WorldWideScience

Sample records for predadores agistemus floridanus

  1. Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food

    Noeli Juarez Ferla; Gilberto José de Moraes

    2003-01-01

    Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius conc...

  2. Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento

    Ferla Noeli Juarez; Moraes Gilberto José de

    2003-01-01

    Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius conc...

  3. Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento

    Ferla Noeli Juarez

    2003-01-01

    Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

  4. Seletividade de produtos fitossanitrios sobre o caro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mrio Eidi, Sato.

    2009-06-01

    Full Text Available Os caros predadores das famlias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este caro-praga causa srios prejuzos na produo, devido transmisso do vrus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] maes sobre a sensibilidade de caros Phytoseiidae a agrotxicos, praticamente no existem informaes sobre o efeito desses compostos em caros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotxicos utilizados em citros sobre o caro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condies de laboratrio. Arenas de folhas de citros da variedade Pera, contendo 25 fmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos caros 72 horas aps a aplicao. O efeito dos produtos na reproduo do acarino e a viabilidade dos ovos tambm foram avaliados. Quanto seletividade, conforme proposta da "Organizao Internacional para o Controle Biolgico" (IOBC), os produtos foram classificados como: classe 1 - incuo (E99%), calda sulfoclcica, cyhexatin, flufenoxuron, hexythiazox, xido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condies de campo ainda so necessrios para se compreender melhor o efeito desses agrotxicos sobre o caro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  5. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae

    Marcos Zatti da Silva

    2009-06-01

    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  6. Immune responses of the ant Camponotus floridanus towards pathogens and its obligate mutualistic endosymbiont Blochmannia floridanus

    Ratzka, Carolin

    2013-01-01

    Ants of the species Camponotus floridanus live in huge colonies composed of genetically identical or closely related animals, which should predispose them to an increased vulnerability towards infection by pathogens (Cremer et al. 2007). Therefore the question is how ants (or social insects in general) can nevertheless efficiently combat infections. In order to investigate the immune response of the ant C. floridanus, the present study initially focused on the identification of possible immun...

  7. Social isolation and brain development in the ant Camponotus floridanus.

    Seid, Marc A; Junge, Erich

    2016-06-01

    Social interactions play a key role in the healthy development of social animals and are most pronounced in species with complex social networks. When developing offspring do not receive proper social interaction, they show developmental impairments. This effect is well documented in mammalian species but controversial in social insects. It has been hypothesized that the enlargement of the mushroom bodies, responsible for learning and memory, observed in social insects is needed for maintaining the large social networks and/or task allocation. This study examines the impact of social isolation on the development of mushroom bodies of the ant Camponotus floridanus. Ants raised in isolation were shown to exhibit impairment in the growth of the mushroom bodies as well as behavioral differences when compared to ants raised in social groups. These results indicate that social interaction is necessary for the proper development of C. floridanus mushroom bodies. PMID:27126402

  8. Seletividade de oito inseticidas a predadores de lagartas em citros

    Galvan Tederson Luiz

    2002-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure e Protopolybia exigua (Saussure (Hymenoptera: Vespidae em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom.

  9. Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou na ausência de ácaros fitófagos Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without the presence of phytophagous mites

    Alfredo de Gouvea

    2007-02-01

    Full Text Available O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 2002. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor, e três espécies de predadores, Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus.This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tree commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor, and three species of predator mites Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

  10. Effects of Hydrogen Peroxide and Metrifonate on Monogenean ligictaluridus floridanus on Catfish ( Ictalurus punctatus , Rafinesque) Gills.

    Benavides-González, Flaviano; Gomez-Flores, Ricardo Alberto; Rábago-Castro, Jaime Luis; Sánchez-Martínez, Jesús Genaro; Montelongo-Alfaro, Isidro Otoniel

    2015-12-01

    Hydrogen peroxide (H2O2) and metrifonate (Mtf) are common products used in ectoparasite infestations on fish cultures. The therapeutic efficacy of H2O2 and Mtf on a common monogenean parasite, Ligictaluridus floridanus, was evaluated in channel catfish ( Ictalurus punctatus ). In vitro trials were conducted using excised fish gills naturally infected with L. floridanus, which were immersed in H2O2 (150, 300, and 570 mg L(-1)) and Mtf (0.25, 0.5, and 0.75 mg L(-1)) solutions. The efficacy of the treatments was based on the survival time of the parasites, observed microscopically. In addition, an in vivo trial using catfish juveniles, naturally infected with L. floridanus, was also performed. One group received immersion baths of 570 mg L(-1) H2O2 (3%) during 4 min; the Mtf (90%) group received 0.5 mg L(-1) Mtf for 10 min. Treatments were done on days 3, 7, and 11 of the experiment. Results indicate that baths with Mtf do not significantly reduce the mean intensity of the parasite per gill arch, nor do they reduce the in vitro survival time of parasites during treatment; H2O2 baths at 570 mg L(-1) during 4 min were effective (P < 0.05) against adult and juvenile stages of L. floridanus. This study supports the use of H2O2 as an effective antiparasitic agent against I. punctatus . PMID:26286108

  11. Reproductive biology and adaptability of the invasive alien freshwater Amphipod Crangonyx floridanus (Crustacea: Amphipoda, Crangonyctidae).

    Tojo, Koji; Tanaka, Yoshiki; Kuranishi, Ryoichi B; Kanada, Shoji

    2010-06-01

    We studied the reproductive biology and adaptability of the alien freshwater crangonyctid amphipod Crangonyx floridanus, currently inhabiting a large portion of Japan, both in the field and under controlled laboratory conditions. In the Chikuma River population of this alien amphipod, egg-bearing individuals were found throughout the year. In terms of egg maturation cycle, egg development (during embryogenesis), and egg count per ovipositional cycle, these amphipods display a very efficient reproductive system. This study also established their adaptability to a wide range of water temperatures (primarily 4-20 degrees C, however in some cases, these individuals are able to survive at up to 30 degrees C). C. floridanus's strong capacity to adapt to broad and variable environmental conditions is certainly contributing to its high rate of population increase, and rapid dispersion throughout Japan. PMID:20528160

  12. Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil

    Matioli, Andre L. [Instituto Biologico, Campinas, SP (Brazil). Lab. de Entomologia Economica], e-mail: almatioli@biologico.sp.gov.br; Pallini, Angelo [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal], e-mail: pallini@ufv.br; Tavares, Mara G. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral], e-mail: mtavares@ufv.br

    2009-03-15

    Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute ({+-} 360 {mu}m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

  13. Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil

    Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute ( 360 ?m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

  14. Regulation of reproductive division of labor in the ant Camponotus floridanus : behavioral mechanisms and pheromonal effects

    Endler, Annett

    2006-01-01

    A hitherto unresolved problem is how workers are prevented from reproducing in large insect societies. The queen informs about her fertility and health which ensures sufficient indirect fitness benefits for workers. In the ant Camponotus floridanus, I found such a signal located on eggs of highly fertile queens. Groups of workers were regularly provided with different sets of brood. Only in groups with queen eggs workers refrain from reproducing. Thus, the eggs seem to inform the workers abou...

  15. SEM Observations on the Predation Behavior of Agistemus terminalis (Quayle) (Acari: Stigmaeidae) and Amblyseius sojaensis Ehara (Acari: Phytoseiidae) on Panonychus citri (Mcgregor) (Acari: Tetranychidae)

    Abdul Razaq; Nobuo Ohbayashi; Pear Mohammad; Masaya Shiraishi

    2000-01-01

    The predation behavior of Agistemus terminalis and Amblyseius sojaensis on Panonychus citri was studied under scanning electron microscope. Agistemus terminalis grasped egg stalk by claws and sensory organ of palpi and direct attack on eggs was done by needle-shaped stylets extruded from the rostrum. A distinct hole was found on the egg surface produced by the penetration and successive withdrawn of the rostrum and stylets. Finally, the hole became wide by the further attack of rostrum and pa...

  16. SEM Observations on the Predation Behavior of Agistemus terminalis (Quayle (Acari: Stigmaeidae and Amblyseius sojaensis Ehara (Acari: Phytoseiidae on Panonychus citri (Mcgregor (Acari: Tetranychidae

    Abdul Razaq

    2000-01-01

    Full Text Available The predation behavior of Agistemus terminalis and Amblyseius sojaensis on Panonychus citri was studied under scanning electron microscope. Agistemus terminalis grasped egg stalk by claws and sensory organ of palpi and direct attack on eggs was done by needle-shaped stylets extruded from the rostrum. A distinct hole was found on the egg surface produced by the penetration and successive withdrawn of the rostrum and stylets. Finally, the hole became wide by the further attack of rostrum and palpi. Amblyseius sojaensis predated on the larvae and adults of P. citri. It grasped the anterior portion of the prey body by palpi and legs. Several sharply pointed and bent setae of palpi invaded into the cuticle of the prey. The prey was then attacked by the chelicerae and the cuticle was lacerated. The drawing of body fluid occurred by the extended malae which were positioned between the corniculi and the chelicerae.

  17. Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus

    Moya Andres

    2006-01-01

    Full Text Available Abstract Background There is an increasing interest to better understand endosymbiont capabilities in insects both from an ecological point of view and for pest control. Blochmannia floridanus provides important nutrients for its host, the ant Camponotus, while the bacterium in return is provided with a niche to proliferate. Blochmannia floridanus proteins and metabolites are difficult to study due to its endosymbiontic life style; however, its complete genome sequence became recently available. Results Improved sequence analysis algorithms, databanks and gene and pathway context methods allowed us to reveal new information on various enzyme and pathways from the Blochmannia floridanus genome sequence [EMBL-ID BX248583]. Furthermore, these predictions are supported and linked to experimental data for instance from structural genomics projects (e.g. Bfl341, Bfl 499 or available biochemical data on proteins from other species which we show here to be related. We were able to assign a confirmed or at least a putative molecular function for 21 from 27 previously conserved hypothetical proteins. For 48 proteins of 66 with a previous putative assignment the function was further clarified. Several of these proteins occur in many proteobacteria and are found to be conserved even in the compact genome of this endosymbiont. To extend and re-test predictions and links to experimentally verified protein functions, functional clusters and interactions were assembled. These included septum initiation and cell division (Bfl165, Bfl303, Bfl248 et al.; translation; transport; the ubiquinone (Bfl547 et al., the inositol and nitrogen pathways. Conclusion Taken together, our data allow a better and more complete description of the pathway capabilities and life style of this typical endosymbiont.

  18. Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus

    Gaudermann, Peter; Vogl, Ina; Zientz, Evelyn; Silva, Francisco J; Moya, Andres; Gross, Roy; Dandekar, Thomas

    2006-01-01

    Background There is an increasing interest to better understand endosymbiont capabilities in insects both from an ecological point of view and for pest control. Blochmannia floridanus provides important nutrients for its host, the ant Camponotus, while the bacterium in return is provided with a niche to proliferate. Blochmannia floridanus proteins and metabolites are difficult to study due to its endosymbiontic life style; however, its complete genome sequence became recently available. Results Improved sequence analysis algorithms, databanks and gene and pathway context methods allowed us to reveal new information on various enzyme and pathways from the Blochmannia floridanus genome sequence [EMBL-ID BX248583]. Furthermore, these predictions are supported and linked to experimental data for instance from structural genomics projects (e.g. Bfl341, Bfl 499) or available biochemical data on proteins from other species which we show here to be related. We were able to assign a confirmed or at least a putative molecular function for 21 from 27 previously conserved hypothetical proteins. For 48 proteins of 66 with a previous putative assignment the function was further clarified. Several of these proteins occur in many proteobacteria and are found to be conserved even in the compact genome of this endosymbiont. To extend and re-test predictions and links to experimentally verified protein functions, functional clusters and interactions were assembled. These included septum initiation and cell division (Bfl165, Bfl303, Bfl248 et al.); translation; transport; the ubiquinone (Bfl547 et al.), the inositol and nitrogen pathways. Conclusion Taken together, our data allow a better and more complete description of the pathway capabilities and life style of this typical endosymbiont. PMID:16401340

  19. Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae)

    Momen, Faten Mamdouh

    2012-01-01

    The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproducti...

  20. Predadores asociados a panonychus citri mcgregor (acari: tetranychidae en la costa central del Perú

    Alberto Daniel Guanilo

    2007-01-01

    Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor, Typhlodromus (Anthoseius evectus (Schuster, Typhlodromus (Anthoseius transvaalensis (Nesbitt, Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A. evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados

  1. Trypsin inhibitor from edible mushroom Pleurotus floridanus active against proteases of microbial origin.

    Ali, P P Manzur; Sapna, K; Mol, K R Rekha; Bhat, Sarita G; Chandrasekaran, M; Elyas, K K

    2014-05-01

    Protease inhibitors can be versatile tools mainly in the fields of medicine, agriculture and food preservative applications. Fungi have been recognized as sources of protease inhibitors, although there are only few such reports on mushrooms. This work reports the purification and characterization of a trypsin inhibitor from the fruiting body of edible mushroom Pleurotus floridanus (PfTI) and its effect on the activity of microbial proteases. The protease inhibitor was purified up to 35-fold by DEAE-Sepharose ion exchange column, trypsin-Sepharose column and Sephadex G100 column. The isoelectric point of the inhibitor was 4.4, and its molecular mass was calculated as 37 kDa by SDS-PAGE and 38.3 kDa by MALDI-TOF. Inhibitory activity confirmation was by dot-blot analysis and zymographic activity staining. The specificity of the inhibitor toward trypsin was with Ki of 1.043 × 10(-10) M. The inhibitor was thermostable up to 90 °C with maximal stability at 30 °C, active over a pH range of 4-10 against proteases from Aspergillus oryzae, Bacillus licheniformis, Bacillus sp. and Bacillus amyloliquefaciens. Results indicate the possibility of utilization of protease inhibitor from P. floridanus against serine proteases. PMID:24615526

  2. Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum infection in invasive Eastern Cottontail Rabbits Sylvilagus floridanus in Northwestern Italy.

    Zanet, S; Palese, V; Trisciuoglio, A; Cantón Alonso, C; Ferroglio, E

    2013-11-01

    Sylvilagus floridanus is a lagomorph introduced for hunting purposes from North America to Europe where, in certain areas like Northern Italy, its population reached high densities. Brain, kidney and skeletal muscle of 144 Eastern Cottontail Rabbits S. floridanus were examined by PCR for Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum. DNA of E. cuniculi was found with a prevalence of 9.72% (CI 95% 0.058-0.156). T. gondii and N. caninum DNA was detected in 2.08% (CI 95% 0.0071-0.0595) and 2.78% (CI 95% 0.0109-0.0692) of the samples examined, respectively. This is the first report of E. cuniculi infection in a lagomorph species other than in its natural host Oryctolagus cuniculus, and this is also the first time N. caninum is found to naturally infect S. floridanus. E. cuniculi, T. gondii and N. caninum infect S. floridanus at low but relevant prevalences, considered the important role that these pathogens could play in both animal and human health. PMID:23747104

  3. Bacteriocyte dynamics during development of a holometabolous insect, the carpenter ant Camponotus floridanus

    Fraunholz Martin J

    2010-12-01

    Full Text Available Abstract Background The carpenter ant Camponotus floridanus harbors obligate intracellular mutualistic bacteria (Blochmannia floridanus in specialized cells, the bacteriocytes, intercalated in their midgut tissue. The diffuse distribution of bacteriocytes over the midgut tissue is in contrast to many other insects carrying endosymbionts in specialized tissues which are often connected to the midgut but form a distinct organ, the bacteriome. C. floridanus is a holometabolous insect which undergoes a complete metamorphosis. During pupal stages a complete restructuring of the inner organs including the digestive tract takes place. So far, nothing was known about maintenance of endosymbionts during this life stage of a holometabolous insect. It was shown previously that the number of Blochmannia increases strongly during metamorphosis. This implicates an important function of Blochmannia in this developmental phase during which the animals are metabolically very active but do not have access to external food resources. Previous experiments have shown a nutritional contribution of the bacteria to host metabolism by production of essential amino acids and urease-mediated nitrogen recycling. In adult hosts the symbiosis appears to degenerate with increasing age of the animals. Results We investigated the distribution and dynamics of endosymbiotic bacteria and bacteriocytes at different stages during development of the animals from larva to imago by confocal laser scanning microscopy. The number of bacteriocytes in relation to symbiont-free midgut cells varied strongly over different developmental stages. Especially during metamorphosis the relative number of bacteria-filled bacteriocytes increased strongly when the larval midgut epithelium is shed. During this developmental stage the midgut itself became a huge symbiotic organ consisting almost exclusively of cells harboring bacteria. In fact, during this phase some bacteria were also found in midgut cells other than bacteriocytes indicating a cell-invasive capacity of Blochmannia. In adult animals the number of bacteriocytes generally decreased. Conclusions During the life cycle of the animals the distribution of bacteriocytes and of Blochmannia endosymbionts is remarkably dynamic. Our data show how the endosymbiont is retained within the midgut tissue during metamorphosis thereby ensuring the maintenance of the intracellular endosymbiosis despite a massive reorganization of the midgut tissue. The transformation of the entire midgut into a symbiotic organ during pupal stages underscores the important role of Blochmannia for its host in particular during metamorphosis.

  4. [Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)].

    Matioli, André L; de Oliveira, Carlos A L

    2007-01-01

    The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35 degrees C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biological parameters. The optimal development of A. brasiliensis took place at 29 degrees C. The values of T (time of generation - days), R0 and r m at 30 degrees C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29 degrees C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage. PMID:17934624

  5. Interspecific interactions involving Neoseiulus californicus (Acari: Phytoseiidae) and Agistemus brasiliensis (Acari: Stigmaeidae) as predators of Brevipalpus phoenicis (Acari: Tenuipalpidae).

    da Silva, Marcos Zatti; Sato, Mário Eidi; de Oliveira, Carlos Amadeu Leite; Nicastro, Roberto Lomba

    2015-03-01

    Brevipalpus phoenicis (Geijskes) is associated with the transmission of Citrus leprosis which is considered the main viral disease for the Brazilian citrus production. Mites of the families Stigmaeidae and Phytoseiidae coexist in various agricultural crops, often promoting the biological control of pest mites. The aim of this work was to study the interactions of Neoseiulus californicus (McGregor) (Phytoseiidae) and Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Stigmaeidae), in the presence or absence of B. phoenicis. Two experiments were carried out. In the first, a N. californicus female was placed in each leaf disc arena, with eggs of B. phoenicis and A. brasiliensis as food sources. In the second, an A. brasiliensis female was placed in each arena, with eggs of B. phoenicis and N. californicus as food sources. Adults of both predators were able to consume both types of eggs available as food sources, but they fed on considerably higher proportions of B. phoenicis than on eggs of the predator. Eggs of A. brasiliensis were not a suitable food source for N. californicus, which produced only 0.1 egg per female per day when only eggs of that species were present in the experimental unit. The results suggest that eggs of N. californicus were a suitable food source for A. brasiliensis, which oviposited 1.12 eggs per day, when only eggs of N. californicus were provided to the stigmaeid mite. The possible interactions among N. californicus, A. brasiliensis and B. phoenicis in citrus orchards are discussed. PMID:25524512

  6. Invasive species and their parasites: eastern cottontail rabbit Sylvilagus floridanus and Trichostrongylus affinis (Graybill, 1924) from Northwestern Italy.

    Tizzani, P; Catalano, S; Rossi, L; Duignan, P J; Meneguz, P G

    2014-04-01

    The eastern cottontail Sylvilagus floridanus is a native American lagomorph. Within the genus Sylvilagus, the eastern cottontail is the species with the widest distribution. From 1950s, the species was introduced to several European countries. A rapid territorial expansion of the introduced eastern cottontails has been observed in many areas of Italy. The eastern cottontail has been demonstrated to play a main role as carrier of exotic parasites. To date, three nematode species, exotic in Italian ecosystems, have been reported from introduced S. floridanus. However, its parasite fauna biodiversity is richer in native populations of the American continent. The aim of this work was to further investigate the gastrointestinal parasites of S. floridanus, to evaluate the potential presence of other exotic species. During 2010, 101 hosts were examined, and three nematodes were collected from their digestive tract. Two parasite species (Obeliscoides cuniculi, Trichostrongylus calcaratus) were already reported in Italy; the isolation of Trichostrongylus affinis is instead the first report of this nematode in Italy and in Europe as a whole. This study wants to highlight the great risks related to the introduction of allochthonous species. The impact of the invasion by alien animal species may be particularly severe for public and animal health, due to the potential introduction of new pathogens. The good number of exotic parasites found in introduced eastern cottontails, together with the few sanitary surveys carried out, suggests that an epidemiological survey, with specimens from multiple localities on a wider geographic range, could lead to interesting findings on parasites of native and alien lagomorphs in Europe. PMID:24481904

  7. Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae)

    Momen, Faten Mamdouh

    2012-01-01

    The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproductive rate. Preying on Aculops lycopersici (Massee) gave the lowest fecundity and net reproductive rate; therefore, this prey was the least suitable for the oviposition of A. olivi. Preying on Aculus fockeui (Nalepa et Trouessart) and A. mangiferae produced higher intrinsic rates of increase and finite rates of increase for the predator in comparison to A. lycopersici, which showed the lowest value. These differences in response to various eriophyid pests should be considered for the production of healthy cultures of A. olivi. PMID:24575223

  8. Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae).

    Momen, Faten Mamdouh

    2012-05-01

    The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproductive rate. Preying on Aculops lycopersici (Massee) gave the lowest fecundity and net reproductive rate; therefore, this prey was the least suitable for the oviposition of A. olivi. Preying on Aculus fockeui (Nalepa et Trouessart) and A. mangiferae produced higher intrinsic rates of increase and finite rates of increase for the predator in comparison to A. lycopersici, which showed the lowest value. These differences in response to various eriophyid pests should be considered for the production of healthy cultures of A. olivi. PMID:24575223

  9. Ácaros predadores associados ao ácaro-da-erinose da lichia

    Pedro Renan Ferreira Picoli

    2010-11-01

    Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.

  10. Evaluation of the eastern cottontail Sylvilagus floridanus as an amplifying vertebrate host for Cache Valley virus (Bunyaviridae) in Indiana.

    Blackmore, Carina G M; Grimstad, Paul R

    2008-01-01

    To evaluate the importance of eastern cottontails (Sylvilagus floridanus) as amplifying hosts for Cache Valley virus (CVV), we tested hunter-provided blood samples from northern Indiana for specific neutralizing (N) antibodies against this mosquito-borne bunya-virus. Samples were collected during the winter of 1994-95. Two seronegative eastern cottontails, captured in July 1995, were also infected with CVV by subcutaneous inoculation, and two others were infected by allowing CVV-infected mosquitoes to feed on them. The results indicate that eastern cottontails probably are not important amplifying hosts for CVV. The prevalence of N antibodies against CVV was low (6.0%, n=82) among the hunter-killed animals. Low viremia (CVV. PMID:18263839

  11. Seletividade de oito inseticidas a predadores de lagartas em citros / Selectivity of eight insecticides to predators of citrus caterpillars

    Tederson Luiz, Galvan; Marcelo Coutinho, Picano; Leandro, Bacci; Eliseu Jos Guedes, Pereira; Andr Luiz Barreto, Crespo.

    2002-02-01

    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metlico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymen [...] optera: Vespidae) em concentraes que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados no foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metlico e triclorfom no foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante dose de deltametrina que B. lecheguana e P. sylveirae. As trs espcies de predadores foram altamente suscetveis s doses e subdoses de fenitrotiom, fenpropatrina e paratiom metlico, e dose de triclorfom. Abstract in english The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) and Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) was evaluated using insec [...] ticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

  12. Efeito de espcies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfdeos predadores

    Gonalves Paulo Antonio de Souza

    2003-01-01

    Full Text Available Analisou-se a relao entre o efeito do plantio de diferentes espcies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidncia de Thrips tabaci Lind. e sirfdeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench; cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.; cebola + cenoura (Daucus carota L., cv. Nantes e cv. Braslia; cebola + milho (Zea mays L.; cebola + rcula (Eruca sativa L. + vegetao espontnea. O plantio de diferentes espcies vegetais em bordadura no provocou diferenas significativas na incidncia de tripes e sirfdeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possvel adotar tais sistemas sem perdas em rendimento.

  13. Microtriatoma pratai sherlock & Guitton, 1982 sinnimo do Hemptero predador Aradomorpha Championi Lent & Wygodzinsky, 1944 (Reduviidae, Reduviidae): notas

    Herman Lent

    1982-01-01

    Microtriatoma pratai Sherlock & Guitton, 1982 no pertence a este gnero de Triatominae. No inseto hematfago. Pertence ao gnero Aradomorpha Champion, 1899 e espcie A. championi descrita por Lent & Wygodzinsky em 1944, inseto predador da subfamlia Reduviidae.Microtriatoma pratai Sherlock & Guitton, 1982 is not a species of this genus of the subfamily Triatominae. It is not hematophagous. I identify it as Aradomorpha championi Lent & Wygodzinsky, 1944, a predator insect of the subfamil...

  14. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis

    Bruce Veronez

    2012-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.

  15. Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids

    Marcos Rafael Gusmão

    2000-07-01

    Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

  16. Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa

    Rodolfo Vargas Castilhos; Anderson Dionei Grützmacher; Paulo Ricardo Baier Siqueira; Ítalo Lucas de Moraes; Cleiton Jair Gauer

    2014-01-01

    Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas). Os agrotóxicos foram pulverizados diretamente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fe...

  17. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae)

    Silveira Luís Cláudio Paterno; Bueno Vanda Helena Paes; Pierre Leonardo Santa Rosa; Mendes Simome Martins

    2003-01-01

    O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), ...

  18. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff (Heteroptera: anthocoridae

    Silveira Luís Cláudio Paterno

    2003-01-01

    Full Text Available O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say foi coletado nas culturas de milho (Zea mays L., milheto (Pennisetum glaucum (L. R.Br., sorgo (Sorghum spp., feijão (Phaseolus vulgaris L., girassol (Helianthus annuus L., alfafa (Medicago sativa L., soja [Glycine max (L. Merr.], crisântemo (Chrysanthemum spp., tango (Solidago canadensis L. e cartamus (Carthamus tinctorius L. e nas plantas invasoras picão-preto (Bidens pilosa L., caruru (Amaranthus sp., losna-branca (Parthenium hysterophorus L. e apaga-fogo (Alternanthera ficoidea L.. Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen.

  19. Efeito de inseticidas em insetos predadores em culturas de algodo Effect of insecticides on predator insects associated with cotton

    JOS JANDUI SOARES

    2000-09-01

    Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodo (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratrio. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratrio, alm das formulaes base de Fipronil foi utilizado o Paration metlico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrpodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratrio, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relao a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma reduo dos insetos inferior a 30%, e o Paration metlico no foi seletivo para C. sanguinea em laboratrio.To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L. crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.; Fipronil 800 WDG (64, 80 and 100 g/ha of a.i.; Endosulfan 350 EC (700 g/ha of a.i.; and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare under field condition and to Cycloneda sanguinea (L. under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb., and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L. and Doru lineare (Eschs under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.

  20. Local feeding specialization of the red fox (Vulpes vulpes in response to eastern cottontail (Sylvilagus floridanus introduction (NW Italy

    Alessandro Balestrieri

    2006-03-01

    Full Text Available Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus on the food habits of the red fox (Vulpes vulpes, between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115 in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989. Comparison included also the diet of badgers (Meles meles, considered as potential competitors for food resources. Alien lagomorphs (mean percent volume, Vm% = 68% represented by far the most exploited resource, only three other food items reaching values of mean percent volume barely higher than 5%. Cottontails frequency of occurrence did not vary according either to season or to their reproductive cycle (II-IX vs. X-I, whilst diet niche breadth varied inversely proportional to the use of this key-resource. Overall fox trophic niche breadth varied from 0.64 in 1988-89 to 0.31 in 1998-00 (B, Levin’s index. These findings led us to consider the feeding habits of the fox in the study area as a result of local specialization of a typical generalist carnivore, according to the predictions of optimal foraging theory. No variation occurred in the badger niche breadth since cottontail introduction, whilst niche overlap between foxes and badgers decreased from 0.59 to 0.13 (O, Pianka’s index, possibly reducing competition for food in summer. Riassunto Specializzazione alimentare a livello locale della Volpe Vulpes vulpes in risposta all’introduzione del Silvilago Sylvilagus floridanus (Italia nord occidentale. Per valutare gli effetti dell’introduzione del Silvilago (Sylvilagus floridanus sul comportamento alimentare della volpe (Vulpes vulpes, nel periodo giugno 1998-febbraio 2000, la dieta del carnivoro è stata definita tramite l’analisi di 115 feci raccolte nella Riserva Naturale “Garzaia di Valenza” (Provincia di Alessandria, Italia nord occidentale di circa 250 ha. I risultati ottenuti sono stati confrontati con quelli conseguiti nella medesima area prima dell’introduzione del Silvilago, oltre che con quelli disponibili sulla dieta del Tasso (Meles meles, che può essere ritenuto un potenziale competitore per le risorse alimentari. I lagomorfi sono risultati la categoria alimentare maggiormente consumata (volume medio percentuale, Vm% = 68%, mentre solo tre altre categorie hanno raggiunto valori di Vm di poco superiori al 5%. Non sono emerse variazioni stagionali o relative al periodo riproduttivo (febbraio-settembre vs. ottobre-gennaio del Silvilago, anche se l’ampiezza di nicchia complessiva è risultata inversamente proporzionale al consumo di lagomorfi. L’ampiezza di nicchia della Volpe è scesa da 0,64 nel 1988-89 a 0,31 nel 1998-00. Nel complesso, la dieta della Volpe nell’area di studio può essere considerata l’espressione di una specializzazione a livello locale, così come previsto dalla teoria del foraggiamento ottimale. Non è emersa alcuna variazione per l’ampiezza di nicchia del Tasso, mentre il grado di sovrapposizione (indice di Pianka tra il mustelide e la Volpe è nettamente diminuito (da 0,59 a 0,13. In questi termini la specializzazione della Volpe potrebbe rendere minima la competizione alimentare con il Tasso, in particolar modo in estate, quando la siccità limita la disponibilità di lombrichi.

  1. SELECTIVITY OF INSECTICIDES TO PREDATORS OF PESTS COTTON PLANT SELETIVIDADE DE INSETICIDAS AOS PREDADORES DAS PRAGAS DO ALGODOEIRO

    Julio Cezar Silveira Nunes

    2007-09-01

    Full Text Available

    The selectivity of insecticides for the complex of predators of the pests of cotton plant was evaluated in field experiment, in Goiânia- Goiás (Brazil, during the crop 1998/99. The experimental design was the randomized blocks with seven treatments and four repetitions (check, clorfluazuron, Bacillus thuringiensis, alanycarb, endosulfan and acephate in two amounts. The samplings were accomplished in beforeapplication, two days, seven and fourteen days after the treatment. For the obtained results (Henderson & Tilton, the products, in the decreasing order of selectivity, were: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    KEY-WORDS: Insecta; insecticides; cotton plant; predators.

    A seletividade de inseticidas para o complexo das pragas do algodoeiro foi avaliada em experimento de campo, em Goiânia (GO, durante a safra 1998/99. O delineamento experimental foi em blocos ao acaso com sete tratamentos testemunha, clorfluazuron, B. thuringiensis, alanycarb, endosulfan e acephate em duas dosagens, em quatro repetições. As amostragens foram realizadas em pré-aplicação; aos dois, sete e quatorze dias após as pulverizações. Pelos resultados obtidos (fórmula de Herderson & Tilton, os produtos, na ordem decrescente de seletividade, foram: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    PALAVRAS-CHAVE: Insecta; inseticidas; algodão; predadores.

  2. Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa

    Rodolfo Vargas Castilhos

    2014-11-01

    Full Text Available Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas. Os agrotóxicos foram pulverizados diretamente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas se mostrou inócua (classe 1 a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2 a ovos e pupas de C. externa

  3. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil

    Ferla Noeli Juarez; Moraes Gilberto José de

    2006-01-01

    Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. ano...

  4. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)

    Luís Cláudio Paterno Silveira; Vanda Helena Paes Bueno; Leonardo Santa Rosa Pierre; Simome Martins Mendes

    2003-01-01

    O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), ...

  5. BIOLOGÍA Y COMPORTAMIENTO DE Amblyseius chungas Denmark & Muma (ACARI: PHYTOSEIIDAE COMO PREDADOR DE Panonychus citri (McGregor (ACARI: TETRANYCHIDAE

    Alberto Daniel Guanilo

    2009-01-01

    Full Text Available Panonychus citri (McGregor es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencial de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR. El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día.

  6. Toxicidade de compostos sintticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis

    Bruce, Veronez; Mrio Eidi, Sato; Roberto Lomba, Nicastro.

    2012-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas aps a aplicao de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentraes recomendadas; leos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influncia dos compostos sobre a taxa de crescimento instantneo dos caros foram avaliadas em laboratrio. Extratos de A. cepa, A. angustifolia, produtos base de leo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina no causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem no afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a populao de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

  7. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    Harley Nonato de Oliveira

    2004-10-01

    Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae tm sido criadas em laboratrio com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, no existem relatos sobre a predao, no campo ou em laboratrio, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e caractersticas reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratrio. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produo e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as caractersticas reprodutivas de P. nigrispinus, de forma que a sua utilizao como presa alternativa pode servir para incrementar a produo massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

  8. SELETIVIDADE DE INSETICIDAS SOBRE O COMPLEXO DE PREDADORES DAS PRAGAS DO ALGODOEIRO SELECTIVITY OF PESTICIDES OVER PREDATORS OF COTTON PLANT PESTS

    Elmo Pontes de Melo

    2010-08-01

    Full Text Available

    O algodoeiro é hospedeiro de um complexo de pragas, que podem ocasionar danos às estruturas das plantas. Para o desenvolvimento sustentado, neste agroecossistema, há necessidade da implementação do Manejo Integrado das Pragas (MIP. O objetivo deste trabalho foi estudar a seletividade de inseticidas aos predadores das pragas do algodoeiro. O delineamento experimental utilizado foi o de blocos ao acaso, com nove tratamentos e quatro repetições. Os tratamentos foram aplicados aos 84 dias após a emergência. As amostragens foram feitas através do método de batida de pano, com cinco batidas ao acaso, por parcela, nas quais foram identificados e contados os predadores vivos. Os inseticidas Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1.000 g ha-1, Thiamethoxam 250 WG (200 g ha-1 e Acetamiprid 200 SP (150 g ha-1 não foram seletivos ao complexo de predadores ocorrentes, com percentagens de mortalidades que oscilaram entre moderadamente tóxicos e tóxicos. Etofenprox 300 EC (450 mL ha-1 apresentou a maior percentagem de mortalidade, em relação aos demais tratamentos inseticidas, sendo classificado como tóxico. O tratamento Flonicamid 500 WG (150 g ha-1 foi seletivo, com média de predadores semelhante à testemunha, até 8 dias após a aplicação (daa. Dentre os inseticidas testados, somente o Flonicamid 500 WG foi considerado seletivo, segundo a classificação do IOBC, pois apresentou a menor percentagem de mortalidade ao complexo de predadores ocorrentes.

    PALAVRAS-CHAVE: Gossypium hirsutum L.; Insecta; inseticidas; algodão; predadores.

    The cotton plant hosts a complex of pests that can damage plant structures. Its supported development, in this agroecosystem, demands the implementation of an integrated pest management (IPM system. The goal of this research was to study the selectivity of pesticides over predators of cotton plant pests. The experimental design was randomized blocks, with 9 treatments (84 days after the emergence and 4 replicates. The sampling involved the beat cloth method, with 5 beats per plot, allowing to identify and count the living predators. Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1,000 g ha-1, Thiamethoxam 250 WG (200 g ha-1, and Acetamiprid 200 SP (150 g ha-1 were not selective for the complex of the predators identified, with mortality percentages ranging from moderately toxic to toxic. Etofenprox 300 EC (450 mL ha-1 was the most toxic pesticide, when compared to the others treatments. The Flonicamid 500 WG (150 g ha-1 treatment was selective, with average of predators similar to the control, until 8 days after spraying. Among the pesticides evaluated, only Flonicamid 500 WG was considered selective, according to the IOBC classification, because it showed the lowest mortality percentage for the complex of predators identified.

    KEY-WORDS: Gossypium hirsutum L.; insecta; pesticides; cotton plant; predators.

  9. Plantas transgênicas resistentes a insetos e organismos não-alvo: predadores, parasitóides e polinizadores - doi: 10.5102/ucs.v4i1.23

    Marina Regina Frizzas

    2008-04-01

    Full Text Available Plantas geneticamente modificadas resistentes aos insetos oferecem benefícios à agricultura moderna. No entanto, esta tecnologia pode afetar o controle biológico natural e a biodiversidade por meio de efeitos diretos e indiretos das plantas transgênicas sobre o valor adaptativo e comportamental de predadores, parasitóides, polinizadores e outros artrópodes não-alvo. Neste artigo, são discutidos os impactos ou os efeitos potenciais de plantas transgênicas resistentes a insetos sobre organismos não-alvo, com ênfase em artrópodes predadores, parasitóides e polinizadores, e os principais estudos com plantas transgênicas resistentes a insetos, publicados nos últimos dez anos.

  10. Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis

    André Luiz Barreto Crespo

    2002-03-01

    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart (Lepidoptera: Pieridae e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90, calcularam-se os índices de seletividade diferencial (ISD90, de toxicidade relativa, e de tolerância relativa (ITRe90. O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75 e P. sylveirae (ISD90 = 2,95 e 3,59 em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70 em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64. B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05, e mais tolerante ao carbaril (ITRe90 = 0,14. Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04. As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis.This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart (Lepidoptera: Pieridae and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Based on concentration-response curves and lethal concentrations for 90% of the population (LC90, the differential selectivity index (DSI90, relative toxicity index and relative tolerance index (ReTI90 were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75 and P. sylveirae (DSI90 = 2.95 and 3.59 against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70 against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64. B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05, but the opposite was observed to carbaryl (ReTI90 = 0.14. These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04. Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

  11. Potencial reprodutivo horrio do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae

    Evaldo Martins Pires

    2006-12-01

    Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunstica, incluindo predadores de pragas agrcolas e florestais. Espcies do gnero Podisus destacam-se entre os percevejos predadores no controle biolgico de lagartas desfolhadoras de eucalipto, soja, algodo e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predao de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratrio. Casais desse predador foram acondicionados em potes plsticos de 500 mL com pupas de T. molitor e gua em tubos tipo anestsico odontolgico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentao de machos e fmeas de P. nigrispinus s 0 h, 6 h, 12 h e 18 h. O porcentual de fmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, s 0 h, 6 h, 12 h e 18 h, respectivamente. O maior nmero de fmeas ovipositando foi observado s 00 h. A maior porcentagem de fmeas predando foi s 18 h (32,21% e a de atividade de postura, 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos s 12 h. O nmero de acasalamentos de P. nigrispinus foi maior s 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

  12. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae

    Daniele Cristine Hoffmann Schlesener

    2013-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.

  13. Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stl (Heteroptera:Pentatomidae Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stl (Heteroptera:Pentatomidae

    Francisco Roberto de Azevedo

    1999-02-01

    Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilizao de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stl. Quantificaram-se em cada um dos nstares do predador Supputius cincticeps os consumos bruto e dirio das larvas de T. molitor com e sem defesa, ganho de peso total e ganho de peso dirio pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2, 3, 4 e 5 nstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biolgico da Embrapa-Centro Nacional de Pesquisa de Algodo, em Campina Grande, PB, a 20, 25, e 30C, 6010% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do nstar do predador e da temperatura, do nstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo dirio de S. cincticeps depende do nstar do predador e da temperatura, e do nstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu nstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps.The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stl. The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius cincticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodo, at Campina Grande, PB, Brazil, at 20, 25, and 30C, 6010% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

  14. Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reproduo do predador Podisus nigrispinus (Hemiptera: Pentatomidae.

    Anderson Mathias Holtz

    2011-04-01

    Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentao em plantas sobre os aspectos biolgicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratrio. O desenvolvimento e a sobrevivncia ninfal desse predador, alm do perodo de pr-oviposio, nmero de posturas, viabilidade dos ovos e afertilidade e longevidade de fmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condies controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficincia de P. nigrispinus para o controle biolgico em plantios de eucalipto.

  15. Atrao do predador Doru luteipes (Scudder (Dermaptera: Forficulidae por estmulos olfativos de dietas alternativas em laboratrio Attraction of the predator Doru luteipes (Scudder (Dermaptera: Forficulidae by olfactory stimulus of alternative diets in the laboratory

    Mariana Campana Nonino

    2007-06-01

    Full Text Available Doru luteipes consome lagartas de Spodoptera frugiperda, que atualmente a principal praga da cultura do milho no Brasil. Normalmente, se 70% das plantas tivessem o predador, a praga seria mantida abaixo do nvel de dano econmico. Entretanto, o predador ocorre aps a praga danificar as plantas. Assim, a disponibilidade de materiais que atrassem e antecipassem a presena do predador na lavoura poderia reduzir populaes da praga. Desta forma, estudou-se em laboratrio a atratividade de dietas artificiais para machos e fmeas do predador D. luteipes. Os tratamentos foram: pupa desidratada e moda do bicho-da-seda; plen misto, nas quantidades de 0,05; 0,1; 0,2; 0,5 e 1,0g para ambas as dietas. Em olfatmetro, os estmulos da dieta foram comparados testemunha. Foram realizadas 30 repeties. Os resultados mostraram que houve atratividade tanto para machos quanto para fmeas. Em geral, a atrao foi aumentada com o aumento da quantidade das dietas. Estudos adicionais foram propostos para testar a viabilidade do uso dos materiais como estratgia de manejo da praga no campo.Doru luteipes consumes larvae of Spodoptera frugiperda, which is at this moment the main pest of maize crop in Brazil. In general, if 70% of the plants had this predator the pest would be kept under the threshold of economic damage. However, the predator occurs after the pest damages the plants. Thus, the availability of materials that would attract and anticipate the presence of predator in the field,could reduce pest populations. In such a way, it was studied in the laboratory the attractiveness of artificial diets for males and females of the D. luteipes. The treatments were: ground dehydrated pupa of the silk worm and pollen mixture in the amounts of 0.05, 0.1, 0.2, 0.5 e 1.0g, for both the diets The diet stimulus were compared to control using a olfactometer. In general, attraction increased with rising amounts of the diets. Further investigations were proposed to test the viability of the usage of the materials to manage the pest in the field.

  16. Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae e ácaros predadores da família Phytoseiidae Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae and mites predators from the family Phytoseiidae

    Hilda Maria Brito

    2006-08-01

    Full Text Available A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks, foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L. DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores.The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L. DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

  17. Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação

    Campos Artur Kanadani; Mota Marcelo de Andrade; Araújo Jackson Victor de; Cecon Paulo Roberto

    2004-01-01

    Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente...

  18. Ácaros predadores (Acari em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil Predators mites (Acari in native and cultivated plants of the State of Rio Grande do Sul, Brazil

    Noeli Juarez Ferla

    2002-12-01

    Full Text Available This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species, was met in Morus spp. (Moraceae and Tabebuia spp. (Bignoniaceae; Phaseolus vulgaris (Papilionaceae; only one species of the mite was met in Campomanesia spp. (Myrtaceae, Phaseolus vulgaris (Papilionaceae and Rosa spp. (Rosaceae. In Alamanda spp.(Apocinaceae, Ficus spp. (Moraceae, Jacaranda mimosifolia (Bignoniaceae and Solanum spp. (Solanaceae were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

  19. A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.

    Fernanda Cristina, Massaro; Natalia Felix, Negreiros; Odete, Rocha.

    2013-04-01

    Full Text Available As hidras so os representantes mais comuns dos cnidrios de gua doce. Em geral, estes organismos so encontrados em todos os continentes, exceto na Antrtica. O presente estudo teve como objetivo obter informaes mais aprofundadas sobre aspectos biolgicos e ecolgicos de duas espcies de Hydra n [...] ativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predao e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espcies. Os resultados indicaram que as duas espcies de Hydra no foram consumidas por nenhum dos predadores testados, os quais so usuais predadores de invertebrados em guas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espcie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de coppodos calanides e os pequenos cladceros, e selecionou negativamente as presas grandes, como os adultos de coppodos calanides e os ostrcodos. J a espcie H. salmacidis, a qual apresenta um tamanho maior, alm de ter preferncia pelos nuplios e copepoditos de coppodos calanides e pequenos cladceros, tambm selecionou positivamente os indivduos adultos dos coppodos calanides. Os resultados obtidos evidenciaram que as espcies H. viridissima e H. salmacidis provavelmente so pouco ou no so predadas em muitos ambientes naturais, sendo elas prprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos so predadores eficientes e observou-se uma relao positiva entre o tamanho da espcie de Hydra e o tamanho da presa. A seletividade alimentar destas espcies esteve relacionada com o tamanho das presas, assim como com outras caractersticas, tais como a espessura da carapaa e a eficincia de natao. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

  20. A dieta alimentar da presa Tenebrio molitor (Coleoptera: Tenebrionidae) pode afetar o desenvolvimento do predador Podisus nigrispinus (Heteroptera: Pentatomidae)? / Can the diet of the prey Tenebrio molitor (Coleoptera: Tenebrionidae) affect the development of the predator Podisus nigrispinus (Heteroptera: Pentatomidae)?

    Claubert Wagner Guimares de, Menezes; Silma da Silva, Camilo; Arley Jos, Fonseca; Sebastio Loureno de, Assis Jnior; Diego Faustolo, Bispo; Marcus Alvarenga, Soares.

    2014-09-01

    Full Text Available Inimigos naturais so importantes para o controle de pragas em culturas agrcolas e florestais. A criao de insetos predadores em biofbricas deve ser de baixo custo para serem utilizados em programas de Manejo Integrado de Pragas (MIP). O objetivo deste trabalho foi avaliar o desenvolvimento de Po [...] disus nigrispinus Dallas, 1851 (Heteroptera: Pentatomidae), alimentado com larvas de Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae), criadas com as seguintes dietas: farelo de trigo, rao triturada ou peletizada para aves poedeiras e fub de milho. Foram obtidos os parmetros de desenvolvimento e reproduo necessrios para calcular a tabela de vida do predador. Os parmetros da tabela de vida revelaram crescimento populacional em todos os tratamentos. No entanto, a taxa lquida de reproduo (Ro) de P. nigrispinus foi menor quando alimentados com larvas de T. molitor criadas com fub de milho, mostrando ser a alimentao menos adequada para esse predador. Por proporcionar maior nmero total de ovos, o farelo de trigo constituiu a melhor dieta para P. nigrispinus. Estudos sobre dietas de presas alternativas so importantes, pois podem favorecer a nutrio de inimigos naturais e, consequentemente, melhorar o desempenho das criaes massais em laboratrio. Abstract in english Natural enemies are important for controlling pests in agricultural and forestry culture. The reproductions of predatory insects in biofactories should have low cost to be used in Integrated Pest Management Program (IPM). The objective of this study was to evaluate the development of Podisus nigrisp [...] inus Dallas, 1851 (Heteroptera: Pentatomidae) fed with Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae). The larvae of T. molitor were created with the following diets: wheat bran, shredded or pelleted poultry feed layers and corn meal. Parameters for the development and reproduction of the P. nigrispinus were obtained. Parameters of the life table show population growth in all treatments. However, the net rate of reproduction (Ro) of P. nigrispinus was lower when they were fed with larvae of T. molitor created with corn meal, which proved to be the least adequate food for this predator. By providing a larger total number of eggs, wheat bran was the best diet for P. nigrispinus. Studies on alternative prey diets are important as they may favor the nutrition of natural enemies and, consequently, improve the performance in laboratory rearing.

  1. Toxoplasmosis Silvestre: relación presa-predador y papel funcional de pequeños felinos silvestres neotropicales en la transmisión -resumen-

    William A Cañón-Franco

    2014-12-01

    Full Text Available Pequeños felinos neotropicales se ubican en el tope de la cadena alimenticia y‚ aunque críticamente amenazados‚ ocho especies de felinos son relativamente abundantes en el continente americano‚ sin embargo‚ pocos estudios biológicos sobre la circulación de agentes infecciosos han sido realizados. Para determinar el papel epidemiológico que cumplen las poblaciones de felinos silvestres en la transmisión de la Toxoplasmosis en la región sur de Brasil (estado de Rio Grande do Sul‚ fue determinada la frecuencia molecular de Toxoplasma gondii. La amplificación del marcador ITS1 fue posible en 31 de los 90 felinos analizados (34‚4%‚ de las especies Puma yagouaroundi (9/22‚ Leopardus geoffroyi (6/22‚ Leopardus tigrinus (8/28‚ Leopardus wiedii (6/10‚ Leopardus pardalis (1/1 y Leopardus colocolo (1/7. Dos nuevos genotipos de T. gondii fueron caracterizados por PCR-RFLP (Lw#31Tn - Py#21Sm y el genotipo Py#56Br previamente descrito en gatos domésticos‚ perros y chigüiros del Brasil. Adicionalmente‚ fue parcialmente caracterizado el genotipo I (Py#36Sm‚ evidenciando la circulación ambiental y su posible relación en la presentación de toxoplasmosis ocular en humanos. Los resultados demuestran que pequeños felinos silvestres tienen un papel importante en la transmisión de la toxoplasmosis en la interfase animales domésticos-silvestres‚ por lo que no se descarta la posible hibridación con genotipos urbanos. La carnivoría y las relaciones presa-predador son fundamentales en la transmisión horizontal de Toxoplasma. Aunque existan variaciones biogeográficas y estacionales en la dieta de los felinos silvestres‚ aproximadamente 40% a 80%‚ corresponde a pequeños mamíferos no voladores (marsupiales y roedores. El estudio de la dinámica de transmisión en diferentes niveles tróficos es de gran interés para la comprensión ecológica del ciclo silvestre de este parásito. Esta propuesta se fundamenta en evaluar el impacto de variables biológicas de las especies predadas (edad‚ sexo‚ peso y dieta y de variables ecológicas (uso vertical y horizontal del espacio‚ densidad de la especie‚ tiempo de vida y distribución en el bioma en la toxoplasmosis silvestre en tres diferentes biomas del estado de Mato Grosso (Brasil. Actualmente‚ están siendo analizados tejidos de roedores (géneros Necromys‚ Oecomys‚ Oligoryzomys‚ Oryzomys‚ Oxymycterus‚ Proechimys‚ Calomys‚ Cavia‚ Holochilus‚ Necromys‚ Oecomys‚ marsupiales (géneros Philander‚ Didelphis‚ Marmosa‚ Marmosops‚ Metachirus‚ Micoureus‚ Monodidelphis y de otros mamíferos silvestres de la región (Familia Felidae‚ Canidae‚ Myrmecophagidae‚ Cebidae‚ Dasypodidae‚ Mustelidae. Los resultados parciales de la investigación demuestran la circulación de Toxoplasma entre carnívoros (Cerdocyon thous y primates (Sapajus sp‚ con resultados negativos para las demás especies en estudio‚ indicando que otros niveles biológicos participan en la transmisión.

  2. SELETIVIDADE DE CHLORFENAPYR E FENBUTATIN-OXIDE SOBRE DUAS ESPÉCIES DE ÁCAROS PREDADORES (ACARI: PHYTOSEIIDAE EM CITROS SELECTIVITY OF CHLORFENAPYR AND FENBUTATIN-OXIDE ON TWO SPECIES OF PREDACEOUS MITES (ACARI: PHYTOSEIIDAE IN CITRUS

    PAULO REBELLES REIS

    2001-12-01

    Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espéciesThrough the bioassays, it was verified the residual contact, ovicidal and persistence effects of the products chlorfenapyr and fenbutatin-oxide on two species of predaceous mites, Iphiseiodes zuluagai Denmark & Muma and Euseius alatus DeLeon (Acari: Phytoseiidae, associated to the citrus leprosis mite Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. The adult total effect was studied through the residual spray contact method in glass surface, according to IOBC methodology. Ovicidal effect was evaluated through direct spray on the predators mite eggs, also in glass surface. Persistence of the products was evaluated, in laboratory conditions, in arenas made with sprayed orange leaves in the field at 0, 5, 15 and 30 days after the application. Results showed that chlorfenapyr was noxious to I. zuluagai and E. alatus, and fenbutatin-oxide was slightly harmful to E. alatus and innocuous to I. zuluagai. None of the products presented ovicidal effect. Fenbutatin-oxide presented low persistence to both predators mite species, and chlorfenapyr in the smallest rate (31.3 ml was of low persistence and in the great one (62.5 ml moderately persistent. Fenbutatin-oxide was innocuous and slightly harmful to the predaceous mites I. zuluagai and E. alatus, respectively, and of low persistence for both species

  3. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?

    Rafael Braga da Silva

    2012-06-01

    Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae e Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior, apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores

  4. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa

    M. Florencia Grandi

    2012-11-01

    Full Text Available Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American sea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predatorio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica.

  5. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics / Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tcticas del predador y la presa

    M. Florencia, Grandi; Roco, Loizaga de Castro; Enrique A, Crespo.

    2012-11-01

    Full Text Available Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predat [...] orio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitn del barco, se describe cmo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamferos marinos y las pesqueras a lo largo de la costa patagnica. Abstract in english Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American s [...] ea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.

  6. Toxicidade letal e subletal do nim sobre o pulgo-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa

    Madelaine Venzon

    2007-05-01

    Full Text Available O objetivo deste trabalho foi avaliar, em laboratrio, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgo-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em soluo aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em gua. Fmeas do pulgo foram transferidas para essas folhas e, aps seis dias, avaliou-se a populao final. Larvas de quarto nstar do predador foram colocadas em plantas de pimenteira infestadas com pulges e pulverizadas com soluo aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em gua. Aps 48 horas, as larvas foram transferidas para tubos de plstico e alimentadas com pulges. A mortalidade larval, a viabilidade pupal e a emergncia de adultos foram avaliadas. A populao de pulges foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com gua. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e no houve emergncia de adultos. Apesar do potencial do nim em reduzir a populao de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

  7. Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e caros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil

    A.L., Marsaro Jnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Jnior; J.L. de C., Mineiro.

    2012-03-01

    Full Text Available O caro-hindustnico-dos-citros, Schizotetranychus hindustanicus (Hirst), uma praga de importncia quarentenria, recentemente introduzida no Brasil. At a conduo do presente estudo, no havia informaes na literatura sobre a eficincia de acaricidas no controle de S. hindustanicus, em condie [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no pas, sobre o caro-praga e caros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limo-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentraes (g i.a./100 L de gua) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicao foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatstico foi inteiramente casualizado com seis tratamentos e cinco repeties. As avaliaes foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias aps a aplicao (DAA). Em cada avaliao, foram coletados 20 folhas e 10 frutos por parcela, contando-se o nmero de caros S. hindustanicus e fitosedeos. Todos os produtos reduziram significativamente a populao do caro-hindustnico nas folhas at 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um perodo de controle mais longo que dimetoato. Com relao aos caros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitosedeos, at 4 DAA. A espcie predominante de fitosedeo foi Euseius concordis (Chant), correspondendo a 71% dos caros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

  8. Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae em diferentes temperaturas = Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae under different temperatures

    José Wagner da Silva Melo

    2009-07-01

    Full Text Available Euseius alatus DeLeon (Acari: Phytoseiidae é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avaliar o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e33°C, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30°C mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatusem laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro.Euseius alatus DeLeon (Acari: Phytoseiidae is one of the mostcommon predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effect of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33°C; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility lifetable, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

  9. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil

    Noeli Juarez Ferla; Gilberto José de Moraes

    2006-01-01

    Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. ano...

  10. NOTA PRÉVIA SOBRE ALGUNS DADOS BIONÔMICOS DO PREDADOR DE ABELHAS Apiomerus nigrilobus Stal, 1872 OBTIDOS EM CONDIÇÕES DE LABORATÓRIO PRELIMINARY NOTE ON BIONOMIC DATA OF THE HONEYBEE PREDATOR Apiomerus nigrilobus STAL, 1872 GOTTEN IN LABORATORY CONDITIONS

    Érico Amaral

    2007-09-01

    Full Text Available

    Esta nota prévia apresenta alguns dados bionômicos do predador de abelhas Apiomerus nigrilobus Stal, 1872 obtidos sob condições de laboratório. O estudo foi realizado no Departamento de Entomologia da Escola Superior de Agricultura “Luiz de Queiroz” da Universidade do Estado de São Paulo, no período de março de 1972 a dezembro de 1973. O ciclo biológico médico constatado para este predador foi de 246 dias. Os autores apresentam três quadros que resumem os dados obtidos.

    This preliminary note presents some bionomics data of the honeybee predator Apiomerus nigrilobus Stal, 1872 obtained in laboratory. The study was conducted at the Agricultural College ";Luiz de Queiroz” U.S.P. — São Pau1o, Brazil, from March 1972 to December 1973. The evolutionary cycle of this predator, on an average, is 246 days. A table is presented showing the results.

  11. Ácaros predadores e o fungo Neozygites floridana associados a tetraniquídeos em soja no Rio Grande do Sul Predatory mites and the fungus Neozygites floridana associated with spider mites on soybean, in Rio Grande do Sul, Brazil

    Samuel Roggia

    2009-01-01

    Full Text Available O objetivo deste trabalho foi verificar a ocorrência de ácaros predadores e do fungo Neozygites floridana, associados a ácaros tetraniquídeos, em soja (Glycine max L., no Estado do Rio Grande do Sul. Entre 2003 e 2005, foram avaliadas amostras de folhas de soja das principais regiões produtoras do Estado. Essas amostras foram coletadas de diferentes posições da planta e aleatoriamente na lavoura. As espécies de ácaros predadores encontradas foram: Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis e Galendromus annectens. O fungo N. floridana apresentou ampla distribuição e ocorreu em todas as espécies de tetraniquídeos encontradas: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni e T. urticae.The objective of this work was to verify the occurrence of predatory mites and the fungus Neozygites floridana, associated with spider mites in soybean (Glycine max L., in Rio Grande do Sul, Brazil. From 2003 to 2005, samples of soybean leaves from the most important soybean producing regions of the state were evaluated. These samples were collected from different positions of the plant and randomly in the field. The predatory mite species found were Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis, and Galendromus annectens. The fungus N. floridana was widely distributed and occurred in all the spider mite species found: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni and T. urticae.

  12. Seletividade de agrotxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa / Selectivity of pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grtzmacher; Paulo Ricardo Baier, Siqueira; talo Lucas de, Moraes; Cleiton Jair, Gauer.

    2014-11-01

    Full Text Available Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condies laboratoriais (temperatura 251C, umidade relativa 7010% e fotofase 14 horas). Os agrotxicos foram pulverizados direta [...] mente sobre ovos e pupas por meio de uma torre de Potter, utilizando a mxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, alm da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotxicos foram classificados para ovos em funo da reduo na ecloso e, para pupas, em funo do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas) se mostrou incua (classe 1) a ovos e pupas, com reduo na ecloso de larvas e efeito total em pupas inferiores a 30%. A exceo se deu para o inseticida leo mineral, que reduziu a ecloso de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2) a ovos e pupas de C. externa Abstract in english This research aimed to evaluate the effect of nineteen pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa in bioassays carried under laboratory conditions (temperature of 251C, relative humidity 7010% and 14 hours photophase). The pesticides were directly spra [...] yed on eggs and pupae trough a Potter tower using the maximum recommended dosage for peach orchards. It was evaluated eggs and pupae viability, in addition to fecundity and fertility of adults emerged from treated pupae. The pesticides were classified to eggs according to reduction in eggs hatch, and to pupae according to the total effect into IOBC toxicity categories. Most of pesticides evaluated (8 insecticides, 8 fungicides and 2 herbicides) were harmless (category 1) to eggs and pupae, with a reduction in eggs hatch and total effect to pupae lower than 30%, except for the insecticide mineral oil, which reduced eggs hatch in 69.55% and caused a total effect of 36.22% in pupae, being therefore classified as slightly harmful (category 2) to eggs and pupae of C. externa

  13. Initial screening of little known predatory mites in Brazil as potential pest control agents.

    De Vis, R M J; de Moraes, G J; Bellini, M R

    2006-01-01

    The objective of this study was to evaluate the oviposition rate and the survivorship of some of the most common predators on plants of the natural vegetation of southeastern Brazil, when confined with different food sources. Forty-four laboratory tests were carried out, each corresponding to a different combination of predator species and food source. The predators tested were: Phytoseiidae--Amblyseius acalyphus, Euseius citrifolius, Iphiseiodes zuluagai, Metaseiulus (Metaseiulus) camelliae, Typhlodromips cananeiensis; Stigmaeidae--Agistemus floridanus, Zetzellia malvinae; Tydeidae--Pronematus sp. For most predators, the highest oviposition rate and survivorship were obtained when the prey was one of the tenuipalpid mites, Brevipalpus phoenicis or Tenuipalpus heveae. With the exception of A. floridanus, the predators had low oviposition rate and survivorship on Calacarus heveae relative to their respective rate on other food sources. Predators had also generally low oviposition rate and survivorship when feeding on Tetranychus urticae, Oligonychus gossypii or Frankliniella sp. PMID:16770686

  14. Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops

    M.A. Watanabe

    1994-04-01

    Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

  15. Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton

    JORGE B., TORRES; CHRISTIAN S.A., SILVA-TORRES; MURILO R., SILVA; JOSINLIA F., FERREIRA.

    2002-06-01

    Full Text Available Os objetivos deste trabalho foram estudar a ao dos inseticidas espinosade, lambdacialotrina e monocrotofs no controle do curuquer-do-algodoeiro Alabama argillacea (Hbner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predao de A. argillacea por P. nigrispinus no campo. Inseticidas e concentraes utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicao. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofs (240 e 320 g i.a./ha) foi observado at trs dias aps aplicao, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% at cinco dias. Monocrotofs e lambdacialotrina foram significativamente mais txicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofs e lambdacialotrina para P. nigrispinus foi evidente at trs dias aps a aplicao. A sobrevivncia de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre aps um dia, e apenas por tiametoxam aps trs dias da aplicao. Pimetrozine, dicofol e propargite no afetaram a sobrevivncia de P. nigrispinus. A predao de lagartas de A. argillacea por P. nigrispinus no foi observada no dia da aplicao em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo trs dias aps a aplicao. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hbner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.

  16. Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions

    Luciano Pamplona de Góes Cavalcanti

    2007-08-01

    Full Text Available OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada caixa, e a cada semana acrescentavam-se 100 larvas por caixa/dia, até se obter um máximo de 500 larvas/dia. Comprimento e peso dos peixes foram medidos semanalmente. RESULTADOS: Foram utilizadas 369.000 larvas no total. O Trichogaster trichopteros foi a única espécie em que ambos os sexos predaram 100% das larvas oferecidas. O Betta splendens deixou de predar apenas 15 larvas. Machos do Poecilia reticulata apresentaram baixa capacidade larvófaga quando comparados às fêmeas da mesma espécie. Em relação ao peso e tamanho o Betta splendens mostrou-se capaz de predar 523 larvas/grama/dia. CONCLUSÕES: Fêmeas e machos de Trichogaster trichopteros e de Astyanax fasciatus, e fêmeas de Betta splendens e de Poecillia sphenops foram os peixes que apresentaram maior competência para predar as larvas. Embora com competência menor, machos de Poecillia sphenops e fêmeas de Poecilia reticulata foram capazes de eliminar o número de larvas de Aedes aegypti que possam emergir durante 24 horas num criadouro, em condições naturais. Machos de Poecilia reticulata não foram predadores eficazes.OBJECTIVE: To evaluate the efficacy of fish as predators of the Aedes aegypti larvae in laboratory conditions. METHODS: The male and female of five different fish were included in the experiment. The tests to measure their consumption ability lasted five weeks for each species. Each trial involved four test tanks and four control tanks. Two control tanks contained just one fish, and the other two just larvae. Each of the test tanks contained one fish and the larvae. During the first week, 100 larvae were placed in the tank, with an additional 100 added every week, up to a maximum daily amount of 500 larvae. The length and weight of the fish were measured at the beginning and end of every week. RESULTS: A total of 369,000 larvae were used. The Trichogaster trichopteros was the only species in which both sexes ate 100% of the available larvae. The Betta splendens failed to eat only 15 larvae. The male Poecilia reticulate showed a strong capacity for larvae eating, compared with the female of the same species. In terms of weight and size, the Betta splendens proved capable of eating 523 larvae per gram of weight per day. CONCLUSIONS: The female and male Trichogaster trichopteros and Astyanax fasciatus, and the female Betta splendens and Poecilia sphenops proved to be the most effective predators of the Aedes aegypti larvae. And although the male Poecilia sphenops and female Poecilia reticulata were less effective, they were also capable of eradicating the total number of Aedes aegypti larvae that could appear over 24 hours in a breeding site under natural conditions. The male Poecilia reticulata, however, proved incapable of doing so.

  17. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo

    Maria A Medeiros

    2009-09-01

    Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

  18. Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests

    Marcelo Gustavo Ruiz

    2008-12-01

    Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative effects on the survival of N. californicus. Azimphos-methyl was the pesticide that least affected the survival of the predatory mite. Tested insecticides, used in the "Alto Valle del Río Negro y Neuquén" region to control codling moth, C. pomonella, key pest of pip fruit crops, showed low toxicity to N. californicus.

  19. Toxicidade de agroqumicos ao caro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao caro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)

    M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.

    2012-09-01

    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade dos principais agroqumicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de caros fitfagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fmeas adultas do caro predador e 50 fmeas adultas do caro fitfago. Utilizaram-se 13 agroqumicos nas concentraes recomendadas para o controle do caro da leprose. As aplicaes foram feitas por meio de torre de Potter, sendo realizadas quatro repeties para cada tratamento. As avaliaes do nmero de caros vivos e mortos foram observadas 72 horas aps a aplicao. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, xido de fembutatina e deltametrina foram incuos ao N. californicus. Espirodiclofeno no provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, xido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina no foi eficiente no controle do caro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

  20. Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939 e ácaros predadores (Phytoseiidae Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939 and predatory mites (Phytoseiidae

    M.E. Sato

    1995-08-01

    Full Text Available Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939 (AcarirTenuipalpidae e ácaros predadores (Phytoseiidae, em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0, acrinathrin (0,5; hexythiazox (1,5; amitraz (40,0 e enxofre (225,0. Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização.The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939 (Acari,Tenuipalpidae and predatory mites (Phytoseiidae hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0, acrinathrin (0.5, hexythiazox (1.5, amitraz (40.0 and sulphur (225.0. The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

  1. Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests

    Ivan Carlos Corso

    1999-09-01

    Full Text Available Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquisa de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93 e percevejos (4/3/93. A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também n��o foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias.A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993 or the stink bug complex (3/4/1993. Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

  2. Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites

    Alfredo de Gouvea; Carla Felicita Zanella; Sergio Miguel Mazaro; Joel Donazzolo; Luis Francisco Angeli Alves

    2007-01-01

    O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 2002. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas d...

  3. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae

    Daniele Cristine Hoffmann Schlesener

    2013-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

  4. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil

    Noeli Juarez Ferla

    2006-04-01

    Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

  5. Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil

    Márla Maria Marchetti

    2011-06-01

    Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.

  6. Composição faunística de insetos predadores em fragmento florestal e em área de hortaliças na região de Jaboticabal, Estado de São Paulo - DOI: 10.4025/actascibiolsci.v25i2.2015 Faunal composition of predator insects in forest fragment and area of vegetables in Jaboticabal region, state of São Paulo, Brazil - DOI: 10.4025/actascibiolsci.v25i2.2015

    Luciano Kenji Sakemi

    2003-04-01

    Full Text Available Efetuou-se um levantamento populacional em área de fragmento florestal e em área de hortaliças, entre novembro de 1996 a fevereiro/1998, visando determinar as espécies de insetos predadores e a influência de fatores abióticos. A amostragem foi efetuada semanalmente por meio de armadilha luminosa, aplicando-se aos resultados análise faunística e correlação simples com temperatura, umidade relativa e precipitação. No fragmento florestal foi observado maior semelhança na abundância de espécies do que na área de hortaliças, mas neste hábitat capturou-se maior número de indivíduos (95%. As espécies Metius sp., Polpochila impressifrons (Dej., Eulissus sp. e Doru sp. foram predominantes nas duas áreas, evidenciando a importância dessas espécies como predadoras de pragas de hortaliças. Arthrostictus speciosus (Dej. e Leptotrachelus sp. predominaram no fragmento florestal, o mesmo ocorrendo com Paederus sp. na área de hortaliças. Esta espécie deve preferir locais abertos e quentes, enquanto A. speciosus e Leptotrachelus sp. podem estar melhor adaptadas para locais escuros e úmidos de florestasA population survey was carried out in a forest fragment and in an area of vegetables, from November/1996 to February/1998, aiming to determine the predator insect species and the influence of abiotic factors. The samples were taken weekly by light traps. The results were evaluated using faunistic analysis and simple correlation with temperature, relative humidity and rainfall. In the forest fragment higher similarity in the abundance of species was observed comparing to the area of vegetables, but the largest number of captured individuals (95% occurred in this last habitat. Metius sp., Polpochila impressifrons (Dej., Eulissus sp. and Doru sp. were predominant species in both areas, evidencing they may play an important role as pest predators in areas of vegetables. Arthrostictus speciosus (Dej. and Leptotrachelus sp. predominated in the forest fragment, and the same was observed with Paederus sp. in the vegetable area. This species is probably adapted for open and hot places, while A. speciosus and Leptotrachelus sp. can be adapted for dark and humid places of forests

  7. Seletividade fisiolgica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro

    GUSMO MARCOS RAFAEL

    2000-01-01

    Full Text Available Estudou-se, em laboratrio, a seletividade dos inseticidas clorpirifs, deltametrina, dimetoato, ethion, monocrotofs e permetrina s vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentraes que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Gurin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas no foram seletivos s vespas predadoras. A ordem crescente de tolerncia das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifs, deltametrina, dimetoato, monocrotofs e permetrina apresentaram semelhante toxicidade s vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.

  8. Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae occurrence in Rio de Janeiro coast, Brazil

    Lydia M. S. Oliveira

    2006-12-01

    Full Text Available Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia.The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia.

  9. Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) occurrence in Rio de Janeiro coast, Brazil

    Lydia M. S. Oliveira; Lídia M.Y. Oshiro

    2006-01-01

    Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia).The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Al...

  10. Aplicao de formulao do fungo predador de nematides Monacrosporium thaumasium (Drechsler, 1937 no controle de nematides de bovinos

    Alves P.H.

    2003-01-01

    Full Text Available A viabilidade de uma formulao do fungo Monacrosporium thaumasium (Drechsler, 1937 foi avaliada no controle biolgico de nematides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestias Holands Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulao granulada de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com incio na estao chuvosa (outubro, 2001. No grupo B (controle, as bezerras no receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P<0,05 do que as do grupo A e a diferena entre o OPG dos animais dos grupos A e B, no final do experimento, foi de 88,8%. O gnero Cooperia foi o mais prevalente em ambas as pastagens. Conclui-se que a aplicao de pellets de M. thaumasium na dosagem e periodicidade de aplicao usadas foi eficiente no controle de nematides parasitos gastrintestinais de bovinos.

  11. Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

    Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny

    2012-01-01

    Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransfera...

  12. Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010

    Héctor Guerra Hernández

    2014-06-01

    Full Text Available Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório.

  13. Seletividade de agroqumicos ao caro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)

    Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.

    1998-06-01

    Full Text Available Testes de efeito adverso de agroqumicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratrio, utilizando o mtodo residual de contato com pulverizao em superfcie de vidro. Foram testados 42 produtos qumicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reproduo do caro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao caro (combinao da mortalidade e efeito na reproduo) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram incuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidrxido de cobre, naled, oxicloreto de cobre, xido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao caro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, leo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

  14. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Rodolfo Vargas Castilhos

    2011-03-01

    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.

  15. Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae

    MARCELO FIALHO DE MOURA

    2000-02-01

    Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae. Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90 calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris.Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveirae (Hymenoptera: Vespidae was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90 of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

  16. Inducers of resistance in potato and its effects on defoliators and predatory insects Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores

    FRANSCINELY APARECIDA DE ASSIS

    2012-06-01

    Full Text Available The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised complete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM; and 4 - 1.15% diatomaceous earth (DE. Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM, y 4 - 1,15% tierra de diatomeas (DE. Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo.

  17. Seletividade de agrotxicos utilizados em pomares de pssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grtzmacher; Dori Edson, Nava; Moiss Joo, Zotti; Paulo Ricardo Baier, Siqueira.

    2011-03-01

    Full Text Available A seletividade de dezesseis agrotxicos utilizados na produo integrada e convencional de pssego foi avaliada sobre a fase adulta de Chrysoperla externa atravs de bioensaios de exposio residual conduzidos em laboratrio (temperatura de 251C, umidade relativa 7010% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), leo mineral 1 (2,420), leo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram incuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 251C, relative humidity 7010% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

  18. Seletividade de alguns agrotxicos em uso na citricultura ao caro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.

    2006-08-01

    Full Text Available Objetivou-se avaliar o efeito dos principais agrotxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condies de laboratrio, por tratar-se de um fitosedeo com grande potencialidade para ser utilizado no controle dos caros fitfagos na cultura. O mtodo de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pra, contendo 25 fmeas adultas de N. californicus procedentes de uma criao-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do caro 72 horas aps a aplicao e o efeito dos produtos na viabilidade dos ovos. Quanto seletividade, conforme proposta da "Organizao Internacional para o Controle Biolgico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 incuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotxicos, o que viabiliza sua utilizao, juntamente com produtos qumicos pertencentes a grupamentos distintos e de diferentes mecanismos de ao, o que atende a um manejo adequado de controle dos principais caros fitfagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

  19. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Rodolfo Vargas Castilhos

    2011-03-01

    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

  20. Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions

    Luciano Pamplona de Góes Cavalcanti; Ricardo José Soares Pontes; Ana Cláudia Ferreira Regazzi; Francisco José de Paula Júnior; Rodrigo Lins Frutuoso; Emanuel Primos Sousa; Fábio Fernandes Dantas Filho; José Wellington Oliveira Lima

    2007-01-01

    OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada ca...

  1. Ácaros predadores (Acari) em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil Predators mites (Acari) in native and cultivated plants of the State of Rio Grande do Sul, Brazil

    Noeli Juarez Ferla; Gilberto José de Moraes

    2002-01-01

    This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the samp...

  2. Durao do perodo ninfal e sobrevivncia do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae, em trs presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae, in three alternative preys

    Jos Cola Zanuncio

    1993-01-01

    Full Text Available Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae catterpilars; T2 - Musca domestica (Diptera, Muscidae larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae larva. Longevity and survival were: 22,10,6 days and 54,35,3%; 25,21,3 days and 56,04,9% and 22,00,8 days and 34,68,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

  3. Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests; Efeito de doses e de refugio sobre a seletividade de inseticidas a predadores e parasitoides de pragas de soja

    Corso, Ivan Carlos; Gazzoni, Decio Luiz; Nery, Manoel Eugenio [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja]. E-mail: gazzoni@cnpso.embrapa.br

    1999-09-15

    A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the EMBRAPA-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvet bean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed. (author)

  4. Sustainable harvest of two large predatory catfish in the Cuiab river basin, northern Pantanal, Brazil Pesca sustentvel de dois grandes bagres predadores na bacia do Rio Cuiab, Pantanal norte, Brasil

    JMF. Penha; LAF. Mateus

    2007-01-01

    Fishery is an important economic activity in the Pantanal. Among the regions species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiab river and landed at the "Antnio Moyss Nadaf" Market in the Cuiab city, Mato Gr...

  5. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematides Monacrosporium thaumasium

    Jackson Victor de Arajo

    2004-04-01

    Full Text Available The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control, the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000. In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (PA viabilidade de uma formulao do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biolgico de nematides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotao de 1,6 animal/hectare. No grupo 1 (controle, os bezerros no receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um perodo de seis meses que comeou na estao chuvosa (23 de outubro, 2000. No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo perodo do grupo 2, assim como dois tratamentos estratgicos com ivermectina (200 mcg/kg em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P< 0,01 do que os animais dos grupos 2 e 3 e a diferena no final do experimento foi prxima de 100%. Os OPGs dos animais do grupo 4 permaneceram altos at o primeiro tratamento estratgico com ivermectina. Os resultados do grupo 1 e 4 diferiram significativamente (P< 0,05 daqueles dos grupos 2 e 3 a partir de dezembro de 2000. Concluiu-se que a aplicao de pellets de M. thaumasium nesta dosagem e periodicidade de aplicao tornaram os tratamentos anti-helmnticos desnecessrios.

  6. Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados

    Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail: r.franco@bioagri.com.br; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail: paulo.rebelles@epamig.ufla.br; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail: zacarias@epamig.ufla.br; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)

    2010-01-15

    Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

  7. Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)

    RAGUSA-NETTO J.

    2000-01-01

    Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed flocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time wit...

  8. ClEST cluster :Cl_singleton0472 [ClEST

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  9. Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae

    Marcos Zatti da Silva

    2006-08-01

    Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

  10. O valor de Mabea fistulifera Mart. (Euphorbiaceae, planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae The value of Mabea fistulifera Mart. (Euphorbiaceae, indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae

    Rodrigo Damasco Daud

    2004-09-01

    Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para comparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I; de 15 a 26 dias (Pólen II e de 30 a 41 dias (Pólen III. A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of their known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I; from 15 to 26 days old (Pollen II and from 30 to 41 days old (Pollen III. The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p < 0.0001 between some treatments: mites fed pollen III of M. fistulifera had higher oviposition than those fed Pollen I and R. communis Pollen III. Mites fed Pollen II of T. angustifolia had higher oviposition rates than those fed pollen III of R. communis. Only females fed pollen of R. communis had negative correlation between oviposition rates and the periods of storage of pollen. The results showed that M. fistulifera pollen is used by E. citrifolius as food and comparable with pollen from T. angustifolia, futhermore, showed great durability when storage at 10ºC.

  11. O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)

    Rodrigo Damasco Daud; Reinaldo José Fazzio Feres

    2004-01-01

    No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para comparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dia...

  12. Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae

    Araújo, J. V.; R.C.L. Assis; A. K. Campos; M.A. Mota

    2006-01-01

    Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A), Monacrosporium sinense (isolado SF 470), Monacrosporium appendiculatum (isolado CGI), Arthrobotrys robusta (isolado I 31), Arthrobotrys cladodes (isolado CG 719) e Duddingtonia flagrans (isolado CG 768) foram avaliados em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05) durante os cinc...

  13. Avaliao de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae

    Renan N. Costa

    2014-06-01

    Full Text Available Os girinos de anuros so elementos importantes das redes trficas de ambientes aquticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfolgicos, comportamentais e/ou fisiolgicos. A impalatabilidade, produzida pelo acmulo de substncias txicas na pele, um mecanismo comum em muitas linhagens de anfbios. No entanto, alguns predadores no so afetados por estas substncias txicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predao. Neste contexto, nosso objetivo foi avaliar se girinos impalatveis de Rhinella ornata (Spix, 1824, podem apresentar mecanismos comportamentais de defesa contra predao na presena de predadores que no so afetados pelas substncias txicas em sua pele. Para testar nossa hiptese, utilizamos dois tipos de predadores aquticos: um heterptero aqutico do gnero Belostoma e uma larva de liblula do gnero Aeshna. Os girinos foram colocados em aqurios com pistas visuais e qumicas dos predadores (experimento de risco direto, somente pistas qumicas (experimento de risco indireto e ausncia completa de sinais de predadores (controle. Em ambos os casos, o comportamento de natao foi observado durante 5 minutos. Durante os experimentos no houve alterao no comportamento de natao dos girinos.

  14. ClEST cluster :Cl_contig0301 [ClEST

    Full Text Available Cl_contig0301 transcription initiation factor iia subunit 2 ... Cimex lectularius nuclear gene 596 T ... GTTGTACACACCAAACTAAAGTTTCATTTTGTTT fw04077 mb18045 2 ... Transcription initiation factor IIA subunit 2 ... [Cam ... ponotus floridanus] EFN74357 2 .9E-61 GO:0003743 GO:0006413 GO:0006357 GO:0006367 ... GO:0005672 ... GO:0003702 ...

  15. ClEST cluster :Cl_contig0419 [ClEST

    Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...

  16. Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae

    Walkymário Paulo Lemos

    2005-11-01

    Full Text Available Attack behavior of the predator Podisus rostralis (Stäl (Heteroptera: Pentatomidae adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack behavior: (1 Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2 Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl (Heteroptera: Pentatomidae tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae. Dez adultos do predador, com 24 horas de idade, foram observados durante duas horas acompanhando-se os seguintes comportamentos de ataque: (1 Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2 Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas.

  17. PUNTOS DE BIFURCACIÓN ZIP EN MODELOS DEPREDADOR PRESA DEGENERADOS

    CARLOS MARIO ESCOBAR CALLEJAS

    2010-01-01

    Full Text Available En el presente artículo de investigación se demuestra que los modelos degenerados del tipo dos predadores compitiendo por una presa que se regenera los cuales son modelados por un sistema tridimensional no lineal de ecuaciones diferenciales y que satisfacen las condiciones planteadas por Butter-Farkas: los puntos de bifurcación que definen la existencia de la bifurcación Zip coinciden aún en el caso en que la respuesta funcional de los predadores son diferentes.

  18. Parasitismo natural em ovos crisopídeos Natural egg parasitism of chrysopids

    Maria Alice de Medeiros

    2009-01-01

    Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os objetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliças, em camp...

  19. Identification of a Bitter-Taste Receptor Gene Repertoire in Different Lagomorphs Species

    Ferreira, Ana M.; Marques, Andreia T.; Fontanesi, Luca; Thulin, Carl-Gustaf; Sales-Baptista, Elvira; Araújo, Susana S.; Almeida, André M.

    2016-01-01

    The repertoires of bitter-taste receptor (T2R) gene have been described for several animal species, but these data are still scarce for Lagomorphs. The aim of the present work is to identify potential repertoires of T2R in several Lagomorph species, covering a wide geographical distribution. We studied these genes in Lepus timidus, L. europaeus, Oryctolagus cuniculus algirus, Romerolagus diazi, and Sylvilagus floridanus, using O. cuniculus cuniculus as control species for PCR and DNA sequencing. We studied the identities of the DNA sequences and built the corresponding phylogenetic tree. Sequencing was successful for both subspecies of O. cuniculus for all T2R genes studied, for five genes in Lepus, and for three genes in R. diazi and S. floridanus. We describe for the first time the partial repertoires of T2R genes for Lagomorphs species, other than the common rabbit. Our phylogenetic analyses indicate that sequence proximity levels follow the established taxonomic classification.

  20. Neuronal representation and processing of chemosensory communication signals in the ant brain

    Zube, Christina

    2008-01-01

    Ants heavily rely on olfaction for communication and orientation and ant societies are characterized by caste- and sex-specific division of labor. Olfaction plays a key role in mediating caste-specific behaviours. I investigated whether caste- and sex-specific differences in odor driven behavior are reflected in specific differences and/or adaptations in the ant olfactory system. In particular, I asked the question whether in the carpenter ant, Camponotus floridanus, the olfactory pathway exh...

  1. Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

    Wernegreen Jennifer J

    2010-12-01

    Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

  2. Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB) after Fungal and Phosphoric Acid Pretreatment

    Mohammad J. Taherzadeh; Muhammad N. Cahyanto; Claes Niklasson; Ria Millati; Siti Syamsiah; Ishola, Mofoluwake M.; Isroi

    2012-01-01

    Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydra...

  3. Modelo matemático para la enfermedad del dengue

    Mosquera, Luis; Perea, Milton

    2012-01-01

    En este artículo describimos la dinámica de transmisión de unserotipo de virus del dengue, incluyendo el control biológico del vector hembra adulto (de Aedes Aegypti) mediante un predador acuático.

  4. DISTRIBUIO DAS POSTURAS, DE LARVAS E DE INIMIGOS NATURAIS DE Oncideres impluviata (Bermar, 1824 (COL.; CERAMBYCIDAE.

    Jos H. Pedrosa-Macedo

    1992-12-01

    Full Text Available Com o objetivo de verificar a distribuio, independente do efeito de cada componente, contou-se posturas, larvas sadias, predadas ou parasitadas de Oncideres impluviata em galhos de bracatinga (Mimosa scabrella Benth.. O levantamento foi realizado no perodo de 1984/85, em Almirante Tamandar, Paran. Para o estudo da distribuio das larvas e de imimigos naturais foi medida a distncia da base do galho at o ponto onde se encontrava cada larva sadia ou parasitada, galeria vazia ou predador. Os resultados demostraram que as larvas se concentram a partir dos 10,0 cm do ponto base do galho, estendendo-se at 40,0 cm, com uma concentrao mxima entre 10,0 e 20,0 cm. Os predadores e parasitas apresentam uma concentrao no coincidente, sendo que os parasitas concentram-se entre 20, e 30,0 cm e os predadores entre 10,0 e 20,0 cm a partir da base. Pelos resultados obtidos conclui-se que as larvas se estabelecem numa posio onde encontram as melhores condies de sobrevivncia, ao passo que os parasitas e predadores esto na depend~encia das condies intrinsecas de cada espcie em funo das condies ideais da fase de desenvolvimento dos hospedeiros ou presas.

  5. On the relation amongst limnological factors and fish abundance in reservoirs at semiarid region / Relao entre caractersticas limnolgicas e abundncia de peixes em reservatrios da regio semirida

    Ronaldo Csar, Gurgel-Loureno; Carlos Alberto de Sousa, Rodrigues-Filho; Ronaldo, Angelini; Danielle Sequeira, Garcez; Jorge Ivn, Snchez-Botero.

    2015-03-01

    Full Text Available Objetivo: Avaliar os possveis padres temporais nictemerais e sazonais na assembleia ctica em relao a aspectos limnolgicos e fatores biticos em dois reservatrios no semirido Nordeste do Brasil. Mtodos Peixes foram amostrados com redes de espera em ciclos nictemerais nos perodos seco e chu [...] voso em dois reservatrios (Paulo Sarasate /PS e Edson Queiroz /EQ). O contedo estomacal das espcies predadoras foi avaliado. As variveis limnolgicas foram submetidas a uma PCA, enquanto suas relaes com a abundncia de peixes foi determinada por uma CCA. Padres temporais relativos abundncia de espcies de peixes foram detectados com nMDS. Resultados Temperatura e oxignio dissolvido segregaram fisico-quimicamente os reservatrios. Nveis de turbidez e clorofila-a diferiram entre os perodos do ano, e a abundncia relativa das espcies diferiram entre os reservatrios. Predadores foram mais abundantes no PS, enquanto detritvoros foram mais abundantes no EQ. Triportheus signatus e Plagioscion squamosissimus foram as espcies mais abundantes em ambos os reservatrios. No geral, a abundncia de predadores foi positivamente relacionada com altas temperaturas e oxignio dissolvido (PS>EQ) e negativamente associada com turbidez. Os padres de atividades de P. squamosissimus no podem ser explicados por flutuaes nas variveis ambientais. Espcies no predadoras tenderam a se agruparem aos vetores clorofila-a, pH e turbidez. Predadores apresentaram dieta mais diversificada no PS de acordo com a disponibilidade de alimento, enquanto predadores no EQ consumiram somente peixe e camaro. Padres nictemerais variaram para algumas espcies dependendo do reservatrio. Em geral, no PS predadores foram mais ativos durante as horas iluminadas do dia, enquanto no predadores foram mais ativos aps o escurecer. Entretanto, no EQ predadores e no predadores mostraram padres nictemerais de atividades similares. Independentemente do reservatrio, predadores foram mais abundantes no perodo chuvoso. Nenhuma tendncia sazonal foi observada para espcies no predadoras. Concluses Diferenas limnolgicas entre PS e EQ influenciaram padres temporais na abundncia das espcies. Abstract in english Aim: To evaluate possible nycthemeral and seasonal temporal patterns in fish assemblage associated with limnological aspects and biotic factors in two reservoirs in semarid Northeastern Brazil. Methods Fish were sampled with gillnets in nycthemeral cycles throughout the dry and rainy season in two [...] reservoirs (Paulo Sarasate/PS and Edson Queiroz/EQ). The stomach contents of the predator species were surveyed. The limnological variables were submitted to principal components analysis, while their relation to fish abundance was determined by canonical correspondence analysis. Temporal patterns in relative fish species abundance were detected with nMDS. Results Temperature and dissolved oxygen levels segregated the reservoirs physico-chemically. Turbidity and chlorophyll-a levels differed between seasons, and the relative abundance of species differed between the reservoirs. Predators were more abundant in PS, while detritivores were more abundant in EQ. Triportheus signatus and Plagioscion squamosissimus were the most abundant species in both reservoirs. In general, predator abundance was positively associated with high temperature and dissolved oxygen (PS>EQ) and negatively associated with turbidity. The activity patterns of P. squamosissimus could not be explained by fluctuations in environmental variables. Non-predators tended to cluster around the vectors chlorophyll-a, pH and turbidity. Predators had a more diversified diet in PS in accordance with food availability, while predators in EQ ate only fish and shrimp. Nycthemeral patterns varied for the same species depending on the reservoir. Generally, in PS predators were more active during daylight hours while non-predators were more active after dark. However, in EQ predators and non-predators displayed

  6. Avaliao de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)

    Renan N., Costa; Fausto, Nomura.

    2014-06-01

    Full Text Available Os girinos de anuros so elementos importantes das redes trficas de ambientes aquticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfolgicos, comportamentais e/ou fisiolgicos. A impala [...] tabilidade, produzida pelo acmulo de substncias txicas na pele, um mecanismo comum em muitas linhagens de anfbios. No entanto, alguns predadores no so afetados por estas substncias txicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predao. Neste contexto, nosso objetivo foi avaliar se girinos impalatveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predao na presena de predadores que no so afetados pelas substncias txicas em sua pele. Para testar nossa hiptese, utilizamos dois tipos de predadores aquticos: um heterptero aqutico do gnero Belostoma e uma larva de liblula do gnero Aeshna. Os girinos foram colocados em aqurios com pistas visuais e qumicas dos predadores (experimento de risco direto), somente pistas qumicas (experimento de risco indireto) e ausncia completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natao foi observado durante 5 minutos. Durante os experimentos no houve alterao no comportamento de natao dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

  7. Zoophytophagy in predatory Hemiptera

    Jorge Braz Torres

    2009-10-01

    Full Text Available Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variability in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase and herbivores taking prey (peptidase.Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sobre enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase e percevejos fitófagos alimentarem de presas (peptidase.

  8. Parasites of cottontail rabbits of southern Illinois.

    Lepitzki, D A; Woolf, A; Bunn, B M

    1992-12-01

    Fifteen species of parasites including Haemaphysalis leporispalustris, Ixodes dentatus, Amblyomma americanum, Cediopsylla simplex, Odontopsyllus multispinosus, Cuterebra sp., Obeliscoides cuniculi, Trichostrongylus calcaratus, Trichostrongylus affinis, Longistriata noviberiae, Dermatoxys veligera, Trichuris sp., Mosgovoyia sp., Taenia pisiformis, and Hasstilesia tricolor as well as coccidia oocysts were collected from 96 cottontail rabbits (Sylvilagus floridanus) confined to a pen in southern Illinois in 1983 and 1984. The diversity of parasites and the intensities of infections were similar to published reports on free-ranging populations. Most variations in parasite abundances were attributable to season. Few lesions were seen in association with parasitism. PMID:1491303

  9. Predao de sementes de leguminosas por bruqudeos (Insecta: Coleoptera na Serra dos Carajs, Par, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajs, Par state, Brazil

    Ceclia Lomnaco

    1994-12-01

    Full Text Available Estudou-se a predao de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predao e a existncia de defesas contra a ao de predadores. Foi constatada a preferncia por sementes de maior tamanho pelo bruqudeo de Bauhinia pulchella, o que pode significar uma adaptao das plantas em ter sementes pequenas que escapem da predao. Em Mimosa somnians, a imprevisibilidade do nmero de sementes viveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimizao da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ao de predadores. A alta resistncia da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecnicas. Existe relao entre o tamanho de sementes e o tamanho de predadores para as espcies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

  10. First record of Aspergillus flavus as a fungal pathogen of reduviid predator, Rhynocoris marginatus (Fab.) (Hemiptera: Reduviidae)

    Kitherian Sahayaraj; Jesu Alexander Borgio; Subramanian Kumar

    2012-01-01

    An entomopathogenic fungus, Aspergillus flavus Raper and Fennell is recorded as a pathogen of reduviid predator, Rhynocoris marginatus (Fab.) (Hemiptera: Reduviidae) in natural agro-ecosystems of Tirunelveli District, Tamil Nadu for the first time. Primeiro registro de Aspergillus flavus como patôgeno de reduviídeo predador Rhynocoris marginatus (Hemiptera: Reduviidae) Resumo. O fungo entomófago, Aspergillus flavus Raper and Fennell é registrado como um patógeno do reduviídeo predad...

  11. Association between Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) and Bidens rubifolia Kunth (Asterales, Asteraceae)

    Hélcio Gil-Santana; Ruy Alves

    2011-01-01

    The association between the assassin bug Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) and the plant Bidens rubifolia Kunth (Asterales, Asteraceae) is related. Associação entre Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) e Bidens rubifolia Kunth (Asterales, Asteraceae) Resumo. Relata-se a associação entre o percevejo predador Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) e a planta Bidens rubifolia ...

  12. Predation on Leptinopterus Hope species (Coleoptera, Lucanidae by three species of Reduviidae (Hemiptera, Heteroptera in the Atlantic Forest, Brazil

    Paschoal Grossi

    2012-06-01

    Resumo. Relata-se a ocorrência de predação natural de Leptinopterus burmeisteri Arrow e Leptinopterus femoratus (Olivier (Coleoptera, Lucanidae, Lucaninae por Zelurus angularis (Stål (Reduviinae, Apiomerus mutabilis Costa Lima, Seabra & Hathaway e Apiomerus nigricollis Stål (Apiomerinae (Hemiptera, Reduviidae no Estado de São Paulo, Brasil. Dados adicionais sobre hábitos predadores de A. nigricollis são apresentados também.

  13. Influence of customized cooking methods on the phenolic contents and antioxidant activities of selected species of oyster mushrooms (Pleurotus spp.).

    Tan, Yee-Shin; Baskaran, Asweni; Nallathamby, Neeranjini; Chua, Kek-Heng; Kuppusamy, Umah Rani; Sabaratnam, Vikineswary

    2015-05-01

    Nutritional value of cooked food has been considered to be lower compared to the fresh produce. However, many reports showed that processed fruits and vegetables including mushrooms may retain antioxidant activity. Pleurotus spp. as one of the edible mushroom are in great demand globally and become one of the most popular mushrooms grown worldwide with 25-fold increase in production from 1960-2009. The effects of three different cooking methods (boiling, microwave and pressure cooking) on the antioxidant activities of six different types of oyster mushrooms (Pleurotus eryngii, P citrinopileatus, P. cystidiosus P. flabellatus, P. floridanus and P. pulmonarius) were assessed. Free radical scavenging (DPPH) and reducing power (TEAC) were used to evaluate the antioxidant activities and the total phenolic contents were determined by Folin-Ciocalteu reagent. Pressure cooking improved the scavenging abilities of P. floridanus (>200 %), P. flabellatus (117.6 %), and P. pulmonarius (49.1 %) compared to the uncooked samples. On the other hand, the microwaved Pleurotus eryngii showed 17 % higher in the TEAC value when compared to the uncooked sample. There was, however, no correlation between total phenolic content and antioxidant activities. There could be presence of other bioactive components in the processed mushrooms that may have contributed to the antioxidant activity. These results suggested that customized cooking method can be used to enhance the nutritional value of mushrooms and promote good health. PMID:25892809

  14. Nestmate recognition in ants is possible without tactile interaction

    Brandstaetter, Andreas Simon; Endler, Annett; Kleineidam, Christoph Johannes

    2008-07-01

    Ants of the genus Camponotus are able to discriminate recognition cues of colony members (nestmates) from recognition cues of workers of a different colony (non-nestmates) from a distance of 1 cm. Free moving, individual Camponotus floridanus workers encountered differently treated dummies on a T-bar and their behavior was recorded. Aggressive behavior was scored as mandibular threat towards dummies. Dummies were treated with hexane extracts of postpharyngeal glands (PPGs) from nestmates or non-nestmates which contain long-chain hydrocarbons in ratios comparable to what is found on the cuticle. The cuticular hydrocarbon profile bears cues which are essential for nestmate recognition. Although workers were prevented from antennating the dummies, they showed significantly less aggressive behavior towards dummies treated with nestmate PPG extracts than towards dummies treated with non-nestmate PPG extracts. In an additional experiment, we show that cis-9-tricosene, an alkene naturally not found in C. floridanus cuticular profile, is behaviorally active and can interfere with nestmate recognition when presented together with a nestmate PPG extract. Our study demonstrates for the first time that the complex multi-component recognition cues can be perceived and discriminated by ants at close range. We conclude that contact chemosensilla are not crucial for nestmate recognition since tactile interaction is not necessary.

  15. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predao

    Cristiano S. de, Azevedo; Robert J., Young.

    2006-03-01

    Full Text Available As atividades humanas tm diminudo as populaes de emas Rhea americana (Linnaeus, 1758) por toda sua rea de distribuio. Reintrodues de emas nascidas em cativeiro tm sido tentadas, mas sem sucesso, uma vez que os indivduos reintroduzidos so mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por vrias geraes podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivncia dos animais reintroduzidos, pesquisadores tm utilizado tcnicas de treinamento anti-predao. O objetivo deste trabalho foi a aplicao de treinamento anti-predao em emas nascidas em cativeiro e avaliao de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em trs grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predao e quatro testes-controle com cada grupo. O teste anti-predao consistia em parear um modelo taxidermizado de predador (ona-pintada) ou um predador real (cachorro domstico) com uma simulao de captura. Os testes-controle consistiram na apresentao do modelo do predador (ona empalhada) s aves, depois do treinamento, mas sem a associao com o estmulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenas individuais evidentes em resposta ao treinamento anti-predao. Os resultados demonstraram que o treinamento anti-predao pode ser uma ferramenta valiosa para futuros projetos de reintroduo envolvendo emas. Alm disso, os mtodos empregados nesta pesquisa podem ser aplicados a outras espcies de aves no-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

  16. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação

    Cristiano S. de Azevedo

    2006-03-01

    Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

  17. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia

    Mueller Martin J

    2007-10-01

    Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.

  18. Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.], in Presidente Prudente, State of São Paulo, Brazil

    Sônia Maria Nalesso Marangoni Montes

    2010-06-01

    Full Text Available Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas.This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

  19. Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi

    MONTEIRO LINO B.

    2002-01-01

    Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores Agropastoril (Agriflor, em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução.

  20. POSSVEL ASSOCIAO PODISUS NIGRISPINUS E ESPCIES DE TRICHOGRAMMA EM UM PROGRAMA DE CONTROLE BIOLGICO EM FLORESTAS? IS THE ASOCIATION OF PODISUS NIGRISPINUS AND SPECIES OF THE TRICHOGRAMA POSIBLE IN PROGRAMS OF BIOLOGICAL CONTROL IN FORESTS?

    Anderson Mathias Holtz

    2006-08-01

    Full Text Available Tm-se buscado alternativas para o controle de pragas no setor florestal. Uma possibilidade a utilizao do controle biolgico com predadores e parasitides. O objetivo deste trabalho foi avaliar o parasitismo de diferentes espcies de Trichogramma em ovos de P. nigrispinus. Foram colados em retngulos de cartolina azul celeste 15 ovos, de P. nigrispinus, com um dia de idade. Foram utilizados ovos de uma mesma postura em cada tratamento. As cartelas contendo os ovos do predador foram expostas ao parasitismo de fmeas de cinco espcies de Trichogramma por 24 horas. Como testemunha, foram utilizados ovos de P. nigrispinus que no foi submetido a presena do parasitide. No houve emergncia de adultos do parasitide oriundos desses ovos e a viabilidade no foi afetada por nenhuma das cinco espcies utilizadas. O predador P. nigrispinus e o parasitide Trichogramma podem ser utilizados em programas de controle biolgico.Alternatives for the control of pests in forest sectors have been searched. A possibility is the use of the biological control with predators and parasitoids. The objective of this work was to evaluate the parasitism of different Trichogramma species in P. nigrispinus egges. For each treatment fifteen P. nigrispinus egges, of the same posture, with one day of age, were agglutinated in rectangles of celestial blue cardboard. They were exposed to the parasitism of 5 female Trichogramma species for 24 hours. Besides those that underwent the tests, P. nigrispinus egges that were not submitted to the parasitoid presence were used. There were parasitoid adults that originated from of those eggs born and the viability of all of the five species used was not affected. The predator P. nigrispinus and the parasitoid Trichogramma can be used in programs of biological control.

  1. Dinmica trfica, estrategias de consumo y alteraciones seas en la sabana africana: resumen de un proyecto de investigacin etoarqueolgico (1991-1993

    Domnguez-Rodrigo, Manuel

    1994-06-01

    Full Text Available The main results of a broad etho-archaeological research carried out in East Africa are succintly exposed. These provide an accurate explanation of the behavior exhibited by the main savanna and steppe predators with regard fo the process of carcass consumption, thereby creating a referential framework that can be useful for taphonomists. Carnivore behavior is accounted for in terms of its contextual variability, due to the changing selective pressure according to trophic dynamics. Therefore, the adaptive patterns of each predator are discussed and special emphasis is laid on the role played by ecology in shaping their behavior. Initial consumption strategies, bone accumulating agencies and contexts, the predatory range of each predator and bone modification patterns are the main subjects treated. As an innovative complement to these issues, the spatial analysis of bon

    Se exponen los principales resultados de un amplio proyecto de investigacin etoarqueolgica llevado a cabo en frica oriental. Estos sirven de base para la interpretacin del comportamiento de los predadores de sabana y estepa, con respecto al proceso de consumo de sus presas, creando al mismo tiempo un marco referencial de gran utilidad para la Tafonoma. El comportamiento de los carnvoros se explica en trminos de su variabilidad contextual, debida a la modificacin de la presin selectiva segn la dinmica trfica. Por consiguiente, se discuten los principales patrones adaptativos de estos predadores y se pone especial nfasis en el papel jugado por la ecologa en la conducta que exhibe cada uno de ellos. Las principales cuestiones tratadas son las estrategias iniciales de consumo, los agentes y contextos que generan acumulaciones seas, el espectro cinegtico de cada carnvoro y los patrones de alteracin sea. Como complemento innovador a estos temas, se presenta tambin el anlisis espacial de dispersin de restos debido a la accin de los predadores en la desarticulacin y consumo de carcasas.

  2. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate.

    Maria Alice de Medeiros; Edison Ryoiti Sujii; Helena Castanheira de Morais

    2011-01-01

    A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema o...

  3. Papel de la codorniz en la agroecología de malas hierbas (II). Influencia de la digestión en la viabilidad de las semillas

    Guerrero Herrero, Lucía; López Navarro, Pablo; González Redondo, Pedro; Urbano Fuentes-Guerra, José María

    2015-01-01

    El papel de las aves granívoras en la agroecología de las malas hierbas es poco conocido. La codorniz es un ave granívora migratoria frecuente en la campiña española. El objetivo de este trabajo ha sido conocer el potencial predador y dispersor de la codorniz sobre una serie de malas hierbas frecuentes y problemáticas en la agricultura mediterránea. Los resultados obtenidos han permitido demostrar que la codorniz es fundamentalmente predadora de semillas de malas hierbas, eliminando cerca del...

  4. USO DE RECURSOS E DIETA DAS RAIAS DE ÁGUA DOCE (CHONDRICHTHYES, POTAMOTRYGONIDAE) DA RESERVA BIOLÓGICA DO PARAZINHO, AP

    Cecile Souza Gama; Ricardo de Souza Rosa

    2015-01-01

    Elasmobrânquios ocorrem em todos os ecossistemas aquáticos, são predadores dominantes das comunidades onde vivem e desempenham papel importante na transferência de energia entre os níveis tróficos superiores. O objetivo deste trabalho foi conhecer a dieta das espécies de raias encontradas na Reserva Biológica do Parazinho (Amapá), estabelecendo quais os itens preferidos pelo grupo e por cada espécie e o consumo de itens alimentares pela taxocenose ao longo de um ano. As coletas aconteceram de...

  5. Dieta e disperso de sementes por Cerdocyon thous (Linnaeus) (Carnvora, Canidae), em um fragmento florestal no Paran, Brasil Diet and seed dispersal by Cerdocyon thous (Linnaeus) in a forest fragment in Paran (Carnivora, Canidae)

    Vlamir J. Rocha; Nelio R. dos Reis; Margareth L. Sekiama

    2004-01-01

    Embora o cachorro-do-mato, Cerdocyon thous (Linnaeus, 1706), seja um Canidae relativamente comum, no h muita informao sobre sua dieta e seu papel como dispersor de sementes nos diferentes habitats onde ocorre. O objetivo deste trabalho foi o de reportar a dieta de C. thous e sua importncia como dispersor e/ou predador de sementes, e ainda testar a taxa de germinao de sementes aps passar pelo trato digestrio do animal. O estudo foi realizado em um fragmento (680 ha) de Floresta Estaci...

  6. Preferncia alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae em plantas hospedeiras Feeding preference and performance of Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae among host plants

    Roberta R. Coelho

    2009-01-01

    Full Text Available O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae e a relao com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae, caruru, Amaranthus lividus L. (Amaranthaceae e feijo, Phaseolus vulgaris L. (Fabaceae. Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentao. Tambm, o desenvolvimento e a reproduo foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus no demonstrou preferncia para alimentao entre as plantas estudadas. O tempo de alimentao (106 a 115 minutos e ganho de peso (28 a 30% do peso vivo foram similares em relao alimentao em plantas. Entretanto, a longevidade das fmeas foi menor quando mantidas em feijo, comparadas com algodoeiro e caruru. A durao da fase ninfal do predador variou entre as plantas, bem como a produo de descendentes demonstrando menor desempenho sobre plantas de feijo. As ninfas alimentadas, apenas, de plantas no atingiram a fase adulta e viveram at 6,5 dias, sendo maior a sobrevivncia em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus no apresentar seleo da planta hospedeira para alimentao, estas podem contribuir diferentemente na sua histria de vida com destaque para o algodo e o caruru entre as plantas estudadas.The choice between cotton, Gossypium hirsutum L. (Malvaceae, green bean, Phaseolus vulgaris L. (Fabaceae and pigweed, Amaranthus lividus L. (Amaranthaceae and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes and weight gain (28 to 30% of body weight were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

  7. Dieta de Liolaemus ruibali Donoso Barros(Iguania:Liolaeminae en la Reserva de Usos Mltiples Don Carmelo, San Juan, Argentina

    Hctor J. Villavicencio

    2005-01-01

    Full Text Available Se estudi la dieta de Liolaemus ruibali en la reserva de Usos Mltiples Don Carmelo, Provincia de San Juan. Se analizaron los estmagos e intestinos de 12 individuos, determinando el rol de cada presa mediante el clculo del ndice de importancia relativa y la amplitud trfica mediante el ndice de Levins. Hemptera fue la categora alimentaria ms importante. Otra categora alimentaria importante fue Formicidae. La dieta est constituida adems por vegetales (Lycium chanar y Ephedra breana. El anlisis indica que Liolaemus ruibali es un predador pasivo y omnvoro.

  8. Exigências térmicas e tabela de vida de fertilidade de Amblyseius largoensis Thermal requirements and fertility life table of the Amblyseius largoensis

    Andréia Serra Galvão; Manoel Guedes Corrêa Gondim Junior; Gilberto José de Moraes; José Vargas Oliveira

    2008-01-01

    Amblyseius largoensis (Muma) (Acari: Phytoseiidae) é uma espécie de ampla distribuição, ocorrendo em regiões tropicais e subtropicais, freqüentemente associada a plantas perenes, sendo um dos principais predadores de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro (Cocos nucifera L.). O objetivo deste trabalho foi determinar as exigências térmicas de A. largoensis alimentado com uma combinação de Tetranychus urticae Koch (Acari: Tetranychidae), pólen de Ricinus communis L. e mel a ...

  9. Toxicidade diferencial de agrotóxicos utilizados em citros para Neoseiulus californicus, Euseius concordis e Brevipalpus phoenicis

    Marcos Zatti da Silva; Mário Eidi Sato; Carlos Amadeu Leite Oliveira; Débora Soller Rais

    2011-01-01

    Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) é considerada uma das principais pragas em citros no Brasil, devido à transmissão do vírus da leprose dos citros e à necessidade de frequentes aplicações de acaricidas para seu controle. Assim, objetivou-se comparar a toxicidade dos principais agrotóxicos utilizados em citros no Brasil, sobre populações de B. phoenicis e de ácaros predadores das espécies Neoseiuluscalifornicus (McGregor) e Euseius concordis (Chant) (Acari: Phytoseiidae)....

  10. Ecologia e conservação de felinos no pantanal do Brasil

    Porfírio, Grasiela Edith de Oliveira

    2014-01-01

    A rápida conversão dos habitats e a degradação ambiental têm atingido números alarmantes no Pantanal colocando em risco toda a sua biodiversidade. Soma-se a esse cenário o fato do bioma contar com poucas unidades de conservação, que juntas não ultrapassam 10% do território. Os felinos, como predadores, desempenham um papel vital para o bom funcionamento dos ecossistemas, entretanto são espécies que necessitam de grandes áreas, possuem baixas densidades populacionas e, geralmente são demasiada...

  11. A low-cost GPS-GPRS telemetry system for otters: field tests and preliminary data on wild otters

    Martins, Bruno Herlander Mira, 1987-

    2010-01-01

    Os rios europeus, particularmente os do sul da Europa representam um dos habitats com maior riqueza de espécies que, contudo, continuam a sofrer um acentuado declínio, quase sempre devido a actividades humanas. No que diz respeito às populações de lontraeuropeia (Lutra lutra, Linnaeus 1758), sendo um predador de topo destes ecossistemas e com grandes requisitos ecológicos, o impacto sentido nas suas populações, essencialmente pela destruição do seu habitat e consequente diminuição de recursos...

  12. Victimización y nuevas tecnologías : un análisis transcultural de los riesgos de vivir en la era digital

    Ferreira, Fátima Abreu; Martins, Paula Cristina; Gonçalves, Rui Abrunhosa

    2011-01-01

    Introducción: En los últimos años las nuevas tecnologías se convirtieron en parte de la vida cuotidiana de los jóvenes y constituyen un valioso recurso para su desarrollo. El actual uso intensivo de las nuevas tecnologías y el anonimato que ellos ofrecen han creado un tema nuevo de interés para la protección de los niños, ya que los expone a una multitud de riesgos: violencia, bullying, predadores sexuales, entre otros. La falta de supervisión de estas actividades, la escasa legislación exist...

  13. Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predao

    Igor Aurlio Silva

    2008-12-01

    Full Text Available Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per feeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae. We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.Plantas em frutificao atraem visitas freqentes de aves que comem frutos e tendem a ser manchas previsveis para um predador. Conseqentemente, o risco de ataque de um predador aumenta com o tempo de permanncia de uma ave frugvora em uma planta com frutos. Neste estudo, testamos se espcies de aves grandes e crpticas passam mais tempo por visita de alimentao em plantas em frutificao que espcies pequenas e conspcuas. Obtivemos dados da literatura para oito espcies de plantas do Cerrado e tambm de observaes em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae. Procuramos por uma relao positiva entre o tempo mdio de visita e o comprimento total das espcies de aves, considerando a cor das espcies como uma co-varivel. A durao das visitas de espcies grandes e crpticas foi maior que a durao de visitas de aves pequenas e conspcuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes so menos comuns. Aves crpticas, por sua vez, devem ser difceis de serem detectadas por predadores e, conseqentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provm apoio hiptese de que espcies de aves vulnerveis passam menos tempo forrageando em plantas com frutos.

  14. Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas

    Walter S. Evangelista Junior

    2011-06-01

    Full Text Available Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas. Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the interaction of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20% ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.Efeito do gossipol na sobrevivncia e reproduo do percevejo zoofitfago Podisus nigrispinus (Dallas. O gossipol um aldedo sesquiterpeno produzido pelo algodoeiro que confere resistncia contra a herbivoria. A interao deste sesquiterpeno com predadores zoofitfagos, como Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae, inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae e suplementado com solues do gossipol nas concentraes 0, 0,05, 0,10 e 0,20% (peso/volume durante os estgios ninfal e adulto e somente durante o estgio adulto. A durao do estgio ninfal do predador foi em mdia dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentrao (0,20%. Contudo, adultos no foram afetados quando suplementados com gossipol somente durante este estgio. Os resultados demonstram que a ingesto prolongada do gossipol ocasiona efeito no desenvolvimento e reproduo do predador P. nigrispinus, porm somente em concentrao superior quela produzida naturalmente pela planta de algodo.

  15. Efeitos da aplicação de agrotóxicos utilizados na produção integrada de maçã sobre pupas de Chrysoperla externa Effects of pesticides application used in integrated apple production on Chrysoperla externa pupae

    Alexandre Pinho Moura; Geraldo Andrade Carvalho; Olinto Lasmar; Valéria Fonseca Moscardini; Denise Tourino Rezende

    2009-01-01

    Devido à grande importância de Chrysoperla externa (Neuroptera: Chrysopidae) como agente de controle biológico de artrópodes-praga na cultura da macieira no Brasil, avaliaram-se os efeitos dos agrotóxicos (g i.a. L-1) abamectina (0,02), carbaril (1,73), enxofre (4,80), fenitrotiona (0,75), metidationa (0,40) e triclorfom (1,50) em pupas desse predador, oriundas de Bento Gonçalves e Vacaria, Rio Grande do Sul, bem como sobre o desenvolvimento dos adultos obtidos e sua reprodução. A aplicação d...

  16. Ecología trófica y áreas de forrajeo del escúa polar del sur, Stercorarius maccormicki, en dos localidades antárticas

    Santos, María Mercedes

    2014-01-01

    El escúa polar del sur Stercorarius maccormicki, es un predador tope, con una dieta amplia y es considerado como uno de los mejores representantes de especies oportunistas y generalistas entre las aves marinas antárticas. En la época reproductiva, se distribuye en el continente antártico, extendiéndose hacia el norte de la Península Antártica, islas Shetland del Sur e islas Orcadas del Sur. En esta zona se reproduce en simpatría con el escúa pardo S. lonnbergi. Aquí, el escúa pardo monopoliza...

  17. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae) from dry forest in Brazil and new occurrence records for other Heimbrinae

    Daniell Rodrigo Rodrigues Fernandes; Rogéria Inês Rosa Lara; Nelson Wanderley Perioto

    2012-01-01

    The geographic ranges of Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil) of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) is described, illustrated...

  18. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate

    Maria Alice de Medeiros

    2011-01-01

    Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick (Lep.: Gelechiidae está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1 coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2 exposição de ovos sentinelas no campo por 72 horas; 3 ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3, evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate.

  19. NÍVEL DE INFESTAÇÃO DA BROCA DOS CITROS, Diploschema rotundicolle (SERVILLE, 1834) EM CINAMOMO E PLANTAS CÍTRICAS, EM SANTA MARIA - RS

    Dionísio Link; Ervandil Corrêa Costa

    1994-01-01

    RESUMO Aspectos da biologia e frequência de infestação de Diploschema rotundicolle (Serville, 1834) foram estudados em cinamomo e plantas cítricas, em Santa Maria - RS, durante os anos de 1989 e 1990. Há preferência para oviposição em citros. O ciclo evolutivo é maior em citros que em cinamomo. Emergem menos adultos em citros que em cinamomo. Há maior incidência de predadores nas galerias larvais, nas plantas cítricas.

  20. Mites occurrence on Pachira aquatica Aubl. including aspects of external mouthpart morphology of Brachytydeus formosa (Acari: Tydeidae).

    Lorençon, J R; Andrade, S C; Andrade, D J

    2016-02-01

    Pachira aquatica Aubl. is commonly used as an ornamental plant in urban areas of Brazil. The objective of the study was to investigate the occurrence of mites on P. aquatica, with emphasis on Brachytydeus formosa (Cooreman), and to describe aspects the external features of its mouthpart. The study was conducted in 2012 in Jaboticabal, State of São Paulo, Brazil. Ten trees of P. aquatica were selected for the experiment. Approximately 130 leaflets were collected from each tree, which were located in different quadrants (north, south, east, and west) and strata (upper, middle, and lower). The leaflets were placed in paper bags and transported to the laboratory. The mites were prepared on optical microscope slides. A total of eleven species of mites were found, belonging to eight different families. The species and genera of the organisms included B. formosa, Eutetranychus banksi (McGregor), Agistemus sp., Tyrophagus putrescentiae (Schrank, 1781), Brevipalpus phoenicis (Geijskes), Brevipalpus sp., Cheletogenes sp., Iphiseiodes zuluagai Denmark & Muma, Euseius sp., Neoseiulus sp., and only one specimen from the Bdellidae family. The predominant species was B. formosa, with 8,142 mites equally distributed among the four quadrants and mostly in the middle and upper strata of the plant. B. formosa mites from leaflets of P. aquatica were separated for the study of the external mouthpart morphology by scanning electron microscopy (SEM). PMID:26871751

  1. Syllidae (Annelida, Polychaeta) from the Caribbean coast of Venezuela

    Liero-Arana, Ildefonso; Daz Daz, Oscarn

    2011-01-01

    Abstract Venezuela possesses a great variety of coastal environments allowing for a high diversity of marine species. However, systematic studies on marine invertebrates are scarce, especially on polychaetes. The family Syllidae is poorly known, and only 14 genera and 42 species have been reported from this country. A total of 13 genera and 26 species the Syllidae were identified from benthic samples collected on different substrata of the northeastern coast of Venezuela. Of these, seven genera and 16 species constitute new records for Venezuela: Odontosyllis guillermoi, Syllides floridanus, Salvatoria clavata, Salvatoria limbata, Sphaerosyllis longicauda, Parapionosyllis longicirrata, Trypanosyllis parvidentata, Trypanosyllis vittigera, Opisthosyllis sp., Syllis amica, Syllis armillaris, Syllis gracilis, Syllis pseudoarmillaris, Syllis vittata, Parasphaerosyllis indica and Myrianida convoluta. PMID:21998503

  2. Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica

    Cedar I Garca-Ros

    2011-03-01

    Full Text Available Los poliplacforos asociados a los arrecifes de coral en la costa caribea de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de coleccin, localizadas en la Provincia de Limn revel una diversidad de quitones mayor a la documentada. Anteriormente se haban registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aqu por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.

  3. Cuticular Hydrocarbon Pheromones for Social Behavior and Their Coding in the Ant Antenna.

    Sharma, Kavita R; Enzmann, Brittany L; Schmidt, Yvonne; Moore, Dani; Jones, Graeme R; Parker, Jane; Berger, Shelley L; Reinberg, Danny; Zwiebel, Laurence J; Breit, Bernhard; Liebig, Jrgen; Ray, Anandasankar

    2015-08-25

    The sophisticated organization of eusocial insect societies is largely based on the regulation of complex behaviors by hydrocarbon pheromones present on the cuticle. We used electrophysiology to investigate the detection of cuticular hydrocarbons (CHCs) by female-specific olfactory sensilla basiconica on the antenna of Camponotus floridanus ants through the utilization of one of the largest family of odorant receptors characterized so far in insects. These sensilla, each of which contains multiple olfactory receptor neurons, are differentially sensitive to CHCs and allow them to be classified into three broad groups that collectively detect every hydrocarbon tested, including queen and worker-enriched CHCs. This broad-spectrum sensitivity is conserved in a related species, Camponotus laevigatus, allowing these ants to detect CHCs from both nestmates and non-nestmates. Behavioral assays demonstrate that these ants are excellent at discriminating CHCs detected by the antenna, including enantiomers of a candidate queen pheromone that regulates the reproductive division of labor. PMID:26279569

  4. Dicty_cDB: Contig-U09515-1 [Dicty_cDB

    Full Text Available 3( AM086400 |pid:none) Staphylococcus simulans pSCFS4 pla... 41 0.074 ( Q00357 ) RecName: Full=Putative HC-toxin...07( AM238664 |pid:none) Streptomyces ambofaciens ATCC 2... 41 0.097 CP001019_129( CP001019 |pid:none) Coxiel...pid:none) Bacillus cereus subsp. cytotoxi... 48 8e-04 BX248583_225( BX248583 |pid:none) Blochmannia floridanus co...U928167_421( CU928167 |pid:none) Kluyveromyces thermotolerans str... 46 0.002 ( P02980 ) RecName: Full=Tetracycline resistance prot...41( CU928180 |pid:none) Kluyveromyces thermotolerans str... 43 0.020 CP000323_195

  5. Cuticular Hydrocarbon Pheromones for Social Behavior and Their Coding in the Ant Antenna

    Kavita R. Sharma

    2015-08-01

    Full Text Available The sophisticated organization of eusocial insect societies is largely based on the regulation of complex behaviors by hydrocarbon pheromones present on the cuticle. We used electrophysiology to investigate the detection of cuticular hydrocarbons (CHCs by female-specific olfactory sensilla basiconica on the antenna of Camponotus floridanus ants through the utilization of one of the largest family of odorant receptors characterized so far in insects. These sensilla, each of which contains multiple olfactory receptor neurons, are differentially sensitive to CHCs and allow them to be classified into three broad groups that collectively detect every hydrocarbon tested, including queen and worker-enriched CHCs. This broad-spectrum sensitivity is conserved in a related species, Camponotus laevigatus, allowing these ants to detect CHCs from both nestmates and non-nestmates. Behavioral assays demonstrate that these ants are excellent at discriminating CHCs detected by the antenna, including enantiomers of a candidate queen pheromone that regulates the reproductive division of labor.

  6. [Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica].

    García-Ríos, Cedar I; Alvarez-Ruiz, Migdalia

    2011-03-01

    Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulata (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). PMID:21516641

  7. Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia ao longo da costa do estado do Rio de Janeiro, Brasil Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia along the coast of Rio de Janeiro State, Brazil

    Andrea de O. R. Junqueira

    1989-01-01

    Full Text Available In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is characterized by the dominance of Lyrodus floridanus (Bartsch, 1922; Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917 and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

  8. AcEST: DK955481 [AcEST

    Full Text Available yte plasma membrane-associated prote... 37 0.084 sp|Q7VQP1|PURA_BLOFL Adenylosuccinate synthetase OS=Bloch...--DDEPTCGRPLGIR 155 >sp|Q7VQP1|PURA_BLOFL Adenylosuccinate synthetase OS=Blochmannia floridanus GN=purA PE=3...|P92976|STS3_ARATH Strictosidine synthase 3 OS=Arabidopsis tha... 62 2e-09 sp|Q9HDC9|APMAP_HUMAN Adipocyte plasma membrane-assoc...RO Strictosidine synthase OS=Catharanthus rose... 37 0.084 sp|Q9D7N9|APMAP_MOUSE Adipoc... CGRP G+ FN K GD Sbjct: 91 GTTNVEK----CGRPAGIAFNTKTGD 112 >sp|Q9HDC9|APMAP_HUMAN Adipoc

  9. Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica

    Cedar I Garca-Ros

    2011-03-01

    Full Text Available Los poliplacforos asociados a los arrecifes de coral en la costa caribea de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de coleccin, localizadas en la Provincia de Limn revel una diversidad de quitones mayor a la documentada. Anteriormente se haban registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aqu por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.Diversity and microstructure of quitons (Mollusca: Polyplacophora from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limn revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon 1886; S. purpurascens (C.B. Adams 1845; Acanthopleura granulate (Gmelin 1791; Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893. This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889. Rev. Biol. Trop. 59 (1: 129-136. Epub 2011 March 01.

  10. ESPÉCIES DE HISTERIDAE COLETADAS EM PIRACICABA, SP

    S.R. RODRIGUES

    1998-01-01

    Full Text Available Besouros predadores da família Histeridae foram coletados através do uso de armadilhas "pitfall" iscadas com massa fecal fresca de bovinos instaladas em área de pastagem em Piracicaba, SP. Coletaram-se durante o período de 15 de abril de 1995 a 17 de fevereiro de 1996, quatro espécies identificadas como Hister punctifer, Phelister panamensis, P. haemorrhous e P. rufinotus. A espécie P. panamensis é um importante predador de ovos e larvas de Haematobia irritans e representou 72,93% do total de insetos coletados.Histeridae beetles were collected using pitfall traps baited with cattle manure, placed in a pasture area in Piracicaba, SP, Brazil. The following species were collected from April 15th 1995 to February 17th 1996.: Hister punctifer, Phelister panamensis, P. haemorrhous and P. rufinotus. The species P. panamensis, an important predator of the horn fly, Haematobia irritans, represented 72,93% of all insects collected.

  11. Períodos de ausência de presas e estabilidade do controle biológico do ácaro-rajado Periods of prey absence and stability of the spider mite biological control

    Hamilton Oliveira

    2007-08-01

    Full Text Available O objetivo deste trabalho foi avaliar os parâmetros biológicos do ácaro predador Phytoseiulus macropilis na ausência de alimento por períodos de um a seis dias. Foram avaliados: o número de ovos por fêmea ao dia; o número total de ovos; a longevidade de fêmeas; e a razão sexual dos descendentes. Fêmeas que ficaram por mais de três dias sem alimento apresentaram queda em todas variáveis biológicas avaliadas. O predador P. macropilis somente se estabelecerá em campo se as manchas ocupadas pelo ácaro-rajado não estiverem muito distantes umas das outras.The objective of this work was to access the biological parameters of the predator mite Phytoseiulus macropilis in the food absence for periods of one or more days. Data evaluated were: egg number per female per day; total number of eggs; longevity of females; and the offspring sex rate. Female in starvation for three or more days showed decrease in all biological variables. P. macropilis only will settle in the field if patch populations occupied by spider mite are not very distant from each other.

  12. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae from dry forest in Brazil and new occurrence records for other Heimbrinae Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae

    Daniell Rodrigo Rodrigues Fernandes

    2012-12-01

    Full Text Available The geographic ranges of Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.Os limites geográficos de Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 e H. parallela Stage & Snelling, 1986 são estendidos com base no material examinado das coleções entomológicas do Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brasil e do Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brasil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae é descrita, ilustrada e comparada com a única espécie conhecida desse gênero, S. cordobensis Stage & Snelling, 1986. Uma chave para os gêneros de Heimbrinae e para as espécies de Symbra é fornecida.

  13. Controller design techniques for the Lotka-Volterra nonlinear system

    Magno Enrique Mendoza Meza

    2005-06-01

    Full Text Available A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species. In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, that the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinmico no linear em uma ou duas variveis (espcies. Em diversos contextos necessrio introduzir um controle nessas dinmicas. Este artigo foca-se em modelos de duas variveis. Assume-se, de acordo com a praxe em ecologia matemtica, que o controle corresponde remoo de uma proporo da populao dos predadores (controle proporcional. Seis tcnicas de projeto de controladores so aplicados ao modelo Lotka-Volterra, o qual utilizado como um padro ou "benchmark'' para avaliar e comparar estas tcnicas em um contexto ecolgico.

  14. Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil

    WJ. Minto

    2010-02-01

    Full Text Available The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical contact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A predator and kairomones present and B predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A predator and kairomones absent and B the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity and food (algae did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do contato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A predador e "kairomones" presentes e B predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A predador e "kairomones" ausentes e B igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica e alimento (algas não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones".

  15. Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?

    Cristiano S. de Azevedo

    2006-03-01

    Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

  16. The relationship between winter egg counts of the European red mite Panonychus ulmi (Acari: Tetranychidae) and its summer abundance in a reduced spray orchard.

    Bostanian, Noubar J; Hardman, John Michael; Racette, Gaétan; Franklin, Jeffrey L

    2007-01-01

    We studied the relationship between counts of Panonychus ulmi (Koch) winter eggs per bud and mite-days per leaf accumulated in early to mid-summer on 92-96 apple trees in an orchard in Quebec, Canada. Stepwise regression was used to compute mite-days in the 4 year (1992-1995) data set using winter egg density, cumulative rainfall (R), cumulative degree-days (D), squared values of R and of D, and the product RD as potential predictors. Degree-days were accumulated above 10.1 degrees C, the minimum threshold of development for P. ulmi in Eastern Canada. The 4-year model that gave the best fit included terms for winter eggs, rainfall, R2, and the product RD, and explained 76% of the variation in mite-days. When the 4-year model was applied to each year's data separately, winter eggs, adjusted for current year rainfall and degree-days, were always highly significant predictors of mite-days. These significant effects of weather indicate that estimation of potential economic loss should take account of rainfall and heat units, as well as the density of winter eggs. Predators, including the stigmaeid, Agistemus fleschneri Summers, and occasional low numbers of phytoseiids, did not have any evident within-season effect on mite-days but their appearance in July-September of 1994 was followed by a ten-fold decrease in the mean density of winter eggs in 1995 compared with the previous spring. This reduction contrasted with increasing densities each successive spring from 1992 to 1994, which followed summers when predators were scarce or absent. PMID:17611807

  17. Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds

    Walter Santos Evangelista Jnior

    2004-05-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reproduo e sobrevivncia do percevejo predador Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae sob escassez parcial de presas, alimentao em intervalos de trs dias, e ausncia total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos nstares, peso de fmeas, perodo de pr-oviposio e fecundidade foram similares entre as plantas, porm o peso de machos e longevidade de fmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porm no viveram alm do terceiro nstar. A longevidade de fmeas do predador foi favorecida pela presena de A. conyzoides em relao a Gossypium hirsutum, vivendo em mdia 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas no foi suficiente para as fmeas atingirem maturao sexual e produo de ovos, quando submetidas escassez total de presas.This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods under partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third nstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

  18. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Geuza, Cantanhde; Norma Segatti, Hahn; Rosemara, Fugi; der Andr, Gubiani.

    2008-12-01

    Full Text Available O objetivo deste estudo foi investigar alteraes na dieta de um peixe piscvoro (Acestrorhynchus pantaneiro) aps mudanas na abundncia de um peixe forrageiro (Moenkhausia dichroura) durante a colonizao de um reservatrio. Os peixes foram amostrados mensalmente entre maro/2000 e fevereiro/2001 [...] (perodo I) e maro/2003 e fevereiro/2004 (perodo II), no reservatrio de Manso (Mato Grosso, Brasil). A abundncia de M. dichroura foi significativamente diferente entre os perodos, representando 9,6% dos indivduos no perodo I e 66,4% no perodo II. No perodo I A. pantaneiro consumiu 41 presas, enquanto que no perodo II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no perodo I representava apenas 15%. A relao entre o tamanho do predador e da presa foi positiva em ambos os perodos, porm significativamente diferente. No perodo II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura). Os resultados mostraram que A. pantaneiro consumiu, no perodo II, a presa mais abundante e disponvel, alterando a composio de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alteraes provavelmente causaram um decrscimo nos custos energticos associados procura da presa, maximizando o ganho de energia do predador. Abstract in english The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro) following changes in abundance of a forage fish (Moenkhausia dichroura) during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (Stat [...] e of Mato Grosso, Brazil) from March 2000 to February 2001 (period I) and from March 2003 to February 2004 (period II). The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura) in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.

  19. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Geuza Cantanhde

    2008-12-01

    Full Text Available The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro following changes in abundance of a forage fish (Moenkhausia dichroura during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (State of Mato Grosso, Brazil from March 2000 to February 2001 (period I and from March 2003 to February 2004 (period II. The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.O objetivo deste estudo foi investigar alteraes na dieta de um peixe piscvoro (Acestrorhynchus pantaneiro aps mudanas na abundncia de um peixe forrageiro (Moenkhausia dichroura durante a colonizao de um reservatrio. Os peixes foram amostrados mensalmente entre maro/2000 e fevereiro/2001 (perodo I e maro/2003 e fevereiro/2004 (perodo II, no reservatrio de Manso (Mato Grosso, Brasil. A abundncia de M. dichroura foi significativamente diferente entre os perodos, representando 9,6% dos indivduos no perodo I e 66,4% no perodo II. No perodo I A. pantaneiro consumiu 41 presas, enquanto que no perodo II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no perodo I representava apenas 15%. A relao entre o tamanho do predador e da presa foi positiva em ambos os perodos, porm significativamente diferente. No perodo II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura. Os resultados mostraram que A. pantaneiro consumiu, no perodo II, a presa mais abundante e disponvel, alterando a composio de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alteraes provavelmente causaram um decrscimo nos custos energticos associados procura da presa, maximizando o ganho de energia do predador.

  20. Toxicidade de formulaes de nim (Azadirachta indica A. Juss.) ao caro-rajado e a Euseius alatus De Leon e Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae) / Toxicity of neem (Azadirachta indica A. Juss) formulations for twospotted spider mite and Euseius alatus De Leon and Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae)

    Hilda M., Brito; Manoel G.C., Gondim Jr.; Jos V. de, Oliveira; Cludio A.G. da, Cmara.

    2006-08-01

    Full Text Available A toxicidade de formulaes comerciais de nim a Tetranychus urticae Koch (Acari: Tetranychidae) e a dois caros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks) foi estudada. A toxicidade tpica foi avaliada com trs formulaes comerciais (Natuneem, Neemseto e Callneem) e com o [...] extrato de sementes de nim, todos na concentrao de 1%, em comparao ao acaricida padro, abamectina na concentrao de 0,3ml/L e ao tratamento controle com gua destilada. Com base no melhor efeito tpico sobre T. urticae, a formulao Neemseto foi selecionada para avaliar diferentes concentraes sobre ovos, e o efeito residual e repelente sobre adultos desses caros. O tratamento dos ovos consistiu na imerso em diluies de Neemseto por cinco segundos; e o efeito residual e repelente sobre adultos foi avaliado pela imerso de discos de folha nas diluies tambm por cinco segundos. A toxicidade de Neemseto a ovos e adultos foi maior para T. urticae comparada toxicidade observada para os caros predadores. Neemseto foi repelente para T. urticae e E. alatus, quando testados nas concentraes 0,25; 0,50 e 1,00%, mas no afetou P. macropilis. A fecundidade de T. urticae foi reduzida significativamente por Neemseto em todas as concentraes, enquanto para os caros predadores, reduo significante na fecundidade foi observada apenas nas maiores concentraes. Assim, nas formulaes testadas, Neemseto foi o mais eficiente para o caro-rajado e provocou, relativamente, menor impacto aos caros predadores estudados. Abstract in english The toxicity of selected commercial formulations of neem on Tetranychus urticae Koch (Acari: Tetranychidae) and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) was studied. Topical toxicity was tested with the commercial formulations (Natuneem, Neemseto and Callneem) a [...] nd extract of neem's seeds at concentration 1%, compared to the standard acaricide abamectin at concentration of 0.3 ml/L and the control treatment (distilled water). Based on the best performance against T. urticae through topical contact, the formulation Neemseto was selected to be evaluated using different concentrations against eggs, and residual and repellent effects on adults of the mites. Egg treatment consisted of dipping eggs into Neemseto dilutions and control treatment for five seconds. In addition, residual and repellent effects of Neemseto for adult mites consisted of using leaf discs dipped into the dilutions for five seconds. The toxicity of Neemseto on eggs and adults was greater for T. urticae compared to the toxicity observed for the predatory mites. Neemseto was repellent for T. urticae and E. alatus when tested at the concentrations of 0.25, 0.50 and 1.0%, and did not affect P. macropilis. Neemseto using all concentrations, while for the predatory mites significant reduction of mite fecundity was only observed at the largest concentrations reduced the fecundity of T. urticae significantly. So Neemseto, among tested neem formulations, performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites studied.

  1. Toxicidade Diferencial de Agroqumicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro / Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry

    MRIO E., SATO; MARCOS DA, SILVA; LEANDRA R., GONALVES; MIGUEL F. DE, SOUZA FILHO; ADALTON, RAGA.

    2002-07-01

    Full Text Available Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroqumicos a populaes de caros das espcies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fmeas adult [...] as de N. californicus foram tratadas atravs de pulverizao direta utilizando torre de Potter. O caro predador N. californicus mostrou tolerncia igual ou superior a T. urticae a diversos produtos, em condies de laboratrio. A maior diferena foi observada para o acaricida propargite, para o qual o caro predador mostrou-se 25,1 vezes mais tolerante que o caro rajado. Este fitosedeo tambm se mostrou 4,7; 2,9 e 2,5 vezes mais tolerante que o caro rajado, a clorfenapir, fempiroximate e ciexatim, respectivamente. No teste de toxicidade residual de agroqumicos, a pulverizao foi realizada em canteiros de morango. Foram coletados fololos em diferentes perodos aps a aplicao e infestados artificialmente com fmeas adultas de N. californicus. As avaliaes de mortalidade foram realizadas 48h ou 72h aps a infestao. Fempiroximate, fempropatrim, dimetoato, propargite, enxofre e benomil mostraram-se incuos a N. californicus. Clorfenapir, ciexatim e abamectim foram significativamente prejudiciais ao caro predador causando mortalidades iniciais entre 37,5% e 57,5%. A utilizao de caros predadores como desta populao de N. californicus, que apresenta baixa suscetibilidade a diversos agroqumicos, poderia ser muito til em programas de manejo de T. urticae em morangueiro no Brasil Abstract in english This work aimed to evaluate the differential toxicity of pesticides to populations of the mite species Neoseiulus californicus (McGregor) and Tetranychus urticae Koch collected from commercial crops of strawberry (Fragaria sp.) in Atibaia county, State of So Paulo, Brazil. In the test of acute toxi [...] city of pesticides, adult females of N. californicus received the pesticide treatment under Potter spray tower. The predaceous mite N. californicus showed the same or higher tolerance than T. urticae to various pesticides in laboratory. The highest difference was observed to the acaricide propargite, for which the predaceous mite was 25.1 times more tolerant than the two-spotted spider mite. This phytoseiid was also 4.7, 2.9 and 2.5 times more tolerant than T. urticae to chlorfenapyr, fenpyroximate, and cyhexatin, respectively. In the test of residual toxicity of pesticides, the chemicals were sprayed on plants of strawberry in the field. Leaves were collected after different periods from the treatment and artificially infested with adult females of N. californicus. The mortality was assessed 48h or 72h after treatment. Fenpyroximate, fenpropathrin, dimethoate, propargite, sulphur, and benomyl were innocuous to N. californicus. Chlorfenapyr, cyhexatin, and abamectin were significantly harmful to the predaceous mite causing initial mortality rates between 37.5% and 57.5%. The use of predaceous mites like of this population of N. californicus, which presents low susceptibility to various pesticides can be very useful for programs of management of T. urticae on strawberry in Brazil.

  2. Toxicidade residual de alguns agrotxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor) (Acari: phytoseiidae)

    Marcos Zatti da, Silva; Caralos Amadeu Leite de, Oliveira.

    2007-04-01

    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotxicos utilizados em citros sobre Neoseiulus californicus (McGregor) em condies de laboratrio. O mtodo de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pra, acondicionadas em arenas, foram pulve [...] rizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias aps a aplicao. Em cada arena, foram transferidas dez fmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliaes de mortalidade foram realizadas 72 horas aps a transferncia dos caros para as arenas. Os agrotxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, xido de fenbutatin e propargite no causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para caros N. californicus expostos a resduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos caros predadores expostos aos resduos txicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um perodo inferior a um dia. Resduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por perodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsdio para a escolha adequada dos agrotxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados tambm servem para a escolha do momento mais favorvel para a liberao dos caros predadores dessa espcie no campo, aps a aplicao de agrotxicos nos pomares. Estudos conduzidos em condies de campo ainda so necessrios para se compreender melhor o efeito desses agrotxicos sobre o caro predador. Abstract in english This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor) under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pra" were sprayed in a Potter tower. The produc [...] ts' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  3. Hemiptera acuáticos asociados a los estuarios de la costa pacífica colombiana Aquatic Hemiptera associated to estuaries of the colombian pacific coast

    DORA N. PADILLAGIL; OSVALDO ARCOS P.

    2011-01-01

    la mayoría de los hemípteros acuáticos son insectos predadores que habitan en agua dulce, estuarios y mar. Las familias que incluyen especies de hábitat salobres y estuarios son Gerridae y Veliidae. Con el fin de contribuir al conocimiento faunístico y ecológico de los hemípteros acuáticos asociados a los estuarios de la Costa Pacífica de Colombia y de la región del Chocó biogeográfico, se estudiaron seis estuarios del municipio de Tumaco: El Bajito, El Morro, Villa del Sol, Agua clara, Chilv...

  4. TANINOS CONDENSADOS DE Ephedra breana phil. -EphedraceaE-

    Rafael A. Ricco

    2007-01-01

    Full Text Available Este trabajo aborda el estudio de los taninos condensados (proantocianidinas de Ephedra breana Phil. Se estudiaron comparativamente los extractos metanlicos de los tallos areos herbceos y lignificados. En los tallos herbceos se determin la presencia de prodelfinidina, que se encuentra principalmente bajo la forma de compuestos de alto peso molecular (polmeros, mientras que en los tallos lignificados se detect proapigeninidina (una 3-desoxi-proantocianidina bajo la forma de monmero y oligmeros. Se determinaron diferencias cuali-cuantitativas cuando se compararon los tallos herbceos y lignificados. Se considera que la elevada concentracin de taninos en los tallos herbceos constituye un posible mecanismo de defensa contra los predadores. Por otro lado, debido a su estructura qumica, los taninos condensados presentes en los tallos areos herbceos podran actuar, adems, como agentes antioxidantes.

  5. Mercúrio total em cação comercializado em São Paulo - SP, Brasil

    Isabel C. MORALES-AIZPURÚA; TENUTA-FILHO Alfredo; SAKUMA Alice M.; ZENEBON Odair

    1999-01-01

    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislação, expondo os cons...

  6. Mercúrio total em cação comercializado em São Paulo - SP, Brasil Total mercury contents in shark species commercialized in São Paulo-SP, Brazil

    Isabel C. MORALES-AIZPURÚA; TENUTA-FILHO Alfredo; SAKUMA Alice M.; ZENEBON Odair

    1999-01-01

    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislação, expondo os cons...

  7. DIETA DE ORESTIAS AGASSII (CUVIER & VALENCIENNES, 1846 (TELEOSTEI: CYPRINIDONTIDAE DEL SALAR DEL HUASCO, NORTE DE CHILE DIET OF ORESTIAS AGASSII (CUVIER & VAIENCIENNES, 1846 (TELEOSTEI: CYPRINIDONTIDAE OF "EL HUASCO" SALT LAKE, HIGH ANDES OF NORTHERN CHILE

    Jonathan A Guzmn

    2009-01-01

    Full Text Available Se estudi la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Regin. El contenido estomacal present; ostracodos, anfpodos, coppodos, moluscos, colepteros, caros y algas macrfitas. Los resultados permiten afirmar que O. agassii es un predador carnvoro, que consume una amplia variedad de microcrustaeos que busca activamente entre la vegetacin.The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Dptera, Copepoda, Mollusca, Coleptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore in freshwater communities of the South-American altiplano.

  8. Plantas de ocorrência espontânea como substratos alternativos para fitoseídeos (Acari, Phytoseiidae) em cultivos de seringueira Hevea brasiliensis Muell. Arg. (Euphorbiaceae) Weeds as alternative substrates to phytoseiids (Acari, Phytoseiidae) in rubber tree Hevea brasilienis, Muell. Arg. (Euphorbiaceae) cultivation

    Marcos Roberto Bellini; Gilberto José de Moraes; Reinaldo José Fazzio Feres

    2005-01-01

    O objetivo deste estudo foi determinar as espécies de plantas espontâneas em áreas de cultivo de seringueira que poderiam servir com reservatório de ácaros predadores. O trabalho foi conduzido em Olímpia, Estado de São Paulo, Brasil, em dois cultivos de seringueira. A cada três meses, cerca de 1.000 cm³ de folhas de cada uma das cinco espécies de plantas espontâneas dominantes em cada cultivo foi tomada para determinar os fitoseídeos. Como as plantas espontâneas dominantes variaram durante o ...

  9. Ecological Roles of Coleoptera Associated with Carcasses in Caatinga

    Wellington Santos

    2013-12-01

    Resumo. O papel ecológico da coleopterofauna associada a carcaças de porcos em uma área de Caatinga foi examinado. Para captura desses insetos foram utilizadas armadilhas do tipo bandeja, pitfall e Shannon modificada, durante duas estações (seca e chuvosa. 4.851 coleópteros foram coletados, pertencentes a 19 famílias e 88 espécies. A categoria ecológica mais abundante foi predador/parasita (72,7%, seguida por onívoro (15,1%, necrófago (10,9% e incidental (1,3%. Futuros estudos sobre biologia das espécies predadoras/parasitas são necessários para se determinar sua possível utilidade forense na estimativa do intervalo pós-morte.

  10. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae from dry forest in Brazil and new occurrence records for other Heimbrinae

    Daniell Rodrigo Rodrigues Fernandes

    2012-12-01

    Full Text Available The geographic ranges of Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.

  11. Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiolgica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)

    Ana Carolina Maciel, Redoan; Geraldo Andrade, Carvalho; Ivan, Cruz; Maria de Lourdes Corra, Figueiredo; Rafael Braga da, Silva.

    2013-12-01

    Full Text Available Doru luteipes (SCUDDER, 1876) um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservao necessria a utilizao de inseticidas seletivos a S. frugiperda e incuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposio aos resduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas aps o tratamento. Os inseticidas foram classificados segundo ndices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi incuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposio de D. luteipes aos resduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivncia de adultos aps o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram incuos. Devido baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservao dessa espcie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetao e campo para comprovao de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

  12. Distribuição do metal mercúrio em atum (Thunnus albacares) e pescada bicuda (Cynoscion microlepidotus) capturados no litoral do Rio de Janeiro, Brasil Distribution of metal mercury in tuna (Thunnus albacares) and weaker fish (Cynoscion microlepidotus) captured in Rio de Janeiro coast, Brazil

    Medeiros, R.J.; E.T. Mársico; S.C. São Clemente; Ferreira, M. S.

    2008-01-01

    O presente estudo verificou a cinética mercurial em órgãos, tecido muscular e conteúdo estomacal de duas espécies de peixes marinhos predadores, identificando os locais de maior acumulação desse metal. Para o processo analítico, foi utilizada a técnica de espectrofotometria de absorção atômica por arraste de vapor a frio. A distribuição de Hg nas porções analisadas apresenta ampla dispersão. Para o atum, a variação foi de 0,004 µg.g-1 no fígado, nas brânquias e baço, e 0,172µg.g-1 no tecido m...

  13. Uso de recursos alimentares por peixes imaturos e adultos de espcies piscvoras em uma plancie de inundao neotropical / Use of food resources by juveniles and adults of piscivorous fish species in a neotropical floodplain

    Andr Nogueira, Bozza; Norma Segatti, Hahn.

    2010-09-01

    Full Text Available Este estudo teve como objetivo avaliar o uso dos recursos alimentares por indivduos imaturos e adultos de Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis, da plancie de inundao do alto [...] Rio Paran, coletados trimestralmente entre maro de 2007 e dezembro de 2008. Foi avaliada a composio quantitativa da dieta atravs da obteno do volume das presas (% volume) e amplitude de nicho trfico de cada uma das espcies, bem como as inter-relaes trficas entre elas, atravs da similaridade entre as dietas e tamanho das presas. A dieta das seis espcies foi composta por peixes-presa (42 espcies), crustceos e insetos, sendo que todas elas, com exceo de P. corruscans, mostraram alteraes ontogenticas. A amplitude de nicho foi maior para H. aff. malabaricus adultos e menor para P. corruscans adultos e P. squamosissimus imaturos. A similaridade na dieta foi maior para aquelas espcies que consumiram Characidae e menor para P. squamosissimus imaturos, os quais consumiram preferencialmente crustceos. Houve correlao positiva entre o tamanho da presa e do predador, porm cada espcie consumiu presas de tamanhos diferentes, mostrando que elas no so correlacionadas. Os resultados demonstraram que as seis espcies consumiram peixes desde as fases imaturas, porm com pouca similaridade intra e inter-especfica na dieta para a maioria delas, e que o tamanho das presas consumidas aumentou em relao ao tamanho do predador e foi varivel entre as espcies. Assim, a dieta dos predadores depende da distribuio e colonizao das espcies-presas no ambiente, morfologia e comportamento alimentar tanto das presas quanto dos predadores. Abstract in english The aim of this study was to evaluate the use of food resources by juveniles and adults of Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis from the upper Paran River floodplain, sampled q [...] uarterly between March 2007 and December 2008. The quantitative trophic composition was obtained by prey volume (% volume) and diet niche breadth of each piscivorous species, as well as trophic relationships among them through diet similarity and prey size. The diet of the species was composed of fish-preys (42 species), crustaceans and insects, with ontogenetic diet changes, except to P. corruscans. The niche breadth was high to H. aff. malabaricus adults and low to P. corruscans adults and P. squamosissimus juveniles. Diet similarity was high to Characidae species consumers and low to P. squamosissimus juveniles, which consumed mainly crustaceans. Positive correlation was found between prey and predator size, however, each piscivorous species consumed different prey sizes, showing no correlation among them. Results showed that the six species consumed fish since juveniles, however, with low diet similarity intra and inter specific to most of them, and the prey size consumed increased in relation to predator size and varied among species. Thus, the piscivorous species diet depends of prey species distribution and colonization, morphology and feeding behavior of the prey as well as the predator.

  14. Colonization of artificial substrata by teredinid larvae released from a previously infested focus at Ilha Grande Bay, RJ

    Ricardo Silva Varotto

    1998-08-01

    Full Text Available The colonization pattern of wooden panels by teredinid larvae released from a previously infested focus was investigated. Panels were placed at different distances (1, 10, 20m and in different directions from the focus. The colonization experiment took place at Parcel do Aleijado, Ilha Grande Bay, RJ. The focus remained immersed in nearly surface water, by the coast, during three months for infestation by teredinids. After this period, it was transferred to the study site. The infested focus and colonization panels remained in water, 10m deep, for three months more. Total density and density of the dominant species were considered for each group of panels. Five teredinid species were found: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. The dominant species was Teredo furcifera (76.6%. Significant differences were only observed between directions for total teredinids and for dominant species density. Results concerning the dominant species Teredo furcifera were even more expressive and suggested the occurrence of a local water circulation pattern.Foi estudado o padrão de colonização de larvas de teredinídeo liberadas a partir de um foco previamente infestado. Coletores foram posicionados a diferentes distâncias (1m, 10m, 20m e em diferentes sentidos a partir do foco. O experimento de colonização foi realizado junto ao Parcel do Aleijado, Baía da Ilha Grande, RJ. O foco permaneceu imerso próximo à superfície, junto à costa, durante 3 meses para infestação por teredinídeos. Após este período, foi tranferido para a área de estudo. O foco infestado e os coletores permaneceram imersos, a 10m de profundidade, por mais 3 meses. Foram consideradas a densidade total e a densidade da espécie dominante para cada grupo de coletores. Foram encontradas 5 espécies de teredinídeos: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. A espécie dominante foi Teredo furcifera (76,6%. Diferenças significativas foram observadas somente entre os diferentes sentidos, para o valor total de teredinídeos e para a densidade da espécie dominante. Os resultados envolvendo a espécie dominante Teredo furcifera foram ainda mais expressivos e sugerem a ocorrência de um padrão local de circulação de água.

  15. The effect of low salinity on teredinids

    Cristine C. Barreto

    2000-01-01

    Full Text Available Teredinids survival in low salinities was determined in aquaria. Panels previously immersed in Ponta de Leste, Ilha Grande Bay, Rio de Janeiro, were transferred to aquaria with salinities ranging from 5.0 to 15.0 Practical Salinity Unities (PSU. The waters of Ilha Grande Bay receive a large amount of wood from the marginal rainforest vegetation, being suitable for the development of teredinids. The coastal areas of the bay are subjected to wide salinity fluctuations due to strong and sudden tropical storms. Eleven different species of teredinids were found in the panels. The critical salinity concentration for the survival of the two most common species was 11.93 PSU for Lyrodus floridanus and 12.90 PSU for Teredo furcifera. The effect of time on the mortality of teredinids at low salinities is also discussed.A sobrevivência de moluscos bivalves perfurantes de madeira da família Teredinidae foi avaliada a partir de sua manutenção em aquários de baixa salinidade. Painéis de madeira previamente imersos em Ponta de Leste, Baía da Ilha Grande, RJ, foram transferidos para aquários, contendo água do mar, cujas concentrações salinas variaram de 5,0 a 15,0 PSU. A Baía da Ilha Grande recebe uma grande quantidade de madeira da vegetação marginal de Mata Atlântica, o que torna o ambiente particularmente favorável ao desenvolvimento de teredinídeos. As áreas costeiras da baía estão sujeitas a grandes variações salinas decorrentes de tempestades tropicais que ocorrem súbita e intensamente. A salinidade crítica à sobrevivência das duas espécies mais comuns nos painéis foi de 11,93, para Lyrodus floridanus e 12,90 para Teredo furcifera. O efeito do tempo na mortalidade dos teredinídeos, quando sujeitos a baixas salinidades, foi discutido.

  16. A new rabbit species (sylvilagus, Mammalia: leporidae from the lowlands of venezuela

    Pedro Durant

    2001-03-01

    Full Text Available A new species of Venezuelan rabbit of the genus Sylvilagus from Fundo Millano (08º 46'N and 69º 56'W and Chorrosco Bajo (08º 05'N and 69º 18'W, between 190 and 120 masl, state of Barinas, is described based on: 1. Body and skull measurements. 2. Coloration patterns of the pelage. 3. Arrangement and length of the color hair bands of dorsal, lateral, ventral nuchal, and gular patches. Body and cranial measurements, and some color patterns of the new species, Sylvilagus varynaensis, were compared with those of the closest relative groups such as S. brasiliensis (from Venezuela and Brazil, S. b. meridensis from the Venezuelan paramos, and three of the most representative groups of S. floridanus (S. f. continentis, S. f. orinoci, and S. f. valenciae. Most of the values recorded for these parameters were significally higher for the new species (P Se describe una especie nueva de conejo silvestre de Venezuela procedente del Fundo Millano (08º 46’ N y 69º 56’ W entre 120 y 180 m de altitud y Chorrosco Bajo (08º 05'N and 69º 18'W, entre 190 y 120 de altitud, en el estado Barinas. La descripción se basó en: 1. Medidas corporales y craneales. 2. Patrones de coloración del pelaje. 3. Organización y longitud de las bandas de color del pelo de las regiones dorsal, lateral, ventral, nucal y mancha gular. Las medidas corporales, craneales y algunos de los patrones de coloración de la nueva especie, Sylvilagus varynaensis, fueron comparados con las de los grupos más cercanos, como S. brasiliensis (de Venezuela y de Brasil, S. b. meridensis de los páramos venezolanos y tres de los grupos más representativos de S. floridanus (S. f. continentis, S. f. orinoci, S. f. valenciae. La mayoría de los valores registrados en estas medidas fueron significativamente más altos (P < 0.005; "t" de Student en la nueva especie de conejo. El Análisis de Componentes Principales y de Agrupación de los datos registrados para las características craneales indicaron que S. varynaensis es el conejo silvestre de mayor tamaño de Venezuela, de coloración más oscura, de cráneo más alargado y con arreglo diferente de las bandas de color del pelo en varias regiones corporales.

  17. First record of the fireworm Hermodice carunculata (Annelida, Polychaeta) preying on colonies of the fire coral Millepora alcicornis (Cnidaria, Hydrozoa) / Primeiro registro do verme de fogo Hermodice carunculata (Annelida, Polychaeta) predando colnias do coral de fogo Millepora alcicornis (Cnidaria, Hydrozoa)

    Carlos Daniel, Prez; Paula Braga, Gomes.

    2012-06-01

    Full Text Available O poliqueta Hermodice carunculata um voraz predador de vrios organismos bentnicos e um dos grupos preferenciais na sua dieta o dos cnidrios. No presente trabalho se apresenta o primeiro registro de predao do verme de fogo sobre o hidrocoral Millepora alcicornis. O verme engolfa os ramos ter [...] minais do hidrocoral e fica vrios minutos raspando a superfcie e retirando os tecidos moles. Apesar deste hidrocoral ser um dos representantes mais comuns dos recifes do norte e nordeste brasileiros e de albergar uma vasta comunidade associada, nunca tinha sido registrada esta associao. Esta nova descoberta alerta na necessidade de se estudar esta associao j que geralmente os danos ocasionados pelo poliqueta so irreversveis e dependendo da quantidade de predadores pode alterar a sade dos recifes ou modificar os componentes da comunidade recifal. Abstract in english The polychaete Hermodice carunculata is a voracious predator of several benthic organisms and one of the preferential groups in its diet is that of the cnidarians. This note presents the first record of a fireworm preying on the calcified hydroid Millepora alcicornis. The fireworm engulfs the termin [...] al branches of the fire coral and spends several minutes scraping the surface and removing the soft tissues. Despite this being one of the most common calcified hydroids of the Brazilian northern and northeastern regions (and home to a vast associated community), this kind of association had never been recorded. This discovery points to the need of studying such associations because the damage caused by this polychaete is irreversible and depending on the amount of predators might alter reefs' health or modify the components of the reef community.

  18. Luta biolgica clssica com Hyperaspis pantherina Frsch (Coleoptera: Coccinellidae) no combate Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarand / Biological control with Hyperaspis pantherina Frsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda

    Ana Paula, Flix; Antnio Miguel Franquinho, Aguiar; Celestina, Brazo; Paula, Rocha.

    2008-12-01

    Full Text Available Os jacarands e vrias plantas ornamentais que ornamentam passeios e reas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Qunia, uma joaninha, Hyperaspis pantherina Frsch. Este predador especfico de O. [...] insignis e tem sido utilizado, com sucesso em programas de luta biolgica, em vrios pases de frica, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina est a ser criado em laboratrio e largado em jacarands infestados com o objectivo de combater a cochonilha-dojacarand atravs da luta biolgica clssica. Referem-se as largadas de H. pantherina e o sistema de monitorizao adoptado para verificar a aclimatao do predador. Abstract in english The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal), are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Frsch, was [...] imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

  19. Feeding of Acestrorhynchus lacustris (Characidae: a post impoundment studies on Itaipu reservoir, upper Paran River, PR

    Norma Segatti Hahn

    2000-01-01

    Full Text Available With objective to know feeding spectrum of Acestrorhynchus lacustris (Reinhardt, 1874, a middle size predator in different places of influence area of Itaipu reservoir, stomach contents were analyzed. Samples were collected from March 1984 to February 1989 from Itaipu Reservoir and its adjacent areas. Its fed mainly on fishes, but it was an opportunistic (consumed 17 species of prey. Despite of the wide feeding spectrum, few preys were dominant in the diet, according to the different habitats sampled. As a result, it significant spatial differences in the diet was observed. Was observed through "Detrented Correspondence Analysis" (DCA these were divided into three groups in relation with diet: preys from upstream, with higher scores; preys from the reservoir, with intermediate scores; and preys from a tributary with smaller scores. This discrimination may be a function of prey availability in each habitat. The mean size of preys consumed increased with the size of the predator, as well as the variance, i. e. the largest fish also consumed small preys.Com o objetivo de conhecer o espectro alimentar de Acestrorhynchus lacustris (Reinhardt, 1874, um predador de mdio porte, em diferentes locais da rea de influncia do reservatrio de Itaipu, foram analisados contedos estomacais coletados no perodo de maro/84 a fevereiro/89. Os dados evidenciaram tratar-se de uma espcie exclusivamente piscvora, porm oportunista, visto que consumiu 17 espcies de peixes-presa. Apesar do amplo espectro alimentar, poucas presas se destacaram nos distintos ambientes amostrados, resultando em diferenas significativas entre suas dietas. A anlise de correspondncia (DCA discriminou espacialmente trs grupos; montante, com maiores escores; reservatrio, com valores intermedirios e tributrio com menores valores, provavelmente em funo dos tipos de presas disponveis em cada ambiente. O tamanho das presas ingeridas aumenta com o crescimento do predador, porm os maiores exemplares no descartam peixes de pequeno porte de sua dieta.

  20. Luta biolgica clssica com Hyperaspis pantherina Frsch (Coleoptera: Coccinellidae no combate Orthezia insignis Browne (Homoptera: Ortheziidae em jacarand Biological control with Hyperaspis pantherina Frsch (Coleoptera: Coccinellidae to control Orthezia insignis Browne (Homoptera: Ortheziidae on blue jacaranda

    Ana Paula Flix

    2008-12-01

    Full Text Available Os jacarands e vrias plantas ornamentais que ornamentam passeios e reas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Qunia, uma joaninha, Hyperaspis pantherina Frsch. Este predador especfico de O. insignis e tem sido utilizado, com sucesso em programas de luta biolgica, em vrios pases de frica, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina est a ser criado em laboratrio e largado em jacarands infestados com o objectivo de combater a cochonilha-dojacarand atravs da luta biolgica clssica. Referem-se as largadas de H. pantherina e o sistema de monitorizao adoptado para verificar a aclimatao do predador.The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal, are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Frsch, was imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

  1. Incidência de ácaros em cafeeiro cv. Catuaí Amarelo Mite fauna on coffee plants cv. Catuaí Amarelo

    Jeferson Luiz de Carvalho Mineiro

    2008-01-01

    Full Text Available Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L., no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes (Tenuipalpidae e Oligonychus yothersi (McGregor (Tetranychidae. Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae foi outra espécie muito abundante observada nos ramos.The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L. plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and berries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes (Tenuipalpidae and Oligonychus yothersi (McGregor (Tetranychidae. Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae was also mostly present on branches.

  2. Diet of the chola guitarfish, Rhinobatos percellens (Rhinobatidae), in the Paranagu Estuarine complex

    Wanessa P.D. do, Carmo; Hugo, Bornatowski; Elton C., Oliveira; Lus L., Fvaro.

    2015-06-01

    Full Text Available A raia viola, Rhinobatos percellens, um dos batodeos mais capturados na costa brasileira, e um importante predador da comunidade bntica. Estmagos de R. percellens foram amostrados no complexo estuarino de Paranagu (Maro/2006 a Maro/2007 e Outubro/2008 a Setembro/2009). Os estmagos obtidos [...] foram utilizados para descrever a dieta de R. percellens, e verificar se h diferenas sazonais e ontogenticas em sua alimentao nesta rea estuarina. A anlise geral mostrou uma dieta especializada com a predominncia de trs espcies em seu contedo alimentar: Leptochela serratorbita, restos de Caridea e Ogyrides alphaerostris. Anlises ontogenticas e sazonais no revelaram diferenas significantes no consumo de alimento. Estes dados revelam que R. percellens um predador especialista em L. serratorbita, e este alimento consumido por todas as classes de tamanho. Abstract in english The chola guitarfish, Rhinobatos percellens, is one of the most-captured batoids on the Brazilian coast, and an important predator of benthic community. Stomachs from R. percellens were sampled in the Paranagu estuarine complex (March/2006 to March/2007 and October/2008 to September/2009). The stom [...] achs obtained were used for describing the diet of R. percellens, and verifying if there are seasonal and ontogenetic differences in their feeding into the estuarine area. The general analysis showed a specialized diet with a predominance of three species in food contents: Leptochela serratorbita, Caridea remains and Ogyrides alphaerostris. Ontogenetic and seasonal analysis did not reveal significant differences in the food consumption. These data reveal that R. percellens is a specialist predator of L. serratorbita, and this food component is consumed by all size classes.

  3. Feeding of Pellona flavipinnis (Clupeiformes, Pristigasteridaein a Central Amazonian floodplain Dieta de Pellona flavipinnis (Clupeiformes, Pristigasteridae em plancie alagada da Amaznia Central

    Sandra S. Moreira-Hara

    2009-06-01

    Full Text Available The feeding habits of Pellona flavipinnis (Valenciennes, 1836 at Catalo, a floodplain area on the Brazilian Central Amazon was studied. Data was obtained during three hydrological cycles, between September 1999 and September 2003. Diet composition, daily and seasonal variation in the feeding activity and the relationship between predator's size and its prey were analyzed. Almost 80% of the food consumed has autochthonous origin and diet was composed basically by insects and fish. Juvenile fish predominated in the stomach contents of all size classes but there was no significant relationship between predator's size and its prey. Pellona flavipinnis may be considered a carnivorous species which feeds mainly on juvenile (young-of-the-year specimens of other fish. More intense feeding activity occurred at night and in the high water period.Os hbitos alimentares de Pellona flavipinnis (Valenciennes, 1836 de uma rea de vrzea na Amaznia Central, Catalo, foram estudados. Foram utilizados dados referentes a trs ciclos hidrolgicos, entre setembro de 1999 e setembro de 2003. Foram analisados a dieta, a atividade alimentar diria e sazonal e a relao entre o comprimento da presa e o do predador. Cerca de 80% dos alimentos consumidos eram de origem autctone e a dieta composta basicamente de insetos e peixes. Peixes juvenis predominaram nos contedos estomacais de exemplares de todas as classes de tamanho, mas no houve relao significativa entre o tamanho do predador e o das presas consumidas. Pellona flavipinnis pode ser considerada uma espcie carnvora que se alimenta principalmente de indivduos juvenis de outras espcies de peixes. A atividade alimentar foi maior durante a noite e no perodo da cheia.

  4. Parasitismo natural em ovos crisopdeos Natural egg parasitism of chrysopids

    Maria Alice de Medeiros

    2009-02-01

    Full Text Available Os predadores, em geral, apresentam hbitos generalistas e por isso podem ser usados em programas de controle biolgico, em diferentes agroecossistemas. A sobrevivncia dos predadores afetada por diversos fatores, como, por exemplo, a presena de parasitides. Este trabalho foi conduzido com os objetivos de identificar os parasitides de crisopdeos, especialmente os parasitides de ovos, e determinar o nvel de parasitismo natural. As amostragens foram feitas na Embrapa Hortalias, em campos de milho-doce, de setembro/1997 a fevereiro/1998. Os ovos de crisopdeos foram coletados semanalmente, sendo individualizados em cpsulas de gelatina at a emergncia da larva e/ou do parasitide. Foram coletados 800 ovos de crisopdeos, sendo que em 71% dos ovos, as larvas sobreviveram; 9% dos ovos foram considerados inviveis e 20% foram parasitados por seis espcies de microhimenpteros. Destes, 57% foram parasitados por Telenomus sp. (Scelionidae, 32% por Trichogramma pretiosum (Trichogrammatidae, 6% por Oencyrtus chrysopae Crawford (Encyrtidae e 5% por Aprostocetus sp. (Eulophidae.Most predators, in general, have generalist habits and can be used as biological control agents in several crops. Predator survival is affected by several factors, such as occurrence of parasitoids. The main purpose of this research was to identify the parasitoids of chrysopids, especially egg parasitoids and their level of parasitism. The samples were taken in a sweet-corn field at Embrapa Hortalias from September/1997 to February/1998. The chrysopids eggs were collected weekly and then individualized in gelatine capsules until larval or parasitoid emergency. A total of 800 eggs were collected. The predator emerged from 71% of the eggs, 9% were inviable eggs and the other 20% were parasitized by six species of microhymenopterans. Among these, 57% were parasitized by Telenomus sp. (Scelionidae, 32% were parasitized by Trichogramma pretiosum (Trichogrammatidae, 6% by Oencyrtus chrysopae Crawford (Encyrtidae and 5% by Aprostocetus sp. (Eulophidae.

  5. Influncia de sistemas de produo sobre a ocorrncia de inimigos naturais de afdeos em pomares de pessegueiros em Araucria-PR Influence of systems of production on the occurrence of natural enemies of aphids on orchards of peach trees in Araucaria-PR

    Joselia Maria Schuber

    2008-06-01

    Full Text Available A presso da sociedade tem forado a adoo de sistemas de produo de frutas mais sustentveis e de menor impacto ambiental. O objetivo deste trabalho foi verificar a influncia dos sistemas de produo de Boas Prticas Agrcolas (BPA e Convencional (PC sobre a diversidade de inimigos naturais de afdeos presentes em seis pomares de pessegueiros no municpio de Araucria-PR, de julho de 2005 a setembro de 2006. O levantamento do nmero de inimigos naturais foi realizado por meio de cinco mtodos de amostragens: visual em plantas de pessegueiros e em plantas invasoras; armadilhas Mericke; funil e adesivas. No sistema BPA, foram coletados mais espcimes de inimigos naturais (53%, em relao aos pomares PCs (46%, havendo a ocorrncia, em ambos, de predadores das famlias Syrphidae, Coccinellidae e Chrysopidae e parasitides da ordem Hymenoptera. Do total de inimigos naturais coletados, verificou-se a ocorrncia de maior quantidade de predadores de afdeos.The pressure of the society has forced the adoption of more sustainable fruit production systems and with less environmental impact. The objective of this work was to verify the influence of production systems of Good Agricultural Practices (GAP and Conventional Production (CP, about the diversity of natural enemies of aphids present on six orchards of peach trees in the city of Araucaria, PR, from July 2005 to September 2006. The evaluation of the number of natural enemies of aphid's species was made by means of five sampling methods: visual in plants of peach trees; visual in invading plants; yellow water traps of Mericke type; funnel and adhesive traps. In the system GPA, more specimens of natural enemies had been collected (53% in relation to orchards CP (46%, having the occurrence, in both orchards, of predators of the Syrphidae, Coccinellidae and Chrysopidae family and parasitoids of Hymenoptera order. Concerning the total of collected natural enemies, it was verified the greatest occurrence of aphid predators.

  6. Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish

    Roberta Martini Bonaldo

    2004-06-01

    Full Text Available The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medusa was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa estava sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação.

  7. Estudio del comportamiento de una jauría de perros ferales presente en el humedal de La Conejera (Compartir-Suba, Bogotá, Colombia

    Zerda Ordóñez Enrique

    2006-06-01

    Full Text Available Los perros ferales son un problema en la actualidad para las instituciones encargadas en el cuidado de los diferentes humedales presentes en la ciudad de Bogotá, debido a la constante amenaza que estos animales representan para la fauna residente en estos espacios en recuperación. Se utilizaron técnicas de observación directa y registro indirecto para obtener una descripción morfológica de cada uno de los animales y realizar un catálogo comportamental de los perros tanto a nivel individual como social. Los muestreos se realizaron entre agosto y septiembre de 2005 en el humedal de La Conejera (Compartir-Suba, Bogotá, Colombia. Se registraron diez individuos pertenecientes a un mismo grupo social, conformado por siete machos y tres hembras. La organización social de los perros mostró semejanzas con la de sus antecesores los lobos, presentando básicamente dos líneas jerárquicas siendo una para los machos y una para las  hembras, cada una con un macho y hembra alpha respectivamente. Los perros encuentran al interior del humedal los recursos necesarios como es abrigo,agua y alimento suficiente para su supervivencia y la de sus crías, debido a la ausencia de otros predadores que luchan por los mismos recursos, teniendo mejor acceso y menor competencia. Se realizan observaciones y recomendaciones para implementar en contra de la supervivencia y permanencia de estos animales en lugares donde se tenga fauna silvestre amenazada por este tipo de predadores.

  8. Dieta de Leopardus colocolo (Carnivora: Felidae en la Reserva Nacional de Junín, Junín, Perú

    Ursula Fajardo

    2014-05-01

    Full Text Available Este estudio caracteriza la dieta de Leopardus colocolo en los alrededores del lago Junín, en el centro del Perú, a partir de los restos de las presas presentes en 43 heces. El origen de las heces del predador se determinó a partir del ADN mitocondrial de las células epiteliales intestinales adheridas a la superficie de las heces, utilizando como marcador la región de control. Los restos de las presas fueron identificados utilizando literatura especializada y la comparación con especímenes de colección, identificando un total of 14 ítems alimenticios pertenecientes a mamíferos de las familias Cricetidae (6, Chinchillidae (1 y Caviidae (1 y aves de las familias Anatidae (3 y Rallidae (2, y un grupo de aves no identificadas (1. Los roedores fueron el principal componente de la dieta de L. colocolo, en frecuencia y biomasa, seguido por las aves. Entre los ítems alimenticios consumidos, el roedor cricétido pequeño Calomys sp. fue el más frecuente; sin embargo, el mayor aporte de biomasa relativa fue proporcionado por el roedor mediano Cavia tschudii. La amplitud de nicho obtenida fue baja (Bsta= 0.17, indicando una dieta especializada. Nuestros resultados confirman que, como ocurre con la mayoría de felinos pequeños neotropicales, L. colocolo es un predador especializado en la captura de vertebrados, principalmente mamíferos pequeños. No se registró variación estacional en la dieta y el análisis de las clases de edad de los roedores cricétidos mostró que los adultos fueron los más consumidos. Se infiere que L. colocolo tiene un patrón de actividad diurno y nocturno.

  9. Effect of female weight on reproductive potential of the predator Brontocoris tabidus (Signoret, 1852 (Heteroptera: Pentatomidae

    Isaias Oliveira

    2005-03-01

    Full Text Available The objective of this work was to determine the fecundity of the predator Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae females of two weight classes aiming to define, which one presented higher productivity in the laboratory. Males and females of B. tabidus were reared from nymphs fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in laboratory. Females of B. tabidus weighting 95 to 150 mg and those with 160 to 220 mg constituted two treatments. Oviposition period and numbers of egg masses, eggs and nymphs per female of B. tabidus were higher in the treatment with heavier females, while the periods of preoviposition, between egg mass laying, egg incubation and number of eggs per egg mass, besides the percentage of nymphs hatched and adult longevity were similar between treatments. Heavier females of B. tabidus presented better productivity and for this reason they should be used in programs of mass rearing this predator.Este trabalho apresenta a fecundidade de fmeas do predador Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae de duas classes de peso, objetivando avaliar qual delas apresenta melhor produtividade em criaes mantidas em laboratrio. Machos e fmeas foram alimentadas, desde o estdio ninfal, com pupas do besouro Tenebrio molitor L. (Coleoptera: Tenebrionidae. Fmeas de B. tabidus pesando entre 95 e 150 mg e entre 160 e 220 mg constituram as duas classes de peso. O perodo de oviposio e os nmeros de posturas, de ovos e ninfas por fmea de B. tabidus foram maiores naquelas fmeas pertencentes classe mais pesada, enquanto os perodos de pr-oviposio, entre posturas, incubao dos ovos e nmero de ovos por postura, bem como a percentagem de ecloso de ninfas e a longevidade dos adultos foram semelhantes entre ambas as classes de peso. Fmeas mais pesadas de B. tabidus apresentaram maior nmero de ovos por fmea e por esta razo devem ser utilizadas em programas de criao massal deste predador.

  10. Potencial reprodutivo de Supputius cincticeps (Stal (Heteroptera: Pentatomidae influenciado pelo peso do corpo da fmea - DOI: 10.4025/actascibiolsci.v25i1.2081 Reproductive potential of the predator Supputius cincticeps (Heteroptera: Pentatomidae affected by female body weight - DOI: 10.4025/actascibiolsci.v25i1.2081

    Jose Eduardo Serro

    2003-04-01

    Full Text Available O potencial reprodutivo de fmeas de Supputius cincticeps (Stal (Heteroptera: Pentatomidae de duas classes de peso foi avaliado. Machos e fmeas desse predador foram obtidos de ninfas alimentadas com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. Foram analisadas fmeas com peso inferior a 45 mg (fmeas leves e superior a 60 mg (fmeas pesadas. A longevidade e os perodos de pr-oviposio, oviposio e ps-oviposio foram semelhantes entre fmeas das duas classes de peso, enquanto aquelas mais pesadas apresentaram maior nmero de posturas, ovos, ovos/postura e ninfas. Perodos entre posturas e de incubao dos ovos foram menores para fmeas com peso superior a 60mg. Esses resultados so discutidos em relao ao uso de fmeas mais pesadas de S. cincticeps para aumentar a produo em criao massal desse predadorThe reproductive potential of Supputius cincticeps (Stal (Heteroptera: Pentatomidae females of two weight classes was evaluated with males and females of this predator obtained from nymphs fed on Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae. Females of S. cincticeps weighing less than 45 mg (light females and more than 60 mg (heavy females constituted the treatments. Pre-oviposition, oviposition and post-oviposition periods besides adult longevity were similar between treatments while number of egg masses, eggs, eggs/egg mass and number of nymphs hatched were higher for heavier females. Periods between egg mass laying and egg incubation were shorter for insects of the last treatment. These results are discussed in relation to the use of heavier females of S. cincticeps to improve mass rearing of this predator in laboratory

  11. Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae Desenvolvimento ninfal e preferncia alimentar de Podisus maculiventris (Heteroptera: Pentatomidae em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae parasitados ou no por Trichogramma brassicae (Hymenoptera: Trichogrammatidae

    H. N. Oliveira

    2004-08-01

    Full Text Available Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae, parasitised or not by Trichogramma brassicae (pupae stage. Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventris as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that it is possible to combine the use of P. maculiventris with releases of T. brassicae in control programs of lepidopteran pests.Avaliou-se a predao de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa ou no por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos s ninfas de P. maculiventris como alimento. Esse Pentatomidae s atingiu a fase adulta quando se alimentou de ovos no parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criao desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estdio. Em teste de escolha, ninfas desse predador mostraram preferncia por ovos no parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que possvel associar o uso de P. maculiventris com liberaes de T. brassicae em programas de controle de lepidpteros pragas,

  12. A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates

    Cristina Sazima

    2005-09-01

    Full Text Available Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos peixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores.

  13. Defensive repertoire of Xenodon dorbignyi (Serpentes, Dipsadidae) / Repertrio defensivo de Xenodon dorbignyi (Serpentes, Dipsadidae)

    Alexandro Marques, Tozetti; Roberto Baptista de, Oliveira; Glaucia Maria Funk, Pontes.

    2009-09-01

    Full Text Available A capacidade de uma espcie em defender-se da ao de um predador esta diretamente relacionada sua sobrevivncia. Nesse sentido, os mecanismos de interao presa/predador so elementos importantes da histria natural das espcies. Neste estudo foi avaliado o repertrio defensivo da cobra-nariguda [...] (Xenodon dorbignyi), a partir da simulao de ataques predatrios na natureza. Foram observadas nove unidades comportamentais defensivas, sendo os movimentos errticos, achatamento do corpo, triangulao da cabea e display caudal os comportamentos mais freqentemente exibidos. No foram detectadas diferenas na estratgia defensiva entre os sexos ou entre indivduos em diferentes estados reprodutivos. Os resultados sugerem que X. dorbignyi possui a capacidade de avaliar o nvel de ameaa imposto pelo agressor, sendo o comportamento crptico, o achatamento do corpo e a fuga as estratgias defensivas primrias, com os demais displays representando respostas secundrias ao ataque predatrio. Os resultados reforam a hiptese de que X. dorbignyi represente simultaneamente um mmico de Micrurus e Bothrops. Abstract in english The ability of a species to defend itself against a predator is directly correlated with its survivorship. Thus, prey/predator interaction mechanisms are important elements of the natural history of species. In this study, we examined the defensive repertoire of the South-American hognose snake (Xen [...] odon dorbignyi) through simulations of predator attacks in the field. Nine defensive displays were observed. The most frequently observed displays were erratic movements, body flattening, head triangulation and tail display. No differences were detected in the defensive strategies shown by males and females, regardless of their reproductive state. Our findings suggest that X. dorbignyi has the ability to evaluate the level of threat imposed by the aggressor, with cryptic behavior, body flattening and locomotor escape as the primary defensive strategies, with other displays used as secondary responses to a predator attack. Our results support the hypothesis that X. dorbignyi is a mimic of both Micrurus and Bothrops.

  14. Fish ladders: safe fish passage or hotspot for predation?

    Angelo Antonio Agostinho

    2012-10-01

    Full Text Available Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmonids during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladder environment, which is associated with injuries suffered along the ladder course and the presence of multiple predator groups with different predation strategies, transformed the fish corridor into a hotspot for predation.Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embora a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predaç��o em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil, buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003. Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação

  15. Great horned owl (Bubo virginianus) dietary exposure to PCDD/DF in the Tittabawassee River floodplain in Midland, Michigan, USA.

    Coefield, Sarah J; Zwiernik, Matthew J; Fredricks, Timothy B; Seston, Rita M; Nadeau, Michael W; Tazelaar, Dustin L; Moore, Jeremy N; Kay, Denise P; Roark, Shaun A; Giesy, John P

    2010-10-01

    Soils and sediments in the floodplain of the Tittabawassee River downstream of Midland, Michigan, USA contain elevated concentrations of polychlorinated dibenzofurans (PCDF) and polychlorinated dibenzo-p-dioxins (PCDD). As a long-lived, resident top predator, the great horned owl (Bubo virginianus; GHO) has the potential to be exposed to bioaccumulative compounds such as PCDD/DF. Site-specific components of the GHO diet were collected along 115 km of the Tittabawassee, Pine, Chippewa, and Saginaw Rivers during 2005 and 2006. The site-specific GHO biomass-based diet was dominated by cottontail rabbits (Sylvilagus floridanus) and muskrats (Ondatra zibethicus). Incidental soil ingestion and cottontail rabbits were the primary contributors of PCDD/DF to the GHO diet. The great horned owl daily dietary exposure estimates were greater in the study area (SA) (3.3 to 5.0 ng 2,3,7,8-TCDD equivalents (TEQ(WHO-avian))/kg body wt/d) than the reference area (RA) (0.07 ng TEQ(WHO-Avian)/kg body wt/d). Hazard quotients (HQs) based on central tendency estimates of the average daily dose and no-observable-adverse effect level (NOAEL) for the screech owl and uncertainty factors were <1.0 for both the RA and the SA. Hazard quotients based on upper end estimates of the average daily dose and NOAEL were <1.0 in the RA and up to 3.4 in the SA. PMID:20872700

  16. Influence of habitat modification on the intestinal helminth community ecology of cottontail rabbit populations.

    Boggs, J F; McMurry, S T; Leslie, D M; Engle, D M; Lochmiller, R L

    1990-04-01

    The influence of five brush management treatments using the herbicides tebuthiuron and triclopyr, with or without prescribed burning, on the intestinal helminth community of cottontail rabbits (Sylvilagus floridanus) was studied in 1987 on the Cross Timbers Experimental Range in Payne County, Oklahoma (USA). Six helminth species were found (Dermatoxys veligera, Trichostrongylus calcaratus, Passalurus nonanulatus, Wellcomia longejector, Taenia pisiformis cystercercus, and Mosgovoyia pectinata americana) in 102 rabbits (88 adult and 14 juveniles) collected over two seasons (winter and summer). Prevalence of M. pectinata americana in cottontail rabbits was significantly greater in untreated control pastures than herbicide treated pastures in winter, while prevalence of T. pisiformis was significantly greater in burned than unburned pastures. Abundances of helminth species in the intestinal tract of cottontail rabbits were unaffected by brush treatments. Mosgovoyia pectinata americana abundance demonstrated a highly significant increase from winter to summer; conversely, abundance of all oxyurid pinworms combined (D. veligera, P. nonanulatus, W. longejector) was significantly higher in winter than summer. Helminth community dynamics were significantly influenced by season, but were unaffected by brush treatments. Habitat modification could have influenced cestode transmission by altering the ecology of invertebrate and vertebrate hosts. PMID:2338720

  17. Ocorrncia e recrutamento larval de Teredinidae (Mollusca, Bivalvia na regio do Sistema Costeiro Canania-Iguape, So Paulo, Brasil

    Daniela T. de Moraes

    2015-03-01

    Full Text Available A ocorrncia e o recrutamento larval de Teredinidae na regio do Sistema Costeiro Canania-Iguape foram acompanhados por doze meses utilizando-se coletores laminados de pinho, instalados em trs estaes dentro do bosque de mangue (mediolitoral e em uma estao, localizada no infralitoral. No manguezal, a colonizao por larvas de teredindeos ocorreu aps quatro meses de permanncia dos coletores na estao mais frequentemente inundada pela mar e somente aps oito meses nas duas estaes com menor frequncia de inundao. No infralitoral, aps quatro meses, os coletores j estavam consideravelmente danificados. Ao longo do experimento, houve um decrscimo no nmero de teredindeos, especialmente no infralitoral, ocasionado possivelmente pela competio por alimento e espao entre teredindeos e foladdeos. Foram encontrados 2.658 indivduos, sendo 704 de Teredinidae e 1.954 de Pholadidae. Entre os teredindeos, Bankia fimbriatula foi a espcie mais abundante tanto no infralitoral quanto no manguezal, seguida de Bankia gouldi e Lyrodus floridanus que ocorreram somente no infralitoral, e Nausitora fusticula encontrada somente no manguezal. Martesia striata, nico foladdeo, ocorreu somente no infralitoral.

  18. Ability of bed bug-detecting canines to locate live bed bugs and viable bed bug eggs.

    Pfiester, Margie; Koehler, Philip G; Pereira, Roberto M

    2008-08-01

    The bed bug, Cimex lectularius L., like other bed bug species, is difficult to visually locate because it is cryptic. Detector dogs are useful for locating bed bugs because they use olfaction rather than vision. Dogs were trained to detect the bed bug (as few as one adult male or female) and viable bed bug eggs (five, collected 5-6 d after feeding) by using a modified food and verbal reward system. Their efficacy was tested with bed bugs and viable bed bug eggs placed in vented polyvinyl chloride containers. Dogs were able to discriminate bed bugs from Camponotus floridanus Buckley, Blattella germanica (L.), and Reticulitermes flavipes (Kollar), with a 97.5% positive indication rate (correct indication of bed bugs when present) and 0% false positives (incorrect indication of bed bugs when not present). Dogs also were able to discriminate live bed bugs and viable bed bug eggs from dead bed bugs, cast skins, and feces, with a 95% positive indication rate and a 3% false positive rate on bed bug feces. In a controlled experiment in hotel rooms, dogs were 98% accurate in locating live bed bugs. A pseudoscent prepared from pentane extraction of bed bugs was recognized by trained dogs as bed bug scent (100% indication). The pseudoscent could be used to facilitate detector dog training and quality assurance programs. If trained properly, dogs can be used effectively to locate live bed bugs and viable bed bug eggs. PMID:18767752

  19. Structural changes of oil palm empty fruit bunch (OPEFB) after fungal and phosphoric acid pretreatment.

    Isroi; Ishola, Mofoluwake M; Millati, Ria; Syamsiah, Siti; Cahyanto, Muhammad N; Niklasson, Claes; Taherzadeh, Mohammad J

    2012-01-01

    Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI) of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB's cellulose by 4, 6.3, and 7.4 folds, respectively. PMID:23247371

  20. Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB after Fungal and Phosphoric Acid Pretreatment

    Mohammad J. Taherzadeh

    2012-12-01

    Full Text Available Oil palm empty fruit bunch (OPEFB was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB’s cellulose by 4, 6.3, and 7.4 folds, respectively.

  1. Effect of fungal and phosphoric acid pretreatment on ethanol production from oil palm empty fruit bunches (OPEFB).

    Ishola, Mofoluwake M; Isroi; Taherzadeh, Mohammad J

    2014-08-01

    Oil palm empty fruit bunches (OPEFB), a lignocellulosic residue of palm oil industries was examined for ethanol production. Milled OPEFB exposed to simultaneous saccharification and fermentation (SSF) with enzymes and Saccharomyces cerevisiae resulted just in 14.5% ethanol yield compared to the theoretical yield. Therefore, chemical pretreatment with phosphoric acid, a biological pretreatment with white-rot fungus Pleurotus floridanus, and their combination were carried out on OPEFB prior to the SSF. Pretreatment with phosphoric acid, combination of both methods and just fungal pretreatment improved the digestibility of OPEFB by 24.0, 16.5 and 4.5 times, respectively. During the SSF, phosphoric acid pretreatment, combination of fungal and phosphoric acid pretreatment and just fungal pretreatment resulted in the highest 89.4%, 62.8% and 27.9% of the theoretical ethanol yield, respectively. However, the recovery of the OPEFB after the fungal pretreatment was 98.7%, which was higher than after phosphoric acid pretreatment (36.5%) and combined pretreatment (45.2%). PMID:24630370

  2. Diet of four annual killifishes: an intra and interspecific comparison

    Gabriel Laufer

    2009-03-01

    Full Text Available We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lagoon basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae, Ephemeroptera (especially Betidae, and coleopteran larvae (especially Dytiscidae. Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae, Ephemeroptera (especialmente Betidae, e larvas de Coleoptera (especialmente Dytiscidae. Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação.

  3. Fitoseídeos (Acari: Phytoseiidae associados a cafezais e fragmentos florestais vizinhos Phytoseiids (Acari: Phytoseiidae associated to coffee plantations and adjacent forest fragments

    Ester Azevedo Silva

    2010-10-01

    Full Text Available Existem poucas informações sobre a fauna de ácaros predadores (Phytoseiidae em ambientes naturais brasileiros adjacentes a agroecossistemas cafeeiros (Coffea spp. ou sobre a influência que essa vegetação exerce como reservatório de ácaros predadores. Neste estudo, objetivou-se avaliar a diversidade destes organismos em cafeeiros e fragmentos florestais adjacentes. Coletaram-se amostras das espécies Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart. (Rutaceae, Metrodorea stipularis Mart. (Rutaceae e Allophylus semidentatus (Miq. Radlk. (Sapindaceae, em oito fragmentos florestais, de 5 a 51 ha, e cafezais adjacentes, nos meses de junho (final período chuvoso e outubro (final período seco nos anos 2004 e 2005, na região Sul do Estado de Minas Gerais. Ácaros foram extraídos das folhas, utilizando o método de lavagem e, em seguida, montados em lâminas de microscopia em meio de Hoyer, para identificação específica. No total foram identificados 2.348 fitoseídeos, sendo 2.090 nos fragmentos florestais e 258 espécimes nos cafezais adjacentes, pertencentes a 38 espécies. Servindo-se de análise faunística, a espécie Iphiseiodes zuluagai Denmark & Muma, 1972 apresentou os melhores índices no agroecossistema cafeeiro, sendo muito frequente e constante nas épocas estudadas. Nos fragmentos florestais Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 e Euseius alatus DeLeon, 1966 foram dominantes, muito abundantes, muito frequentes e constantes nas épocas estudadas. Podemos concluir que a vegetação nativa abriga ácaros predadores, inimigos naturais de ácaros-praga, que ocorrem na cultura cafeeira, possibilitando o desenvolvimento de programas de manejo ecológico com áreas de vegetação natural e agroecossistemas cafeeiros adjacentes.There is little information about the fauna of predatory mites (Phytoseiidae in Brazilian natural environments, adjacent to coffee agroecosystems (Coffea spp., or about the influence exerted by neighbor vegetation as a reservoir of predatory mites. The objective of this study was to evaluate the diversity of these organisms in coffee plantations and adjacent forest fragments. Samples of the species Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart., Metrodorea stipularis Mart. (Rutaceae and Allophylus semidentatus (Miq. Radlk. (Sapindaceae were collected in eight forest fragments, from 5 to 51ha, adjacent to coffee plantations, in June (end of the rainy season and October (end of the dry season in the years of 2004 and 2005, in the Southern region of State of Minas Gerais. Leaf mites were extracted using the wash method, mounted in microscopy slides with Hoyer's medium for identification. A total of 2.348 phytoseiids was collected, being 2.090 in the forest fragments and 258 in adjacent coffee plantations, belonging to 38 species. According to fauna analysis, Iphiseiodes zuluaguai Denmark & Muma, the year of 1972 presented the best indexes in the coffee agroecosystem, being very frequent and constant in those periods. In the forest fragments, Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 and Euseius alatus DeLeon, 1966 were dominant, very abundant, very frequent and constant in those periods. One may conclude that the native vegetation shelters predator mite, natural enemies of mite-pests that still occur in coffee culture, making possible ecological management program development involving areas of natural vegetation and adjacent coffee agroecosystems.

  4. Activity, habitat use, feeding behavior, and diet of four sympatric species of Serranidae (Actinopterygii: Perciformes in southeastern Brazil

    Fernando Zaniolo Gibran

    2007-09-01

    Full Text Available Diplectrum formosum (the sand perch, Diplectrum radiale (the aquavina, Epinephelus marginatus (the dusky grouper and Mycteroperca acutirostris (the comb grouper are four sympatric serranid of remarkable ecological and commercial importance. This study investigated the feeding of these four species in the São Sebastião Channel, São Paulo State (southeastern Brazil, comparing their diet, habitat utilization and morphological features related to foraging. These four serranids are opportunistic visual predators that use a total of nine different tactics to capture their preys, feed mostly on crustaceans during the day and twilight, and keep stationary and quiescent at night. The ecomorphological study was conducted to test its predictive value to infer lifestyles. It was verified that such analysis should be used carefully and must be complemented by field observations. Although morphologically and behaviorally very similar, D. formosum and D. radiale showed different preferences to the substratum type used by large individuals, which are exclusively sit-and-wait predators. On the other hand, E. marginatus displayed more sedentary habits than M. acutirostris, the most versatile predator from the studied species. The studied species of Diplectrum and E. marginatus can be regarded as benthic serranids, while M. acutirostris could be viewed as a nektobenthic species.Diplectrum formosum, Diplectrum radiale (micholes-da-areia, Epinephelus marginatus (garoupa-verdadeira e Mycteroperca acutirostris (badejo-mira são quatro espécies simpátricas que pertencem à família Serranidae, de reconhecida importância ecológica e comercial. Este estudo analisou a alimentação destas quatro espécies de peixes no Canal de São Sebastião, Estado de São Paulo (sudeste do Brasil, comparando suas dietas, o uso do habitat e algumas características morfológicas relacionadas ao comportamento alimentar e a distribuição vertical na coluna d'água. Estes quatro serranídeos são predadores oportunistas que utilizam um total de nove táticas diferentes para capturar suas presas, alimentando-se principalmente de crustáceos durante o dia e crepúsculo, e permanecendo estacionários e inativos durante a noite. Um estudo ecomorfológico foi empregado para testar seu valor preditivo. Foi verificado que tal abordagem deve ser utilizada com cautela e sempre complementada com observações diretas no ambiente. Apesar de morfologicamente e comportamentalmente muito semelhantes, D. formosum e D. radiale mostraram divergências com relação ao tipo de substrato preferido pelos maiores indivíduos, que são exclusivamente predadores de espreita. Por outro lado, E. marginatus mostrou possuir hábitos de vida mais sedentários do que M. acutirostris, o mais versátil predador dentre as espécies estudadas. As espécies de Diplectrum estudadas, assim como E. marginatus, podem ser classificadas como serranídeos bentônicos, enquanto que M. acutirostris pode ser classificada como uma espécie nectobentônica.

  5. Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato Critical analysis of the neural systems organizing innate fear responses

    Newton Sabino Canteras

    2003-12-01

    Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While these shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing, it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

  6. Life history of Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) fed with castor bean (Ricinus communis L.) pollen in laboratory conditions / Histria de vida de Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae), alimentado com plen de mamoneira (Ricinus communis L.) em condio de laboratrio

    PP, Marafeli; PR, Reis; EC. da, Silveira; GC, Souza-Pimentel; MA. de, Toledo.

    2014-08-01

    Full Text Available O caro predador, Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) um dos principais inimigos naturais de caros tetraniqudeos em vrios pases, promovendo um eficiente controle em vrias culturas alimentcias e ornamentais. O ataque de pragas como o caro-rajado, Tetranychus urtica [...] e Koch, 1836 (Acari: Tetranychidae), um dos problemas enfrentados pelos produtores, principalmente em casa de vegetao, pela dificuldade de seu controle com o uso de agroqumicos devido ao rpido desenvolvimento de resistncia o que dificulta seu controle. Foi objetivo deste trabalho estudar a histria de vida do caro predador N. californicus como contribuio sua criao massal em laboratrio tendo como alimento plen de mamoneira [Ricinus communis L. (Euphorbiaceae)] para posterior uso como inimigo natural de T. urticae em cultivo de roseiras (Rosa spp.) em casa de vegetao. Os estudos foram conduzidos em laboratrio temperatura de 25 2C, 70 10% de UR e 14 horas de fotofase. Foram avaliados os aspectos biolgicos e confeccionada a tabela de vida de fertilidade. Foi constatada uma longevidade de 32,9 dias para fmeas adultas e 40,4 dias para machos. A estimativa da capacidade inata de crescimento da populao (rm) foi 0,2 dias e a durao mdia de gerao (T) foi 17,2 dias. A populao dobrou a cada 4,1 dias. Os resultados obtidos foram semelhantes queles nos quais o predador N. californicus foi alimentado com T. urticae. Abstract in english The predatory mite, Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) is one of the principal natural enemies of tetranychid mites in several countries, promoting efficient control of those mites in several food and ornamental crops. Pest attacks such as that of the spider mite, Tetrany [...] chus urticae Koch, 1836 (Acari: Tetranychidae), is one of the problems faced by farmers, especially in the greenhouse, due to the difficulty of its control with the use of chemicals because of the development of fast resistance making it hard to control it. The objective of this work was to study the life history of the predatory mite N. californicus as a contribution to its mass laboratory rearing, having castor bean plant [Ricinus communis L. (Euphorbiaceae)] pollen as food, for its subsequent use as a natural enemy of T. urticae on a cultivation of greenhouse rosebushes. The studies were carried out in the laboratory, at 25 2C of temperature, 70 10% RH and a 14 hour photophase. The biological aspects and the fertility life table were appraised. Longevity of 32.9 days was verified for adult females and 40.4 days for males. The intrinsic rate of increase (rm) was 0.2 and the mean generation time (T) was 17.2 days. The population doubled every 4.1 days. The results obtained were similar to those in which the predatory mite N. californicus fed on T. urticae.

  7. CARACTERÍSTICAS BIOLÓGICAS DE ADULTOS DE PODISUS NIGRISPINUS E SUPUTIUS CINCTICEPS (HEMIPTERA: PENTATOMIDAE ALIMENTADOS COM THYRINTEINA ARNOBIA (LEPIDOPTERA: GEOMETRIDAE BIOLOGICAL CHARACTERISTICS OF ADULTS OF PODISUS NIGRISPINUS AND SUPPUTIUS CINCTICEPS (HEMIPTERA: PENTATOMIDAE FED ON THYRINTEINA ARNOBIA (LEPIDOPTERA: GEOMETRIDAE

    Anderson Mathias Holtz

    2006-08-01

    Full Text Available O gênero Eucalyptus (mirtacea exótica proveniente da Austrália é o mais utilizado para reflorestamento no Brasil. Porém, somente a partir de 1966 é que este setor tomou impulso no país. Assim, além de exótica, a eucaliptocultura é recente. Periodicamente são observados surtos de lepidópteros desfolhadores (Thyrinteina arnobia, por exemplo. No Brasil, os predadores Podisus nigrispinus e Supputius cincticeps vem sendo utilizados contra lepidópteros desfolhadores, porém não se têm dados sobre o estabelecimento desses predadores em campo. Sendo assim, o objetivo deste trabalho foi verificar os aspectos biológicos de adultos de P. nigrispinus e S. cincticeps sobre lagartas de T. arnobia provenientes de plantas de Eucalyptus urophylla. Comparando-se os aspectos biológicos das duas espécies de predadores, observa-se que o desempenho de P. nigrispinus sobre as lagartas de T. arnobia foi melhor do que o desempenho de S. cincticeps. Este resultado demonstra que P. nigrispinus está conseguindo quebrar possíveis sistemas de defesa dessa espécie de herbívoro, tais como os compostos secundários que o herbívoro provavelmente estaria seqüestrando das plantas de eucalipto e, se os inimigos naturais (S. cincticeps, por exemplo não estiverem adaptados a esses compostos, a sua performance no controle da praga e no seu próprio desenvolvimento podem ser afetados negativamente.The Eucalyptus genus (an exotic mirtacea proceeding from Australia is used for reforestation in Brazil. However, only after 1966 did this sector take impulse in the country. Thus, beyond exotic, the cultivation of this genus is recent. Defoliation caused by epidemics of lepidopterous species, such as Thyrinteina arnobia, for example, had been observed periodically. In Brazil Podisus nigrispinus and Supputius cincticeps are being used as predators against defoliator lepidopterous species, however in current literature information is not available about the establishment of these predators in the field. The objective of this work was to analyze the biological aspects of P. nigrispinus and S. cincticeps adults on T. arnobia caterpillars collected on Eucalyptus urophylla plants. Comparing the biological aspects of the two predators species, the performance of P. nigrispinus on the caterpillars of T. arnobia was observed as better than the performance of S. cincticeps. Based on these results it is possible to demonstrate that P. nigrispinus is breaking possible systems of defense of this specie of herbivore, such as the secondary metabolites that the herbivore probably would be kidnapping from eucalyptus plants. If the natural enemies (S. cincticeps, for example will not be adapt to these composites, its performance in the control of the pest and on its development can be negatively affected.

  8. Impact and Selectivity of Insecticides to Predators and Parasitoids

    Flávio Lemes Fernandes

    2010-04-01

    Full Text Available Problems with the use of insecticides has brought losses, such as, negative impact on natural enemies. When these beneficial insects reduce cause the eruption of pests and resurgence it’s more common. Thus principles of conservation these arthropods are extremely important in the biological natural control of pests, so that these enemies may present a high performance. Because of the negative impacts caused by insecticides on agriculture and their harmful effects on natural enemies, the objective of this article is to approach two important subjects, divided into three parts. Part I relates to the description of the main crop pests and their natural enemies; Part II involves the impact of insecticides on predators and parasitoids and Part III focuses on the selectivity of several groups of insecticides to natural enemies. Before spraying insecticides, it is necessary to choose a product that is efficient to pests and selective to natural enemies. So, it is indispensable to identify correctly the groups and species of natural enemies, since insecticides have an impact on their survival, growth, development, reproduction (sexual ratio, fecundity, longevity and fertility, and behavior (motility, orientation, feeding, oviposition and learning of insects. The mechanisms of toxicity and selectivity of insecticides are related to the properties of higher or lower solubility and molecular weight. Besides, characteristics of the cuticular composition of the integument of natural enemies are extremely important in the selectivity of a product or the tolerance of a certain predator or parasitoid to this molecules.Impacto e Seletividade de Inseticidas para Predadores e ParasitóidesResumo.Dentre os problemas advindos do uso de inseticidas, a destruição de inimigos naturais é fator importante. Estes insetos benéficos podem reduzir problemas de erupção de pragas secundárias, ressurgência de pragas e manter a praga abaixo do nível de dano econômico. Dessa forma a conservação de inimigos naturais, para que os mesmos exerçam alta performance frente às pragas, é de extrema importância em controle biológico de pragas. Método de controle essencial utilizados nos programas de manejo integrado de pragas. Tendo em vista os impactos negativos dos inseticidas na agricultura e os seus efeitos adversos sobre os inimigos naturais, este artigo visa abordar dois assuntos importantes, que para isso é dividido em três partes. A parte I relacionada com o reconhecimento das principais pragas agrícolas e seus inimigos naturais; a parte II envolve o impacto dos inseticidas sobre os predadores e parasitóides e a parte III abordará sobre a seletividade dos diversos grupos de inseticidas aos inimigos naturais. Antes de se pulverizar inseticida é necessário a escolha de um produto que seja seletivo e eficiente, assim torna-se imprescindível identificar de forma correta os grupos e espécies de inimigos naturais. Uma vez que os inseticidas apresentam impacto sobre a sobrevivência, o crescimento e desenvolvimento, na reprodução (razão sexual, fecundidade, longevidade e fertilidade, no comportamento (mobilidade, orientação, alimentação, oviposição e aprendizado. Os mecanismos de toxicidade e seletividade dos inseticidas estão relacionados às propriedades de maior ou menor solubilidade e peso molecular. Além disso, características da composição cuticular do integumento dos inimigos naturais são de extrema importância na seletividade de um produto ou a tolerância de determinado predador ou parasitóide.

  9. Aspectos biolgicos de Chrysoperla externa (Hagen, 1861(Neuroptera: Chrysopidae alimentada com Planococcus citri (Risso, 1813(Hemiptera: Pseudococcidae e Toxoptera citricida (Kirkaldy, 1907 (Hemiptera: Aphididae Bipogical aspects of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae fed with Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae and Toxoptera citricida (Kirkaldy, 1907 (Hemiptera: Aphididae (Hemiptera: Aphididae

    Jean Patrick Bonani

    2009-02-01

    Full Text Available O ecossistema citrcola abriga muitas espcies de inimigos naturais, entre eles Chrysoperla externa (Hagen, 1861 que apresenta um grande potencial como agente de controle biolgico de pragas. Neste trabalho, objetivou-se avapar o efeito das presas Planococcus citri (Risso, 1813 e Toxoptera citricida (Kirkaldy, 1907 sobre o desenvolvimento das fases de larva e pupa de C. externa. O ensaio foi conduzido em sala cpmatizada a uma temperatura de 251C, 7010% UR e fotofase de 12 horas, sendo os tratamentos constitudos pelo fornecimento contnuo e alternado dessas duas presas em cada nstar do predador, alm de ovos de Anagasta kuehniella (Zeller, 1879, utilizados para fins de comparao. Foram avaliados o tempo de vida e a viabilidade das fases de larva, pupa e do perodo larva-adulto de C. externa. Constatou-se que T. citricida fornecido isoladamente ao longo do desenvolvimento larval ou em dois nstares consecutivos do predador, no foi uma presa adequada, constatando-se 100% de mortalidade no perodo larva-adulto. Quando as larvas alimentaram-se de P. citri fornecida em dois nstares do predador, a viabilidade no perodo larva-adulto foi semelhante dieta constituda por apenas ovos de A. kuehniella, exceto quando se alimentaram de T. citricida no primeiro nstar.The citrus-growing ecosystem houses a great deal of species of natural enemies, among them Chrysoperla externa (Hagen, 1861, which presents a great potential for use in the bipogical contrp of pests. The aim of this work was to evaluate the effects of the preys Planococcus citri (Risso, 1813 and Toxoptera citricida (Kirkaldy, 1907 on the development of larva and pupa of C. externa. The trial was carried out in an accpmatized room at 251C, 7010% RH and 12-hour photophase, the treatments consisting of the continuous and alternate supply of those two preys in each instar of the predator, in apition to eggs of Anagasta kuehniella (Zeller, 1879 utilized for comparison purposes. Both the white mealybug and the aphids were given in sufficient amounts to the C. externa larvae to be able to feed ad libitum. The pfetime and the survival rate of the phases of larva, pupa and the larval-adult period of C. externa were evaluated. It was found that T. citricida given either singly along the larval development or in two consecutive instars of the predator was not an adequate prey, 100% of mortapty over the larval-adult period being found. When the larvae fed on P. citri, given in two instars of the predator, the survival rate in the larval-adult period was similar to the diet constituted of only A. kuehniella eggs, except when fed with T. citricida in the first instar.

  10. Variação espaço-temporal na distribuição e abundância de Moenkhausia sanctaefilomenae (Characiformes: Characidae em lagoas da planície de inundação do rio Cuiabá, Pantanal, Brasil=Spatial-temporal variation of the distribution and abundance of Moenkhausia sanctaefilomenae at lagoons of the Cuiaba river floodplain, Pantanal, Brazil

    Jerry Penha

    2012-01-01

    Full Text Available Identificar os fatores bióticos e abióticos que determinam a variação na distribuição e abundância das populações, tornou-se nos últimos anos um grande desafio para os ecologistas. Assim neste estudo foram avaliados o efeito das variáveis abióticas e a abundância de predadores sobre a abundância de Moenkhausia sanctaefilomenae, a variação no comprimento médio dos indivíduos entre lagoas e períodos e o efeito das variáveis abióticas e da abundância de predadores sobre a estrutura em comprimento. Foram amostradas 16 lagoas da planície de inundação do rio Cuiabá, no período de junho (vazante, setembro (seca e dezembro (enchente de 2005 e março (cheia de 2006. Para M. sanctaefilomenae, a distribuição é mais ampla e a abundância é maior no final da vazante, início da seca, reduzindo-se gradualmente ao longo dos períodos de seca, enchente e cheia. Adicionalmente, o período afeta a estrutura em tamanho das populações, que são espacialmente homogêneas. Indivíduos menores foram capturados no final do período de vazante e os maiores ao início da enchente. Durante o final da vazante/início da seca, a variação espacial na abundância da população foi relacionada positivamente com o pH, o oxigênio dissolvido e cobertura de macrófitas e área da lagoa, mas, não com a abundância local de predadores na zona litorânea das lagoas.Identifying the biotic and abiotic factors that determine the variation in the distribution and abundance of populations has become a great challenge for the field of ecology in recent years. Thus, in this study we evaluated the effect of abiotic variables and the abundance of predators on the abundance of Moenkhausia sanctaefilomenae, the variation in the average length of the individuals between lakes and periods, and the effect of the abiotic variables and abundance of predators on the structure in length of that species. Sixteen lakes of the Cuiabá river flood plain were sampled in June (drying period, September (dry period and December (flooding period 2005 and March (flood period 2006. For M. sanctaefilomenae, the distribution is ampler and the abundance is greater at the end of the drying period, beginning of dry season, reducing gradually over the periods of dry, drying and flood season. Additionally, the period affects the structure in size of the populations that are spatially homogeneous. Smaller individuals were captured at the end of the drying period and the larger individuals at the start of flooding. During the end of the drying period and in the beginning of the dry season, the spatial variation in the abundance of the population was positively related with pH, dissolved oxygen and macrophyte cover and area of the lake, but not with the local abundance of predators in the littoral zone of the lakes.

  11. Spatiotemporal variation patterns of plants and animals in San Carlos de Apoquindo, central Chile Patrones de variacin espaciotemporal de plantas y animales en San Carlos de Apoquindo, Chile central

    FABIN M. JAKSIC

    2001-06-01

    Full Text Available I summarize what is known about the mediterranean ecosystem represented in San Carlos de Apoquindo (33 23' S, 70 31' W, a rugged area of 835 ha located ca. 20 km east of downtown Santiago on the Andean foothills. This site attracted numerous researchers during 1976-1990 because of its proximity to Santiago and its relatively protected status. I review the literature, and provide unpublished information on this site. A total of 132 literature entries describe the ecology of San Carlos de Apoquindo, in about 30 topics. The shrub and herbaceous vegetation have been well studied, but little is known about the respective seed banks. Among animals, small mammals, rabbits, and avian and mammalian predators are the best investigated, whereas epigean arthropods, amphibians, lizards, snakes, passerine birds, and scavengers of all types are the least studied. Thematically, interactions from plant/climate, to plant/soil, to plant/herbivore, to herbivore/predator interactions, and to decomposition of animal carcasses, have been addressed. But gross inequalities exist on the thoroughness with which each topic has been researched. The best studied aspects deal with plant/herbivore and herbivore/predator interactions. Up to now, no description existed of soils and climate in the area, which I present in this paper. Taking advantage of the long-term aspect of the research at the site, I highlight temporal variation patterns. And because of the different landscape aspects present at the site, I also highlight data that depict such spatial variability. In general, San Carlos de Apoquindo has contributed greatly to the understanding of ecological processes in central Chile. I call for renewed efforts at studying this site's ecology from an ecosystem perspectiveResumo lo que se conoce acerca del ecosistema mediterrneo representado en San Carlos de Apoquindo (33 23' S, 70 31' O, un rea con alto relieve y de 835 ha localizada ca. 20 km al Este del centro de Santiago en la precordillera andina. Este sitio atrajo a numerosos investigadores durante 1976-1990 debido a su proximidad a Santiago y a su condicin de relativamente protegido. Reviso la literatura y proveo informacin no publicada sobre este sitio. Un total de 132 referencias bibliogrficas describen la ecologa de San Carlos de Apoquindo, en alrededor de 30 tpicos. La vegetacin arbustiva y herbcea han sido bien estudiadas, pero poco se sabe acerca de sus respectivos bancos de semillas. Entre los animales, los micromamferos, conejos, y predadores rapaces y carnvoros son los mejor investigados, en tanto que los artrpodos epgeos, anfibios, lagartijas, culebras, aves paserinas y los carroeros de todo tipo son los menos estudiados. Temticamente, se han analizado interacciones planta/clima, planta/suelo, planta/herbvoro y herbvoro/predador, as como la descomposicin de cadveres animales. Sin embargo, hay desbalances grandes en la profundidad con que se han tratado estos tpicos. Los aspectos mejor estudiados se refieren a interacciones planta/herbvoro y herbvoro/predador. Hasta ahora, no exista descripcin detallada de suelos y clima en el rea, que aqu presento. Aprovechando el aspecto de largo plazo de la investigacin en el sitio, destaco los patrones de variacin temporal. Y aprovechando la presencia de diferentes unidades de paisaje en el sitio, tambin destaco su variabilidad espacial. En general, San Carlos de Apoquindo ha contribudo grandemente al entendimiento de los procesos ecolgicos en Chile central. Llamo a realizar esfuerzos renovados para estudiar la ecologa de este sitio desde una perspectiva ecosistmica

  12. Aspectos biolgicos de Harmonia axyridis alimentada com duas espcies de presas e predao intraguilda com Eriopis connexa Biological aspects of Harmonia axyridis fed on two prey species and intraguild predation with Eriopis connexa

    Natlia Ribeiro Pereira dos Santos

    2009-06-01

    Full Text Available O objetivo deste trabalho foi determinar os aspectos biolgicos de Harmonia axyridis, alimentada com duas espcies de presas, e a ocorrncia de predao intraguilda com Eriopis connexa. Larvas de H. axyridis foram alimentadas diariamente com ovos de Anagasta kuehniella ou com o pulgo Schizaphis graminum. Adultos da joaninha foram separados em dez casais que receberam o mesmo tipo de alimento da fase larval. Na avaliao da predao, uma larva de quarto instar de cada espcie foi mantida na presena ou ausncia de abrigo e de ovos de A. kuehniella. A fase larval de H. axyridis durou 10,2 e 8,9 dias, quando alimentada com A. kuehniella e S. graminum, respectivamente. A sobrevivncia do predador, em fase imatura, variou de 70 a 100%. A joaninha apresentou perodo de oviposio de 47,3 e 51,7 dias, com 887,6 e 822,5 ovos, ao se alimentar de A. kuehniella e S. graminum, respectivamente. A longevidade das fmeas foi de 74,1 e 76,2 dias e a dos machos de 67,3 e 70,3 dias, em A. kuehniella e S. graminum, respectivamente. H. axyridis atuou como predador intraguilda e foi a espcie dominante na competio com E. connexa.The objective of this work was to determine the biological aspects Harmonia axyridis, fed on two prey species, and the occurrence of intraguild predation with Eriopis connexa. Larvae of H. axyridis were fed daily with Anagasta kuehniella eggs or Schizaphis graminum aphid. Adults of H. axyridis were separated in ten couples which received the same food type of the larval stage. For the estimation of predation, a fourth instar larva of each species was maintained in the presence or absence of shelter and eggs of A. kuehniella. The larval stage lasted 10.2 days, when H. axyridis fed on A. kuehniella eggs, and 8.9 days when reared with S. graminum. The survival of predator during immature stages ranged from 70 to 100%. H. axyridis had an oviposition period of 47.3 and 51.7 days, laying a total of 887.6 and 822.5 eggs, when fed on A. kuehniella and S. graminum, respectively. Females had longevity of 74.1 and 76.2 days, and males of 67.3 and 70.3 days, fed on A. kuehniella and S. graminum, respectively. H. axyridis acted as an intraguild predator and was the dominant species in the competition with E. connexa.

  13. Diel density variation of amphipods associated with Sargassum beds from two shores of Ubatuba, Southeastern, Brazil Variação ao longo do dia na densidade de anfípodos associados a bancos de Sargassum em duas praias de Ubatuba, SP, Brasil

    Fosca P. P. Leite

    2007-12-01

    Full Text Available Densities of mobile epifaunal assemblages associated with macrophytes are very variable during the day and the activity of visually-oriented predators is thought to have an important influence on this pattern. Here we compared densities of amphipods associated with a common brown alga, Sargassum stenophyllum (Phaeophyceae, at sites contrasting in water turbidity. We expected that diel variation of amphipods would occur in a shore with clear waters (Perequê, whereas no variation was expected in a shore with turbid waters (Lamberto. Amphipod density varied during the day at both shores, with no indication of a larger variation at Perequê. Most species showed two density peaks, one at night and the other in the afternoon. These peaks occurred close the times of high tide, suggesting that tidal rhythms could influence more amphipod densities than the activity of predators. Thus, more studies are necessary to understand factors that influence short-term variation of epifaunal assemblages.As densidades da epifauna móvel associada a macrófitas variam muito ao longo do dia, sendo a atividade de predadores visualmente orientados um dos principais fatores apontados para explicar este padrão. Neste estudo, comparamos as densidades de anfípodos associados a uma alga parda comum, Sargassum stenophyllum (Phaeophyceae, em praias contrastando em turbidez da água. Era esperada a ocorrência de variação ao longo do dia numa praia com águas claras (Perequê e nenhuma variação na praia com águas turvas (Lamberto. A densidade de anfípodos variou ao longo do dia em ambas as praias, sem indicação de maior variação em Perequê. A maioria das espécies apresentou dois picos de densidade: um à noite e outro à tarde. Estes ocorreram próximos aos períodos de maré alta, sugerindo que o ritmo de maré poderia influenciar mais as densidades de anfípodos que a atividade de predadores. Assim, mais estudos são necessários para se compreender os fatores que influenciam a variação de curto prazo das comunidades epifaunais.

  14. Predao e remoo de sementes de cinco espcies de palmeiras por Guerlinguetus ingrami (Thomas, 1901 em um fragmento urbano de Floresta Atlntica Montana Predation and removal of seeds from five species of palms by Guerlinguetus ingrami (Thomas, 1901 in an urban fragment of the Montane Atlantic Forest

    Luci Ferreira Ribeiro

    2010-08-01

    Full Text Available Em um fragmento urbano de Floresta Ombrfila Densa Montana no Estado do Esprito Santo (Sudeste do Brasil, foram avaliados o padro de frugivoria e as propores de remoo, predao e armazenamento de frutos por Guerlinguetus ingrami, em relao a cinco espcies de palmeira (Syagrus pseudococos, S. ruschiana, Bactris setosa, Polyandrococos caudescens e Euterpe edulis. As espcies de Arecaceae enquadram-se na sndrome associada disperso por G. ingrami, na qual as espcies de plantas apresentam alta produo, grandes frutos com poucas sementes envolvidas por endocarpos resistentes e que no so usadas por outros predadores de sementes arborcolas. Os resultados apontaram que existem diferenas no padro de frugivoria da espcie G. ingrami quando comparadas com as de espcies com a mesma sndrome; aquelas que possuem frutos maiores apresentaram maior taxa de remoo e de armazenamento de seus disporos. E, devido especificidade exibida por G. ingrami na atividade de disperso de sementes, este roedor dever atuar apenas em trocas compensatrias especficas em pequenos fragmentos defaunados. Portanto, a seletividade de G. ingrami poderia indicar que o seu papel como dispersor em pequenos fragmentos estaria restrito em funo da maior probabilidade de mortalidade associada s plantas preferencialmente dispersas por essa espcie, e sua atuao como predador de sementes deve ser quantificada para que os seus efeitos, em pequenos fragmentos, sejam mais bem compreendidos.This study investigated the fruvigory pattern of Guerlinguetus ingrami, considering the removal, predation and caching of the fruits of palm species (Syagrus pseudococos, S. ruschiana, Bactris setosa, Polyandrococos caudescens and Euterpe edulis in an urban forest fragment of the montane Atlantic forest in the state of Esprito Santo, Southeastern Brazil. These palm species show characteristics theoretically expected to be seen in plants dispersed by squirrels (trees with a high productivity and whose fruits are large, with few seeds covered by rigid endocarps and that are not utilized by other arborean seed predators. Here we describe differences in the frugivory pattern exhibited by G. ingrami towards plants with the same dispersal syndrome. The diaspores of species with larger fruits were removed and cached by the squirrel at rates higher than the palms with small fruits. As a result of the high specificity showed by the squirrel's activities related to seed dispersal, this rodent should be important in compensatory shifts only in small, defaunated forest fragments. Therefore, the selectivity of G. ingrami could indicate that its role as a seed dispersor into small forest fragments would be restricted, due to the grater likelihood of mortality associated to the plants scattered by this species. The role of G. ingrami as a seed predator must be quantified for the effects of its behavioral activities in small fragments to be understood.

  15. Food extraction by the males of Podisus nigrispinus (Dallas (Hemiptera: Pentatomidae from cotton leafworm larvae

    Alexandre Igor de Azevedo Pereira

    2010-10-01

    Full Text Available In this work, the effect of different densities (1, 3, 5, 7 and 9 of 3rd instar Alabama argillacea (Huebner larvae on food consumption by Podisus nigrispinus (Dallas males was evaluated. The densities established were converted to weight of prey offered: 13.4 mg (one larva, 33.3 mg (three larvae, 54.3 mg (five larvae, 81.8 mg (seven larvae, and 110.34 mg (nine larvae. The quantity of food consumed by P. nigrispinus increased with the prey density. The density of preys did not affect the time spent by the predator to ingest the food. The quantity of food extracted per minute was always higher in smaller densities and lower in higher densities. Males mean body weight did not differ statistically between the treatments tested, and weight gain was smaller in the first two densities tested. Relative consumption rates increased with the quantity of larvae offered. P. nigrispinus males might change its predatory behavior as a function of the quantity of prey available.O efeito de diferentes densidades (1, 3, 5, 7 e 9 de 3 lagartas do instar de Alabama argillacea (Huebner no consumo de alimento por machos de Podisus nigrispinus (Dallas foi avaliado em condies de laboratrio. As densidades utilizadas foram convertidas a peso de presa oferecida: 13,40 mg (1 lagarta, 33.30 mg (3 lagartas, 54,30 mg (5 lagartas, 81,80 mg (7 lagartas e 110,34 mg (9 lagartas. A quantidade de alimento consumido pelo macho de P. nigrispinus aumentou com a densidade da presa. A densidade da presa no afetou o tempo gasto pelo predador para ingerir o alimento. A quantidade de alimento extrado por minuto pelo predador foi sempre maior nas mais baixas densidades e menores nas mais altas densidades. O peso corpreo mdio dos machos de P. nigrispinus no difereriu entre os tratamentos testados e o seu ganho de peso foi menor nas duas primeiras densidades testadas. As taxas de consumo relativo aumentaram com a quantidade de lagartas oferecidas. Os machos de P. nigrispinus podem mudar seu comportamento predatrio em funo da quantidade de presas disponveis.

  16. Avaliao da predao de Podocnemis expansa e Podocnemis unifilis (Testudines, Podocnemididae) no rio Javas, Tocantins / Evaluation of predation in Podocnemis expansa and Podocnemis unifilis (Testudines, Podocnemididae) in the Javas River, Tocantins

    Giovanni, Salera Junior; Adriana, Malvasio; Thiago Costa Gonalves, Portelinha.

    2009-03-01

    Full Text Available Podocnemis expansa e P. unifilis so animais de vida longa, com uma demorada maturao sexual, o que influencia uma baixa taxa de substituio de indivduos. Suas populaes so caracterizadas por uma pequena mortalidade dos animais adultos, mas alta taxa de mortalidade de filhotes e embries. Sendo [...] a predao natural de ninhos e filhotes um dos fatores mais importantes do baixo sucesso de ecloso dessas espcies. No rio Javas, os ovos e recm-eclodidos podem ser predados por uma grande diversidade de animais: dentre as aves, urubus (Coragyps atratus e Cathartes aura), carcar (Polyborus plancus), jaburu (Jabiru mycteria); lagartos (Tupinambis teguixin) e mamferos de pequeno porte, coati (Nasua nasua) e cachorro-do-mato (Cerdocyon thous). Do total anual de desovas de P. unifilis em mdia 65,98% so predadas, sendo 41,68% de forma total e 24,30% parcialmente. Enquanto que apenas 5,31% das ninhadas de P. expansa so sempre parcialmente predadas. Dentre os predadores aquticos existem diversos peixes, principalmente piranhas (Serrasalmus nattereri) e jacars (Melanosuchus niger e Caimam crocodilus). Os predadores das fmeas de P. unifilis so: jacar-au (Melanosuchus niger), ona-pintada (Panthera onca) e ona-parda (Puma concolor). Enquanto que as fmeas de P. expansa em postura, somente so predadas por P. onca. As fmeas de P. unifilis em postura so predadas num total mdio de 3,93% anualmente, enquanto que para P. expansa a mdia anual 5,66% das fmeas. Abstract in english Podocnemis expansa and P. unifilis long lived with late sexual maturation, which influences a low replacement rate of individuals. Their populations are characterized by low adults mortality, but high mortality of embryos and hatchlings. The natural nest predation is an important factor for hatchlin [...] g success. In Javas River, the eggs and hatchlings can be predated by a large number of animals such as birds, vultures (Coragyps atratus and Cathartes aura), carcar (Polyborus plancus), jabiru (Jabiru mycteria); lizards (Tupinambis teguixin) and small mammals, coati (Nasua nasua) and crab-eating-fox (Cerdocyon thous). About 65,98% of nests of P. unifilis are predated (41,68% totally and 24,30% partially). Only 5,31% of P. expansa nests are partially predated. There are many aquatic predators, like carnivorous fish, mainly piranhas (Serrasalmus nattereri) and caimans (Melanosuchus niger e Caimam crocodilus). The predators of P. unifilis females are: black caiman (Melanosuchus niger), jaguar (Panthera onca) and puma (Puma concolor), and of P. expansa females is the P. onca. In average 3,93% of P. unifilis females are predated annually while that to P. expansa the average is 5,66%.

  17. Ecological relations between mangrove leaf litter and the spatial distribution of the gastropod Melampus coffeus in a fringe mangrove forest / Relaes ecolgicas entre a serrapilheira de manguezal e a distribuio espacial do gastrpodo Melampus coffeus em uma borda de floresta de mangue

    Diva S., Tavares; Rafaela C., Maia; Cristina, Rocha-Barreira; Helena, Matthews-Cascon.

    2015-03-01

    Full Text Available A serapilheira representa fonte de alimentos para diversos organismos que podem contribuir diretamente para a decomposio de matria orgnica. A presena fsica desses detritos vegetais pode modificar reas do ambiente e promover a formao de microhabitats, servindo de refgio para diversos animai [...] s contra predadores e dessecao. O gastrpode Melampus coffeus (Linnaeus, 1758) (Ellobiidae) comum em florestas de mangue na costa do Atlntico e se alimenta de folhas de mangue cadas. Nesse trabalho foi assumida a hiptese de que a distribuio espacial do Melampus coffeus diretamente afetada pela deposio de serapilheira no manguezal. Objetivou-se avaliar a distribuio espacial desses gastrpodes em relao serapilheira de mangue durante doze meses de coletas. A rea de estudo foi estabelecida no mdio esturio do rio Pacoti, Estado do Cear, Brasil onde foram determinadas duas zonas de diferentes perfis topogrficos. Amostras de Melampus coffeus e de serapilheira foram coletadas mensalmente. Os resultados indicaram que a presena de galhos na superfcie do solo do manguezal favorece a ocupao do ambiente por indivduos dessa espcie de molusco de menor tamanho, provavelmente porque indivduos menores so mais suscetveis ao ataque de predadores e dessecao e a presena de galhos pode formar microhabitats mais seguros. Abstract in english Leaf litter represents a food source to many organisms that may directly contribute to organic matter decomposition. In addition, the physical presence of these vegetal detritus contributes for the modification of some environmental areas and produce microhabitats that may act as a refuge against pr [...] edators and desiccation for many animals. The pulmonate gastropod Melampus coffeus (Linnaeus, 1758) (Ellobiidae) is a very common specie in Atlantic Coast mangrove forests and feeds on fallen mangrove leaves. It was hypothesized that the spatial distribution of Melampus coffeus is directly affected by mangrove leaf litter biomass deposition. Thus, this research aimed at evaluating the spatial distribution of these gastropods in relation to the biomass of mangrove leaf litter through a twelve-month period. The study area was established in the middle estuary of Pacoti River, state of Cear, Brazil where two adjacent zones with different topographic profiles were determined. Samples of Melampus coffeus and leaf litter were collected monthly, throughout a year, from the mangrove ground surface. The results indicated that the presence of twigs in mangrove litter favor the occupation by smaller individuals of M. coffeus, probably because smaller individuals are more susceptible to predator attacks and desiccation than larger ones, and twigs and branches may provide a safe microhabitat.

  18. Efeito do manejo de plantas daninhas sobre Neoseiulus californicus (Acari:Phytoseiidae em pomar de macieira Effect of weed management on Neoseiulus californicus (Acari:Phytoseiidae in apple orchard

    Lino Bittencourt Monteiro

    2002-12-01

    Full Text Available Avaliou-se a influência do manejo de plantas daninhas sobre o deslocamento de ácaros tetraniquídeos (Panonychus ulmi e Tetranychus urticae e do ácaro predador Neoseiulus californicus em um pomar de macieira 'Gala', onde foi implantado o controle biológico do ácaro vermelho, P. ulmi, por meio de liberações massais de N. californicus. As parcelas tiveram as plantas daninhas manejadas de três formas: sem manejo, com roçadas manuais e com herbicidas. As populações de ácaros foram avaliadas sobre as plantas daninhas, Plantago tormentosa e Erigeron sp, e sobre as folhas de macieira. As maiores populações de N. californicus foram observadas nas parcelas onde os manejos proporcionaram desenvolvimento de plantas daninhas na linha de plantio. Na parcela manejada com herbicida, houve maior população de ácaros tetraniquídeos sobre as macieiras, provavelmente, devido ao reduzido número de N. californicus. P. tormentosa foi o hospedeiro preferencial do ácaro predador. Concluiu-se que o manejo de plantas daninhas, na linha de plantio das macieiras, assume um importante papel no equilíbrio entre as populações de ácaros.The influence of weed management on tetranychid mites (Panonychus ulmi and Tetranychus urticae and phytoseids movement was evaluated. Neoseiulus californicus populations were released in an apple orchard for biological control of tetranychid mites. Three kinds of weed management were used: no weed control at all, manual control and control with herbicide. The mites were evaluated in Plantago tormentosa, Erigeron sp, and apple tree leaves. The highest population of N. californicus was observed where weed was not controlled. Tetranychid mites populations were abundant on apple trees when herbicide was used, probably due to the low population of N. californicus. P. tormentosa was the preferred host of phytoseids. The conclusion was that weed management plays an important role in the regulation of mite species in apple orchards.

  19. Comparação econômica entre controle biológico e químico para o manejo de ácaro-vermelho em macieira Economic comparison of biological and chemical control in the management of red spider mites in apple orchard

    Lino Bittencourt Monteiro

    2006-12-01

    Full Text Available O ácaro-vermelho da macieira, Panonychus ulmi (Acari: Tetranychidae, é uma importante praga na cultura da macieira em Fraiburgo - SC, e o controle biológico aplicado foi implantado em meados dos anos 90. O objetivo deste trabalho foi demonstrar os benefícios econômicos da utilização do controle biológico no manejo do ácaro-vermelho. A avaliação foi realizada em dois pomares comerciais de macieiras. Em um deles, foi implantado o controle biológico aplicado de ácaros, baseado na liberação do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae, seleção de inseticidas e manejo de ervas invasoras, e o outro pomar seguiu o manejo convencional de artrópodes, baseado na aplicação de produtos químicos para o controle de insetos, ácaros fitófagos e ervas invasoras. A análise econômica mostrou que os custos com mão-de-obra e máquinas foram semelhantes em ambos os pomares, entretanto os custos com acaricidas foram significativamente inferiores no pomar onde o manejo foi o controle biológico, demonstrando que, apesar da necessidade de investimentos em instalações para a criação do ácaro predador e custos de manutenção das mesmas, a estratégia biológica foi economicamente viável.Red spider mite, Panonychus ulmi (Acari: Tetranychidae is a significant pest in apple tree in Fraiburgo, Santa Catarina (SC and applied biological control was implemented in the mid-nineties. The objective of this study was to demonstrate the economic benefits of biological control in the management of red spider mite. The assessment was carried out in two commercial orchards, one of which was subjected to biological control of spider mite by releasing the predator Neoseiulus californicus, insecticide selection and weed management, and the other to conventional arthropod management, based on the application of chemicals to control insects, phytofagous mites and weed. Economic analysis showed that the costs for labor and machines were similar in both orchards; however acaricide costs were significantly lower in the orchard subjected to biological control, demonstrating that despite the need for investment in predator mite breeding apparatus and maintenance costs, the biological strategy was economically viable.

  20. Morphology of female reproductive tract of the predator Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed on different diets

    Walkymrio de Paulo Lemos

    2005-01-01

    Full Text Available The morphology of the reproductive tract of Podisus nigrispinus (Dallas females fed with Alabama argillacea (Hbner larvae, artificial diet, Tenebrio molitor L. larvae or Musca domestica L. larvae were studied. The reproductive tract of females of this species presented yellow coloration and independent of the diet, each ovary had seven ovarioles joined through terminal filaments and forming a bunch shape structure. The histological data revealed that the ovary of P. nigrispinus was of meroistic telotrophic type, with each individual ovariole divided in a terminal filament, a tropharium (trophic chamber, a vitellarium, and a pedicel. The prey type affected the development and morphometry of these structures. Females of P. nigrispinus fed with 3rd or 5th instar larvae of cotton leafworm (A. argillacea presented developed ovaries with ovarioles showing a great number of oocytes in advanced stages of development. Females fed with artificial diet presented atrophic ovaries and ovarioles practically without oocytes. Females fed with T. molitor or M. domestica showed ovaries in intermediary stage of development. The central ovariole was longer in females fed with 5th instar larvae of cotton leafworm and shorter in those fed with artificial diet. Most developed oocytes were observed in ovaries of females fed with 5th or 3rd instar larvae of cotton leafworm, and the majority of atrophic oocytes were found in females fed with artificial diet.Este estudo apresenta a morfologia do sistema reprodutor feminino de Podisus nigrispinus (Dallas alimentado com larvas de Alabama argillacea (Hbner, Musca domestica L. e de Tenebrio molitor L. ou dieta artificial. As gnadas internas desse predador apresentaram colorao amarelada e, independente da dieta, cada ovrio apresentou sete ovarolos unidos pelos filamentos terminais em uma estrutura em forma de cacho. A anlise histolgica revelou que o ovrio de P. nigrispinus do tipo merostico telotrfico com cada ovarolo dividido morfologicamente em filamento terminal, trofrio (cmara nutridora, vitelrio e pedicelo. A dieta recebida por esse predador alterou o desenvolvimento e a morfometria de seus ovrios. Fmeas de P. nigrispinus alimentadas com larvas de terceiro ou quinto estdio de A. argillacea apresentaram ovrios desenvolvidos com grande nmero de ovcitos em estgio avanado de desenvolvimento nos ovarolos. Fmeas com dieta artificial apresentaram ovrios atrofiados e ovarolos, praticamente, sem ovcitos em seu interior enquanto aquelas alimentadas com larvas de T. molitor ou M. domestica tiveram ovrios em estgios intermedirios de desenvolvimento. O comprimento do ovarolo central foi maior em fmeas alimentadas com larvas de quinto estdio de A. argillacea e menor naquelas com dieta artificial. Ovcitos em estgios mais avanados de desenvolvimento foram observados para fmeas alimentadas com larvas de terceiro ou quinto estdios de A. argillacea, enquanto ovcitos atrofiados foram observados para aquelas com dieta artificial.

  1. Toxicidade de acaricidas a ovos e adultos de Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae) / Toxicity of acaricides to eggs and adults of Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae)

    Geraldo Andrade, Carvalho; Csar Freire, Carvalho; Mrcio do Nascimento, Ferreira.

    2011-02-01

    Full Text Available Objetivou-se, neste trabalho, avaliar o efeito de treze acaricidas sobre ovos e adultos de Ceraeochrysa cubana (Hagen, 1861). Os acaricidas foram pulverizados por meio de torre de Potter, nas concentraes recomendadas para o controle de caros na cultura dos citros. Os ensaios foram conduzidos sob [...] condies controladas de 25 2 C, umidade relativa de 70 10% e fotofase de 12 horas. Os acaricidas no foram txicos ao predador em sua fase de ovo. Em relao aos adultos, o carbosulfan e o triazophos foram altamente txicos (100% de mortalidade), enquanto que os piretrides bifenthrin e fenpropathrin causaram mortalidade aproximadamente de 60%. Os acaricidas dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e xido de fenbutatin no provocaram mortalidade dos adultos de C. cubana. Flufenoxuron inibiu a capacidade de oviposio e provocou a inviabilizao dos ovos. Baseando-se na escala da IOBC, os acaricidas carbosulfan, triazophos e flufenoxuron foram enquadrados na classe 4 = nocivos; bifenthrin e fenpropathrin na classe 2 = levemente nocivos, e dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e xido de fenbutatin na classe 1 = incuos a C. cubana. Os compostos enquadrados na classe 1 podem ser recomendados em programas de manejo integrado de pragas de citros objetivando a integrao entre os mtodos qumico e biolgico por meio dessa espcie de predador. Abstract in english The objective of this work was to evaluate the effects of thirteen acaricides on eggs and adults of the lacewing Ceraeochrysa cubana (Hagen, 1861). The acaricides were sprayed using a Potter's tower at the rate recommended for mite control in citrus orchard. The trials were performed in climatic cha [...] mber at 25 2 C, 70 10% RH and photophase of 12 hours. The egg stage showed high tolerance to the tested acaricides. Carbosulfan and triazophos caused 100% adult mortality, whereas bifenthrin and fenpropathrin caused around 60%. All other acaricides, dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin and fenibutatin oxide did not cause mortality of C. cubana adult. Flufenoxuron reduced adult egg laying and all eggs were nonviable. According to IOBC scale, the acaricides carbosulfan, triazophos and flufenoxuron were classified into class 4 = harmful; bifenthrin and fenpropathrin into class 2 = slightly toxic; and dicofol, clofentezine, abamectin, hexythiazox, cyhexatin, and fenbutatin oxide into class 1 = harmless to C. cubana. The compounds classified as first class may be recommended in programs of integrated pest management of citrus aiming at the integration between the biological and chemical control through this kind of predator.

  2. Impact and Selectivity of Insecticides to Predators and Parasitoids

    Flávio Fernandes

    2010-04-01

    Resumo.Dentre os problemas advindos do uso de inseticidas, a destruição de inimigos naturais é fator importante. Estes insetos benéficos podem reduzir problemas de erupção de pragas secundárias, ressurgência de pragas e manter a praga abaixo do nível de dano econômico. Dessa forma a conservação de inimigos naturais, para que os mesmos exerçam alta performance frente às pragas, é de extrema importância em controle biológico de pragas. Método de controle essencial utilizados nos programas de manejo integrado de pragas. Tendo em vista os impactos negativos dos inseticidas na agricultura e os seus efeitos adversos sobre os inimigos naturais, este artigo visa abordar dois assuntos importantes, que para isso é dividido em três partes. A parte I relacionada com o reconhecimento das principais pragas agrícolas e seus inimigos naturais; a parte II envolve o impacto dos inseticidas sobre os predadores e parasitóides e a parte III abordará sobre a seletividade dos diversos grupos de inseticidas aos inimigos naturais. Antes de se pulverizar inseticida é necessário a escolha de um produto que seja seletivo e eficiente, assim torna-se imprescindível identificar de forma correta os grupos e espécies de inimigos naturais. Uma vez que os inseticidas apresentam impacto sobre a sobrevivência, o crescimento e desenvolvimento, na reprodução (razão sexual, fecundidade, longevidade e fertilidade, no comportamento (mobilidade, orientação, alimentação, oviposição e aprendizado. Os mecanismos de toxicidade e seletividade dos inseticidas estão relacionados às propriedades de maior ou menor solubilidade e peso molecular. Além disso, características da composição cuticular do integumento dos inimigos naturais são de extrema importância na seletividade de um produto ou a tolerância de determinado predador ou parasitóide.

  3. Roadkills of vertebrates in Venezuela Vertebrados mortos em estradas na Venezuela

    Jan Pinowski

    2005-03-01

    Full Text Available This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October. During five passages on this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758 (Myrmecophagidae, 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae. Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-outubro. Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae, durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 raposas Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766 (Myrmecophagidae, 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae. Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.

  4. Análisis comparativo de la alimentación del gato montés (Lynx Rufus en dos diferentes ambientes de México

    Marcelo Aranda

    2002-01-01

    Full Text Available En el presente trabajo se analiza, en forma comparativa, la alimentación del gato montés en dos localidades con ambientes diferentes: la primera es el predio “El Plomito”, Sonora, con vegetación de matorrales áridos, y la segunda es la Sierra del Ajusco, en el sur de la Cuenca de México, donde predominan los bosques de coníferas. Mediante el análisis de 197 y 922 excretas, se identificaron 18 y 28 presas diferentes, respectivamente. En ambas localidades, los grupos de especies presa que aportaron mayor biomasa a la alimentación del gato montés fueron los lagomorfos, con 74.2% en El Plomito y 70.0% en El Ajusco, y los roedores con 18.9 y 18.7%, en el mismo orden. En El Plomito la presa más importante fue Sylvilagus audubonii (35.5%, seguida por Lepus sp. (31.5%, Neotoma albigula (14.0%, Odocoileussp. (2.9% y Spermophilus variegatus (1.7%. En El Ajusco la presa más importante fue Sylvilagus floridanus(41.6%, seguida por Sylvilagus cunicularius (15.4%, Romerolagus diazi (12.3%, Cratogeomys merriami (5.1% y Sciurus aureogaster (4.9%. Los resultados obtenidos apoyan la teoría de que el gato montés, al igual que las otras especies de linces, es un depredador especialista en la caza de lagomorfos.

  5. New records of stink bugs (Hemiptera: Pentatomidae) from Colombia.

    Castro-Huertas, Valentina; Schwertner, Cristiano F; Fernández, Fernando

    2015-01-01

    New records of genera and species of stink bugs (Hemiptera: Pentatomidae) from Colombia are provided. Two genera are new records for South America: Alathetus and Schraderiellus. Fifteen genera are new record for Colombia: Agaclitus, Boea, Ceratozygum, Euthyrhynchus, Eritrachys, Doesburguedessa, Lopadusa, Marmessulus, Paralincus, Patanius, Peromatus, Phalaecus, Phoeacia, Rio, and Tyrannocoris. Forty-nine species from five subfamiles are recorded for the first time in Colombia. Asopinae: Coryzorhaphis carneolus Erichson, Coryzorhaphis superba Breddin, Euthyrhynchus floridanus (Linnaeus), Podisus sagitta Fabricius, Stiretrus anchorago (Fabricius), Stiretrus cinctellus Germar, Tylospilus peruvianus Horvath, Tyrannocoris nigriceps Thomas. Cyrtocorinae: Ceratozygum horridum (Germar). Discocephalinae: Agaclitus dromedarius Stål, Antiteuchus melanoleucus (Westwood), Antiteuchus sepulcralis (Fabricius), Dinocoris gibbosus (Fallou), Dinocoris variolosus (Linnaeus), Discocephalessa terminalis (Walker), Dryptocephala crenata Ruckes, Dryptocephala dentifrons (Latreille), Eurystethus ovalis Ruckes, Paralcippus dimidiatus (Ruckes), Alathetus rufitarsus Dallas, Eritrachys bituberculata Ruckes, Paralincus bimaculatus (Ruckes), Schraderiellus cinctus (Ruckes), Xynocoris recavus (Garbelotto & Campos). Edessinae: Brachystethus cribus (Fabricius), Brachystethus tricolor Bolívar, Doesburguedessa elongatispina Fernandes and Lopadusa fuscopunctata (Distant). Pentatominae: Banasa fulgida Thomas, Banasa paraexpallescens Thomas, Dichelops divisus (Walker), Dichelops nigrum Bergroth, Euschistus carbonerus Rolston, Mormidea bovilla (Distant), Mormidea triangularis (Walker), Murgantia bifasciata Herrich-Schaeffer, Murgantia violascens (Westwood), Oebalus pugnax (Fabricius), Oebalus ypsilon-griseus (DeGeer), Odmalea concolor (Walker), Patanius vittatus Rolston, Proxys albopunctulatus (Palisot), Proxys punctulatus (Palisot), Rhyncholepta grandicallosa Bergroth, Rio insularis Ruckes, Roferta marginalis (Herrich-Schäffer), Serdia concolor Ruckes, Sibaria armata (Dallas) and Taurocerus achilles (Stål). These new records for Colombia are importanst for the understanding of the distributional range of the genera and species involved. PMID:26249877

  6. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Qul., P. sapidus Qul., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as ?-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, ?-carotene ranged from 0.134 to 0.221 ?g/100 g, and lycopene from 0.055 to 0 .075 ?g/100 g. PMID:23510284

  7. Genetic diversity of Kenyan native oyster mushroom (Pleurotus).

    Otieno, Ojwang D; Onyango, Calvin; Onguso, Justus Mungare; Matasyoh, Lexa G; Wanjala, Bramwel W; Wamalwa, Mark; Harvey, Jagger J W

    2015-01-01

    Members of the genus Pleurotus, also commonly known as oyster mushroom, are well known for their socioeconomic and biotechnological potentials. Despite being one of the most important edible fungi, the scarce information about the genetic diversity of the species in natural populations has limited their sustainable utilization. A total of 71 isolates of Pleurotus species were collected from three natural populations: 25 isolates were obtained from Kakamega forest, 34 isolates from Arabuko Sokoke forest and 12 isolates from Mount Kenya forest. Amplified fragment length polymorphism (AFLP) was applied to thirteen isolates of locally grown Pleurotus species obtained from laboratory samples using five primer pair combinations. AFLP markers and internal transcribed spacer (ITS) sequences of the ribosomal DNA were used to estimate the genetic diversity and evaluate phylogenetic relationships, respectively, among and within populations. The five primer pair combinations generated 293 polymorphic loci across the 84 isolates. The mean genetic diversity among the populations was 0.25 with the population from Arabuko Sokoke having higher (0.27) diversity estimates compared to Mount Kenya population (0.24). Diversity between the isolates from the natural population (0.25) and commercial cultivars (0.24) did not differ significantly. However, diversity was greater within (89%; P > 0.001) populations than among populations. Homology search analysis against the GenBank database using 16 rDNA ITS sequences randomly selected from the two clades of AFLP dendrogram revealed three mushroom species: P. djamor, P. floridanus and P. sapidus; the three mushrooms form part of the diversity of Pleurotus species in Kenya. The broad diversity within the Kenyan Pleurotus species suggests the possibility of obtaining native strains suitable for commercial cultivation. PMID:25344263

  8. DIAGNÓSTICO TAXONÓMICO DE LA FAMILIA TENUIPALPIDAE (ACARI: TETRANYCHOIDEA EN EL VALLE DEL CAUCA (COLOMBIA

    Mesa Nora Cristina

    2013-07-01

    Full Text Available Varias especies de ácaros de la familia Tenuipalpidae, especialmente las del géneroBrevipalpus Donnadieu, son reconocidas como vectores de enfermedades viralesen diferentes cultivos comerciales. La falta de estudios taxonómicos en esta familiade ácaros en Colombia y la posibilidad de introducir en forma accidental especiesde estos ácaros planos, son una amenaza para la bioseguridad de la producciónfrutícola del país. El objetivo de este trabajo es contribuir a la identificación de lasespecies de Tenuipalpidae en la vegetación silvestre y cultivada en el departamentodel Valle del Cauca y confirmar la identidad taxonómica de las especies deBrevipalpus en cítricos, guayaba, maracuyá, café y orquídeas. Las recoleccionesde ejemplares se realizaron en épocas seca y lluviosa en varios municipios deldepartamento. El montaje de los ácaros se realizó en medio Hoyer. La especiepredominante en todas las localidades y en los hospedantes recolectados fueBrevipalpus phoenicis Geijskes (1939. Por el contrario, B. obovatus Donnadieuse encontró en poblaciones muy bajas en limón Tahití y mandarina en algunaslocalidades de Palmira. Tenuipalpus anacardii De León se presentó en Anacardiumexcelsum (Bertero y Balb. ex Kunth Skeels, en el municipio de Roldanillo y T.pacificus Baker se encontró en el corregimiento de Rozo, municipio de Palmira,sobre plantas importadas de un cultivo comercial de Dendrobium sp., mientrasque Dolichotetranychus floridanus (Banks solamente se encontró sobre Ananascomosus (L. Merr., en muestras recolectadas en Cali

  9. Micropaleontological data (dinocysts, nannoplankton, spores and pollen) and biostratigraphy of the Alkun Formation, North Ossetia

    Filippova, N. Yu.; Beluzhenko, E. V.; Golovina, L. A.

    2010-06-01

    The initially obtained data characterize organic-walled phytoplankton (dinocysts), nannoplankton, spores, and pollen from the Upper Argun, Alkun, and Lower Assa deposits of the Fiagdon and Mairamadag sections situated on the southeast of North Ossetia (North Caucasus) in the Alkun Formation stratotype area. The lithology of the formation is described, and its position in the Oligocene-Miocene succession is considered. According to the analyzed data on organic-walled phytoplankton from the Fiagdon and Mairamadag sections, the transitional late Oligocene-early Miocene dinoflora from the top of the Argun Formation and the lower part of the Alkun Formation is in general of the Miocene aspect. Based on the dinocysts, deposits from the upper part of the Alkun Formation coupled with the Assa Formation are attributed to the lower Miocene. The entire interval of the studied deposits corresponds to the acme subzone Def of the Ebu Zone in the Mediterranean dinocyst zonation by D. Zevenboom, where it spans the top of the Chattian and lower part of the Aquitanian Stage. Nannoplankton assemblages from the Alkun deposits are tentatively correlated with the nannoplankton assemblage of Zone NN1 in the standard zonation by E. Martini. It is impossible to date precisely the Alkun Formation based on nannoplankton, as the respective deposits are lacking index species and characteristic taxa of the standard zonation. The dominance of the cosmopolitan species Cyclicargolithus floridanus is a peculiar feature of nannoplankton assemblages from the Alkun Formation. Palynological data are used to consider the dynamics of the evolution of the vegetation cover and climate. Four episodes of relative cooling are distinguished against a background of warm-temperate climatic conditions in general. The most significant episodes occurred in the mid-Alkun time and during the early phase of the Assa time.

  10. Evidence for and geomorphologic consequences of a reptilian ecosystem engineer: The burrowing cascade initiated by the Gopher Tortoise

    Kinlaw, A.; Grasmueck, M.

    2012-07-01

    Physical ecosystem engineers often make major, durable physical constructs that can provide living space for other species and can structure local animal communities over evolutionary time. In Florida, a medium sized chelonian, the Gopher Tortoise (Gopherus polyphemus) will excavate extensive subterranean chambers that can endure for long periods of time. The tortoise starts a 'burrowing cascade', by first excavating a larger burrow that may extend 10 m, which is then re-engineered by Florida Mice (Podomys floridanus) and other rodents that dig smaller side-burrows and pockets. This sequence is often followed by an invertebrate, the camel cricket (Ceuthophilus labibuli) which is reported to excavate even smaller chambers. Our first aim was to quantify the zoogeomorphic impact of this burrowing cascade by measuring the amount of soil excavated in a large sample of burrows in two communities. Secondly, we hypothesized that the high biodiversity reported for these structures might be related to the quasi-fractal nature of the geometry, following the work of Frontier (1987). To visualize this underground geometry, we used high-resolution 3D Ground Penetrating Radar (GPR), which provided images and insights previously unobtainable using excavations or 2D GPR. Our images verified that the active tortoise burrow had a spiraling shape, but also showed splits in the larger burrow apparently dug by tortoises. For the first time, the smaller Florida Mouse burrows were imaged, showing side loops that exit and re-renter the tortoise burrow. This study also presents new information by making the discovery of numerous remnants of past tortoise burrows underground in the sampling grid surrounding the active burrow. Our third aim was to interpret our field results with previous ecological field studies to evaluate the strength of evidence that this species ranks as an ecosystem engineer.

  11. The safety of ONRAB® in select non-target wildlife.

    Fry, Tricia L; Vandalen, Kaci K; Duncan, Colleen; Vercauteren, Kurt

    2013-08-20

    ONRAB(®) is a recombinant human adenovirus type 5 (HAd5) with the rabies glycoprotein gene incorporated into its genome. ONRAB(®) has been used in Canada as an oral rabies vaccine in target wildlife species such as: red fox (Vulpes vulpes), raccoon (Procyon lotor), and striped skunk (Mepthis mephitis). We evaluated the safety of ONRAB(®) in non-target wildlife species likely to contact the vaccine baits during oral rabies vaccine campaigns in the United States. We investigated the effects of oral inoculation of high titer ONRAB(®), approximately ten times the dose given to target species, in wood rats (Neotoma spp.), eastern cottontail rabbits (Sylvilagus floridanus), Virginia opossums (Didelphis virginiana), eastern wild turkeys (Meleagris gallopavo silvestri), and fox squirrels (Sciurus niger). We performed real-time polymerase chain reaction (PCR) on fecal swabs, oral swabs, and tissues, including lung, liver, kidney, small intestine, large intestine, and when appropriate nasal turbinates, to detect ONRAB(®) DNA from inoculated animals. By seven days post-inoculation, turkeys, opossums, and cottontails had all stopped shedding ONRAB(®) DNA. One wood rat and one fox squirrel still had detectable levels of ONRAB(®) DNA in fecal swabs 14 days post-inoculation. Real-time PCR analysis of the tissues revealed some ONRAB(®) DNA persisting in certain tissues; however, there were no significant gross or histologic lesions associated with ONRAB(®) in any of the species studied. Our results suggest that many non-target species are not likely to be impacted by the distribution of ONRAB(®) as part of oral rabies vaccination programs in the United States. PMID:23831321

  12. Phylogeographic Analyses of American Black Bears (Ursus americanus) Suggest Four Glacial Refugia and Complex Patterns of Postglacial Admixture.

    Puckett, Emily E; Etter, Paul D; Johnson, Eric A; Eggert, Lori S

    2015-09-01

    Studies of species with continental distributions continue to identify intraspecific lineages despite continuous habitat. Lineages may form due to isolation by distance, adaptation, divergence across barriers, or genetic drift following range expansion. We investigated lineage diversification and admixture within American black bears (Ursus americanus) across their range using 22 k single nucleotide polymorphisms and mitochondrial DNA sequences. We identified three subcontinental nuclear clusters which we further divided into nine geographic regions: Alaskan (Alaska-East), eastern (Central Interior Highlands, Great Lakes, Northeast, Southeast), and western (Alaska-West, West, Pacific Coast, Southwest). We estimated that the western cluster diverged 67 ka, before eastern and Alaskan divergence 31 ka; these divergence dates contrasted with those from the mitochondrial genome where clades A and B diverged 1.07 Ma, and clades A-east and A-west diverged 169 ka. We combined estimates of divergence timing with hindcast species distribution models to infer glacial refugia for the species in Beringia, Pacific Northwest, Southwest, and Southeast. Our results show a complex arrangement of admixture due to expansion out of multiple refugia. The delineation of the genomic population clusters was inconsistent with the ranges for 16 previously described subspecies. Ranges for U. a. pugnax and U. a. cinnamomum were concordant with admixed clusters, calling into question how to order taxa below the species level. Additionally, our finding that U. a. floridanus has not diverged from U. a. americanus also suggests that morphology and genetics should be reanalyzed to assess taxonomic designations relevant to the conservation management of the species. PMID:25989983

  13. Novel Hepatozoon in vertebrates from the southern United States.

    Allen, Kelly E; Yabsley, Michael J; Johnson, Eileen M; Reichard, Mason V; Panciera, Roger J; Ewing, Sidney A; Little, Susan E

    2011-08-01

    Novel Hepatozoon spp. sequences collected from previously unrecognized vertebrate hosts in North America were compared with documented Hepatozoon 18S rRNA sequences in an effort to examine phylogenetic relationships between the different Hepatozoon organisms found cycling in nature. An approximately 500-base pair fragment of 18S rDNA common to Hepatozoon spp. and some other apicomplexans was amplified and sequenced from the tissues or blood of 16 vertebrate host species from the southern United States, including 1 opossum (Didelphis virginiana), 2 bobcats (Lynx rufus), 1 domestic cat (Felis catus), 3 coyotes (Canis latrans), 1 gray fox (Urocyon cinereoargenteus), 4 raccoons (Procyon lotor), 1 pet boa constrictor (Boa constrictor imperator), 1 swamp rabbit (Sylvilagus aquaticus), 1 cottontail rabbit (Sylvilagus floridanus), 4 woodrats (Neotoma fuscipes and Neotoma micropus), 3 white-footed mice (Peromyscus leucopus), 8 cotton rats (Sigmodon hispidus), 1 cotton mouse (Peromyscus gossypinus), 1 eastern grey squirrel (Sciurus carolinensis), and 1 woodchuck (Marmota monax). Phylogenetic analyses and comparison with sequences in the existing database revealed distinct groups of Hepatozoon spp., with clusters formed by sequences obtained from scavengers and carnivores (opossum, raccoons, canids, and felids) and those obtained from rodents. Surprisingly, Hepatozoon spp. sequences from wild rabbits were most closely related to sequences obtained from carnivores (97.2% identical), and the sequence from the boa constrictor was most closely related to the rodent cluster (97.4% identical). These data are consistent with recent work identifying prey-predator transmission cycles in Hepatozoon spp. and suggest this pattern may be more common than previously recognized. PMID:21506825

  14. Thysanoptera (Thrips) Within Citrus Orchards in Florida: Species Distribution, Relative and Seasonal Abundance Within Trees, and Species on Vines and Ground Cover Plants

    Childers, Carl C.; Nakahara, Sueo

    2006-01-01

    Seven citrus orchards on reduced to no pesticide spray programs were sampled for Thysanoptera in central and south central Florida. Inner and outer canopy leaves, fruits, twigs, trunk scrapings, vines and ground cover plants were sampled monthly between January 1995 and January 1996. Thirty-six species of thrips were identified from 2,979 specimens collected from within citrus tree canopies and 18,266 specimens from vines and ground cover plants within the seven citrus orchards. The thrips species included seven predators [Aleurodothrips fasciapennis (Franklin), Karnyothrips flavipes (Jones), K. melaleucus (Bagnall), Leptothrips cassiae (Watson), L. macroocellatus (Watson), L. pini (Watson), and Scolothrips sexmaculatus (Pergande)] 21 plant feeding species [Anaphothrips n. sp., Arorathrips mexicanus (Crawford), Aurantothrips orchidaceous (Bagnall), Baileyothrips limbatus (Hood), Chaetanaphothrips orchidii (Moulton), Danothrips trifasciatus (Sakimura), Echinothrips americanus (Morgan), Frankliniella bispinosa (Morgan), F. cephalica (Crawford), F. fusca (Hinds), F. gossypiana (Hood), Frankliniella sp. (runneri group), Haplothrips gowdeyi (Franklin), Heliothrips haemorrhoidalis (Bouché), Leucothrips piercei (Morgan), Microcephalothrips abdominalis (Crawford), Neohydatothrips floridanus (Watson), N. portoricensis (Morgan), Pseudothrips inequalis (Beach), Scirtothrips sp., and Thrips hawaiiensis (Morgan)]; and eight fungivorous feeding species [Adraneothrips decorus (Hood), Hoplandrothrips pergandei (Hinds), Idolothripinae sp., Merothrips floridensis (Watson), M. morgani (Hood), Neurothrips magnafemoralis (Hinds), Stephanothrips occidentalis Hood and Williams, and Symphyothrips sp.]. Only F. bispinosa, C. orchidii, D. trifasciatus, and H. haemorrhoidalis have been considered economic pests on Florida citrus. Scirtothrips sp. and T. hawaiiensis were recovered in low numbers within Florida citrus orchards. Both are potential pest species to citrus and possibly other crops in Florida. The five most abundant thrips species collected within citrus tree canopies were: A. fasciapennis, F. bispinosa, C. orchidii, K. flavipes, and D. trifasciatus. In comparison, the following five thrips species were most abundant on vines or ground cover plants: F. bispinosa, H. gowdeyi, F. cephalica, M. abdominalis, and F. gossypiana. Fifty-eight species of vines or ground cover plants in 26 families were infested with one or more of 27 species of thrips. PMID:20233100

  15. Natural history of interaction between Meteorus sp. Haliday, 1835 (Hymenoptera: Braconidae) and its hyperparasitoid Toxeumella albipes Girault, 1913 (Hymenoptera: Pteromalidae) / Histria natural da interao entre Meteorus sp. Haliday, 1835 (Hymenoptera: Braconidae) e seu hiperparasitoide Toxeumella albipes Girault, 1913 (Hymenoptera: Pteromalidae)

    JF, Sobczak; DP, Maia; JCMS, Moura; VA, Costa; J, Vasconcellos-Neto.

    2012-02-01

    Full Text Available Alguns parasitoides constroem um agregado de casulos que fica pendurado no corpo do hospedeiro at a emergncia dos adultos, o que uma vantagem contra o ataque de predadores que vasculham a vegetao em busca de presas. No entanto, tal comportamento no eficiente contra o ataque de hiperparasito [...] ides. Este estudo registra a interao entre a lagarta Manduca sexta Linnaeus, 1763 (Lepidoptera, Sphingidae) parasitada por larvas de Meteorus sp. (Hymenoptera, Braconidae), e seu hiperparasitoide Toxeumella albipes (Hymenoptera, Pteromalidae). Esta a primeira descrio do ataque e da oviposio de T. albipes. Abstract in english Some parasitoids build a cocoon mass that hangs in the host body until the adults emergence, which is an advantage against attack by predators who troll the vegetation in search of prey. However, such behaviour is not effective against the hyperparasitoid attacks. This study reports the interaction [...] between the caterpillar Manduca sexta Linnaeus, 1763 (Lepidoptera, Sphingidae) parasitised by Meteorus sp. (Hymenoptera, Braconidae) larvae and its hyperparasitoid Toxeumella albipes (Hymenoptera, Pteromalidae). This is the first description of the attack and oviposition of T. albipes.

  16. caro branco do algodo Polyphagotarsonemus latus (Banks, 1904) (Acari: Tarsonemidae) e ensaio de combate qumico / The tropical mite on cotton Polwhaqolarswnemus latus (Banks, 1904) (Acari: Tarsonemidae) and test of chemical control

    R.C., Rangel; R., Hamamura; E.B., Regitano; F.Y., Arashiro; M.C., Rangel; A.I., Clari; F.A.M., Mariconi.

    Full Text Available Com o intuito de avaliar o desempenho de produtos qumicos no combate ao "caro branco" Polyphagotarsonemus latus (Banks, 1904) em algodoeiro, instalou-se o presente trabalho. Os 7 tratamentos, com 4 repeties, foram os seguintes: A) testemunha; B) triazofs, 300g; C) triazofs, 150g + feromnios ( [...] alquenis multimetlicos), 4,77g; D) propargite, 1,080g; E) abamectina, 6g + feromnios (alquenis multimetlicos), 6,67g; F) profenofs, 400g; G) enxofre, 3.000g. As quantidades acima so de ingredientes ativos por hectare. Os melhores resultados foram conseguidos pelo triazofs, seguido pelo enxofre e as duas misturas com feromnios. Abstract in english Chemical control of the tropical mite was evaluated by means of a field test conducted in Tiete, State of So Paulo, Brazil. Seven treatments with four replicates each were applied to plots of 150m. Treatments and their respective active ingredients were as follows: A) check; B) triazophos, 300g; C [...] ) triazophos, 150g + pheromones (multimethyl alkenols), 4.77g; D) propargite, 1080g; E) abamectin, 6g + pheromones (multimethyl alkenols), 6.67g; F) profenophos, 400g; G) sulfur, 3000g. Best results were obtained with treatment B (triazophos), followed by G (sulfur) and the two mixtures with pheromones (C and E) (triazophos plus multimethyl alkenols and abamectin plus multimethyl alkenols) (tables 2, 3 and 4). Predador mites were considered.

  17. Categorização funcional trófica das comunidades de macroinvertebrados de dois reservatórios na região Centro-Oeste do Estado de São Paulo, Brasil - DOI: 10.4025/actascibiolsci.v31i1.331 Functional feeding groups of benthics macroinvertebrates communities of two lentic systems in the central west region of São Paulo State - DOI: 10.4025/actascibiolsci.v31i1.331

    Jandira Liria Biscalquini Talamoni

    2009-04-01

    Full Text Available A utilização do conceito de guilda pode ser útil para a categorização funcional trófica de comunidades, pois não há obrigatoriedade da identificação dos organismos em nível de espécie, nem de tratar cada espécie como uma entidade separada. O objetivo deste estudo foi analisar os grupos funcionais tróficos (coletores-catadores, coletores-filtradores, fragmentadores, predadores e raspadores das comunidades de macroinvertebrados de dois reservatórios da região Centro-Oeste do Estado de São Paulo, Brasil. As amostragens foram realizadas nos períodos chuvoso (março/abril - 2001 e de seca (julho/agosto - 2001 e os dados obtidos indicam que os coletores-catadores foram a guilda mais frequente. Este fato sugere grande importância da matéria orgânica como recurso alimentar na dieta dos macroinvertebrados analisados.The aim of this study was analyze the functional feeding groups (collectors, shredders, predators and grazer-scrapers of benthic macroinvertebrates communities in two lentic systems in the central west region of São Paulo State. The samples were realized in rainy (March/April - 2001 and dry (July/August - 2001 seasons. The results obtained contribute for the best knowledgement of benthic macroinvertebrate community on those two systems.

  18. Lesiones post mortales por fauna cadavérica: La acción de las hormigas sobre el cadáver Post-mortal injuries by cadaveric fauna: The action of the ants on human corpses

    P.M. Garamendi

    2008-04-01

    Full Text Available Los animales pueden actuar como predadores de los restos humanos y las lesiones postmortales que infligen en los cadáveres pueden dar lugar a errores de interpretación de los hallazgos en las autopsias forenses. Entre la fauna cadavérica, las hormigas constituyen un caso excepcional al ser los únicos insectos que pueden iniciar su actividad predadora antes de instaurarse la putrefacción. Las hormigas suelen producir lesiones que por su asiento y morfología resultan típicas. Se presenta un caso en el que se evidencia la presencia de lesiones de morfología típica por la acción lesiva postmortal de hormigas, pero con una extensión y localización inhabituales.Post-mortem animal predation can lead to errors when interpreting forensic autopsy findings. Ants are the only insects that can attack human corpses after death and before decomposition process starts. Ants produce post mortal injuries in the skin that have a distinct location and morphology. We present a forensic case in which post mortal injuries produced by ants in a human corpse had a typical morphology; however their location and extension were unusual.

  19. Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor (Acari: phytoseiidae

    Marcos Zatti da Silva

    2007-04-01

    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulverizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The products' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  20. BIOLOGICAL ASPECTS OF PELAGIC LONGLINE CAUGTH SPECIES IN WINTER 2001 OFF SOUTH BRAZIL ASPECTOS DA BIOLOGIA DAS ESPÉCIES CAPTURADAS POR ESPINHEL PELÁGICO NA COSTA SUL DO BRASIL NO INVERNO DE 2001

    P. R SCHWINGEL

    2004-12-01

    Full Text Available The present work describes biological aspects of species caught with pelagic longline off Rio Grande do Sul State, Brazil, between 30ºS to 35ºS. Results point this area as a possible feeding ground of pelagic predators like sharks, swordfish and tunas. Data revealed this area as a parturition location for females blue sharks Prionace glauca. O presente trabalho descreve aspectos da biologia das espécies capturadas com espinhel pelágico na região oceânica frente ao Estado do Rio Grande do Sul, Brasil, cobrindo a área entre 30ºS e 35ºS. Os resultados indicam o uso da área como possível sítio de alimentação para grandes predadores pelágicos como tubarões, espadartes e atuns. Os dados indicam ainda a área como um local utilizado por fêmeas de tubarão-azul Prionace glauca para o parto.

  1. Populations analysis of the Brazilian Sharpnose Shark Rhizoprionodon lalandii (Chondrichthyes: Carcharhinidae) on the So Paulo coast, Southern Brazil: inferences from mt DNA sequences

    Fernando Fernandes, Mendona; Claudio, Oliveira; Otto Bismarck Fazzano, Gadig; Fausto, Foresti.

    2009-06-01

    Full Text Available Tubares do gnero Rhizoprionodon so considerados predadores de grande importncia ao longo da cadeia trfica nos ecossistemas costeiros e marinhos, tambm representando um importante recurso econmico para a pesca, especialmente no litoral brasileiro. A fim de analisar a estrutura populacional do [...] tubaro Rhizoprionodon lalandii no litoral de So Paulo, sudeste do Brasil, foram identificados os nveis de diversidade gentica a partir da anlise de sequncias nucleotdicas da regio controladora do DNA mitocondrial. Os dados obtidos neste estudo apresentam valores moderados de diversidade haplotpica e baixos ndices de diversidade nucleotdica. Embora os testes de AMOVA (?ST = 0,08394, P Abstract in english Sharks of the genus Rhizoprionodon can be considered some of the most important predators along the trophic coastal marine ecosystems and represent an important economic resource for the small-scale fisheries, especially on the Brazilian coastline. In order to analyze the population structure of the [...] shark Rhizoprionodon lalandii of So Paulo, Southeastern coast of Brazil, levels of genetic diversity were identified by nucleotide sequence analyses of the mitochondrial DNA control region. The results obtained from this study present moderate values of haplotype diversity and low nucleotide diversity. Although the AMOVA tests (?ST = 0.08394, P

  2. Use of the flooded forest by fish assemblages in lakes of the National Park of Anavilhanas (Amazonas, Brazil Uso do igapó por assembléias de peixes nos lagos no Parque Nacional das Anavilhanas (Amazonas, Brasil

    Janette Noveras

    2012-01-01

    Full Text Available We evaluated diversity and distribution of fish species in two habitats: flooded forest and open water of lakes of Rio Negro. Each of four lakes within the Anavilhanas Archipelago was sampled three times from 2009-2010. Species diversity generally was higher in flooded forests and at night, according to correspondence analysis. Predators were most active at night, but showed no preference between the flooded forest and open water habitats. Omnivores, filter feeders, and detritivores were most active during the day.Avaliamos a diversidade e a distribuição de espécies de peixes em dois habitats: floresta alagada e água aberta de lagos do rio Negro. Três amostragens foram realizadas em quatro lagos do Arquipélago de Anavilhanas, em 2009 e 2010. Em geral, a diversidade de espécies foi maior na floresta alagada e durante a noite. A análise de correspondência indicou que predadores estavam mais ativos a noite nos dois habitats. Onívoros, filtradores e detritívoros foram mais capturados durante o dia.

  3. Feeding strategy of the night shark (Carcharhinus signatus) and scalloped hammerhead shark (Sphyrna lewini) near seamounts off northeastern Brazil

    Teodoro, Vaske Jnior; Carolus Maria, Vooren; Rosangela Paula, Lessa.

    2009-06-01

    Full Text Available Um total de 425 estmagos de tubaro-toninha (Carcharhinus signatus) e 98 estmagos de tubaro-martelo-entalhado (Sphyrna lewini), oriundos da pesca de espinhel e pesca com rede de emalhe nas adjacncias dos bancos ocenicos do nordeste do Brasil, foi analisado entre 1992 e 1999. Ambas as espcies p [...] redam sobre peixes bento-pelgicos e recifais, cefalpodes migradores, e crustceos de guas profundas, apresentando nichos alimentares similares (ndice de Schoener T=0.75). A alta riqueza de presas nas dietas deve ser um reflexo de que as teias alimentares para estas espcies so consideravelmente longas nessa regio. Devido concentrao alimentar de ambos predadores nos bancos ocenicos, a pescaria intensa deve ser monitorada para evitar deplees locais. Abstract in english A total of 425 stomachs of night shark (Carcharhinus signatus), and 98 stomachs of scalloped hammerhead shark (Sphyrna lewini), from longline and surface gillneters near seamounts off northeastern Brazil, were analysed between 1992 and 1999. Both predators prey upon reef and benthopelagic fishes, mi [...] grant cephalopods and deep water crustaceans, showing similar feeding niches (Schoener Index T=0.75). The great prey richness of the diets may reflect the fact that the marine food web for these species is very extensive in this region. Due to the concentration for feeding of both predators in the seamounts, intense fisheries should be monitored to avoid localised depletions.

  4. Food categories reconstruction and feeding consumption estimates for the Sciaenid Macrodon ancylodon (Bloch & Schneider, and the congeneric fishes Stellifer rastrifer (Jordan and Stellifer naso (Jordan (Pisces, Perciformes in the Caet Estuary, Northern Coast of Brazil

    Mauricio Camargo

    2004-03-01

    Full Text Available A quantitative method to estimate fish feeding consumption and energy intake from different food categories through the reconstruction of ingested preys based on hard not digestible body structures is presented. In order to establish the equations of the functional relationships between preys weight and body structures, stomachs of 1.086 specimens of Macrodon ancylodon (Bloch & Schneider, 1801, Stellifer rastrifer (Jordan, 1889, and Stellifer naso (Jordan, 1889 fish species were dissected. Consequently, preys reconstruction enabled a quantitative evaluation of food categories consumption. Results indicate a marked difference in diet composition and energy requirements according to fish species ontogenetic development.Um mtodo quantitativo para se estimar o consumo alimentar e o aporte energtico das diferentes categorias alimentares apresentado atravs da reconstruo das presas ingeridas com base em estruturas corporais no digerveis. Para tal, o presente estudo estabelece, atravs do exame dos contedos estomacais de 1.086 exemplares dissecados de Macrodon ancylodon (Bloch & Schneider, 1801, Stellifer rastrifer (Jordan, 1889 e Stellifer naso (Jordan, 1889, as equaes das relaes funcionais entre o peso das presas e estruturas corporais. Com as categorias reconstrudas foi possvel quantificar o alimento ingerido pelos espcimes. Os resultados indicaram que existe uma marcada diferena, tanto na composio das categorias alimentares, bem como no aporte energtico acompanhando o desenvolvimento ontognico do predador.

  5. Gentica de comunidades

    M. Verd

    2009-01-01

    Full Text Available Los estudios sobre los procesos responsables del ensamblaje de las especies en comunidades ecolgicas tradicionalmente han considerado a las especies como unidades de estudio. Sin embargo, dentro de las especies existe gran cantidad de variacin genotpica y fenotpica que puede finalmente ser decisiva en el resultado de las interacciones con el resto de especies en la comunidad (competencia, mutualismo, etc. Recientemente se ha propuesto una nueva regla de ensamblaje de las comunidades que sugiere que la composicin gentica de una poblacin afecta a la estructura y composicin de la comunidad (es decir alfenotipo de la comunidad. Apoyando esta regla, varios estudios han demostrado que los cambios en la diversidad gentica de poblaciones de plantas conllevan cambios predecibles en sus comunidades asociadas de herbvoros y predadores. Ms all de la visin poblacional, la nueva gentica de comunidades pretende demostrar 1 que el genotipo particular de ciertos individuos es responsable del fenotipo de la comunidad, 2 que el fenotipo de la comunidad es heredable, y por lo tanto 3 que las comunidades evolucionan. Tras explicar estos tres conceptos, se discute el valor que esta aproximacin puede tener desde el punto de vista de la biologa de la conservacin.

  6. Dinâmica populacional de insetos-praga em um cultivo agroecológico de Lima Ácida Tahiti (Citrus latifolia Tanaka no município de Vassouras-RJ

    Armando Santos Vargas

    2015-12-01

    Full Text Available As pragas da lima ácida Tahiti (Citrus latifolia Tanaka representam um perigo para a manutenção sustentável da cultura. Enquanto a maioria das vezes usa-se produtos químicos no seu combate, alguns métodos alternativos têm sido empregados, e o objetivo deste trabalho foi monitorar os insetos-praga em um cultivo agroecológico, a fim de entender a sua dinâmica populacional. O estudo foi conduzido entre março de 2012 e janeiro de 2013 em um pomar no município de Vassouras, RJ, a metodologia utilizada consiste na verificação aleatoriamente das folhas das plantas, observando a presença de insetos-praga e inimigos naturais. A presença de insetos predadores mostrou ser proporcional a diversidade de insetos-praga, levando em consideração a maior oferta de alimento. Já a diversidade de espécies não mostrou relação positiva com a abundância, mas sim com a riqueza de espécies. Este método se mostrou eficaz para o entendimento da dinâmica populacional de insetos praga, podendo auxiliar no melhor manejo agroecológico na citricultura.

  7. Colonização de macroinvertebrados bentônicos em detritos foliares em um riacho de primeira ordem na Floresta Atlântica do nordeste brasileiro

    Iris Gabrielly Arruda dos Santos

    2015-03-01

    Full Text Available O objetivo do estudo foi avaliar a colonização de macroinvertebrados bentônicos em detritos foliares de Inga ingoides (Leguminosae em experimentos de campo em um riacho de primeira ordem da Mata Atlântica do Estado de Pernambuco no nordeste do Brasil. Um total de 270 bolsas de folhiço, distribuídas em três trechos do riacho com características similares em relação à morfologia e parâmetros físicos e químicos da água foram submersas, entre fevereiro a julho de 2013 e retiradas após 7, 30, 60, 90 e 120 dias. Dois tratamentos foram utilizados: colonização e exclusão da macrofauna. O percentual de biomassa remanescente final (%R foi maior para bolsas de colonização do que para as de exclusão, evidenciando a efetiva participação dos macroinvertebrados no processo de decomposição. Os fragmentadores apresentaram menor participação no processo de decomposição foliar de I. ingoides, sendo Tripletides (Trichoptera: Leptoceridae, Polypedillum e Stenochironomus (Diptera, Chironomidae os táxons predominantes na macrofauna. Filtrador foi o grupo trófico funcional predominante (45,6%, seguido por predador (31,2%, coletor (11,8%, raspador (6,7% e fragmentador (4,8%.

  8. DINÁMICA DE LA BIFURCACIÓN DE HOPF EN UNA CLASE DE MODELOS DE COMPETENCIA QUE EXHIBEN LA BIFURCACIÓN ZIP Hopf Bifurcation Dynamic in a Class of Competence Model Exhibiting Zip Bifurcation

    Carlos Mario Escobar Callejas

    2011-12-01

    Full Text Available En el presente artículo de investigación se caracteriza el tipo de bifurcación de Hopf que se presenta en el fenómeno de la bifurcación de zip para un sistema tridimensional no lineal de ecuaciones diferenciales que satisface las condiciones planteadas por Butler y Farkas, las cuales modelan la competición de dos especies predadoras por una presa singular que se regenera. Se demuestra que en todas las variedades bidimensionales invariantes del sistema considerado se desarrolla una bifurcación de Hopf supercrítica lo cual es una extensión de algunos resultados sobre el tipo de bifurcación de Hopf que se forma en el fenómeno de la bifurcación de zip en sistema con respuesta funcional del predador del tipo Holling II, [1].This research article characterizes the type of Hopf bifurcation occurring in the Zip bifurcation phenomenon for a non-linear 3D system of differential equations which meets the conditions stated by Butler and Farkas to model competition of two predators struggling for a prey. It is shown that a supercritical Hopf bifurcation is developed in all invariant two-dimensional varieties of the system considered, which is an extension of some results about the kind of Hopf bifurcation which is formed in the Zip bifurcation phenomenon in a system with functional response of the Holling-type predator.

  9. Communal egg laying by Gonatodes humeralis (Sauria, Gekkonidae in Manaus primary and secondary forest areas Desovas comunais de Gonatodes humeralis (Sauria, Gekkonidae em reas de floresta primria e secundria de Manaus

    Welton Yudi ODA

    2004-01-01

    Full Text Available Communal nesting has been registered for a number of lizard species at different sites. Here it is described communal egg laying of Gonatodes humeralis at different sites near and in human buildings in the period between 1990 and 1998. All these communal nests have been found in the dry season, between April and July, suggesting that the nests of are more common in this season, when the activity of their predators is less intense and the reduction of humidity diminish the decomposition action of the fungi that may kill the eggs.Desovas comunais tem sido registradas para inmeras espcies de lagartos em diferentes regies. Neste estudo, esto descritas desovas comunais de Gonatodes humeralis em diferentes localidades prximas, no interior de construes humanas no perodo entre 1990 e 1998. Todas estas desovas comunais foram encontradas na estao seca, entre abril e julho, sugerindo que estas desovas so mais comuns neste perodo, quando a atividade dos predadores menos intensa e a reduo da umidade diminui a ao decompositora dos fungos que pode matar os ovos.

  10. Preferncia alimentar de juvenis de lambari-cachorro, Oligosarcus hepsetus, em relao a duas espcies de presas de peixe em ambiente controlado

    Alejandra Filippo Gonzalez Neves dos Santos

    2014-02-01

    Full Text Available O presente trabalho foi baseado em dados pretritos sobre a dieta natural do lambari-cachorro Oligosarcus hepsetus em um reservatrio do Sudeste brasileiro, e com isso foi testada a preferncia alimentar desse carnvoro, a partir de experimentos com microcosmos. Os experimentos foram realizados em aqurios, em janeiro de 2011. Os predadores foram coletados em um tributrio do Rio Paraba do Sul, enquanto as presas: Tilpia rendalli e o lambari, Astyanax fasciatus, foram adquiridas em pisciculturas. Foi testada a preferncia alimentar do lambari-cachorro quanto ao tamanho das presas e s espcies-presa e os resultados foram relacionados com a energia da presa. O lambari-cachorro predou tilpia de menores comprimentos (CT e alturas do corpo (AC, ao passo que no foi observado um padro evidente de consumo de lambaris. Nos experimentos com CT padronizado, lambari-cachorro consumiu preferencialmente tilpias a lambaris, enquanto, nos experimentos com AC padronizada, no foram detectadas preferncias no consumo por determinada espcie-presa. Diferenas energticas entre espcies-presa parecem importar menos que diferenas morfolgicas na preferncia alimentar do lambari-cachorro.

  11. Dinámica de polifenoles y estudio anatomo-histoquímico en Schinus longifolius (Lindl. Speg. (Anacardiaceae en respuesta a la infección por Calophya mammifex (Hemiptera - Calophyidae

    Ignacio AGUDELO

    2013-01-01

    Full Text Available Se analizaron los fenoles totales, taninos totales, proantocianidinas, flavonoides totales y ácidos hidroxicinámicos totales de hojas sanas y agallas de Schinus longifolius (Lindl. Speg. (Anacardiaceae infectado por Calophya mammifex (Hemiptera - Calophyidae. La agalla presenta una variación cuali-cuantitativa de los polifenoles estudiados, con una disminución de los fenoles, taninos, flavonoides y ácidos hidroxicinámicos y un aumento en el contenido de proantocianidinas, cuyo monómero se transforma en cianidina luego del clivaje ácido. Se realizó además un análisis anatómico de la agalla donde se encontraron acúmulos de esclereidas y un mayor desarrollo vascular respecto de la hoja sana y un ensayo histoquímico que mostró una expresión diferencial de metabolitos polifenólicos en sus tejidos. C. mammifex utiliza la agalla como refugio contra las condiciones climáticas adversas y predadores y provee además de alimento con menos compuestos potencialmente perjudiciales en las etapas tempranas de su desarrollo.

  12. Predation on Alouatta guariba clamitans Cabrera (Primates, Atelidae by Leopardus pardalis (Linnaeus (Carnivora, Felidae Predação em Alouatta guariba clamitans Cabrera (Primates, Atelidae por Leopardus pordalis (Linnaeus (Carnivora, Felidae

    João M. D. Miranda

    2005-09-01

    Full Text Available There are a few studies about predation on primates. Howler monkeys, being relatively large animals, were believed to be preyed on successfully only by medium to large-sized carnivores and large birds of prey. Our study took place at Chácara Payquerê, which is situated in the municipality of Balsa Nova, State of Paraná, Southern Brazil. Fingers and nails from Alouatta guariba clamitans Cabrera, 1940 were founded in two faecal samples from Leopardus pardalis (Linnaeus, 1758. With our documentation large howler monkey remains in faeces, the possibility of ocelot being a potential predator of all Neotropical primates should be taken into consideration.São poucos os estudos sobre a predação de primatas. Sendo os bugios animais relativamente grandes, acredita-se que somente médios e grandes carnívoros e grandes rapineiros possam lograr sucesso em sua predação. O estudo foi realizado na Chácara Payquerê, situada no município de Balsa Nova, Estado do Paraná, sul do Brasil. Dedos e unhas de Alouatta guariba clamitans Cabrera, 1940 foram encontradas em duas amostras fecais de Leopardus pardalis (Linnaeus, 1758 que foram coletadas. Com este registro de grande primata em fezes, a possibilidade de a jaguatirica ser um potencial predador de todos os primatas neotropicais pode ser levada em consideração.

  13. Las araas en agroecosistemas: bioindicadores terrestres de calidad ambiental

    Miguel Sim

    2011-12-01

    Full Text Available Las araas son predadores generalistas en ecosistemas terrestres, ampliamente utilizadas en estudios de biodiversidad. En el ltimo siglo, el paisaje de Uruguay se transform en un mosaico de reas formadas por ambientes naturales y agroecosistemas. Qu nivel de cambio se espera hallar en la comunidad de araas si las reas de estudio estn prximas? Qu porcentaje de especies nativas sern reemplazadas con la plantacin? Cmo afecta esto a la biodiversidad local? Se realiz un estudio en cuatro reas vecinas en INIA Las Brujas, Canelones: un bosque ribereo, un bosque de Espinillo, una plantacin de Eucalyptus globulus y una pradera artificial de Trifolium pratense y Avena sativa. Las araas fueron capturadas con trampas de cada, trampas de tronco, segado, batido de follaje y colecta manual nocturna. Un total de 3.023 adultos fueron colectados. La mayor abundancia y riqueza de especies se observ en el bosque ribereo. A pesar de la proximidad de los sitios estudiados, se observ un alto reemplazo de especies, especialmente entre reas naturales y agroecosistemas. Los protocolos de colecta utilizados podran ser tiles para evaluar el impacto de agroecosistemas con diferentes tipos de manejos sobre la biodiversidad local y su aplicacin en la certificacin de calidad ambiental.

  14. Juveniles of the piscivorous dourado Salminus brasiliensis mimic the piraputanga Brycon hilarii as an alternative predation tactic

    Eduardo Bessa

    2011-06-01

    Full Text Available In the district of Bom Jardim, in Nobres, Mato Grosso State, Brazil, there are clear water streams originating on karstic terrain. The dourado, Salminus brasiliensis, is an apex stalking predator in these streams. In clear waters, where visually oriented prey may perceive predator in advance, surprise is needed for successful attacks. These streams are cohabited by other Characiformes, like the frugivorous piraputanga Brycon hilarii, which lives in schools and exhibits body colour and shape similar to the dourados. Here we describe an alternative predatory tactic for juvenile dourado occurring in headwater streams of the Paraguay River basin, in which they act as an aggressive mimic of the piraputanga. Based on 43 h of observations in Bom Jardim, and on additional 11 h in the Bodoquena Plateau Rivers of Mato Grosso do Sul State, we quantified the number of rushes by dourados when they were among piraputangas or foraging alone, and observed the proportion of piraputangas per dourado in multispecific schools. Dourados of up to 30 cm total length (TL stayed among the piraputangas of similar size hiding within the school and going to the periphery of the school before rushing against prey. The dourados exhibited colours similar to the piraputangas. They not only stayed longer among piraputangas (78% of the observation time, but also rushed against prey more often than when foraging alone (53 rushes/h against 14 rushes/h, respectively.No distrito de Bom Jardim, Nobres, Mato Grosso, Brasil, existem rios de guas claras que se originam sobre terreno crstico. O dourado, Salminus brasiliensis, um predador perseguidor de topo de cadeia nestes rios. Em guas, onde presas visualmente orientadas so capazes de perceber antecipadamente o predador, o fator surpresa necessrio para ataques bem sucedidos. Estes crregos so coabitados por outros Characiformes, como a frugvora piraputanga, Brycon hilarii, a qual vive em cardumes e exibe colorao do corpo e forma similares aos dourados. Aqui descrevemos a ocorrncia de uma ttica predatria alternativa para dourados juvenis, na qual eles agem como mmicos agressivos da piraputanga. Baseados em 43 h de observao em Bom Jardim e 11 h adicionais em riachos da Bodoquena, Mato Grosso do Sul, ns quantificamos o nmero de arremetidas do dourado quando estava entre as piraputangas ou forrageando sozinhos e observamos a proporo de piraputangas por dourado em cardumes multiespecficos. Dourados de at 30 cm de comprimento total permaneceram entre as piraputangas de tamanho similar, escondendo-se em meio ao cardume e indo periferia deste antes de arremeter contra suas presas. Os dourados exibiam cores similares s da piraputanga. Eles no s permaneceram mais tempo entre as piraputangas (78% do tempo de observao, mas tambm arremeteram mais frequentemente contra as presas do que enquanto forrageavam sozinhos (53 arremetidas/h contra 14 arremetidas/h, respectivamente.

  15. Feeding preference of adult females of ribbonfish Trichiurus lepturus through prey proximate-composition and caloric values

    Vanessa Trindade Bittar

    2012-01-01

    Full Text Available In the present study we analysed the proximate-composition and caloric values of the preferred prey consumed by ribbonfish, Trichiurus lepturus L. 1758 (adult females, that are distributed in the inner continental shelf from northern Rio de Janeiro State, southeastern Brazil (~22S, assessing the potential of nutritional and energetic approach as a tool to understand the feeding selective pattern of this marine top carnivore. The preferred prey of this predator composed of fish co-specifics, Pellona harroweri, Chirocentrodon bleekerianus, Lycengraulis grossidens, Peprilus paru, squid Doryteuthis plei, and shrimp Xiphopenaeus kroyeri were collected from 2007 to 2010 for proximate-composition (water, protein, lipid, ash, and carbohydrate and caloric value analyses. The correspondence analysis showed that protein is the main component in the prey species (61.32% of variance explained, standing out from the other nutrients. Lipid has the highest percentage related to L. grossidens, ash to X. kroyeri and carbohydrate to D. plei. The strong correlations between protein and caloric value (positive and lipid and caloric value (negative indicated that T. lepturus is attending its energy demand through the prey protein content. This work elucidated the feeding preference of adult females of T. lepturus in relation to nutritional and caloric content of their preferred prey. The species showed food selectivity to prey that provide more energy per ingested biomass, so that the feeding events can maximize the predator's caloric gain, which is obtained by a protein-based diet.No presente estudo foram analisadas a composio centesimal e o valor calrico das presas preferenciais consumidas pelo peixe-espada, Trichiurus lepturus L. 1758 (fmeas adultas, que se distribuem na plataforma continental interna do norte do estado do Rio de Janeiro, sudeste do Brasil (~ 22S. O objetivo foi avaliar o potencial da abordagem nutricional e energtica como ferramenta para compreender o padro de seletividade alimentar deste carnvoro marinho. As presas preferenciais deste predador, compostas por co-especficos e pelos peixes Pellona harroweri, Chirocentrodon bleekerianus, Lycengraulis grossidens e Peprilus paru, pela lula Doryteuthis plei e pelo camaro Xiphopenaeus kroyeri, foram coletadas entre 2007 e 2010 para anlise da composio centesimal (gua, protena, lipdio, cinzas e carboidratos e do valor calrico. A anlise de correspondncia mostrou que a protena o principal componente nas espcies de presa (61,32% da varincia explicada, destacando-se dos outros nutrientes. Para o lipdio a maior porcentagem esteve relacionada com L. grossidens, cinzas com X. kroyeri e carboidratos com D. plei. As fortes correlaes entre protena e valor calrico (positiva e lipdio e valor calrico (negativa indicaram que T. lepturus est atendendo sua demanda de energia atravs do teor de protena das presas. Este trabalho elucidou a preferncia alimentar de fmeas adultas de T. lepturus em relao ao contedo nutricional e calrico das presas preferenciais. A espcie apresentou seletividade alimentar por presas que fornecem mais energia por biomassa ingerida, de modo que os eventos de alimentao maximizem o ganho calrico do predador, que obtido por uma dieta base de protenas.

  16. Seletividade de agrotxicos usados na cultura da macieira a Neoseiulus Californicus (McGregor) (Acari: Phytoseiidae)1 / Pesticide selectivity used in apple crops Neoseiulus californicus (McGregor) (Acari: Phytoseiidae)

    Geraldine de Andrade, Meyer; Adalecio, Kovaleski; Rosa Maria, Valdebenito-Sanhueza.

    2009-06-01

    Full Text Available Objetivou-se avaliar os efeitos secundrios dos principais agrotxicos utilizados em macieira sobre adultos e imaturos de Neoseiulus californicus (McGregor) (Acari: Phytoseiidae). Os testes foram conduzidos em laboratrio, utilizando as doses dos produtos recomendadas para a cultura e o mtodo de co [...] ntato e residual com pulverizao em superfcie de folha. Foram testados tebufenozida, fosmete, metidationa, clorpirifs, abamectina, fenpiroximato, piridabem, captana, mancozebe (duas dosagens) e ditianona. Para o clculo do efeito total (E%) sobre os adultos, avaliaram-se a mortalidade, a oviposio e a viabilidade dos ovos, e para os imaturos, somente a mortalidade. Os resultados do E% foram avaliados 96 horas aps a pulverizao. Os produtos foram classificados quanto ao efeito total (E%) de toxicidade proposta pela IOBC/WPRS. Fosmete, tebufenozida e metidationa foram incuos; abamectina, fenpiroximato, clorpirifs, captana, mancozebe (nas duas dosagens testadas) e ditianona foram levemente nocivos, e piridabem foi moderadamente nocivo aos adultos de N. californicus. O fungicida mancozebe, na maior dosagem (320g,i.a./100L), foi o que mais afetou o caro predador. Quanto seletividade dos agrotxicos aos imaturos, constatouse que abamectina e piridabem foram moderadamente nocivos, e os demais foram incuos. Nenhum produto foi classificado como nocivo, evidenciando a tolerncia de N. californicus a estes agrotxicos. Estes resultados permitem uma escolha e manejo mais adequado para os agrotxicos utilizados nos pomares comerciais de macieira, de forma que a presena deste caro predador exera presso de controle do caro-vermelho. Abstract in english The objective of this study was to evaluate the side effects of the main pesticides used in adult and immature Neoseiulus californicus (McGregor) (Acari: Phytoseiidae). The tests were carried out in the laboratory by using the contact and residual spraying method on the leaf surface. It was tested t [...] ebufenozide, phosmet, methidation, chlorpyrifos, abamectin, fenpyroximate, pyridaben, captan, mancozeb (two concentrations) and dithianon. To calculate the total effect (E%) on the adults, it was evaluated the mortality, oviposition and viability of eggs, and for the immature ones, only the mortality. The results of E% were assessed 96 hours after the spraying. The products were classified considering the total effect (E%) of toxicity proposed by the IOBC/WPRS. Phosmet, tebufenozide and methidation were innocuous; abamectin, fenpyroximate, chlorpyrifos, captan, mancozeb (two concentrations), and dithianon were slightly harmful, and pyridaben was moderately harmful to the N. californicus adults. As the pesticide selectivity for the immature ones, it was verified that abamectin and pyridaben were moderately harmful, and the others were innocuous. The treatment with 320 g.a.i./100l of mancozeb was the most harmful to N. californicus. No product has been classified as harmful to N. californicus, showing tolerance to these pesticides. These results allow a choice and a more adequate handling for the pesticides used in commercial orchards of apple trees, so that the presence of this mite predator has ability to control red mite.

  17. Efeitos da aplicao de agrotxicos utilizados na produo integrada de ma sobre pupas de Chrysoperla externa / Effects of pesticides application used in integrated apple production on Chrysoperla externa pupae

    Alexandre Pinho de, Moura; Geraldo Andrade, Carvalho; Olinto, Lasmar; Valria Fonseca, Moscardini; Denise Tourino, Rezende.

    2009-11-01

    Full Text Available Devido grande importncia de Chrysoperla externa (Neuroptera: Chrysopidae) como agente de controle biolgico de artrpodes-praga na cultura da macieira no Brasil, avaliaram-se os efeitos dos agrotxicos (g i.a. L-1) abamectina (0,02), carbaril (1,73), enxofre (4,80), fenitrotiona (0,75), metidatio [...] na (0,40) e triclorfom (1,50) em pupas desse predador, oriundas de Bento Gonalves e Vacaria, Rio Grande do Sul, bem como sobre o desenvolvimento dos adultos obtidos e sua reproduo. A aplicao dos compostos e de gua destilada (testemunha) foi realizada sobre as pupas utilizando-se torre de Potter. Carbaril e triclorfom causaram mortalidade significativa de pupas tratadas de ambas as populaes. Abamectina somente causou mortalidade de pupas oriundas de Vacaria; enxofre, fenitrotiona e metidationa mostraram-se incuos ao predador. No foram constatadas redues no nmero de ovos depositados por C. externa de Bento Gonalves; entretanto, fenitrotiona causou redues nessa caracterstica biolgica de fmeas provenientes de Vacaria. Apenas carbaril e abamectina no afetaram negativamente a viabilidade dos ovos depositados por C. externa oriundas de pupas tratadas, provenientes de Bento Gonalves e Vacaria, respectivamente. Baseando-se no efeito total (E), enxofre, fenitrotiona e metidationa so incuos, enquanto abamectina, carbaril e triclorfom so levemente prejudiciais a insetos oriundos de Bento Gonalves. Abamectina e enxofre so incuos a indivduos de Vacaria, enquanto carbaril, fenitrotiona, metidationa e triclorfom so levemente prejudiciais, conforme classificao da IOBC. Abstract in english Chrysoperla externa (Neuroptera: Chrysopidae) is an important biological control agent of artropod-pests in apple crop. In this research the effects of the pesticides (g a.i. L-1) abamectin (0.02), carbaryl (1.73), fenitrothion (0.75), methidathion (0.40), sulphur (4.80) and trichlorfon (1.50), on C [...] . externa pupae from Bento Gonalves and Vacaria regions, Rio Grande do Sul, Brazil, as well as on the development of the adults obtained and its reproduction were evaluated. The sprayings of those compounds and distilled water (control) on pupae were accomplished using a Potter tower. Carbaryl and trichlorfon caused mortality of treated pupae in both studied populations. Abamectin only caused significant mortality of treated pupae from Vacaria; sulphur, fenitrothion and methidathion presented to be harmless to the predator. None of the compounds reduced the oviposition capacity of C. externa from Bento Gonalves, originated from treated pupae; however, fenitrothion caused reductions in that biological parameter for females from Vacaria. Among the evaluated pesticides, only carbaryl and abamectin did not reduced the viability of eggs laid by C. externa from Bento Gonalves and Vacaria, respectively. According to the total effect (E) of each pesticide, sulphur, fenitrothion and methidathion are harmless, whereas abamectin, carbaryl and trichlorfon are slightly harmful to insects from Bento Gonalves. Abamectin and sulphur are harmless to insects from Vacaria, while carbaryl, fenitrothion, methidathion and trichlorfon are slightly harmful, according to the IOBC classification.

  18. Experimental assessment of the effects of a Neotropical nocturnal piscivore on juvenile native and invasive fishes

    Alejandra F. G. N. Santos

    2012-01-01

    Full Text Available We experimentally examined the predator-prey relationships between juvenile spotted sorubim Pseudoplastystoma corruscans and young-of-the-year invasive and native fish species of the Paraná River basin, Brazil. Three invasive (peacock bass Cichla piquiti, Nile tilapia Oreochromis niloticus, and channel catfish Ictalurus punctatus and two native (yellowtail tetra Astyanax altiparanae and streaked prochilod Prochilodus lineatus fish species were offered as prey to P. corruscans in 300 L aquaria with three habitat complexity treatments (0%, 50% and 100% structure-covered. Prey survival was variable through time and among species (C. piquiti A relação predador-presa entre juvenis de pintado Pseudoplatystoma corruscans (piscívoro nativo e jovens do ano de espécies nativas e invasoras de peixes da bacia do rio Paraná, Brasil, foi testada experimentalmente. Três espécies de peixe invasoras (o tucunaré Cichla piquiti, a tilápia do Nilo Oreochromis niloticus e o bagre do canal Ictalurus punctatus e duas nativas (o lambari do rabo amarelo Astyanax altiparanae e o curimbatá Prochilodus lineatus foram oferecidas como presa para P. corruscans em microcosmos, com três tratamentos de complexidade de habitat (0%, 50% e 100% de cobertura por estruturas submersas. A sobrevivência de presas variou ao longo do tempo e entre espécies (C. piquiti < O. niloticus < A. altiparanae < P. lineatus < I. punctatus, sendo governada, em grande parte, por diferenças espécies-específicas no comportamento das presas, mas também pelo tamanho e defesas morfológicas das mesmas. A complexidade de habitat não afetou diretamente a piscivoria de P. corruscans, mas, na presença do predador, algumas espécies-presa alteraram seu comportamento quanto ao uso de micro-habitat e grau de agregação entre os níveis de complexidade de habitat. Pseudoplatystoma corruscans predou preferencialmente sobre os indivíduos menores das espécies invasoras que apresentaram estruturas morfológicas defensivas pouco desenvolvidas e que não formavam cardume. Em geral, os resultados obtidos contrastam com os de um experimento análogo, no qual foi usado um piscívoro diurno, sugerindo que piscívoros noturnos predam preferencialmente sobre espécies de peixes diferentes (de hábitos mais diurnos e que são menos afetados pela complexidade estrutural de habitats. Os resultados obtidos sugerem que a recuperação de populações nativas de P. corruscans poderia contribuir para o controle de algumas espécies de peixes introduzidas no rio Paraná, especialmente C. piquiti e O. niloticus, dos quais se espera que o cuidado parental seja reduzido ou nulo à noite.

  19. The inverted trophic cascade in tropical plankton communities: impacts of exotic fish in the Middle Rio Doce lake district, Minas Gerais, Brazil A cascata trófica invertida em comunidades planctônicas tropicais: impactos da introdução de peixes exóticos no distrito de lagos do médio rio Doce, MG

    RM. Pinto-Coelho

    2008-11-01

    Full Text Available The present study deals with the ecological impacts of the introduction of two alien species of piscivorous fish in several lakes of the Middle Rio Doce lake district in Minas Gerais, Brazil. It was demonstrated that these effects were not restricted only to the fish community. The introduction of the predatory red piranha Pygocentrus nattereri and the tucunaré Cichla cf. ocellaris caused not only a sharp decrease in the number of native fish species, but also major shifts in other trophic levels. Just after the fish were introduced, most lakes began to show conspicuous changes in phytoplankton species composition, in which Cyanophyceae gradually came to dominate. The zooplankton community lost several species, and in some cases, such as Lake Carioca, all the cladoceran species disappeared. On the other hand, invertebrate predators, represented by the dipteran Chaoboridae, boomed in the lake, with higher densities of exotic species, probably as a result of the "ecological release" by reduction of the original fish fauna. There was a general trend of species loss in different trophic levels. All these changes are apparently associated with decreases in water quality. The present situation in these lakes demands new approaches to the management and conservation of these ecosystems.O presente estudo trata dos impactos ecológicos da introdução de duas espécies invasoras de peixes piscívoros em diversos lagos da região lacustre do médio rio Doce em Minas Gerais, Brasil. Demonstrou-se que estes efeitos não se restringiram às comunidade de peixes. A introdução dos predadores Pygocentrus nattereri (piranha-vermelha e Cichla cf. ocelaris (tucunaré não só causou uma forte redução no número de espécies de peixes nativos, como também mudanças nos níveis tróficos inferiores. Pouco depois das introduções, a maioria dos lagos começou a mostrar alterações na comunidade fitoplanctônica, tais como o aparecimento da dominância de Cyanophyceae. A comunidade zooplanctônica perdeu diversas espécies e, em alguns casos, houve o desaparecimento de todas as espécies de cladóceros limnéticos, como é o caso da lagoa Carioca. Por outro lado, predadores invertebrados, representados pelos dípteros da família Chaoboridae, floresceram nos lagos com maiores densidades de espécies exóticas de peixes, provavelmente como resultado da "liberação ecológica" causada pela redução da ictiofauna original. Além de uma tendência geral de perda de espécies em diferentes níveis tróficos, outras mudanças estão aparentemente associadas com a redução da qualidade de água. Dessa forma, esses ecossistemas estão necessitando urgentemente de novas abordagens nas estratégias de manejo e conservação.

  20. Seletividade de agrotóxicos usados na cultura da macieira a Neoseiulus Californicus (McGregor (Acari: Phytoseiidae1 Pesticide selectivity used in apple crops Neoseiulus californicus (McGregor (Acari: Phytoseiidae

    Geraldine de Andrade Meyer

    2009-06-01

    Full Text Available Objetivou-se avaliar os efeitos secundários dos principais agrotóxicos utilizados em macieira sobre adultos e imaturos de Neoseiulus californicus (McGregor (Acari: Phytoseiidae. Os testes foram conduzidos em laboratório, utilizando as doses dos produtos recomendadas para a cultura e o método de contato e residual com pulverização em superfície de folha. Foram testados tebufenozida, fosmete, metidationa, clorpirifós, abamectina, fenpiroximato, piridabem, captana, mancozebe (duas dosagens e ditianona. Para o cálculo do efeito total (E% sobre os adultos, avaliaram-se a mortalidade, a oviposição e a viabilidade dos ovos, e para os imaturos, somente a mortalidade. Os resultados do E% foram avaliados 96 horas após a pulverização. Os produtos foram classificados quanto ao efeito total (E% de toxicidade proposta pela IOBC/WPRS. Fosmete, tebufenozida e metidationa foram inócuos; abamectina, fenpiroximato, clorpirifós, captana, mancozebe (nas duas dosagens testadas e ditianona foram levemente nocivos, e piridabem foi moderadamente nocivo aos adultos de N. californicus. O fungicida mancozebe, na maior dosagem (320g,i.a./100L, foi o que mais afetou o ácaro predador. Quanto à seletividade dos agrotóxicos aos imaturos, constatouse que abamectina e piridabem foram moderadamente nocivos, e os demais foram inócuos. Nenhum produto foi classificado como nocivo, evidenciando a tolerância de N. californicus a estes agrotóxicos. Estes resultados permitem uma escolha e manejo mais adequado para os agrotóxicos utilizados nos pomares comerciais de macieira, de forma que a presença deste ácaro predador exerça pressão de controle do ácaro-vermelho.The objective of this study was to evaluate the side effects of the main pesticides used in adult and immature Neoseiulus californicus (McGregor (Acari: Phytoseiidae. The tests were carried out in the laboratory by using the contact and residual spraying method on the leaf surface. It was tested tebufenozide, phosmet, methidation, chlorpyrifos, abamectin, fenpyroximate, pyridaben, captan, mancozeb (two concentrations and dithianon. To calculate the total effect (E% on the adults, it was evaluated the mortality, oviposition and viability of eggs, and for the immature ones, only the mortality. The results of E% were assessed 96 hours after the spraying. The products were classified considering the total effect (E% of toxicity proposed by the IOBC/WPRS. Phosmet, tebufenozide and methidation were innocuous; abamectin, fenpyroximate, chlorpyrifos, captan, mancozeb (two concentrations, and dithianon were slightly harmful, and pyridaben was moderately harmful to the N. californicus adults. As the pesticide selectivity for the immature ones, it was verified that abamectin and pyridaben were moderately harmful, and the others were innocuous. The treatment with 320 g.a.i./100l of mancozeb was the most harmful to N. californicus. No product has been classified as harmful to N. californicus, showing tolerance to these pesticides. These results allow a choice and a more adequate handling for the pesticides used in commercial orchards of apple trees, so that the presence of this mite predator has ability to control red mite.

  1. Plantas de ocorrência espontânea como substratos alternativos para fitoseídeos (Acari, Phytoseiidae em cultivos de seringueira Hevea brasiliensis Muell. Arg. (Euphorbiaceae Weeds as alternative substrates to phytoseiids (Acari, Phytoseiidae in rubber tree Hevea brasilienis, Muell. Arg. (Euphorbiaceae cultivation

    Marcos Roberto Bellini

    2005-03-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de plantas espontâneas em áreas de cultivo de seringueira que poderiam servir com reservatório de ácaros predadores. O trabalho foi conduzido em Olímpia, Estado de São Paulo, Brasil, em dois cultivos de seringueira. A cada três meses, cerca de 1.000 cm³ de folhas de cada uma das cinco espécies de plantas espontâneas dominantes em cada cultivo foi tomada para determinar os fitoseídeos. Como as plantas espontâneas dominantes variaram durante o estudo, um total de 20 espécies foi verificado. Somente Cecropia sp. foi dominante em todo estudo, em ambos os cultivos. Um total de 336 fitoseídeos pertencentes às seguintes espécies foi encontrado: Euseius citrifolius Denmark & Muma, 1970, E. concordis (Chant, 1959, Galendromus annectens (DeLeon, 1958, Iphiseiodes zuluagai Denmark & Muma, 1972, Neoseiulus anonymus (Chant & Baker, 1965 e N. tunus (DeLeon, 1967. E. citrifolius (189 espécimes e N. tunus (138 espécimes foram os mais abundantes. A maior abundância (231espécimes e diversidade (5 espécies foram observadas sobre Cecropia sp. Sobre esta planta foi encontrado o maior número de ácaros por amostra (29 espécimes, seguida por Piper duncum Linnaeus (22, Guarea sp. (18 e Ageratum conyzoides Linnaeus (12. E. citrifolius tem sido determinado como um dos ácaros predadores mais abundantes sobre seringueiras cultivadas na região onde este trabalho foi conduzido. Cecropia sp. parece ser uma das plantas espontâneas mais importantes consideradas como reservatório de E. citrifolius porque está continuamente presente nos cultivos. Estudos complementares poderiam indicar a viabilidade de se manejar esta planta nas áreas de cultivo de seringueira para permitir o controle biológico dos ácaros-praga desta cultura.The objective of this study was to determine weed species of rubber tree cultivation areas that could serve as reservoirs of predatory mites. The work was conducted in Olímpia, State of São Paulo, Brazil, in two rubber tree plantations. Every three months, about 1.000 cm³ of leaves of each one of the five dominant weeds in each plantation was taken to determine the phytoseiids. As the dominant weeds varied during the study, a total of 20 species were evaluated. Only Cecropia sp. was a dominant weed throughout the study, in both plantations. A total of 336 phytoseiids of the following species were found: Euseius citrifolius Denmark & Muma, 1970, E. concordis (Chant, 1959, Galendromus annectens (DeLeon, 1958, Iphiseiodes zuluagai Denmark & Muma, 1972, Neoseiulus anonymus (Chant & Baker, 1965 and N. tunus (DeLeon, 1967. E. citrifolius (189 specimens and N. tunus (138 specimens were the most abundant species. The highest abundance (231 specimens and diversity (5 species were observed on Cecropia sp. On this plant was found the largest number of mites per sample (29 specimens, followed by Piper duncum Linnaeus (22, Guarea sp. (18 and Ageratum conyzoides Linnaeus (12. E. citrifolius has been determined as the most abundant predatory mite on rubber trees in the region where this work was conducted. Cecropia sp. seems to be the most important of the weeds considered as reservoir of E. citrifolius because it is continuously present in the plantations. Complementary studies could indicate the viability of managing this weed in or around rubber tree plantations to promote the biological control of mite pests on that crop.

  2. INIMIGOS NATURAIS DE Alabama argillacea (HUEBB., EM REGIES COTONICULTORAS DO ESTADO DE GOIS AN EVALUATION OF SOME NATURAL ENEMIES Alabama argillacea (HUEBNER. 1818 IN THE GOIS STATE, BRAZIL

    Gislene A. Ferreira

    2007-09-01

    Full Text Available

    Foram realizados, nos municpios de Goinia e Itumbiara (GO, levantamentos e avaliaes de parasitismo e predatismo de Alabama argillacea (Huebb. (Lep.; Noctuidae, em duas safras agrcolas. Os principais inimigos naturais desta praga foram: Trichogramma spp. e Pantelloa similis, parasitides de ovos e de crislidas, respectivamente, e Rhinacloa spp., Orius spp., Geocoris spp., Nabis spp., Podisus spp., Zellus sp., Crysoperla externa e Doru lineare, predadores de ovos e de crislidas. Os resultados mostraram que a maior porcentagem de parasitismo de ovos ocorreu em abril (88%, e a predao de ovos (59% durante o ms de fevereiro, em Goinia. Com relao s crislidas, os maiores ndices de parasitismo ocorreram no final do ciclo da cultura durante o ms de maio, com 63% em Goinia e 68% em Itumbiara. Com referncia predao, constatou-se que as maiores percentagens ocorreram em fevereiro (38% e maro (24% em Goinia e Itumbiara, respectivamente. Os taquindeos e trichogramatdeos podem controlar biologicamente o curuquer do algodoeiro e auxiliar na manuteno de um nvel populacional tolervel da praga.

    PALAVRAS-CHAVE: Parasitide; Trichograma; predadores; Geocoris; Podisus; Zellus.

    The experiments were carried out in Goinia and Itumbiara, Gois, Brazil, from February to May, in two consecutive crop cycles. The main cotton leafworm natural enemies found were the egg parasitoid Trichogramma spp. and coccon parasitoid Panteloa similis, and the predatory insects Rhinacloa spp., Orius spp., Geocoris spp., Nabis spp.Lethal and sublethal effects of neem on Aphis gossypii and Cycloneda sanguinea in watermelon / Efeito letal e subletal do nim em Aphis gossypii e Cycloneda sanguinea na cultura da melancia

    Cntia Ribeiro, Souza; Renato Almeida, Sarmento; Madelaine, Venzon; Gil Rodrigues dos, Santos; Marcela Cristina Agustini Carneiro da, Silveira; Paulo Henrique, Tschoeke.

    2015-06-01

    Full Text Available O objetivo deste estudo foi avaliar o impacto de extrato oleoso de nim, Azadirachta indica, no afdeo Aphis gossipii e em seu inimigo natural Cycloneda sanguinea, na melancia. Ensaios de toxicidade foram conduzidos com o produto comercial (DalNeem(r)) (1.475 g L-1 de azadirachtina) 0,0037 g i.a. mL [...] -1, 0,0074 g i.a. mL-1 and 0,0148 g i.a. mL-1, Malathion 1 g i.a. mL-1, e gua destilada como tratamento controle. Os produtos foram aplicados em discos de folhas de melancia e os insetos foram expostos ao resduo dos produtos. Foram calculados padro de crescimento instantneo da populao de A. gossypii e sobrevivncia das larvas de C. sanguinea expostos aos diferentes tratamentos. Houve uma diminuio no padro de crescimento instantneo da populao de A. gossypii com aumento da concentrao de nim. Afdeos no se reproduziram nos discos de folhas tratadas com malathion, devido ao rpido efeito letal em adultos, menor que 24 horas aps a exposio. Larvas de C. sanguinea expostas ao malathion sobreviveram por 24 horas. Sobrevivncia do predador exposto a diferentes concentraes de nim tambm foi significativamente reduzida quando comparada a exposio gua. Entretanto, experimentos de laboratrio podem ter superestimado o efeito do nim em predadores porque eles no mostraram comportamento de escape causado pela repelncia do nim. Abstract in english The objective of this study was to evaluate the impact of oil extract of neem, Azadirachta indica, on the watermelon aphid Aphis gossypii and its natural enemy Cycloneda sanguinea. Toxicity bioassays were conducted with the commercial product DalNeem (1,475 g L-1 azadirachtin) at 0.0037 g a.i. mL-1 [...] , 0.0074 g a.i. mL-1 and 0.0148 g a.i. mL-1, Malathion at 1 g a.i. mL-1 and distilled water as a control treatment. The products were sprayed to watermelon leaf discs, and the insects were exposed to the product residues. The instantaneous population growth rate of A. gossypii and the survival of C. sanguinea larvae exposed to the different treatments were calculated. A decrease in the instantaneous population growth rate of A. gossypii with increasing concentrations of neem was observed, and the aphids did not reproduce on the leaf discs treated with malathion during the first 24 hours of exposure due to its rapid lethal effect on adult insects. The larvae of the predator C. sanguinea exposed to malathion survived only for 24 hours. The survival of the predator exposed to different concentrations of neem was also significantly reduced compared to the predators exposed only to water. However, laboratory experiments may overestimate the effect of neem on predators because the individuals cannot employ escape behavior caused by neem repellency.

  3. Seletividade de inseticidas utilizados em cultura cafeeira para larvas de Cryptolaemus montrouzieri Mulsant Selectivity of insecticides used in the coffee crop to larvae of Cryptolaemus montrouzieri Mulsant

    Luiz Carlos Dias Rocha

    2011-06-01

    Full Text Available Assim como a maioria dos cultivos, em cafeeiro, a associao de inimigos naturais com produtos fitossanitrios seletivos uma importante estratgia no manejo integrado de pragas (MIP. Dessa forma, este estudo objetivou avaliar a seletividade de agrotxicos utilizados na cultura cafeeira sobre larvas de Cryptolaemus montrouzieri Mulsant, 1853 (Coleoptera: Coccinellidae, em laboratrio. Os bioensaios foram realizados em condies controladas (252C, UR de 7010% e fotofase de 12 horas. Cada bioensaio consistiu em seis tratamentos e dez repeties, sendo cada parcela composta por duas larvas. Para as comparaes das mdias dos tratamentos, empregou-se um esquema fatorial inteiramente ao acaso de produtos x nmero de instares para os diferentes instares subsequentes aplicao. Os inseticidas utilizados e suas respectivas dosagens de aplicao, em g de i.a. L-1 foram: tiametoxam (0,5, imidacloprido (0,7, leo mineral (13,3, endossulfam (2,63 e dimetoato (0,48. A testemunha foi composta apenas por gua destilada. A aplicao dos produtos foi realizada por meio de torre de Potter. Avaliaram-se a sobrevivncia dos espcimes aps serem contaminados com os produtos e os efeitos dos compostos sobre os parmetros reprodutivos do predador. Tiametoxam (0,5, imidacloprido (0,7 e endossulfam (2,63 foram os mais prejudiciais, tendo sido observados, para os dois primeiros, 100% de mortalidade de larvas de primeiro e de segundo instares um dia aps a aplicao e significativa reduo na sobrevivncia das larvas de terceiro e quarto instares. Dimetoato (0,48 foi nocivo para larvas de primeiro instar e levemente nocivo para larvas de quarto instar. Em funo da seletividade apresentada pelo leo mineral (13,3, este pode ser recomendado em compatibilizao com o predador C. montrouzieri em programas de MIP na cultura cafeeira, sem prejuzo ao desempenho do inimigo natural.As well as most of the crops, in coffee crop, the association of selective compounds and natural enemies, composes an important tool for the integrated pest management (IPM. The objective of this study was to evaluate the selectivity of some pesticides used in coffee crops on larvae of Cryptolaemus montrouzieri Mulsant, 1853 (Coleoptera: Coccinellidae under controlled laboratory conditions (climatic chamber at 252C, RH of 7010% with a 12 h-photophase. The randomized experimental design was used, with six treatments and ten repetitions, being each composed for two larvae. For the comparisons of the averages of treatments, a factorial scheme was used with the products x number of instars for the different instars subsequent the application. The pesticides and doses in g of a.i. L-1 were: thiamethoxan (0.5, imidacloprid (0.7, mineral oil (13.3, endosulfan (2.63 and dimethoate (0.48. Distilled water was used as control. The sprayings of the pesticides were accomplished using a Potter's tower. The parameters evaluated were: specimens survival after the application of the compounds, and the compounds effects over the reproductive parameters of the predator. Thiamethoxan (0.5, imidacloprid (0.7 and endosulfan (2.63 were the most harmful to the treated individuals and for the first two compounds it was observed 100% of larvae mortality of the first and second instars soon at 1 day after the application and reduction in the survival of the larvae of third and fourth instars. Dimethoate (0.48 was harmful for the larvae of the first instar and slightly harmful for larvae of fourth instar. As a function of the selectivity presented by mineral oil (13.3, it can be recommended aiming its compatibilization with the C. montrouzieri natural enemy in programs of IPM in coffee crop.

  4. Efeitos do plantio direto e da consorciação soja-milho sobre inimigos naturais e pragas Effects of no-tillage and of soybean-corn intercropping on natural enemies and pests

    Francisco Jorge Cividanes

    2001-02-01

    Full Text Available Procurou-se avaliar os efeitos do plantio direto e da consorciação soja (Glycine max (L. Merrill e milho (Zea mays L. sobre pragas e inimigos naturais. Os tratamentos constituíram um fatorial 3 x 2 (monocultura de soja, monocultura de milho, consorciação soja-milho x plantio direto, plantio convencional, em blocos casualizados. Os insetos foram amostrados pelo método do pano, rede entomológica, procura visual e armadilha de sucção. Entre os insetos-pragas do milho, Maecolaspis assimilis ocorreu em maior número no sistema de plantio convencional; o mesmo ocorreu com os predadores Cycloneda sanguinea e Doru sp. Por outro lado, M. assimilis e o predador Toxomerus sp. foram mais numerosos na monocultura de milho em relação à cultura do milho consorciado com soja. Dos insetos-pragas da soja, destacaram-se pelo maior número Anticarsia gemmatalis e Diabrotica gracilenta, no sistema de plantio convencional, e o mesmo aconteceu com a espécie da família Trichogrammatidae, enquanto as espécies da família Eulophidae foram mais numerosas na soja sob sistema de plantio direto. Na soja consorciada com milho foi maior o número de insetos-pragas Megalotomus sp. e Maecolaspis sp. e dos inimigos naturais Geocoris sp., Lebia concina, Orius sp., Braconidae e Scelionidae.This study evaluated the effects of no-tillage and of strip intercropping of soybean (Glycine max (L. Merrill and corn (Zea mays L. on the abundance of pests and natural enemies. The plots were arranged in a randomized complete block design for a 3 x 2 factorial experiment (soybean monoculture, corn monoculture, strip intercropping of soybean-corn x no-tillage and conventional tillage. Insects were sampled by sweep net, ground cloth, visual search and suction net. Among the corn insect pests, Maecolaspis assimilis occurred in highest number in the no-tillage system, the same being observed with the predators Cycloneda sanguinea and Doru sp. On the other hand, M. assimilis and the predator Toxomerus sp. were more abundant in corn monoculture than in corn of the strip-intercropping system. Considering the soybean insect pests, highest number of Anticarsia gemmatalis and Diabrotica gracilenta was found in the conventional tillage system; the same happened to the Trichogrammatidae species, while species of Eulophidae family were more numerous in soybean under no-tillage system. Soybean of the strip-intercropping system showed highest abundance of the insect pests Megalotomus sp. and Maecolaspis sp. and the natural enemies Geocoris sp., Lebia concina, Orius sp., Braconidae and Scelionidae.

  5. Seletividade de inseticidas a Doru luteipes (Scudder, 1876 (Dermaptera: Forficulidae e Cotesia sp. (Hymenoptera: Braconidae inimigos naturais de Ascia monuste orseis (Godart, 1818 (Lepdoptera: Pieridae Selectivity of insecticides to Doru luteipes (Scudder, 1876 (Dermaptera: Forficulidae and Cotesia sp. (Hymenoptera: Braconidae natural enemies of Ascia monuste orseis (Godart, 1818 (Lepdoptera: Pieridae

    Marcelo Coutitnho Picanço

    2003-04-01

    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em favor do predador Doru luteipes (Scudder (Dermaptera: Forficulidae e do parasitóide Cotesia sp. (Hymenoptera: Braconidae, em relação ao controle do curuquerê Ascia monuste orseis (Godart (Lepidoptera: Pieridae. Foram determinadas as CL90 para A. monuste orseis e estas foram utilizadas como doses discriminatórias para se avaliar o grau de seletividade dos inseticidas. Deltametrina e permetrina foram altamente seletivos em favor de D. luteipes. Deltametrina foi medianamente seletiva em favor de Cotesia sp. e a permetrina não apresentou seletividade em favor deste parasitóide. Triclorfom foi altamente seletivo em favor de ninfas de quarto estádio e adultos de D. luteipes e mediamente seletivo em favor de Cotesia sp. e de ninfas de primeiro estádio do predador. Carbaril foi medianamente seletivo em favor de Cotesia sp. mas não apresentou seletividade em favor de D. luteipes. Paratiom metílico não foi seletivo em favor de Cotesia sp. e D. luteipes. Adultos de D. luteipes foram menos sensíveis a deltametrina, permetrina e triclorfom do que adultos de Cotesia sp., sendo que o inverso ocorreu com o carbaril. Esses inimigos naturais apresentaram alta sensibilidade ao paratiom metílico. Ninfas de quarto estádio e adultos de D. luteipes foram mais sensíveis ao paratiom metílico e triclorfom que ninfas de primeiro estádio. Ninfas e adultos de D. luteipes apresentaram semelhante sensibilidade ao carbaril, deltametrina e permetrina.This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in favor of the predator Doru luteipes (Scudder (Dermaptera: Forficulidae and of the parasitoid Cotesia sp. (Hymenoptera; Braconidae in relation to the control of the kale leafworm Ascia monuste orseis (Godart (Lepidoptera: Pieridae. LC90 were determined for A. monuste orseis, and these were used as discriminatory doses to evaluate the degree of selectivity of the insecticides. Deltamethrin and permethrin were highly selective in favor of D. luteipes. Deltamethrin was intermediate selectivity in favor of Cotesia sp., while permethrin was not selective in favor of this parasitoid. Trichlorfon was highly selective in favor of fourth instar nymphs and adults of D. luteipes, and it was intermediate selectivity in favor of Cotesia sp. and first instar nymphs of the predator. Carbaryl was intermediate selectivity in favor of Cotesia sp., but it did not show selectivity in favor of D. luteipes. Methyl parathion did not show selectivity in favor of D. luteipes and Cotesia sp. Adults of D. luteipes were less sensitive to deltamethrin, permethrin and trichlorfon than adults of Cotesia sp. and the inverse happened with carbaryl. Both natural enemies presented high sensibility to methyl parathion. Fourth instar nymphs of and adults of D. luteipes were more sensitive to methyl parathion and trichlorfon than first instar nymphs. Both nymphs and adults of D. luteipes presented similar sensibility to the carbaryl, deltamethrin and permethrin.

  6. Bemisia tabaci, Brevicoryne brassicae and Thrips tabaci abundance on Brassica oleracea var. acephala Abundância de Bemisia tabaci, Brevicoryne brassicae e Thrips tabaci em Brassica oleracea var. acephala

    Germano Leão Demolin Leite

    2005-03-01

    Full Text Available Kale Brassica oleracea var. acephala is attacked by whitefly Bemisia tabaci, aphid Brevicoryne brassicae and Thrips tabaci. One of the main reasons for extensive insecticide application is the lack of information about factors that control insect population. The objectives of this study were to investigate the relationships between predators and parasitoids, organic compound leaves, levels of leaf nitrogen and potassium, total rainfall, relative humidity, sunlight and median temperature on the abundance of whitefly, aphid, and thrips in kale genotype "Talo Roxo". The beating tray method, direct counting and magnifying lens were used to estimate the number of these pests, predators and parasitoids. Median temperature, sunlight and relative humidity correlated to the amount of leaf nonacosane, which in turn was associated with aphids population increase. A tendency in the reduction of aphids and thrips populations with increase in total rainfall was observed. The whitefly can be a harmful pest in kale producing regions of higher temperature and smaller rainfall. In regions which present moderate temperature, where there is a high incidence of aphids, genotype with low leaf wax content should be chosen. Natural enemies, especially the parasitoid Adialytus spp., can control agents of the aphids population in kale.A couve, Brassica oleracea var. acephala, é atacada por mosca-branca Bemisia tabaci, pulgão Brevicoryne brassicae e tripes Thrips tabaci. Uma das principais razões para o uso intensivo de inseticidas é a falta de informação sobre os fatores que controlam a população de insetos. O objetivo deste estudo foi investigar as relações entre predadores e parasitóides, compostos orgânicos foliares, níveis foliares de nitrogênio e de potássio, pluviosidade total, umidade relativa, insolação e temperatura média na abundância da mosca-branca, pulgões e tripes em couve genótipo Talo Roxo. Foi usado o método da batida em bandeja, contagem direta e lupas de aumento para estimar o número dessas pragas, de predadores e de parasitóides. A temperatura média, insolação e umidade relativa correlacionaram com nonacosano foliar que, por sua vez, esteve associado com o aumento populacional de pulgões. Foi observada uma tendência na redução de pulgões e de tripes com o aumento da pluviosidade total. A mosca-branca pode ser uma praga prejudicial em regiões produtoras de couve de maior temperatura e de menor pluviosidade. Em regiões onde se tem maior incidência de pulgões (regiões de temperatura moderada deve-se escolher um genótipo com baixo conteúdo foliar de cera. Inimigos naturais, especialmente o parasitóide Adialytus spp., podem ser agentes de controle da população de pulgões em couve.

  7. Avaliação da predação de Podocnemis expansa e Podocnemis unifilis (Testudines, Podocnemididae no rio Javaés, Tocantins Evaluation of predation in Podocnemis expansa and Podocnemis unifilis (Testudines, Podocnemididae in the Javaés River, Tocantins

    Giovanni Salera Junior

    2009-03-01

    Full Text Available Podocnemis expansa e P. unifilis são animais de vida longa, com uma demorada maturação sexual, o que influencia uma baixa taxa de substituição de indivíduos. Suas populações são caracterizadas por uma pequena mortalidade dos animais adultos, mas alta taxa de mortalidade de filhotes e embriões. Sendo a predação natural de ninhos e filhotes um dos fatores mais importantes do baixo sucesso de eclosão dessas espécies. No rio Javaés, os ovos e recém-eclodidos podem ser predados por uma grande diversidade de animais: dentre as aves, urubus (Coragyps atratus e Cathartes aura, carcará (Polyborus plancus, jaburu (Jabiru mycteria; lagartos (Tupinambis teguixin e mamíferos de pequeno porte, coati (Nasua nasua e cachorro-do-mato (Cerdocyon thous. Do total anual de desovas de P. unifilis em média 65,98% são predadas, sendo 41,68% de forma total e 24,30% parcialmente. Enquanto que apenas 5,31% das ninhadas de P. expansa são sempre parcialmente predadas. Dentre os predadores aquáticos existem diversos peixes, principalmente piranhas (Serrasalmus nattereri e jacarés (Melanosuchus niger e Caimam crocodilus. Os predadores das fêmeas de P. unifilis são: jacaré-açu (Melanosuchus niger, onça-pintada (Panthera onca e onça-parda (Puma concolor. Enquanto que as fêmeas de P. expansa em postura, somente são predadas por P. onca. As fêmeas de P. unifilis em postura são predadas num total médio de 3,93% anualmente, enquanto que para P. expansa a média anual é 5,66% das fêmeas.Podocnemis expansa and P. unifilis long lived with late sexual maturation, which influences a low replacement rate of individuals. Their populations are characterized by low adults mortality, but high mortality of embryos and hatchlings. The natural nest predation is an important factor for hatchling success. In Javaés River, the eggs and hatchlings can be predated by a large number of animals such as birds, vultures (Coragyps atratus and Cathartes aura, carcará (Polyborus plancus, jabiru (Jabiru mycteria; lizards (Tupinambis teguixin and small mammals, coati (Nasua nasua and crab-eating-fox (Cerdocyon thous. About 65,98% of nests of P. unifilis are predated (41,68% totally and 24,30% partially. Only 5,31% of P. expansa nests are partially predated. There are many aquatic predators, like carnivorous fish, mainly piranhas (Serrasalmus nattereri and caimans (Melanosuchus niger e Caimam crocodilus. The predators of P. unifilis females are: black caiman (Melanosuchus niger, jaguar (Panthera onca and puma (Puma concolor, and of P. expansa females is the P. onca. In average 3,93% of P. unifilis females are predated annually while that to P. expansa the average is 5,66%.

  8. Toxicidade de acaricidas a ovos e adultos de Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae Toxicity of acaricides to eggs and adults of Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae

    Geraldo Andrade Carvalho

    2011-02-01

    Full Text Available Objetivou-se, neste trabalho, avaliar o efeito de treze acaricidas sobre ovos e adultos de Ceraeochrysa cubana (Hagen, 1861. Os acaricidas foram pulverizados por meio de torre de Potter, nas concentrações recomendadas para o controle de ácaros na cultura dos citros. Os ensaios foram conduzidos sob condições controladas de 25 ± 2º C, umidade relativa de 70 ± 10% e fotofase de 12 horas. Os acaricidas não foram tóxicos ao predador em sua fase de ovo. Em relação aos adultos, o carbosulfan e o triazophos foram altamente tóxicos (100% de mortalidade, enquanto que os piretróides bifenthrin e fenpropathrin causaram mortalidade aproximadamente de 60%. Os acaricidas dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin não provocaram mortalidade dos adultos de C. cubana. Flufenoxuron inibiu a capacidade de oviposição e provocou a inviabilização dos ovos. Baseando-se na escala da IOBC, os acaricidas carbosulfan, triazophos e flufenoxuron foram enquadrados na classe 4 = nocivos; bifenthrin e fenpropathrin na classe 2 = levemente nocivos, e dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin na classe 1 = inócuos a C. cubana. Os compostos enquadrados na classe 1 podem ser recomendados em programas de manejo integrado de pragas de citros objetivando a integração entre os métodos químico e biológico por meio dessa espécie de predador.The objective of this work was to evaluate the effects of thirteen acaricides on eggs and adults of the lacewing Ceraeochrysa cubana (Hagen, 1861. The acaricides were sprayed using a Potter's tower at the rate recommended for mite control in citrus orchard. The trials were performed in climatic chamber at 25 ± 2º C, 70 ± 10% RH and photophase of 12 hours. The egg stage showed high tolerance to the tested acaricides. Carbosulfan and triazophos caused 100% adult mortality, whereas bifenthrin and fenpropathrin caused around 60%. All other acaricides, dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin and fenibutatin oxide did not cause mortality of C. cubana adult. Flufenoxuron reduced adult egg laying and all eggs were nonviable. According to IOBC scale, the acaricides carbosulfan, triazophos and flufenoxuron were classified into class 4 = harmful; bifenthrin and fenpropathrin into class 2 = slightly toxic; and dicofol, clofentezine, abamectin, hexythiazox, cyhexatin, and fenbutatin oxide into class 1 = harmless to C. cubana. The compounds classified as first class may be recommended in programs of integrated pest management of citrus aiming at the integration between the biological and chemical control through this kind of predator.

  9. Trophic interactions in northern Chile upwelling ecosystem, year 1997 / Interacciones trficas en el ecosistema de surgencia del norte de Chile, ao 1997

    Mnica E, Barros; Sergio, Neira; Hugo, Arancibia.

    2014-11-01

    Full Text Available Se construye un modelo de trama trfica para describir las interacciones predador-presa, estructura comunitaria y flujos trficos en el ecosistema de surgencia del norte de Chile (1820'S, 24S), en el ao 1997. El modelo se construye utilizando el programa computacional Ecopath con Ecosim versin 6 [...] .4, y considera 21 grupos funcionales que abarcan desde productores primarios (fitoplancton) hasta predadores tope (aves y mamiferos marinos), incluyendo los principales recursos pesqueros y la pesquera. Los parmetros de entrada requeridos para implementar el modelo fueron obtenidos de literatura especializada, literatura gris y estimaciones propias. Los resultados indican que la biomasa total del sistema (B T) se estim en 624.7 ton km-2. La biomasa combinada de pelgicos pequeos represent 26% de B T, mientras que la biomasa combinada de peces demersales represent slo 0,1% of Bt. Estos resultados realzan la importancia de los peces pelgicos en este sistema. La mortalidad por depredacin result ser la principal fuente de mortalidad en el sistema. Sin embargo, la mortalidad por pesca fue importante en anchoveta, caballa, palometa o dorado de altura y jurel. El nivel trfico promedio de la pesquera fue estimado en 3.7, con desembarques sustentados principalmente por anchoveta. La produccin primaria requerida para sustentar los desembarques (PPR) se estim en 7,5% de la produccin primaria neta calculada, que es inferior a estimados de PPR en otros sistemas de surgencia. La eficiencia promedio de transferencia de energa fue 18%, que se encuentra en el rango (10-20%) informado para ecosistemas marinos. Los resultados indican que en 1997, el ecosistema marino del norte de Chile se encontraba en condicin alejada de la madurez, dominado en trminos de biomasa y flujos por el ambiente pelgico. Abstract in english A food web model is constructed to describe predator-prey interactions, community structure and trophic flows in northern Chile upwelling ecosystem (1820'S, 24S), for the year 1997. The model is built using the Ecopath with Ecosim software version 6.4, and encompasses 21 functional groups, ranging [...] from primary producers (phytoplankton) to top predators (birds and marine mammals), the principal fishing resources and the fishery. Input parameters required to build the model were gathered from specialized literature, grey literature and our own estimates. The results indicated that the total biomass (B T) was estimated at 624.7 ton km-2. The combined biomass of small pelagic fish represented 26% of B T, while the combined biomass of demersal fish represented only 0.1% of B T. These results highlight the importance of pelagic fish in this system. Predation mortality resulted to be the main source of mortality. Nevertheless, fishing mortality was important in anchovy, mackerel, common dolphinfish and jack mackerel. The mean trophic level of the fishery was estimated as 3.7, with landings sustained mainly by anchovy. Primary production required to sustain the landings (PPR) was estimated at 7.5% of calculated total net primary production, which is lower than PPR estimates in other upwelling ecosystems. The average trophic transfer efficiency was 18%, which is in the range (10-20%) informed for marine ecosystems. Results indicate that in 1997 the northern Chile marine ecosystem was characterized for being a system far from maturity, dominated in terms of biomass and flows by the pelagic realm.

  10. Seletividade de inseticidas utilizados em cultura cafeeira para larvas de Cryptolaemus montrouzieri Mulsant / Selectivity of insecticides used in the coffee crop to larvae of Cryptolaemus montrouzieri Mulsant

    Luiz Carlos Dias, Rocha; Geraldo Andrade, Carvalho; Valria Fonseca, Moscardini; Denise Tourino, Rezende.

    2011-06-01

    Full Text Available Assim como a maioria dos cultivos, em cafeeiro, a associao de inimigos naturais com produtos fitossanitrios seletivos uma importante estratgia no manejo integrado de pragas (MIP). Dessa forma, este estudo objetivou avaliar a seletividade de agrotxicos utilizados na cultura cafeeira sobre larv [...] as de Cryptolaemus montrouzieri Mulsant, 1853 (Coleoptera: Coccinellidae), em laboratrio. Os bioensaios foram realizados em condies controladas (252C, UR de 7010% e fotofase de 12 horas). Cada bioensaio consistiu em seis tratamentos e dez repeties, sendo cada parcela composta por duas larvas. Para as comparaes das mdias dos tratamentos, empregou-se um esquema fatorial inteiramente ao acaso de produtos x nmero de instares para os diferentes instares subsequentes aplicao. Os inseticidas utilizados e suas respectivas dosagens de aplicao, em g de i.a. L-1 foram: tiametoxam (0,5), imidacloprido (0,7), leo mineral (13,3), endossulfam (2,63) e dimetoato (0,48). A testemunha foi composta apenas por gua destilada. A aplicao dos produtos foi realizada por meio de torre de Potter. Avaliaram-se a sobrevivncia dos espcimes aps serem contaminados com os produtos e os efeitos dos compostos sobre os parmetros reprodutivos do predador. Tiametoxam (0,5), imidacloprido (0,7) e endossulfam (2,63) foram os mais prejudiciais, tendo sido observados, para os dois primeiros, 100% de mortalidade de larvas de primeiro e de segundo instares um dia aps a aplicao e significativa reduo na sobrevivncia das larvas de terceiro e quarto instares. Dimetoato (0,48) foi nocivo para larvas de primeiro instar e levemente nocivo para larvas de quarto instar. Em funo da seletividade apresentada pelo leo mineral (13,3), este pode ser recomendado em compatibilizao com o predador C. montrouzieri em programas de MIP na cultura cafeeira, sem prejuzo ao desempenho do inimigo natural. Abstract in english As well as most of the crops, in coffee crop, the association of selective compounds and natural enemies, composes an important tool for the integrated pest management (IPM). The objective of this study was to evaluate the selectivity of some pesticides used in coffee crops on larvae of Cryptolaemus [...] montrouzieri Mulsant, 1853 (Coleoptera: Coccinellidae) under controlled laboratory conditions (climatic chamber) at 252C, RH of 7010% with a 12 h-photophase. The randomized experimental design was used, with six treatments and ten repetitions, being each composed for two larvae. For the comparisons of the averages of treatments, a factorial scheme was used with the products x number of instars for the different instars subsequent the application. The pesticides and doses in g of a.i. L-1 were: thiamethoxan (0.5), imidacloprid (0.7), mineral oil (13.3), endosulfan (2.63) and dimethoate (0.48). Distilled water was used as control. The sprayings of the pesticides were accomplished using a Potter's tower. The parameters evaluated were: specimens survival after the application of the compounds, and the compounds effects over the reproductive parameters of the predator. Thiamethoxan (0.5), imidacloprid (0.7) and endosulfan (2.63) were the most harmful to the treated individuals and for the first two compounds it was observed 100% of larvae mortality of the first and second instars soon at 1 day after the application and reduction in the survival of the larvae of third and fourth instars. Dimethoate (0.48) was harmful for the larvae of the first instar and slightly harmful for larvae of fourth instar. As a function of the selectivity presented by mineral oil (13.3), it can be recommended aiming its compatibilization with the C. montrouzieri natural enemy in programs of IPM in coffee crop.

  11. High consumption of primates by pumas and ocelots in a remnant of the Brazilian Atlantic Forest / Alto consumo de primatas por onas-pardas e jaguatiricas em um fragmento na Mata Atlntica no Brasil

    JL, Santos; AMO, Paschoal; RL, Massara; AG, Chiarello.

    2014-08-01

    Full Text Available Ns estudamos a dieta de jaguatiricas e onas-pardas entre os anos de 2007 e 2008 na Reserva Feliciano Miguel Abdala, em Minas Gerais, sudeste do Brasil. Ns coletamos 49 amostras fecais de felinos, em 23 das quais foi possvel a identificao do predador atravs da anlise do padro microestrutural [...] dos seus pelos encontrados nas fezes, sendo 17 fezes de ona-parda (Puma concolor) e seis de jaguatirica (Leopardus pardalis). Nas amostras de ona-parda ns identificamos trs espcies de primatas (Brachyteles hypoxanthus, Alouatta guariba e Sapajus nigritus), cujas partes no digeridas foram encontradas em oito das 17 fezes coletadas, representando 26,7% dos itens consumidos por onas-pardas. Para jaguatirica, ns detectamos macacos-prego (S. nigritus) em trs de seis fezes, o que correspondeu a 18,7% dos itens consumidos. Para as 26 amostras fecais restantes, cuja identificao do predador no foi possvel, ns analisamos os itens alimentares presentes. Restos de primatas foram identificados em cinco dessas fezes (19,3%), representando 10,2% dos itens encontrados. Apesar do tamanho da amostra ser limitado, nossos resultados indicam uma taxa relativamente alta de consumo de primatas por felinos. Ns acreditamos que essa alta taxa de predao pode ser resultado da grande densidade local de primatas, bem como do aumento do risco de predao em paisagens fragmentadas, o que tende a aumentar a incidncia do uso do cho por parte dos primatas. Abstract in english We studied the diet of the ocelot and puma during the years 2007 and 2008 at the Feliciano Miguel Abdala Reserve, in Minas Gerais, south-eastern Brazil. We collected 49 faecal samples (scats) from cats, and identified the species of cat from 23 of them by the analysis of the microstructure patterns [...] of hairs found in their faeces: 17 scats of the puma (Puma concolor) and six of the ocelot (Leopardus pardalis). In the puma scats, we identified three species of primates (Brachyteles hypoxanthus, Alouatta guariba and Sapajus nigritus), the remains of which were found in eight of 17 collected (47.1%), representing 26.7% of items consumed. For the ocelot, we detected capuchin monkey (S. nigritus) remains in three of the six scats (50%), accounting for 18.7% of items consumed by ocelot. We were unable to identify the cat species in the remaining 26 faecal samples, but we were able to analyse the food items present. Primates were found in five of these 26 faeces (19.2%) and represented 10.2% of the items found. Although the sample size is limited, our results indicate a relatively high consumption of primates by felines. We believe that this high predation may be the result of the high local density of primates as well as the greater exposure to the risks of predation in fragmented landscapes, which tends to increase the incidence of the primates using the ground.

  12. Efeitos da aplicação de agrotóxicos utilizados na produção integrada de maçã sobre pupas de Chrysoperla externa Effects of pesticides application used in integrated apple production on Chrysoperla externa pupae

    Alexandre Pinho de Moura

    2009-11-01

    Full Text Available Devido à grande importância de Chrysoperla externa (Neuroptera: Chrysopidae como agente de controle biológico de artrópodes-praga na cultura da macieira no Brasil, avaliaram-se os efeitos dos agrotóxicos (g i.a. L-1 abamectina (0,02, carbaril (1,73, enxofre (4,80, fenitrotiona (0,75, metidationa (0,40 e triclorfom (1,50 em pupas desse predador, oriundas de Bento Gonçalves e Vacaria, Rio Grande do Sul, bem como sobre o desenvolvimento dos adultos obtidos e sua reprodução. A aplicação dos compostos e de água destilada (testemunha foi realizada sobre as pupas utilizando-se torre de Potter. Carbaril e triclorfom causaram mortalidade significativa de pupas tratadas de ambas as populações. Abamectina somente causou mortalidade de pupas oriundas de Vacaria; enxofre, fenitrotiona e metidationa mostraram-se inócuos ao predador. Não foram constatadas reduções no número de ovos depositados por C. externa de Bento Gonçalves; entretanto, fenitrotiona causou reduções nessa característica biológica de fêmeas provenientes de Vacaria. Apenas carbaril e abamectina não afetaram negativamente a viabilidade dos ovos depositados por C. externa oriundas de pupas tratadas, provenientes de Bento Gonçalves e Vacaria, respectivamente. Baseando-se no efeito total (E, enxofre, fenitrotiona e metidationa são inócuos, enquanto abamectina, carbaril e triclorfom são levemente prejudiciais a insetos oriundos de Bento Gonçalves. Abamectina e enxofre são inócuos a indivíduos de Vacaria, enquanto carbaril, fenitrotiona, metidationa e triclorfom são levemente prejudiciais, conforme classificação da IOBC.Chrysoperla externa (Neuroptera: Chrysopidae is an important biological control agent of artropod-pests in apple crop. In this research the effects of the pesticides (g a.i. L-1 abamectin (0.02, carbaryl (1.73, fenitrothion (0.75, methidathion (0.40, sulphur (4.80 and trichlorfon (1.50, on C. externa pupae from Bento Gonçalves and Vacaria regions, Rio Grande do Sul, Brazil, as well as on the development of the adults obtained and its reproduction were evaluated. The sprayings of those compounds and distilled water (control on pupae were accomplished using a Potter tower. Carbaryl and trichlorfon caused mortality of treated pupae in both studied populations. Abamectin only caused significant mortality of treated pupae from Vacaria; sulphur, fenitrothion and methidathion presented to be harmless to the predator. None of the compounds reduced the oviposition capacity of C. externa from Bento Gonçalves, originated from treated pupae; however, fenitrothion caused reductions in that biological parameter for females from Vacaria. Among the evaluated pesticides, only carbaryl and abamectin did not reduced the viability of eggs laid by C. externa from Bento Gonçalves and Vacaria, respectively. According to the total effect (E of each pesticide, sulphur, fenitrothion and methidathion are harmless, whereas abamectin, carbaryl and trichlorfon are slightly harmful to insects from Bento Gonçalves. Abamectin and sulphur are harmless to insects from Vacaria, while carbaryl, fenitrothion, methidathion and trichlorfon are slightly harmful, according to the IOBC classification.

  13. Seletividade fisiológica de inseticidas aos inimigos naturais de Plutella xylostella (L. (Lepidoptera: Plutellidae em brássicas Insecticide physiological selectivity to natural enemies of Plutella xylostella (L. (Lepidoptera: Plutellidae in Brassicae

    Leandro Bacci

    2009-01-01

    Full Text Available A conservação de inimigos naturais é um componente fundamental no manejo integrado de pragas. Neste trabalho, estudou-se a seletividade de sete inseticidas usados no manejo de Plutella xylostella (L. (Lepidoptera: Plutellidae ao parasitóide Oomyzus sokolowskii (Kurdjumov (Hymenoptera: Eulophidae e aos predadores Discodon sp. (Coleoptera: Cantharidae e Lasiochilus sp. (Hemiptera: Anthocoridae. Os organofosforados metamidofós e paratiom metílico e o carbamato carbaril foram altamente tóxicos aos três inimigos naturais estudados. Dimetoato apresentou seletividade em favor do Discodon sp., na dose e subdose. O inseticida acefato apresentou alto impacto ao Discodon sp., no momento da aplicação e seu efeito foi reduzido com a metade da concentração do princípio ativo. Deltametrina apresentou seletividade à O. sokolowskii nas duas dosagens. Já permetrina foi seletiva a Lasiochilus sp., somente na subdose. Discodon sp. foi mais tolerante à dose e subdose do dimetoato e à subdose do acefato do que O. sokolowskii e Lasiochilus sp. O predador Lasiochilus sp. foi mais tolerante à dose e subdose da permetrina do que O. sokolowskii e Discodon sp. O parasitóide O. sokolowskii foi mais tolerante à dose e subdose da deltametrina do que Lasiochilus sp. e Discodon sp. Os resultados desta pesquisa foram obtidos em condições de exposição extrema, portanto indicam que os inseticidas seletivos possivelmente não serão prejudiciais aos inimigos naturais, em condições de campo.The conservation of natural enemies is a fundamental component in the integrated pest management. In this work, one studied the selectivity of seven insecticides, used in the management of Plutella xylostella (L. (Lepidoptera: Plutellidae, to the parasitoid Oomyzus sokolowskii (Kurdjumov (Hymenoptera: Eulophidae, and to the predators Discodon sp. (Coleoptera: Cantharidae and Lasiochilus sp. (Hemiptera: Anthocoridae. The organophosphates methamidophos and methyl parathion, and the carbamate carbaryl showed high toxicity to the three natural enemies studied. Dimethoate showed selectivity in favor of Discodon sp. in the dose and sub-dose. The insecticide acephate showed a high impact on Discodon sp. at the time of the application, and its effect was reduced with half of the concentration of the active ingredient. Deltamethrin showed selectivity to O. sokolowskii in both dosages. Permethrin was selective to Lasiochilus sp. only in the sub-dose. Discodon sp. was more tolerant to the dose and sub-dose of dimethoate and to the sub-dose of acephate than O. sokolowskii and Lasiochilus sp. The predator Lasiochilus sp. was more tolerant to the dose and sub-dose of permethrin than O. sokolowskii and Discodon sp. The parasitoid O. sokolowskii was more tolerant to the dose and sub-dose of deltamethrin than Lasiochilus sp. and Discodon sp. The results of this research were obtained in conditions of extreme exposition. Thus, the results indicate that it is probable that the selective insecticides will not be harmful to the natural enemies in the field.

  14. Post-embryonic development of Ceraeochrysa cincta (Schneider, 1851 (Neuroptera: Chrysopidae fed with eggs of Diatraea saccharallis (Fabricius, 1794 (Lepidoptera: CrambidaeDesenvolvimento pós-embrionário de Ceraeochrysa cincta (Schneider, 1851 (Neuroptera: Chrysopidae alimentada com ovos de Diatraea saccharallis (Fabricius, 1794 (Lepidoptera: Crambidae

    Luis Gustavo Amorim Pessoa

    2010-02-01

    Full Text Available The lacewings (Ceraeochrysa cincta are important predators found associated to many pests in several agroecosystems. Eggs of Sitotroga cerealella and Anagasta kuehniella are used traditionally for massal rearing of these predators. Other foods can be used in substitution to the traditional ones, but little is known about the biology of lacewings and other alternative foods. So, this work was carried out to evaluate the effect of different diets on the post-embryonic development of C. cincta in laboratory. After been individualized in glass tubes, each larva was fed with S. cereallella and Diatraea saccharallis. It was evaluated the larvae duration, weight and viability in each instar, the duration, weight and viability of the pupa and pre-pupa stages and the duration of the post-embryonic period. It was adopted a completely randomized design with ten replications per treatment, each consisting of five eggs or larvae of C. cincta. Larvae were weighed 48 hours after hatching and 48 hours after each molt, and pre-pupae and pupae, 48 hours after starting these stages. There was no effect of the kind of food provided on the parameters evaluated. Therefore, D. saccharallis eggs can be used to feed C. cincta.Os crisopídeos são importantes predadores encontrados associados a diversos artrópodes-praga em diversos agroecossistemas. Para a criação massal desses predadores são utilizados tradicionalmente ovos de Sitotroga cerealella e de Anagasta kuehniella. Outros alimentos podem ser utilizados em substituição aos tradicionais, mas pouco se conhece sobre a biologia de crisopídeos e outros alimentos alternativos. Assim, este trabalho objetivou verificar o efeito de diferentes dietas sobre o desenvolvimento pós-embrionário dessa espécie em laboratório. Após a individualização em tubos de vidro, cada larva foi alimentada com ovos de S. cerealella e Diatraea saccharallis. Avaliou-se a duração, o peso e a viabilidade das larvas em cada ínstar, a duração o peso e viabilidade das fases de pré-pupa e pupa e a duração do período pós-embrionário. Adotou-se o delineamento inteiramente casualizado, com dez repetições por tratamento, cada uma constituída por cinco ovos ou larvas de C. cincta. As larvas foram pesadas 48 horas após a eclosão e 48 horas após cada ecdise, e as pré-pupas e pupas, 48 horas após iniciarem esses estágios Não houve interferência do tipo de alimento fornecido sobre os parâmetros avaliados. Desta forma, ovos de D. saccharallis podem ser utilizados para alimentação de C. cincta.

  15. Biological aspects of the immature stages of Ceraeochrysa everes (Banks (Neuroptera: Chrysopidae Aspectos biológicos dos estágios imaturos de Ceraeochrysa everes (Banks (Neuroptera: Chrysopidae

    Leonardo Rodrigues Barbosa

    2002-09-01

    Full Text Available A knowledge of the behavior and biological aspects of natural enemies is extremely important for the establishment of biological control programs. Biological aspects of the larvae, pre-pupae and pupae of the predator Ceraeochrysa everes (Banks were studied. Larvae of the adult F1 generation were reared in the laboratory (25 ± 2°C, 65 ± 10 % RH and 14h photophase on eggs of the Angoumois grain moth Sitotroga cerealella (Olivier. The duration and viability of the embryonic period, development of the immature stages and egg-adult period were evaluated. The mean embryonic period was 5.0 days, while the mean durations of the first, second and third instars were: 5.1 ± 0.03; 4.3 ± 0.05 and 4.5 ± 0.05 days, respectively, with viability exceeding 90%. Duration of the larval, pre-pupal and pupal stages averaged 13.9 ± 0.07; 5.7 ± 0.07 and 9.6 ± 0.12 days, respectively. Duration of the biological cycle was 34 ± 0.11 days on average. S. cerealella eggs were not suitable for rearing C. everes under laboratory conditions because they affected predator development.Para o estabelecimento de um programa de controle biológico, o conhecimento de alguns aspectos biológicos e de comportamento dos inimigos naturais é de extrema importância. Os aspectos biológicos do desenvolvimento larval e pupal do predador Ceraeochrysa everes (Banks foram estudados. Larvas oriundas de adultos da geração F1 foram mantidas em laboratório a 25 ± 21°C, 70 ± 10 % UR e fotofase 14 horas, sendo alimentadas com ovos de Sitotroga cerealella (Olivier. A duração e viabilidade do período embrionário, estágios imaturos de desenvolvimento e o período de ovo a adulto foram avaliados. O período embrionário foi em média de 5,0 dias, enquanto que as durações médias para o primeiro, segundo e terceiro instares foram de 5,1 ± 0,03; 4,3 ± 0,05 e 4,5 ± 0,05 dias, respectivamente, com viabilidade superior a 90 %. Os estágios larval, pré-pupal e pupal apresentaram duração média de 13,9 ± 0,07; 5,7 ± 0,07 e 9,6 ± 0,12 dias, respectivamente. A duração do ciclo biológico foi de 34 ± 0,11 dias em média. Ovos de S. cerelella não foram adequados para a manutenção de C. everes em laboratório, por interferir no desenvolvimento do predador.

  16. Efeitos de Fatores Ambientais na Reprodução de Tartarugas Environmental factors effects in turtles reproduction

    Paulo Dias Ferreira Júnior

    2009-01-01

    Full Text Available Para as espécies de tartaruga que apresentam a determinação sexual dependente da temperatura da incubação o local e o momento da desova, exercem influências que vão além da definição do sexo dos embriões. A influência do local da desova se estende a todo o desenvolvimento embrionário afetando o comportamento e o tamanho dos filhotes. O momento em que ocorre a desova trará conseqüências ao ambiente térmico dos ninhos à medida que a temperatura e a umidade variam ao longo do ano. A umidade será decisiva nas trocas hídricas e gasosas entre os ovos e o meio afetando a absorção do vitelo e o crescimento dos embriões. As cheias e os alagamentos são importantes fatores de perda de ninhos nas espécies de tartaruga de água doce. A desova no momento adequado possibilita uma incubação segura, sem a interferência de alagamentos dos ninhos e conseqüente morte dos embriões. A predação dos ninhos varia de acordo com o local da desova, o tipo e a abundância de predadores e a profundidade da câmara de ovos. A escolha de pontos de desova no interior da vegetação, onde a taxa de predação é geralmente menor, nem sempre é a estratégia mais frequentemente adotada pelas tartarugas, uma vez que esse procedimento pode levar a uma maior exposição das fêmeas aos predadores, à diminuição do sucesso da eclosão ou a alterações na razão sexual provocadas por diferenças na temperatura da incubação.Turtle species in which the sex determination is dependent of incubation temperature, the nest site and the laying moment will affect more than embryo sex determination. The influence of the laying site extends all over the embryonic development, affecting hatching weight and size. The time of the egg-laying will bring consequences to the nest thermal environment, as the temperature and humidity change throughout the year. The humidity will be decisive in gaseous and hydric exchanges between eggs and the environment, affecting yolk absorption and embryo growth. Floods and inundation are important factors related to nest loss in freshwater turtle species. Egg laying at the appropriated time makes a safe incubation possible, without the interference of nest inundation and subsequent embryo death. The nest predation varies according to the egg-laying site, type and abundance of predator and nest depth. The choice of areas in the middle of vegetation, where the predation rate is generally smaller, is not always the most used strategy by turtles, since this procedure can decrease the hatching success or provoke changes in sex ratio.

  17. Avaliação de substratos de oviposição para Orius insidiosus (Say (Hemiptera, Anthocoridae Evaluation of oviposition substrates for Orius insidiosus (Say (Hemiptera, Anthocoridae

    Lívia M. Carvalho

    2010-03-01

    Full Text Available Avaliação de substratos de oviposição para Orius insidiosus (Say (Hemiptera, Anthocoridae. Fêmeas do predador O. insidiosus usam tecidos de plantas para colocação de seus ovos, o que caracteriza a oviposição endofítica. Este trabalho teve por objetivo avaliar diferentes substratos de oviposição para este predador. O estudo foi conduzido em sala climatizada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12 horas. Os substratos de oviposição utilizados foram brotos de feijão (Phaselus vulgaris L., brotos de soja [Glycine max (L. Merr.], brotos de batata (Solanum tuberosum L., vagem de feijão (Phaselus vulgaris L. e inflorescências de picão-preto (Bidens pilosa L.. Foram avaliados os números médio diário e total de ovos por um período de 15 dias, o número de adultos vivos em cada recipiente e a viabilidade na produção dos adultos. Todos os substratos testados foram aceitos pelas fêmeas. Entretanto, foi observado um número significativamente maior de ovos de O. insidiosus em brotos de feijão (4,3 ovos por dia e brotos de soja (3,9 ovos por dia, comparado aos demais substratos avaliados. As menores (pFemales of O. insidiosus deposit their eggs in the plant tissue. This study aimed to evaluate oviposition substrates for this predator. The study was conducted in an air-conditioned room at 25 ± 2ºC, 70 ± 10% RH, and a 12 h photophase. The oviposition substrates used consisted of bean sprouts (Phaseolus vulgaris L., soybean sprouts [Glycine max (L. Merr.], potato sprouts (Solanum tuberosum L., bean pods (Phaseolus vulgaris L., and farmer's friend inflorescences (Bidens pilosa L.. Evaluations included the daily mean and total numbers of eggs per female during a 15-day period, the number of live adults in each container, and adult production viability. All substrates tested were accepted by the females. However, a significantly higher number of O. insidiosus eggs was found on bean sprouts (4.3 eggs per day and soybean sprouts (3.9 eggs per day, when compared with the other substrates evaluated. The lowest (p<0,05 viability values in the production of O. insidiosus adults (75.1 and 71.7% were observed from eggs laid on potato sprouts and bean pods, respectively. Bean and soybean sprouts were suitable to rear O. insidiosus in the laboratory; these substrates have the additional advantages of being produced throughout the year without requiring large areas for its production, thus reducing the costs and labor necessary to obtain and prepare them to be use on the mass-rearing system. These results may be useful in the mass rearing of O. insidiosus in the laboratory, with the objective of releasing the predator in biological control programs against thrips.

  18. Predation, Competition, and Abiotic Disturbance: Population Dynamics of Small Mammals

    Yunger, John A.; /Northern Illinois U. /Northern Illinois U.

    1996-01-01

    Predation and food availability have been implicated in annual non-cyclic fluctuations of vertebrate prey at mid-latitudes. The timing and magnitude of these factors are unclear due to a lack of large-scale field experiments, little attention to interactions, and a failure to closely link vertebrate predators with their prey. From October 1992 to January 1996, small mammal populations were censused on eight 0.6 ha plots at monthly intervals in a 32-ha prairie restoration at Fermi National Accelerator Laboratory, Illinois. Terrestrial vertebrate predators were excluded after July 1993 from four of the eight plots and canid diets monitored. Both terrestrial and avian vertebrate predators were excluded in March 1994. During 1993 small mammal densities (i.e., Microtus Pennsylvanicus, Peromyscus leucopus, and P. maniculatus) were relatively high. Following peak densities in late summer, Microtus numbers wer 2-3x greater on exclusion plots relative to controls due to preferential selection of Microtus by canids, as reflected in dits. Following an ice-storm and crash in small mammal numbers (particularly Microtus), vertebrate predator exclusion had no detectable effect on P. leucopus numbers, probably due to an abundance of alternative prey (i.e., Sylvilagus floridanus). Meadow vole numbers began to increase in Fall 1995, and a numerical effect of predator exclusion, similar to that in 1993, was observed. Predator exclusion had no detectable effect on the movements and spatial patterns of Microtus during 1993. There was a significant decrease in home range and a significant increase in home range overlap for P. leucopus on the predator exclusion plots. The change in spatial behavior may be due to interspecific competition with Microtus resulting from increased densities on exclusion plots. Thus, predators had an indirect effect on P. leucopus spatial patterns mediated through M. Pennsylvanicus. The role of food limitation was studied using natural and manipulative experiments. Unusually high acorn production in Fall 1994 resulted in increased P. leucopus numbers at one Fermilab site due to immigration since survivorship or reproduction were unaffected. A food supplementation experiment during October 1994-March 1995 induced a strong increase in P. leucopus numbers, due again to immigration, although reproduction also was advanced by two months.

  19. CACERÍA DE MAMÍFEROS MEDIANOS EN CAFETALES DEL CENTRO DE VERACRUZ, MÉXICO

    Liliana TLAPAYA

    2010-01-01

    Full Text Available El presente trabajo analiza la cacería de mamíferos medianos en cafetales del centro de Veracruz, México, enfocado en dos zonas: Huatusco y Teocelo-Coatepec, registrando datos por medio de entrevistas estructuradas aplicadas a cazadores activos en las zonas de estudio. Los cafetales son agroecosistemas que presentan un sistema de manejo bajo sombra de árboles, que permiten mantener una biodiversidad considerable de mamíferos medianos. La colecta de datos se realizó durante los meses de enero a mayo del 2006 en los cafetales muestreados como parte de un proyecto más amplio titulado BIOCAFE. Se aplicaron un total de 77 entrevistas estructuradas que nos permitieron conocer qué mamíferos son cazados, los métodos utilizados para cazarlos, el uso que les dan, además de inferir cuantos animales se extraen por año y que biomasa representa. Los resultados de las entrevistas muestran que de las 24 especies registradas de mamíferos medianos, son cinco especies las más cazadas en ambas zonas en proporciones significativas: armadillo (Dasypus novemcinctus, tlacuache (Didelphis virginiana, conejo (Sylvilagus floridanus, mapache (Procyon lotor y zorra (Urocyon cinereoargenteus. De las 16 especies cazadas, el armadillo es la presa de mayor demanda y la más aprovechada en ambas zonas. La estimación de biomasa extraída al año fue de 194 kg/cazador para la zona de Teocelo-Co atepec y de 174 kg/cazador en la zona Huatusco. En cuanto a los métodos más comúnmente utilizados para cazar son; arma de fuego (53%, seguido del uso de perros (41% y por último la arreada (33%. La presión de cacería fue mucho mayor en los cafetales de la zona de Teocelo-Coatepec por haber una mayor densidad poblacional humana. La cacería que se practica en ambas zonas es completamente ilegal, es por esto que es necesario realizar acciones para promover el manejo y la conservación de las especies, así como al desarrollo de la comunidad en el área de estudio.

  1. Mechanisms of social regulation change across colony development in an ant

    Liebig Jürgen

    2010-10-01

    Full Text Available Abstract Background Mutual policing is an important mechanism for reducing conflict in cooperative groups. In societies of ants, bees, and wasps, mutual policing of worker reproduction can evolve when workers are more closely related to the queen's sons than to the sons of workers or when the costs of worker reproduction lower the inclusive fitness of workers. During colony growth, relatedness within the colony remains the same, but the costs of worker reproduction may change. The costs of worker reproduction are predicted to be greatest in incipient colonies. If the costs associated with worker reproduction outweigh the individual direct benefits to workers, policing mechanisms as found in larger colonies may be absent in incipient colonies. Results We investigated policing behaviour across colony growth in the ant Camponotus floridanus. In large colonies of this species, worker reproduction is policed by the destruction of worker-laid eggs. We found workers from incipient colonies do not exhibit policing behaviour, and instead tolerate all conspecific eggs. The change in policing behaviour is consistent with changes in egg surface hydrocarbons, which provide the informational basis for policing; eggs laid by queens from incipient colonies lack the characteristic hydrocarbons on the surface of eggs laid by queens from large colonies, making them chemically indistinguishable from worker-laid eggs. We also tested the response to fertility information in the context of queen tolerance. Workers from incipient colonies attacked foreign queens from large colonies; whereas workers from large colonies tolerated such queens. Workers from both incipient and large colonies attacked foreign queens from incipient colonies. Conclusions Our results provide novel insights into the regulation of worker reproduction in social insects at both the proximate and ultimate levels. At the proximate level, our results show that mechanisms of social regulation, such as the response to fertility signals, change dramatically over a colony's life cycle. At the ultimate level, our results emphasize the importance of factors besides relatedness in predicting the level of conflict within a colony. Our results also suggest policing may not be an important regulatory force at every stage of colony development. Changes relating to the life cycle of the colony are sufficient to account for major differences in social regulation in an insect colony. Mechanisms of conflict mediation observed in one phase of a social group's development cannot be generalized to all stages.

  2. Diapause in copepods (Crustacea) from ephemeral habitats with different hydroperiods in Everglades National Park (Florida, U.S.A.)

    Bruno, M.C.; Loftus, W.F.; Reid, J.W.; Perry, S.A.

    2001-01-01

    Water management practices in the Everglades have severely stressed the natural system, particularly by reducing the hydroperiods of much of the region. During the dry season of 1999, we investigated the influence of hydroperiod on the species composition and dormancy patterns of freshwater copepod communities in seasonal wetlands of Everglades National Park, Florida, U.S.A. The habitats were characterized by an annual dry season, from December through June. We sampled at two locations: the Long Pine Key area of the Rocky Glades region (short hydroperiod, ca. 4-5 months), and western Taylor Slough (intermediate hydroperiod, ca. 8-10 months). Both areas have experienced a reduction in natural hydroperiods and an increase in the frequency of dry-down. We collected weekly plankton samples from Rocky Glades solution holes to assess the potential species pool of copepods. To document the taxa capable of surviving dry-down by resting, we performed three immersion trials in which we rehydrated, in laboratory aquaria, sediment patches from solution holes and surface soils from all stations. Only a subset of the planktonic species collected emerged from the dried sediments. The cyclopoids Microcyclops rubellus and Paracyclops poppei were dominant. This is the first record of diapause for P. poppei. Species distributions from the different hydroperiod soil patches indicated that more diapausing species occurred at the sites that dried for shorter periods. Emerging individuals of M. rubellus and P. poppei were mainly ovigerous females, demonstrating a resting strategy seldom before recorded. The cyclopoid Diacyclops nearcticus had not been previously reported to diapause, but they emerged from the dried sediments in our trials. Our collections included six new records for Florida: Diacyclops nearcticus, Megacyclops latipes, Orthocyclops modestus, Elaphoidella marjoryae, Bryocamptus sp. and Bryocamptus cf. newyorkensis. Paracyclops poppei, Macrocyclops fuscus and Arctodiaptomus floridanus are new records for Everglades National Park. Clearly, diapause is an important strategy for the persistence of copepods in short-hydroperiod wetlands. The duration of the dry period appears to be inversely related to the number of species that emerge from diapause.

  3. Marine reserve design for conservation and fisheries management: a case study from the California Channel Islands

    Airame, S.J.; Dugan, E.; Lafferty, K.D.; Leslie, H.M.; McArdle, D.A.; Warner, R.R.

    2003-01-01

    Five races of cottontail rabbits belonging to three species occur in Virginia. One of them, the Mearns cottontail (Sylvilagus floridanus mearnsi), is reported here for the first time. It occurs in six southwestern counties of the state, while the eastern cottontail (S. f. mallurus) occurs in the remainder of the state with the exception of Smith and Fishermans islands off the eastern coast of Cape Charles, where it is replaced by Hitchens cottontail (S. f. hitchensi). The New England cottontail (S. transitionalis) is found on the higher mountain peaks, above 3000 feet, and the swamp rabbit (S. palustris) occurs in the Dismal Swamp region of southeastern Virginia.....The height of the breeding season for the eastern cottontail in Virginia is March and April, but breeding continues through the entire year except in December and January. The average litter size based on embryo counts was 4.7. The sex ratio of 234 specimens from all parts of the state, taken mostly in the December to February period, was 53 males to 47 females. That of a group of 145 rabbits live-trapped at Blacksburg during February and Marchwas 58 males to 42 females. The figures show that males are more active than females during the winter months, and therefore are more easily taken then....In transplanting cottontails from one section of the state to another, it is recommended that only cottontails of the same race as those originally present in the region being restocked be released there....Tularemia is not a common disease among rabbits in Virginia, but the rabbit ticks are often carriers of the disease and may transmit it to rabbits. Rabbit ticks are also found to be carriers of Rocky Mountain fever and American Q. fever. After the ticks drop off the rabbits to hibernate in the ground, which is likely to occur during mid-winter in Virginia, there is relatively little danger of humans contracting tularemia by contact with rabbits. Present laws in Virginia which prohibit rabbit hunting until the opening of the general hunting season, November 15and November 20--west and east of the Blue Ridge Mountains, respectively--protect the licensed hunters to which these regulations apply, but landowners or tenants are still allowed to take rabbits for their own use on their own land at any time. It is recommended that as a public health measure the taking of cottontails be completely prohibited to all until the opening of the general hunting season.

  4. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A.

    Hamer Sarah A

    2012-10-01

    Full Text Available Abstract Background Wild birds contribute to maintenance and dissemination of vectors and microbes, including those that impact human, domestic animal, and wildlife health. Here we elucidate roles of wild passerine birds, eastern cottontail rabbits (Sylvilagus floridanus, and Ixodes dentatus ticks in enzootic cycles of two spirochetes, Borrelia miyamotoi and B. andersonii in a region of Michigan where the zoonotic pathogen B. burgdorferi co-circulates. Methods Over a four-year period, wild birds (n = 19,631 and rabbits (n = 20 were inspected for tick presence and ear tissue was obtained from rabbits. Samples were tested for Borrelia spirochetes using nested PCR of the 16S-23S rRNA intergenic spacer region (IGS and bidirectional DNA sequencing. Natural xenodiagnosis was used to implicate wildlife reservoirs. Results Ixodes dentatus, a tick that specializes on birds and rabbits and rarely bites humans, was the most common tick found, comprising 86.5% of the 12,432 ticks collected in the study. The relapsing fever group spirochete B. miyamotoi was documented for the first time in ticks removed from wild birds (0.7% minimum infection prevalence; MIP, in I. dentatus, and included two IGS strains. The majority of B. miyamotoi-positive ticks were removed from Northern Cardinals (Cardinalis cardinalis. Borrelia andersonii infected ticks removed from birds (1.6% MIP, ticks removed from rabbits (5.3% MIP, and rabbit ear biopsies (5% comprised twelve novel IGS strains. Six species of wild birds were implicated as reservoirs for B. andersonii. Frequency of I. dentatus larval and nymphal co-feeding on birds was ten times greater than expected by chance. The relatively well-studied ecology of I. scapularis and the Lyme disease pathogen provides a context for understanding how the phenology of bird ticks may impact B. miyamotoi and B. andersonii prevalence and host associations. Conclusions Given the current invasion of I. scapularis, a human biting species that serves as a bridge vector for Borrelia spirochetes, human exposure to B. miyamotoi and B. andersonii in this region may increase. The presence of these spirochetes underscores the ecological complexity within which Borrelia organisms are maintained and the need for diagnostic tests to differentiate among these organisms.

  5. Predao de ninhos de Trachemys dorbigni (Dumril & Bibron (Testudines, Emydidae no extremo sul do Brasil Nest predation of Trachemys dorbigni (Dumril & Bibron (Testudines, Emydidae in Southern Brazil

    Fernanda A. Gonalves

    2007-12-01

    Full Text Available Ninhos da tartaruga tigre-d'gua, Trachemys dorbigni, foram monitorados durante a estao reprodutiva de 2005/2006 para avaliar as taxas de predao e a variao temporal destas; identificar as espcies predadoras, sua importncia na destruio dos ninhos e determinar a influncia da disperso dos ninhos sobre a predao, no extremo sul do Brasil. Dos 58 ninhos monitorados, 98% (n = 57 foram destrudos por predadores. Eventos de predao ocorreram predominantemente nas primeiras 48 horas aps a oviposio e no houve variao temporal nas taxas de predao. Atravs de armadilhas fotogrficas e observaes diretas foram identificadas seis espcies predadoras dos ninhos, no havendo prevalncia de nenhuma das espcies. A densidade de ninhos no influenciou as taxas de predao, mas houve correlao negativa entre densidade e tempo decorrido entre a desova e a predao.Nests of the D'Orbigny's slider, Trachemys dorbigni, were monitored during the nesting season of 2005/2006 to evaluate predation rates; time variation on these rates; to identify predator species and their importance on nest destruction and the influence of nest dispersion on predation rates in Southern Brazil. Of the 58 monitored nests, 98% (n = 57 were destroyed by predators. Predation events occurred primarily during the first 48 hours after oviposition and there was no time variation on predation rates. Using camera traps and direct observations we could identify six species of nest predators. There was not prevalence of any predator. Nest density did not influence predation rates, but there was a negative correlation between time after egg laying and predation.

  6. Aspectos da predao entre larvas de Chrysoperla externa (Hagen, 1861 e Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae em laboratrio Predation among Chrysoperla externa (Hagen, 1861 and Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae larvae under laboratory conditions

    Brgida Souza

    2008-06-01

    Full Text Available Objetivou-se no presente trabalho estudar aspectos da predao entre larvas de Chrysoperla externa e Ceraeochrysa cubana, sob condies de laboratrio, verificando a sobrevivncia desses predadores nos diferentes nstares, quando mantidos nas propores de 1:1, 2:2 e 3:3. De modo geral, C. externa apresentou maior sobrevivncia, independente do nstar e da proporo de adensamento entre indivduos. Ao contrrio, C. cubana foi fortemente afetada pela interao com C. externa, tendo sua capacidade de sobrevivncia reduzida com o aumento da proporo de adensamento e com o desenvolvimento larval. No final da fase larval, verificou-se uma taxa de sobrevivncia prxima a 96, 90 e 95%, e 56, 23 e 9% para C. externa e C. cubana nas propores de 1:1, 2:2 e 3:3 indivduos, respectivamente.This work aimed to study aspects of predation among Chrysoperla externa and Ceraeochrysa cubana larvae under laboratory conditions. The survival of those predators in different larval stages was studied, maintaining the larvae grouped in proportions of 1:1, 2:2 and 3:3 individuals. C. externa presented higher survival rates, independently of larval nstar and density proportion among individuals. On the other hand, C. cubana was strongly affected by interaction with C. externa, and had its survival capacity reduced with the increase of grouping proportion and larval development. At the end of larval phase, a survival rate around 96, 90, and 95 and 56, 23 and 9% for C. externa and C. cubana in proportions of 1:1, 2:2 and 3:3 individuals, respectively, was verified.

  7. Fauna benfica asociada a cultivos de cerezo (Prunus avium L.) en el Valle Inferior del Ro Chubut (Regin Patagonia Sur)

    S.G, Bado; R, Blum; M.E, Santos.

    2013-12-01

    Full Text Available El conocimiento de los agentes benficos asociados a un cultivo forma parte de los aspectos bsicos que deben tenerse en cuenta a la hora de establecer estrategias de control biolgico. El objetivo del trabajo es brindar informacin acerca del complejo de enemigos naturales hallado en dos cultivos d [...] e cerezo en la Regin Patagonia Sur donde no se emplean agroqumicos. Para ello, se desarrollaron monitoreos semanales con el fin de recolectar predadores y parasitoides sobre el cultivo. La determinacin de los individuos se realiz con ayuda de claves entomolgicas adecuadas. Se cont con la colaboracin de especialistas taxonmos. Se obtuvieron ms de 170 individuos en ambos predios, entre las cuales el 70% pertenece a las familias Braconidae, Ichneumonidae y Chalcididae (Orden Hymenoptera) que son las que poseen reconocida accin como agentes de biocontrol. Abstract in english The knowledge of the natural enemies associated with a culture is one of the basic aspects to think of when applying strategies for biological control. The aim of this study is to obtain information about the complex of natural enemies present in two cherry orchards in southern Patagonia where no ap [...] plication of agrochemicals takes place. Surveys were carried out weekly in order to collect predators and parasitoids in the orchards. Determination of individuals was carried out by means of entomological determination keys. Furthermore, specialized taxonomists were consulted for determination of doubtful individuals. More than 170 individuals were determined from both sites, of which around 70% belonged to the families Braconidae, Ichneumonidae and Chalcididae, which are known for their great potential as agents for biocontrol.

  8. Categorização funcional trófica das comunidades de macroinvertebrados de dois reservatórios na região Centro-Oeste do Estado de São Paulo, Brasil = Functional trophic categorization of macroinvertebrate communities of two reservoirs in the Midwestern region of São Paulo State, Brazil

    Fabio Laurindo da Silva

    2009-01-01

    Full Text Available A utilização do conceito de guilda pode ser útil para a categorização funcional trófica de comunidades, pois não há obrigatoriedade da identificação dos organismos em nível de espécie, nem de tratar cada espécie como uma entidade separada. O objetivo deste estudo foi analisar os grupos funcionais tróficos (coletores-catadores, coletores-filtradores, fragmentadores, predadores e raspadores das comunidades de macroinvertebrados de dois reservatórios da região Centro-Oeste do Estado de São Paulo, Brasil. As amostragens foramrealizadas nos períodos chuvoso (março/abril - 2001 e de seca (julho/agosto - 2001 e os dados obtidos indicam que os coletores-catadores foram a guilda mais frequente. Este fato sugere grande importância da matéria orgânica como recurso alimentar na dieta dosmacroinvertebrados analisados.The use of the concept of guild can be useful for the functional trophic categorization of communities, because there is no requirement identification of organisms in the level of species and not to treat each species as a separate entity. The aim of this studywas to analyze the functional feeding groups (collectors-gatherers, collectors-filterers, shredders, predators and grazer-scrapers of the macroinvertebrate communities of two reservoirs in the Midwestern region of São Paulo State. Sampling was carried out in rainy(March/April - 2001 and dry (July/August - 2001 seasons and the data obtained indicate that ‘collectors-gatherers’ is the most frequent guild. This fact suggests a great importance of organic matter as a food source in the diet of the macroinvertebrates analyzed.

  9. COEXISTENCIA TRÓFICA DE AVES CARPINTERAS (Picidae EN UN BOSQUE DE Pinus cembroides (Zucc. DEL ÁREA NATURAL PROTEGIDA PEÑA ALTA, SAN DIEGO DE LA UNIÓN, GUANAJUATO

    Saúl Ugalde-Lezama

    2011-01-01

    Full Text Available Estudiar la coexistencia trófica en aves es relevante para su manejo y conservación. Para ello, de enero a octubre de 2008 se identificaron técnicas de cacería y componentes entomológicos de las dietas de aves piciformes. Para la observación de las aves se usó la técnica de búsqueda intensiva en puntos de radio fijo, y para su captura, redes de niebla. Melanerpes formicivorous y Picoides scalaris prefirieron las técnicas de cacería Perforar y Colectar. Dichas técnicas se explicaronpor cinco y cuatro variables (P<0.05, respectivamente. Los estratos más utilizados fueron Pinus cembroides y Quercus spp. Los órdenes de insectos más consumidos fueron Coleóptera y Hemíptera. Las principales familias registradas corresponden a Scolytidae, Curculionidae, Pentatomidae, Cicadellidae, Cleridae y Melyridae. Los insectos más consumidos fueron los tipo Plaga (P, No Plaga (NP y Predadores (PR. Se registró una proporción significativa de individuos (X2=9.19, X2 0.001(5=20.5 de insectos en las dietas. Sin embargo, no fue posible registrar todos los fragmentos (X2=56.33, X2 0.001(5=20.5. El número de individuos (a=0.05, P-value=0.2317 y fragmentos (a=0.05, P-value=0.2606 entre especies fue similar. Siete variables (P<0.05 determinaron la ocurrencia de grasa y el consumo de presas. Los Picidos bajo estudio, a pesar de poseer anatomías, fisiologías y etologías similares, coexistieron tróficamente segregados durante la procuración alimenticia, minimizando de esta manera la competencia interespecífica.

  10. Short-term assessment of bt maize on non-target arthropods in Brazil / Avaliao do efeito de milho bt sobre artrpodos no alvo no Brasil

    Odair Aparecido, Fernandes; Marcos, Faria; Samuel, Martinelli; Francisco, Schmidt; Vincius Ferreira, Carvalho; Gloverson, Moro.

    2007-06-01

    Full Text Available Embora no haja cultivos comerciais de milho geneticamente modificado no Brasil, o efeito de hbridos de milho Bt sobre inimigos naturais e artrpodos de solo deve ser avaliado antes da liberao aos produtores. Assim, ensaios foram conduzidos durante uma safra em duas localidades. Os hbridos de mi [...] lho modificado geneticamente 7590-Bt11 e Avant-ICP4 foram comparados com seus respectivos isognicos no transgnicos. Os artrpodes foram avaliados atravs de observao direta nas plantas e armadilhas de alapo. De modo geral, no se observaram diferenas entre as populaes de tesourinha (Dermaptera: Forficulidae), joaninhas (Coleptera: Coccinellidae), percevejo-pirata (Coleoptera: Anthocoridae), carabdeos (Carabidae), cicindeldeos (Cicindelidae) e aranhas (Araneae). Tambm no houve diferena no parasitismo de ovos de Helicoverpa zea (Boddie) por Trichogramma sp. (Hymenoptera: Trichogrammatidae). Assim, milho geneticamente modificado expressando as protenas inseticidas Cry1A(b) e VIP 3A no causa reduo nas populaes dos principais predadores e parasitides. Abstract in english Although not yet available for cultivation in Brazil, the effect of Bt maize hybrids on natural enemies and soil dwelling arthropods should be assessed prior to its release to growers. Trials were carried out during one growing season in two different locations with the genetically modified maize hy [...] brids 7590-Bt11 and Avant-ICP4, comparing with their respective non-Bt isogenic hybrids. Arthropods were evaluated through direct observation on plants and pitfall traps. In general, no differences were observed between populations of earwig (Dermaptera: Forficulidae), lady beetles (Coleptera: Coccinellidae), minute pirate bug (Coleoptera: Anthocoridae), ground beetles (Carabidae), tiger beetles (Cicindelidae), and spiders (Araneae). There was no difference in egg parasitism of Helicoverpa zea (Boddie) by Trichogramma sp. (Hymenoptera: Trichogrammatidae). Thus, Bt maize hybrids expressing insecticide proteins Cry1A(b) and VIP 3A do not cause reduction of the main maize dweeling predators and parasitoids.

  11. Influncia da densidade de Myzus persicae (Sulzer sobre alguns aspectos biolgicos e capacidade predatria de Chrysoperla externa (Hagen = Influence of the density of Myzus persicae (Sulzer on the biological aspects and predatory capacity of Chrysoperla externa (Hagen

    Leonardo Rodrigues Barbosa

    2006-04-01

    Full Text Available Avaliou-se a influncia de diferentes densidades de Myzus persicae criados em folhas de pimento, Capsicum annum L. sobre os aspectos biolgicos e a capacidade predatria de Chrysoperla externa (Hagen. Larvas recm-eclodidas do predador foram alimentadas com ninfas do pulgo, oferecidas nas densidades de 50% abaixo do consumo mdio, o consumo mdio dirio e 50% acima desse consumo, sobre discos foliares de pimento mantidos em placas de Petri 25 1C, UR de 70 10% e fotofase de 12 horas. A densidade do pulgo influenciou o consumo de C. externa durante os nstares e fase larval, ocorrendo maior consumo de presa em funo do aumento da densidade. A durao de cada nstar e da fase de larva foi maior quando a densidade de presa estava 50% abaixo do consumo mdio. O porcentual de larvas sobreviventes durante os nstares e fase larval aumentou em funo do incremento na densidade. A fecundidade dos adultos e a viabilidade de ovos no foram influenciadas pelas densidades da presa.The influence of different densities of Myzus persicae (Sulzer reared on sweet pepper leaves, Capsicum annuum L., was evaluated on biological aspects and on the predatory capacity of Chrysoperla externa (Hagen. The newly emerged larvae of predator were fed with aphid nymphs, offered in the densities of 50% below the average daily consumption, 50% above that consumption, and on sweet pepper foliar discs maintained in Petri dishes at 25C. The aphid density affectedC. externa consumption during the instars and larvae stage, occurring high prey consumption with the density increase. The average duration of each instar and larvae stage was higher when the prey density was 50% below the average consumption. The percentage of surviving larvae during the instars and larvae stage became higher with the densityincrease. Prey densities did not affect adult fecundity and eggs viability.

  12. Populations analysis of the Brazilian Sharpnose Shark Rhizoprionodon lalandii (Chondrichthyes: Carcharhinidae on the São Paulo coast, Southern Brazil: inferences from mt DNA sequences

    Fernando Fernandes Mendonça

    2009-06-01

    Full Text Available Sharks of the genus Rhizoprionodon can be considered some of the most important predators along the trophic coastal marine ecosystems and represent an important economic resource for the small-scale fisheries, especially on the Brazilian coastline. In order to analyze the population structure of the shark Rhizoprionodon lalandii of São Paulo, Southeastern coast of Brazil, levels of genetic diversity were identified by nucleotide sequence analyses of the mitochondrial DNA control region. The results obtained from this study present moderate values of haplotype diversity and low nucleotide diversity. Although the AMOVA tests (ΦST = 0.08394, P Tubarões do gênero Rhizoprionodon são considerados predadores de grande importância ao longo da cadeia trófica nos ecossistemas costeiros e marinhos, também representando um importante recurso econômico para a pesca, especialmente no litoral brasileiro. A fim de analisar a estrutura populacional do tubarão Rhizoprionodon lalandii no litoral de São Paulo, sudeste do Brasil, foram identificados os níveis de diversidade genética a partir da análise de sequências nucleotídicas da região controladora do DNA mitocondrial. Os dados obtidos neste estudo apresentam valores moderados de diversidade haplotípica e baixos índices de diversidade nucleotídica. Embora os testes de AMOVA (ΦST = 0,08394, P < 0,01 tenham revelado uma pequena diferença entre as amostras estudadas, evidências sobre a ocorrência de estruturação populacional não foram encontradas o que pode representar uma característica geral para tubarões vivendo em áreas costeiras.

  13. Diversidade e dinâmica populacional de ácaros em pomar cítrico

    Marcos Zatti da Silva

    2012-01-01

    Full Text Available As plantas de citros hospedam diversas espécies de ácaros que causam sérios prejuízos à produção e qualidade de frutos no Brasil. Esta pesquisa teve por objetivo estudar a diversidade de ácaros e a dinâmica populacional das principais espécies de ácaros em pomar de citros, Citrus sinensis (L. Osbeck, localizado no município de Descalvado, Estado de São Paulo. Foram realizadas 14 avaliações em um período de 12 meses, de fevereiro de 2007 a fevereiro de 2008. Em cada avaliação, foram coletadas dez folhas e cinco frutos na parte interna de cada uma das 40 plantas demarcadas no pomar. Foram encontradas 34 espécies de ácaros, distribuídas em 17 famílias. As espécies mais abundantes foram: Phyllocoptruta oleivora (Ashmed (Eriophyidae, Panonychus citri (McGregor (Tetranychidae, Brevipalpus phoenicis (Geijskes (Tenuipalpidae e Fungitarsonemus sp. (Tarsonemidae. Entre os ácaros predadores, a família Phytoseiidae foi a de maior riqueza (oito espécies e abundância (1.072 indivíduos. A espécie predominante foi Euseius concordis (Chant, correspondendo a 98,3% dos ácaros desta família. Foram observadas correlações significativas entre densidades populacionais de E. concordis e dos ácaros fitófagos P. citri, B. phoenicis e P. oleivora. Também foram observadas correlações significativas entre densidades populacionais desses ácaros e fatores meteorológicos como temperatura e precipitação pluvial. Os resultados indicam que E. concordis atua como inimigo natural de P. citri, B. phoenicis e P. oleivora no pomar cítrico estudado.

  14. Estrutura da Comunidade de Invertebrados Bentnicos do Rio Piranhas-Assu, Rio Grande do Norte, Nordeste do Brasil

    Jansen Fernandes Medeiros

    2008-12-01

    Full Text Available Esse trabalho teve como objetivo conhecer os invertebrados bentnicos, bem como caracterizar os grupos trficos funcionais existentes no rio Piranhas-Assu, municpio de Alto do Rodrigues, Rio Grande do Norte. As coletas foram realizadas nos meses de maio (chuva, julho e setembro (seca de 2002, em trechos diferentes do rio. Foi medida a velocidade da correnteza, a largura, profundidade do rio e temperatura da gua. Foram coletados 3525 indivduos de Insecta e outras classes (Malacostraca, Gastropoda, Bivalvia, Arachnida, Ostracoda e Copepoda. A maior abundncia da classe Insecta ocorreu no ms de setembro (seca. A vazo apresentou correlao com a abundncia com na Classe Insecta, j a velocidade superficial da gua para outras classes. Entre os Insecta observou-se uma maior abundncia de predadores, seguida dos coletores, j para as outras classes os raspadores foram mais abundantes.Structure of benthic invertebrates community with focus in the aquatic insects of the Piranhas-Assu river, State of Rio Grande do Norte, Northeast, BrazilAbstract. The aim of this work was to verify the benthonic invertebrates, and to identify the functional trophic groups that exist in the Piranhas-Assu, in Alto do Rodrigues municipality, Rio Grande do Norte State. The samples were carried taken on May (rain season, July and September (dry season from 2002, in different sites in the river. The measurements of water speed, wide, temperature and river deep where made. It was collected 3525 individuals of Insecta and other classes (Malacostraca, Gastropoda, Bivalvia, Arachnida, Ostracoda and Copepoda. Insecta showed a higher abundance in September (dry season. The river discharge showed significant correlation with Insecta classe abundance, and the superficial water speed had correlation with other classes. The insects showed a highest abundance of predators, followed by collectors, in the other classes, the scrappers were the most abundant.

  15. Mercrio total em cao comercializado em So Paulo - SP, Brasil / Total mercury contents in shark species commercialized in So Paulo-SP, Brazil

    Isabel C., MORALES-AIZPURA; Alfredo, TENUTA-FILHO; Alice M., SAKUMA; Odair, ZENEBON.

    1999-12-01

    Full Text Available Foram determinados os teores de mercrio total em espcies de cao - anjo, cao-azul, cambeva, caoa, machote e anequim - comercializadas em So Paulo - SP, Brasil. Os nveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que o limite aceito pela legisla [...] o brasileira especificamente para peixes predadores, para o propsito de consumo. Os resultados mostram que espcies de cao tm sido comercializadas em desacordo com a legislao, expondo os consumidores aos riscos txicos provocados pelo mercrio. Foram feitas consideraes em relao aos elevados nveis de mercrio observados e o consumo correspondente, baseado na Ingesto Semanal Tolervel Provisional de 0,3mg de mercrio total por pessoa, que no mximo no dever ser superior a 0,2mg na forma de metilmercrio, recomendada pela FAO/OMS. Consideraes tambm foram feitas em relao necessidade de inspeo e monitoramento das espcies brasileiras de cao usadas como alimento. Abstract in english Total mercury contents in shark species - anjo, cao-azul, cambeva, caoa, machote and anequim - commercialized in So Paulo-SP, Brazil. Were determined. The levels ranged from 0.04 to 4.71 mg Hg/kg being 54% above the Brazilian acceptable legal limit of 1 mg Hg/kg (predator fishes) for consumption [...] purposes. The results show that sharks have been commercialized in disagreement with the legislation exposing consumers to a high risk of mercury toxicity. Considerations were made in relation to the observed high levels of mercury and to the corresponding consumption based upon the Provisional Tolerable Weekly Intake to a total mercury of 0.3 mg Hg/person, of which no more than 0.2 mg should be present as methylmercury (FAO/WHO). Considerations were also made regarding the need of inspection and monitoring of the shark species locally used as food.

  16. Influência do formato do aquário na sobrevivência e no desenvolvimento de larvas de matrinxã Brycon cephalus (Osteichthyes, Characidae Effects of two formats of aquariums on survival and development of matrinxã Brycon cephalus larvae (Osteichthyes, Characidae

    Marcelo Mattos Pedreira

    2006-04-01

    Full Text Available Neste experimento, utilizaram-se cinco aquários cilíndricos com relevo no fundo (em forma de anel e cinco retangulares com fundo liso para estudo da influência do formato do aquário na sobrevivência e no desenvolvimento de larvas de matrinxã Brycon cephalus. Observou-se melhor eficiência dos aquários retangulares, confirmada pela maior sobrevivência e biomassa. Os valores de temperatura, pH, condutividade e oxigênio dissolvido foram similares entre os tipos de aquários, sugerindo que esses parâmetros não influenciaram os resultados. O relevo no fundo dos aquários cilíndricos afetou negativamente o cultivo de larvas de matrinxã, pela criação de zonas com pequena capacidade da água em suspender partículas, o que resultou em acúmulo de dejetos, predadores, competidores e alimento. Aquários retangulares com fundo liso são mais adequados ao cultivo de larvas de matrinxã, por promover melhor circulação da água.This experiment compared the effects of five cylindrical aquarium with circular relief in the bottom or a rectangular aquariums with flat bottom on the intensive cultivation of matrinxã larvae (Brycon cephalus. Five aquariums of each format were used and the rectangular aquarium was the most efficient, confirmed by better survival average and biomass. Limnological variables were similar between aquariums, assuming that the parameters did not affect the results. The bottom relief in the aquarium resulted in areas with slow flow velocity, which resulted in the accumulation of waste, predators competitors and aliment, showing negative effects to culture of matrinxã. Rectangular aquariums with flat bottom are more recommended for matrinxã culture, because it provides better water circulation.

  17. Selectivity of phytosanitary products used in organic farming on adult of Cryptolaemus montrouzieri (Coleoptera, Coccinellidae under laboratory conditionsSeletividade de produtos fitossanitrios, usados no sistema de produo orgnica, sobre adultos de Cryptolaemus montrouzieri (Coleoptera, Coccinellidae, em laboratrio

    Cludia Bernardes Ourique

    2011-10-01

    Full Text Available The association of pesticides with biological control is possible only if they provide some selectivity to natural enemies. In the organic production system the effect of insecticides on beneficial insects has not been extensively studied. Thus, this study aimed to evaluate in laboratory conditions the effect of pesticides used in this system on the adults of the predator Cryptolaemus montrouzieri Mulsant (Coleoptera, Coccinellidae. We used four treatments, which corresponded to four multiple values (0.25x, 0.5x, 2x and 1x of the concentration recommended by manufacturers of the following products: Rotenat CE, Pironat, Biopirol 7M, Organic Neem, Natuneem and lime sulfur, which were tested in C. montrouzieri by topical application and residual exposure. None of the products, at any concentrations tested, had a significant effect on the survival of adults of C. montrouzieri, what did not differ from the distilled water control, showing that the products tested are selective to the adults of this species. However, other forms of exposure and evaluation methods must be studied.A associao do controle biolgico com produtos fitossanitrios s possvel se estes apresentarem alguma seletividade aos inimigos naturais. No sistema de produo orgnica, o efeito de inseticidas sobre insetos benficos no tem sido extensivamente estudado. Assim, este trabalho objetivou avaliar em laboratrio o efeito de produtos fitossanitrios utilizados neste sistema, sobre adultos do predador Cryptolaemus montrouzieri Mulsant (Coleoptera, Coccinellidae. Foram utilizados quatro tratamentos, os quais corresponderam quatro mltiplos (0,25x, 0,5x, 1x e 2x da concentrao recomendada pelos fabricantes dos seguintes produtos comerciais: Rotenat CE, Pironat, Biopirol 7M, Organic neem, Natuneem e calda sulfoclcica, que foram testados sobre C. montrouzieri por aplicao tpica e exposio a resduos. Nenhum dos produtos, em qualquer das concentraes testadas, apresentou efeito significativo sobre a sobrevivncia de adultos de C. montrouzieri, no diferindo da testemunha gua destilada, demonstrando que os produtos testados so seletivos aos adultos dessa espcie.

  18. Predation of bat (Molossus molossus: Molossidae) by the centipede Scolopendra viridicornis (Scolopendridae) in Southern Amazonia / Predao de morcego (Molossus molossus: Molossidae) pela centopeia Scolopendra viridicornis (Scolopendridae) no sul da Amaznia

    Janaina da Costa de, NORONHA; Leandro Dnis, BATTIROLA; Amazonas, CHAGAS JNIOR; Robson Moreira de, MIRANDA; Rainiellen de S, CARPANEDO; Domingos de Jesus, RODRIGUES.

    2015-09-01

    Full Text Available Centopeias so predadores carnvoros oportunistas e grandes espcies podem se alimentar de uma grande variedade de vertebrados, inclusive de morcegos. O objetivo desse trabalho reportar o terceiro registro de predao de morcego por centopeia, e o primeiro para a regio Amaznica, abrangendo aspec [...] tos do forrageamento, captura e manipulao da presa. O registro foi realizado de forma fortuita, no Parque Estadual do Cristalino, regio de Floresta Amaznica, no estado de Mato Grosso, Brasil. O ataque ocorreu em uma estrutura de madeira a cerca de trs metros de altura e foi observado por 20 minutos. Durante a observao, a centopeia picou vrias vezes o pescoo e regio abdominal do morcego, agarrando a presa com seus 15 pares de pernas anteriores e se pendurando ao teto com as pernas posteriores. Esse tipo de observao sugere que vertebrados podem ser importantes presas para invertebrados, como centopeias gigantes, tanto por sua composio nutricional quanto pela quantidade de energia disponvel em uma nica presa. Abstract in english Centipedes are opportunistic carnivore predators, and large species can feed on a wide variety of vertebrates, including bats. The aim of this study was to report the third record of bat predation by centipedes worldwide, the first record in the Amazon region, while covering aspects of foraging, cap [...] ture and handling of prey. We observed the occurence in a fortuitous encounter at Cristalino State Park, located in the Amazon region of the state of Mato Grosso, Brazil. The attack took place in a small wooden structure, at about three meters from the floor, and was observed for 20 minutes. During the observation, the centipede stung the neck and abdominal region of the bat several times, grabbing the prey with its 15 pairs of front legs while hanging from the ceiling with its hind legs. This type of observation suggests that vertebrates can be important preys for invertebrates such as giant centipedes, both for its nutritional composition and for the amount of energy available in a single prey.

  19. Flutuação de populações de ácaros na cultura algodoeira em algumas regiões do estado de São Paulo Fluctuation of mite populations on cotton plants in severai regions of the state of São Paulo

    L. G. Chiavegato

    1975-01-01

    Full Text Available Das amostragens e contagens de ácaros feitas sobre o algodoeiro em algumas regiões do Estado de São Paulo, durante três anos consecutivos, foi possível estabelecer gráficos, os quais dão idéia do comportamento das populações nas regiões estudadas. Os gráficos são apresentados comparativamente com os dados climáticos médios (temperatura e precipitação das respectivas regiões. Independente dos fatores climáticos, os ácaros Tetranychus (Tetranychus urticae e Polyphagotarsonemus latus atingiram o pico populacional em fevereiro, em algodoal plantado em fins de outubro. As precipitações afetaram de modo específico a densidade populacional dos ácaros. Em anos chuvosos, o ácaro P. latus apresentou alta densidade populacional, enquanto o oposto ocorreu com as demais espécies. O nível populacional do ácaro Mononychellus planki e dos ácaros predadores aumentou quando a cultura atingiu o fim do seu ciclo. Assim, o pico populacional desses ácaros ocorreu em abril.Samples of mites were collected from cotton plants in several regions of São Paulo State. Monthly counsts were made in three consecutive crops, generally planted in October. The data obtained permitted to establish graphs illustrating the fluctuations of mite populations in the respective regions. Tetranychus (T. urticae and Polyphagotarsonemus latus generally showed peak of population density in February independently of climatic conditions. Rainfall affected the population densities. In relatively rainy years Polyphagotarsonemus latus presented a high population density whereas the contrary occurred with all the other species studied. The populational level of the mite Mononychellus planki and of predator mites increased as the cotton plants reached the end of their cycle, showing a peak in April.

  20. Factors affecting the attack rate of Bemisia tabaci on cucumber Fatores que afetam o ataque de Bemisia tabaci em pepino

    Germano Leão Demolin Leite

    2006-08-01

    Full Text Available The objective of this work was to determine the effects of rainfall, temperature, predators, parasitoids, plant age, leaf chemical composition, levels of leaf nitrogen and potassium, besides density of leaf trichomes, on attack intensity of Bemisia tabaci biotype B on the Cucumis sativus. An increase in the number of whitefly adults and nymphs per leaf was observed with plant aging. A higher number of whitefly adults per leaf and eggs cm-2 was verified in the apical part than in the middle and bottom part of the plants canopy. However, the higher number of whitefly nymphs was observed in the mid-part than in the apical and bottom part of the plant canopy. The incidence of whitefly nymphs was negatively affected with foliar nitrogen. Pentacosane and octacosane positively affected whitefly adults and the first compound also affected the nymphs of this pest species.O objetivo deste trabalho foi determinar os efeitos de pluviosidade, temperatura, predadores, parasitóides, idade de planta, composição química foliar, níveis de nitrogênio e potássio foliares, assim como de densidade de tricomas, na intensidade de ataque de Bemisia tabaci biótipo B em Cucumis sativus. Observaram-se maiores números de adultos e de ninfas de mosca-branca por folha com o aumento de idade de plantas. Adultos por folha e ovos cm-2 foram encontrados com maior freqüência na parte apical do que na parte mediana e basal do dossel das plantas. Entretanto, observou-se maior número de ninfas desse inseto no terço mediano do que nos terços apical e basal. Nitrogênio foliar afetou negativamente ninfas de mosca-branca. Pentacosano e octacosano afetaram positivamente adultos e o primeiro composto afetou também as ninfas dessa praga.

  1. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  2. Ação de produtos fitossanitários utilizados em cafeeiros sobre pupas e adultos de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Silva Rogério Antônio

    2006-01-01

    Full Text Available Avaliou-se a ação de produtos fitossanitários usados em cafeeiros sobre pupas e adultos de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae. Os bioensaios foram conduzidos no Departamento de Entomologia da Universidade Federal de Lavras - UFLA, Lavras, MG, Brasil. Os tratamentos avaliados, em g i.a.L-1 de água, foram: 1- endosulfan (Thiodan 350 CE - 1,75, 2- chlorpyrifos (Lorsban 480 CE -1,2, 3- betacyfluthrin (Turbo 50 CE - 0,013, 4- enxofre (Kumulus 800 PM - 4,0, 5- azocyclotin (Peropal 250 PM - 0,31, 6- oxicloreto de cobre (Cuprogarb 500 PM - 5,0 e 7- Testemunha (água. As pulverizações foram realizadas diretamente sobre pupas e adultos do crisopídeo por meio de torre de Potter. As pupas foram colocadas em tubos de vidro e os adultos em gaiolas de PVC, e mantidos em sala climatizada a 25 ? 2degreesC, UR de 70 ? 10% e fotofase de 12 horas. O delineamento experimental foi inteiramente casualizado, com sete tratamentos e dez repetições, sendo cada parcela formada por quatro pupas ou um casal de C. externa. Os produtos foram distribuídos nas quatro classes de toxicidade conforme escala estabelecida pela IOBC. O chlorpyrifos mostrou-se levemente nocivo para pupas (classe 2, 30?E?79%, e os demais produtos foram inócuos (classe 1, E99%. Os produtos testados à base de endosulfan, enxofre, azocyclotin e oxicloreto de cobre podem ser recomendados em programas de manejo de pragas do cafeeiro em associação com C. externa, em função da baixa toxidade apresentada por esses compostos ao predador.

  3. Hbitos alimentares de Enyalius perditus (Squamata, Leiosauridae no Parque Estadual do Ibitipoca, Minas Gerais, Brasil Feeding habits of Enyalius perditus (Squamata, Leiosauridae from the Parque Estadual do Ibitipoca, Minas Gerais, Brazil

    Bernadete Maria de Sousa

    2008-06-01

    Full Text Available No presente estudo foi analisado a dieta de Enyalius perditus Jackson, 1978 e suas variaes de acordo com disponibilidade de alimento no Parque Estadual do Ibitipoca, Minas Gerais, Brasil. Trs reas de matas foram amostradas, utilizando-se armadilhas de queda e adesivas para captura dos lagartos e itens-presa disponveis. Os lagartos (n= 55 foram dissecados e o contedo estomacal analisado. O ndice de eletividade mostrou que larvas foram importantes volumetricamente na dieta de E. perditus, enquanto que formigas e ispodos foram importantes numericamente. A quantidade de itens nas dietas de machos e fmeas diferiram estatisticamente, talvez como uma conseqncia da maior quantidade de formigas ingeridas pelas fmeas e ispodos e larvas pelos machos. Baseado no comportamento alimentar, os machos so mais semelhantes aos forrageadores ativos e as fmeas, aos predadores senta-e-espera.The present study was carried out to describe the diet, and its variations according to food availability, in Enyalius perditus Jackson, 1978 from Parque Estadual do Ibitipoca, State of Minas Gerais, Brazil. Three areas were chosen in the forest fragments; pit falls and glue traps were used to capture lizards and their preys. Lizards (n=55 were dissected in order to analyze the stomach content. The Electivity Index showed that insect larvae were volumetrically important in the diet of E. perditus, while ants and woodlices where numerically important. The quantity of diet items have differed significantly between males and females, perhaps, as a consequence of the higher quantity of ants ingested by female lizards and larvae ingested by males lizards. Based upon alimentary behavior, the male lizards resemble the active forragers and the females sit and wait forragers.

  4. Feeding strategy of the night shark (Carcharhinus signatus and scalloped hammerhead shark (Sphyrna lewini near seamounts off northeastern Brazil

    Teodoro Vaske Júnior

    2009-06-01

    Full Text Available A total of 425 stomachs of night shark (Carcharhinus signatus, and 98 stomachs of scalloped hammerhead shark (Sphyrna lewini, from longline and surface gillneters near seamounts off northeastern Brazil, were analysed between 1992 and 1999. Both predators prey upon reef and benthopelagic fishes, migrant cephalopods and deep water crustaceans, showing similar feeding niches (Schoener Index T=0.75. The great prey richness of the diets may reflect the fact that the marine food web for these species is very extensive in this region. Due to the concentration for feeding of both predators in the seamounts, intense fisheries should be monitored to avoid localised depletions.Um total de 425 estômagos de tubarão-toninha (Carcharhinus signatus e 98 estômagos de tubarão-martelo-entalhado (Sphyrna lewini, oriundos da pesca de espinhel e pesca com rede de emalhe nas adjacências dos bancos oceânicos do nordeste do Brasil, foi analisado entre 1992 e 1999. Ambas as espécies predam sobre peixes bento-pelágicos e recifais, cefalópodes migradores, e crustáceos de águas profundas, apresentando nichos alimentares similares (Índice de Schoener T=0.75. A alta riqueza de presas nas dietas deve ser um reflexo de que as teias alimentares para estas espécies são consideravelmente longas nessa região. Devido à concentração alimentar de ambos predadores nos bancos oceânicos, a pescaria intensa deve ser monitorada para evitar depleções locais.

  5. Diversidad de insectos depredadores en rea orizcola orgnica y de conservacin, en Viamo, RS, Brasil

    MARA LETICIA GONZLEZ F.

    2014-06-01

    Full Text Available La presencia de los depredadores en los ecosistemas es fundamental para la regulacin de poblaciones de insectos fitfagos. El presente estudio tuvo como objetivo conocer y comparar a travs de ndices faunsticos, la diversidad de insectos depredadores entre un agro-ecosistema de produccin orgnica de arroz irrigado (AO y un rea preservada, Refugio de Vida Silvestre Banhado dos Pachecos (RBP, ambas localizadas en Viamo, RS, Brasil. Se realizaron colectas mensuales de mayo de 2011 a abril de 2012. Se utilizaron trampas de Malaise, Moericke y de cada, permaneciendo instaladas por 24 horas. En total se colectaron 355 individuos de hbito predador en el AO, siendo identificados 26 morfotipos distribuidos en cuatro rdenes y 11 familias. En el rea RBP, se colectaron 653 individuos de 50 morfotipos, pertenecientes a seis rdenes y 13 familias. Los estimadores de riqueza Chao 1, Chao 2 y Bootstrap, apuntaron a una riqueza de 29 a 35 especies en el AO y de 59 a 71 para el RBP. La comparacin entre los ndices de diversidad apunt a una mayor diversidad para el rea de RBP (P = 0,001. La variacin estacional, fue responsable por las diferencias, tanto en la riqueza como en la abundancia de especies en ambas reas, siendo el periodo de enero el que present mayor nmero de individuos. Considerando la composicin de especies, se encontraron 18 morfotipos en comn entre las reas, a pesar de la baja complejidad estructural en el cultivo de arroz, indicando que el RBP puede estar actuando como reservorio de especies depredadoras.

  6. La formacin de las acumulaciones seas de macrofauna: revisin de los criterios de discernimiento de los agentes biolgicos no antrpicos desde un enfoque ecolgico

    Manuel DOMNGUEZ-RODRIGO

    2009-12-01

    Full Text Available RESUMEN: La Tafonoma o la interpretacin de los conjuntos seos fsiles es un rea de investigacin utilizada para lograr una comprensin sobre la formacin de los suelos de ocupacin arqueolgicos y de los yacimientos paleontolgicos. Para elaborar interpretaciones tafonmicas vlidas, paulatinamente se ha ido poniendo de relieve la necesidad de incrementar nuestro conocimiento sobre el comportamiento trfico de los agentes biolgicos, con el fin de ser capaces de entender el modo en que se generan este tipo de acumulaciones. Por consiguiente, en este artculo se discuten los principales aspectos de la accin de los carnvoros sobre el transporte de animales bajo el prisma de una consideracin ecolgica. Se concluye que, aunque la mayor parte de los predadores desplazan carcasas a lugares prximos del paisaje segn los puntos de obtencin de las presas, slo unos pocos realizan realmente una acumulacin sea relevante. Esta conducta est relacionada con las condiciones ecolgicas y las caractersricas biolgicas de cada tipo de carnvoro, al igual que con la organizacin social del mismo.ABSTRACT: Taphonomy or the interpretation of fossil bone assemblages is a research framework used to achieve a comprehension of the formation of both archaeological living floors and paleontological sites. In order to make right taphonomic interpretations it has increasingly become necessary to improve our knowledge on the trophic behavior of diverse biological agents, so as to be able to understand the way that bone accumulations are originated. Therefore, in this work the main aspects of carnivore behavior on carcass transport are discussed under the light of an ecological consideration. It is concluded that, although most predators shift carcasses to different spots of the landscape, nearby the place where they were obtained, only very few indeed are involved in bone accumulations. This behavior is related to the ecological conditions and the biological features of each kind of carnivore as well as to its social organizarion.

  7. Educação ambiental e a conservação da onça parda: potenciais das unidades de conservação do nordeste paulista. Environmental education and puma conservation: potentials of the protected areas of northeastern São Paulo state (Brazil.

    Mayla Willk VALENTI

    2014-06-01

    Full Text Available No nordeste do Estado de São Paulo as unidades de conservação abrigam importante parcela da biodiversidade brasileira. Espécies predadoras de topo de cadeia, como a onça parda (Puma concolor, ainda estão presentes nessa região e dependem dessas unidades para sobreviverem. Nesse contexto, a educação ambiental pode contribuir com a conservação das espécies, embora existam desafios a serem superados. O objetivo deste trabalho foi identificar potencialidades e limites da educação ambiental para a conservação da biodiversidade nas unidades de conservação do nordeste paulista, tendo como tema a conservação de predadores, em especial a onça parda. A área de estudo foi definida com base na população dessa espécie na região. Realizamos levantamento das unidades de conservação na área de estudo e consulta para identificar aquelas com programas de educação ambiental ativos. Visitamos sete áreas protegidas, sendo que em cada uma realizamos entrevista estruturada com pessoas envolvidas em ações de educação ambiental e/ou gestores das unidades, totalizando sete entrevistas. Os dados indicaram que essas unidades estão em contextos relevantes para a realização de ações educativas voltadas à conservação de predadores. Contudo, as/os entrevistadas/os relataram dificuldades em se aproximar da população do entorno fora do ambiente escolar, especialmente o público adulto. Apesar disso, identificamos uma preocupação em envolver a comunidade do entorno, percebida nos próprios objetivos das atividades realizadas pelas unidades de conservação. A partir dos resultados obtidos, consideramos que, embora o tema dos predadores não seja especificamente trabalhado, existe um potencial grande para atuação nesse sentido. Ainda, destacamos que as unidades de conservação são espaços privilegiados para a integração dos conhecimentos científicos e educação ambiental. In northeastearn São Paulo state (Brazil, the protected areas shelter important portion of Brazilian biodiversity. Top-chain predators, such as puma (Puma concolor still remain in this region and need these areas to survive. In this context, environmental education can contribute to the conservation of these species, although there are challenges to overcome. The aim of this paper was to identify potentialities and limits of environmental education to biodiversity conservation in the protected areas of northeastearn São Paulo state from the theme of predator conservation, particularly pumas. The studied area was defined based on the distribution of puma’s population in the region. A research of protected areas and a consultation to identify the ones with ongoing environmental education programs were perfomed. Seven protected areas were visited where we conducted an structured interview with people involved in environmental education actions and/or with the managers of the areas, totalizing seven interviews. Data indicated that these areas are in relevant contexts for performing educational actions for predator conservation. However, interviewers reported difficulties in approaching to the surrounding community in non-scholar contexts, specially the adult audience. Nevertheless, we identified concerns about involving the surrounding community, perceived by the aims of the activities performed in the protected areas. From our results, we consider that, although predator conservation was not cited as a theme addressed in the education activities, there is a great potential to act in that sense. Besides, we emphasize that the protected areas are privileged spaces to integrate scientific knowledge and environmental education.

  8. Differentiation between the traces of predation of muricids and naticids in Spanish Pliocene Chlamys

    Reyment, R. A.

    1988-08-01

    Full Text Available The statistical analysis of holes drilled in species of the bivalve genus Chlamys from localities in the Lower Pliocene of Southern Spain throws light on aspects of muricid and naticid predation. Discriminant function analysis was found to be a useful means of identifying the nature of boreholes, with but slight errors of identification for known specimens. In particular, significant differences in relationships between predators and prey could be established. The question as to whether preferred locations of boreholes occur could be answered affirmatively for muricids. Also for muricids, the majority of the observed boreholes (74.1% are concentrated to the region fo the adductor muscle: such a relationship could not be definitely proven for naticids (36.9% within the adduetor muscle field. An association between the site of the prey and predator could only be demonstrated for naticids in connexion with prey of several species and genera. There is a strong association between the size of the prey and the site chosen for drilling for both groups of predators. There is indecisive evidence for a correlation between the location and size a drillhole for naticids, but probably not for muricids. The strategy of seleetion of a drilling site by muricids seems to• be to weaken the function of the adductor muscle in the monomyarian Chlamys, hence facilitating access to the víscera. In general, multivariate analytical procedures, and especiaIly the method of canonical correlations, were found lo aid greatly the interpretation of the quantitative observations.El análisis estadístico de los orificios perforados en las especies del género Chlamys del Plioceno Inferior del Sur de España aclara algunos aspectos muy interesantes sobre la predacción de los murícidos y natícidos. El análisis de la función discriminante se ha determinado como un método muy útil para identificar la naturaleza de los orificios, son muy pocos los errores de identificación para los especímenes analizados. En concreto, se ha podido establecer diferencias significativas en las relaciones entre los predadores y las presas. Se ha podido responder afirmativamente a la cuestión de cómo eligen los sitios preferentes para la localización de las perforaciones en el caso de los murídicos. También, para los murícidos la mayoría de las perforaciones observadas (74,1% se ha concentrado en la región del músculo abductor; en cambio, para los natícidos no se ha observado este techo (sólo un 36,9%, de perforaciones en la región del músculo abductor. Para los natícidos se ha podido demostrar una asociación entre el lugar de la presa donde se producen las perforaciones y predador, únicamente cuando se toman en cuenta presas de muchas especies y géneros distintos. También existe una estrecha asociación entre el tamaño de la presa y el lugar donde perforan ambos grupos de predadores. No hay una evidencia decisiva que permita correlacionar la localización de las perforaciones para los natícidos, pero probablemente si la haya para los murícidos. La estrategia de selección del lugar de la perforación para los murícidos se ha determinado en función del músculo abductor en los monomiarios Chlamys para facilitar el acceso a las vísceras. En general, los métodos de análisis multivariado y en especial el método de correlaciones canónicas, se han encontrado como de gran ayuda en la interpretación de observaciones cuantitativas.

  9. Velocidade da água e a distribuição de larvas e pupas de Chirostilbia pertinax (Kollar (Diptera, Simuliidae e macroinvertebrados associados Water velocity and the distribution of larvae and pupae of Chirostilbia pertinax (Kollar (Diptera, Simuliidae and associated macroinvertebrates

    José Eloy dos Santos Jr

    2007-03-01

    Full Text Available O presente trabalho objetivou investigar a relação entre a velocidade da água e a distribuição dos estágios imaturos de Chirostilbia pertinax (Kollar, 1832 e os macroinvertebrados bentônicos associados. As coletas foram realizadas em cinco pontos, no trecho superior do Rio dos Sinos, no Estado do Rio Grande do Sul. A fauna bentônica foi amostrada com substratos artificiais, que permaneceram instalados nos locais de maior corenteza d'água por períodos de 14 dias. Antes do recolhimento dos substratos foram realizadas medidas de velocidade d'água no local da sua instalação. Essas medidas foram agrupadas em três classes: baixa (0,20 a 0,63 m/s, média (0,64 a 1,07 m/s e alta (1,08 a 1,50 m/s para posterior relação com a distribuição da fauna coletada. Para avaliar a influência da velocidade de água sobre a distribuição dos macroinvertebrados e a abundância de C. pertinax foi realizada uma regressão múltipla. As coletas resultaram em 39.598 indivíduos, sendo 33.418 simulídeos e 6.180 macroinvertebrados associados. Entre os simulídeos 5.704 espécimes correspondem a larvas do último ínstar e pupas, dos quais 828 são de C. pertinax. Quanto à distribuição dessa espécie, 30,8% ocorreram na classe de baixa velocidade d'água, 24,9% na velocidade média e 44,3% na alta velocidade. Foi observado que a abundância de C. petinax aumenta à medida que os macroinvertebrados predadores diminuem e os organismos não predadores aumentam (GLM, R² = 0,207; F 2,50 = 6,536; P = 0,003. Esses resultados revelam que os imaturos de C. pertinax têm uma tendência em ocupar um microhábitat com menor ocorrência de predadores.The objective of the current study was to evaluate the distribution of the immature stages of Chirostilbia pertinax (Kollar, 1832 and associated bentic macroinvertebrates in relation to water velocity. This study was carried out on the upper course of Sinos river, in Rio Grande do Sul. Seasonal collections of larvae and pupae of black flies and associated benthic fauna were carried out at five places. In all sampling sites artificial substrates were installed, remaining submersed for 14 days in places of great water flow. Before removing the substrates the flow speeds on the collection sites were measured. To assess the distinct distribution patterns of the benthic fauna, the flow speed was divided in three classes: slow (0.20 - 0.63 m/s, medium (0.64 - 1.07 m/s and fast (1.08 - 1.50 m/s. A total of 39,598 specimens were collected, from which 33,418 were black flies and 6,180 associated macroinvertebrates. From the total black flies, 5,704 were in the last larval instar and pupae from which 828 were C. pertinax. In the distribution of this species 30.8% occurred in slow flow, 24.9% in medium flow and 44.3% in fast flow. The abundance of C. pertinax is inversely related to the predatory macroinvertebrates (GLM, R² = 0.207; F 2.50 = 6.536; P = 0.003. These results demonstrate that the immature stages of C. pertinax have a tendency to occupy microhabitats with less predator occurrence.

  10. Consumo de Uroleucon ambrosiae (Thomas, 1878 (Hemiptera: Aphididae por larvas de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae em casa-de-vegetação Consumption of Uroleucon ambrosiae (Thomas, 1878 (Hemiptera: Aphididae BY Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae larvae in greenhouse

    Alexander M. Auad

    2003-06-01

    Full Text Available Com esta pesquisa objetivou-se verificar o consumo de Uroleucon ambrosiae em diferentes densidades, por larvas de Chrysoperla externa provenientes de diferentes regimes alimentares, em casa-de-vegetação. Ninfas de 3º e 4º ínstares do afídeo foram separadas nas densidades 30, 40 e 50, e colocadas nas plantas de alface (35 dias de idade, as quais, foram envolvidas por gaiola de armação de ferro de 27x27x26 cm cobertas com tecido “voil” e acoplada nos tubos de PVC do cultivo hidropônico. Quatro horas após, uma larva de C. externa, de diferentes ínstares e previamente alimentadas com U. ambrosiae ou ovos de Sitotroga cerealella (Olivier, 1819, foi liberada próximo à colônia de afídeos, sendo a gaiola fechada imediatamente; o mesmo procedimento foi adotado sem que a larva fosse confinada. Após quarenta e oito horas, realizou-se a contagem do número de afídeos consumidos em cada densidade de presa disponível. A eficiência do predador, confinado em gaiola, foi de 12,46%, 13,63% e 25,76% para larvas de 1º, 2º e 3º ínstares previamente alimentadas com ovos de S. cerealella; 9,59% e 17,63% para aquelas de 2º e 3º ínstares alimentadas anteriormente com ninfas de U. ambrosiae, respectivamente e de 18,62% para larvas de 3º ínstar previamente alimentadas com ovos do lepidóptero no 1º ínstar e ninfas dos afídeos no 2º instar; no entanto, para larvas não confinadas, não foram verificadas diferenças significativas na eficiência. Nas densidades de 40 e 50 afídeos, as porcentagens de predação (18,30 e 18,72, respectivamente foram significativamente superiores quando comparada à densidade 30 (11,79; para testes sem confinamento, não houve influência da densidade da presa na resposta do predador. Assim, o alimento fornecido às larvas de C. externa antes de serem liberadas em casa-de-vegetação, o confinamento das mesmas e a densidade de U. ambrosiae disponível influenciaram o potencial de consumo do predador.The objective of this research was to evaluate the consumption of Uroleucon ambrosiae in different densities by Chrysoperla externa larvae derived from different alimentary regimes, in greenhouse conditions. The 3rd and 4th instars nymphs of the aphid were separated in the densities 30, 40, 50 and put on the lettuce plants (35 days old which were kepted in a voil cage of 27x27x26 cm connected to the PVC tube used for hydroponic cultivation. After four hours, one larva of C. externa previously fed with U. ambrosiae or eggs of Sitotroga cerealella (Olivier, 1819 was released near the aphid colony, with the lettuce plant being immediately covered. The same procedure was adopted without confinement of the larvae. The different instars of C. externa were evaluated, through counting of the aphids after forty eight hours. The efficiencies of the predator, confined in a cage, were 12.46, 13.63 and 25.76% for 1st, 2nd and 3th instars which were previously fed with eggs of S. cerealella. For 2nd and 3rd instar larvae fed with aphids, the efficiencies were 9.59 and 17.63%, respectively. Efficiency was 18.62% for 3th instar larvae fed previously with eggs of the lepidopterous in the 1st instar and with nymphs of aphids in the 2nd ínstar.However, for larvae without confinement, there were no differences among the instars or alimentary regimes. In the densities of 40 and 50 aphids, the percentages of predation (18.3 and 18.72, respectively were significantly superior as compared with density 30 (11.79. There was no influence of density of prey in response to predator in the experiments without confinement. Thus, the food provided to C. externa larvae before releasing into a greenhouse, their confinement and available density of U. ambrosiae influenced the potential of consumption of the predator.

  11. Aproximaciones teóricas a la relación naturaleza - cultura: algunas contribuciones entre 1980 – 2004

    Ricardo Gómez

    2009-10-01

    Full Text Available El objetivo del presente artículo es mostrar algunas de las críticas más importantes dadas en el debate actual entre naturaleza y cultura. Busca reivindicar nuevos paradigmas de las ciencias dentro de la problemática del agotamiento de los recursos naturales del hogar que habitamos, la tierra, y el papel que juegan las comunidades locales contra el discurso predador del capitalismo global, a partir de su existencia cultural y social. Este trabajo se divide en tres partes que proponen por analogía, un símil entre los momentos de cambio de la noche al amanecer de un nuevo día; de la misma forma en que podríamos pasar de paradigmas “clásicos”, a procesos sociales recientes que incluyen los conocimientos locales. La primera, llamada “la noche”, expone brevísimamente los planteamientos más comunes que el capitalismo y las corrientes positivistas de la ciencia, mantienen frente a la naturaleza. La segunda, “el amanecer”, es una de las partes más importantes del presente escrito, ya que realiza una crítica a la oscuridad de la noche, a los planteamientos del capitalismo global desde el marxismo, el post-estructuralismo y el género. La tercera, “nuevo día”, concluye que a la luz de estas nuevas perspectivas de análisis podemos comprender mejor la relación entre los seres humanos y la tierra. Estos nuevos conocimientos políticos, culturales, ambientales y globales, desde el centro y la periferia, están atravesados por vínculos de poder que proponen una posición integradora entre conceptos aparentemente contradictorios y suponen susuperación a partir de la conciencia que autogeneran buscando orientar el tema político hacia estos nuevos conocimientos dentro de una agenda global.

  12. Distribuio do metal mercrio em atum (Thunnus albacares e pescada bicuda (Cynoscion microlepidotus capturados no litoral do Rio de Janeiro, Brasil Distribution of metal mercury in tuna (Thunnus albacares and weaker fish (Cynoscion microlepidotus captured in Rio de Janeiro coast, Brazil

    R.J. Medeiros

    2008-06-01

    Full Text Available O presente estudo verificou a cintica mercurial em rgos, tecido muscular e contedo estomacal de duas espcies de peixes marinhos predadores, identificando os locais de maior acumulao desse metal. Para o processo analtico, foi utilizada a tcnica de espectrofotometria de absoro atmica por arraste de vapor a frio. A distribuio de Hg nas pores analisadas apresenta ampla disperso. Para o atum, a variao foi de 0,004 g.g-1 no fgado, nas brnquias e bao, e 0,172g.g-1 no tecido muscular. Para a pescada bicuda, a variao foi entre 0,013g.g-1 nas brnquias a 0,250g.g-1 no tecido muscular. Este ltimo demonstrou ser, nas duas espcies, a poro de maior concentrao do metal, atum = 0,0800,050g.g-1 e pescada bicuda = 0,1870,030g.g-1. Os locais de menor concentrao na pescada foram as brnquias 0,0290,031g.g-1, e no atum os olhos (0,0130,008g.g-1.The mercuric kinetic in organs, muscular tissue, and stomach contents of two species of marine fish predators was evaluated by the identification of the places showing higher accumulation of the metal. For the analytical process, the used technique was cold vapor atomic absorption spectrometry. The results demonstrated that the distribution of Hg in the analyzed portions presented wiede dispersion. For Thunnus albacares, the variation was of 0.004g.g-1 in the liver, gills and spleen, and 0.172g.g-1 in the muscular tissue. For Cynoscion microlepidotus, the variation was between 0.013g.g-1 in gills and 0.250g.g-1 in muscular tissue. The latter was the portion of higher concentration of this metal in both species, T. albacares = 0.0800.050g.g-1 and C. microlepidotus = 0.1870.030g.g-1, while less concentrations were found in the gills (0.0290.031g.g-1 in C. microlepidotus and in the eyes (0.0130.008g.g-1 in T. albacares.

  13. Potencial de Chrysoperla externa (Hagen no controle de Bemisia tabaci (Gennadius bitipo B em tomateiro = Potential of Chrysoperla externa (Hagen at B-biotype Bemisia tabaci (Gennadius nymphs control in tomato plants

    Andr Luiz Furtado Braga

    2007-01-01

    Full Text Available Objetivou-se avaliar o potencial de Chrysoperla externa (Hagen, 1861 no controle de ninfas de Bemisia tabaci (Gennadius, 1889 bitipo B em tomateiro. Foram colocados 96 vasos com uma planta, isenta de mosca-branca, em gaiolas mantidas em casa de vegetao. Em seguida, cada planta foi infestada por 100 adultos do aleiroddeo por 24 horas. No primeiro e oitavo dias aps a ecloso das ninfas, liberou-se uma, cinco e dez larvas de primeiro, segundo e terceiro nstares de C. externa nos tomateiros infestados, exceto nas testemunhas. A contagem das ninfas que escaparam predao foi efetuada no 11o dia aps a ecloso da presa. Utilizou-se o delineamento inteiramente casualizado em esquema fatorial, com oito repeties. As larvas de C. externa, liberadas no primeiro dia apsa ecloso das ninfas de mosca-branca, foram eficientes na reduo da populao da presa quando foi utilizado 10 larvas por planta, assegurando cerca de 50% de controle da praga. Quando o predador foi liberado oito dias aps a ecloso das ninfas, nas densidades de cincoe dez larvas de C. externa por planta, verificou-se reduo na densidade populacional da praga prxima a 40%. Assim, a liberao de larvas de C. externa em tomateiros individualizados em gaiolas denota ser eficiente no controle de B. tabaci bitipo B.This study aimed to evaluate the potential of Chrysoperla externa (Hagen, 1861 in controlling nymphs of Bemisia tabaci (Gennadius, 1889, biotype B, in tomato plants. Ninety-six pots, each with one whiteflyfree plant, were placed in cages at greenhouse and each plant was infested with 100 adult whiteflies for 24 hours. In the first and eighth days after nymph eclosion, infested plants were inoculated with one, five and ten larvae of the first, second and third C. externa instars, excepting the control plants. The number of nymphs that escaped predation was counted on the eleventh day after prey eclosion. Totally casualized delineation was used, with 3 x 4factorial scheme and eight repetitions. The C. externa larvae released in the first day after whitefly nymph eclosion were most efficient in reducing prey population at 10 larvae per plant, ensuring roughly 50% pest control. When released on the eight day after nymph eclosion, at densities of five and ten C. externa larvae per plant, a pest density reduction of approximately 40% was observed. Therefore, releasing C. externa larvae on tomato plantskept individually in cages is efficient to control B-biotype B. tabaci.

  14. Atratividade de adultos de Chrysoperla externa (Hagen, 1861 aos compostos voláteis de coentro, endro e erva-doce (Apiaceae em condições de laboratório

    André Luis Santos Resende

    2015-02-01

    Full Text Available Espécies de Apiaceae dispõem de óleos essenciais, nos quais podem ocorrer compostos voláteis, que funcionam como sinais para atração e manutenção de inimigos naturais nas áreas cultivadas. Com base nestas características, este trabalho objetivou avaliar a atratividade aos adultos do predador Chrysoperla externa. Foram utilizados folhas e caules de coentro, endro e erva-doce, coletados aos 30 e 60 dias após a semeadura. As plantas foram dispostas em olfatômetro de quatro vias (formato de "X" disponibilizando-se os odores para machos e fêmeas, virgens e acasalados, em testes de livre escolha. Ao serem liberados individualmente no interior do olfatômetro, foram cronometrados cinco minutos e contabilizado o tempo total de permanência do inseto em cada braço do aparelho. Os dados foram analisados pelo teste c², com frequência esperada de 25%. Estudou-se o rendimento de óleo essencial das três espécies de plantas, 30 e 60 dias após a semeadura, utilizando-se do método de hidrodestilação. A composição química dos óleos foi determinada por cromatografia gasosa acoplada a espectrômetro de massas. Verificou-se que adultos virgens têm preferência por plantas de coentro, enquanto os acasalados preferem plantas de erva-doce, ambas coletadas aos 30 dias. Plantas com 60 dias não proporcionaram resposta atrativa aos adultos de C. externa. O rendimento de óleo tendeu a aumentar com o desenvolvimento fenológico da planta. A composição química do óleo de coentro revelou, como componentes majoritários, o (2E-decenal e decanal e, para erva-doce, a maior concentração foi de (E-anetol.

  15. Toxicidade de pesticidas recomendados na produo integrada de ma (PIM) a populaes de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) / Toxicity of pesticides recommended in the integrated apple production (IAP) to populations of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae)

    Alexandre P, Moura; Geraldo A, Carvalho; Valria F, Moscardini; Mrcio C, Marques; Jander R, Souza.

    2009-06-01

    Full Text Available Os efeitos dos pesticidas abamectim, carbaril, fenitrotiom, metidatiom, enxofre e triclorfom foram avaliados sobre a fase de ovo de duas populaes de Chrysoperla externa (Hagen), bem como sobre as fases subsequentes do desenvolvimento e reproduo do predador. A pulverizao dos pesticidas e de gu [...] a destilada (testemunha) sobre ovos de C. externa foi realizada por meio de torre de Potter. Nenhum dos pesticidas avaliados reduziu a viabilidade de ovos tratados, independente da populao de C. externa estudada. Para as demais fases de desenvolvimento, apenas carbaril causou mortalidade acumulada significativa de ambas as populaes quando em comparao aos demais pesticidas. A razo sexual dos adultos obtidos no foi afetada por nenhum dos compostos. Nenhum dos pesticidas afetou negativamente a capacidade de oviposio de fmeas de C. externa oriundas de ovos tratados. No entanto, enxofre reduziu a viabilidade de ovos depositados por fmeas da populao de Bento Gonalves. Considerando-se o efeito total (E) de cada pesticida, triclorfom, fenitrotiom, metidatiom e abamectim foram incuos a ambas as populaes de C. externa quando aplicados sobre seus ovos, enquanto carbaril foi considerado levemente prejudicial; o fungicida enxofre, por outro lado, foi considerado levemente prejudicial populao de Bento Gonalves, e incuo aos insetos da populao de Vacaria. Abstract in english The goal of this work was to evaluate the effects of the pesticides abamectin, carbaryl, fenitrothion, methidathion, sulphur and trichlorfon on eggs of two Chrysoperla externa (Hagen) populations, as well as on the subsequent developmental stages and reproduction capacity of this green lacewing. Pes [...] ticide exposure and distilled water (control) were accomplished using a Potter's tower. None of the evaluated pesticides affected the egg viability of the C. externa populations studied, but abamectin and carbaryl caused significant mortality of other developmental stages of the predator. Sex ratio and reproduction capacity of females originated from treated eggs were unaffected. However, egg viability of C. externa from Bento Gonalves, RS, Brazil, was reduced by sulphur. Considering to the total effect (E) of each pesticide, trichlorfon, fenitrothion, methidathion and abamectin were harmless to both C. externa populations (Bento Gonalves and Vacaria), when applied on eggs, whereas carbaryl was slightly harmful. On the other hand, the fungicide sulphur was slightly harmful to C. externa from Bento Gonalves, but harmless to those from Vacaria.

  16. Seletividade de acaricidas utilizados em cafeeiro para larvas de crisopdeos / Selectivity of acaricides used in coffee crops to green lacewing

    Michelle, Vilela; Geraldo Andrade, Carvalho; Csar Freire, Carvalho; Matheus Alvarenga, Vilas Boas; Maria Isabella Santos, Leite.

    2010-10-01

    Full Text Available Os crisopdeos so encontrados em agroecossistema cafeeiro alimentando-se de vrias pragas. Objetivou-se avaliar a seletividade de acaricidas utilizados na cafeeiculta sobre a biologia de Chrysoperla externa (Hagen, 1861). Os tratamentos foram: testemunha (gua), espirodiclofeno (0,12 g i.a./L), fen [...] propatrina (0,15 e 0,30 g i.a./L), enxofre (4,0 e 8,0 g i.a./L) e abamectina (0,0067 e 0,0225 g i.a./L). Pulverizaram-se os produtos sobre larvas de primeiro, segundo e terceiro instares de C. externa por meio da torre de Potter. Avaliaram-se a durao do instar, sobrevivncia das larvas e pupas e viabilidade dos ovos produzidos pelos adultos provenientes das larvas tratadas. Os produtos foram classificados em classes de toxicidade. Fenpropatrina foi nocivo e espirodiclofeno e abamectina foram moderadamente nocivos, necessitando de novos estudos em condies de casa de vegetao e campo para confirmao ou no de suas toxicidades. Em funo da baixa toxicidade apresentada pelo enxofre ao predador C. externa, pode ser recomendado em programas de manejo de pragas do cafeeiro visando compatibilizar os mtodos qumico e biolgico por meio dessa espcie de crisopdeo. Abstract in english Green lacewings are commonly found in coffee agroecosystems feeding on several pests of economic importance. The objective of this study was to evaluate the selectivity of acaricides used in coffee crop to Chrysoperla externa (Hagen, 1861). The treatments consisted of control (water), spirodiclofen [...] (0.12 g a.i./L), fenpropathrin (0.15 and 0.30 g a.i./L), sulphur (4.0 and 8.0 g a.i./L) and abamectin (0.0067 and 0.0225 g a.i./L). The products were sprayed directly on first, second and third-instar larvae of C. externa, using a Potter spray tower. Duration of instar, survival of larvae and pupae and viability of eggs produced by the adults emerged from the treated larvae were evaluated. The pesticides were classified into toxicity classes. Fenpropathrin was toxic and spirodiclofen and abamectin were moderately toxic, requiring further studies under greenhouse and field conditions to confirm or not their toxicities. Because of the low toxicity of sulphur to the predator C. externa, it can be recommended for coffee pest management programs in order to combine chemical and biological control using this Chrysopidae species.

  17. Seletividade de inseticidas para ovos e ninfas de Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Selectivity of inseticides to eggs and nymphs of Orius insidiosus (Say) (Hemiptera: Anthocoridae)

    Geraldo A. de, Carvalho; Alexandre A., Morais; Luiz C.D., Rocha; Maurcio S., Godoy; Luciano V., Cosme.

    2005-06-01

    Full Text Available O predador Orius insidiosus (Say) alimenta-se de tripes, afdeos, moscas-brancas, caros e pequenas lagartas, contribuindo para a regulao populacional dessas pragas em diferentes agroecossistemas. Este trabalho teve por objetivo avaliar a seletividade dos inseticidas abamectina, cartape, ciromazin [...] a, fempropatrina e imidaclopride, registrados para a cultura do crisntemo, para ovos e ninfas de 1, 2 e 3 instares de O. insidiosus. Os produtos foram pulverizados em torre de Potter, sendo utilizadas as maiores doses recomendadas para o controle de pragas na cultura do crisntemo. Aps a pulverizao, os ovos e ninfas foram mantidos em condies controladas, com temperatura de 25 1C, UR de 70 10% e fotofase de 12h. Avaliaram-se a durao do perodo embrionrio, a viabilidade dos ovos e a durao e sobrevivncia de ninfas. Os ovos de O. insidiosus foram tolerantes a todos os inseticidas. Cartape e ciromazina foram seletivos s ninfas de 1, 2 e 3 nstares, enquanto que os demais produtos foram txicos. Fempropatrina provocou 100% de mortalidade de O. insidiosus nos trs nstares avaliados. Os inseticidas cartape e ciromazina podem ser recomendados para uso em programas de manejo integrado de pragas na cultura do crisntemo. Abstract in english The predator Orius insidiosus (Say) feeds on thrips, aphids, whiteflies, mites and small caterpillars and contributes to regulate the population of these pests in different agroecossystems. The present research aimed to evaluate the selectivity of the pesticides abamectin, cartap, cyromazine, fenpro [...] pathrin and imidacloprid, which are registered for chrysanthemum crops, to eggs and first-, second- and third-instar nymphs of O. insidiosus. A Potter tower was used to spray the insecticides on the eggs and nymphs at the highest recommended rates. After spraying, the individuals were kept under controlled conditions at 25 1C, 70 10% RH and 12h photophase. The effects of the pesticides on the embryonic period, on egg viability, instar duration and nymph survival were evaluated. The eggs of O. insidiosus were tolerant to all pesticides. Both cartap and cyromazine were selective, whereas abamectin, fenpropathrin and imidacloprid were toxic to all tested instars of O. insidiosus. Fenpropathrin was the most toxic pesticide and killed 100% of the nymphs. The insecticides cartap and cyromazine can be recommended for integrated pest management programs in chrysanthemum crops.

  18. Interaes predatrias entre Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) e Loxosceles intermedia Mello-Leito (Araneae, Sicariidae) / Predatory interactions between Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) and Loxosceles intermedia Mello-Leito (Araneae, Sicariidae)

    Marta L., Fischer; Flvia S., Krechemer.

    2007-06-01

    Full Text Available A co-ocorrncia de Pholcus phalangioides (Fuesslin, 1775) e de Loxosceles intermedia Mello-Leito, 1934 no intra e no peridomiclio somada natureza araneofgica e invasora de teias de P.phalangioides sugere que ambas as espcies tenham desenvolvido algum padro de interao interespecfica. Assim, [...] objetivou-se caracterizar essa interao e avaliar a eficincia de P.phalangioides como predador de L.intermedia. Foram realizados cinco experimentos laboratoriais visando quantificar os padres motores utilizados na captura de diferentes presas, preferncia alimentar, influncia do regime alimentar no desenvolvimento ps-embrionrio e aspectos de colonizao pelas duas espcies. A predao de L.intermedia foi maior apesar de P.phalangioides ser at cinco vezes mais leve. Alm de nem todas as espcies do gnero Loxosceles serem predadas em igual proporo, diante de diferentes presas P.phalangioidespreferiu os insetos em detrimento de L.intermedia, sugerindo ser a araneofagia um item complementar na sua dieta. Provavelmente apenas a presena de P.phalangioides no ambiente antrpico no seja o suficiente para a manuteno das populaes de Loxosceles em nveis que no causem riscos a sade humana, porm a co-existncia j confere a necessidade de uma partilha de recursos e deve ser considerada em aes de manejo. Abstract in english The co-occurrence of Pholcus phalangioides (Fuesslin, 1775) and Loxosceles intermedia Mello-Leito, 1934 outdoor and indoor added to the P.phalangioides araneophagic nature and web invader habit suggest that both species have developed some pattern of interspecific interaction. Thus, we had as objec [...] tive to characterize this interaction and to evaluate the efficiency of P.phalangioides as predator of L.intermedia.We made five experiments with objective of quantifying the motor patterns used in the capture of different preys, alimentary preference, influence of the diet in the post-embryonic development and colonization for the two species.The predation on L.intermedia was greater despite P.phalangioides be until five times lighter. In the presence of different prey P.phalangioides preferred the insects instead L.intermedia, suggesting being the araneophagy a complementary item in their diet. Probably only the presence of P.phalangioides in the antropic environment is not enough for the maintenance of the Loxosceles populations in levels that do not cause risks to the human health, however the co-existence already takes the need of a resources partitionship and should be considered in management actions.

  19. Hemiptera acuáticos asociados a los estuarios de la costa pacífica colombiana Aquatic Hemiptera associated to estuaries of the colombian pacific coast

    DORA N. PADILLAGIL

    2011-12-01

    Full Text Available la mayoría de los hemípteros acuáticos son insectos predadores que habitan en agua dulce, estuarios y mar. Las familias que incluyen especies de hábitat salobres y estuarios son Gerridae y Veliidae. Con el fin de contribuir al conocimiento faunístico y ecológico de los hemípteros acuáticos asociados a los estuarios de la Costa Pacífica de Colombia y de la región del Chocó biogeográfico, se estudiaron seis estuarios del municipio de Tumaco: El Bajito, El Morro, Villa del Sol, Agua clara, Chilvi, e Inguapi, donde se realizaron recolecciones y se caracterizó el hábitat a través de la medición de algunos parámetros fisicoquímicos del agua. En total se colectaron diez especies, pertenecientes a tres familias: Gerridae con cuatro géneros Limnogonus, Rheumatobates, Telmatometroides y Trepobates; Veliidae, con dos géneros Microvelia y Rhagovelia; y un Mesoveliidae, con Mesovelia. Se caracteriza el hábitat y se señalan las especies más abundantes por sitio de muestreo. Se registra por primera vez en Colombia la especie Microvelia inquilina y se adicionan nuevos datos para las especies en la costa Pacífica del departamento de Nariño.Most of the aquatic hemipterans are predatory insects that inhabit fresh waters, estuaries and a few live in the open ocean. Ocean-dwelling and estuarine-inhabiting families include Gerridae and Veliidae. With the purpose of contributing to the biodiversity and ecology of aquatic hemipterans associated with estuaries of the Pacific coast of Colombia and the Chocó biogeographical region, six estuaries were studied from the municipality of Tumaco: El Bajito, El Morro, Villa del Sol, Agua clara, Chilvi, and Inguapi. Aquatic hemiptera were collected and each habitat was characterized measuring physical-chemical parameters of the water. In total, ten species were collected belonging to four genera Limnogonus, Rheumatobates, Telmatometroides, and Trepobates (Family: Gerridae; and two genera Microvelia and Rhagovelia (Family: Veliidae; and Mesoveliidae, with Mesovelia. The habitat was characterized and the most abundant species by sampling place are showed. The species Microvelia inquilina is recorded for the frst time. New collection data are added for the species of the Pacific coast of the department of Nariño.

  20. Gape size influences seasonal patterns of piscivore diets in three Neotropical rivers

    Carmen G. Montaña

    2011-01-01

    Full Text Available We examined diets of four piscivores, two in the order Perciformes (Cichla temensis and C. orinocensis and two in the order Characiformes (Boulengerella cuvieri and B. lucius, from the Cinaruco, La Guardia, and Ventuari rivers in Venezuela throughout the wet-dry seasonal cycle. The four piscivores consumed a phylogenetically and morphologically diverse group of fishes, reflecting the overall diversity of fish species in these rivers. At the start of the falling-water period, Cichla consumed large prey, especially the abundant, migratory, fish of the genus Semaprochilodus. As these relatively large prey became depleted during the dry season, Cichla tended to consume smaller prey. For Boulengerella, gape limitation precluded consumption of larger, seasonally abundant, fishes, and so prey sizes were more consistent throughout the seasonal cycle. Our findings show how prey abundance and gape limitations interact to influence seasonal patterns of predator-prey interactions.Foram examinadas as dietas de quatro espécies de peixes piscívoros, duas da ordem Perciformes (Cichla temensis and C. orinocensis e duas da ordem Characiformes (Boulengerella cuvieri and B. lucius, coletadas durante os ciclos de cheia e seca nos rios Cinaruco, La Guardia e Ventari, Venezuela. Os quatro piscívoros consumiram grupos de peixes filogenética e morfologicamente diversos, o que reflete a ampla diversidade de peixes nos rios estudados. No início da vazante, Cichla consumiu presas grandes, especialmente Semaprochilodus, um peixe migrador muito abundante. Com a diminuição das presas maiores durante a estação seca, Cichla tendeu a se alimentar de presas menores. Para Boulengerella, a limitação da abertura bucal impediu o consumo de peixes grandes e sazonalmente abundantes e, deste modo, o tamanho de suas presas foi menos variável ao longo do ciclo sazonal. Nossos resultados mostram como a abundância das presas e a limitação na abertura bucal interagem, influenciando os padrões de interação predador-presa.

  1. Feeding ecology of Lutjanus analis (Teleostei: Lutjanidae from Abrolhos Bank, Eastern Brazil

    Matheus Oliveira Freitas

    2011-06-01

    Full Text Available Diet and feeding ecology of the mutton snapper Lutjanus analis were investigated in the Abrolhos Bank, Eastern Brazil, the largest and richest coral reefs in the South Atlantic, where about 270 species of reef and shore fishes occur. To evaluate seasonal and ontogenetic shifts in the diet, specimens of L. analis were obtained through a fish monitoring program in four cities in southern Bahia State, from June 2005 to March 2007. Stomachs from 85 mutton snappers that ranged in size from 18.1 to 74.0 cm TL were examined. Prey were identified to the lowest possible taxon and assessed by the frequency of occurrence and volumetric methods. Variations in volume prey consumption were evaluated using non-metric multi-dimensional scaling ordination, analysis of similarity, and similarity percentage methods. Significant differences in diet composition among size classes were registered, whereas non significant differences between seasons were observed. Considering size-classes, food items consumption showed important variations: juveniles (50.1 cm TL consumed basically fish, mostly Anguiliformes. Lutjanus analis is an important generalist reef predator, with a broad array of food resources and ontogenetic changes in the diet. This snapper species plays an important role on the trophic ecology of the Abrolhos Bank coral reefs.Foram avaliadas a dieta e a ecologia alimentar da cioba Lutjanus analis no Banco dos Abrolhos, Leste do Brasil. O Banco dos Abrolhos abrange os maiores e mais diversos recifes de corais do Atlntico Sul, onde cerca de 270 espcies de peixes recifais e costeiros ocorrem. Para a avaliao das variaes sazonais e ontognicas na dieta, exemplares de L. analis foram obtidos atravs de um programa de monitoramento em quatro cidades do extremo sul da Bahia, entre junho de 2005 e maro de 2007. Estmagos de 85 exemplares com comprimento total variando entre 18,1 e 74,0 cm foram examinados. Os itens alimentares foram identificados at o menor nvel taxonmico possvel e avaliados atravs dos mtodos de frequncia de ocorrncia e volumtrico. Variaes no consumo das presas foram avaliadas atravs do mtodo de escalonamento multidimensional no-mtrico e mtodos de anlise de similaridade e percentagem de similaridade. Diferenas significativas na dieta foram observadas entre as classes de tamanho, porm estas no foram detectadas entre as estaes do ano. Considerando as classes de tamanho, os itens consumidos apresentaram importantes variaes: os juvenis (50,1 cm CT consumiram basicamente peixes, principalmente Anguiliformes. Lutjanus analis um importante predador recifal generalista, que consome um amplo espectro de presas, apresentando mudanas ontognicas na dieta. Esse lutjandeo desempenha um importante papel na ecologia trfica dos recifes de corais do Banco dos Abrolhos.

  2. Nova fase da economia mundial e a crise do euro: a China, a Europa e a Amrica / Nouvelle phase de l'economie mondiale et la crise de l'euro: la Chine, l'Europe et l'Amrique / New phase in the world economy and the euro crisis: China, Europe and America

    Robert, Rollinat.

    2013-04-01

    Full Text Available Aborda-se, aqui, as causas profundas da crise e as formas que ela tomou durante os ltimos cinco anos, particularmente sobre a gigantesca concorrncia, verdadeira "guerra de moedas". Para alm da "crnica de acontecimentos" da crise suas dimenses financeira e monetria, crise das dvidas "soberanas [...] ", o futuro e a "sobrevida" do euro busca-se a problemtica que circunscreve esta crise desde 2008. O fio condutor, capaz de abarcar seu processo, continua sendo aquele da anlise do processo real, baseado no mtodo e na teoria de Marx, atravs da evoluo do capitalismo de "concorrncia". Revela-se a importncia da concorrncia e o fato de que, atualmente, ela tambm tende a se exacerbar. Evidenciam-se as novas condies de valorizao do capital e a busca pelo lucro, em processos complexos de destruio-criao de valor e se ilustram, tambm, os mecanismos ligados superacumulao do capital, superproduo de mercadorias dela decorrentes. Marx nos ajuda a compreender que, para sobreviver, o capitalismo deve continuar "extorquindo" a mais-valia, a qualquer preo. um imperativo absoluto para sua reproduo e o que hoje lhe confere um carter predador e brutal em todos os domnios da vida social. Abstract in english This text is about the deeply underlying causes of the crisis and its manifestations over the past five years, particularly regarding the intense competition, truly a "currency war." Beyond the "chronicle of events" of the crisis its financial and monetary dimensions, a crisis of "sovereign" debts, [...] the Euro's future and its "afterlife" the author seeks out the problematic that has hovered over this crisis since 2008. The guiding principle capable of grasping its process is still the analysis of real process, based on Marx's method and theory, through the evolution of "competitive" capitalism. The importance of competition and also its current tendency for intensification have been revealed. New conditions of capital appreciation and profit-seeking have become evident in complex processes of destruction-creation of value, and they also illustrate the mechanisms linked to super-accumulation of capital to the resulting super-production of goods. Marx helps us understand that in order for capitalism to survive, it must keep "extorting" the surplus value, whatever the cost. It is an absolute imperative for it to reproduce, and today this gives it a brutal predatory character in all societal domains.

  3. FERAL HORSE SOCIAL STABILITY IN TORNQUIST PARK, ARGENTINA

    Alberto L. Scorolli

    2010-01-01

    Full Text Available Estabilidad social de caballos cimarrones en el Parque Tornquist, Argentina. Los caballos cimarrones (Equus ferus caballus presentan poliginia con defensa de harén y las tropas-harén son generalmente consideradas como unidades sociales estables en el tiempo. Estudiamos una población de caballos cimarrones no manejada, con muy alta densidad y pocos predadores en el Parque Provincial Ernesto Tornquist, Argentina. Los caballos fueron observados recorriendo un camino fijo de 20 km de longitud que cubría toda el área de estudio. Los caballos fueron identificados individualmente basados en el color del pelaje y las marcas características en cara y patas. Se tomaron datos sobre la composición de los grupos sociales mensualmente desde 1995 a 1997, estacionalmente de 1998 a 2000 y mensualmente de 2000 a 2003. Calculamos el porcentaje de tropasharén formadas y disueltas, el porcentaje de hembras adultas que cambió de tropa-harén y la tenencia de los padrillos. La estabilidad social fue alta, con 82% de las tropas-harén estables anualmente. Por otra parte la estabilidad fue menor que la reportada por otros autores, con un 24% de nuevas tropas-harén formadas y 18% de tropas-harén disueltas anualmente. La tasa promedio de cambio de hembras adultas fue de 20% por año y la tenencia de las tropas-harén promedio de los padrillos fue de cuatro años. No hallamos una relación significativa entre inestabilidad social y densidad poblacional o lluvia en otoñoinvierno. En el Parque Tornquist la mayoría de las tropas-harén fueron estables durante el año en los ocho años del período de estudio, sin embargo algunas fueron inestables y algunas hembras adultas cambiaron de tropa-harén. Al mismo tiempo muchos caballos cimarrones cambiaron de su tropa-harén original a otra durante el período de estudio y esto sólo se hizo evidente a través de la investigación a largo plazo.

  4. Toxicidade diferencial de agrotóxicos utilizados em citros para Neoseiulus californicus, Euseius concordis e Brevipalpus phoenicis

    Marcos Zatti da Silva

    2011-01-01

    Full Text Available Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae é considerada uma das principais pragas em citros no Brasil, devido à transmissão do vírus da leprose dos citros e à necessidade de frequentes aplicações de acaricidas para seu controle. Assim, objetivou-se comparar a toxicidade dos principais agrotóxicos utilizados em citros no Brasil, sobre populações de B. phoenicis e de ácaros predadores das espécies Neoseiuluscalifornicus (McGregor e Euseius concordis (Chant (Acari: Phytoseiidae. Foram avaliadas duas populações de E. concordis: uma procedente de Jaboticabal (SP e outra de Descalvado (SP. Arenas de folhas (para fitoseídeos ou frutos (para B. phoenicis de Citrus sinensis Osbeck (L. cv. Pera, contendo 25 fêmeas adultas de cada espécie foram pulverizadas em torre de Potter. As avaliações de mortalidade foram realizadas 72 horas após a aplicação. Foram utilizadas 4 a 6 concentrações de cada produto (abamectina, acefato, azociclotina, bifentrina, clorfenapir, dicofol, dinocape, óxido de fembutatina, propargito e piridabem para a obtenção das curvas de concentração-resposta. Abamectina, azociclotina, clorfenapir, dicofol, dinocape, óxido de fembutatin, propargito e piridabem foram altamente tóxicos a B. phoenicis, com valores de CL90 iguais ou inferiores aos das concentrações recomendadas desses produtos. N. californicus foi mais tolerante a bifentrina, propargito, óxido de fembutatina e dinocape que B. phoenicis e E. concordis (ambas as populações. Esses acaricidas tiveram baixa toxicidade aos adultos de N. californicus, para o qual as CL50 foram pelo menos seis vezes maiores que suas concentrações recomendadas. Acefato foi extremamente tóxico a E. concordis, mas inócuo a adultos de N. californicus. A população de E. concordis de Jaboticabal foi mais resistente que a de Descalvado a azociclotina, bifentrina, clorfenapir, dicofol e propargito.

  5. Influence of a waterfall over richness and similarity in adjoining pools of an Atlantic Rainforest stream Influência de uma queda d'água sobre a riqueza e a similaridade de dois remansos em um rio da Mata Atlântica

    Célio Roberto Jönck

    2010-12-01

    Full Text Available AIM: The main goal of the study was to determine the effect of the Morato Fall in the richness and composition of the aquatic animal community; METHODS: We compared faunal richness and similarity in four substrate samples from two pools separated by a waterfall in the Morato River, southern Brazil; RESULTS: The richness was not significantly different, although the upstream pool had 72 taxa and the downstream one just 65. On the other hand, composition was poorly similar, just a 36.5% similarity between the two sites; CONCLUSIONS: That indicates a strong influence of the waterfall, mainly on organisms which spent its entire life cycle on the water, such as fish and small crustaceans. That allow aquatic insects, a group with airborne adult phase and, therefore, able to disperse up to the upstream pool, to evolve with less predatory pressure, becoming the top group in the food web of this environment.OBJETIVO: O objetivo principal foi determinar o efeito do Salto Morato na riqueza e na composição da comunidade aquática; MÉTODOS: Nós comparamos a riqueza e a similaridade da fauna em amostras de quatro substratos de dois poços separados por uma cachoeira no Rio Morato, no sul do Brasil; RESULTADOS: A riqueza não foi significativamente diferente, embora o poço acima do salto tenha apresentado 72 taxa e o poço abaixo do salto apenas 65. Por outro lado, a fauna apresentou-se pouco similar, com apenas 36,5% de similaridade entre os poços; CONCLUSÕES: Isso indicou uma forte influencia da presença da cachoeira, principalmente nos organismos que tem todo o ciclo de vida na água, como os peixes e pequenos crustáceos. Isso permite que os insetos aquáticos, que tem fase adulta alada e, portanto, a capacidade de se dispersar até o poço acima do salto, se desenvolvam sem a pressão de seus principais predadores e tornem-se, naquele ambiente, os organismos de topo da teia trófica.

  6. Composio elementar e caracterizao da frao lipdica de seis cultivares de caupi Biochemical composition and characterization of lipid fraction of six cowpea cultivars

    Rolando E. R. Castelln

    2003-04-01

    Full Text Available A composio bioqumica elementar de sementes de seis cultivares de feijo de corda (Vigna unguiculata foi determinada e a frao lipdica de cada cultivar, caracterizada. Os resultados sugerem que todas as farinhas de semente compartilham composio bioqumica similar, embora as cultivares Br-14 e CE-315 difiram das Br-9 e Br-17 no teor de umidade. As fraes lipdicas purificadas foram caracterizadas quanto ao teor e tipos de cidos graxos presentes. A cultivar Br-17 possui alto contedo de cido palmtico (58,2% e o menor contedo de cido linolico (6,4% enquanto a Vita 7 apresenta alto contedo de cido linolico (21,8% e relativamente baixo contedo de cido palmtico (41% em uma base comparativa. Os cidos graxos pentacosanico e eicosanico representam a frao lipdica menor e o primeiro no ocorre em CE-315. Os resultados sugerem que diferentes cultivares obtidas por melhoramento gentico podem apresentar diferenas quantitativas e qualitativas na composio bioqumica; assim, diferenas na capacidade germinativa, resistncia a predadores no campo de plantio e no armazenamento, poderiam estar relacionadas inibio ou estmulo da expresso de genes codificadores da sntese de molculas relevantes, que refletem diferenas de composio, como demonstrado neste trabalho.The biochemical composition of the seeds of six bean - Vigna unguiculata (Walp cultivars was determined and the lipid fraction of each of these cultivars was characterized. The results suggest that all analyzed seed flours share similar biochemical composition, although the cultivars Br-14 and CE-315 differ in relation to Br-9 and Br-17 in water content. The purified fatty acid fractions were characterized according to their lipid content. The cultivar Br-17 possesses high content of palmitic acid (58.2% and low content of linoleic acid (6.4% while Vita 7 possesses high contents of linoleic acid (21.8% and relatively low content of palmitic acid (41% on a comparative basis. Pentacosanoic and eicosanoic acids represent the minor fraction of lipids and the former does not occur in CE-315. The results suggest that different cultivars obtained by genetic combination may present relevant differences in their biochemical composition. Thus, differences in germination capacity, resistance to predators in the field or storage house may be related to over expression or inhibition of genes encoding synthesis of relevant molecules which refleet difference in composition as demonstrated in this study.

  7. Aleochara pseudochrysorrhoa, a new species from southern Brazil (Coleoptera: Staphylinidae: Aleocharinae, with a complete checklist of Neotropical species of the genus Aleochara pseudochrysorrhoa, nova espcie do sul do Brasil (Coleoptera: Staphylinidae: Aleocharinae, com uma lista completa das espcies Neotropicais do gnero

    Edilson Caron

    2008-12-01

    Full Text Available The ectoparasitoid habit of larvae and the active predatory habit of adults of Aleochara Gravenhorst, 1802 established this group as natural fly regulators and important for ecological studies, biological control programs and forensic entomology. In the current study, a new aleocharine species, Aleochara pseudochrysorrhoa sp. nov., from southern Brazil, is described and its natural history is briefly discussed. The species has a robust body, uniformly dark-brown to black with apex of abdomen rust-brown, median lobe of male with expanded bulbus, sclerites of internal sac forming complex arrangement, and female with spermatheca L-shaped. Aleochara pseudochrysorrhoa sp. nov. may be considered to be closely related to the species belonging to the lustrica group. A complete checklist of Neotropical species of Aleochara is also provided. Nomenclatural problems are also discussed. Aleochara lateralis Erichson, 1839 is a junior primary homonym of A. lateralis Heer, 1839, and is replaced by the available name Aleochara bonariensis Lynch, 1884. A new name, Aleochara newtoni nom. nov., is proposed to replace Maseochara (= Aleochara duplicata Sharp, 1883, which is a junior secondary homonym of A. duplicata Erichson, 1839.Os hbitos ectoparasitide da larva e predador ativo dos adultos de Aleochara Gravenhorst, 1802 faz deste um grupo regulador natural de moscas e importante para estudos ecolgicos, programas de controle biolgico e entomologia forense. No presente estudo, uma nova espcie de Aleocharinae, Aleochara pseudochrysorrhoa sp. nov., do sul do Brasil descrita e notas de sua histria-natural so brevemente discutidas. A espcie possui corpo robusto, uniformemente castanho-escuro a preto e pice do abdome castanho-avermelhado, o macho possui lobo mdio com base bulbosa e uma complexa estrutura dos escleritos no saco-interno, e a fmea possui espermateca em forma de "L". Aleochara pseudochrysorrhoa sp. nov. pode ser considerada fortemente relacionada com as espcies do grupo lustrica. Uma lista completa das espcies Neotropicais de Aleochara tambm apresentada.Tambm so discutidos problemas nomenclaturais. Aleochara lateralis Erichson, 1839 homnimo primrio jnior de A. lateralis Heer, 1839, e substitudo por Aleochara bonariensis Lynch, 1884. Um novo nome, Aleochara newtoni nom. nov., proposto para substituir Maseochara (= Aleochara duplicata Sharp, 1883, que homnimo secundrio jnior de A. duplicata Erichson, 1839.

  8. Interacciones planta-animal en la regeneración de Quercus pyrenaica: ecología y gestión

    R. Perea

    2014-01-01

    Full Text Available Los rebollares de Quercus pyrenaica son formaciones casi exclusivas de la península ibérica cuya regeneración sexual se encuentra fuertemente comprometida como consecuencia de su estructura dominada por rebrotes de cepa y raíz (monte bajo. El abandono del aprovechamiento histórico de estos rebrotes (leña, carbón, etc. ha provocado que, actualmente, muchos rebollares se hayan convertido en ecosistemas degradados con exceso de espesura, puntisecado y estancamiento del crecimiento. Este trabajo trata de resumir el estado del conocimiento de las principales interacciones planta-animal en la regeneración sexual de los bosques dominados por el rebollo, con el fin de proporcionar bases científicas para una mejor gestión y conservación de estos ecosistemas. Algunas especies animales (arrendajo, ratón de campo, trepador azul juegan un papel importante en la dispersión efectiva de las bellotas, lo que contribuye a un mejor flujo génico y a la colonización de nuevos lugares. Sin embargo, la creciente densidad de ungulados silvestres (ciervo, jabalí, etc. es uno de los factores de mayor amenaza para estos bosques al reducir drásticamente el número de bellotas disponibles para la germinación y limitar el crecimiento y la supervivencia de las nuevas plántulas. Además, existen interacciones multi-tróficas (p. ej. bellota-predador-dispersor y fenómenos de facilitación (plántula-matorral que revelan la importancia de las relaciones múltiples en la regeneración de los rebollares. Finalmente, se exponen posibles medidas de gestión encaminadas a facilitar la regeneración sexual de estos sistemas de manera que pueda revertirse la actual situación de estancamiento y decaimiento de muchos rebollares.

  9. Composicin fitoperiftica durante el proceso de colonizacin de substratos artificiales en dos perodos hidrolgicos (sistema de lagos Yahuarcaca, Amazona colombiana Composicin fitoperiftica durante el proceso de colonizacin de substratos artificiales en dos perodos hidrolgicos (sistema de lagos Yahuarcaca, Amazona colombiana

    Gantiva Rocha Jess Anbal

    2000-06-01

    Full Text Available Dentro del lago Yahuarcaca I, perteneciente al sistema lagunar del plano de inundacin del roAmazonas, en el territorio colombiano, se llev a cabo un experimento con el fin de colectarmuestras del fitoperifiton sobre substratos artificiales. Para ello se diseo un Equipo MuestreadorMltiple de Perifiton (EMMP, de tal manera que se pudiera estudiar el proceso de colonizacinen cuatro niveles de profundidad, aislado de predadores mayores y con intervalos temporalesde maduracin diferentes. El EMMP, se ubic en la zona litoral del lago, por dos perodoshidrolgicos de la siguiente manera. De enero a febrero de 1997, y de junio a julio del mismo ao,se colectaron muestras a los 2, 4, 6 y 8 das de maduracin en cada uno. Los resultados delexperimento mostraron una relacin directa entre la variacin del nivel del lago y el desarrollo delas especies de algas perifiticas. La variacin del nivel del lago es tomada como uno de losfactores generadores, puesto que este influye directamente en las condiciones fsico qumicasdel medio. A la vez, una condicin que mostr su papel decisivo fue la generacin de una matrizgelatinosa, en el substrato antes de iniciarse el proceso de colonizacin. La clase que sepresent con mayor desarrollo fue la Bacillariophyta, durante los dos perodos hidrolgicos.Into Yahuarcaca lake, in the flood plain of the Amazonas river in Colombia, Phytoperiphytonsamples over artifitial substrates were collected. A Periphyton Multiple Sampler Equipment(EMMP, was built to study the process of colonization at four depth levels, isolated frompredators and with different maturation intervals. We put EMMP, in the litoral zone of the lake,for the hidrological periods, between January to February of 1997 and June to July of the sameyear, collecting samples with colonization intervals of 2, 4, 6 and 8 days in each period. Theexperiment showed a direct relation between the level variation of the lake and the developmentof algues species. The variation of the level was a generator factor, since it influences thephysico-chemical conditions directly. The Bacillariophytaclass was present in major density overthe two periods.

  10. Preferncia alimentar de juvenis de lambari-cachorro, Oligosarcus hepsetus, em relao a duas espcies de presas de peixe em ambiente controlado / Feeding preference by juvenile pike characin, Oligosarcus hepsetus, on two prey fish species of fish in a controlled environment

    Alejandra Filippo Gonzalez Neves dos, Santos; Pedro Ribeiro de Oliveira, Carrera; Marcos, Aronovich; Luciano Neves dos, Santos.

    2014-02-01

    Full Text Available O presente trabalho foi baseado em dados pretritos sobre a dieta natural do lambari-cachorro Oligosarcus hepsetus em um reservatrio do Sudeste brasileiro, e com isso foi testada a preferncia alimentar desse carnvoro, a partir de experimentos com microcosmos. Os experimentos foram realizados em a [...] qurios, em janeiro de 2011. Os predadores foram coletados em um tributrio do Rio Paraba do Sul, enquanto as presas: Tilpia rendalli e o lambari, Astyanax fasciatus, foram adquiridas em pisciculturas. Foi testada a preferncia alimentar do lambari-cachorro quanto ao tamanho das presas e s espcies-presa e os resultados foram relacionados com a energia da presa. O lambari-cachorro predou tilpia de menores comprimentos (CT) e alturas do corpo (AC), ao passo que no foi observado um padro evidente de consumo de lambaris. Nos experimentos com CT padronizado, lambari-cachorro consumiu preferencialmente tilpias a lambaris, enquanto, nos experimentos com AC padronizada, no foram detectadas preferncias no consumo por determinada espcie-presa. Diferenas energticas entre espcies-presa parecem importar menos que diferenas morfolgicas na preferncia alimentar do lambari-cachorro. Abstract in english This study was based on previously published data on natural diet of the pike characin, Oligosarcus hepsetus in a reservoir at Southeastern Brazil, and thus tested the feeding preference of this carnivore using microcosm experiments. The experiments were conducted in aquariums, in January 2011. Pred [...] ators were collected in a tributary of the Paraba do Sul River, while preys: Tilapia rendalli and Astyanax fasciatus were obtained of fish farms. We tested the feeding preference by pike characin in relation to prey size and species, and the results were compared to prey energy. Juvenile pike characin predated preferentially on tilapias with lower body length height, whereas no clear pattern of consumption was observed for lambaris. Tilapias were preferentially predated at experiments with standardized prey body length, whereas no feeding preference was recorded on any prey species at experiments with standardized prey body height. Energetic differences between prey species seem to be less important than morphological differences for the feeding preference of pike characin.

  11. Exigências térmicas e tabela de vida de fertilidade de Amblyseius largoensis Thermal requirements and fertility life table of the Amblyseius largoensis

    Andréia Serra Galvão

    2008-10-01

    Full Text Available Amblyseius largoensis (Muma (Acari: Phytoseiidae é uma espécie de ampla distribuição, ocorrendo em regiões tropicais e subtropicais, freqüentemente associada a plantas perenes, sendo um dos principais predadores de Aceria guerreronis Keifer (Acari: Eriophyidae em coqueiro (Cocos nucifera L.. O objetivo deste trabalho foi determinar as exigências térmicas de A. largoensis alimentado com uma combinação de Tetranychus urticae Koch (Acari: Tetranychidae, pólen de Ricinus communis L. e mel a 10% e elaborar uma tabela de vida de fertilidade. O estudo foi conduzido a 18, 21, 24, 27 e 30°C, umidade relativa 70 ± 10 % e fotofase de 12 h. Nessas temperaturas, o período de ovo-adulto durou 14,0; 8,6; 6,1; 5,0 e 3,9 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 13,3; 13,3; 13,5; 11,9 e 13,3°C e constantes térmicas de 20,9; 13,5; 14,9; 18,9 e 66,1 graus-dia. Os parâmetros da tabela de vida de fertilidade foram melhores a 27 e 30°C.Amblyseius largoensis (Muma (Acari: Phytoseiidae is a species widely spread and naturally occurring in the tropics and subtropics regions. This species is also associated with perennial plants and considered an important predator of Aceria guerreronis Keifer (Acari: Eriophyidae in coconut trees (Cocos nucifera L.. The objective of this research was to determinate the thermal requirements of A. largoensis fed with a combination of Tetranychus urticae Koch (Acari: Tetranychidae, pollen of Ricinus communis L. and a 10 % honey solution. The study was conducted at 18, 21, 24, 27 and 30°C, 70 ± 10 % relative humidity and 12 h photophase. At these temperatures, the period from egg-adult lasted 14.0, 8.6, 6.1, 5,0 e 3.9 respectively. At those temperatures, the threshold temperature for the development of larva, protonynph, deutonymph and egg-adult were 13.3, 13.3, 13.5, 11.9 and 13.3°C, and the thermal constants were 20.9, 13.5, 14.9, 18.9 and 66.1 degree-days, respectively. The fertility life table parameters were better in the 27 and 30°C.

  12. Nocturnal and diurnal activity of armored suckermouth catfish (Loricariidae: Pterygoplichthys associated with wintering Florida manatees (Trichechus manatus latirostris

    Leo G. Nico

    2010-01-01

    Full Text Available Several Pterygoplichthys species, members of the Neotropical catfish family Loricariidae, have been widely introduced outside their native ranges. In this paper, I present observations on the diel activity pattern of non-native Pterygoplichthys, tentatively identified as P. disjunctivus, with respect to their attachment and grazing on endangered Florida manatees, Trichechus manatus latirostris. The study was conducted in December 2009 at Volusia Blue Spring, an artesianal spring system in the St. Johns River basin, Florida (USA. Supplemented by information gathered during previous visits to the spring site, this study revealed that adult Pterygoplichthys are active throughout the diel period (day, twilight and night. However, juvenile Pterygoplichthys were largely nocturnal and only at night did they consistently join adults in attaching to manatees. The juveniles generally remain hidden during the day, probably responding to presence of diurnal predators, mainly birds. Differences in diel behaviors among different Pterygoplichthys size classes in Florida are consistent with published observations on loricariids inhabiting clearwater streams within their native ranges.Várias espécies de Pterygoplichthys, siluriformes Neotropicais da família Loricariidae, tem sido largamente introduzidos além de suas áreas naturais de ocorrência. Neste artigo, eu apresento observações dos padrões de atividade diária de uma população não nativa de Pterygoplichthys, identificada tentativamente como P. disjunctivus, associados com a espécie ameaçada de peixe-boi nativa da Flórida, Trichechus manatus latirostris. O estudo foi conduzido em dezembro de 2009 em Volusia Blue Spring um sistema artesiano na bacia do rio St. John, Flórida (USA. Suplementado por informações reunidas durante visitas prévias ao sítio em análise, este estudo revelou que Pterygoplichthys adultos estiveram ativos durante a maioria dos períodos (dia, crepúsculo e noite. No entanto, jovens foram principalmente noturnos e somente a noite eles uniram-se aos adultos sobre os peixes-boi. No sistema estudado na Flórida, jovens de Pterygoplichthys geralmente permanecem escondidos durante o dia, provavelmente respondendo a presença de predadores visuais diurnos, principalmente aves. As diferenças observadas na atividade diária entre diferentes classes de tamanho são semelhantes ao descrito para certos loricariídeos que habitam cursos d'água de águas límpidas em suas áreas nativas de ocorrência.

  13. La naturaleza de la lengua

    José Luis Díaz Gómez

    2015-01-01

    Full Text Available El presente texto de ingreso a la Academia Mexicana de la Lengua perfila los fundamentos biológicos del lenguaje y el significado en la conducta animal, la hominización y la neurociencia. Las expresiones intencionales y simbólicas en animales consti-tuyen claros cimientos del lenguaje y el pensamiento proposicional humano. Mediante entrenamiento, ejemplares de aves y simios apren-den, reconocen y expresan símbolos abstractos, en tanto que los mo-nos verdes en su medio natural emiten diferentes voces para identificar a sus predadores. La intención comunicativa está además sugerida por el juego social, el engaño táctico, la inteligencia maquiavélica o los silbidos para nombrar individuos. Dichas habilidades evoluciona-ron hasta el Homo sapiens cuyas representaciones pictóricas iniciales marcan una simbolización adaptativa basada en circuitos neuronales que generan recursos cognoscitivos en coordinación con el medio. La destreza derecha, la fabricación de herramientas, el lengua-je simbólico y la predominancia del hemisferio izquierdo son capa-cidades engarzadas que emergieron durante la escisión humana de los simios. Si bien la modularidad del lenguaje implica zonas espe-cializadas para su expresión y comprensión, el significado requiere de una amplia conectividad. Procesar información verbal requiere la activación de redes genéticamente dispuestas en un dispositivo cere-bral que se acondiciona por aprendizaje repetitivo. La representación lingüística utiliza códigos de disparo de neuronas organizadas en dichas redes cuyos contenidos están determinados por el origen y destino de las vías, en tanto que el significado surge de la pauta di-námica de las interconexiones entre los módulos. El ámbito simbólico humano está la vista en el mundo de la expresión y la cultura pues está mediado por procesos sociales acoplados a procesos cerebrales mediante una práctica. El significado tiene así un asa externa o cultu-ral un asa interna o neurosemántica.La contribución de las ciencias biológicas, cognitivas y cerebra-les coordinadas con las humanidades para comprender la naturaleza de la lengua es tan reveladora como desafiante.

  14. Effect of Light Intensity on Initial Survival of Fat Snook (Centropomus parallelus, Pisces: Centropomidae Larvae

    Vinicius Ronzani Cerqueira

    2001-12-01

    Full Text Available Different light intensities were tested during the larval rearing of fat snook (Centropomus parallelus to evaluate its influence on survival and functional swim bladder rate. Newly-hatched larvae were obtained by stripping of hormonally induced broodstock, and were stocked in 32-liter tanks at densities from 30 to 50 L-1. Four experiments were carried out testing six light intensities: 50, 100, 200, 500, 1500, and 2500 lx, and total darkness as a control. Mean survival ranged from 0.06 to 16.0% and were significantly influenced by light intensity. Complete darkness resulted in 100% mortality after one week, larvae appeared to have starved since they had empty stomachs. The species has the characteristics of a visual-feeder. Survival was the highest at 200 lx, while at 500 lx was higher than at 50, 100, and 2500 lx. Frequency of functional swim bladder ranged from 36.8 to 100%, but it was not significantly correlated with light intensity. Based on this study, a medium light intensity, 200 to 1500 lx, is recommended for rearing fat snook larvae. Extreme values must be avoided, mainly in the first two weeks after hatching.Diferentes intensidades de luz foram testadas na larvicultura do robalo peva, Centropomus parallelus, avaliando sua influência na sobrevivência e insuflação da bexiga gasosa. Larvas obtidas de desova induzida foram mantidas até 14 dias, em tanques de 32 L, com densidade inicial de 30-50 L-1. Foram utilizados o escuro total e 6 intensidades de luz: 50, 100, 200, 500, 1.500 e 2.500 lx. A sobrevivência média variou entre 0,06 e 16,0%, dependendo significativamente (P<0,05 da intensidade de luz. No escuro, as larvas morreram após uma semana, sem conteúdo no tubo digestivo, comprovando serem predadores visuais. Em 200 lx, a sobrevivência foi maior que em 500, 1.500 e 2.500 lx. Em 500 lx também foi superior a 50, 100 e 2.500 lx. A insuflação da bexiga gasosa ficou entre 36,8 e 100%, independendo da intensidade de luz. Recomenda-se intensidade luminosa média, de 200 a 1.500 lx, evitando valores extremos, sobretudo nas duas primeiras semanas de vida.

  15. Biophysical interactions in the Cabo Frio upwelling system, southeastern Brazil

    Sergio Augusto, Coelho-Souza; Maria Soledad, Lpez; Jean Remy Davee, Guimares; Ricardo, Coutinho; Rogrio Nader, Candella.

    2012-09-01

    Full Text Available Os sistemas costeiros de ressurgncia so caracterizados pela ascenso de guas frias que tornam os nutrientes disponveis na camada euftica para o crescimento e aumento da produo fitoplanctnica. No Brasil, a regio do Cabo Frio (RJ) o principal sistema de ressurgncia costeira. O objetivo des [...] se artigo foi revisar o atual conhecimento desse sistema atravs dos conceitos sobre interaes biofsicas. A ascenso da gua Central do Atlntico Sul ocorre devido alta frequncia e amplitude dos ventos, presena de meandros e vrtices na Corrente do Brasil, alm da topografia local e da linha de costa. Os eventos de ressurgncia so comuns durante os perodos de primavera/vero e a biomassa primria exportada devido circulao da gua, sendo tambm controlada pela rpida predao zooplanctnica. Os pequenos peixes pelgicos regulam o crescimento do plncton e so consumidos pelos peixes predadores, resultando em um importante estoque pesqueiro regional. A irregularidade da costa define as enseadas do Cabo Frio, na Reserva Extrativista Marinha do Arraial do Cabo, apresentando distintas influncias das guas ressurgidas e resultando em grande diversidade de espcies. Consequentemente, ambientes com caractersticas tropicais e subtropicais so observados dentro de uma pequena escala espacial, o que constitui uma particularidade desse ecossistema. Abstract in english The rising of cold water from deeper levels characterizes coastal upwelling systems. This flow makes nutrients available in the euphotic layer, which enhances phytoplankton production and growth. On the Brazilian coast, upwelling is most intense in the Cabo Frio region (RJ). The basic knowledge of t [...] his system was reviewed in accordance with concepts of biophysical interactions. The high frequency and amplitude of the prevailing winds are the main factor promoting the rise of South Atlantic Central Water, but meanders and eddies in the Brazil Current as well as local topography and coast line are also important. Upwelling events are common during spring/summer seasons. Primary biomass is exported by virtue of the water circulation and is also controlled by rapid zooplankton predation. Small pelagic fish regulate plankton growth and in their turn are preyed on by predatory fish. Sardine furnishes an important regional fish stock. Shoreline irregularities define the embayment formation of the Marine Extractive Reserve of Arraial do Cabo making it an area with evident different intensities of upwelled water that harbors high species diversity. Consequently, on a small spatial scale there are environments with tropical and subtropical features, a point to be explored as a particularity of this ecosystem.

  16. Diet of Leptodactylus fuscus (Amphibia: Anura: Leptodactylidae) in the Pantanal of Miranda river, Brazil / Dieta de Leptodactylus fuscus (Amphibia: Anura: Leptodactylidae) no Pantanal do rio Miranda, Brasil

    Jos Luiz Massao Moreira, Sugai; Juliana de Souza, Terra; Vanda Lcia, Ferreira.

    2012-03-01

    Full Text Available Anfbios so, em geral, predadores generalistas cuja dieta influenciada por fatores extrnsecos (e.g. disponibilidade de alimento) e intrnsecos (e.g. tamanho do corpo e formato do crnio). Este estudo tem como objetivo descrever a dieta de machos e fmeas adultos de Leptodactylus fuscus no Pantan [...] al do rio Miranda e responder as seguintes perguntas: i) O tamanho mximo da presa e o nmero de itens alimentares so explicados pelo tamanho corpreo do anuro? ii) A riqueza de morfoespcies e nmero de itens alimentares so explicados pelo sexo do anuro? iii) Existe sobreposio de dieta entre macho e fmea? Registramos 62 itens alimentares distribudos por sete ordens de Arthropoda e um indivduo de Annelida. A dieta de L. fuscus possui dominncia de Orthoptera, seguida por Coleoptera, Araneae, Hymenoptera, Blattaria, Hemiptera e Diptera. O tamanho corpreo do anuro no influenciou o tamanho da presa ou o nmero de itens alimentares consumidos. O nmero de presas e riqueza de morfotipos no diferiu entre machos e fmeas. Houve baixa sobreposio alimentar entre os sexos. Os resultados mostram evidncias de comportamento alimentar oportunstico e generalista para L. fuscus. Abstract in english Amphibians are usually generalist predators, and their diet is influenced by extrinsic (e.g. food availability) and intrinsic factors (e.g. body size and skull shape). This study aims to describe the diet of adult males and females of Leptodactylus fuscus in the Pantanal of the Miranda river and to [...] answer the following questions: i) Are prey's maximum size and number of food items explained by the anuran's body size? ii) Are richness of morphospecies and number of food items explained by frog sex? iii) Is there diet overlap between male and female? We recorded 62 food items, belonging to seven orders of Arthropoda, and one individual of Annelida. The diet of L. fuscus was dominated by Orthoptera, followed by Coleoptera, Araneae, Hymenoptera, Blattaria, Hemiptera and Diptera. Frog's body size did not influence prey size or number of food items consumed. The number of prey and richness of morphospecies did not differ between males and females. There was low diet overlap between the sexes. Our results provide evidence for the opportunistic and generalist feeding behavior of L. fuscus.

  17. Feeding habits of the leaf litter frog Haddadus binotatus (Anura, Craugastoridae) from two Atlantic Forest areas in southeastern Brazil

    LVIA, COCO; VITOR N.T., BORGES JNIOR; LUCIANA A., FUSINATTO; MARA C., KIEFER; JANE C.F., OLIVEIRA; PABLO G., ARAUJO; BIANCA M., COSTA; MONIQUE VAN, SLUYS; CARLOS F.D., ROCHA.

    2014-03-01

    Full Text Available Haddadus binotatus um anuro endmico da Mata Atlntica Brasileira e, atualmente, ainda no existem informaes sobre a dieta desta espcie. Analisamos a dieta de duas populaes desse anuro em dois estados do sudeste brasileiro. As amostragens foram realizadas em 2004 no estado do Rio de Janeiro [...] e em 2009 e 2010 no estado do Esprito Santo. Haddadus binotatus apresentou uma composio de dieta rica, predando 19 tipos de presas. Orthoptera, Coleoptera e Blattodea foram as presas mais importantes na populao do Rio de Janeiro, e Orthoptera, Araneae e Hemiptera foram as presas mais importantes na populao do Esprito Santo. A composio da dieta diferiu numericamente entre as duas localidades, mas no em termos de volume, o que pode refletir diferenas locais na disponibilidade de presas nos dois habitats. A largura da mandbula limitou o tamanho da presa, o que esperado para predadores que engolem as presas sem mastigar. A proporo de indivduos com estmagos vazios foi maior na populao do Rio de Janeiro (39,2%) do que na do Esprito Santo (17,9%), sugerindo que a primeira poderia estar em um menor balano energtico. As fmeas da espcie foram maiores que os machos, o que pode resultar de uma seleo de tamanhos maiores atingidos pelas fmeas, favorecendo a produo de ovos maiores. Abstract in english Haddadus binotatus is an endemic anuran of the Brazilian Atlantic Forest and currently, there is no information about the diet of this species. We analyzed the diet of two populations of this anuran in two states in southeast Brazil. Samplings were carried out in 2004 in the state of Rio de Janeiro [...] and in 2009 and 2010 in the state of Esprito Santo. Haddadus binotatus presented a rich diet composition, preying 19 prey types. Orthoptera, Coleoptera, and Blattodea were the most important preys in the Rio de Janeiro population, and Orthoptera, Araneae and Hemiptera were the most important in the Esprito Santo population. The diet composition differed numerically between the two localities, but not in terms of volume, which can reflect local differences in the prey availability in the two habitats. The jaw width limited the size of prey, which is expected for predators who swallow the preys without chewing. The proportion of individuals with empty stomachs was higher in the Rio de Janeiro population (39.2%) than in the Esprito Santo population (17.9%), suggesting that the former could be in a lower energy balance. The females of the species were larger than the males, which may result from the production of larger eggs.

  18. Influence of agricultural environment on the plant mite community in forest fragments / Influncia do ambiente agrcola vizinho na comunidade de caros plantcolas em fragmentos florestais

    PR., Demite; RJF., Feres; AC., Lofego.

    2015-05-01

    Full Text Available Foi estudada a comunidade de caros em fragmentos de mata estacional semidecidual com trs tipos de ambientes agrcolas circunvizinhos para testar a hiptese de que a abundncia e a riqueza de caros em fragmentos florestais so influenciadas pelo tipo de ambiente agrcola. O estudo foi conduzido em [...] seis fragmentos, divididos em trs conjuntos de dois fragmentos, sendo cada conjunto vizinho de um determinado tipo de ambiente agrcola: canavial (FS), laranjal (FO) e pastagem (FP). Em cada fragmento foram selecionados e marcados dez indivduos de Actinostemon communis (Euphorbiaceae), cinco na borda e cinco no interior do fragmento. Iphiseiodes zuluagai, registrado frequentemente em laranjais, foi mais abundante nos fragmentos vizinhos a essa cultura, bem como algumas espcies de Tarsonemidae. Neste estudo os fitosedeos foram mais abundantes nos fragmentos vizinhos de reas de pastagens, enquanto os cultivos de cana-de-acar provavelmente favoreceram a ocorrncia de fitfagos nos fragmentos adjacentes. Os tetraniqudeos foram menos abundantes em FO, o que pode ser explicado pela aplicao peridica de pesticidas nos laranjais. Fragmentos florestais so importantes para a colonizao de predadores nas culturas vizinhas, principalmente em culturas anuais, como a cana-de-acar, nas quais o ambiente perene prximo muito importante para a colonizao do cultivo. A conservao dessas reas, alm de favorecer a manuteno de espcies silvestres de caros de grande importncia para o aumento da diversidade nos agroecossistemas vizinhos. Abstract in english The mite community has been surveyed in Seasonal Semideciduous Forest with three types of surrounding agricultural environments to test the hypothesis that abundance and richness of mites in forest fragments are influenced by the type of agricultural environment. The survey has been carried out in s [...] ix fragments, divided into sets of two fragments, each one neighboring one sort of agricultural environment: sugarcane crop (FS), orange crop (FO) and pasture (FP). In each fragment, ten individuals of Actinostemon communis (Euphorbiaceae) were selected, five at the edge and five within each fragment. Iphiseiodes zuluagai, often registered in orange crops, was more abundant in the fragments neighboring such crop, as well as some species of Tarsonemidae. In this study, the Phytoseiidae were more abundant in the fragments neighboring pasture, while sugarcane crops probably favored occurrence of phytophagous mites in the neighboring fragments. Tetranychidae were less abundant in FO, which can be explained by periodical use of pesticides in the orange crops. Forest fragments are important for colonies of predators in the neighboring crops, mainly for annual crops such as sugarcane, where the close perennial environment is very important for colonization of the crop. Maintenance of those areas, besides favoring preservation of wild species of mite, is very important to increase diversity of the neighboring agricultural ecosystems.

  19. Predação de sementes ao longo de uma borda de Floresta Ombrófila Mista e pastagem Seed predation along an edge gradient between Araucaria forest and pasture

    Ronei Baldissera

    2005-03-01

    Full Text Available Este estudo teve como objetivo avaliar o processo de predação de sementes em três árvores nativas (Mimosa scabrella Bentham, Prunus sellowii Koehne e Myrsine laetevirens Mez. ao longo de uma borda de Floresta Ombrófila Mista e pastagem, na Floresta Nacional de São Francisco de Paula, RS, Brasil. Grupos de sementes foram distribuídos em dez pontos aleatórios nas distâncias: 0m, 25m, 50m, 100m e 250m da borda para dentro da floresta e 5m e 50m da borda para dentro da pastagem. As sementes foram monitoradas até a predação total ou até esgotado o tempo para germinação. Houve redução nas taxas de predação de sementes até 50m da borda para dentro da floresta em relação ao interior da floresta e da pastagem. M. scabrella e M. laetevirens apresentaram redução nas taxas de predação de sementes na pastagem próxima à borda da floresta. Os resultados indicam que houve decréscimo na atividade de predadores de sementes nas proximidades da borda florestal estudada, podendo ocorrer maior regeneração de plantas próximo à borda e um avanço da floresta na pastagem adjacente.This study aims to evaluate how seed predation of three native tree species (Mimosa scabrella Bentham, Prunus sellowii Koehne, and Myrsine laetevirens Mez. could be altered along an edge between Araucaria forest and pasture at the National Forest of São Francisco de Paula, Rio Grande do Sul, Brazil. Groups of seeds were placed at ten random points in each of the following distances from the forest edge: 0m, 25m, 50m, 100m, and 250m from the edge into the forest, and 5m and 50m from the edge into the pasture. Seeds were monitored until total predation or until their time for germination was over. Seed predation rates decreased from the edge up to 50m inside the forest in relation to the forest interior and open pasture. M. scabrella and M. laetevirens showed a reduction in seed predation rates in pasture points that were located at the vicinities of the forest. The results indicated a decrease in the activity of seed predators near the forest edge, which could enhance plant community regeneration at the edge, and promote the expansion of the forest towards the adjacent pasture.

  20. Natural enemies associated to aphids in peach orchards in Araucria, Paran, Brazil Inimigos naturais associados a afdeos em pomares de pessegueiros em Araucria, Estado do Paran, Brasil

    JM. Schuber

    2012-11-01

    Full Text Available Natural enemies of the Class Insecta are important agents in the balance of aphid populations and an alternative to using insecticides to control these insects. The aim of this study was to identify the species of natural enemies associated with aphids present in peach orchards and observe the efficiency of capturing different sampling methods. The experiment was conducted from July, 2005 to September, 2006 in six peach orchards 'Chimarrita', in Araucria, PR, Brazil. The samples were taken by visual analysis in peach plants and weeds, yellow pan traps, sticky traps and funnels. Predator species were identified: Cryptolaemus montrouzieri, Cycloneda pulchella, Cycloneda sanguinea, Eriopis connexa, Harmonia axyridis, Hippodamia convergens and Scymnus sp. (Coleoptera, Coccinellidae, Allograpta sp., Palpada sp. and Toxomerus sp. (Diptera, Syrphidae and Chrysoperla sp. (Neuroptera, Chrysopidae and the parasitoids: Diaretiella rapae, Opius sp. and Praon sp (Braconidae. Examples of Encyrtidae and Eulophidae await identification. Chrysoperla sp. was a less abundant species. There were no statistically significant differences between the different sampling methods tested.Os inimigos naturais da Classe Insecta so importantes agentes no equilbrio das populaes de afdeos e uma forma alternativa ao uso de inseticidas no controle desses insetos. O objetivo deste estudo foi identificar as espcies de inimigos naturais associados aos afdeos presentes em pomares de pessegueiros, alm de verificar a eficincia de captura de diferentes mtodos de amostragem. O experimento foi realizado de julho de 2005 a setembro de 2006, em seis pomares de pessegueiros 'Chimarrita' em Araucria-PR, Brasil. As amostragens foram realizadas por meio de: anlise visual em plantas de pessegueiros e plantas invasoras; armadilhas amarelas; armadilhas adesivas, e funil. Foram identificados os predadores: Cryptolaemus montrouzieri, Cycloneda pulchella, Cycloneda sanguinea, Eriopis connexa, Harmonia axyridis, Hippodamia convergens, Scymnus sp. (Coleoptera, Coccinellidae, Allograpta sp., Palpada sp., Toxomerus sp. (Diptera, Syrphidae e Chrysoperla sp. (Neuroptera, Chrysopidae, alm dos parasitoides: Diaretiella rapae, Opius sp. e Praon sp. (Braconidae. Exemplares de Encyrtidae e Eulophidae aguardam identificao. Chrysoperla sp. foi a espcie menos abundante. No foram constatadas diferenas estatsticas significativas entre os diferentes mtodos de amostragem testados.

  1. Abundance and diversity of soil mites of fragmented habitats in a biosphere reserve in Southern Nigeria Abundância e diversidade de ácaros de habitats fragmentados em uma reserva de biosfera no sul da Nigéria

    MOSADOLUWA ADETOLA BADEJO

    2000-11-01

    Full Text Available Soil samples were collected from the top 7.5 cm of soil in a Strict Natural Reserve (SNR, a surrounding buffer zone, a cassava farm and matured plantations of Gmelina, teak, and pine, so as to determine if plantation establishment and intensive cultivation affect the density and diversity of soil mites. Altogether, 41 taxonomic groups of mites were identified. The diversity and densities of mites in within the SNR, the buffer zone and the Gmelina were more than the diversity and densities in the cassava farm, teak and pine plantations. Each plantation had its own unique community structure which was different from the community structure in the SNR plot. The SNR plot and Gmelina were dominated by detritivorous cryptostigmatid mites unlike teak and pine which were dominated by predatory mesostigmatid and prostigmatid mites respectively. Low cryptostigmatid mite densities in the plantations and cassava farm were seen as a consequence of low fertility status of the soil, the evidence of which was revealed by soil pH and organic matter data.Foram coletadas amostras de solo até a profundidade de 7,5 cm em uma reserva estritamente natural (SRN, em uma zona na vizinhança da SRN, e em plantações de mandioca, Gmelina, teca e pinheiros. O objetivo foi verificar se o estabelecimento de plantação e cultivo intensivo afetam a densidade e a diversidade de ácaros do solo. Ao todo, 41 grupos taxonômicos de ácaros foram identificados. A SNR, a zona vizinha da SNR e a plantação de Gmelina apresentavam maior densidade e diversidade de ácaros do que as plantações de mandioca, tecas e pinheiros. Cada plantação tinha sua própria estrutura de comunidade, diferente da estrutura existente na SNR. A SNR e a Gmelina eram dominadas por ácaros criptostigmatidas detritívoros, diferentemente das plantações de tecas e pinheiros, que eram dominadas por predadores mesostigmatidas e prostigmatidas, respectivamente. As baixas densidades de criptostigmatidas nas plantações de mandioca eram vistas como conseqüência da baixa fertilidade do solo, demonstrada pelos dados do pH baixo e pelos dados da matéria orgânica.

  2. Mangrove oyster (Crassostrea rhizophorae (Guilding, 1928 farming areas as artificial reefs for fish: A case study in the State of Cear, Brazil

    Luiz Eduardo Lima de Freitas

    2006-03-01

    Full Text Available A type of platform, known as a table, is now being used for mangrove oyster farming. In Fortim, Cear, Brazil, this activity was begun in June 2000 and covers an area of 50 m overlying a sand-clay substrate. The present study has the following main objectives: to identify and catalogue the ichthyofauna colonizing the Crassostrea rhizophorae farming platforms; to evaluate ecological aspects, such as the possible correlation between the physical and chemical variables for water quality and the occurrence of the ichthyofauna; and to observe the differences in the fish species found during tidal variations. Specimens were identified and quantified using the linear-transect, visual census methodology. The ichthyofauna observed comprised 3,030 individuals belonging to 28 species and 20 families. Of the 28 species found in the area studied, 14 were marine transients, 12 marine dependent, and only 2 permanent residents. A significant association was observed between the abundance of 11 species and the physical and chemical variables studied. Based on these results, it may be concluded that the platforms act as artificial reefs for the ichthyofauna, being colonized by at least 28 species, and providing protection from predators as well as a source of food and a reproductive substrate.Um tipo de plataforma, conhecido como mesas, esto sendo utilizadas para o cultivo de ostras. Em Fortim, Cear, este cultivo teve incio em junho de 2000 e abrange uma rea total de 50m sobre um substrato argilo-arenoso. A presente pesquisa tem como objetivo identificar e catalogar a ictiofauna colonizadora das mesas de cultivo de ostras do mangue (Crassostrea rhizophorae, avaliar aspectos ecolgicos tais como as possveis correlaes de parmetros fsico-qumicos da gua com a ocorrncia da ictiofauna, alm de observar as diferenas na composio da mesma durante as variaes de mars. Os exemplares foram identificados visualmente e quantificados empregando-se a tcnica de censo visual por transecto de faixa. A ictiofauna avistada compreendeu 3.030 indivduos pertencentes 28 espcies e 20 famlias. Das 28 espcies encontradas na rea estudada, 14 so marinhas visitantes, 12 marinhas dependentes e apenas duas aparecem como residentes. Apenas 11 espcies apresentaram correlao com os parmetros fsico-qumicos estudados. Com base nestes resultados, pode-se afirmar que as estruturas de cultivo da ostra do mangue funcionam como um recife artificial para a ictiofauna, sendo colonizadas por, no mnimo, 28 espcies de peixes, podendo fornecer abrigo, proteo contra predadores, alimento e rea de reproduo.

  3. Short-term assessment of bt maize on non-target arthropods in Brazil Avaliação do efeito de milho bt sobre artrópodos não alvo no Brasil

    Odair Aparecido Fernandes

    2007-06-01

    Full Text Available Although not yet available for cultivation in Brazil, the effect of Bt maize hybrids on natural enemies and soil dwelling arthropods should be assessed prior to its release to growers. Trials were carried out during one growing season in two different locations with the genetically modified maize hybrids 7590-Bt11 and Avant-ICP4, comparing with their respective non-Bt isogenic hybrids. Arthropods were evaluated through direct observation on plants and pitfall traps. In general, no differences were observed between populations of earwig (Dermaptera: Forficulidae, lady beetles (Coleptera: Coccinellidae, minute pirate bug (Coleoptera: Anthocoridae, ground beetles (Carabidae, tiger beetles (Cicindelidae, and spiders (Araneae. There was no difference in egg parasitism of Helicoverpa zea (Boddie by Trichogramma sp. (Hymenoptera: Trichogrammatidae. Thus, Bt maize hybrids expressing insecticide proteins Cry1A(b and VIP 3A do not cause reduction of the main maize dweeling predators and parasitoids.Embora não haja cultivos comerciais de milho geneticamente modificado no Brasil, o efeito de híbridos de milho Bt sobre inimigos naturais e artrópodos de solo deve ser avaliado antes da liberação aos produtores. Assim, ensaios foram conduzidos durante uma safra em duas localidades. Os híbridos de milho modificado geneticamente 7590-Bt11 e Avant-ICP4 foram comparados com seus respectivos isogênicos não transgênicos. Os artrópodes foram avaliados através de observação direta nas plantas e armadilhas de alçapão. De modo geral, não se observaram diferenças entre as populações de tesourinha (Dermaptera: Forficulidae, joaninhas (Coleptera: Coccinellidae, percevejo-pirata (Coleoptera: Anthocoridae, carabídeos (Carabidae, cicindelídeos (Cicindelidae e aranhas (Araneae. Também não houve diferença no parasitismo de ovos de Helicoverpa zea (Boddie por Trichogramma sp. (Hymenoptera: Trichogrammatidae. Assim, milho geneticamente modificado expressando as proteínas inseticidas Cry1A(b e VIP 3A não causa redução nas populações dos principais predadores e parasitóides.

  4. LOS CONJUNTOS FAUNÍSTICOS PLEISTOCÉNICOS DE CUEVA LAS GUANACAS (REGIÓN DE AISEN, PATAGONIA CHILENA: ALCANCES TAXONÓMICOS Y TAFONÓMICOS THE PLEISTOCENE ARCHAEOFAUNA OF CUEVA LAS GUANACAS (REGIÓN DE AISEN, CHILEAN PATAGONIA: TAXONOMIC AND TAPHONOMIC IMPLICATIONS

    RAFAEL LABARCA E

    2008-11-01

    Full Text Available Este trabajo entrega los resultados de los análisis taxonómicos y tafonómicos efectuados a los conjuntos faunísticos de las capas más profundas del sitio cueva Las Guanacas (Región de Aisén. Se constata la presencia de ocho taxones mayores, cuatro de ellos extintos (Mylodon darwini Owen, Macrauchenia patachonica Owen, Hippidion saídiasi Roth y Camelidae indet. y cuatro que aún habitan el sector o sus alrededores (Hippocamelus bisulcus Molina, Pudú pudú Molina, Lama guanicoe Müller y Dusicyon culpaeus Molina. La evidencia tafonómica descarta una ocupación cultural temprana, apuntando en cambio a una utilización natural de la cueva por una o más especies adicionales, reconocibles a partir de distintas líneas de evidencia (etología de los predadores finipleistocénicos, taxones presentes, frecuencia de partes esqueletarias, modificaciones naturales. Se plantea que el principal agente responsable de la formación del conjunto faunístico de Las Guanacas habría sido un carnívoro (al menos un felino de tamaño medio, posiblemente Panthera onca Linnaeus, el que habría implementado distintas estrategias de obtención de las carcasas (caza y carroñeo hacia los 13.200 AP.The results of taxonomic and taphonomic analyses from the lowermost layers of the Cueva Las Guanacas archaeological site (XI Región, Chilean Central Patagonia are presented. Eight major taxa have been identified, among them four extinct (Mylodon darwini Owen, Macrauchenia patachonica Owen, Hippidion saídiasi Roth and Camelidae indet. and other four currently living on the valley or nearby áreas (Hippocamelus bisulcus Molina, Pudú pudú Molina, Lama guanicoe Müller y Dusicyon culpaeus Molina. The taphonomic analysis confirms the non-cultural nature of the early levéis and instead backs up the idea of non human predators occupying the cave. Resorting to many different lines of evidence (ethology of Pleistocene predators, observed taxonomic and skeletal profiles, gastric acid corrosión and other damages, it is claimed that the agent responsible for the Pleistocene/Holocene bone assemblage at cueva Las Guanacas were carnivores (including a mid-sized feline, possibly Panthera onca Linnaeus. These predators would have had deveoped several strategies to obtain the carcasses, including active hunt and scavenging around 13.200 BP.

  5. DESENVOLVIMENTO E REPRODUO DE PODISUS NIGRISPINUS (HETEROPTERA: PENTATOMIDAE ALIMENTADO COM LAGARTAS DE HELIOTHIS VIRESCENS (LEPIDOPTERA: NOCTUIDAE DEVELOPMENT AND REPRODUCTION OF PODISUS NIGRISPINUS (HETEROPTERA: PENTATOMIDAE FED ON HELIOTHIS VIRESCENS (LEPIDOPTERA: NOCTUIDAE CATERPILLARS

    Marcelo Curitiba Espindula

    2010-12-01

    Full Text Available Heliothis virescens (Fabr. (Lepidoptera: Noctuidae um inseto polfago amplamente distribudo no continente americano, onde o controle qumico a ttica mais utilizada. Os impactos de seu uso tornam necessria a busca de alternativas de manejo desse inseto-praga. Assim, este trabalho teve por objetivo avaliar o desenvolvimento e a reproduo de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae com lagartas de H. virescens, comparado alimentao com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. O experimento foi conduzido em sala climatizada a 25 1 C, 70 15% de umidade relativa e 14 horas de fotofase. O delineamento foi o inteiramente casualizado com 50 e 20 repeties nas etapas I e II, respectivamente. O desenvolvimento ninfal desse predador foi semelhante com essas presas, mas o nmero de posturas, ovos e ninfas por fmea, alm do intervalo entre posturas de P. nigrispinus apresentaram melhores resultados com T. molitor. Assim, P. nigrispinus apresentou desenvolvimento ninfal satisfatrio com lagartas de H. virescens, mas o sucesso reprodutivo foi melhor quando recebeu T. molitor como presa.Heliothis virescens (Fabr. (Lepidoptera: Noctuidae is a polyphagous insect widely distributed in the American continent, in which the use of chemical pesticides is the most common control strategy. The impacts caused by such practice make it necessary to seek alternatives for the management of this insect-pest. The objective of this work was to evaluate the development and reproduction of Podisus nigrispinus ( Dallas (Heteroptera: Pentatomidae fed on H. virescens caterpillars compared with those fed on Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae. The experiment was carried out in an acclimatized room 25 1 C, 70 15% relative humidity and photophase of 14 hours. The experiment was arranged in a complete randomized design with 50 and 20 repetitions at stages I and II, respectively. The nymphal development of this predator was similar with both prey, but the results for number of egg-layings, eggs and nymphs per female, as well as the interval between egg-layings of P. nigrispinus were better with T. molitor. In conclusion, P. nigrispinus showed satisfactory nymphal development with H. virescens caterpillars, but better reproductive success when it was fed on T. molitor prey.

  6. Behavioral changes in Rattus norvegicus experimentally infected by Toxocara canis larvae Alteraes de comportamento em Rattus norvegicus experimentalmente infectados por larvas de Toxocara canis

    Pedro P. Chieffi

    2010-10-01

    Full Text Available Toxocara canis is a common canine nematode parasite and one of its possible transmission mechanisms is the predation of infected rodents by canids. Fifty Rattus norvegicus were used to study behavioral alterations in rodents infected by T. canis larvae. The rats were divided into three groups: G1, 20 rats infected with 300 T. canis eggs; G2, 20 rats infected with 2,000 T. canis eggs; and G3, 10 non-infected rats. Thirty and 60 days post-infection, rats from all the groups were submitted to an open-field apparatus for five min and subsequently, to an elevated plus-maze apparatus, again for five min. The data obtained indicated improvement in mobility (total locomotion time and rearing frequency and exploratory behavior in infected rats, principally in G2, which provides some support for the hypothesis that behavioral alterations in rodents infected by Toxocara canis larvae enhance the transmission rate of this ascarid to dogs.Toxocara canis um nematdeo parasita habitual do intestino delgado de ces. Um dos mecanismos conhecidos de transmisso para ces representado pela predao de pequenos roedores que, como hospedeiros paratnicos albergam larvas de Toxocara canis em seus tecidos. Para avaliar a ocorrncia de alteraes de comportamento em roedores infectados por Toxocara canis 50 exemplares de Rattus norvegicus foram utilizados no experimento. Os animais foram divididos em trs grupos: G1 - 20 ratos infectados com 300 ovos de Toxocara canis; G2 - 20 ratos infectados com 2.000 ovos de Toxocara canis e G3 - 10 ratos sem infeco. Trinta e 60 dias aps a infeco avaliou-se a ocorrncia de alteraes comportamentais nos trs grupos submetendo os animais, primeiramente, a uma arena de campo aberto durante cinco minutos e, a seguir, a labirinto em cruz elevado por mais cinco minutos. Os resultados obtidos indicaram aumento significativo da mobilidade (tempo total de movimentao e nmero de vezes em que os animais se levantaram nas patas traseiras e comportamento exploratrio nos ratos infectados, principalmente nos pertencentes ao G2, sugerindo a ocorrncia de alteraes comportamentais que favoreceriam a transmisso de Toxocara canis para candeos por meio de relao presa-predador.

  7. Age-dependent fecundity of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) with sublethal doses of gammacyhalothrin

    Alexandre Igor Azevedo, Pereira; Francisco de Sousa, Ramalho; Catarina de Medeiros, Bandeira; Jos Bruno, Malaquias; Jos Cola, Zanuncio.

    2009-10-01

    Full Text Available Estudou-se o efeito estimulatrio de baixas concentraes de gamacihalotrin sobre Podisus nigrispinus (Dallas)(Heteroptera: Pentatomidae). As doses de gamacihalotrin estudadas foram: 23,4375, 11,7188, 5,8594, 2,9297, 1,4648, 0,7324 mg.litro-1 e gua (controle). Todas as doses estudadas de gamacihalo [...] trin reduziram o perodo de desenvolvimento do 3, 4 e 5 nstares de P. nigrispinus. A sobrevivncia e a longevidade do predador foram mais altas quando foi exposto a baixas doses. O perodo de oviposio de P. nigrispinus reduziu medida que foram aumentadas as doses de gamacihalotrin. A dose de 11,7188 mg.litro-1 de gamacihalotrin causou os mais curtos perodos de pr-oviposio e ps-oviposio. O intervalo entre posturas aumentou com a dose de 0,7324 mg.litro-1 de gamacihalotrin. A viabilidade de ovos no foi afetada pelo piretride. O nmero de ovos por postura, posturas por fmea, perodo de incubao e peso corpreo de fmea no foram afetados pelas doses testadas de gamacyhalotrin. Abstract in english Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) was exposed to gammacyhalothrin to study the stimulatory effect of low concentrations of this pyrethroid. The doses studied were 23.4375, 11.7188, 5.8594, 2.9297, 1.4648, 0.7324 mg.litre-1 and water, as control. The third, fourth, and fifth in [...] stars of P. nigrispinus were shorter with all the doses of this insecticide. The survival and longevity of this predator was highest with the lowest doses. The oviposition period of P. nigrispinus decreased as the doses increased. The lowest pre-and postoviposition periods were found with 11.7188 mg.litre-1 of gammacyhalothrin. The dose 0.7324 mg.litre-1 increased the clutch interval. The egg viability was similar between the treatments. The number of eggs per clutch, clutches per female, incubation period, and female body weight were not affected. The hormesis response could be used as a tool for IPM programs, allowing the manipulating parameters of this predator in synergism with this insecticide.

  8. Levantamento da fauna de Coleoptera que habita a carcaa de Sus scrofa L., em Curitiba, Paran / A study of the Coleoptera (Insecta) fauna that inhabits Sus scrofa L. carcass in Curitiba, Paran

    Kleber Makoto, Mise; Lcia Massutti de, Almeida; Maurcio Osvaldo, Moura.

    2007-09-01

    Full Text Available Este trabalho visou levantar a fauna de Coleoptera associada carcaa de Sus scrofa L.,1758, espcie utilizada como modelo em Entomologia Forense. O acrscimo ou a substituio seqencial das espcies de insetos pode ser utilizado para estimar o intervalo post mortem (IPM). O experimento foi realiz [...] ado no Centro Politcnico (UFPR), de setembro de 2005 a setembro de 2006. A cada estao foi sacrificado um suno de 15 kg no local, colocado em gaiola. A captura dos insetos foi realizada diariamente em bandeja posicionada abaixo da carcaa e em armadilha tipo Shannon modificada, e a cada 14 dias em cinco armadilhas do tipo pit-fall. Foram coletados 4.360 Coleoptera, pertencentes a 112 espcies de 26 famlias, 12 consideradas de importncia forense. A coleta ativa realizada na bandeja foi responsvel pela maior captura (2.023 espcimes), seguida pela armadilha Shannon modificada (2.016 espcimes) e por ltimo pelas do tipo pit-fall (324 espcimes). Staphylinidae foi mais coletada na bandeja e Shannon modificada, e Silphidae na armadilha pit-fall. Os principais hbitos encontrados foram predador/parasita (55%)e onvoro (38,05%), com poucas espcies consideradas necrfagas (1,31%). Abstract in english This paper sought to assess the Coleoptera fauna associated with carcasses of Sus scrofa L., 1758, which is usually used as model in Forensic Entomology. The addition and sequential substitution of insect species could be used to estimate the post mortem interval (PMI). The present study took place [...] in Centro Politcnico (UFPR), between september 2005 to september 2006. A pig weighting 15 kg was sacrificed each season and put inside a cage. Sampling is made daily in a tray placed below the carcass and in a Shannon modified trap, and each 14 days in five pit-fall traps. 4,360 beetles were collected, belonging to 112 species of 26 families, 12 were considered of forensic potential. The active collecting made in the tray was responsible for the largest number of beetles (2,023 specimens), followed by the modified Shannon trap (2,016 specimens) and by the pit-fall traps (324 specimens). Staphylinidae was more abundant in the modified Shannon trap, while Silphidae was more abundant in pit-fall traps. The main habits found are predator/parasite (55%) and omnivorous (38,05%), with only a few species considered necrophagous (1,31%).

  9. Araneofauna captured in the forest and adjacent area, in the north of Paraná, Brazil Araneofauna capturada na mata e área aberta adjacente, no norte do Paraná, Brasil

    Lizandra Lucy Catelli

    2008-10-01

    Full Text Available Arachnids make up an exclusive predator group. Eating habit makes the arthropods to move around in search for hunting or building traps with silk threads. In order to know the araneofauna of the Godoy’s Forest State Park, pitfall-like traps were installed inside the forest, edge and adjacent area predominantly grassy. Collections were carried out fortnightly, in the period of a year, separating what was collected during the day and during the night. One hundred and twenty-one individuals were collected, belonging to 18 families where Lycosidae and Theridiidae were the most abundant, although Lyniphiidae family has prevailed in the forest area. Young individuals prevailed. It is concluded that the highest frequency and abundance of young individuals may be directly related to its dispersal and spiders belonging to the Lycosidae, Zoridae and Theridiidae families, being able to be used as bioindicators. Os aracnídeos compõem um grupo exclusivamente predador. O hábito alimentar faz com que o artropoda locomova-se em busca da caça ou construa armadilhas com fios de seda. Buscando conhecer a araneofauna do Parque Estadual Mata dos Godoy, foram instaladas armadilhas tipo ptiffal dentro da mata, borda e área adjacente, com vegetação predominantemente formada por gramíneas. As coletas eram realizadas quinzenalmente, no período de um ano, separando o coletado em diurno e noturno. Foram coletados 121 indivíduos, pertencentes a 18 famílias, das quais as famílias Lycosidae e Theridiidae foram as mais abundantes, embora a família Lyniphiidae tenha predominado na área de mata. Houve maior freqüência de indivíduos jovens. Conclui-se que a maior freqüência e abundância de indivíduos jovens pode estar diretamente relacionada a sua dispersão e, além disso, as aranhas pertencentes as famílias Lycosidae, Zoridae e Theridiidae, podem ser utilizadas como bioindicadores.

  10. Insecticide effects of Ruta graveolens, Copaifera langsdorffii and Chenopodium ambrosioides against pests and natural enemies in commercial tomato plantation = Ação inseticida de Ruta graveolens, Copaifera langsdorffii e Chenopodium ambrosioides sobre pragas de tomate

    Flávia Silva Barbosa

    2011-01-01

    Full Text Available The aim of this study was to evaluate the insecticide effect of watery leaf extracts of Ruta graveolens (Rutaceae, alcoholic leaf extracts of Copaifera langsdorffii (Caesalpinaceae and Chenopodium ambrosioides (Chenopodiaceae in the concentration of 5% under field conditions. The experiment design was randomized blocks with six replications. The parcels treated with plant extracts showed reduction in the population of pests when compared with the controlparcels. The extract elaborated with C. langsdorffii presented greater insecticidal effect under Bemisia tabaci (Hemiptera: Aleyrodidae and sum of pests. It was verified that after 24 hours ofspraying, the parcels treated with the extract of C. ambrosioides presented minor numbers of adults of Tuta absoluta (Lepidoptera: Gelechiidae, followed by the parcels treated with extract of R.graveolens. There were smaller numbers of parasitoid eggs of epidopterans Trichogramma sp. (Hymenoptera: Trichogrammatidae and sum of natural enemies (predators + parasitoids in the parcels that had received spraying with extracts from the plants of C. langsdorffii and C. ambrosioides, followed by R. graveolens, compared to the control. There were a smaller number of parasitoids from the family Eulophidae (Hymenoptera attacking caterpillars of T. absoluta in plants treated with R. graveolens, followed by C. langsdorffii and C. ambrosioides than in the control.O objetivo deste trabalho foi avaliar o efeito inseticida dos extratos aquosos de folhas de Ruta graveolens (Rutaceae e alcoólicos de folhas de Copaifera langsdorffii (Caesalpinaceae e de folhas de Chenopodium ambrosioides (Chenopodiaceae a 5%. O experimento foi em blocos casualizados com seis repetições. As parcelas tratadas tiveram redução na população de pragas, quando comparadas às parcelas sem nenhum tratamento. O extrato elaborado com C. langsdorffii apresentou maior efeito inseticida em Bemisia tabaci (Hemiptera: Aleyrodidae e soma das pragas. Verificou-se que após 24h de pulverização, as parcelas tratadas com o extrato de C. ambrosioides apresentaram menores números de adultos de Tuta absoluta (Lepidoptera: Gelechiidae seguido pelas parcelas tratadas com extrato de R. graveolens. Foram observados menores números do parasitoide de ovos de lepidópteros Trichogramma sp. (Hymenoptera: Trichogrammatidae e da soma dos inimigos naturais (predadores + parasitoides nos tratamentos que receberam as pulverizações com os extratos das plantas de C. langsdorffii e C. ambrosioides seguido por R. graveolens do que na testemunha; do parasitoide da família Eulophidae (Hymenoptera, que atacam lagartas de T. Absoluta em plantas tratadas com R. graveolens, seguido por C. langsdorffii e C. ambrosioides do que na testemunha.

  11. Chemical defense of Hymeniacidon heliophila (Porifera: halichondrida against tropical predators

    Suzi Meneses Ribeiro

    2010-12-01

    Full Text Available Various benthic organisms have chemical defenses which reduce their predators' consumption. Although their efficiency may be noticed in many organisms, many of their effects are not well- known yet. Multiple ecological roles of secondary metabolites are shown in some sponges, which may represent an adaptative advantage considering the high amount of energy used to produce these chemical compounds. The goal of this work was to investigate the defensive property of the extracts from the sponge Hymeniacidon heliophila against the tropical predators: hermit crabs (Calcinus tibicens, sea urchins (Lytechinus variegatus and generalist fishes. Extracts obtained with n-hexane, ethyl acetate and acetone/methanol were used in assays and all of them were effective in reducing the consumption by C. tibicens; n-hexane extract reduced the consumption by L. variegatus; and medium polarity extracts reduced fish consumption. Either the variation in action or the multiple ecological roles of the extracts indicates that different types of compounds can be associated to the defensive system produced by H. heliophila.Diversos organismos bênticos possuem defesas químicas que ajudam a diminuir a predação. Embora sua eficácia seja comprovada, muitos de seus efeitos são ainda desconhecidos. Múltiplas funções dos metabolitos secundários foram evidenciadas em algumas esponjas e isso pode representar uma vantagem adaptativa, considerando o alto valor energético gasto pelas espécies para produzí-los. O objetivo desse trabalho foi investigar as propriedades defensivas de extratos da esponja Hymeniacidon heliophila contra predadores tropicais: paguros (Calcinus tibicens, ouriços-do-mar (Lytechinus variegatus e peixes generalistas. Extratos em n-hexano, acetato de etila e acetona/metanol foram usados nos ensaios e todos foram eficientes na redução do consumo por C. tibicen; extratos em n-hexano reduziram o consumo por L. variegatus; e extratos de média polaridade reduziram o consumo por peixes. A variação na ação ou as funções ecológicas múltiplas dos extratos indicam que diferentes tipos de substâncias podem ser associadas ao sistema defensivo produzido por Hymeniacidon heliophila.

  12. Chemical composition of Ulvaria oxysperma (Ktzing bliding, Ulva lactuca (Linnaeus and Ulva fascita (Delile

    Mrcia de Pdua

    2004-03-01

    Full Text Available Chemical composition of three species of Chlorophyta, Ulva lactuca, Ulva fasciata and Ulvaria oxysperma, was determined. Ulvaria oxysperma showed humidity (16-20%, ash (17-31% dry-base, proteins (6-10%db, lipids (0.5-3.2%db, fibers (3-12%db and carbohydrates (46-72%db which corresponded to 192-270 kcal.100g-1 (wet-base. U lactuca (15-18%db and U fasciata (13-16%db revealed grades slightly higher for proteins, but with similar energetic contents (250-272 and 225-239 kcal.100g-1, respectively. Natural blades of U lactuca and of U fasciata were more rigid than blades of U oxysperma. Other native algae showed higher protein levels. Ulvaria sp could be cultivated on the cotton-nylon net without having significance competition from other algae or predators degradation. On the other hand, it was essential choose a place without destructive tide action. Cultivated Ulvaria sp showed similar chemical composition as that grown on natural substrates.A composio qumica de trs espcies de Chlorophyta foi determinada. Ulva lactuca se desenvolve em Guaraqueaba e Ulva fasciata na Ilha do Mel, enquanto que Ulvaria oxysperma se desenvolve nos dois ecossistemas. Umidade (16-20%, cinzas (17-31%, base seca, protenas (6-10%bs, lipdeos (0,5-3.2%bs, fibras (3-12%bs e carboidratos (46-72%bs para U.oxysperma correspondeu a 192-270 kcal.100g-1 (base mida. U.lactuca (15-18%bs e U.fasciata (13-16%bs mostraram teores levemente maiores para a protena, mas com contedos energticos similares (250-272 e 225-239 kcal.100g-1, respectivamente. As folhas in natura de U.lactuca e de U.fasciata eram mais rgidas do que as de U.oxysperma. Outras algas nativas apresentaram teores de protenas maiores. Ulvaria sp pode ser cultivada sobre redes, sem apresentar competio com outras algas ou ao significativa de predadores. Ulvaria sp cultivada apresentou composio qumica similar ao da Ulvaria sp crescida sobre substratos naturais. essencial escolher um local protegido da ao destrutiva da mar.

  13. Contribuio da fauna silvestre em projetos de restaurao ecolgica no Brasil Contribution of the wildlife in ecological restoration projects in Brazil

    Wanuza Helena Campos

    2012-12-01

    Full Text Available O sucesso no processo de restaurao e manuteno da dinmica de um ecossistema extremamente dependente da capacidade das espcies em promover interaes interespecficas entre as diversas formas de vida. Estas interaes criam um cenrio favorvel restaurao ecolgica de ecossistemas degradados. Assim, por meio de reviso de literatura, o objetivo deste trabalho relatar a contribuio e utilizao dos diferentes grupos de animais na execuo de projetos de restaurao ecolgica no Brasil. As aves e mamferos frugvoros e tambm outros animais, como os rpteis, peixes e insetos, tm se destacado como ferramentas de auxlio aos projetos de restaurao ecolgica. As tcnicas para atrao de animais e consequente chegada de propgulos em um ecossistema degradado compreende a utilizao de poleiros, que servem de pouso e abrigo para a avifauna e morcegos, e a utilizao de abrigos artificiais, que servem para fuga de predadores, descanso e reproduo dos animais. De modo geral, estes estudos so excelentes ferramentas para gerir aes de manejo ambiental em ecossistemas degradados, possibilitando a recuperao da biodiversidade destes ambientes. The success in the process of restoration and maintenance of the dynamics of an ecosystem is highly dependent on the capacity of species to promote interspecific interactions among the various life forms. These interactions create a favorable environment for the ecological restoration of degraded ecosystems. Thus, by review the literature, the objective of this study is to report the contribution and use of different animal groups in carrying out ecological restoration projects in Brazil. The fruit-eating birds and mammals and also other animals such as reptiles, fish and insects have been highlighted as tools to aid environmental ecological restoration projects. Techniques for attracting animals and consequent arrival of seedlings in a degraded ecosystem comprises the use of perches, which serve as landing and shelter for birds and bats, and the use of artificial shelters, which serve to escape from predators, resting and reproduction of animals. In general, these studies are excellent tools for managing environmental management actions in degraded ecosystems, enabling the recovery of biodiversity in these environments.

  14. Age-dependent fecundity of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae with sublethal doses of gammacyhalothrin

    Alexandre Igor Azevedo Pereira

    2009-10-01

    Full Text Available Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was exposed to gammacyhalothrin to study the stimulatory effect of low concentrations of this pyrethroid. The doses studied were 23.4375, 11.7188, 5.8594, 2.9297, 1.4648, 0.7324 mg.litre-1 and water, as control. The third, fourth, and fifth instars of P. nigrispinus were shorter with all the doses of this insecticide. The survival and longevity of this predator was highest with the lowest doses. The oviposition period of P. nigrispinus decreased as the doses increased. The lowest pre-and postoviposition periods were found with 11.7188 mg.litre-1 of gammacyhalothrin. The dose 0.7324 mg.litre-1 increased the clutch interval. The egg viability was similar between the treatments. The number of eggs per clutch, clutches per female, incubation period, and female body weight were not affected. The hormesis response could be used as a tool for IPM programs, allowing the manipulating parameters of this predator in synergism with this insecticide.Estudou-se o efeito estimulatrio de baixas concentraes de gamacihalotrin sobre Podisus nigrispinus (Dallas(Heteroptera: Pentatomidae. As doses de gamacihalotrin estudadas foram: 23,4375, 11,7188, 5,8594, 2,9297, 1,4648, 0,7324 mg.litro-1 e gua (controle. Todas as doses estudadas de gamacihalotrin reduziram o perodo de desenvolvimento do 3, 4 e 5 nstares de P. nigrispinus. A sobrevivncia e a longevidade do predador foram mais altas quando foi exposto a baixas doses. O perodo de oviposio de P. nigrispinus reduziu medida que foram aumentadas as doses de gamacihalotrin. A dose de 11,7188 mg.litro-1 de gamacihalotrin causou os mais curtos perodos de pr-oviposio e ps-oviposio. O intervalo entre posturas aumentou com a dose de 0,7324 mg.litro-1 de gamacihalotrin. A viabilidade de ovos no foi afetada pelo piretride. O nmero de ovos por postura, posturas por fmea, perodo de incubao e peso corpreo de fmea no foram afetados pelas doses testadas de gamacyhalotrin.

  15. Ontogenetic allometry in the foot size of Oligoryzomys flavescens (Waterhouse, 1837) (Rodentia, Sigmodontinae) / Alometria ontogentica no tamanho dos ps em Oligoryzomys flavescens (Waterhouse, 1837) (Rodentia, Sigmodontinae)

    R., Maestri; R., Fornel; TRO., Freitas; JR., Marinho.

    2015-05-01

    Full Text Available A alometria ontogentica estuda como o tamanho ou forma de determinada estrutura muda ao longo do desenvolvimento. Neste estudo, atravs da frmula do crescimento alomtrico de Huxley (1932), acessamos as variaes na taxa de crescimento do tamanho dos ps do roedor sigmodontineo Oligoryzomys flaves [...] cens, ao longo de sua ontogenia e entre machos e fmeas. Ns encontramos evidncia de uma mudana de polaridade ontogentica ao longo do desenvolvimento da espcie, com presena de alometria positiva na fase gestacional, e alometria negativa na fase adulta. Alm disso, constatamos a presena de dimorfismo sexual no tamanho dos ps, onde machos da espcie apresentam uma maior taxa de crescimento nesta caracterstica em comparao com as fmeas. Esse padro de crescimento deve estar positivamente relacionado com a fuga de predadores na infncia em ambos os sexos, e na vida adulta propicia uma maior taxa de encontro de fmeas pelos machos, devido ao maior deslocamento destes ltimos. Sugerimos que tanto as foras da seleo natural quanto da seleo sexual tem atuado para moldar a evoluo do tamanho dos ps nesta espcie. Abstract in english Ontogenetic allometry is the study of how the size or shape of certain structures changes over the course of an animals development. In this study, using Huxley's formula of allometric growth (1932), we assessed the changes in the rate of growth of the feet size of the sigmodontine rodent Oligoryzo [...] mys flavescens during its ontogeny and compared differences between males and females. We find evidence of a change of polarity during the ontogenetic development of the species, with the presence of positive allometry during pregnancy and negative allometry in adulthood. Moreover, we note the presence of sexual dimorphism in the size of the feet, in which males of the species have a higher rate of growth than females. This growth pattern is positively related to escape from predators in childhood in both sexes and, in adulthood, provides a higher encounter rate of females by males, due to the larger displacement of the latter. We suggest that both the forces of natural selection and sexual selection have acted to shape the evolution of foot size in this species.

  16. EFECTO DEL MANEJO AGROECOLÓGICO Y CONVENCIONAL SOBRE LA FLUCTUACIÓN DE BABOSA EN CULTIVOS DE LECHUGA EN TENJO CUNDINAMARCA EFFECTS OF AGROECOLOGICAL AND CONVENTIONAL HANDLING IN SLUG POPULATIONS IN LETTUCE IN TENJO CUNDINAMARCA

    Cindy Alexandra Córdoba Vargas

    Full Text Available En una finca ecológica (FE y una convencional (FC se comparó el comportamiento de poblaciones de babosas y su relación con algunos carábidos predadores, la presencia de arvenses, prácticas agrícolas y la productividad de cuatro variedades de lechuga (Lactuca sativa. L.. Semanalmente se realizaron capturas de babosas, conteos de nivel de daño, altura y número de hojas en 10 plantas. Se recolectaron arvenses y coleópteros en las dos fincas. Los conteos totales de babosas en la FE fueron estadísticamente superiores. Se colectaron cuatro especies (Deroceras. reticulatum, Milax gagates, Deroceras. laeve y Limax. maximux frente a dos encontradas en FC. Con excepción de la variedad "Morada Lisa", no se encontraron diferencias significativas en el nivel de daño en las otras variedades entre las dos fincas, pero sí en la variable peso seco de FE. En FE se presentaron 5 especies de carábidos y 25 de arvenses frente a ninguna y 6 en FC, respectivamente. Los datos anteriores se explican en función de las prácticas agronómicas de cada sistema de manejo.In an organic (FE and a conventional (FC farm system the population behavior of slugs and their relationship with some carabids predators was compared, as well as, the presence of weeds, agricultural practices and productivity of four varieties of lettuce. Weekly catches of slugs were made and the damage level, height and the number of leaves in ten plants was measured. Weeds and carabids were collected in both farms. The total number of slugs in the FE was statistically higher and four species (D. reticulatum, Milax gagates, D. and L. laev maximux were collected compared with two found in FC. With the exception of the variety "Morada Lisa", there were no significant differences in the level of damage in the other varieties between the two farms. There were significant differences in the dry weight variable in favour of the organic farm. In FE, 5 carabids species and 25 weeds were presented compared to none in FC and 6, respectively. The data above are explained in terms of the agronomic practices of each management system.

  17. The food spectrum of the cardinal - tetra (Paracheirodon axelrodi, Characidae in its natural habitat Estratégias alimentares do cardinal-tetra (Paracheirodon axelrodi, Characidae em seu ambiente natural

    Ilse Walker

    2004-01-01

    Full Text Available The cardinal tetra (Paracheirodon axelrodi is the most intensively commercialized ornamental fish from the Rio Negro Basin (Amazonas State, Brasil. Analysis of the stomach and gut contents of fish caught in their natural habitats show conclusively that the cardinal is essentially a predator, feeding on the mesofauna that adheres to submerged litter, roots and waterplants. Microcrustacea and chironomid larvae (Diptera were the most frequently ingested prey, while algae intake was relatively infrequent. It is argued that the relatively small size of the cardinals captured in their natural habitat is due to the annual migrations imposed by the inundation cycles, rather than to resource limitation, because it is known from earlier investigations of similar habitats, that these plant substrates are densely colonized by the aquatic mesofauna. Cardinals raised in captivity are larger and have higher rates of growth.O cardinal (Paracheirodon axelrodi é o peixe ornamental comercializado com maior intensidade na Bacia do Rio Negro (Estado do Amazonas, Brasil. Análise do conteúdo estomacal de peixes capturados nos seus habitats naturais mostra, que o cardinal é essencialmente um predador, alimentando-se da mesofauna que está colonizando a liteira submersa, arbustos submersos, raízes flutuantes e plantas aquáticas. As presas principais são microcrustáceos e larvas de quironomídeos (Chironomidae, Diptera, enquanto ingestão de algas é pouco freqüente. Considera-se que o tamanho relativamente pequeno de cardinais capturados nos ambientes naturais é devido as migrações anuais que acompanham os ciclos anuais de enchente e vazante, e não à falta de recursos; já que é conhecido de ambientes parecidos de outros rios da região, que estes substratos aquáticos são densamente colonizados pela mesofauna. Cardinais criados em cativeiros tem taxas de crescimento mais altas e são de tamanho maiores.

  18. Datos biolgicos de Doru luteipes (Dermaptera: Forficulidae en plantaciones de caa de azcar y consumo de huevos de Diatraea saccharalis (Lepidoptera: Crambidae en condiciones de laboratorio Biological traits of Doru luteipes (Dermaptera: Forficulidae in sugar-cane crops, and consumption rates against Diatraea saccharalis eggs (Lepidoptera: Crambidae under laboratory conditions

    Gladys M Romero Sueldo

    2009-12-01

    Full Text Available Diatraea saccharalis (Fabr. es considerada la principal plaga de la caa de azcar en el noroeste argentino. El dermptero Doru luteipes (Scudder desarrolla importantes poblaciones en dicho cultivo y ha sido descrito como predador de plagas en maz, algodn y coles. El objetivo de este trabajo fue brindar informacin sobre algunos aspectos biolgicos y estimar la capacidad de predacin de las ninfas de Doru luteipes, a travs de la tasa de consumo de huevos de Diatraea saccharalis. Se realizaron observaciones de campo y ensayos de laboratorio, en estos ltimos se colocaron individualmente en tubos de ensayo, 50 ninfas de D. luteipes recin eclosionadas y se les ofreca diariamente cien huevos de la plaga. La proporcin de sexos de D. luteipes en campo fue de aproximadamente 1:1 y sus posturas presentaron una media de 31 huevos, con una tasa de emergencia cercana al 95%. El perodo de incubacin se prolong entre 6 y 10 das y el desarrollo de los estadios ninfales promedi los 37,6 das. Las ninfas pasaron por cuatro estadios y consumieron una media de 591,3 huevos de D. saccharalis. Estos resultados sugieren que D. luteipes desempea un papel importante en el control natural de las poblaciones de D. saccharalis, por lo tanto, su presencia debera tenerse en cuenta al disear estrategias para controlar esta plaga.Diatraea saccharalis (Fabr. is considered the key pest of sugarcane crops in the Argentine northwest. The earwig Doru luteipes (Scudder develops high populations on sugarcane, and in other regions it was depicted as a significant predator of diverse pest in corn, cotton, and cabbage crops. The aim of this contribution is to inform about different biological parameters of this Dermaptera, and to assess the predatory capacity of its nymphs by means of the estimation of consumption rates using Diatraea saccharalis eggs. Both field and laboratory observations were carried out. In the latter, 50 neonate nymphs were confined in glass tubes and 100 sugarcane borer eggs were provided daily. Information on different behavioral aspects is provided. In field conditions, the sex proportion is approximately 1:1; an average of 31 eggs were laid, and the emergence rate reached 95%. Egg incubation is complete within a range of 6-10 days, and pre-imaginal development has a mean duration of 37.6 days. Throughout the four nymphal instars, a single individual could consume an average of 591.3 sugarcane borer eggs. The potential implication of the given information in applied sugarcane borer control methodologies is discussed.

  19. Solapamiento trófico entre el lobo marino de un pelo Otaria flavescens y la pesquería de arrastre demersal del golfo San Matías, Patagonia, Argentina Trophic overlap between the South American sea lion Otaria flavescens and the demersal trawl fishery in San Matías Gulf, Patagonia, Argentina

    María Alejandra Romero

    2011-07-01

    Full Text Available A nivel internacional, paralelo a la declinación y al colapso de pesquerías de gran escala, surgió un interés creciente por el estudio de las interacciones entre mamíferos marinos y pesquerías. El golfo San Matías (Patagonia, Argentina es considerado un ecosistema pesquero independiente de las aguas de la Plataforma Continental Argentina, con condiciones oceanográficas y biológicas particulares. La condición de sistema semi-cerrado podría generar escenarios particulares para la interacción entre la flota pesquera de arrastre de fondo y la población de lobos marinos de un pelo Otaria flavescens. En el presente trabajo se caracterizó la dieta del predador y la composición de las capturas pesqueras a fin de evaluar el solapamiento trófico entre ambos componentes. A partir de este análisis y la comparación de las tallas de las presas consumidas, se encontró que la posibilidad de una interacción competitiva entre la flota pesquera y los lobos marinos, a partir de la utilización de recursos similares, sería baja en el ecosistema del golfo San Matías.As world fisheries began to decline and massive collapses were observed, the competition between marine mammals and fisheries became an issue of growing concern. San Matías Gulf (Patagonia, Argentina is considered to be a fishery ecosystem independent of the Argentine Continental Shelf waters, with particular oceanographic and biological properties. As a semi-enclosed ecosystem, this gulf may generate particular scenarios for interactions between the demersal trawl fishery fleet and the population of South American sea lions Otaria flavescens. In this paper, the diet of the top predator and the composition of fishery catches were characterized in order to assess the trophic overlap between these two components. This analysis and a comparison of the sizes of prey consumed revealed a low probability of competition for similar resources between the fishing fleet and the marine mammals in the San Matías Gulf ecosystem.

  20. Duração e viabilidade das fases pré-imaginais de Chrysoperla externa (Hagen alimentadas com Aphis gossypii Glover e Sitotroga cerealella (Olivier Duration and viability of Chrysoperla externa (Hagen pre-imago phases, fed with Aphis gossypii (Glover and Sitotroga cerealella (Olivier

    Luciano Pacelli Medeiros Macedo

    2002-05-01

    Full Text Available Estudou-se a duração e a viabilidade das fases imaturas de Chrysoperla externa (Hagen (Neuroptera, Chrysopidae alimentadas com o pulgão do algodoeiro, Aphis gossypii Glover (Homoptera, Aphididae, e com a traça do milho, Sitotroga cerealella (Olivier (Lepidoptera: Gelechiidae. A pesquisa foi conduzida no Laboratório de Entomologia da Embrapa - CNPA, em Campina Grande, Paraíba, em 1998/99 em condições controladas sob temperatura de 25±2ºC, 70±10% UR e fotofase de 12 horas. O desenvolvimento pré-imaginal de C. externa decorreu normalmente: fase larval com três ínstares, pré-pupa e pupa. De acordo com os resultados, pode-se concluir que as larvas de C. externa alimentadas com A. gossypii apresentam uma duração significativamente maior para o primeiro e terceiro ínstares, que às alimentadas com S. cerealella. Entretanto, não há efeito dessas presas na viabilidade das fases desse predador, exceto para a de pré-pupa. C. externa pode ser criado em A. gossypii ou S. cerealella sem risco de perda de viabilidade, embora algumas fases possam ser mais longas.This work was carried out at the Laboratório de Entomologia da Embrapa - CNPA, in Campina Grande, state of Paraíba, Brazil, in 1998/99, to study the duration and viability of Chrysoperla externa (Hagen (Neuroptera, Chrysopidae larvae, fed with Aphis gossypii (Homoptera, Aphididae and Sitotroga cerealella (Lepidoptera: Gelechiidae, under controlled conditions. The temperature was 25+-2º C, 70+-10% UR and 12-hour photophase. The C. externa pre-imaginal development was normal: larval phase with three instars, pre-pupa and pupa. The results showed that C. externa larvae fed on A. gossypii had a first and third instar longer than the ones fed with S. cerealella. However, no effect was observed in the phases' viability, excepting the pre-pupa. C. externa can feed on both preys without viability loss, although this may enhance some phases' duration.

  1. Predação de sementes de plantas daninhas em áreas cultivadas Weed seeds predation in cultivaded fields

    Alvadi Antonio Balbinot Jr.

    2002-08-01

    Full Text Available Na investigação das relações ecológicas entre as espécies, observou-se que certos animais, principalmente insetos, alimentavam-se de sementes de plantas daninhas antes e depois da sua deiscência, reduzindo a entrada de sementes no banco de sementes do solo e, portanto, a quantidade total de propágulos disponíveis à germinação. Em situações favoráveis à atividade dos predadores, o consumo de sementes pode ser significativo, chegando a 90% do total de sementes produzidas. Esse processo depende, basicamente, das condições de ambiente e das práticas de manejo adotadas, como: método de preparo do solo, espécie cultivada, densidade e espaçamento da cultura e também do tamanho da lavoura. Deste modo, a predação de sementes pode ser uma ferramenta natural importante para o manejo integrado de plantas daninhas. Todavia são necessários estudos com maior consistência dos fatores envolvidos na regulação do processo de consumo de sementes para elucidação e orientação de práticas culturais que maximizem a intensidade de ocorrência desta forma biológica de manejo de infestantes.In investigating ecological relations among species, it has been observed that various animals, mainly insects, feed on weed seeds before and after their dehiscence, reducing seed replenishment in the soil and total amount of propagules available for future germination. Under favorable conditions for predation activity, consumption of seeds can be quite high, reaching as much as 90% of total seeds produced. This process depends, basically, on environmental conditions and on management practices adopted, as soil preparation method, crop species, crop density and spacing, and on the size of cultivated area. Therefore, seed predation is an important natural tool to be used in integrated weed management. Nevertheless, seed predation requires additional studies in order to elucidate more consintently the factors involved in the regulation of seed consumption process, and through this elucidation, to guide adoption of cultural practices which could increase occurrence intensity of this biological method of weed management.

  2. Total mercury in the night shark, Carcharhinus signatus in the western equatorial Atlantic Ocean

    Alexandre Gomes Ferreira

    2004-08-01

    Full Text Available Mercury is the only element capable to biomagnificate along the food chain, and carnivorous fish tend to accumulate high concentrations of this element. Total mercury in muscle tissue of Carcharhinus signatus sampled along the western equatorial Atlantic Ocean was measured by atomic emission spectrophotometry with ICP/AES. The average total mercury concentrations were consistently greater than the maximum limit for human consumption established by the Brazilian Health Ministry for carnivorous fishes (1000 µg. kg-1 w.w.. Therefore, an average consumption of 0.1 kg/day of C. signatus would result in an average daily ingestion of 174.2 µg of Hg, more than five times the 30 µg/day intake established by the World Health Organization. In the range of lengths studied, body length could not be used as an indicator of the Hg contamination degree for C. signatus. Also, sex cannot be considered a determining factor in the total mercury accumulation in C. signatus.O mercúrio (Hg é o único metal que comprovadamente biomagnifica através da cadeia alimentar, e sendo assim, espécies de peixes predadores tendem a apresentar altas concentrações deste metal. Porções de tecido muscular de C. signatus coletados na região oeste equatorial do oceano Atlântico foram submetidas a extração ácida e tiveram a concentração de mercúrio determinada com acessório gerador de vapor a frio acoplado a um ICP-AES. A concentração média de Hg apresentou valores acima do limite máximo permissível para consumo humano estabelecido pela legislação brasileira (1000 µg.kg-1 de peso úmido. Conseqüentemente, um consumo médio de 0,1 kg.dia-1 de C. signatus resultaria numa ingestão media de 174,2 µg de Hg, mais de cinco vezes o consumo máximo de 30 µg.dia-1 estabelecido pela Organizacao Munidal da Saúde. Dentro das classes de tamanho analisadas, o comprimento total não pode ser utilizado como indicador do grau de contaminação por mercúrio em C. signatus. Ainda, o sexo não pode ser considerado um fator determinante na acumulação total de mercúrio em C. signatus.

  3. Seletividade de Lecanicillium lecanii e Metarhizium anisopliae para larvas de primeiro nstar de Ceraeochrysa cincta (Neuroptera: Chrysopidae em laboratrio = Selectivicty of Lecanicillium lecanii and Metarhizium anisopliae for Ceraeochrysa cincta first instar larvae (Neuroptera: Chrysopidae in laboratory

    Eliane Ribeiro Cardoso

    2007-10-01

    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos fungos Lecanicillium lecanii e Metarhizium anisopliae para larvas de Ceraeochrysa cincta, utilizando-se a aplicao por imerso e aaplicao em bases de vidro, formando filme seco (IOBC modificado. Nos dois mtodos, foram aplicados os tratamentos: 1 - L. lecanii; 2 - M. anisopliae - 2.1x107 condios viveis mL-1; 3 - soluo de Tween 80 a 0,05% como testemunha. Avaliou-se a mortalidade, durao mdiado perodo larval, fecundidade e a viabilidade dos ovos. Todos os insetos mortos foram submetidos assepsia, para confirmao da mortalidade causada pelo fungo. Em ambos os bioensaios, as mortalidades confirmadas pelos fungos foram iguais a zero. No filme seco o efeito total dos fungos sobre o predador foi classificado como pouco nocivo de acordo com as categorias propostas pelo mtodo IOBC. L. lecanii e M. anisopliae no afetaram a viabilidade dos ovos de C. cincta, quando aplicados por imerso. Na concentrao que foi estabelecida para a realizao dos bioensaios, os fungos entomopatognicos L. lecanii e M. anisopliae foram seletivos para larvas de 1o nstar de C. cincta.This paper aimed to evaluate the selectivity of the fungi Lecanicillium lecanii and Metarhizium anisopliae for Ceraeochrysa cincta. Two bioassays were developed: 1st application of dry filmproposed by the International Organization for Biological Control IOBC (modified - they were applied in glass bases, forming dry film. 2nd immersion application. In the two methods, the following treatments were applied: 1- watery suspension of L. lecanii; 2- the same for M. anisopliae (both at 2.1x107 viable conidia mL-1; and 3- Tween 80 0.05% watery solution. The larvae mortality, the average duration of the larvae period, the females fecundity and the eggsviability were evaluated. All the dead insects were submitted to asepsis to confirm the mortality caused by the fungi. In both bioassays, the mortality caused by the fungi was not verified. In the bioassay dry film, the fungi total effect on the predator was classified as not very harmful according to the categories proposed by the IOBC method. L. lecanii and M. anisopliae did not affect the viability of C. cincta eggs, when applied by immersion. In theestablished concentration for the accomplishment of the bioassays, entomopatogenic fungi L. lecanii and M. anisopliae were selective for first instar larvae of C. cincta.

  4. INTEGRACIÓN DE CONTROL BIOLÓGICO Y DE PRODUCTOS ALTERNATIVOS CONTRA Tetranychus urticae (ACARI: TETRANYCHIDAE INTEGRATION OF BIOLOGICAL CONTROL AND ALTERNATIVE PRODUCTS AGAINST Tetranychus urticae (ACARI: TETRANYCHIDAE

    Alberto Soto

    Full Text Available Tetranychus urticae es una importante plaga asociada al cultivo de fresa debido a las altas densidades poblacionales alcanzadas y a los daños ocasionados a las plantas. Los productores utilizan acaricidas en grandes volúmenes sin cumplir los periodos de carencia, ocasionando residuos tóxicos en los frutos, desarrollo de poblaciones resistentes a los productos, destrucción de organismos benéficos, intoxicación de mamíferos y contaminación del medio ambiente. Por lo tanto, es necesario generar otras alternativas de manejo de este ácaro plaga. El objetivo de este trabajo fue evaluar, mediante el análisis conjunto de la concentración letal y subletal, la acción tóxica de productos comerciales a base de nim sobre los ácaros T. urticae y Phytoseiulus macropilis. Fueron controladas poblaciones de T. urticae en plantas de fresa cuando se emplearon concentraciones correspondientes a CL95 de los productos alternativos a base de nim, y también cuando se utilizaron concentraciones inferiores. La aplicación de los productos a base de nim, Neem Pro, Organic Neem y Natuneem en la CL95 y cuando la tasa instantánea de crecimiento poblacional ri=0,1 para el predador representan una alternativa viable para el control del ácaro fitófago T. urticae.Tetranychus urticae is an important pest associated with strawberry, due to its high densities and plant damage. Farmers use acaricides in large volumes without complying with the window between the last application and harvest, resulting on toxic residues in fruits, as well as pest populations resistant to pesticides, decrement of beneficial organisms, mammalian toxicity and environmental pollution. Therefore, it is necessary to generate new alternatives for the control of this mite. The aim of this work was to evaluate the toxic effect of commercial neem-based products on the mites T. urticae and Phytoseiulus macropilis, through a combined analysis using both, lethal and sublethal concentrations. Tetranychus urticae populations were controlled in strawberry plants when neem was used at or below LC95 concentrations. The application of the neem-based products, Neem Pro, Organic Neem and Natuneem at CL95, and when the instantaneous predator’s rate of population increase ri = 0.1, represents a viable alternative to be considered for the control of the phytophagous mite T. urticae.

  5. Long-term ecological research in the forests of the United States: Key lessons for its application in Chile and around the world Estudios ecolgicos de largo plazo en bosques de Estados Unidos: Lecciones claves para su aplicacin en Chile y otras regiones

    JERRY F FRANKLIN

    2010-03-01

    Full Text Available Long-term ecological research addresses questions to which short-term research projects cannot effectively respond because of the temporal scales over which many ecosystem processes operate. In North America, this type of research has yielded important information on key processes and organisms in many forest types, from eastern broadleaf forests to the coniferous forests of the west, and from tropical to boreal latitudes. Long-term ecological research (that conducted at the decade scale or longer in the forests of North America has included watershed studies, silvicultural trials, establishment of permanent plots to assess forest demographics, and the study of disturbance regimes and predator-prey systems. Instituting such research in forest ecosystems of other regions of the world, especially at corresponding latitudes on either side of the equator, will help scientists understand patterns of natural disturbance and succession, the effects of alternative management strategies, and the impacts of climate change. Key recommendations based on North American long-term ecological research include: 1 the importance of multidisciplinary research, 2 the need to invest in data storage and management, 3 the deployment of both basic and advanced technology (e.g., eddy covariance systems, and 4 development of collaboration networks among regions, institutions, and individual researchers.La investigacin ecolgica de largo plazo es capaz de abordar ciertas preguntas de una manera mejor que los proyectos de corto plazo, debido a las escalas temporales en que funcionan muchos procesos ecolgicos. En Norteamrica, este tipo de investigacin ha brindado conocimiento sobre importantes procesos y organismos claves en muchos tipos forestales, extendindose desde los bosques caducifolios de la costa este a los bosques de coniferas en la costa oeste, y en latitudes tropicales hasta boreales. La investigacin ecolgica de largo plazo en los bosques de Norteamrica ha incluido estudios de cuencas, ensayos silviculturales, establecimiento de parcelas permanentes para investigar demografa forestal, y el estudio de regmenes de perturbacin y sistemas predadores/presa. El inicio de investigacin de largo plazo en ecosistemas forestales de otras regiones del mundo, especialmente en latitudes correspondientes a ambos lados del ecuador, ayudar a los cientficos a comprender los regmenes de perturbaciones naturales y sucesin, as como los efectos de varias estrategias del manejo forestal, y los impactos de cambio climtico. Recomendaciones claves basadas en la experiencia de Norteamrica incluyen: 1 la importancia de la investigacin multidisciplinaria, 2 la necesidad de invertir recursos en el manejo de bases de datos, 3 la aplicacin tanto de tecnologa bsica como avanzada (por ejemplo, sistemas de deteccin de eddy covariance para cuantificar el intercambio de carbono entre los bosques y la atmsfera, y 4 colaboracin entre regiones, instituciones, y cientficos individuales.

  6. Mites fluctuation population on peach tree (Prunus persica (L. Batsch and in associated plants Flutuação populacional de ácaros na cultura do pessegueiro (Prunus persica (L. Batsch e em plantas associadas

    Carla Rosana Eichelberger

    2011-09-01

    Full Text Available Despite the importance of peach (Prunus persica (L. Batsch in Rio Grande do Sul, little is known about mites fluctuation population considered important to this crop. The objective of this study was to know the population diversity and fluctuation of mite species associated with Premier and Eldorado varieties in Roca Sales and Venâncio Aires counties, Rio Grande do Sul. The study was conducted from July 2008 to June 2009 when 15 plants were randomly chosen in each area. The plants were divided in quadrants and from each one a branch was chosen from which three leaves were removed: one collected in the apical region, another in the medium and the other in the basal region, totalizing 180 leaves/area. Five of the most abundant associated plants were collected monthly in enough amounts for the screening under the stereoscopic microscope during an hour. A total of 1,124 mites were found belonging to 14 families and 28 species. Tetranychus ludeni Zacher, 1913, Panonychus ulmi (Koch, 1836 and Mononychellus planki (McGregor, 1950 were the most abundant phytophagous mites, whereas Typhlodromalus aripo Deleon, 1967 and Phytoseiulus macropilis (Banks, 1904 the most common predatory mites. The period of one hour under stereoscopic microscope was enough to get a representative sample. In both places evaluated the ecologic indices were low, but little higherin Premier (H' 0.56; EqJ: 0.43 when compared to Eldorado (H' 0.53; EqJ 0.40. In Premier constant species were not observed and accessory only Brevipalpus phoenicis (Geijskes, 1939, T. ludeni and T. aripo. Higher abundance was observed in December and January and bigger amount in April. Already in Eldorado, T. ludeni and P. ulmi were constants. Greater abundance was observed in November and December, whereas grater richness in December and January. In both orchards were not found mites in buds. Tetranychus ludeni is the most abundant phytophagous mites with outbreak population in November, December and January and high predator diversity was observed on associated plants and on peach plants, indicating the existence of species mobility in peach orchard.Apesar da grande importância da cultura do pêssego [Prunus persica (L. Batsch] no Rio Grande do Sul, pouco se conhece sobre a diversidade e a flutuação populacional de ácaros considerados importantes para esta cultura. O objetivo deste trabalho foi conhecer a flutuação populacional das espécies acarinas associadas às cultivares Premier e Eldorado nos municípios de Roca Sales e Venâncio Aires, Rio Grande do Sul. O estudo foi realizado no período de julho de 2008 a junho de 2009, quando foram amostradas 15 plantas escolhidas ao acaso numa área em cada município. As plantas foram divididas em quadrantes, e de cada quadrante foi escolhido um galho de onde foram retiradas três folhas das regiões apical, mediana e basal, totalizando 180 folhas/área. Foram coletadas, mensalmente, parte de cinco plantas não cultivadas mais abundantes. O período de uma hora sob microscópio estereoscópio foi suficiente para se obter uma amostra representativa. Um total de 1.124 ácaros foi coletado pertencentes a 14 famílias e 28 espécies. Tetranychus ludeni Zacher, 1913, Panonychus ulmi (Koch, 1836 e Mononychellus planki (McGregor, 1950 foram os ácaros fitófagos mais abundantes, enquanto Typhlodromalus aripo Deleon, 1967 e Phytoseiulus macropilis (Banks, 1904 os ácaros predadores mais comuns. O esforço amostral foi suficiente. Nos dois pomares avaliados, os índices ecológicos foram baixos, mas um pouco superiores em Premier (H' 0,56; EqJ: 0,43 quando comparados a Eldorado (H' 0,53; EqJ 0,40. Em Premier não foram observadas espécies constantes, apenas acessórias com Brevipalpus phoenicis (Geijskes, 1939, T. ludeni e T. aripo. Maior abundância foi observada em dezembro e janeiro, e maior quantidade em abril. Em Eldorado, T. ludeni e P. ulmi foram constantes. Maior abundância foi observada em novembro e dezembro, e maior quantidade em dezembro e janeiro. Não foram observados ácaros nas gemas. Tetranychus ludeni é o ácaro fitófago mais comum, com picos populacionais em novembro, dezembro e janeiro. Alta diversidade de ácaros predadores foi observada tanto em plantas associadas como em plantas de pessegueiro, indicando mobilidade das espécies predadoras na cultura.

  7. Dispersão e predação de sementes de araticum no Cerrado de Mato Grosso, Brasil Dispersal and predation of araticum seeds in the Cerrado of Mato Grosso, Brazil

    Vanessa Golin

    2011-01-01

    Full Text Available Este estudo objetivou caracterizar plantas e frutos de araticum (Annona crassiflora, avaliar a frequência de consumo, predação e dispersão de suas sementes por animais e seus efeitos na germinação, em área de Cerrado, entre fevereiro de 2007 a junho de 2008. Baseado em armadilhas de pegadas, registrou-se a frequência de visitação (FV e o consumo de frutos por animais, além da ação de insetos em frutos caídos no solo, sob as plantas. Estrumes de antas, Tapirus terrestris, foram amostrados para verificar a frequência de ocorrência (FO e os danos causados por elas e por insetos. Para analisar a dispersão por antas, foram inseridas miçangas coloridas em frutos maduros caídos sob plantas-mãe. Posteriormente, foi medida a distância entre o local das fezes com miçanga até a planta-mãe da cor específica da miçanga. Realizou-se teste de germinação com sementes de amostras fecais e de frutos intactos. Dentre os animais que se alimentaram dos frutos, antas contribuíram com maior frequência de visitação e consumo de frutos de araticum, o qual representou 54% de frequência de ocorrência nas amostras fecais e as sementes não foram significativamente danificadas. Besouros (Scarabaeidae se alimentaram da polpa de frutos e enterraram sementes de araticum próximo da planta-mãe. Insetos curculionídeos e euritomídeos predaram as sementes de araticum nos frutos. Os danos causados nas sementes por esses insetos foram significativamente maiores que aqueles provocados pelas antas. Foram encontradas duas fezes com miçangas distantes 1,7km e 1,8km das plantas-mãe, respectivamente. A germinação das sementes foi baixa neste período de estudo, no entanto, as antas podem proteger as sementes de insetos predadores, defecando-as intactas para longas distâncias. Assim, T. terrestris é um possível dispersor, enquanto que curculionídeos e euritomídeos são possíveis predadores de sementes de araticum. Essas relações provavelmente contribuem para o controle da população de araticum no Cerrado brasileiro.This study aimed to characterize araticum (Annona crassiflora plants and fruits, and evaluate the frequency of consumption, predation and dispersal of the seeds by animals and its effect on germination, in Cerrado vegetation area, between February 2007 and June 2008. Using track traps installed on araticum plants, the frequency of visitation (FV and the fruit consumption by the animals was assessed, as well as, the action of insects in fallen fruits under the trees was registered. Sample of tapirs excrement Tapirus terrestris were analyzed to verify the occurrence frequency (FO and the damage caused on the seeds by tapirs and insects. To analyze the dispersal by tapirs, colored beads were inserted in fallen mature fruits under the parent trees. Then, the distance between the location of the excrements with beads to the parent tree in the specific color of the bead was measured. Germination test was performed with excrement samples and unbroken fruit seeds. Among the animals that fed on fruits, tapirs contributed with the largest frequency of visitation and consumption of araticum fruits, representing 54% of the frequency occurrence in excrement samples, and the seeds were not damaged significantly. Dung beetles (Scarabaeidae fed the pulp of the fruit and buried araticum seeds next to the parent tree. Curculionid and eurytomid insects predated the araticum seeds on the fruits. The damage caused by these insects in the seeds was significantly higher than those caused by tapirs. Two excrements with beads were found at 1,7 and 1,8km distant from the parent trees, respectively. The seeds had low germinability in this period of study, however the tapirs can protect the seeds of predator insects, defecating the intact seeds for long distances. Thus, T. terrestris is a possible disperser of seeds, whereas curculionids and eurytomids can be considered predators of araticum seeds. These relations probably contribute with the control of araticum population in the Brazilian Cerrado.

  8. A remarkable sand-dwelling fish assemblage from central Amazonia, with comments on the evolution of psammophily in South American freshwater fishes

    Jansen Zuanon

    2006-03-01

    Full Text Available We studied a specialised assemblage of sand-dwelling fish species from a streamlet in central Amazonia. The five sanddwelling species comprised 15.2 % of the total number in the streamlet (33 species. Two of the sand-dwellers are daytime foragers, Characidium cf. pteroides (Crenuchidae and Stauroglanis gouldingi (Trichomycteridae, whereas three ones are night-time foragers, Gymnorhamphichthys rondoni (Rhamphichthyidae, "Imparfinis" pristos and Mastiglanis asopos (Heptapteridae. With the exception of C. cf. pteroides, the remainder species bury in the sand during their resting period. All five species bear a cryptic, sand-colour pattern, and some are translucent, traits which we regard as advantageous both for evasion from predators and for approaching prey (for the daytime foragers. All five species are microphagous carnivores and their foraging tactics range from generalised sit-and-wait (C. cf. pteroides to active searching for interstitial prey (G. rondoni. A unique "drift-trap" system made up by the extended barbels and filamentous first pectoral-fin rays is employed by M. asopos. We regard the small size and low number of vertebrae (which is functionally expressed by fast displacements in the sand as additional features advantageous to explore the sand habitat, allowing diving quickly in the substrate to evade predators and to forage for small prey in sand interstices or plant debris. The relationship between morphological and behavioural characters suited to life in sandy substrates is examined under the perspective of the current phylogenies for each group of psammophilous fishes here studied. The mapping of these characters demonstrates that not all of them evolved specifically for strict psammophily. Instead, some of them may represent the final step of a transformation series or synapomorphies of higher hierarchical levels. Several characters linked to psammophily, such as small body, large eyes, and scarce pigmentation are probably paedomorphic traits. We consider that the little variable specific composition of fish sand-dwelling assemblages and the wide (although patchy geographical distribution of their species in the Amazon are due to the widespread occurrence and low complexity of this specialised habitat. The pre-existence of benthic habits, small size, and the broad distribution of rivers with sandy beds, mainly in the Amazon and Orinoco basins, possibly played a determinant role in the origin and diversification of psammophilous assemblages among freshwater fishes in South America.Estudamos uma comunidade especializada de espécies de peixes psamófilos de um igarapé na Amazônia central. As cinco espécies psamófilas correspondem a 15.2 % do número total estimado de espécies do igarapé (33 espécies. Duas das espécies psamófilas são forrageadores diurnos, Characidium cf. pteroides (Crenuchidae e Stauroglanis gouldingi (Trichomycteridae, ao passo que três são forrageadores noturnos, Gymnorhamphichthys rondoni (Rhamphichthyidae, "Imparfinis" pristos e Mastiglanis asopos (Heptapteridae. Com exceção de C. cf. pteroides, as demais espécies ficam enterradas na ar