedades nutricionais, o milho é acometido por inúmeros predadores, destacando-se Fusarium verticillioides Sacc. Niremberg (F. moniliforme Sheldon produtor de fumonisina, por ser o integrante que predomina a micoflora. Os efeitos deletérios extende-se do campo ao consumo em vista a distribuição mundial, contaminando o milho nos principais países exportadores. Para contornar os prejuízos, o domínio sobre princípios básicos referentes a infecção/micotoxicologia é fundamental, visando direcionamento adequado de medidas preventivas. Apresenta-se uma revisão sobre importância de milho, enfatizando o impacto da contaminação por F. verticillioides/fumonisina na segurança alimentar.

Elisa Yoko Hirooka



Controller design techniques for the Lotka-Volterra nonlinear system  

Directory of Open Access Journals (Sweden)

Full Text Available A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species. In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, that the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies. Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional. Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico.

Magno Enrique Mendoza Meza



Controller design techniques for the Lotka-Volterra nonlinear system  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies). Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe [...] em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional). Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico. Abstract in english A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species). In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, tha [...] t the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.

Magno Enrique Mendoza, Meza; Amit, Bhaya; Eugenius, Kaszkurewicz.


Períodos de ausência de presas e estabilidade do controle biológico do ácaro-rajado Periods of prey absence and stability of the spider mite biological control  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar os parâmetros biológicos do ácaro predador Phytoseiulus macropilis na ausência de alimento por períodos de um a seis dias. Foram avaliados: o número de ovos por fêmea ao dia; o número total de ovos; a longevidade de fêmeas; e a razão sexual dos descendentes. Fêmeas que ficaram por mais de três dias sem alimento apresentaram queda em todas variáveis biológicas avaliadas. O predador P. macropilis somente se estabelecerá em campo se as manchas ocupadas pelo ácaro-rajado não estiverem muito distantes umas das outras.The objective of this work was to access the biological parameters of the predator mite Phytoseiulus macropilis in the food absence for periods of one or more days. Data evaluated were: egg number per female per day; total number of eggs; longevity of females; and the offspring sex rate. Female in starvation for three or more days showed decrease in all biological variables. P. macropilis only will settle in the field if patch populations occupied by spider mite are not very distant from each other.

Hamilton Oliveira



The glassy sweepers' way: seeking a versatile wrasse to be cleaned  

Directory of Open Access Journals (Sweden)

Full Text Available Diurnal reef fishes compose the bulk of clients that seek cleaner fishes' services, but some nocturnal species that shelter at daytime also seek the cleaners. While doing so the nocturnal clients must leave their hiding places and thus they get exposed to potential diurnal predators. We report here on the cleaning interactions between a daytime cleaner wrasse (Thalassoma noronhanum and a night time active client (Pempheris schomburgki that usually remains sheltered at daytime. We recorded P. schomburgki leaving their shelter at daytime and heading towards T. noronhanum, whenever the cleaner swam by the shelter. Since T. noronhanum is able to tend temporary cleaning station near the safety of the shelters of its clients, P. schomburgki lessens a possible risk of predation by seeking this versatile cleaner.Peixes recifais diurnos compõem a maioria dos clientes nas estações de peixes limpadores. Entretanto, algumas espécies com hábitos noturnos também procuram os peixes limpadores, ficando expostas a potenciais predadores diurnos quando precisam deixar seus abrigos. Registramos aqui as interações de limpeza entre um labrídeo diurno (Thalassoma noronhanum e um cliente com hábitos noturnos (Pempheris schomburgki, que permanece abrigado durante o dia. Esta espécie de cliente deixa seu abrigo durante o dia e nada em direção a T. noronhanum quando este limpador desloca-se próximo aos esconderijos. Uma vez que T. noronhanum é capaz de manter estações de limpeza temporárias, próximas aos abrigos dos clientes, P. schomburgki diminui uma possível exposição aos predadores quando procura esta espécie versátil de limpador.

Cristina Sazima



A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates  

Directory of Open Access Journals (Sweden)

Full Text Available Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos peixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores.

Cristina Sazima



Biology of Brontocoris tabidus (Heteroptera: Pentatomidae) fed with Musca domestica (Diptera: Muscidae) larvae / Biologia de Brontocoris tabidus (Heteroptera: Pentatomidae) alimentado com larvas de Musca domestica (Diptera: Muscidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A performance reprodutiva e o desenvolvimento de Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) alimentado com larvas de Musca domestica L. (Diptera: Muscidae) foram investigados. A duração da fase ninfal desse predador foi de 31,2 dias, com sobrevivência de 44,1%. Os períodos de pré-ovi [...] posição e de incubação e o número de ovos por postura foram de 8,14 dias, 5,6 dias e 45,4 dias, respectivamente. B. tabidus apresentou viabilidade de ovos de 44,7%. A longevidade das fêmeas desse predador foi de 18,4 dias. Esses resultados são discutidos com ênfase ao uso de M. domestica em criação massal e manutenção de colônias de B. tabidus em condições de laboratório. Abstract in english Development and reproductive performance of Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) fed with Musca domestica L. (Diptera: Muscidae) larvae was evaluated. Duration of the nymphal phase of this predator was 31.2 days, with a 44.1% survival rate. Preoviposition and egg incubation per [...] iods and number of eggs/egg mass were 8.14 days, 5.6 days, and 45.4, respectively. B. tabidus presented 44.7% egg viability. Female longevity of this predator was 18.4 days. Results are discussed based on this prey use in mass rearing and maintenance of colonies of B. tabidus under laboratory conditions.

P., Jusselino-Filho; J. C., Zanuncio; D. B., Fragoso; J. E, Serrão; M. C., Lacerda.


Biology of Brontocoris tabidus (Heteroptera: Pentatomidae fed with Musca domestica (Diptera: Muscidae larvae Biologia de Brontocoris tabidus (Heteroptera: Pentatomidae alimentado com larvas de Musca domestica (Diptera: Muscidae  

Directory of Open Access Journals (Sweden)

Full Text Available Development and reproductive performance of Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae fed with Musca domestica L. (Diptera: Muscidae larvae was evaluated. Duration of the nymphal phase of this predator was 31.2 days, with a 44.1% survival rate. Preoviposition and egg incubation periods and number of eggs/egg mass were 8.14 days, 5.6 days, and 45.4, respectively. B. tabidus presented 44.7% egg viability. Female longevity of this predator was 18.4 days. Results are discussed based on this prey use in mass rearing and maintenance of colonies of B. tabidus under laboratory conditions.A performance reprodutiva e o desenvolvimento de Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae alimentado com larvas de Musca domestica L. (Diptera: Muscidae foram investigados. A duração da fase ninfal desse predador foi de 31,2 dias, com sobrevivência de 44,1%. Os períodos de pré-oviposição e de incubação e o número de ovos por postura foram de 8,14 dias, 5,6 dias e 45,4 dias, respectivamente. B. tabidus apresentou viabilidade de ovos de 44,7%. A longevidade das fêmeas desse predador foi de 18,4 dias. Esses resultados são discutidos com ênfase ao uso de M. domestica em criação massal e manutenção de colônias de B. tabidus em condições de laboratório.

P. Jusselino-Filho



Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?  

Directory of Open Access Journals (Sweden)

Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

Cristiano S. de Azevedo



Biological aspects and predatory capacity of Podisus nigrispinus (Dallas (Hemiptera: Pentatomidae fed on Alabama argillacea (Hübner (Lepidoptera: Noctuidae reared on cotton genotypes Aspectos biológicos e capacidade predatória de Podisus nigrispinus (Dallas (Hemiptera: Pentatomidae alimentado com Alabama argillacea (Hübner (Lepidoptera: Noctuidae criada em genótipos de algodoeiro  

Directory of Open Access Journals (Sweden)

Full Text Available Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute, CNPA 9211-31 (high gossypol level, CNPA 9211-41 (medium gossypol level and GL2 GL3 (gossypol glandless. The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.Plantas hospedeiras podem influenciar indiretamente as características biológicas do predador, de maneira positiva ou negativa, ressaltando assim a importância de estudos relacionando o efeito de cultivares sobre o terceiro nível trófico. Este trabalho avalia os aspectos biológicos e a capacidade predatória de adultos de Podisus nigrispinus alimentados com lagartas de Alabama argillacea criadas em genótipos de algodoeiro. Diariamente o predador foi alimentado com lagartas de quarto ínstar criadas com folhas de algodoeiro CNPA Precoce 1 (média pilosidade, CNPA 9211-31 (alto teor de gossipol, CNPA 9211-41 (teor médio de gossipol e GL2 GL3 (sem gossipol. Essas plantas oferecidas como alimento às lagartas não influenciaram os períodos de pré-oviposição, oviposição e pós-oviposição e a capacidade de oviposição do predador. O peso médio das fêmeas foi maior (126,2 mg quando elas foram alimentadas com lagartas de A. argillacea criadas em folhas do genótipo GL2 GL3, em comparação com aquele (96,2 mg de fêmeas que se alimentaram de lagartas criadas em folhas do genótipo CNPA 9211-41. A longevidade de fêmeas do predador variou de 30,7 a 31,5 dias, enquanto que a dos machos apresentou intervalo de variação de 38,0 a 66,3 dias. Fêmeas de P. nigrispinus predaram, em média, de 125,2 a 184,0 lagartas, durante a fase adulta, enquanto os machos predaram no mínimo 135,7 e no máximo 205,0 lagartas. Para o controle de A. argillacea, a utilização de plantas resistentes em associação com P. nigrispinus é viável, pois genótipos resistentes não influenciam negativamente as características biológicas do predador.

Terezinha Monteiro dos Santos



Biological aspects and predatory capacity of Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) fed on Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) reared on cotton genotypes / Aspectos biológicos e capacidade predatória de Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) alimentado com Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) criada em genótipos de algodoeiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Plantas hospedeiras podem influenciar indiretamente as características biológicas do predador, de maneira positiva ou negativa, ressaltando assim a importância de estudos relacionando o efeito de cultivares sobre o terceiro nível trófico. Este trabalho avalia os aspectos biológicos e a capacidade pr [...] edatória de adultos de Podisus nigrispinus alimentados com lagartas de Alabama argillacea criadas em genótipos de algodoeiro. Diariamente o predador foi alimentado com lagartas de quarto ínstar criadas com folhas de algodoeiro CNPA Precoce 1 (média pilosidade), CNPA 9211-31 (alto teor de gossipol), CNPA 9211-41 (teor médio de gossipol) e GL2 GL3 (sem gossipol). Essas plantas oferecidas como alimento às lagartas não influenciaram os períodos de pré-oviposição, oviposição e pós-oviposição e a capacidade de oviposição do predador. O peso médio das fêmeas foi maior (126,2 mg) quando elas foram alimentadas com lagartas de A. argillacea criadas em folhas do genótipo GL2 GL3, em comparação com aquele (96,2 mg) de fêmeas que se alimentaram de lagartas criadas em folhas do genótipo CNPA 9211-41. A longevidade de fêmeas do predador variou de 30,7 a 31,5 dias, enquanto que a dos machos apresentou intervalo de variação de 38,0 a 66,3 dias. Fêmeas de P. nigrispinus predaram, em média, de 125,2 a 184,0 lagartas, durante a fase adulta, enquanto os machos predaram no mínimo 135,7 e no máximo 205,0 lagartas. Para o controle de A. argillacea, a utilização de plantas resistentes em associação com P. nigrispinus é viável, pois genótipos resistentes não influenciam negativamente as características biológicas do predador. Abstract in english Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus [...] adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute), CNPA 9211-31 (high gossypol level), CNPA 9211-41 (medium gossypol level) and GL2 GL3 (gossypol glandless). The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg) when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg) of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.

Terezinha Monteiro dos, Santos; Arlindo Leal, Boiça Jr..


Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical contact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A predator and kairomones present and B predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A predator and kairomones absent and B the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity and food (algae did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do contato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A predador e "kairomones" presentes e B predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A predador e "kairomones" ausentes e B igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica e alimento (algas não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones".

WJ. Minto



Fish ladders: safe fish passage or hotspot for predation?  

Directory of Open Access Journals (Sweden)

Full Text Available Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmonids during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladder environment, which is associated with injuries suffered along the ladder course and the presence of multiple predator groups with different predation strategies, transformed the fish corridor into a hotspot for predation.Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embora a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predaç??o em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil, buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003. Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às inj

Angelo Antonio Agostinho



Roadkills of vertebrates in Venezuela Vertebrados mortos em estradas na Venezuela  

Directory of Open Access Journals (Sweden)

Full Text Available This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October. During five passages on this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758 (Myrmecophagidae, 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae. Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-outubro. Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae, durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 raposas Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766 (Myrmecophagidae, 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae. Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.

Jan Pinowski



Colonization of artificial substrata by teredinid larvae released from a previously infested focus at Ilha Grande Bay, RJ  

Directory of Open Access Journals (Sweden)

Full Text Available The colonization pattern of wooden panels by teredinid larvae released from a previously infested focus was investigated. Panels were placed at different distances (1, 10, 20m and in different directions from the focus. The colonization experiment took place at Parcel do Aleijado, Ilha Grande Bay, RJ. The focus remained immersed in nearly surface water, by the coast, during three months for infestation by teredinids. After this period, it was transferred to the study site. The infested focus and colonization panels remained in water, 10m deep, for three months more. Total density and density of the dominant species were considered for each group of panels. Five teredinid species were found: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. The dominant species was Teredo furcifera (76.6%. Significant differences were only observed between directions for total teredinids and for dominant species density. Results concerning the dominant species Teredo furcifera were even more expressive and suggested the occurrence of a local water circulation pattern.Foi estudado o padrão de colonização de larvas de teredinídeo liberadas a partir de um foco previamente infestado. Coletores foram posicionados a diferentes distâncias (1m, 10m, 20m e em diferentes sentidos a partir do foco. O experimento de colonização foi realizado junto ao Parcel do Aleijado, Baía da Ilha Grande, RJ. O foco permaneceu imerso próximo à superfície, junto à costa, durante 3 meses para infestação por teredinídeos. Após este período, foi tranferido para a área de estudo. O foco infestado e os coletores permaneceram imersos, a 10m de profundidade, por mais 3 meses. Foram consideradas a densidade total e a densidade da espécie dominante para cada grupo de coletores. Foram encontradas 5 espécies de teredinídeos: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. A espécie dominante foi Teredo furcifera (76,6%. Diferenças significativas foram observadas somente entre os diferentes sentidos, para o valor total de teredinídeos e para a densidade da espécie dominante. Os resultados envolvendo a espécie dominante Teredo furcifera foram ainda mais expressivos e sugerem a ocorrência de um padrão local de circulação de água.

Ricardo Silva Varotto



Colonization of artificial substrata by teredinid larvae released from a previously infested focus at Ilha Grande Bay, RJ  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Foi estudado o padrão de colonização de larvas de teredinídeo liberadas a partir de um foco previamente infestado. Coletores foram posicionados a diferentes distâncias (1m, 10m, 20m) e em diferentes sentidos a partir do foco. O experimento de colonização foi realizado junto ao Parcel do Aleijado, Ba [...] ía da Ilha Grande, RJ. O foco permaneceu imerso próximo à superfície, junto à costa, durante 3 meses para infestação por teredinídeos. Após este período, foi tranferido para a área de estudo. O foco infestado e os coletores permaneceram imersos, a 10m de profundidade, por mais 3 meses. Foram consideradas a densidade total e a densidade da espécie dominante para cada grupo de coletores. Foram encontradas 5 espécies de teredinídeos: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. A espécie dominante foi Teredo furcifera (76,6%). Diferenças significativas foram observadas somente entre os diferentes sentidos, para o valor total de teredinídeos e para a densidade da espécie dominante. Os resultados envolvendo a espécie dominante Teredo furcifera foram ainda mais expressivos e sugerem a ocorrência de um padrão local de circulação de água. Abstract in english The colonization pattern of wooden panels by teredinid larvae released from a previously infested focus was investigated. Panels were placed at different distances (1, 10, 20m) and in different directions from the focus. The colonization experiment took place at Parcel do Aleijado, Ilha Grande Bay, [...] RJ. The focus remained immersed in nearly surface water, by the coast, during three months for infestation by teredinids. After this period, it was transferred to the study site. The infested focus and colonization panels remained in water, 10m deep, for three months more. Total density and density of the dominant species were considered for each group of panels. Five teredinid species were found: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. The dominant species was Teredo furcifera (76.6%). Significant differences were only observed between directions for total teredinids and for dominant species density. Results concerning the dominant species Teredo furcifera were even more expressive and suggested the occurrence of a local water circulation pattern.

Varotto, Ricardo Silva; Barreto, Cristine Costa.


Distribution of warm water alpheoid shrimp (crustacea, caridea on the continental shelf of eastern south america between 23 and 35º lat. S  

Directory of Open Access Journals (Sweden)

Full Text Available The southern boundaries of Tozeuma serratum A. Milne Edwards, Salmoneus ortmanni (Rankin and Processa profunda Manning & Chace, previously known only from the northwestern Atlantic, have been extended to São Paulo, Paraná and Uruguay, respectively. Latreutes parvulus (Stimpson, previously not known beyond São Paulo has been found to as far south as the Province of Buenos Aires. A systematic account of these four species is furnished, based mainly on material collected by the R/V "Prof. W. Besnard". The 16 species of Alpheoidea whose southern boundaries occur in warm-temperate shelf waters of eastern South America belong to two distinct faunal assemblages: (1 Tropical species - Alpheus floridanus Kingsley, A. intrinsecus Bate, A. normanni Kingsley, Salmoneus ortmanni (Rankin Synalpheus longicarpus (Herrick, Ogyrides alphaerostris (Kingsley (= O. occidentalis(Ortmann, Exhippolysmata oplophoroides (Holthuis, Latreutes parvalus (Stimpson, Processa bermudensis (Rankin and P. hemphilli Manning & Chace - which are largely restricted to coastal and inshore shelf waters less than 50 m deep; and (2 Subtropical species - Alpheus pouang Chris toffersen, A. puapeba Christoffersen, Merhippolyte americana Holthuis, Tozeuma serratum A. Milne Edwards, Processa guyanae. Holthuis and P. profunda Manning & Chace - which are largely restricted to the outer portion of the continental shelf within the studied area. Considering the temperature and distributional data available for each species, it is suggested that the poleward boundaries of O. alphaerostris are set by maximum summer temperatures of about 20ºC required for the reproduction of the species, while the poleward boundaries of most of the tropical and subtropical species are set by minimum winter temperatures critical for their survival: about 15ºC for A. floridanus, about 11ºC for E. oplophoroides, about 9ºC for A. pouang, L. parvulus, P. guyanae., P. guyanae and P. hemphilli, and P. profunda and about 8ºC for A. puapeba and M. americana. It is further suggested that the shoreward boundaries of some of the subtropical species are set by maximum summer temperatures critical for their survival: about 20-22ºC for A. puapzba and about 17-18ºC for A. pouang and M. americana.

Martin L Christoffersen



Fototrampeo de mamíferos en la Sierra Nanchititla, México: abundancia relativa y patrón de actividad  

Directory of Open Access Journals (Sweden)

Full Text Available La conservación de las especies y su manejo adecuado dependen de la disponibilidad de información sobre sus poblaciones, por ello es importante estudiar aspectos como la abundancia y el patrón de actividad. En esta investigación se utilizaron trampas-cámara para obtener índices de abundancia relativa y establecer el patrón de actividad de los mamíferos medianos y grandes de la Sierra Nanchititla, México. El trabajo se llevó a cabo durante el periodo de diciembre de 2003 a mayo de 2006, con un esfuerzo total de 4 305 días-trampa. Se obtuvieron 897 fotografías de 19 especies, las más abundantes fueron: Nasua narica, Sylvilagus floridanus y Urocyon cinereoargenteus, de acuerdo con el índice de abundancia relativa (IAR, número de registros independientes/100 días trampa, coincidiendo con estudios basados en métodos indirectos. El patrón de actividad de las especies registradas mostraron que el 67% son de hábitos nocturnos. Algunas especies mostraron diferencias con los patrones mencionados por otros autores, las cuales se relacionan principalmente con la estacionalidad, la disponibilidad de recursos y el sexo de los individuosMammals’ camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns. Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days, and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. Rev. Biol. Trop. 59 (1: 373-383. Epub 2011 March 01.

Octavio Monroy-Vilchis



Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB after Fungal and Phosphoric Acid Pretreatment  

Directory of Open Access Journals (Sweden)

Full Text Available Oil palm empty fruit bunch (OPEFB was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB’s cellulose by 4, 6.3, and 7.4 folds, respectively.

Mohammad J. Taherzadeh



Análisis comparativo de la alimentación del gato montés (Lynx Rufus en dos diferentes ambientes de México  

Directory of Open Access Journals (Sweden)

Full Text Available En el presente trabajo se analiza, en forma comparativa, la alimentación del gato montés en dos localidades con ambientes diferentes: la primera es el predio ?El Plomito?, Sonora, con vegetación de matorrales áridos, y la segunda es la Sierra del Ajusco, en el sur de la Cuenca de México, donde predominan los bosques de coníferas. Mediante el análisis de 197 y 922 excretas, se identificaron 18 y 28 presas diferentes, respectivamente. En ambas localidades, los grupos de especies presa que aportaron mayor biomasa a la alimentación del gato montés fueron los lagomorfos, con 74.2% en El Plomito y 70.0% en El Ajusco, y los roedores con 18.9 y 18.7%, en el mismo orden. En El Plomito la presa más importante fue Sylvilagus audubonii (35.5%, seguida por Lepus sp. (31.5%, Neotoma albigula (14.0%, Odocoileussp. (2.9% y Spermophilus variegatus (1.7%. En El Ajusco la presa más importante fue Sylvilagus floridanus(41.6%, seguida por Sylvilagus cunicularius (15.4%, Romerolagus diazi (12.3%, Cratogeomys merriami (5.1% y Sciurus aureogaster (4.9%. Los resultados obtenidos apoyan la teoría de que el gato montés, al igual que las otras especies de linces, es un depredador especialista en la caza de lagomorfos.

Octavio Rosas



Back-pack unit for capturing waterfowl and upland game by night-lighting (United States)

A night-lighting unit, designed as a light weight back-pack, proved successful for capturing waterfowl pairs, pheasants (Phasianus colchicus), and cottontail rabbits (Sylvilagus floridanus) during the spring and summer when most breeding populations are widely dispersed. Eighty ducks of seven species were captured in 48 hours (1.7 ducks per hour) of night-lighting in marsh habitat. Similarly, 30 pheasants were trapped in 25 hours (1.2 birds per hour) and 63 cottontail rabbits were either observed at close range (6-12 ft) or captured during night-lighting operations in upland habitat. Catch per hour of effort increased for all species as their night habitat requirements and reaction to night-lights became known. The mobile unit proved well suited for intensive use on small areas where other methods of capture were unfeasible and where representative coverage of various habitat types was desired. Besides its utility for capturing animals, the unit provided a method for studying nocturnal movements, behavior, and habitat use of marked animals.

Drewien, R. C.; Reeves, H. M.; Springer, P. F.; Kuck, T. L.



Great horned owl (Bubo virginianus) dietary exposure to PCDD/DF in the Tittabawassee River floodplain in Midland, Michigan, USA. (United States)

Soils and sediments in the floodplain of the Tittabawassee River downstream of Midland, Michigan, USA contain elevated concentrations of polychlorinated dibenzofurans (PCDF) and polychlorinated dibenzo-p-dioxins (PCDD). As a long-lived, resident top predator, the great horned owl (Bubo virginianus; GHO) has the potential to be exposed to bioaccumulative compounds such as PCDD/DF. Site-specific components of the GHO diet were collected along 115 km of the Tittabawassee, Pine, Chippewa, and Saginaw Rivers during 2005 and 2006. The site-specific GHO biomass-based diet was dominated by cottontail rabbits (Sylvilagus floridanus) and muskrats (Ondatra zibethicus). Incidental soil ingestion and cottontail rabbits were the primary contributors of PCDD/DF to the GHO diet. The great horned owl daily dietary exposure estimates were greater in the study area (SA) (3.3 to 5.0 ng 2,3,7,8-TCDD equivalents (TEQ(WHO-avian))/kg body wt/d) than the reference area (RA) (0.07 ng TEQ(WHO-Avian)/kg body wt/d). Hazard quotients (HQs) based on central tendency estimates of the average daily dose and no-observable-adverse effect level (NOAEL) for the screech owl and uncertainty factors were <1.0 for both the RA and the SA. Hazard quotients based on upper end estimates of the average daily dose and NOAEL were <1.0 in the RA and up to 3.4 in the SA. PMID:20872700

Coefield, Sarah J; Zwiernik, Matthew J; Fredricks, Timothy B; Seston, Rita M; Nadeau, Michael W; Tazelaar, Dustin L; Moore, Jeremy N; Kay, Denise P; Roark, Shaun A; Giesy, John P



Structural changes of oil palm empty fruit bunch (OPEFB) after fungal and phosphoric acid pretreatment. (United States)

Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI) of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB's cellulose by 4, 6.3, and 7.4 folds, respectively. PMID:23247371

Isroi; Ishola, Mofoluwake M; Millati, Ria; Syamsiah, Siti; Cahyanto, Muhammad N; Niklasson, Claes; Taherzadeh, Mohammad J



Detection of L1, infectious virions and anti-L1 antibody in domestic rabbits infected with cottontail rabbit papillomavirus. (United States)

Shope papillomavirus or cottontail rabbit papillomavirus (CRPV) is one of the first small DNA tumour viruses to be characterized. Although the natural host for CRPV is the cottontail rabbit (Sylvilagus floridanus), CRPV can infect domestic laboratory rabbits (Oryctolagus cuniculus) and induce tumour outgrowth and cancer development. In previous studies, investigators attempted to passage CRPV in domestic rabbits, but achieved very limited success, leading to the suggestion that CRPV infection in domestic rabbits was abortive. The persistence of specific anti-L1 antibody in sera from rabbits infected with either virus or viral DNA led us to revisit the questions as to whether L1 and infectious CRPV can be produced in domestic rabbit tissues. We detected various levels of L1 protein in most papillomas from CRPV-infected rabbits using recently developed monoclonal antibodies. Sensitive in vitro infectivity assays additionally confirmed that extracts from these papillomas were infectious. These studies demonstrated that the CRPV/New Zealand White rabbit model could be used as an in vivo model to study natural virus infection and viral life cycle of CRPV and not be limited to studies on abortive infections. PMID:18024897

Hu, Jiafen; Budgeon, Lynn R; Cladel, Nancy M; Culp, Timothy D; Balogh, Karla K; Christensen, Neil D



Alkenone producers during late Oligocene-early Miocene revisited (United States)

This study investigates ancient alkenone producers among the late Oligocene-early Miocene coccolithophores recorded at Deep Sea Drilling Project (DSDP) Site 516. Contrary to common assumptions, Reticulofenestra was not the most important alkenone producer throughout the studied time interval. The comparison between coccolith species-specific absolute abundances and alkenone contents in the same sedimentary samples shows that Cyclicargolithus abundances explain 40% of the total variance of alkenone concentration and that the species Cyclicargolithus floridanus was a major alkenone producer, although other related taxa may have also contributed to the alkenone production at DSDP Site 516. The distribution of the different alkenone isomers (MeC37:2, EtC38:2, and MeC38:2) remained unchanged across distinct changes in species composition, suggesting similar diunsaturated alkenone compositions within the Noelaerhabdaceae family during the late Oligocene-early Miocene. However, the overall larger cell size of Cyclicargolithus may have implications for the alkenone-based reconstruction of past partial pressure of CO2. Our results underscore the importance of a careful evaluation of the most likely alkenone producers for periods (>1.85 Ma) predating the first occurrence of contemporary alkenone producers (i.e., Emiliania huxleyi and Gephyrocapsa oceanica).

Plancq, Julien; Grossi, Vincent; Henderiks, Jorijntje; Simon, Laurent; Mattioli, Emanuela




Directory of Open Access Journals (Sweden)

Full Text Available Varias especies de ácaros de la familia Tenuipalpidae, especialmente las del géneroBrevipalpus Donnadieu, son reconocidas como vectores de enfermedades viralesen diferentes cultivos comerciales. La falta de estudios taxonómicos en esta familiade ácaros en Colombia y la posibilidad de introducir en forma accidental especiesde estos ácaros planos, son una amenaza para la bioseguridad de la producciónfrutícola del país. El objetivo de este trabajo es contribuir a la identificación de lasespecies de Tenuipalpidae en la vegetación silvestre y cultivada en el departamentodel Valle del Cauca y confirmar la identidad taxonómica de las especies deBrevipalpus en cítricos, guayaba, maracuyá, café y orquídeas. Las recoleccionesde ejemplares se realizaron en épocas seca y lluviosa en varios municipios deldepartamento. El montaje de los ácaros se realizó en medio Hoyer. La especiepredominante en todas las localidades y en los hospedantes recolectados fueBrevipalpus phoenicis Geijskes (1939. Por el contrario, B. obovatus Donnadieuse encontró en poblaciones muy bajas en limón Tahití y mandarina en algunaslocalidades de Palmira. Tenuipalpus anacardii De León se presentó en Anacardiumexcelsum (Bertero y Balb. ex Kunth Skeels, en el municipio de Roldanillo y T.pacificus Baker se encontró en el corregimiento de Rozo, municipio de Palmira,sobre plantas importadas de un cultivo comercial de Dendrobium sp., mientrasque Dolichotetranychus floridanus (Banks solamente se encontró sobre Ananascomosus (L. Merr., en muestras recolectadas en Cali

Mesa Nora Cristina



Influence of habitat modification on the intestinal helminth community ecology of cottontail rabbit populations. (United States)

The influence of five brush management treatments using the herbicides tebuthiuron and triclopyr, with or without prescribed burning, on the intestinal helminth community of cottontail rabbits (Sylvilagus floridanus) was studied in 1987 on the Cross Timbers Experimental Range in Payne County, Oklahoma (USA). Six helminth species were found (Dermatoxys veligera, Trichostrongylus calcaratus, Passalurus nonanulatus, Wellcomia longejector, Taenia pisiformis cystercercus, and Mosgovoyia pectinata americana) in 102 rabbits (88 adult and 14 juveniles) collected over two seasons (winter and summer). Prevalence of M. pectinata americana in cottontail rabbits was significantly greater in untreated control pastures than herbicide treated pastures in winter, while prevalence of T. pisiformis was significantly greater in burned than unburned pastures. Abundances of helminth species in the intestinal tract of cottontail rabbits were unaffected by brush treatments. Mosgovoyia pectinata americana abundance demonstrated a highly significant increase from winter to summer; conversely, abundance of all oxyurid pinworms combined (D. veligera, P. nonanulatus, W. longejector) was significantly higher in winter than summer. Helminth community dynamics were significantly influenced by season, but were unaffected by brush treatments. Habitat modification could have influenced cestode transmission by altering the ecology of invertebrate and vertebrate hosts. PMID:2338720

Boggs, J F; McMurry, S T; Leslie, D M; Engle, D M; Lochmiller, R L



Effect of fungal and phosphoric acid pretreatment on ethanol production from oil palm empty fruit bunches (OPEFB). (United States)

Oil palm empty fruit bunches (OPEFB), a lignocellulosic residue of palm oil industries was examined for ethanol production. Milled OPEFB exposed to simultaneous saccharification and fermentation (SSF) with enzymes and Saccharomyces cerevisiae resulted just in 14.5% ethanol yield compared to the theoretical yield. Therefore, chemical pretreatment with phosphoric acid, a biological pretreatment with white-rot fungus Pleurotus floridanus, and their combination were carried out on OPEFB prior to the SSF. Pretreatment with phosphoric acid, combination of both methods and just fungal pretreatment improved the digestibility of OPEFB by 24.0, 16.5 and 4.5 times, respectively. During the SSF, phosphoric acid pretreatment, combination of fungal and phosphoric acid pretreatment and just fungal pretreatment resulted in the highest 89.4%, 62.8% and 27.9% of the theoretical ethanol yield, respectively. However, the recovery of the OPEFB after the fungal pretreatment was 98.7%, which was higher than after phosphoric acid pretreatment (36.5%) and combined pretreatment (45.2%). PMID:24630370

Ishola, Mofoluwake M; Isroi; Taherzadeh, Mohammad J



Host utilization and seasonal occurrence of Dermacentor species (Acari:Ixodidae) in Missouri, USA. (United States)

A total of 3,235 Dermacentor variabilis (Say) specimens were collected from birds, mammals, and by dragging vegetation, and 2,683 D. albipictus (Packard) ticks were collected from deer from 1993 to 1996. Peak seasonal occurrence of adult D. variabilis was from May through July with a precipitous decrease in August. Nymphal D. variabilis populations peaked in June. Peak activity of larvae was bimodal, with one activity peak during late summer (September) and a second peak in winter or early spring. The raccoon, Procyon lotor (L.), was the principal host of adults followed by the Virginia opossum, Didelphis virginiana Kerr. Rodents and the eastern cottontail rabbit, Sylvilagus floridanus (J. A. Allen), were the primary hosts of nymphs. The marsh rice rat, Oryzomys palustris (Harlan), was the principal host of larvae followed by the pine vole, Microtus pinetorum (Le Conte), and white-footed mouse, Peromyscus leucopus (Rafinesque). All stages of D. albipictus were found only on white-tailed deer, Odocoileus virginianus (Zimmermann). Numbers of adult and nymphal D. albipictus peaked in November, whereas larvae peaked in September. PMID:11201355

Kollars, T M; Oliver, J H; Masters, E J; Kollars, P G; Durden, L A



Diet of four annual killifishes: an intra and interspecific comparison  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias [...] da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae), Ephemeroptera (especialmente Betidae), e larvas de Coleoptera (especialmente Dytiscidae). Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação. Abstract in english We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lago [...] on basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae), Ephemeroptera (especially Betidae), and coleopteran larvae (especially Dytiscidae). Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.

Laufer, Gabriel; Arim, Matías; Loureiro, Marcelo; Piñeiro-Guerra, Juan Manuel; Clavijo-Baquet, Sabrina; Fagúndez, César.


Resposta funcional de Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) a diferentes densidades do pulgão verde Schizaphis graminum (Rond. ) (Homoptera: Aphididae) / Functional response of Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) at differents densities of greenbug Schizaphis graminum (Rond.) (Homoptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a resposta funcional, o tempo de busca e de manuseio da presa pelo predador Scymnus (Pullus) argentinicus(Weise). Como alimento foram oferecidas ninfas de 3º e 4º ínstares do pulgão verde Schizaphis graminum (Rond.). O delineamento experimental foi o inteiramente casualizado, em esquema f [...] atorial 3 x 5, em três densidades (10, 25 e 35) de ninfas do pulgão e quatro ínstares larvais e adulto do predador, em 10 repetições. Os insetos foram mantidos a 25 ± 1ºC, 70 ± 10% UR e fotofase de 14 horas. Tanto para larvas como para adultos de S. (Pullus) argentinicus, a quantidade de ninfas predadas aumentou com o incremento da densidade da presa, até atingir um platô (resposta funcional Tipo II ). A capacidade predatória no 4º ínstar foi maior em relação a todos os outros ínstares e diferiu significativamente na densidade de 35 ninfas, quando comparada com as densidades de 10 e 25, o mesmo ocorrendo para machos e fêmeas. O incremento da predação foi maior ao passar da densidade 10 para 25, tornando-se menor ao passar de 25 para 35. O tempo de busca aumentou gradualmente com a idade do predador, enquanto que o tempo de manuseio decresceu com a idade. Em um mesmo período, as fêmeas predaram mais que os machos e também buscaram a presa mais rapidamente. Abstract in english The functional response, search time and handling time of the predator Scymnus (Pullus) argentinicus (Weise) were evaluated. Nymphs of 3rdand 4th instars of the greenbug, Schizaphis graminum (Rond.), were provided as food. The statistical design was randomly in a factorial 3 x 5, with three densitie [...] s of the greenbug (10, 25, 35 nymphs) and four instars and adult of the predator, in 10 replications. Tests were conducted in an environmental chamber at 25± 1ºC, 70± 10% RH and 14 hours photophase. For both larvae and adults of S. (Pullus) argentinicus the amount of predated nymphs increased with the increment of aphid densities, until reaching a plateau (functional response Type II). Predation in the 4th instar was higher and greater for the density of 35 nymphs compared to the densities of 10 and 25 nymphs. The increment in predation increased, from density 10 to 25, but decreased at density 25 to 35 nymphs. The search time incresead gradually with the age of the predator, while the handling time decreased with the age. Adult females presented higher predation and searched faster for prey than males. Searching time decreased with the increase in aphid density.

Gilvânia F., Vieira; Vanda H. P., Bueno; Alexander M., Auad.



Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Portuguese Abstract in portuguese O gênero Eucalyptus (mirtacea exótica proveniente da Austrália) é o mais utilizado para reflorestamento no Brasil. Porém, somente a partir de 1966 é que este setor tomou impulso no país. Assim, além de exótica, a eucaliptocultura é recente. Periodicamente são observados surtos de lepidópteros desfol [...] hadores (Thyrinteina arnobia, por exemplo). No Brasil, os predadores Podisus nigrispinus e Supputius cincticeps vem sendo utilizados contra lepidópteros desfolhadores, porém não se têm dados sobre o estabelecimento desses predadores em campo. Sendo assim, o objetivo deste trabalho foi verificar os aspectos biológicos de adultos de P. nigrispinus e S. cincticeps sobre lagartas de T. arnobia provenientes de plantas de Eucalyptus urophylla. Comparando-se os aspectos biológicos das duas espécies de predadores, observa-se que o desempenho de P. nigrispinus sobre as lagartas de T. arnobia foi melhor do que o desempenho de S. cincticeps. Este resultado demonstra que P. nigrispinus está conseguindo quebrar possíveis sistemas de defesa dessa espécie de herbívoro, tais como os compostos secundários que o herbívoro provavelmente estaria seqüestrando das plantas de eucalipto e, se os inimigos naturais (S. cincticeps, por exemplo) não estiverem adaptados a esses compostos, a sua performance no controle da praga e no seu próprio desenvolvimento podem ser afetados negativamente. Abstract in english The Eucalyptus genus (an exotic mirtacea proceeding from Australia) is used for reforestation in Brazil. However, only after 1966 did this sector take impulse in the country. Thus, beyond exotic, the cultivation of this genus is recent. Defoliation caused by epidemics of lepidopterous species, such [...] as Thyrinteina arnobia, for example, had been observed periodically. In Brazil Podisus nigrispinus and Supputius cincticeps are being used as predators against defoliator lepidopterous species, however in current literature information is not available about the establishment of these predators in the field. The objective of this work was to analyze the biological aspects of P. nigrispinus and S. cincticeps adults on T. arnobia caterpillars collected on Eucalyptus urophylla plants. Comparing the biological aspects of the two predators species, the performance of P. nigrispinus on the caterpillars of T. arnobia was observed as better than the performance of S. cincticeps. Based on these results it is possible to demonstrate that P. nigrispinus is breaking possible systems of defense of this specie of herbivore, such as the secondary metabolites that the herbivore probably would be kidnapping from eucalyptus plants. If the natural enemies (S. cincticeps, for example) will not be adapt to these composites, its performance in the control of the pest and on its development can be negatively affected.

Mathias Holtz, Anderson; Cola Zanuncio, José; Scardini Marinho, Jeanne; Pratissoli, Dirceu; Pallini, Ângelo; de Jesus Pereira, Célia.


Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato / Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP) na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/sema [...] na), MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos) e testemunha (sem aplicação de inseticidas e fungicidas). O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) e Liriomyza spp. (Diptera: Agromyzidae) às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), seguido de T. absoluta e Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae), larvas de Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae), adultos de Staphylinidae (Coleoptera), Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera) e Phlaeothripidae (Thysanoptera). Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] e Bethylidae (Goniozus nigrifemur Ashmead), além de Diptera: Tachinidae. Abstract in english The objective of this work was to evaluate the impact of integrated pest management (IPM) in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides), [...] IPM (spraying when action thresholds were achieved), and control (no pesticide was applied). IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and Liriomyza spp. (Diptera: Agromyzidae) to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), followed by T. absoluta and Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae), Cycloneda sanguinea larva (L.) (Coleoptera: Coccinellidae), Staphylinidae adults (Coleoptera), Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera), and Phlaeothripidae (Thysanoptera). The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] and Bethylidae (Goniozus nigrifemur Ashmead), besides Tachinidae (Diptera).

Moacyr Mascarenhas Motta, Miranda; Marcelo Coutinho, Picanço; José Cola, Zanuncio; Leandro, Bacci; Ézio Marques da, Silva.


Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo / Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fo [...] tofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as quais estavam posicionadas sobre disco foliar (4 cm) de cada cultivar ('White Reagan' e'Yellow Snowdon') em camada de ágar-água . Na avaliação da oviposição foram utilizados pecíolos de cada cultivar como substrato de oviposição e ovos de Anagasta kuehniella (Zeller, 1879) como alimento. O predador completou seu desenvolvimento alimentando-se somente de A. gossypii presente em ambas as cultivares. A duração da fase ninfal de O. insidiosus foi de 21,1 e 18,3 dias, em 'White Reagan' e 'Yellow Snowdon', respectivamente. O consumo de A. gossypii por fêmeas foi maior (P Abstract in english This work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832) feeding on Aphis gossypii Glover, 1877 as weel as its oviposition behavior on two crysanthemum cut cultivars. The trials were conducted in climatic chamber at 25±1ºC, RH 70±10% and 12h photophase. Ny [...] mphs of the predator, less than 24h old, were kept individualy in petri dishes (5cm) with 20 nymphs of A. gossypii (1st, 2nd and 3rt instars) on leaf disc (4cm) of each cultivar ("White Reagan" and "Yellow Snowdon") in a layer of agar-water (1%). Petiole of each crysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879). The predador complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on "White Reagan" and "Yellow Snowdon", respectively. The consumption of the females of O. insidiosus was higher (P

Maria da Conceição M., Soglia; Vanda Helena Paes, Bueno; Lívia Mendes, Carvalho.


Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas / Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência tot [...] al de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas. Abstract in english This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods unde [...] r partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

Evangelista Júnior, Walter Santos; Gondim Junior, Manoel Guedes Correa; Torres, Jorge Braz; Marques, Edmilson Jacinto.


Fenologia da copaíba (Copaifera langsdorffii Desf. ¾ Leguminosae, Caesalpinioideae em uma floresta semidecídua no sudeste do Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available A fenologia da emissão foliar, floração e frutificação para espécies de florestas tropicais é pouco conhecida, embora estes ecossistemas apresentem grande diversidade de padrões fenológicos. Foi estudada, de fevereiro de 1991 a abril de 1993, a fenologia da copaíba (Copaifera langsdorffii Desf. na Reserva de Santa Genebra. Foram feitas observações em 36 indivíduos e analisadas queda de folhas, brotamento, floração e frutificação. A queda de folhas e o brotamento foram as fenofases mais sincronizadas dentro da população. Estes eventos ocorreram no final da estação seca (queda de folhas e início da estação chuvosa (brotamento e foram relacionados principalmente com a precipitação. A floração ocorreu na estação chuvosa e a frutificação na estação seca. A frutificação ocorreu em ciclos supra-anuais, com anos de produção intensa seguidos de anos sem frutificação. Além dos fatores climáticos, as interações com dispersores e predadores de sementes também parecem influenciar o padrão de frutificação observado em Copaifera langsdorffii.




Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick (Lepidoptera: Gelechiidae on organic tomato system and on conventional tomato system  

Directory of Open Access Journals (Sweden)

Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick (Lep.: Gelechiidae está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1 coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2 exposição de ovos sentinelas no campo por 72 horas; 3 ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3, evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate.The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick (Lep.: Gelechiidae affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining. The objective of the present work was to quantify the role of each factor in the survivorship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1 tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2 tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3 cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32% than those kept in the field (methodology 2 and 3. However, under field conditions (method 2 and 3 by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

Maria Alice de Medeiros



Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação / Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan') em [...] casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method") e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande), e o restante incluíram F. gemina (Bagnall), Frankliniella sp., Caliothrips phaseoli (Hood) e Haplothrips gowdeyi (Franklin). Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%), sendo também coletados Myzus persicae (Sulzer) e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say) foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson) e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.). Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas. Abstract in english Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan') in commercial [...] greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande) (>90%), F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood) and Haplothrips gowdeyi (Franklin) were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover) (>80%), Myzus persicae (Sulzer) and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say) was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson), and the predators Chrysoperla sp., Cycloneda sanguinea (L.) and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

Lívia Mendes, Carvalho; Vanda Helena Paes, Bueno; Simone Martins, Mendes.


Entomofauna em capítulos de picão-preto Entomofauna in floyer heads of common blackjack  

Directory of Open Access Journals (Sweden)

Full Text Available A ocorrência de insetos fitófagos e de himenópteros parasitóides a eles associados, presentes em capítulos de Bidens pilosa são descritas para as condições do município de Botucatu, SP. Foram encontrados predadores de sementes da ordem Diptera, pertencentes aos gêneros Dioxyna, Melanagromysa e outro não identificado. As moscas Dioxyna depositam seus ovos no interior dos aquênios em estágios iniciais de desenvolvimento, permanecendo no interior do fruto até a emergência do adulto. Melanagromysa localiza-se entre as flores centrais desenvolvendose externamente aos aquênios. Foram observadas oscilações cíclicas e acopladas entre as curvas de abundância dos fitófagos e dos himenópteros parasitóides.Phytophagous diptera and parasitoid hymenoptera occurence on flower heads of Bidens pilosa are related at Botucatu, SP, southeastern Brazil. Seed predators were three diptera genera, Dioxyna, Melanagromyza and an unidentified one. The larvae and pupa of Dioxyna and Melanagromyza develop inside and between the central achenes, respectively. Coupled ciclic oscillations were observed in phytophagous and parasitoid abundance.

Rita C.S. Maimoni-Rodella



Dinámica de polifenoles y estudio anatomo-histoquímico en Schinus longifolius (Lindl. Speg. (Anacardiaceae en respuesta a la infección por Calophya mammifex (Hemiptera - Calophyidae  

Directory of Open Access Journals (Sweden)

Full Text Available Se analizaron los fenoles totales, taninos totales, proantocianidinas, flavonoides totales y ácidos hidroxicinámicos totales de hojas sanas y agallas de Schinus longifolius (Lindl. Speg. (Anacardiaceae infectado por Calophya mammifex (Hemiptera - Calophyidae. La agalla presenta una variación cuali-cuantitativa de los polifenoles estudiados, con una disminución de los fenoles, taninos, flavonoides y ácidos hidroxicinámicos y un aumento en el contenido de proantocianidinas, cuyo monómero se transforma en cianidina luego del clivaje ácido. Se realizó además un análisis anatómico de la agalla donde se encontraron acúmulos de esclereidas y un mayor desarrollo vascular respecto de la hoja sana y un ensayo histoquímico que mostró una expresión diferencial de metabolitos polifenólicos en sus tejidos. C. mammifex utiliza la agalla como refugio contra las condiciones climáticas adversas y predadores y provee además de alimento con menos compuestos potencialmente perjudiciales en las etapas tempranas de su desarrollo.

Alberto u00C1ngel GURNI



Efeitos do sistema de plantio e da consorciação soja-milho sobre artrópodes capturados no solo  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste estudo foi avaliar os efeitos do plantio direto e da consorciação soja [Glycine max (L. Merrill] e milho (Zea mays L. sobre artrópodes que vivem no solo. Os tratamentos constituíram um fatorial 3 x 2 (monocultura de soja, monocultura de milho, consorciação soja-milho x plantio direto, plantio convencional em blocos casualizados com quatro repetições; as amostragens foram efetuadas com armadilhas de solo, durante 1996 a 1998. Resultados estatisticamente significativos em pelo menos uma safra indicaram que o plantio direto foi favorável a predadores, como formigas (Brachymyrmex sp., Camponotus spp. e Ectatomma sp., carabídeos (Metius sp. e aranhas (Lycosidae. A consorciação soja-milho aumentou o número de Acrididae, enquanto a presença do milho favoreceu a ocorrência de Dermaptera em sistemas de consorciação soja-milho.

Cividanes Francisco Jorge



Palm harvesting affects seed predation of Euterpe edulis, a threatened palm of the Brazilian Atlantic Forest / Extração de palmito afeta a predação de sementes de Euterpe edulis, uma palmeira ameaçada da Mata Atlântica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O palmito-jussara, Euterpe edulis, é uma árvore endêmica da Mata Atlântica e constitui-se em produto extrativista economicamente importante. A exploração ilegal e descuidada do palmito tem levado a drásticas reduções em suas populações ao longo de toda sua distribuição, que outrora fora abundante. N [...] este estudo investigamos o efeito da extração do palmito sobre a predação de suas sementes e plântulas por roedores e insetos. Especificamente, testamos a hipótese segundo a qual, em razão da saciação dos predadores, deve haver relação inversa entre a magnitude da predação sobre as sementes e a abundância da planta em determinada área. Durante dois anos consecutivos, sementes de E. edulis foram colocadas em uma área preservada (> 250 indivíduos adultos de E. edulis/ha) e em uma área vizinha explorada com baixíssima densidade de plantas adultas, ambas localizadas na Mata Atlântica do Estado de São Paulo. A mortalidade das plântulas foi estudada e comparada entre ambas as áreas por um período de seis meses. A predação das sementes por roedores foi maior na área explorada que na área preservada e variou entre os anos. A predação por insetos foi maior na área preservada e não variou entre os anos. A mortalidade das plântulas foi similar em ambas as áreas. A relação inversa entre a abundância da planta e a predação de suas sementes foi confirmada para predadores generalistas (roedores), mas não para predadores especializados (insetos). Os resultados mostram que a mortalidade de sementes dependente de densidade, não apenas em nível individual, como já demonstrado, mas também em escala populacional, depende do tipo de predador considerado. Abstract in english The palm tree Euterpe edulis is endemic to the Atlantic Forest, where it constitutes an economically important forest product. The often unplanned and illegal harvesting of palm hearts has led to drastic reductions in the populations of E. edulis in many areas where this palm used to be the dominant [...] understorey tree species. We investigated the effects of harvesting on seed and seedling predation of E. edulis. We tested the predictions of the dominance-predation hypothesis according to which predator satiation leads to an inverse relationship between the amount of predation and the dominance of a tree species. During two consecutive years, seeds were set experimentally on an unharvested (> 250 adult palms/ha) and a neighboring harvested site (few, if any, adult palms) located in the Atlantic Forest of SE Brazil. Seedling mortality was studied at both sites for a six-month period in each of two consecutive years. Seed predation caused by rodents was higher at the harvested site, while insects caused more damage to seeds placed at the unharvested site. The proportion of seeds preyed upon by rodents varied annually, while insect predation did not. Seedling mortality did not differ between harvested and unharvested sites. The dominance-predation hypothesis was confirmed for generalist rodent seed predators, but not for specialist insect predators. This result shows that density-dependent mortality, not only at the individual level but also at the population-level scale, is a function of the class of predators and their types of foraging behavior.

M. A., Pizo; E. M., Vieira.


Localização de presas à curta distância por Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): o papel dos aleloquímicos dos ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Acari: Tetranychidae) e da planta hospedeira, Malus domestica (Borkham) / Short-distance prey location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): the role of the allelochemicals from two phytophagous mites, Panonychus ulmi(Koch) and Tetranychus urticae Koch (Acari: Tetranychidae), and their host plant, Malus domestica (Borkham)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Para conhecer os estímulos olfativos à curta distância que Neoseiulus californicus (McGregor) usa para encontrar seu alimento, isto é, os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch, estudaram-se as respostas deste ácaro predador em relação aos aleloquímicos voláteis oriundos [...] tanto das duas espécies de presa como de sua planta hospedeira, Malus domestica (Borkham). Na extremidade de um braço da trilha em Y foi introduzido um disco de folha sadia de macieira (= controle) e na outra um dos oito tipos de estímulo (= tratamento) seguintes: 1) folha sadia, 2) folha sadia com a presa, 3) folha sadia com cairomônios da presa, 4) folha sadia com a presa e seus cairomônios, 5) folha atacada limpa, 6) folha atacada com a presa, 7) folha atacada com cairomônios da presa e 8) folha atacada com a presa e seus cairomônios. Para cada tratamento, observou-se a direção do deslocamento do ácaro predador e analisou-se sua porcentagem de resposta. Para localizar P. ulmi, N. californicus orientou-se pelos estímulos oriundos de folhas sadias com a presa e seus cairomônios (T4), folhas atacadas com cairomônios da presa (T7) e folhas atacadas com a presa e seus cairomônios (T8). Com relação a T. urticae, o ácaro predador respondeu significativamente aos estímulos oriundos de folhas sadias com cairomônios da presa (T3) e de folhas sadias com a presa e seus cairomônios (T4), assim como de todas as combinações com folhas atacadas (T5-8). Estes resultados demonstram que os voláteis emanados pelos ácaros fitófagos, por seus subprodutos e pela planta por eles atacada, em conjunto ou isoladamente, são importantes fontes de informação para N. californicus localizar T. urticae à curta distância. Por outro lado, somente a combinação de dois ou mais estímulos olfativos parece sinalizar a localização de P. ulmi para o ácaro predador, principalmente se os cairomônios de suas fezes, ovos e exúvias estiveram incluídos em tal mistura. Abstract in english To understand how Neoseiulus californicus (McGregor) locates its prey, i.e. Panonychus ulmi (Koch) and Tetranychus urticae Koch, we studied the predator's short-distance responses to the volatile allelochemicals associated with these two phytophagous mites and their host plant, Malus domestica (Bork [...] ham). At the end of one branch of a Y-shape runway we placed an uninfested apple leaf disk (= control) and, at the other end, one of the eight following types of stimulus (= treatments): 1) uninfested leaf, 2) uninfested leaf + prey, 3) uninfested leaf + prey kairomones, 4) uninfested leaf + prey + prey kairomones, 5) infested leaf, 6) infested leaf + prey, 7) infested leaf + prey kairomones, and 8) infested leaf + prey + prey kairomones. We observed the predator's searching behavior on the runway and analyzed its percentage of response to each of the above stimuli. When P. ulmi was tested, significantly more predators went to the end of the branch with uninfested leaves and prey with its kairomones (T4), infested leaves and prey kairomones (T7), and infested leaves and prey with its kairomones (T8). In relation to T. urticae, the predaceous mite showed significant responses to uninfested leaves with prey kairomones (T3) and to uninfested leaves and prey with its kairomones (T4), as well as to all infested leaf combinations (T5-8). These results indicate that the volatiles associated with the phytophagous mites, their byproducts, and the host plant, either separately or combined, play an important role on the short-distance location of T. urticae by N. californicus. On the other hand, only a combination of two or more of those stimuli appear to signal the location of nearby colonies of P. ulmi to the predaceous mite, specially when the kairomones from their feces, eggs, and exuviae are included in such blend.

Karin F.S., Collier; Álvaro E., Eiras; Gilberto S., Albuquerque; Jacquelyn L., Blackmer; Marilaine C., Araújo; Lino B., Monteiro.



Directory of Open Access Journals (Sweden)

Full Text Available Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador carnívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación.The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore in freshwater communities of the South-American altiplano.

Jonathan A Guzmán




Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador car [...] nívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación. Abstract in english The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore [...] in freshwater communities of the South-American altiplano.

Jonathan A, Guzmán; Walter, Sielfeld.


Eficiência de Chrysoperla externa (Hagen, 1861(Neuroptera: Chrysopidae no controle de Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae em pimentão (Capsicum annum L. Efficiency of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae in the Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae population reduction in sweet pepper (Capsicum annum L.  

Directory of Open Access Journals (Sweden)

Full Text Available Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, contendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente.The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs containing 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

Leonardo Rodrigues Barbosa



Use of the flooded forest by fish assemblages in lakes of the National Park of Anavilhanas (Amazonas, Brazil Uso do igapó por assembléias de peixes nos lagos no Parque Nacional das Anavilhanas (Amazonas, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available We evaluated diversity and distribution of fish species in two habitats: flooded forest and open water of lakes of Rio Negro. Each of four lakes within the Anavilhanas Archipelago was sampled three times from 2009-2010. Species diversity generally was higher in flooded forests and at night, according to correspondence analysis. Predators were most active at night, but showed no preference between the flooded forest and open water habitats. Omnivores, filter feeders, and detritivores were most active during the day.Avaliamos a diversidade e a distribuição de espécies de peixes em dois habitats: floresta alagada e água aberta de lagos do rio Negro. Três amostragens foram realizadas em quatro lagos do Arquipélago de Anavilhanas, em 2009 e 2010. Em geral, a diversidade de espécies foi maior na floresta alagada e durante a noite. A análise de correspondência indicou que predadores estavam mais ativos a noite nos dois habitats. Onívoros, filtradores e detritívoros foram mais capturados durante o dia.

Janette Noveras



Inseticidas seletivos à tesourinha Doru luteipes (Scudder utilizados no controle do pulgão verde em brássicas Selective insecticides to the earwing Doru luteipes (Scudder used for controlling the green peach aphid in Brassicae  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer (Homoptera: Aphididae, em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes, dimetoato (para adultos e ninfas de primeiro e segundo estádios, paratiom metílico (para ninfas de primeiro e terceiro estádio e acefato (para adultos, apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae.The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer (Homoptera: Aphididae and on first, second, and third instar nymphs and adults of the Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes, for dimethoate (to adults and first and second instar nymphs of the predator, for methyl parathion (to first and third instar nymphs of the predator, and for acephate (to adults of the predator showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro Bacci



Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas / Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Der [...] maptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes), dimetoato (para adultos e ninfas de primeiro e segundo estádios), paratiom metílico (para ninfas de primeiro e terceiro estádio) e acefato (para adultos), apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae. Abstract in english The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer) (Homoptera: Aphididae) and on first, second, and third instar nymphs and adults of the Doru [...] luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes), for dimethoate (to adults and first and second instar nymphs of the predator), for methyl parathion (to first and third instar nymphs of the predator), and for acephate (to adults of the predator) showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro, Bacci; Marcelo C., Picanço; Marcos Rafael, Gusmão; Robert W., Barreto; Tederson Luiz, Galvan.


Toxicidade de formulações de nim (Azadirachta indica A. Juss.) ao ácaro-rajado e a Euseius alatus De Leon e Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae) / Toxicity of neem (Azadirachta indica A. Juss) formulations for twospotted spider mite and Euseius alatus De Leon and Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade de formulações comerciais de nim a Tetranychus urticae Koch (Acari: Tetranychidae) e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks) foi estudada. A toxicidade tópica foi avaliada com três formulações comerciais (Natuneem, Neemseto e Callneem) e com o [...] extrato de sementes de nim, todos na concentração de 1%, em comparação ao acaricida padrão, abamectina na concentração de 0,3ml/L e ao tratamento controle com água destilada. Com base no melhor efeito tópico sobre T. urticae, a formulação Neemseto foi selecionada para avaliar diferentes concentrações sobre ovos, e o efeito residual e repelente sobre adultos desses ácaros. O tratamento dos ovos consistiu na imersão em diluições de Neemseto por cinco segundos; e o efeito residual e repelente sobre adultos foi avaliado pela imersão de discos de folha nas diluições também por cinco segundos. A toxicidade de Neemseto a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. Neemseto foi repelente para T. urticae e E. alatus, quando testados nas concentrações 0,25; 0,50 e 1,00%, mas não afetou P. macropilis. A fecundidade de T. urticae foi reduzida significativamente por Neemseto em todas as concentrações, enquanto para os ácaros predadores, redução significante na fecundidade foi observada apenas nas maiores concentrações. Assim, nas formulações testadas, Neemseto foi o mais eficiente para o ácaro-rajado e provocou, relativamente, menor impacto aos ácaros predadores estudados. Abstract in english The toxicity of selected commercial formulations of neem on Tetranychus urticae Koch (Acari: Tetranychidae) and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) was studied. Topical toxicity was tested with the commercial formulations (Natuneem, Neemseto and Callneem) a [...] nd extract of neem's seeds at concentration 1%, compared to the standard acaricide abamectin at concentration of 0.3 ml/L and the control treatment (distilled water). Based on the best performance against T. urticae through topical contact, the formulation Neemseto was selected to be evaluated using different concentrations against eggs, and residual and repellent effects on adults of the mites. Egg treatment consisted of dipping eggs into Neemseto dilutions and control treatment for five seconds. In addition, residual and repellent effects of Neemseto for adult mites consisted of using leaf discs dipped into the dilutions for five seconds. The toxicity of Neemseto on eggs and adults was greater for T. urticae compared to the toxicity observed for the predatory mites. Neemseto was repellent for T. urticae and E. alatus when tested at the concentrations of 0.25, 0.50 and 1.0%, and did not affect P. macropilis. Neemseto using all concentrations, while for the predatory mites significant reduction of mite fecundity was only observed at the largest concentrations reduced the fecundity of T. urticae significantly. So Neemseto, among tested neem formulations, performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites studied.

Hilda M., Brito; Manoel G.C., Gondim Jr.; José V. de, Oliveira; Cláudio A.G. da, Câmara.


Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse  

Directory of Open Access Journals (Sweden)

Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan' em casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method" e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande, e o restante incluíram F. gemina (Bagnall, Frankliniella sp., Caliothrips phaseoli (Hood e Haplothrips gowdeyi (Franklin. Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%, sendo também coletados Myzus persicae (Sulzer e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.. Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas.Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan' in commercial greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande (>90%, F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood and Haplothrips gowdeyi (Franklin were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover (>80%, Myzus persicae (Sulzer and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson, and the predators Chrysoperla sp., Cycloneda sanguinea (L. and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

Lívia Mendes Carvalho



Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiológica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Doru luteipes (SCUDDER, 1876) é um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservação é necessária a utilização de inseticidas seletivos a S. frugiperda e inócuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposição aos resíduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas após o tratamento. Os inseticidas foram classificados segundo índices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi inócuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposição de D. luteipes aos resíduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivência de adultos após o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram inócuos. Devido à baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservação dessa espécie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetação e campo para comprovação de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

Redoan, Ana Carolina Maciel; Carvalho, Geraldo Andrade; Cruz, Ivan; Figueiredo, Maria de Lourdes Corrêa; Silva, Rafael Braga da.



Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish El control biológico a través de predadores es observado como una alternativa promisoria al control químico de plagas. Phytoseiulus macropilis se ha encontrado asociado a poblaciones del ácaro rayado Tetranychus urticae en plantaciones de fresa en el estado de Minas Gerais, Brasil. En este trabajo s [...] e evaluó a través de experimento de olfatometria los efectos subletales de la azadirachtina sobre la capacidad de P. macropilis en detectar volátiles de plantas de fresa infestadas con T. urticae. Los resultados muestran que el ácaro predador P. macropilis puede diferenciar entre olores de plantas de fresa no atacadas y plantas de fresa atacadas por T. urticae. La azadirachtina en la concentración de 0,31 mg i.a/L no interfirió en la respuesta olfativa de P. macropilis alimentado de presas asperjadas. Abstract in english The biological control through predators is seen as a promising alternative to chemical insect pest control. Phytoseiulus macropilis has been found associated with populations of the striped mite, Tetranychus urticae in strawberry plantations in the state of Minas Gerais, Brazil. In this work, the s [...] ublethal effects of azadirachtina on the natural ability of P. macropilis to detect volatile compounds from strawberry plants infested with T. urticae was evaluated by using olfactometry assays. The results show that P. macropilis predatory mite can distinguish odors from non-attacked strawberry plants and those from strawberry plants attacked by T. urticae. Azadirachtina at a concentration of 0.31 mg i.a/L did not interfere in the olfactory response of P. macropilis fed with sprinkled striped mites.

Alberto, Soto G; Angelo, Pallini; Lemos, Felipe.


Caracterização da microfauna em estação de tratamento de esgotos do tipo lodos ativados: um instrumento de avaliação e controle do processo / Microfauna characterization in activated sludge wastewater treatment plant: an instrument of assessment and control of process  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A microfauna presente em uma ETE por lodos ativados foi caracterizada, correlacionada com parâmetros físico-químicos e utilizada em modelos existentes de avaliação de sistemas. Durante 351 dias o lodo ativado manteve-se estável com flocos compactos, pequenos e com poucos filamentos. Os protozoários [...] predominantes no lodo foram as tecamebas e os ciliados predadores de flocos, indicando estabilidade do sistema. Os métodos propostos em literatura, baseados no IBL, na densidade total da microfauna e na relação entre ciliados predadores de flocos e ciliados fixos, mostraram-se eficientes para o diagnóstico das condições depurativas do sistema. A análise qualitativa do lodo, englobando o tamanho, quantidade de filamentos, compactação e a identificação das espécies dominantes, foi suficiente para uma caracterização imediata das condições depurativas do sistema de tratamento. Abstract in english Microfauna found in an activated sludge WTP was characterized, correlated to the physical-chemical parameters and used in existing assessment models. During 351 days, the activated sludge remained stable with compacted and small poorly filamentous flocs. It was composed mainly by testate amoebas and [...] crawling ciliates that indicated the stability of the system. The application of the existent system evaluation models to microfauna (SBI, crawling ciliate/attached ciliate relation and total density) was found to be efficient for the assessment of the system depurative conditions. The sludge qualitative analysis, which included the flocs size, amount of filaments, compacting and the identification of the dominant microfauna species, was enough to an immediate diagnosis of the treatment system depurative conditions.

Alessandra Pellizzaro, Bento; Pablo Heleno, Sezerino; Luiz Sergio, Philippi; Valeria, Reginatto; Flavio Rubens, Lapolli.


Feeding of Pellona flavipinnis (Clupeiformes, Pristigasteridaein a Central Amazonian floodplain Dieta de Pellona flavipinnis (Clupeiformes, Pristigasteridae em planície alagada da Amazônia Central  

Directory of Open Access Journals (Sweden)

Full Text Available The feeding habits of Pellona flavipinnis (Valenciennes, 1836 at Catalão, a floodplain area on the Brazilian Central Amazon was studied. Data was obtained during three hydrological cycles, between September 1999 and September 2003. Diet composition, daily and seasonal variation in the feeding activity and the relationship between predator's size and its prey were analyzed. Almost 80% of the food consumed has autochthonous origin and diet was composed basically by insects and fish. Juvenile fish predominated in the stomach contents of all size classes but there was no significant relationship between predator's size and its prey. Pellona flavipinnis may be considered a carnivorous species which feeds mainly on juvenile (young-of-the-year specimens of other fish. More intense feeding activity occurred at night and in the high water period.Os hábitos alimentares de Pellona flavipinnis (Valenciennes, 1836 de uma área de várzea na Amazônia Central, Catalão, foram estudados. Foram utilizados dados referentes a três ciclos hidrológicos, entre setembro de 1999 e setembro de 2003. Foram analisados a dieta, a atividade alimentar diária e sazonal e a relação entre o comprimento da presa e o do predador. Cerca de 80% dos alimentos consumidos eram de origem autóctone e a dieta composta basicamente de insetos e peixes. Peixes juvenis predominaram nos conteúdos estomacais de exemplares de todas as classes de tamanho, mas não houve relação significativa entre o tamanho do predador e o das presas consumidas. Pellona flavipinnis pode ser considerada uma espécie carnívora que se alimenta principalmente de indivíduos juvenis de outras espécies de peixes. A atividade alimentar foi maior durante a noite e no período da cheia.

Sandra S. Moreira-Hara



Sentinels in Saltator atricollis (Passeriformes: Emberizidae Sentinelas em Saltator atricollis (Passeriformes: Emberizidae  

Directory of Open Access Journals (Sweden)

Full Text Available I studied the existence of sentinels in Saltator atricollis in a 'campo-cerrado' (Brazilian savanna during the breeding seasons of 1994-95 and 1995-96. Groups of this species consisted of two to seven birds (N = 25. Sentinels were present (mean ± sd 62% ± 9% of the time, and most sentinel bouts lasted from less than one to six minutes (although in some occasions for more than 30 min.. Overlap of two or more sentinels occurred on average only 3.2% of the time with birds on guard. Sentinels commonly gave contact calls in the beginning and/or at the end of a sentinel bout. The group size had no effect on time with sentinels. However the encounter rate between raptors and groups significantly influenced the time guarded. The results of this study suggests that the ability of sentinels to detect predators may play a central role as an anti-predator device.Estudei a existência de sentinelas em S. atricollis em campo-cerrado, nas estações reprodutivas de 1994-95 e 1995-96. Os grupos de S. atricollis continham de dois a sete indivíduos (N = 25. Os sentinelas vigiaram os grupos (média ± dp por 62% ± 9% do tempo, sendo que a maioria dos turnos de vigilância durou de menos de um a seis minutos (em alguns casos se extenderam por mais de 30 min.. Dois ou mais sentinelas vigiaram simultaneamente, em média, apenas 3,2% do tempo vigiado. Os sentinelas comumente emitiam chamados de contato quando iniciavam e/ou terminavam um turno de vigilância. O tamanho dos grupos não apresentou relação com o tempo vigiado. Por outro lado, a taxa de encontros entre predadores aéreos e grupos influenciou significativamente o tempo vigiado. A habilidade dos sentinelas em perceber predadores provavelmente apresenta uma função relevante, conferindo vantagens antipredatórias aos grupos dessa espécie.




Incidência de ácaros em cafeeiro cv. Catuaí Amarelo / Mite fauna on coffee plants cv. Catuaí Amarelo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L.), no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais [...] se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) e Oligonychus yothersi (McGregor) (Tetranychidae). Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae) foi outra espécie muito abundante observada nos ramos. Abstract in english The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L.) plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and be [...] rries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) and Oligonychus yothersi (McGregor) (Tetranychidae). Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae) was also mostly present on branches.

Jeferson Luiz de Carvalho, Mineiro; Mário Eidi, Sato; Adalton, Raga; Miguel Francisco de, Souza Filho; Sheila, Spongoski.


Incidência de ácaros em cafeeiro cv. Catuaí Amarelo Mite fauna on coffee plants cv. Catuaí Amarelo  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L., no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes (Tenuipalpidae e Oligonychus yothersi (McGregor (Tetranychidae. Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae foi outra espécie muito abundante observada nos ramos.The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L. plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and berries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes (Tenuipalpidae and Oligonychus yothersi (McGregor (Tetranychidae. Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae was also mostly present on branches.

Jeferson Luiz de Carvalho Mineiro



Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae) on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae) parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae) / Desenvolvimento ninfal e preferência alimentar de Podisus maculiventris (Heteroptera: Pentatomidae) em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae) parasitados ou não por Trichogramma brassicae (Hymenoptera: Trichogrammatidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a predação de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa) ou não por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos às ninfas de P. maculiventris como alimento. Esse Pentatomidae só atingiu a fase [...] adulta quando se alimentou de ovos não parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criação desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estádio. Em teste de escolha, ninfas desse predador mostraram preferência por ovos não parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que é possível associar o uso de P. maculiventris com liberações de T. brassicae em programas de controle de lepidópteros pragas, Abstract in english Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae), parasitised or not by Trichogramma brassicae (pupae stage). Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventr [...] is as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that