WorldWideScience
1

Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker (Acari in response the different kinds of food  

Directory of Open Access Journals (Sweden)

Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez Ferla

2003-03-01

2

Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento / Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including dif [...] ferent species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius concordis (Chant, 1959) and Neoseiulus anonymus (Chant & Baker, 1965), both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921), Polyphagotarsonemus latus (Banks, 1904), Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950), and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day). Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez, Ferla; Gilberto José de, Moraes.

2003-03-01

3

Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da Silva

2009-06-01

4

Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.

2009-06-01

5

Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Viçosa, Minas Gerais State, Brazil / Similaridade genética entre Agistemus pallinii Matioli et al (Acari: Stigmaeidae) encontrados em pomares de citros em Viçosa, MG  

Scientific Electronic Library Online (English)

Full Text Available Stigmaeidae são importantes predadores de ácaros e insetos pragas em várias culturas no Brasil. Essa família é considerada a segunda mais importante de ácaros predadores em citros no Brasil. Entretanto, o status taxonômico desses ácaros, principalmente do gênero Agistemus, é difícil de ser analisado [...] com base em caracteres morfológicos. Assim, este trabalho descreve o uso de marcadores polimórfi cos amplificados ao acaso (PCR-RAPD) para investigar a similaridade genética de uma população de Agistemus pallinii Matioli et al encontrada em 2004 em pomar de citros em Viçosa, MG, predando Panonychus citri (McGregor). As amplificações foram realizadas com 12 iniciadores randômicos (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 e OPAE17), os quais geraram 119 bandas, sendo 53,8% polimórficas. Os coeficientes de similaridade genética entre os indivíduos variaram de 0,68 a 0,99, indicando alta similaridade entre eles. A análise de projeção gráfica 3D mostrou que a maioria dos indivíduos analisados formou um único grupo, confirmando a alta similaridade genética entre os mesmos. Assim, mesmo considerando o pequeno tamanho de A. pallinii (± 360 µm), a técnica de PCR-RAPD pode ser utilizada para a sua identificação, em suporte às análises morfológicas ou em comparações de populações coletadas em diferentes regiões geográficas. O presente trabalho representa o primeiro estudo molecular realizado com ácaros da família Stigmaeidae. Abstract in english Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult b [...] ased only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Viçosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifi cations were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 µm long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the first molecular study carried out with stigmaeid mites.

André L, Matioli; Angelo, Pallini; Mara G, Tavares.

2009-04-01

6

Biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) e sua potencialidade de predação sobre Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) / Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O presente trabalho objetivou estudar a biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira nas temperaturas de 15; 20; 25; 30 e 35°C, alimentada com Brevipalpus phoenicis (Geijskes) e pólen de Thypha sp. em condições de laboratório. Tabelas de vida de fertilidade foram calculadas para [...] determinar os parâmetros biológicos. A temperatura ideal para o desenvolvimento de A. brasiliensis foi 29°C. Os valores de T (ciclo de vida - dias), R0 e r m, na temperatura de 30°C, foram de 13,95; 16,25 e 0,20, respectivamente. A potencialidade de predação de A. brasiliensis foi estudada para as densidades populacionais de 5; 10; 20; 40 e 60 adultos de B. phoenicis a 29°C, em arenas de 3 cm de diâmetro, sobre frutos de laranja-pêra. A densidade de 20 ácaros foi suficiente para que o predador consumisse seu número máximo de presas (7,6 ácaros por dia). Densidades acima de 40 ácaros da leprose proporcionaram 4,7 ovos por dia, em comparação aos 2,5 ovos por dia obtidos na densidade de 20 ácaros da leprose. Abstract in english The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35°C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biolog [...] ical parameters. The optimal development of A. brasiliensis took place at 29°C. The values of T (time of generation - days), R0 and r m at 30°C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29°C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage.

André L., Matioli; Carlos A.L. de, Oliveira.

2007-08-01

7

Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou na ausência de ácaros fitófagos Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without the presence of phytophagous mites  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 2002. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor, e três espécies de predadores, Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus.This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tree commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor, and three species of predator mites Euseius concordis (Chant, Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

Alfredo de Gouvea

2007-02-01

8

Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos / Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 200 [...] 2. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor), e três espécies de predadores, Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus. Abstract in english This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tre [...] e commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor), and three species of predator mites Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

Alfredo de, Gouvea; Carla Felicita, Zanella; Sergio Miguel, Mazaro; Joel, Donazzolo; Luis Francisco Angeli, Alves.

2007-02-01

9

Neuropeptidomics of the Carpenter Ant Camponotus floridanus.  

Science.gov (United States)

Ants show a rich behavioral repertoire and a highly complex organization, which have been attracting behavioral and sociobiological researchers for a long time. The neuronal underpinnings of ant behavior and social organization are, however, much less understood. Neuropeptides are key signals that orchestrate animal behavior and physiology, and it is thus feasible to assume that they play an important role also for the social constitution of ants. Despite the availability of different ant genomes and in silico prediction of ant neuropeptides, a comprehensive biochemical survey of the neuropeptidergic communication possibilities of ants is missing. We therefore combined different mass spectrometric methods to characterize the neuropeptidome of the adult carpenter ant Camponotus floridanus. We also characterized the local neuropeptide complement in different parts of the nervous and neuroendocrine system, including the antennal and optic lobes. Our analysis identifies 39 neuropeptides encoded by different prepropeptide genes, and in silico predicts new prepropeptide genes encoding CAPA peptides, CNMamide as well as homologues of the honey bee IDLSRFYGHFNT- and ITGQGNRIF-containing peptides. Our data provides basic information about the identity and localization of neuropeptides that is required to anatomically and functionally address the role and significance of neuropeptides in ant behavior and physiology. PMID:25641051

Schmitt, Franziska; Vanselow, Jens T; Schlosser, Andreas; Kahnt, Jörg; Rössler, Wolfgang; Wegener, Christian

2015-03-01

10

SEM Observations on the Predation Behavior of Agistemus terminalis (Quayle) (Acari: Stigmaeidae) and Amblyseius sojaensis Ehara (Acari: Phytoseiidae) on Panonychus citri (Mcgregor) (Acari: Tetranychidae)  

OpenAIRE

The predation behavior of Agistemus terminalis and Amblyseius sojaensis on Panonychus citri was studied under scanning electron microscope. Agistemus terminalis grasped egg stalk by claws and sensory organ of palpi and direct attack on eggs was done by needle-shaped stylets extruded from the rostrum. A distinct hole was found on the egg surface produced by the penetration and successive withdrawn of the rostrum and stylets. Finally, the hole became wide by the further attack of rostrum and pa...

Abdul Razaq; Nobuo Ohbayashi; Pear Mohammad; Masaya Shiraishi

2000-01-01

11

Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil  

International Nuclear Information System (INIS)

Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 ?m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

12

Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina  

OpenAIRE

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine

2013-01-01

13

Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae)  

OpenAIRE

The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproducti...

Momen, Faten Mamdouh

2012-01-01

14

Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina.  

Science.gov (United States)

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included. PMID:23825448

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine

2013-01-01

15

Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina  

OpenAIRE

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine

2013-01-01

16

Eastern cottontail (sylvilagus floridanus) as carrier of dermatophyte fungi.  

Science.gov (United States)

Eastern cottontail (Sylvilagus floridanus, fam. Leporidae), introduced into Piedmont (Italy) in the 1960s, was studied as carrier of dermatophyte fungi. Of 216 hair samples collected from animals culled between September 1999 and July 2000 in the Province of Alessandria (Piedmont, Italy) during a pest control project, 57 (26.4%) yielded dermatophyte colonies. As two different species of dermatophytes grew from two samples, a total of 59 fungal isolates (26.5%) were obtained. Six dermatophyte species both geophilic (M. gypseum, M. cookei, Trichophyton ajelloi, T. terrestre) and zoophilic (M. canis, T. mentagrophytes) were identified. No sex-related differences were found but season-related differences were observed. The highest prevalence of dermatophyte-positive samples was recorded in May-September, due to the geophilic fungi whose prevalence decreased during colder and increased during warmer months (p < 0.001). The presence of zoophilic dermatophytes, T. mentagrophytes, commonly associated with rodents, small mammals and lagomorphs and M. canis, usually correlated with domestic environment, did not change the whole year round. As Eastern cottontail has been showed to be a carrier of dermatophytes transmissible to man (M. canis, T. mentagrophytes and M. gypseum), it may represent a source of infection for gamekeepers, hunters and veterinarians. PMID:16170613

Gallo, M G; Tizzani, P; Peano, A; Rambozzi, L; Meneguz, P G

2005-09-01

17

Efeito de inseticidas em insetos predadores em culturas de algodão  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório.

SOARES JOSÉ JANDUI

2000-01-01

18

Modelling the habitat requirements of invasive Eastern Cottontail (Sylvilagus floridanus) introduced to Italy  

OpenAIRE

Abstract We analysed the spatial distribution of Eastern Cottontail (Sylvilagus floridanus) and its relationship with the habitat attributes of the agro-ecosystems in north-western Italy. We used generalised linear models to analyse the relationship between the occurrence of the cottontail and a series of landscape-level variables. Hierarchical partitioning was used to estimate the independent contribution of these variables. Our analysis showed that cottontail is typically a lowla...

2010-01-01

19

Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae).  

Science.gov (United States)

The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproductive rate. Preying on Aculops lycopersici (Massee) gave the lowest fecundity and net reproductive rate; therefore, this prey was the least suitable for the oviposition of A. olivi. Preying on Aculus fockeui (Nalepa et Trouessart) and A. mangiferae produced higher intrinsic rates of increase and finite rates of increase for the predator in comparison to A. lycopersici, which showed the lowest value. These differences in response to various eriophyid pests should be considered for the production of healthy cultures of A. olivi. PMID:24575223

Momen, Faten Mamdouh

2012-05-01

20

SELETIVIDADE DE CHLORFENAPYR E FENBUTATIN-OXIDE SOBRE DUAS ESPÉCIES DE ÁCAROS PREDADORES (ACARI: PHYTOSEIIDAE EM CITROS  

Directory of Open Access Journals (Sweden)

Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies

REIS PAULO REBELLES

2001-01-01

21

Invasive species and their parasites: eastern cottontail rabbit Sylvilagus floridanus and Trichostrongylus affinis (Graybill, 1924) from Northwestern Italy.  

Science.gov (United States)

The eastern cottontail Sylvilagus floridanus is a native American lagomorph. Within the genus Sylvilagus, the eastern cottontail is the species with the widest distribution. From 1950s, the species was introduced to several European countries. A rapid territorial expansion of the introduced eastern cottontails has been observed in many areas of Italy. The eastern cottontail has been demonstrated to play a main role as carrier of exotic parasites. To date, three nematode species, exotic in Italian ecosystems, have been reported from introduced S. floridanus. However, its parasite fauna biodiversity is richer in native populations of the American continent. The aim of this work was to further investigate the gastrointestinal parasites of S. floridanus, to evaluate the potential presence of other exotic species. During 2010, 101 hosts were examined, and three nematodes were collected from their digestive tract. Two parasite species (Obeliscoides cuniculi, Trichostrongylus calcaratus) were already reported in Italy; the isolation of Trichostrongylus affinis is instead the first report of this nematode in Italy and in Europe as a whole. This study wants to highlight the great risks related to the introduction of allochthonous species. The impact of the invasion by alien animal species may be particularly severe for public and animal health, due to the potential introduction of new pathogens. The good number of exotic parasites found in introduced eastern cottontails, together with the few sanitary surveys carried out, suggests that an epidemiological survey, with specimens from multiple localities on a wider geographic range, could lead to interesting findings on parasites of native and alien lagomorphs in Europe. PMID:24481904

Tizzani, P; Catalano, S; Rossi, L; Duignan, P J; Meneguz, P G

2014-04-01

22

Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus).  

Science.gov (United States)

Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization. PMID:25047482

Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric

2015-03-01

23

Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

Marcos Rafael, Gusmão; Marcelo, Picanço; Germano L.D., Leite; Marcelo F., Moura.

2000-07-01

24

Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

Marcos Rafael Gusmão

2000-07-01

25

Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado  

OpenAIRE

Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e ...

Bastos Cristina Schetino; Galvão João Carlos Cardoso; Picanço Marcelo Coutinho; Cecon Paulo Roberto; Pereira Paulo Roberto Gomes

2003-01-01

26

Caracterización del comportamiento y las señales vibratorias en Euthyrhynchus floridanus (Hemiptera: Pentatomidae) durante el cortejo y la cópula / Characterization of the behavioral and vibrational signals in Euthyrhynchus floridanus (Hemiptera: Pentatomidae) during courtship and copulation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) es una especie neotropical perteneciente a la familia Pentatomidae con más de 4 000 especies descritas, y se distribuye desde la Florida hasta Brasil. Este estudio describe el comportamiento sexual y reporta por primera vez la producción [...] de vibraciones de sustrato por machos y hembras durante el comportamiento precopulatorio y la cópula. Se grabó tanto el comportamiento de cortejo y de cópula como las diversas señales producidas utilizando un cartucho fonográfico, conectado a una cámara de video. Posteriormente se reprodujo las vibraciones de las hembras en ausencia de estas y se registró las respuestas de los machos. Se distinguieron al menos tres vibraciones de sustrato distintas para los machos y una para las hembras, y se caracterizaron por ser señales de baja frecuencia que van desde los 127 hasta 180Hz. Las sonidos de los machos en E. floridianus fueron significativamente diferentes en la frecuencia, duración y número de pulsos tanto en el cortejo como en la cópula para los sonidos de ronroneo y tamborileo. La producción de sonidos en esta especie se asoció principalmente con comportamientos estimulatorios- mecánicos durante el cortejo y copula. Patrones de comportamiento y su relación con las vibraciones del sustrato sugiere que estas señales pueden ser importantes para los machos en el contexto de la localización de su compañera y la selección sexual. Abstract in english Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) is a neotropical species belonging to the family Pentatomidae with over 4 000 species described, and is distributed from Florida to Brazil. This study describes the sexual behavior and reported for the first time the production of substra [...] te vibrations by males and females during copulatory behavior and mating. Courtship and copulatory behavior, as well as the diverse signals, were recorded with a phonographic cartridge connected to a video camera. Female vibrations were reproduced in the absence of females and the responses by males were recorded. At least three types of substrate vibrations were distinguished in males and one in females, and these signals were characterized by their low frequency, varying from 127 to 180Hz. The sounds of E. floridianus males were significantly different in frequency, duration and number of pulses, both in courtship and in copulation, for the purring and drumming sounds. The production of sounds in this species is associated principally with mechanical, stimulatory behavior during courtship and copulation. Patterns of behavior and their relation to substrate vibrations suggest that these signals are important for the males in the context of mate location and sexual selection.

R. Daniel, Briceño.

2014-03-01

27

Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes  

Scientific Electronic Library Online (English)

Full Text Available Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for population dynamics of predators and prey and their implication

Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.

2001-03-01

28

Effects of hatchery rearing on Florida largemouth bass Micropterus floridanus resource allocation and performance under semi-natural conditions.  

Science.gov (United States)

This study examined the growth, activity, metabolism and post-release survival of three groups of Florida largemouth bass Micropterus floridanus: wild-caught fish, hatchery fish reared according to standard practice (hatchery standard) and hatchery fish reared under reduced and unpredictable food provisioning (hatchery manipulated). Hatchery-standard fish differed from wild-caught fish in all measured variables, including survival in semi-natural ponds. Hatchery-standard and hatchery-manipulated fish showed higher activity levels, faster growth and lower standard metabolic rates than wild-caught fish in the hatchery. Fish reared under the manipulated feeding regime showed increased metabolic rates and increased post-release growth, similar to wild-caught fish. Their activity levels and post-release survival, however, remained similar to those of hatchery-standard fish. Activity was negatively correlated with post-release survival and failure of the feed manipulation to reduce activity may have contributed to its failure to improve post-release survival. Activity and post-release survival may be influenced by characteristics of the rearing environment other than the feeding regime, such as stock density or water flow rates. PMID:25257181

Garlock, T M; Monk, C T; Lorenzen, K; Matthews, M D; St Mary, C M

2014-12-01

29

Richness, origin and structure of an Eimeria community in a population of Eastern cottontail (Sylvilagus floridanus) introduced into Italy.  

Science.gov (United States)

The composition and structure of a community of Eimeria was investigated in a population of Eastern cottontail (Sylvilagus floridanus) introduced into Italy. Eight Eimeria species were found, of which all but 1 had North American origins and were presumably introduced into Italy together with imported cottontails. The success of cottontails in spreading microparasites is probably related to their massive release for hunting purposes. Nearly all cottontails were infected with at least 1 Eimeria species, with bimonthly prevalence ranging from 0-6.3% (E. leporis) to 42.9-89.3% (E. environ). Bayesian model averaging and multivariate techniques were used to investigate the relationships between the occurrence of each parasite and the structure of the relative community. Among the host parameters, only sex was found to be associated with the prevalence of E. honessi, while the rest of the parameters were only weakly correlated with prevalence and species richness. This indicates that individual phenotypic host characteristics are probably less important than environmental factors in determining levels of parasite prevalence and diversity. The community of Eimeria species was probably structured by competition, with less species co-occurrence than expected under a null hypothesis. This was made evident by the low co-occurrence of E. environ and E. neoirresidua with E. poudrei, E. honessi, and E. maior. PMID:20233489

Bertolino, S; Hofmannová, L; Girardello, M; Modry, D

2010-07-01

30

A new species of Paraheligmonella (Nematoda, Heligmonellidae), parasite of Sylvilagus floridanus (Leporidae) from Costa Rica / Una especie nueva de Paraheligmonella (Nematoda, Heligmonellidae), parásita de Sylvilagus floridanus (Leporidae) en Costa Rica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: English Abstract in spanish Se describe Paraheligmonella lamothei n. sp., parásita del intestino delgado de Sylvilagus floridanus (Allen, 1890) (Leporidae) de Costa Rica. Se aportan además datos nuevos morfológicos sobre el synlophe y la bolsa caudal de Paraheligmonella romerolagi (Gibbons y Kumar, 1980), la especie morfológic [...] amente más parecida. La especie nueva se diferencia de P. romerolagi, parásita de Romerolagus diazi (Ferrari-Pérez, 1893) de México, principalmente por caracteres de la bursa caudal y el synlophe de la hembra en la región posterior del cuerpo. Los machos de P. lamothei n. sp. poseen una bursa caudal sin forma de campana, con un patrón de tipo 2-2-1 para el lóbulo derecho y 2-3 con tendencia a tipo 2-2-1 para el lóbulo izquierdo, mientras que los machos de P. romerolagi poseen una bursa en forma de campana, con un patrón de tipo 2-2-1 con tendencia a tipo 4-1 para ambos lóbulos. En P. lamothei n. sp. los rayos 3 son ligeramente más largos que los rayos 2 y el cono genital está poco desarrollado, mientras que en P. romerolagi los rayos 3 son mucho más largos que los rayos 2 y el cono genital es grande y bulboso. Las hembras de P. lamothei n. sp. poseen, a la altura del oviyector, las crestas cuticulares ventrales y latero-ventrales hipertrofiadas y las dorsales y laterales reducidas, mientras que a la misma altura, las hembras de P. romerolagi poseen las crestas laterales hipertrofiadas y las dorsales y ventrales reducidas. Adicionalmente, las crestas cuticulares hipertrofiadas posteriores a la vulva en P. lamothei n. sp., están ausentes en P. romerolagi. Abstract in english Paraheligmonella lamothei n. sp. (Heligmonellidae: Heligmonellinae) is described from the small intestine of a cottontail, Sylvilagus floridanus (Allen, 1890) (Leporidae), from Costa Rica. New morphological data on the synlophe and caudal bursa of Paraheligmonella romerolagi (Gibbons and Kumar, 1980 [...] ), the most similar species, are also provided. The new species differs from P. romerolagi, parasitic of Romerolagus diazi (Ferrari-Pérez, 1893) from Mexico, mainly by the characters of the caudal bursa and the synlophe of the female within the posterior region of body. Males of P. lamothei n. sp. possess a caudal bursa not bell-shaped, with a pattern of type 2-2-1 for right lobe and 2-3 with a tendency to type 2-2-1 for left lobe, whereas males of P. romerolagi possess a bell-shaped caudal bursa, with a pattern of type 2-2-1 with a tendency to type 4-1 for both lobes. In P. lamothei n. sp. rays 3 are slightly longer than rays 2 and the genital cone is poorly developed, whereas in P. romerolagi rays 3 are much longer than rays 2 and the genital cone is large and bulbous. Females of P. lamothei n. sp. possess, at ovejector level, ventral and latero-ventral ridges hypertrophied and dorsal ridges reduced, whereas at the same level, females of P. romerolagi possess lateral ridges hypertrophied and dorsal and ventral ridges reduced. Additionally, hypertrophied cuticular ridges posterior to the vulva are present in P. lamothei n. sp., but absent in P. romerolagi.

María Celina, Digiani; Ramón A., Carreño; Marie-Claude, Durette-Desset.

2008-08-01

31

Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal variety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%, followed by Phytoseius intermedius (31.2%, Euseius concordis (14.1%, Amblyseius herbicolus (8.8% and Iphiseiodes zuluagai (3.3%. Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira Picoli

2010-11-01

32

Ácaros predadores associados ao ácaro-da-erinose da lichia / Predator mites associated with the litchi erinose mite  

Scientific Electronic Library Online (English)

Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, [...] da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%), seguida por Phytoseius intermedius (31,2%), Euseius concordis (14,1%), Amblyseius herbicolus (8,8%) e Iphiseiodes zuluagai (3,3%). O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação. Abstract in english The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal var [...] iety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%), followed by Phytoseius intermedius (31.2%), Euseius concordis (14.1%), Amblyseius herbicolus (8.8%) and Iphiseiodes zuluagai (3.3%). Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira, Picoli; Marineide Rosa, Vieira; Eloisa Aparecida da, Silva; Max Sander de Oliveira da, Mota.

1246-12-01

33

Predadores asociados a panonychus citri mcgregor (acari: Tetranychidae) en la costa central del Perú / Predators associated to panonychus citri Mcgregor (acari: Tetranychidae) in the central coast of Peru  

Scientific Electronic Library Online (English)

Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthosei [...] us) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A.) evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados. Abstract in english In the central coast of Peru, fifteen predators associated to Panonychus citri were identified: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias-Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbi [...] tt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. and Armascirus sp. Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider and Aeolothrips sp. were the acarophagous insects found. Most abundant species were: A. chungas, T.(A.) evectus and N. californicus. Furthermore, both Stethorus tridens and Stethorus histrio were frequent in fields where predator mites were absent.

Alberto Daniel, Guanilo; Norberta, Martínez.

2007-12-01

34

Efeito de inseticidas em insetos predadores em culturas de algodão / Effect of insecticides on predator insects associated with cotton  

Scientific Electronic Library Online (English)

Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); F [...] ipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.). Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare) no campo, e a Cycloneda sanguinea (L.), em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb.), e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs) no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório. Abstract in english To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L.) crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.); Fipronil 800 WDG (64, [...] 80 and 100 g/ha of a.i.); Endosulfan 350 EC (700 g/ha of a.i.); and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare) under field condition and to Cycloneda sanguinea (L.) under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb.), and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L.) and Doru lineare (Eschs) under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.

JOSÉ JANDUI, SOARES; ANTÔNIO CARLOS, BUSOLI.

1889-18-01

35

Domácias do cafeeiro beneficiam o ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)? / Do coffee domatia benefit the predatory mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)?  

Scientific Electronic Library Online (English)

Full Text Available Os cafeeiros apresentam domácias em suas folhas que abrigam ácaros, inclusive ácaros predadores que podem também fazer uso dessas estruturas. Neste estudo foi avaliado o efeito das domácias sobre o predador Iphiseiodes zuluagai Denmark & Muma, através da manipulação dessas estruturas em folhas de Co [...] ffea arabica L. var. Catuaí. Os testes foram realizados em arenas constituídas por folhas de cafeeiro com a face abaxial voltada para cima. Foi avaliada a sobrevivência de I. zuluagai em folhas com domácias fechadas (T1); domácias abertas contendo alimento (T2) e domácias abertas vazias (T3). Foram feitas observações a cada 24h, contabilizando-se o número de adultos vivos, local de oviposição e quantidade de ovos de I. zuluagai / tratamento. Foram observadas diferenças significativas entre os tratamentos. Nas folhas com domácias abertas (T2 e T3) foram encontrados ácaros vivos até o final do experimento, não ocorrendo o mesmo nas folhas com domácias fechadas (T1). No que se refere à oviposição de I. zuluagai, nos tratamentos em que as domácias se encontravam abertas (T2 e T3), o ácaro ovipositou preferencialmente dentro destas estruturas, enquanto nas folhas com domácias fechadas a oviposição foi feita preponderantemente à margem das folhas em contato com o algodão úmido. Os resultados indicam a importância das domácias como fonte de sobrevivência para os ácaros predadores nas plantas, sugerindo uma interação mutualística planta-predador. No café, o mutualismo planta-predador intermediado por domácias poderia ser explorado em estratégias de controle biológico natural, ao se selecionarem espécies de cafeeiro com domácias que favoreçam a presença dos ácaros predadores nas mesmas, protegendo-as contra o ataque de ácaros herbívoros nocivos. Abstract in english Coffee plants have domatia on their leaves harboring mites, and the predatory mites can also use such structures. Here we evaluated the effect of the domatia on the predatory mite Iphiseiodes zuluagai Denmark & Muma, manipulating these structures on the leaves of Coffea arabica L. var. Catuaí. The t [...] ests were done using arenas made of coffee leaves placed up side down inside petri dishes. The survivorship of I. zuluagai was evaluated when released on leaves with closed domatia (T1); leaves with open domatia plus prey (T2) and leaves with open domatia without prey (T3). The experiment was checked every 24h, measuring the number of alive adults, oviposition site and the number of I. zuluagai eggs/treatment. Significant difference was found between treatments. Mites were alive until the end of the experiments on leaves with open domatia (T2 and T3), which did not happen on leaves with closed domatia (T1). The predators oviposited preferentially inside the domatia on treatments with open domatia, and on the edge of the leaves, next to the moist cotton bordering the leaves, on the treatment with closed domatia. The results indicate the role of domatia on the survivorship of the predators on the coffee plants, suggesting a possible mutualist interactions plant-predator. On coffee crops, a mutualistic plant-predator interaction mediated by domatia could be used in practices of natural biological control, selecting coffee plants with domatia to harbor predatory mites and thereby protecting plants against harmful herbivore mites.

Cláudia H.C., Matos; Angelo, Pallini; Fredson F., Chaves; Carla, Galbiati.

2004-02-01

36

Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyroximate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%; and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce Veronez

2012-04-01

37

Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.

2012-04-01

38

Efeito do peso corporal na fecundidade e na longevidade do percevejo predador Podisus rostralis / Effect of body weight on fecundity and longevity of the stinkbug predator Podisus rostralis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Considerando a importância dos percevejos predadores como agentes de controle biológico e a necessidade de se otimizar sua produção massal, realizou-se o presente trabalho para avaliar a influência do peso corporal sobre a sobrevivência e a reprodução de fêmeas de Podisus rostralis (Stål) (Hemiptera [...] : Pentatomidae). Os tratamentos foram constituídos por fêmeas desse predador com peso médio de: 39,5 mg, 45,5 mg, 51,5 mg, 57,5 mg e 63,5 mg. O período de preoviposição foi menor nas fêmeas mais pesadas, enquanto o número de ovos e de ninfas por dia apresentou relação linear positiva com o peso das fêmeas de P. rostralis. A longevidade das fêmeas desse predador foi semelhante entre tratamentos, porém não apresentou tendência de variação em razão do seu peso corporal. Como o objetivo de uma criação massal é produzir o maior número possível de ninfas por dia, recomenda-se o uso de fêmeas de P. rostralis com peso acima de 60,0 mg. Abstract in english Considering the importance of predatory Pentatomidae as biological control agents it is necessary to optimize mass production facilities of these species. The objective of this research was to evaluate the influence of body weight on survival and reproductive parameters of females of Podisus rostral [...] is (Stål) (Hemiptera: Pentatomidae). Treatments were represented by females of this predator with the following mean weight: 39.5 mg, 45.5 mg, 51.5 mg, 57.5 mg and 63.5 mg. Heavier females of P. rostralis showed shorter preoviposition period while the number of eggs and of nymphs per day presented a positive linear relationship with female weight of this predator. Longevity of females of P. rostralis was similar between treatments with no tendency of variations as a function of body weight of these females. Since the objective of mass rearing facilities of predatory bugs is to produce the maximum possible number of nymphs per day it is recommended to use females of P. rostralis with weight above 60.0 mg.

José Cola, Zanuncio; Adrián José, Molina-Rugama; Germi Porto, Santos; Francisco de Sousa, Ramalho.

1225-12-01

39

Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor / Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Scientific Electronic Library Online (English)

Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), [...] uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural. Abstract in english Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae) have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae), in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae), one of the m [...] ost damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

Harley Nonato de, Oliveira; Dirceu, Pratissoli; Eder Pin, Pedruzzi; Marcelo Curitiba, Espindula.

2004-10-01

40

Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor  

Directory of Open Access Journals (Sweden)

Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

Harley Nonato de Oliveira

2004-10-01

41

Alguns dados bioecológicos de Pomacea haustrum (Reeve, 1856, predador-competidor de hospedeiros intermediários de Schistosoma mansoni Sambon, 1907 Some bioecological data regarding Pomacea haustrum (Reeve, 1856 predator-competitor of intermediate hosts of Schistosoma mansoni Sambon, 1907  

Directory of Open Access Journals (Sweden)

Full Text Available Foram feitas observações no laboratório e no campo, em Belo Horizonte, MG, Brasil, com a finalidade de se obter informações biológicas e ecológicas sobre Pomacea haustrum (Reeve, 1856, molusco pilídeo, competidor-predador de hospedeiros intermediários de Schistosoma mansoni Sambon 1907.Observations carried out in the laboratory and the field (Belo Horizonte, MG, Brazil offered the following biological and ecological informations Pomacea haustrum (Reeve, 1853, mollusk pilid, predator and competitor of Schistosoma mansoni intermediary host.

Roberto Milward-de-Andrade

1978-03-01

42

Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae) / Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi e [...] studar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae) alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae) em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21%) e a de atividade de postura, à 0 h (50,56% dos ovos depositados), enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%), seguido das 00 h (29,65%), 18 h (22,36%) e 6 h (16,60%). Abstract in english Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductiv [...] e behavior and predation rate of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21%) and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited) while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58%) followed by those at 12:00 AM (29.65%) 06:00 PM (22.36%) and 06:00 AM (16.60%).

Evaldo Martins, Pires; Rosenilson, Pinto; Mabio Chrisley, Lacerda; José Cola, Zanuncio; Maria do Carmo Queiroz, Fialho.

1039-10-01

43

Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21% e a de atividade de postura, à 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

Evaldo Martins Pires

2006-12-01

44

Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa Diversity of aphids and their parasitoids and predators in alfalfa crop  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA, em Lavras, MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC.This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.

SIMONE MENDES

2000-07-01

45

Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa / Diversity of aphids and their parasitoids and predators in alfalfa crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA), em Lavras, [...] MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC. Abstract in english This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioa [...] phis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.

SIMONE, MENDES; MARCIA NASCIMENTO, CERVIÑO; VANDA HELENA PAES, BUENO; ALEXANDER MACHADO, AUAD.

1305-13-01

46

Seletividade de Inseticidas a Brevicoryne brassicae (L.) (Hemiptera: Aphididae) e ao Predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Insecticide Selectivity to Brevicoryne brassicae (L.) (Hemiptera: Aphididae) and the Predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve por objetivo estudar a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Brevicoryne brassicae (L.) (Hemiptera: Aphididae), em relação a adultos e ninfas de primeiro, segundo e terceiro estádio [...] s do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe e deltametrina foram altamente seletivos em favor de todos os estádios de desenvolvimento de D. luteipes, sendo que o mesmo ocorreu para o acefato, com exceção de ninfas de primeiro estádio do predador às quais ele é medianamente seletivo. Dimetoato foi, em geral, medianamente seletivo enquanto metamidofós e paratiom metílico foram pouco seletivos em favor do predador. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade do dimetoato (para adultos, ninfas de primeiro e segundo estádios do predador) e metamidofós (para ninfas de terceiro estádio) apresentaram as maiores inclinações, indicando que os estádios estudados apresentam resposta homogênea a esses inseticidas. Abstract in english The objective of this work was to study the selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb to first, second, and third instar nymphs and adults of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) in comparison with l [...] ast instar nymphs of the prey Brevicoryne brassicae (L.) (Hemiptera: Aphididae). Pirimicarb and deltamethrin were highly selective to all developmental stages of D. luteipes; the same was observed with acephate except for first instar nymphs to whom it showed median selectivity. Dimethoate showed median selectivity, but methamidophos and methyl parathion were low selective to the predator. Second and third instar nymphs and adults of D. luteipes were more tolerant to acephate, methyl parathion and pirimicarb than first instar nymphs. First and second instar nymphs showed similar tolerance to deltamethrin, dimethoate and methamidophos. Concentration-response curves for dimethoate (to adults and first and second instar nymphs) and methamidophos (to third instar nymphs) showed steeper slopes indicating an homogeneous response of these developmental stages to these insecticides.

LEANDRO, BACCI; MARCELO C., PICANÇO; MARCOS R., GUSMÃO; ANDRÉ L.B., CRESPO; ELISEU J.G., PEREIRA.

2001-12-01

47

Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.

LILIANE K., FIGUEIRA; FERNANDO M., LARA; IVAN, CRUZ.

2002-03-01

48

Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

Liliane K., Figueira; Fernando M., Lara.

2004-08-01

49

Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Directory of Open Access Journals (Sweden)

Full Text Available Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae, a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamentos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF, e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar (Coleoptera: Chrysomelidae foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius (Hymenoptera: Apidae foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera bem como o fitófago Cicadellidae (Hemiptera preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos.The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae, the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized blocks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar (Coleoptera: Chrysomelidae was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius (Hymenoptera: Apidae was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera and the phytophagous Cicadellidae (Hemiptera preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin Leite

2011-12-01

50

Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae em diferentes temperaturas = Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae under different temperatures  

Directory of Open Access Journals (Sweden)

Full Text Available Euseius alatus DeLeon (Acari: Phytoseiidae é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avaliar o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e33°C, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30°C mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatusem laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro.Euseius alatus DeLeon (Acari: Phytoseiidae is one of the mostcommon predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effect of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33°C; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility lifetable, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

José Wagner da Silva Melo

2009-07-01

51

Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) em diferentes temperaturas / Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae) under different temperatures  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius alatus DeLeon (Acari: Phytoseiidae) é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avalia [...] r o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e 33ºC, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30ºC mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatus em laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro. Abstract in english Euseius alatus DeLeon (Acari: Phytoseiidae) is one of the most common predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effe [...] ct of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33ºC; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility life table, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

José Wagner da Silva, Melo; Cleiton Araújo, Domingos; Andreia Serra, Galvão; Manoel Guedes Corrêa, Gondim Junior; Gilberto José de, Moraes.

2009-09-01

52

Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Scientific Electronic Library Online (English)

Full Text Available Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.

2011-12-01

53

Reproductive characteristics of the predator Podisus nigrispinus fed with an insect resistant soybean variety / Características reprodutivas do predador Podisus nigrispinus alimentado com variedade de soja resistente a insetos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo desta pesquisa foi avaliar o efeito do genótipo IAC 17, resistente a insetos, nas características reprodutivas de fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), utilizando o genótipo susceptível UFV 16 como controle. Os tratamentos foram: T1) fêmeas de P. nigrispinus [...] alimentadas com plantas de UFV 16 e lagartas de Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae), criadas em folhas desta cultivar; T2) fêmeas de P. nigrispinus alimentadas com plantas de IAC 17, e lagartas de A. gemmatalis, criadas em folhas desta cultivar. Avaliou-se a longevidade das fêmeas, períodos de pré-oviposição, oviposição e pós-oviposição, número de ovos e de posturas/fêmea, peso dos ovos, intervalo entre posturas, número de ovos/postura, porcentagem de ovos eclodidos, número de ninfas/fêmea e número total de presas mortas/fêmea de P. nigrispinus. A maioria das características avaliadas mostrou resultados semelhantes entre tratamentos, exceto o período de oviposição, que foi mais longo para fêmeas criadas no genótipo resistente que no susceptível, e a porcentagem de fêmeas que ovipositaram antes de morrer, que foi menor na IAC 17. Além disso, o genótipo IAC 17 causou maior mortalidade de fêmeas de P. nigrispinus no início de sua fase adulta e distribuição mais uniforme da produção de ovos ao longo do período adulto desse predador. Por outro lado, os resultados não sugerem efeito desse genótipo na prole do predador. Abstract in english The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1) females of P. [...] nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae) caterpillars reared on leaves of this variety; T2) females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.

Fausto da Costa, Matos Neto; José Cola, Zanuncio; Marcelo Coutinho, Picanço; Ivan, Cruz.

2002-07-01

54

Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl (Heteroptera:Pentatomidae Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl (Heteroptera:Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl. Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molitor com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps.The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl. The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius cincticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

Francisco Roberto de Azevedo

1999-02-01

55

Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae) / Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl). Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molit [...] or com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps. Abstract in english The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl). The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius c [...] incticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

Francisco Roberto de, Azevedo; Francisco de Sousa, Ramalho.

1999-02-01

56

Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) / Biology of the predaceous mite Euseius alatus DeLeon (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius alatus DeLeon é um ácaro predador encontrado em plantas cítricas (Citrus spp.) no Brasil, que apresenta um ciclo de vida semelhante aos demais ácaros do mesmo gênero. O tempo de incubação e a duração das fases de larva, protoninfa e deutoninfa foi de aproximadamente 24 h cada, quando aliment [...] ado com pólen de mamoneira (Ricinus communis), a 25 ± 2 °C, 70 ± 10% UR e 14 h de fotofase. O período médio de oviposição foi de 26,5 dias, e a oviposição média foi de 1,4 ovos/dia. A capacidade inata de crescimento da população (r m) foi estimada em 0,217, crescendo a população 1,2 vezes ao dia e dobrando a cada 3,2 dias. A população de E. alatus pode aumentar 21,4 vezes (Ro) no tempo médio de uma geração (T = 14,1 dias). Abstract in english Euseius alatus DeLeon is a predaceous mite found on citrus plants (Citrus spp.) in Brazil, with a life cycle similar to the species of the same genus. Incubation period, larval, protonymphal and deutonymphal stages lasted ca. 24 h each, when mites were fed castor bean (Ricinus communis ) pollen and [...] kept at 25 ± 2 °C, 70 ± 10% RH and 14 h photophase. Oviposition period lasted 26.5 days, and the oviposition rate was 1.4 eggs/day. The intrinsic rate of increase (r m) was 0.217; population increased 1.2 times a day and double its population every 3.2 days. The population of E. alatus increase 21.4 times (Ro) in the period of one generation (T = 14.1 days).

Paulo R., Reis; Everaldo B., Alves.

1997-08-01

57

Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae) / Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae) foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae) em plantas de Eucalyptus urophylla no campo ou, apenas, em lab [...] oratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e a fertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas). A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto. Abstract in english The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae on Eucalyptus urophylla plants in the field or only with pupae of this p [...] rey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions) only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.

Anderson Mathias, Holtz; Gustavo Dias de, Almeida; Marcos Antonio Matiello, Fadini; José Cola, Zanuncio; José Salazar, Zanuncio-Júnior; Gilberto Santos, Andrade.

2011-06-01

58

Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae.  

Directory of Open Access Journals (Sweden)

Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e afertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto.

Anderson Mathias Holtz

2011-04-01

59

Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

OpenAIRE

Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e ...

Cristina Schetino Bastos; João Carlos Cardoso Galvão 1; Marcelo Coutinho Picanço; Paulo Roberto Cecon; Paulo Roberto Gomes Pereira

2003-01-01

60

SELETIVIDADE DE CHLORFENAPYR E FENBUTATIN-OXIDE SOBRE DUAS ESPÉCIES DE ÁCAROS PREDADORES (ACARI: PHYTOSEIIDAE) EM CITROS / SELECTIVITY OF CHLORFENAPYR AND FENBUTATIN-OXIDE ON TWO SPECIES OF PREDACEOUS MITES (ACARI: PHYTOSEIIDAE) IN CITRUS  

Scientific Electronic Library Online (English)

Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-d [...] os-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies Abstract in english Through the bioassays, it was verified the residual contact, ovicidal and persistence effects of the products chlorfenapyr and fenbutatin-oxide on two species of predaceous mites, Iphiseiodes zuluagai Denmark & Muma and Euseius alatus DeLeon (Acari: Phytoseiidae), associated to the citrus leprosis m [...] ite Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). The adult total effect was studied through the residual spray contact method in glass surface, according to IOBC methodology. Ovicidal effect was evaluated through direct spray on the predators mite eggs, also in glass surface. Persistence of the products was evaluated, in laboratory conditions, in arenas made with sprayed orange leaves in the field at 0, 5, 15 and 30 days after the application. Results showed that chlorfenapyr was noxious to I. zuluagai and E. alatus, and fenbutatin-oxide was slightly harmful to E. alatus and innocuous to I. zuluagai. None of the products presented ovicidal effect. Fenbutatin-oxide presented low persistence to both predators mite species, and chlorfenapyr in the smallest rate (31.3 ml) was of low persistence and in the great one (62.5 ml) moderately persistent. Fenbutatin-oxide was innocuous and slightly harmful to the predaceous mites I. zuluagai and E. alatus, respectively, and of low persistence for both species

PAULO REBELLES, REIS; ÉLBER OLIVEIRA, SOUSA.

2001-12-01

61

Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) / Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de i [...] ndivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um dos fungos Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 e 1189) e Beauveria bassiana (Bals.) Vuill. (604, 634 e 561) sobre ninfas e adultos de P. nigrispinus pelas vias de contato, residual seco e ingestão de presas contaminadas, em laboratório. M. anisopliae ocasionou maior mortalidade do predador que B. bassiana, tanto por contato como por resíduo seco do fungo. Entre as vias de infecção dos fungos o contato causou maior mortalidade do predador. Não houve confirmação de mortalidade de adultos em nenhuma das vias de infecção pelos isolados testados. A predação de larvas de Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminadas com os fungos afetou a produção de ovos das fêmeas adultas, porém o mesmo não foi constatado quando adultos alimentaram-se de presas contaminadas. Os resultados sugerem que isolados de M. anisopliae podem causar mortalidade de ninfas de P. nigrispinus por contato, enquanto os isolados de B. bassiana foram de menor impacto em todas as vias de infecção estudadas, comparados aos isolados de M. anisopliae. Abstract in english Entomopathogenic fungi and the predatory stinkbug Podisus nigrispinus (Dallas) can target simultaneously the same or different pests in agroecosystems. Topical contact during fungal dispersion or spraying, walking on plant surfaces and ingestion of contaminated prey are some of possible ways of inte [...] ractions between fungi and the predatory stinkbug. The impact of three isolates of Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 and 1189) and Beauveria bassiana (Bals.) Vuill. (604, 634 and 561) against nymphs and adults of P. nigrispinus was investigated under laboratory conditions. M. anisopliae caused higher mortality compared to B. bassiana either by topical application or by dry residue on cotton leaves. Topic contact with both fungi caused higher mortality to the predator. No mortality confirmation was reported for the adults. Nymphs fed with cotton leafworm larvae Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminated by the fungi had their reproduction affected, but this was not observed when adult predators fed on contaminated larvae. These findings suggest that isolates of M. anisopliae can cause mortality of P. nigrispinus nymphs by topical contact, while isolates of B. bassiana were less harmful by all ways of infection as compared to M. anisopliae.

Ítalo W.B., França; Edmilson J., Marques; Jorge B., Torres; José V., Oliveira.

2006-06-01

62

PRELIMINARY NOTE ON BIONOMIC DATA OF THE HONEYBEE PREDATOR Apiomerus nigrilobus STAL, 1872 GOTTEN IN LABORATORY CONDITIONS NOTA PRÉVIA SOBRE ALGUNS DADOS BIONÔMICOS DO PREDADOR DE ABELHAS Apiomerus nigrilobus Stal, 1872 OBTIDOS EM CONDIÇÕES DE LABORATÓRIO  

Directory of Open Access Journals (Sweden)

Full Text Available

This preliminary note presents some bionomics data of the honeybee predator Apiomerus nigrilobus Stal, 1872 obtained in laboratory. The study was conducted at the Agricultural College ";Luiz de Queiroz” U.S.P. — São Pau1o, Brazil, from March 1972 to December 1973. The evolutionary cycle of this predator, on an average, is 246 days. A table is presented showing the results.

Esta nota prévia apresenta alguns dados bionômicos do predador de abelhas Apiomerus nigrilobus Stal, 1872 obtidos sob condições de laboratório. O estudo foi realizado no Departamento de Entomologia da Escola Superior de Agricultura “Luiz de Queiroz” da Universidade do Estado de São Paulo, no período de março de 1972 a dezembro de 1973. O ciclo biológico médico constatado para este predador foi de 246 dias. Os autores apresentam três quadros que resumem os dados obtidos.

Antônio Lopes da Silva

2007-09-01

63

Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines, and ground cover plants.  

Science.gov (United States)

Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the families Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) in central and south central Florida. Inner and outer canopy leaves, fruit, twigs, and trunk scrapings were sampled monthly between August 1994 and January 1996. Open flowers were sampled in March from five of the sites. Two species of eupalopsellid mites (Exothorhis caudata Summers and Saniosulus harteni (van-Dis and Ueckermann)) were identified from 252 specimens collected within citrus tree canopies within the seven citrus orchards of which 249 were E. caudata. Only two E. caudata were collected from ground cover plants within five of the seven orchards. Eight species of Stigmaeidae were identified from 5,637 specimens: Agistemus floridanus Gonzalez, A. terminalis Gonzalez, Eustigmaeus arcuata (Chandhri), E. sp. near arcuata, E. segnis (Koch), Mediostigmaeus citri (Rakha and McCoy), Stigmaeus seminudus Wood, and Zetzellia languida Gonzalez were collected from within citrus tree canopies from seven orchard sites. Agistemus floridanus was the only species in either family that was abundant with 5,483 collected from within citrus tree canopies compared with only 39 from vine or ground cover plants. A total of 431 samples from one or more of 82 vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards and one or more eupalopsellids or stigmaeids were collected from 19 of these plants. Richardia brasiliensis (Meg.) Gomez had nine A. floridanus from 5 of 25 samples collected from this plant. Solanum sp. had five A. floridanus from three samples taken. Both eupalopsellid and stigmaeid species numbers represented orchards were on full herbicide programs and ground cover plants were absent. Agistemus floridanus was more abundant in the citrus orchards with on-going or recent herbicide programs compared with orchards having well-developed ground cover plants. Agistemus floridanus was most abundant on inner leaves between January and April and again during September through November. Additional collection records of E. caudata, S. harteni, A. terminalis, M. citri, Z. languida, and Zetzellia sp. near silvicola within Florida citrus orchards between 1989 and 2004 are included. Four species of Eupalopsellidae and ten species of Stigmaeidae occur within Florida citrus orchards. PMID:24771254

Childers, Carl C; Ueckermann, Eduard A

2014-10-01

64

Impacto da temperatura e da defesa da presa na utilização de Tenebrio molitor L. por ninfas do predador Supputius cincticeps (Heteroptera:Pentatomidae) / Impact of the temperature and of the prey defense on the utilization of Tenebrio molitor L. by nymphs of the predator Supputius cincticeps (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudaram-se os efeitos da temperatura e da defesa da presa na utilização de larvas de Tenebrio molitor L. pelas ninfas do predador Supputius cincticeps (Stäl). Constatou-se que o crescimento de S. cincticeps ocorreu em função da defesa da presa e/ou da temperatura. A taxa de consumo relativo de lar [...] vas de T. molitor pelo S. cincticeps dependeu do ínstar do predador e da temperatura ambiente e também do comportamento de defesa da presa. A eficiência de conversão das larvas de T. molitor ingeridas por ninfas de S. cincticeps dependeu do ínstar do predador, da temperatura e da defesa apresentada pela presa. A taxa de crescimento relativo de S. cincticeps dependeu do ínstar do predador e da temperatura do ambiente, e do ínstar do predador e da defesa da presa. Abstract in english The effects of the temperature and of the prey defense on the utilization of Tenebrio molitor L. larvae by the nymphs of the predator Supputius cincticeps (Stäl) were studied. Growth of S. cincticeps was function of the prey defense and/or temperature. The relative consumption rate of T. molitor lar [...] vae by S. cincticeps depended on the instar of the predator and on the temperature, and also on the defense behavior of the prey. The efficiency of conversion of T. molitor larvae ingested by nymphs of S. cincticeps depended upon the predator instar, temperature and defense of the prey. The relative growth rate of S. cincticeps was related to predator instar and temperature, and predator instar and defense of the prey.

Francisco R. de, Azevedo; Francisco S., Ramalho.

1999-03-01

65

A dieta alimentar da presa Tenebrio molitor (Coleoptera: Tenebrionidae) pode afetar o desenvolvimento do predador Podisus nigrispinus (Heteroptera: Pentatomidae)? / Can the diet of the prey Tenebrio molitor (Coleoptera: Tenebrionidae) affect the development of the predator Podisus nigrispinus (Heteroptera: Pentatomidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Inimigos naturais são importantes para o controle de pragas em culturas agrícolas e florestais. A criação de insetos predadores em biofábricas deve ser de baixo custo para serem utilizados em programas de Manejo Integrado de Pragas (MIP). O objetivo deste trabalho foi avaliar o desenvolvimento de Po [...] disus nigrispinus Dallas, 1851 (Heteroptera: Pentatomidae), alimentado com larvas de Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae), criadas com as seguintes dietas: farelo de trigo, ração triturada ou peletizada para aves poedeiras e fubá de milho. Foram obtidos os parâmetros de desenvolvimento e reprodução necessários para calcular a tabela de vida do predador. Os parâmetros da tabela de vida revelaram crescimento populacional em todos os tratamentos. No entanto, a taxa líquida de reprodução (Ro) de P. nigrispinus foi menor quando alimentados com larvas de T. molitor criadas com fubá de milho, mostrando ser a alimentação menos adequada para esse predador. Por proporcionar maior número total de ovos, o farelo de trigo constituiu a melhor dieta para P. nigrispinus. Estudos sobre dietas de presas alternativas são importantes, pois podem favorecer a nutrição de inimigos naturais e, consequentemente, melhorar o desempenho das criações massais em laboratório. Abstract in english Natural enemies are important for controlling pests in agricultural and forestry culture. The reproductions of predatory insects in biofactories should have low cost to be used in Integrated Pest Management Program (IPM). The objective of this study was to evaluate the development of Podisus nigrisp [...] inus Dallas, 1851 (Heteroptera: Pentatomidae) fed with Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae). The larvae of T. molitor were created with the following diets: wheat bran, shredded or pelleted poultry feed layers and corn meal. Parameters for the development and reproduction of the P. nigrispinus were obtained. Parameters of the life table show population growth in all treatments. However, the net rate of reproduction (Ro) of P. nigrispinus was lower when they were fed with larvae of T. molitor created with corn meal, which proved to be the least adequate food for this predator. By providing a larger total number of eggs, wheat bran was the best diet for P. nigrispinus. Studies on alternative prey diets are important as they may favor the nutrition of natural enemies and, consequently, improve the performance in laboratory rearing.

Claubert Wagner Guimarães de, Menezes; Silma da Silva, Camilo; Arley José, Fonseca; Sebastião Lourenço de, Assis Júnior; Diego Faustolo, Bispo; Marcus Alvarenga, Soares.

2014-09-01

66

Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops  

Directory of Open Access Journals (Sweden)

Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A. Watanabe

1994-04-01

67

Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae) em culturas de pepino e morango / Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae) in cucumber and strawberry crops  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fit [...] oseídeos Amblyseius idaeus (Denmark & Muma) e Phytoseudus macropilis (Banks), comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4) para o pepino e 5 tratamentos para o morangueiro (T1-T5): T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae. Abstract in english The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytosei [...] ids Amblyseius idaeus (Denmark & Muma) and Phytoseudus macropilis (Banks), commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4) and 5 treatments for strawberry crops (T1-T5): T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A., Watanabe; G.J. de, Moraes; I., Gastaldo Jr.; G., Nicolella.

1994-04-01

68

SELECTIVITY OF PESTICIDES OVER PREDATORS OF COTTON PLANT PESTS SELETIVIDADE DE INSETICIDAS SOBRE O COMPLEXO DE PREDADORES DAS PRAGAS DO ALGODOEIRO  

Directory of Open Access Journals (Sweden)

Full Text Available

The cotton plant hosts a complex of pests that can damage plant structures. Its supported development, in this agroecosystem, demands the implementation of an integrated pest management (IPM system. The goal of this research was to study the selectivity of pesticides over predators of cotton plant pests. The experimental design was randomized blocks, with 9 treatments (84 days after the emergence and 4 replicates. The sampling involved the beat cloth method, with 5 beats per plot, allowing to identify and count the living predators. Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1,000 g ha-1, Thiamethoxam 250 WG (200 g ha-1, and Acetamiprid 200 SP (150 g ha-1 were not selective for the complex of the predators identified, with mortality percentages ranging from moderately toxic to toxic. Etofenprox 300 EC (450 mL ha-1 was the most toxic pesticide, when compared to the others treatments. The Flonicamid 500 WG (150 g ha-1 treatment was selective, with average of predators similar to the control, until 8 days after spraying. Among the pesticides evaluated, only Flonicamid 500 WG was considered selective, according to the IOBC classification, because it showed the lowest mortality percentage for the complex of predators identified.

KEY-WORDS: Gossypium hirsutum L.; insecta; pesticides; cotton plant; predators.

O algodoeiro é hospedeiro de um complexo de pragas, que podem ocasionar danos às estruturas das plantas. Para o desenvolvimento sustentado, neste agroecossistema, há necessidade da implementação do Manejo Integrado das Pragas (MIP. O objetivo deste trabalho foi estudar a seletividade de inseticidas aos predadores das pragas do algodoeiro. O delineamento experimental utilizado foi o de blocos ao acaso, com nove tratamentos e quatro repetições. Os tratamentos foram aplicados aos 84 dias após a emergência. As amostragens foram feitas através do método de batida de pano, com cinco batidas ao acaso, por parcela

Izidro dos Santos de Lima Júnior

2010-08-01

69

Avaliação in vitro do fungo predador de nematoides Duddingtonia flagrans sobre larvas infectantes de ciatostomíneos de equinos (Nematoda: Cyathostominae In vitro evaluation of nematode predacious fungus Duddingtonia flagrans on cyathostomes infective larvae of equines (Nematoda: Cyathostominae  

Directory of Open Access Journals (Sweden)

Full Text Available A capacidade predatória de um isolado de fungo predador de nematoides Duddingtonia flagrans (AC001 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Houve redução significativa (p The predatory capacity of one isolate of nematode-trapping fungus Duddingtonia flagrans (AC001 on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. There was significant reduction (p < 0. 01 of 93.64% in the average of infective larvae of cyathostomes recovered of medium WA 2% at seven day. These results show that the isolated AC001 could be used in the biological control of cyathostomes of horses.

Braga Fabio R.

2009-12-01

70

Alcaeorrhynchus grandis (Dallas): an eventual predator of Chlosyne lacinia saundersii Doubleday & Hewitson on sunflower in Northern Paraná State / Alcaeorrhynchus grandis (Dallas): predador eventual de Chlosyne lacinia saundersii Doubleday & Hewitson em girassol no Norte do Estado do Paraná  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Observou-se a ocorrência de Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae: Asopinae) predando larvas da lagarta do girassol Chlosyne lacinia saundersii Doubleday & Hewitson em girassol (Helianthus annuus L.) na Fazenda Experimental da Embrapa Soja, no norte do Paraná, durante janeiro-fev [...] ereiro de 1998. De ovos coletados em campo, ninfas do percevejo foram criadas em laboratório alimentadas com larvas de C. l. saundersii obtidas no campo. As ninfas também foram criadas com larvas da lagarta da soja Anticarsia gemmatalis Hübner obtidas em laboratório, para comparação. Nenhuma ninfa de A. grandis sobreviveu até a idade adulta, atingindo 100% de mortalidade já no 3º instar, quando alimentadas com larvas de C. l. saundersii. Quando alimentadas com larvas de A. gemmatalis, 32,5% das ninfas atingiram a idade adulta. Trata-se do primeiro registro deste predador associado a lagarta do girassol no Norte do Estado do Paraná. Abstract in english [...

Andréa B., Malaguido; Antônio R., Panizzi.

1998-12-01

71

Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.

2009-09-01

72

Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? / A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? O percevejo Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de contro [...] le natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) e Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior), apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores Abstract in english Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natura [...] l control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae), and Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey) depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.

Rafael Braga da, Silva; Alberto Soares, Corrêa; Terezinha Maria Castro, Della Lucia; Alexandre Igor Azevedo, Pereira; Ivan, Cruz; José Cola, Zanuncio.

2012-06-01

73

Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?  

Directory of Open Access Journals (Sweden)

Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae e Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior, apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores

Rafael Braga da Silva

2012-06-01

74

Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae  

Directory of Open Access Journals (Sweden)

Full Text Available Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed flocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time with sentinel was on average 42 ± 17%, 41 ± 17% of which by C. hirundinacea, whereas only 1.2 % by N. fasciata and gave all the alarm calls recorded (54% of the encounters with raptors stimulated alarm calls. A relationship was verified between time with sentinel and the rate of encounters with raptor (ANOVA, F = 3.0, P Bandos mistos de aves incluindo Cypsnagra hirundinacea e Neothraupis fasciata como espécies que vigiam por sentinelas foram estudados em campo-cerrado de março a setembro de 1996. O propósito desse estudo foi verificar a possível relação entre o grau de alerta de uma espécie e a liderança dos bandos. Durante as observações (em média de 2h30 foi quantificado o tempo vigiado por sentinelas de ambas as espécies. Os sentinelas de Cypsnagra hirundinacea realizaram a quase totalidade da vigilância (tempo com sentinela foi em média de 42 ± 17% do tempo, sendo 41 ± 17% vigiado por C. hirundinacea e 1,2% por N. fasciata, além de emitirem todos os chamados de alarme registrados (54% dos encontros com predadores aéreos estimularam chamados de alarme. O tempo vigiado por sentinelas nos bandos apresentou relação significativa com a taxa de encontro entre os predadores aéreos e os bandos (ANOVA, F = 3,0; p < 0,05. Esses resultados evidenciam a função antipredatória dos bandos mistos em campo-cerrado e que o grau de alerta é uma característica relevante em uma espécie líder, uma vez que esses bandos sempre foram liderados por C. hirundinacea.

J. RAGUSA-NETTO

2000-08-01

75

Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) / Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)  

Scientific Electronic Library Online (English)

Full Text Available Bandos mistos de aves incluindo Cypsnagra hirundinacea e Neothraupis fasciata como espécies que vigiam por sentinelas foram estudados em campo-cerrado de março a setembro de 1996. O propósito desse estudo foi verificar a possível relação entre o grau de alerta de uma espécie e a liderança dos bandos [...] . Durante as observações (em média de 2h30) foi quantificado o tempo vigiado por sentinelas de ambas as espécies. Os sentinelas de Cypsnagra hirundinacea realizaram a quase totalidade da vigilância (tempo com sentinela foi em média de 42 ± 17% do tempo, sendo 41 ± 17% vigiado por C. hirundinacea e 1,2% por N. fasciata), além de emitirem todos os chamados de alarme registrados (54% dos encontros com predadores aéreos estimularam chamados de alarme). O tempo vigiado por sentinelas nos bandos apresentou relação significativa com a taxa de encontro entre os predadores aéreos e os bandos (ANOVA, F = 3,0; p Abstract in english Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed fl [...] ocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time with sentinel was on average 42 ± 17%, 41 ± 17% of which by C. hirundinacea, whereas only 1.2 % by N. fasciata) and gave all the alarm calls recorded (54% of the encounters with raptors stimulated alarm calls). A relationship was verified between time with sentinel and the rate of encounters with raptor (ANOVA, F = 3.0, P

J., RAGUSA-NETTO.

2000-08-01

76

Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939) e ácaros predadores (Phytoseiidae) / Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939) and predatory mites (Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939) (AcarirTenuipalpidae) e ácaros predadores (Phytoseiidae), em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0), acrinathrin (0,5); [...] hexythiazox (1,5); amitraz (40,0) e enxofre (225,0). Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização. Abstract in english The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939) (Acari,Tenuipalpidae) and predatory mites (Phytoseiidae) hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0), acrinathrin (0.5), hexythiaz [...] ox (1.5), amitraz (40.0) and sulphur (225.0). The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E., Sato; A., Raga; L.C., Cerávolo; A.C., Cezário; A.C., Rossi.

1995-08-01

77

Field and experimental data indicate that the eastern cottontail (Sylvilagus floridanus) is susceptible to infection with European brown hare syndrome (EBHS) virus and not with rabbit haemorrhagic disease (RHD) virus.  

Science.gov (United States)

The eastern cottontail (Sylvilagus floridanus) is an American lagomorph. In 1966, it was introduced to Italy, where it is currently widespread. Its ecological niche is similar to those of native rabbits and hares and increasing overlap in distribution brings these species into ever closer contact. Therefore, cottontails are at risk of infection with the two lagoviruses endemically present in Italy: Rabbit Haemorrhagic Disease virus (RHDV) and European Brown Hare Syndrome Virus (EBHSV). To verify the susceptibility of Sylvilagus to these viruses, we analyzed 471 sera and 108 individuals from cottontail populations in 9 provinces of north-central Italy from 1999 to 2012. In total, 15-20% of the cottontails tested seropositive for EBHSV; most titres were low, but some were as high as 1/1280. All the cottontails virologically tested for RHDV and EBHSV were negative with the exception of one individual found dead with hares during a natural EBHS outbreak in December 2009. The cottontail and the hares showed typical EBHS lesions, and the EBHSV strain identified was the same in both species (99.9% identity). To experimentally confirm the diagnosis, we performed two trials in which we infected cottontails with both EBHSV and RHDV. One out of four cottontails infected with EBHSV died of an EBHS-like disease, and the three surviving animals developed high EBHSV antibody titres. In contrast, neither mortality nor seroconversion was detected after infection with RHDV. Taken together, these results suggest that Sylvilagus is susceptible to EBHSV infection, which occasionally evolves to EBHS-like disease; the eastern cottontail could therefore be considered a "spill over" or "dead end" host for EBHSV unless further evidence is found to confirm that it plays an active role in the epidemiology of EBHSV. PMID:25828691

Lavazza, Antonio; Cavadini, Patrizia; Barbieri, Ilaria; Tizzani, Paolo; Pinheiro, Ana; Abrantes, Joana; Esteves, Pedro J; Grilli, Guido; Gioia, Emanuela; Zanoni, Mariagrazia; Meneguz, Pier; Guitton, Jean-Sébastien; Marchandeau, Stéphane; Chiari, Mario; Capucci, Lorenzo

2015-01-01

78

Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites  

OpenAIRE

O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 2002. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. ...

Alfredo de Gouvea; Carla Felicita Zanella; Sergio Miguel Mazaro; Joel Donazzolo; Luis Francisco Angeli Alves

2007-01-01

79

Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.

2005-06-01

80

Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997 e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas" e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca"]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae e Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] e do feijoeiro [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae e Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae e Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas.This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott (Homoptera: Cicadellidae and Spodoptera frugiperda (Smith (Lepidoptera: Noctuidae] and bean [Diabrotica speciosa (Germ., Cerotoma arcuata (Oliv. (Coleoptera: Chrysomelidae and Empoasca kraemeri (Ross & Moore (Homoptera: Cicadellidae] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae and Pseudoplusia includens (Walk. (Lepidoptera: Noctuidae were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Cristina Schetino Bastos

2003-06-01

81

Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa / Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azad [...] iractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1) e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa. Abstract in english The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer) and on its predator Eriopis connexa (Germar). Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin) a [...] t concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1) and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1) and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine, Venzon; Maria da Consolação, Rosado; Angelo, Pallini; Amanda, Fialho; Célia de Jesus, Pereira.

2007-05-01

82

Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine Venzon

2007-05-01

83

Effect of prey density on the functional and numerical responses of two species of predaceous mites (Acari: Phytoseiidae) / Efeito da densidade de presa nas respostas funcional e numérica de duas espécies de ácaros predadores (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available Ácaros da família Phytoseiidae são os inimigos naturais de ácaros-praga mais importantes e estudados. Uma questão freqüentemente levantada é se os fitoseídeos podem reduzir altas densidades de ácaros fitófagos a baixos níveis. Os estudos da resposta funcional e numérica podem contribuir para respond [...] er essa pergunta. O objetivo deste trabalho foi avaliar o potencial de predação de Iphiseiodes zuluagai Denmark e Muma e Euseius alatus DeLeon (Acari: Phytoseiidae) como agentes de controle biológico do ácaro fitófago Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vetor do vírus da leprose-dos-citros e da mancha-anular do cafeeiro. Bioensaios foram realizados em laboratório. Fêmeas adultas de cada predador foram individualizadas em arenas de folha de citros com 3 cm de diâmetro. Fases imaturas de B. phoenicis foram oferecidas, como presas, nas seguintes quantidades/arena: 1, 2, 5, 10, 20, 30 e 35 (com sete repetições), 45 (quatro repetições), 55 (três repetições) e 70, 100, 125, 200 e 300 (duas repetições). O número de presas mortas e de ovos colocados pelo predador foram avaliados a cada 24h, durante oito dias. As presas mortas foram diariamente substituídas por novas presas. Para ambos os ácaros predadores foi constatada uma correlação positiva e altamente significativa entre o número de presas oferecidas e mortas. A oviposição média diária também aumentou em função do número de presas mortas. Nas densidades mais baixas, E. alatus matou mais B. phoenicis do que I. zuluagai, e o contrário foi observado nas densidades mais altas. É possível que E. alatus possa reduzir a população de B. phoenicis mesmo em baixas densidades do ácaro fitófago, e que I. zuluagai possa fazer o mesmo nas mais altas. O fato de E. alatus necessitar de menos presas que I. zuluagai sugere que sua sobrevivência possa ser maior do que a de I. zuluagai sob baixa densidade de presa. Abstract in english Phytoseiidae mites are the most important and studied natural enemies of pest mites. A question frequently raised is whether phytoseiid may reduce high densities of phytophagous mites. Studies of functional and numerical responses may help to answer this question. The aim of this work was to evaluat [...] e the potential predation success of Iphiseiodes zuluagai Denmark and Muma and Euseius alatus DeLeon (Acari: Phytoseiidae) on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vector of the citrus leprosis and the coffee ringspot viruses. Bioassays were performed in the laboratory. Adult females of each predator were isolated in arenas made with citrus leaves (3-cm diameter). Immature stages of B. phoenicis were offered as prey, at the following numbers/arena: 1, 2, 5, 10, 20, 30 and 35 (seven replicates), 45 (four replicates), 55 (three replicates) and 70, 100, 125, 200 and 300 (two replicates). The number of killed prey and of eggs laid by the predators was evaluated every 24h, during eight days. Killed prey was replaced daily by new prey. For both predatory mites, a positive and highly significant correlation was found between the numbers of prey offered and killed. The average daily oviposition rate also increased with the number of killed prey. At the lower densities, E. alatus killed and ate more B. phoenicis than I. zuluagai. The opposite was observed at the highest densities. It is possible that E. alatus can reduce B. phoenicis population even at low prey densities, and I. zuluagai can do the same also at high densities. The fact that E. alatus requires less prey than I. zuluagai suggests that its survivorship may be higher than that of I. zuluagai at low prey densities.

Paulo R., Reis; Elber O., Sousa; Adenir V., Teodoro; Marçal, Pedro Neto.

2003-09-01

84

Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis  

Scientific Electronic Library Online (English)

Full Text Available O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.

85

Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil / Dinâmica populacional de Aceria guerreronis Keifer (Acari: Eriophyidae) e predadores associados em frutos de coqueiro no Nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available Aceria guerreronis Keifer pode causar danos severos em coqueiro em vários países ao redor do mundo. Raros estudos têm sido conduzidos para determinar os ácaros predadores associados com A. guerreronis no Brasil. O objetivo deste estudo foi avaliar a prevalência de A. guerreronis e dos predadores ass [...] ociados nas brácteas e na superfície dos frutos abaixo delas, durante 12 meses, em frutos de coqueiro adulto ao longo da costa de Alagoas, Paraíba e Pernambuco, no Nordeste do Brasil. Ácaros de 10 famílias foram encontrados, contudo a espécie mais abundante foi A. guerreronis, correspondendo a 99,5% dos ácaros coletados. Dentre as espécies predadoras prevaleceram os ácaros Phytoseiidae Neoseiulus baraki (Athias-Henriot) e Neoseiulus paspalivorus (De Leon). Estes são achatados e possuem pernas curtas, características que lhes permitem invadir o habitat ocupado por A. guerreronis. Outros predadores foram encontrados, mas em número bem menor, provavelmente pela dificuldade que têm em penetrar nas áreas comumente habitadas por A. guerreronis. Contudo, essas espécies têm potencial de predação sobre o ácaro quando este sai de seu habitat preferido para se dispersar. Não se observaram correlações significativas entre os níveis de fatores abióticos e os níveis populacionais de A. guerreronis ou dos fitoseídeos associados a essa espécie. Isso provavelmente se deu devido aos efeitos simultâneo e conflitante daqueles fatores sobre os ácaros no campo, ou a diferenças significativas entre os fatores climáticos medidos no ambiente e aqueles prevalentes no habitat ocupado por A. guerreronis. Abstract in english Aceria guerreronis Keifer can cause severe damage to coconuts in several countries around the world. Rare studies have been conducted to determine the predatory mites associated with A. guerreronis in Brazil. The study evaluated the prevalence of A. guerreronis and associated predators on the bracts [...] and on the surface of the fruits underneath the bracts, for 12 months, on coconut palms grown along the coast of the States of Alagoas, Paraíba and Pernambuco, Northeastern Brazil. Mites of 10 families were found, but by far the most abundant species was A. guerreronis, corresponding to 99.5% of the mites collected. The prevailing species amongst the predators were the Phytoseiidae mites Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon). These are flat mites that have short limbs, characteristics that allow them to invade the main habitat occupied by A. guerreronis. Other predators were found, but in low numbers, due mainly to their difficulty in reaching the fruit areas most inhabited by A. guerreronis. However, these mites could prey on that pest when it leaves its preferred habitat to disperse. No significant correlations were observed between the levels of abiotic factors and the population levels of A. guerreronis or of the phytoseiids associated with it. This probably occurred due to the simultaneous and conflicting effects of those factors on the mites in the field, or to significant differences between the climatic factors measured in the environment and those prevailing in the habitat occupied by A. guerreronis.

Aleuny C., Reis; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; Rachid, Hanna; Peter, Schausberger; Late E., Lawson-Balagbo; Reginaldo, Barros.

2008-08-01

86

Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado / Insect phitophagous and predators incidence on maize and bean cultivated in exclusive and intercropped systems  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o [...] primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e de predadores nas culturas. Menores densidades populacionais de herbívoros considerados preferenciais da cultura do milho [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) e Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] e do feijoeiro [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) e Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] estiveram associadas ao cultivo consorciado. As densidades de herbívoros generalistas como Thrips tabaci Lind. (Thysanoptera: Thripidae) e Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) foram maiores no feijoeiro consorciado com o milho. No cultivo "das águas", o total de insetos fitófagos foi maior no feijoeiro consorciado com o milho do que no feijoeiro cultivado exclusivamente, sendo que o inverso ocorreu no cultivo "da seca". Os predadores Anthicus sp. (Coleoptera: Anthicidae) e Hymenoptera: Formicidae foram mais abundantes no milho e no feijoeiro cultivados exclusivamente do que as culturas foram consorciadas. Abstract in english This work was carried out in Coimbra, MG,Brazil, during the agricultural year of 1996/97 and it had the objective of evaluating the phytophagous insects and predators occurrence in maize and bean cultivated in exclusive and policultive systems. One cultivation of maize (from 10/25/1996 to 03/24/1997 [...] ) and two cultivation of bean were conducted [the first one from 10/25/1996 to 01/20/1997 (rainy period cultivation) and the second one from 03/25/1997 a 07/21/1997 (drought period cultivation)]. The population of phytophagous insects and predators incident in the cultures were counted directly. Lower herbivores population density, which attacks preferentially maize [Dalbulus maidis (Delong & Wolcott) (Homoptera: Cicadellidae) and Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)] and bean [Diabrotica speciosa (Germ.), Cerotoma arcuata (Oliv.) (Coleoptera: Chrysomelidae) and Empoasca kraemeri (Ross & Moore) (Homoptera: Cicadellidae)] were associated to the intercropped system. The generalists-insect densities as Thrips tabaci Lind. (Thysanoptera: Thripidae) and Pseudoplusia includens (Walk.) (Lepidoptera: Noctuidae) were higher in the bean intercropped with maize. The phytophagous-insect total number was higher in the bean intercropped with maize in the rainy period cultivation than in the bean cultivated exclusively. The opposite happened in the drought period cultivation. The predators Anthicus sp. (Coleoptera: Anthicidae) and Hymenoptera: Formicidae were more abundant in the maize and bean cultivated exclusively than when the cultures were cultivated intercropped.

Cristina Schetino, Bastos; João Carlos Cardoso, Galvão; Marcelo Coutinho, Picanço; Paulo Roberto, Cecon; Paulo Roberto Gomes, Pereira.

2003-06-01

87

Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake / Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD) em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi av [...] aliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade) foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso. Abstract in english The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocer [...] ans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity) were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.

MS., Arcifa; TC., Bunioto; A., Perticarrari; WJ., Minto.

2013-02-01

88

Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea / Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera [...] : Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo. Abstract in english The aphid Schizaphis graminum (Rondani) (Hemiptera: Aphididae) is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus) (Coleo [...] ptera: Coccinellidae). The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

Terezinha Monteiro dos, Santos; Liliane Karla, Figueira; Arlindo Leal, Boiça Júnior; Fernando Mesquita, Lara; Ivan, Cruz.

2003-05-01

89

Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests / Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos  

Scientific Electronic Library Online (English)

Full Text Available Com o objetivo de selecionar ácaros predadores com potencial de controle de ácaros fitófagos do mamão, foram realizadas, de janeiro de 1999 a fevereiro de 2000, amostragens bimensais de ácaros em dois pomares, um orgânico (Silva Jardim, RJ) e outro com controle químico de pragas, doenças e invasoras [...] (Linhares, ES). Todas as espécies presentes nas brotações laterais, folhas novas, folhas velhas e botões florais dos mamoeiros e nas folhas das plantas invasoras foram quantificadas e identificadas ao menos até família. Apesar da relativamente diversa fauna de ácaros, somente representantes de uma família de predadores, Phytoseiidae, foram encontrados. Dentre estes, Neoseiulus idaeus Denmark & Muma destacou-se por sua abundância e freqüência nas diferentes épocas do ano no pomar de Linhares, coincidindo principalmente com as flutuações na abundância dos tetraniquídeos. Tal ocorrência em um sistema de produção com grande emprego de acaricidas, aliada às características biológicas favoráveis dessa espécie, recomendam-na como candidata a agente de controle biológico de ácaros pragas do mamão, em especial Tetranychus urticae Koch. Abstract in english This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where p [...] ests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least family level. Despite the relatively diverse mite fauna, we found representatives of only one family of predacious mites, i.e. Phytoseiidae. Among these, Neoseiulus idaeus Denmark & Muma was the most abundant and frequent during all seasons in the Linhares orchard, coinciding mainly with the fluctuations in abundance of tetranychid mites. Such occurrence in a production system with large use of acaricides, together with its favorable biological traits reported in the literature, lead us to recommend this species as a good candidate for biological control of papaya mite pests, especially Tetranychus urticae Koch.

Karin F.S., Collier; Jose O.G. de, Lima; Gilberto S., Albuquerque.

2004-12-01

90

Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea.The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira Breda

2011-11-01

91

Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido / Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 [...] a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea. Abstract in english The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from [...] 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira, Breda; José Vargas de, Oliveira; Edmilson Jacinto, Marques; Rachel Gonçalves, Ferreira; Mauricéa Fidelis, Santana.

1424-14-01

92

Field tests of predaceous pentatomid pheromones and semiochemistry of Podisus and Supputius species (Heteroptera: Pentatomidae: Asopinae) / Testes de campo com feromônios de pentatomídeos predadores e análise semioquímica de espécies dos gêneros Podisus e Supputius (Heteroptera: Pentatomidae: Asopinae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Armadilhas contendo feromônios sintéticos de Podisus nigrispinus (Dallas) e Supputius cincticeps (Stäl) foram testadas no campo, na Universidade Federal de Viçosa, Minas Gerais, Brasil, a partir de 7 de setembro de 1995. Durante a coleta (setembro-outubro/95), não se observou a presença de P. nigris [...] pinus nas armadilhas em teste. No entanto, diversos adultos (machos e fêmeas) de Podisus distinctus (Stäl) foram coletados durante o mesmo período, bem como, alguns adultos de S. cincticeps e dois parasitóides fêmeas de Cylindromyia atra Roeder (Diptera: Tachinidae). Análises químicas do extrato glandular de machos de P. distinctus indicaram que os principais compostos feromonais desta espécie, também são produzidos por P. nigrispinus e S. cincticeps. Devido a este fato, em 6 de novembro, foram colocadas no campo uma série de armadilhas contendo iscas feromonais tanto de P nigrispinus, como de S. cincticeps. As armadilhas foram monitoradas até 6 de fevereiro de 1996. Durante esta segunda etapa do estudo, observou-se que a combinação das duas iscas feromonais aumentou em seis vezes a coleta de adultos de P. distinctus, em comparação com aquelas onde havia somente a isca para P. nigrispinus. Embora a fenologia para estes asopines neotropicais seja semelhante à do predador norte-americano de clima temperado Podisus maculiventris (Say), menos predadores e parasitóides hospedeiros foram coletados. Possíveis feromônios foram identificados para Podisus rostralis (Stäl), em Goiás, Brasil, e Podisus sagitta (Fabricius), de Honduras. Compostos químicos de outras secreções exócrinas destas espécies neotropicais também foram estudados. Abstract in english Traps baited with synthetic pheromones for either Podisus nigrispinus (Dallas) or Supputius cincticeps (Stäl) were field tested at the Universidade Federal de Viçosa, Minas Gerais, Brazil, beginning September 7, 1995. No P. nigrispinus were caught but, in September and October, several adult males a [...] nd females of P. distinctus (Stäl) were caught along with a few adults of S. cincticeps and two females of a tachinid fly parasitoid, Cylindromyia atra Roeder. Chemical analysis of the pheromone gland extract of P. distinctus males indicated that this species produces a pheromone containing the major compounds of P. nigrispinus and S. cincticeps. Therefore, on November 6 a set of traps was baited with the pheromones of both P. nigrispinus and S. cincticeps, and monitored in the field until February 6, 1996. During this second phase of the study, six times more P. distinctus were caught in the combined pheromone treatment than in traps baited only with the P. nigrispinus pheromone. The phenology of these neotropical asopines is like that for P. maculiventris (Say) in temperate North América, although fewer predators and host-seeking parasitoids were caught. Suspected pheromones were also identified for P. rostralis (Stäl) from Goiás, Brazil, and P. sagitta (Fabricius) from Honduras. In addition, the chemistry of other exocrine secretions from these neotropical species was investigated.

Jeffrey R., Aldrich; José C., Zanuncio; Evaldo F., Vilela; Jorge B., Torres; Ronald D., Cave.

1997-04-01

93

Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.

2012-03-01

94

Ovary development, egg production and oviposition for mated and virgin females of the predator Podisus nigrispinus (Heteroptera: Pentatomidae) / Desenvolvimento ovariano, produção de ovos e oviposição de fêmeas virgens ou acasaladas do predador Podisus nigrispinus (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Insetos Asopinae são predadores generalistas e Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) é a espécie mais estudada desse grupo no Brasil. O objetivo foi avaliar o desenvolvimento ovariano, a produção de ovos e a oviposição de fêmeas de P. nigrispinus virgens ou acasaladas. Cinco fêmea [...] s com 24 horas de idade foram dissecadas e os ovários foram analisados. Quinze fêmeas desse predador foram acasaladas (T1) e outras 15 foram individualizadas sem acasalamento (T2). Os ovários de cinco fêmeas por tratamento foram dissecados e os ovos maduros e em formação foram contados. Cinco fêmeas virgens de P. nigrispinus com 20 dias de idade foram também analisadas. Fêmeas de P. nigrispinus com 24 horas de idade apresentaram baixo desenvolvimento ovariano, sem evidencia de produção de ovócitos. As fêmeas do tratamento T1 apresentaram ovários completamente desenvolvidos, com 22,67 ± 7,26 ovos maduros e 31,33 ± 1,33 ovos em processo de maturação. Ovários de fêmeas do tratamento T2 apresentaram uma quantidade baixa de ovos nos primeiros estágios de maturação (15 ± 1,73). Fêmeas do tratamento T2, dissecadas aos 20 dias, apresentaram 28,33 ± 2,31 e 15 ± 1,96 ovos maduros e imaturos, respectivamente. Fêmeas de P. nigrispinus iniciam a ovogênese e a maturação dos ovos logo após a emergência, porém o acasalamento é importante para manter a produção dos ovos e a oviposição. Abstract in english The Asopinae insects are generalist predators, and Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is the most studied species of this group in Brazil. The objective was to study ovarian development, egg production and oviposition of mated and virgin P. nigrispinus females. Five 24-hours-ol [...] d females were dissected and the ovaries were analyzed. Fifteen females of this predator were mated (T1), and another fifteen were individualized without mating (T2). The ovaries of five females per treatment were dissected and mature and immature eggs were counted. Five virgin females of P. nigrispinus at twenty days old were also analyzed. Twenty-four-hours-old P. nigrispinus females had low ovary development without the evidence of oocyte production. The females of the T1 had completely developed ovaries, with 22.67 ± 7.26 mature eggs and 31.33 ± 1.33 oocytes in the maturation process. Ovaries of females of T2 had a lower quantity of eggs in the early maturation stage (15 ± 1.73). Females of T2 that were dissected at day 20 had 28.33 ± 2.31 and 15 ± 1.96 mature and immature eggs, respectively. Podisus nigrispinus females begin oogenesis and egg maturation soon after their emergence but mating is important to maintain egg production and oviposition.

Marcus Alvarenga, Soares; Joana Darc, Batista; José Cola, Zanuncio; José, Lino-Neto; José Eduardo, Serrão.

2011-12-01

95

A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia  

Scientific Electronic Library Online (English)

Full Text Available O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

Andrew P., Gutierrez; Marina A., Pizzamiglio.

2007-02-01

96

Alternative plants hosts of legume aphids and predators in the province of León, Spain / Plantas hospedadoras alternativas de áfidos de leguminosas y sus predadores, en la provincia de León (España)  

Scientific Electronic Library Online (English)

Full Text Available Durante los meses de primavera, verano y otoño de 1998 y 1999 se observaron al azar cultivos de leguminosas, y las plantas espontáneas marginales e intercalares, en la provincia de León (España). Los cultivos muestreados fueron: Medicago sativa, Phaseolus vulgaris,Pisum sativum, Cicer arietinum, Tri [...] folium repens, Vicia fava, Trifoliumpratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolio y Lens esculenta. Se observaron 23 familias de plantas espontáneas, en ellas y en los cultivos se identificaron los áfidos, su densidad poblacional y de los predadores de las familias Coccinellidae, Syrphidae Chrysopidae. Las familias con mayores registros de los enemigos naturales de los pulgones fueron: Apiaceae, Asteraceae y Chenopodiaceae para Syrphidae y Coccinellidae. Se concluye que el manejo de los agrosistemas, mediante la manipulación de las plantas espontáneas, constituiría un recurso a tener en cuenta para incrementar el potencial de los enemigos naturales de los áfidos plaga de los cultivos de leguminosas. Abstract in english The study was done during the spring, summer and fall of 1998 and 1999. Samples were taken at random from legume crops and spontaneous plants adjacent to them in the province of León (Spain). Observations were made on the following crops: Medicago sativa, Phaseolus vulgaris, Pisum sativum, Cicer ari [...] etinum, Trifolium repens, Vicia fava, Trifolium pratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolius and Lens esculenta. Twenty three families of spontaneous plants were observed. The aphid species and their population densities on the spontaneous plants and crop plants were recorded, as was the presence of members of the families Coccinellidae, Syrphidae and Chrysopidae. The plant families Brassicaceae, Asteraceae and Chenopodiaceae had the greatest numbers of these natural enemies of aphids the manipulation of spontaneous plants in agrosystems is a potential means of increasing populations of natural enemies of aphid pests in legume crops.

Isabel, Bertolaccini; Etelvina, Núñez-Pérez; Emilio Jorge, Tizado.

2011-08-01

97

Ácaros predadores (Acari) associados à cultura do morango (Fragaria sp., Rosaceae) e plantas próximas no Estado do Rio Grande do Sul / Predatory mites (Acari) associated with strawberry and neighboring plants in the State of Rio Grande do Sul  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste estudo foi determinar as espécies de ácaros predadores associados à cultura do morango e em plantas associadas, no estado do Rio Grande do Sul. Este estudo foi conduzido nos municípios de Bom Princípio, Capitão e Lajeado em plantações de morango da variedade Oso Grande em túnel baix [...] o. As avaliações foram feitas mensalmente entre agosto de 2002 e março de 2004. Nas plantas de morango, as amostras foram constituídas de três folhas coletadas em cada uma das 15 plantas escolhidas ao acaso, totalizando 45 folhas/campo. Nas plantas associadas, o esforço de amostragem foi de uma hora para cada planta avaliada. Ácaros das famílias Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae e Tydeidae foram observados associados com o ácaro rajado, Tetranychus urticae Koch, 1836, praga importante na região onde este estudo foi conduzido. Vinte espécies foram identificadas, 14 das quais pertencem à família Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) e Neoseiulus californicus (McGregor, 1954) foram as espécies mais comuns. Nas plantas asssociadas, a maior diversidade foi observada em Richardia sp. (seis espécies), Agerantum conyzoides L.(quatro espécies) e Sonchus oleraceus L., Bidens pilosa L.e Rumex sp. (três espécies). Uma chave docotômica é apresentada para a identificação das espécies. Abstract in english The aim of this study was to determine the species predatory mites on strawberry crop and associated plants in the State of Rio Grande do Sul. It was conducted in Bom Princípio, Capitão and Lajeado counties, in crops of strawberry Oso Grande variety in low tunnels. The evaluations were done monthly [...] between August 2002 and March 2004. In the plants of strawberry, the samples were constituted of three leaves collected in each of 15 plants taken randomly, totaling 45 leaves/field. In the associated plants, the sampling effort was of one hour for each plant evaluated. Mites of the families Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae and Tydeidae were observed associated with the two-spotted spider mite, Tetranychus urticae Koch, 1836, important pest of this crop in the region where the study was conducted. Twenty species were identified, 14 of which belong to the family Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) and Neoseiulus californicus (McGregor, 1954) were the most common species. On associated plants, the highest diversity of predatory mites was found on Richardia sp. (six mite species), Agerantum conyzoides L. (four mite species) and Sonchus oleraceus L., Bidens pilosa L. and Rumex sp. (three mite species). A dichotomous key is presented for the separation of the species collected.

Noeli Juarez, Ferla; Marla Maria, Marchetti; Dinarte, Gonçalves.

98

Seletividade de extratos de nim (Azadirachta indica A. Juss.) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) / Selectivity of neem extracts (Azadirachta indica A. Juss.) to the predatory Mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available A toxicidade relativa dos extratos de folha, semente e óleo de torta de Azadirachta indica A. Juss (nim) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) foi estudada em laboratório. Foram determinadas concentrações discriminatórias (CLs99) dos extratos de folha, semente [...] e óleo de torta de nim para fêmeas adultas de Oligonychus ilicis (McGregor) (Acari: Tetranychidae), através de bioensaios de concentração-mortalidade. Arenas com 3,5 cm de diâmetro, confeccionadas com folhas de cafeeiro flutuando em água, foram impregnadas com resíduo seco dos extratos e usadas para se estimar a seletividade ao ácaro I. zuluagai. As concentrações dos extratos de nim que mataram 99% de O. ilicis, após 72h de exposição foram: 277,4; 520,9 e 10,9 mg/ml, para folha, semente e óleo de torta, respectivamente. A concentração discriminatória do extrato de óleo de torta de nim para fêmeas adultas de O. ilicis foi altamente tóxica ao ácaro I. zuluagai, as dos extratos de folha e de semente foram seletivos. Abstract in english The relative toxicity of the leaf, seed and oil neem cake extracts of Azadirachta indica A. Juss (neem) to the predatory mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) was evaluated. To verify the relative toxicity of these extracts on the predatory mite, discriminating concentrati [...] ons of the extracts were determined for adult females of the Oligonychus ilicis (McGregor) (Acari: Tetranychidae), through the method of concentration-mortality. Coffee leaf disks with 3.5 cm of the diameter were put floating on water and impregnated with dry residue of the extracts. Concentrations of neem extracts which caused mortality (99%) of O. ilicis, after 72h of exposition, were 277.4; 520.9 e 10.9 mg/ml for leaf, seed and oil neem cake, respectively. The discriminating concentration of extract of oil neem cake for O. ilicis females was highly toxic to I. zuluagai; while extract of leaf and seed were selective to the predatory mite.

Sheila A., Mourão; Júlio C.T., Silva; Raul N.C., Guedes; Madelaine, Venzon; Gulab N., Jham; Claudinei L., Oliveira; José C., Zanuncio.

2004-10-01

99

Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants  

Scientific Electronic Library Online (English)

Full Text Available Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.

KARIN F. S., COLLIER; GILBERTO S., ALBUQUERQUE; ÁLVARO E., EIRAS; JACQUELYN L., BLACKMER; MARILAINE C., ARAÚJO; LINO B., MONTEIRO.

2001-12-01

100

Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae) em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas / Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae) in residual toxicity persistence tests  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor), são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando expost [...] o a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA), folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus. Abstract in english Phytoseiid mites, mainly Neoseiulus californicus (McGregor), are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the ins [...] ecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA), leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p

Marcelo Gustavo, Ruiz; Gilberto José de, Moraes.

2008-12-01

101

Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.

1999-12-01

102

Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.

JORGE B., TORRES; CHRISTIAN S.A., SILVA-TORRES; MURILO R., SILVA; JOSINÉLIA F., FERREIRA.

2002-06-01

103

Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

Marcelo Gustavo Ruiz

2008-12-01

104

Aranhas e ácaros predadores em copas de tangerineiras Montenegrina, mantidas sob manejo orgânico, em Montenegro, RS / Spiders and predatory mites in the canopies of organically managed Montenegrina tangerine trees, in Montenegro County, RS  

Scientific Electronic Library Online (English)

Full Text Available O estudo objetivou o levantamento da fauna de aranhas e ácaros com hábito predador, em copas de tangerineiras (Citrus deliciosa var. Montenegrina) em pomar orgânico, situado em Montenegro, RS. Durante um ano, quinzenalmente 24 plantas eram sorteadas e avaliadas em duas regiões da copa, utilizando-se [...] um pano-de-batida (1 m²). Capturou-se o total de 3.129 indivíduos, sendo 2.559 aranhas e 570 ácaros. Em Araneae foram reconhecidas 53 espécies adultas distribuídas em oito famílias, dentre estas, as mais abundantes foram Sphecozone sp. (Linyphiidae) (21,8%) e Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9,9%). No outono observou-se a maior abundância de jovens e adultos (29,2%) e, na primavera, a maior riqueza de espécies (40). Na primavera também se registraram os maiores valores para os índices de Margalef e Shannon-Wiener, este último, porém, não diferiu significativamente dos das demais estações. Os valores de Simpson, em todas as estações foram semelhantes, indicando o mesmo grau de dominância das espécies. Em Acari registraram-se oito espécies, distribuídas em três famílias, as mais abundantes foram Leptus sp.1 (Erythraeidae) (59,4%) e Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). O outono foi a estação mais rica em número de espécies (oito). No inverno observou-se a maior abundância de indivíduos (47%) e, no verão, a menor (0,88%). Entre os ácaros, Phytoseiidae apresentou a maior riqueza. Entre as aranhas, Anyphaenidae foi a que apresentou a maior abundância e Theridiidae, a maior riqueza de espécies, seguindo assim o padrão já observado para o grupo. Abstract in english A survey was conducted to study the spider and predatory mite fauna occurring in the canopies of tangerine trees (Citrus deliciosa Tenore, cultivar Montenegrina) of an organically managed orchard, at Montenegro County, RS. During a year, fortnightly, 24 randomly trees were selected and sampled in tw [...] o canopies areas, by using a sheet of white cloth (1 m²). A total of 3,129 arachnids were collected, being 2,559 spiders and 570 mites. Based on the adults, 53 species of Araneae were recognized, belonging to eight families. Among those, the most abundant were Sphecozone sp. (Linyphiidae) (21.8%) and Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9.9%). Autumn exhibited the greatest abundance of young and adults of Araneae (29.2%) and spring was the season richest in species (40). Margalef and Shannon-Wiener diversity indexes also showed the highest values in spring. The latter index did not show differences among seasons. Simpson complementary index was equal among seasons, reflecting the same degree of species dominance. In Acari, eight species were identified in three families. The most abundant species were the mites Leptus sp.1 (Erythraeidae) (59.4%) and Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). Autumn was the season richest in mite species (eight). The highest abundance (47%) was observed on winter and the lowest (0.88%) on summer. Among mites, Phytoseiidae showed the highest richness. Among the spiders, Anyphaenidae was the most abundant and Theridiidae had the highest species richness, following the patterns observed for the group.

Rosana M. de, Morais; Ricardo, Ott; Ana P., Ott; Luiza R., Redaelli.

2007-12-01

105

Acão de Inseticidas Organofosforados Utilizados no Controle de Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) Sobre o Ácaro Predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Action of Organophosphate Insecticides Used to Control Leucoptera coffeella (Guérin-Mèneville) (Lepidotera: Lyonetiidae) on the Predator Mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O controle químico apresenta vantagens como economicidade e rapidez de ação, e tem sido preferencialmente usado no controle de pragas pelos agricultores. Em contrapartida, entre as desvantagens destaca-se o largo espectro de ação dos compostos, que atingem espécies não-alvos, como inimigos naturais, [...] além de contaminarem o meio ambiente. O presente trabalho avaliou a ação dos inseticidas clorpirifós, dissulfotom, etiom e paratiom-metílico, normalmente usados para controlar o bicho-mineiro-do-cafeeiro Leucoptera coffeella (Guérin-Mèneville), sobre o ácaro predador Iphiseiodes zuluagai Denmark & Muma, agente de controle dos ácaros fitófagos Oligonychus ilicis (McGregor) e Brevipalpus phoenicis (Geijskes) em agroecossistema cafeeiro. Para verificar o efeito seletivo dos compostos sobre o ácaro predador, concentrações discriminatórias (CLs99) dos quatros inseticidas foram determinadas para o 3º instar larval de L. coffeella, através do método de bioensaios de concentração-mortalidade em papel-filtro, impregnado com resíduo seco de inseticidas. O clorpirifós causou 100% de mortalidade dos ácaros testados; o etiom e o paratiom-metílico causaram 34% e 19% de mortalidade, respectivamente. Dissulfotom foi o mais seletivo em favor do predador, não mostrando ação letal. O efeito diferenciado dos inseticidas foi desta forma verificado, e tal informação possibilita a utilização dos inseticidas seletivos no agroecossistema cafeeiro, preservando populações de I. zuluagai e favorecendo o controle biológico exercido pelo ácaro predador. Abstract in english Chemical control has been preferentially used to suppress pests by farmers mainly due to low price of the products and immediate action on target organisms. However, wide action range of the compounds, undesirable effects on non target organisms and the contamination of the environment are among the [...] disadvantages of this method of control. This study evaluated the action of the insecticides chlorpyrifos, disulfoton, ethion and methyl-parathion, normally used to control the coffee leaf-miner, Leucoptera coffeella (Guérin-Mèneville), on the predaceous mite Iphiseiodes zuluagai Denmark & Muma, a control agent of the phytophagous mites Oligonychus ilicis (McGregor) and Brevipalpus phoenicis (Geijskes) in coffee plantation. Discriminatory concentrations (LC99), established on the 3rd instar of L. coffeella, by means of the method of dry insecticide residues impregnated in filter paper, were used to verify the selectivity of the insecticides on the predaceous mite. The insecticide chlorpyrifos caused 100% of mortality in I. zuluagai. Ethion and methyl-parathion showed mortality of 34% and 19%, respectively. Disulfoton presented the highest selectivity for the mite, with no lethal action on the predator. The different effects found on the insecticides' action show that it is possible to use the selective insecticides in coffee plantation to preserve populations of I. zuluagai, thus favouring the biological control on phytophagous mite.

DANIEL B., FRAGOSO; PEDRO, JUSSELINO FILHO; ANGELO, PALLINI FILHO; CÉSAR A., BADJI.

2002-07-01

106

Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.

2012-09-01

107

Toxicidade de produtos fitossanitários utilizados na cultura do cafeeiro a larvas de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e efeitos sobre as fases subseqüentes do desenvolvimento do predador / Toxicity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and their effects on subsequent stages of the predator  

Scientific Electronic Library Online (English)

Full Text Available Avaliou-se a seletividade fisiológica de alguns produtos fitossanitários utilizados em cafeeiro a larvas de Chrysoperla externa (Hagen) e seus reflexos nas fases subseqüentes do desenvolvimento do predador. Os tratamentos avaliados, em g i.a./L de água foram: 1- endosulfam (Thiodan 350 CE - 1,75), 2 [...] - clorpirifós (Lorsban 480 CE - 1,2), 3- betaciflutrina (Turbo 50 CE - 0,013), 4- enxofre (Kumulus 800 PM - 4,0), 5- azociclotina (Peropal 250 PM - 0,31), 6- oxicloreto de cobre (Cuprogarb 500 PM - 5,0) e 7- testemunha (água). As pulverizações foram realizadas em larvas de primeiro, segundo e terceiro ínstares de C. externa, por meio de torre de Potter. Em seguida, as larvas foram individualizadas em tubos de vidro e mantidas em câmara climatizada regulada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12h. A toxicidade dos produtos foi calculada em função do seu efeito total (E) e categorizada conforme escala proposta pela IOBC. Clorpirifós e betaciflutrina foram nocivos a larvas de primeiro ínstar (E > 99%) e os demais foram seletivos. Clorpirifós foi também tóxico a larvas de segundo e terceiro ínstares, sendo os demais compostos inócuos ao predador (E Abstract in english The objective was to evaluate the selectivity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) and their effects on the subsequent developmental stages of the predator. The treatments in g a.i./L of water were: 1 - endosulfan (Thiodan 350 CE - 1.75), 2 - chlorpyrifos (Lors [...] ban 480 CE - 1.2), 3 - betacyfluthrin (Turbo 50 CE - 0.013), 4 - sulphur (Kumulus 800 PM - 4.0), 5 - azocyclotin (Peropal 250 PM - 0.31), 6 - copper oxichloride (Cuprogarb 500 PM - 5.0) and 7 - control (water). The products were sprayed on first, second and third-instar larvae using a Potter's tower. The larvae were individualized in glass tubes and maintained at 25 ± 2ºC, RH of 70 ± 10% and 12h photophase. The toxicity of the pesticides was calculated based in their total effect (E) and classified according to recommendations of IOBC. Chlorpyrifos and betacyfluthrin were harmful to first-instar larvae (E > 99%). Endosulfan, sulphur, azocyclotin and copper oxichloride were harmless to first-instar larvae and the others were selective. Chlorpyrifos was also toxic to second and third-instar larvae, and the other compounds were selective (E

Rogério A., Silva; Geraldo A., Carvalho; César F., Carvalho; Paulo R., Reis; Antônio M.A.R., Pereira; Luciano V., Cosme.

2005-12-01

108

Biología y comportamiento de Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) como predador de Panonychus citri (McGregor) (Acari: Tetranychidae) / Biology and behavior of Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) as a predator of Panonychus citri (McGregor) (Acari: Tetranychidae)  

Scientific Electronic Library Online (English)

Full Text Available Panonychus citri (McGregor) es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencia [...] l de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR). El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día. Abstract in english Panonychus citri (McGregor) is an important citrus pest in the central coast of Peru. Amblyseius chungas Denmark & Muma was the most frequent and abundant predatory mite during some surveys for natural enemies against P. citri in that region. We studied the duration of P. citri by immature stages of [...] A. chungas and analyzed its predatory behavior when female adults of A. chungas were fed with P. citri nymphs and adults. The experiments were carried out in the laboratory (20-25ºC and 70-80 % RH). Development time from egg to adult was 6.60 ± 0.57 days in females and 6.46 ± 0.44 days in males. Female adults of A. chungas fed with different densities of adults and/or nymphs of P. citri showed a functional response type II according with the classification proposed by Holling. Oviposition of A. chungas ranged from 1 to 3 eggs/day.

Alberto Daniel, Guanilo; Norberta, Martínez.

2009-12-01

109

Dinâmica populacional de ácaros (Acari) em erva-mate (Ilex paraguariensis St. Hil.: Aquifoliaceae) / Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi realizado em Dois Vizinhos, PR, com o objetivo de estudar a dinâmica populacional de ácaros fitófagos e seus predadores em plantas de erva-mate (Ilex paraguariensis St. Hil. Aquifoliaceae). Folhas de diferentes partes da planta foram coletadas de agosto de 2001 a julho de 2002, e o [...] s ácaros presentes foram contados sob microscópio estereoscópico. Foram encontradas associadas às plantas de erva-mate duas espécies de ácaros fitófagos Dichopelmus notus Keifer, e Oligonychus yothersi (McGregor), e três espécies de predadores identificados como sendo Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp. O ácaro D. notus ocorreu em maior número na face inferior de folhas, em folhas maduras e em folhas dos estratos inferior e médio. O. yothersi predominou em folhas maduras. A concentração de E. concordis e I. zuluagai sempre foi maior na face inferior de folhas, em folhas maduras, em folhas dos estratos inferior e médio e na região interna da copa. Os ácaros D. notus, O. yothersi, E. concordis e I. zuluagai tiveram picos populacionais em período de temperatura amena e baixa precipitação pluviométrica. A maior densidade populacional de Agistemus sp. ocorreu na face inferior das folhas e seu pico populacional ocorreu em período de alta temperatura e precipitação pluviométrica elevada. Abstract in english The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samp [...] les from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain.

Alfredo de, Gouvea; Luiz C., Boaretto; Carla F., Zanella; Luis F.A., Alves.

2006-02-01

110

Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker / Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os p [...] redadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos) e H. convergens (43 indivíduos) foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo. Abstract in english The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when p [...] redators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals) and H. convergens (43 individuals) were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.

MA, Medeiros; PA, Ribeiro; HC, Morais; M, Castelo Branco; ER, Sujii; ML., Salgado-Laboriau.

2010-05-01

111

Efeito das plantas do algodoeiro e do tomateiro, como complemento alimentar, no desenvolvimento e na reprodução do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of cotton and tomato plants as complementary food on development and reproduction of the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A alimentação em plantas pelo percevejo predador Podisus nigrispinus (Dallas) tem produzido efeitos na sua biologia que variam com a espécie de planta utilizada. Este estudo foi conduzido com o objetivo de avaliar o desenvolvimento e a reprodução de P. nigrispinus confinado sobre as folhas de algodo [...] eiro Gossypium hirsutum cv. Precoce CNPA1 e tomateiro industrial Lycopersicum esculentum cv. IPA5, e alimentados com pupas de Tenebrio molitor (L.). Ninfas e adultos de P. nigrispinus foram confinados com presa sobre algodoeiro, presa sobre tomateiro, com presa e água, e somente presa. O acesso às plantas foi obtido confinando os predadores nas folhas das plantas cultivadas em vasos. Ninfas confinadas em algodoeiro e tomateiro mais presa apresentaram menor duração no segundo e quinto ínstares. No entanto, o menor período ninfal foi observado para ninfas confinadas em algodoeiro mais presa. A sobrevivência de ninfas em cada ínstar e em todo o estágio ninfal foi menor para ninfas mantidas somente com presa comparado com aquelas com presa mais água e com presa sobre a planta. A disponibilidade do algodoeiro juntamente com a presa produziu ninfas de quinto ínstar mais pesadas, quando comparado com o tomateiro mais presa, água mais presa, e somente presa. O peso de adultos na emergência foi menor apenas quando os insetos tiveram acesso somente à presa. No entanto, fêmeas de P. nigrispinus confinadas sobre folhas de algodoeiro com presa ou mantidas com presa e água apresentaram significativo aumento de peso ao iniciar a reprodução, enquanto fêmeas confinadas sobre folhas de tomateiro ou somente com presa não variaram seu peso. A disponibilidade do algodoeiro e do tomateiro proporcionou aumento na produção de ovos e longevidade de P. nigrispinus. Além disso, as fêmeas mantidas com presa sobre as folhas de algodoeiro apresentaram maior taxa de oviposição. Baseado nos parâmetros populacionais taxa reprodutiva, taxa intrínseca de crescimento populacional e tempo médio de geração, conclui-se que o crescimento populacional de P. nigrispinus pode ser melhorado de acordo com o tipo de planta disponível, apresentando melhores resultados quando os insetos foram confinados sobre folhas de algodoeiro, seguido pelo confinamento dos adultos sobre o tomateiro. Além disso, a disponibilidade de água juntamente com a presa também propiciou melhor desenvolvimento da espécie. Abstract in english The occasional feeding on plants by Podisus nigrispinus (Dallas) has produced different responses on its biology according to the plant species available. This study was undertaken to determine the development and reproduction of P. nigrispinus when confined on Gossypium hirsutum cv. Precocious CNPA [...] 1 and processing tomato Lycopersicum esculentum cv. IPA5 plants, using Tenebrio molitor (L.) pupa as prey. Nymphs and adults of P. nigrispinus were provided with prey and plants of cotton, prey and plant of tomato, prey and water, and only the prey. The predator could access the plants by caging nymphs and prey on plant leaves cultivated in pots. Nymphs caged on cotton or tomato plants with prey showed shorter duration of second and fifth ínstars. However, the shortest development period was observed for nymphs caged on cotton plants with prey. Nymphs fed on prey alone had lower survival within each ínstar and for the whole stage when compared to nymphs accessing plant, prey and water. The availability of cotton plants to nymphs produced heavier individuals compared to tomato plants, prey and water, and only prey. The adult weight at emergence was similar between plants and prey plus water, and superior to the treatment with prey alone. However, females of P. nigrispinus with access to the prey and cotton plant and prey and water showed significant body weight increase at the beginning of the reproductive activity, while females confined on tomato plants and only on prey did not range their weight during their lives. The availabilit

JOSÉ E.M., OLIVEIRA; JORGE B., TORRES; ALBERTO F., CARRANO-MOREIRA; REGINALDO, BARROS.

2002-03-01

112

IN VITRO CONTROL OF INFECTIVE CYATHOSTOMES LARVAE (NEMATODE: CYATHOSTOMINAE FROM EQUINES USING PREDACIOUS FUNGUS Duddingtonia flagrans, Monacrosporium thaumasium e Arthrobotrys robusta CONTROLE IN VITRO DE LARVAS INFECTANTES DE CIATOSTOMÍNEOS (NEMATODA: CYATHOSTOMINAE DE EQUINOS UTILIZANDO OS FUNGOS PREDADORES Duddingtonia flagrans, Monacrosporium thaumasium e Arthrobotrys robusta  

Directory of Open Access Journals (Sweden)

Full Text Available The predatory capacity of three isolates of the nematodes predacious fungi Duddingtonia flagrans (AC001, Monacrosporium thaumasium and Arthrobotrys robusta on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%. The isolates AC001, NF34 and I31 had presented significant reduction (p<0.01 de 97.5%, 72.5% e 85% respectively in the average of infective larvae of ciathostomes recovered of the medium WA2% in the end of five days. The results of this assay evidence that these isolates could be used in the biological control of ciathostomes of equines.

KEY WORDS:  Arthrobotrys robusta, Cyathostominae, equine, Duddingtonia flagrans, Monacrosporium thaumasium, Nematophagous fungi.

A capacidade predatória de três isolados de fungos predadores de nematoides Duddingtonia flagrans (AC001, Monacrosporium thaumasium (NF34 e Arthrobotrys robusta (I31 sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%. Os isolados AC001, NF34 e I31 apresentaram redução significativa (p<0,01 de 97,5%, 72,5% e 85%, respectivamente, na média de larvas infectantes de ciatostomíneos recuperadas do meio AA2% ao final de sete dias. Os resultados deste ensaio evidenciam que esses isolados poderão ser utilizados no controle biológico de ciatostomíneos de equinos.
 
PALAVRAS-CHAVES: Arthrobotrys robusta, ciatostomíneos, equinos, Duddingtonia flagrans, fungos nematófagos, Monacrosporium thaumasium.

André Ricardo Silva

2009-09-01

113

Efeito da idade das fêmeas e de fatores ambientais sobre a reprodução do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae - DOI: 10.4025/actascibiolsci.v25i2.2014 Effect of female age and environmental factors on reproduction of the predator Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae - DOI: 10.4025/actascibiolsci.v25i2.2014  

Directory of Open Access Journals (Sweden)

Full Text Available Os fatores bióticos e abióticos afetam o potencial reprodutivo dos insetos. Portanto, estudou-se o efeito da idade das fêmeas e de fatores ambientais sobre a reprodução de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae. Adultos do predador foram criados em gaiolas de PVC, fechadas na parte superior com tecido de malha fina (organza, colocadas sobre plantas de algodão em casa-de-vegetação. A maior produção de ovos por fêmea (87,7 ovos ocorreu aos 49 dias, e a menor (32,2 ovos, aos 63 dias de idade. O reacasalamento ocorreu após o esgotamento das reservas espermáticas, a partir do 28o dia. A fecundidade de fêmeas de C. externa aumentou com a elevação da umidade relativa do ar. Verificou-se, também, um rápido desenvolvimento embrionário com a elevação da temperatura e com fêmeas longevas. Esses resultados fornecem subsídios para o conhecimento da reprodução de C. externa em algodoeiroThe biotic and abiotic factors affect the reproductive potential of insects. Thus, the effects of female age and environmental factors on reproduction of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae were studied. Adults of the predator were reared in "PVC" cages, closed in the upper portion with a thin mesh, organdie, placed on cotton plants at a greenhouse. The largest production of eggs by female (87.7 eggs occurred with 49 days and the smallest (32.2 eggs with 63 days of female age. The remating occurred after the exhaustion of spermatic reservations, starting on 28th day. The fecundity of C. externa females increased with elevation of the relative humidity of air. It was also verified a fast embryonic development with increase of temperature and female age. All these results supply subsidies for knowledge of the reproduction of C. externa in cotton system

Cesar Freire Carvalho

2003-04-01

114

Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.

2007-04-01

115

Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) / Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiu [...] lus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.). A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos. Abstract in english The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L) and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L) over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus m [...] acropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.). The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann, Schlesener; Adriane Fonseca, Duarte; Milton Fernando Cabezas, Guerrero; Uemerson Silva da, Cunha; Dori Edson, Nava.

2013-03-01

116

Efeito da suplementação de folhas de Eucalyptus urophylla no desenvolvimento e reprodução do predador Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) / Effect of supplementary feeding on Eucalyptus urophylla leaves in the development and reproduction of the predatory bug Supputius cincticeps (Stal) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se o efeito da alimentação suplementar de folhas de Eucalyptus urophylla, no desenvolvimento e reprodução de Supputius cincticeps (Stal) em laboratório. S. cincticeps foi alimentado com Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) ou T. molitor mais mudas de E. urophylla. A inclusão da [...] planta na alimentação de S. cincticeps, aumentou sua taxa líquida de reprodução Ro (de 7,15 para 24,05), a razão infinitesimal rm (de 0,034 para 0,052), e a razão finita de aumento populacional 1 (de 1,035 para 1,053), em relação ao uso isolado da presa. Conseguiu-se, ainda, aumentar os índices de sobrevivência, a longevidade e a expectativa de vida média para metade da população (ex50), sendo 50,8 e 64,9 dias para os percevejos alimentados com presa e com presa e planta, respectivamente. O predador S. cincticeps apresentou hábitos alimentares que incluem fitofagia e a inclusão da planta na sua dieta, foi vantajosa para a sua criação massal. Abstract in english The effect of supplementary feeding of Supputius cincticeps (Stal) on Eucalyptus urophylla leaves was evaluated in the laboratory. S. cincticeps was fed with Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) larvae or T. molitor larvae plus E. urophylla. The inclusion of this plant for S. cincticeps [...] feeding increased its net reproductive rate (Ro) from 7.15 to 24.05, its infinitesimal ratio (rm) from 0.034 to 0.052, and the finite population increase (1) from 1.035 to 1.053, compared to feeding only with the prey. S. cincticeps fed both plant and prey showed higher survival rate, longevity, and life span for half of the population (ex50), which was 50.8 and 64.9 for bugs fed the prey, and prey and plant, respectively. The inclusion of the plant also increased the reproduction rate of S. cincticeps, thus being recommended for mass rearing of this predator.

Sebastião L., Assis Jr.; Teresinha V., Zanuncio; Germi P., Santos; José C., Zanuncio.

1998-06-01

117

Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann Schlesener

2013-03-01

118

Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

Márla Maria, Marchetti; Noeli Juarez, Ferla.

2011-06-01

119

Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil Diversity and population fluctuation of mites (Acari in blackberry (Rubus fruticosus, Rosaceae in the state of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae, raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9% and Tetranychidae (13.9%, composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2.1% and Phytoseiidae (0.4% were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae the most common predaceous species.

Márla Maria Marchetti

2011-06-01

120

Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez, Ferla; Gilberto José de, Moraes.

2006-04-01

121

Exigências térmicas e potencial de desenvolvimento dos parasitóides Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) em ovos do percevejo predador Podisus nigrispinus (Dallas) / Thermal requirements and development of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) on the predator stinkbug Podisus nigrispinus (Dallas)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O desenvolvimento e a viabilidade dos parasitóides de ovos Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) foram estudados em cinco temperaturas constantes de 17 a 32°C, em seu hospedeiro, o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatom [...] idae). A duração do período ovo-adulto das fêmeas foi de 10,8 dias (32°C) a 48,6 dias (17°C) para T. podisi e de 10,2 dias (32°C) a 35,4 dias (17°C) para T. brochymenae. A viabilidade, em todas as temperaturas, manteve-se entre 89,0 e 92,7% para T. brochymenae, com redução significativa da viabilidade de T. podisi nas temperaturas extremas de 17 e 32°C. A temperatura base e a constante térmica, para o desenvolvimento das fêmeas foram de 11,1°C e 9,5°C e de 205,3 e 214,7 graus dias, para T. podisi e T. brochymenae, respectivamente. O número de gerações por ano, para os parasitóides e o hospedeiro, estimado com base nas temperaturas de áreas de cultivo de eucalipto, foram de 22,6; 23,9 e 10,2, para T. podisi, T. brochymenae e P. nigrispinus, respectivamente. Essas observações indicam que T. brochymenae é melhor adaptado a variações de temperaturas que T. podisi, no entanto, as duas espécies parasitam com sucesso P. nigrispinus. Abstract in english Development and viability of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) were studied at five constant temperatures ranging from 17°C to 32°C on its host, the predatory bug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae). Fema [...] le development from egg to adult ranged from 10.8 days (32°C) to 48.6 days (17°C) for T. podisi, and from 10.2 days (32°C) to 35.4 days (17°C) for T. brochymenae. Parasitism viability ranged from 89.0 to 92.7% for T. brochymenae. However, T. podisi viability decreased in lower and higher temperatures. Lower threshold temperatures for egg to adult female development was estimated at 11.1°C for T. podisi and 9.5°C for T. brochymenae. Thermal requirements for this period was 205.3 and 214.7 degree-days for T. podisi and T. brochymenae, respectively. Number of generations per year of these parasitoids and its host, considering the temperature conditions of eucalyptus areas, were estimated to be 22.6, 23.9 and 10.2 for T. podisi, T. brochymenae and P. nigrispinus, respectively. These results indicate that T. brochymenae is better adapted to temperature variations than T. podisi, however, both species can successfully parasitize P. nigrispinus.

Jorge B., Torres; Dirceu, Pratissoli; José C., Zanuncio.

1997-12-01

122

Composição faunística de insetos predadores em fragmento florestal e em área de hortaliças na região de Jaboticabal, Estado de São Paulo - DOI: 10.4025/actascibiolsci.v25i2.2015 Faunal composition of predator insects in forest fragment and area of vegetables in Jaboticabal region, state of São Paulo, Brazil - DOI: 10.4025/actascibiolsci.v25i2.2015  

Directory of Open Access Journals (Sweden)

Full Text Available Efetuou-se um levantamento populacional em área de fragmento florestal e em área de hortaliças, entre novembro de 1996 a fevereiro/1998, visando determinar as espécies de insetos predadores e a influência de fatores abióticos. A amostragem foi efetuada semanalmente por meio de armadilha luminosa, aplicando-se aos resultados análise faunística e correlação simples com temperatura, umidade relativa e precipitação. No fragmento florestal foi observado maior semelhança na abundância de espécies do que na área de hortaliças, mas neste hábitat capturou-se maior número de indivíduos (95%. As espécies Metius sp., Polpochila impressifrons (Dej., Eulissus sp. e Doru sp. foram predominantes nas duas áreas, evidenciando a importância dessas espécies como predadoras de pragas de hortaliças. Arthrostictus speciosus (Dej. e Leptotrachelus sp. predominaram no fragmento florestal, o mesmo ocorrendo com Paederus sp. na área de hortaliças. Esta espécie deve preferir locais abertos e quentes, enquanto A. speciosus e Leptotrachelus sp. podem estar melhor adaptadas para locais escuros e úmidos de florestasA population survey was carried out in a forest fragment and in an area of vegetables, from November/1996 to February/1998, aiming to determine the predator insect species and the influence of abiotic factors. The samples were taken weekly by light traps. The results were evaluated using faunistic analysis and simple correlation with temperature, relative humidity and rainfall. In the forest fragment higher similarity in the abundance of species was observed comparing to the area of vegetables, but the largest number of captured individuals (95% occurred in this last habitat. Metius sp., Polpochila impressifrons (Dej., Eulissus sp. and Doru sp. were predominant species in both areas, evidencing they may play an important role as pest predators in areas of vegetables. Arthrostictus speciosus (Dej. and Leptotrachelus sp. predominated in the forest fragment, and the same was observed with Paederus sp. in the vegetable area. This species is probably adapted for open and hot places, while A. speciosus and Leptotrachelus sp. can be adapted for dark and humid places of forests

Luciano Kenji Sakemi

2003-04-01

123

Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

Héctor Guerra, Hernández.

2014-06-01

124

Contribuição ao conhecimento de alguns Ithomiidae brasileiros, predadores de Solanáceas (Lep., Rhopalocera)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This paper is a small contribution to the knowledge of some species of brazilian Ithomiidae (Lep., Rhop.). The Author, during the year 1950, had an oportunity to study the development of the following species: Mechanitis lysimnia Fabr. Mechanitis polymnia casabranca Hsch. Dircenna dero Hübn. Methona [...] themisto (Hübn.) The three first species live, in Piracicaba (State of São Paulo, Brasil), on Solanum variabile Mart., damaging its leaves, Mechanitis polymnia casàbranca being a serious enemy of this medicinal plant. The Author presents some notes on the biological cycle of M. lysimnia, which confirm D'Almeida's observations. Methona themisto is an old pest of Brunfelsia hopeana Benth. In Argentine, according to Hayward's observations, it occurs on Brunfelsia pauciflora Benth. The biology of this species previously has been studied by Figueiredo (1939). In Piracicaba it is not an enemy of B. hopeana on which it is reported to be so harmful elsewhere. The Author's observations were made in the Laboratory of Zoology of the Escola Superior de Agricultura "Luiz de Queiroz" in order to protect the larvae from the attack of their possible natural enemies. Notwithstanding, the Mechanitis polymnia casabranca caterpillars were attacked by an interesting Salticidae, identified by Hélio Camargo as Hasarius adan-soni (Audouin, 1827).

Luiz Gonzaga E., Lordello.

125

Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentrações que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.

GUSMÃO MARCOS RAFAEL

2000-01-01

126

Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae  

Directory of Open Access Journals (Sweden)

Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae. Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90 calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris.

MOURA MARCELO FIALHO DE

2000-01-01

127

Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) na costa do Rio de Janeiro, Brasil / Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) occurrence in Rio de Janeiro coast, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia). [...] Abstract in english The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia). [...

Lydia M. S., Oliveira; Lídia M. Y., Oshiro.

1256-12-01

128

Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae occurrence in Rio de Janeiro coast, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia.The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia.

Lydia M. S. Oliveira

2006-12-01

129

Diversidade de ácaros (Arachnida: Acari) em Coffea arabica L. cv. Mundo Novo, nos municípios de Jeriquara e Garça, Estado de São Paulo / Diversity of mites (Arachnida: Acari) on Coffea arabica L. cv. 'Mundo Novo' in Jeriquara and Garça counties, state of São Paulo  

Scientific Electronic Library Online (English)

Full Text Available O presente estudo teve como objetivo caracterizar a diversidade de ácaros em cafeeiros da cultivar Mundo Novo em duas importantes regiões produtoras (Jeriquara e Garça) do Estado de São Paulo. Para tanto, foram coletadas amostras quinzenais de folhas, ramos e frutos, entre abril de 2001 e junho de 2 [...] 003, do terço médio de 10 plantas tomadas ao acaso em cada campo. De cada planta foram tomadas 12 folhas (cada uma do terceiro ou quarto par a partir da extremidade distal de um ramo), 12 ramos (25 cm apicais) e 100 frutos. Foram coletados no total 13.052 ácaros nos dois locais estudados, sendo 7.155 em Jeriquara e 5.897 em Garça. De um total de 108 espécies de ácaros coletados de plantas de café neste estudo, 45 espécies foram observadas em ambos os locais estudados, que apresentaram similaridade de 56%. O número de espécies encontradas exclusivamente em Jeriquara (47) foi aproximadamente três vezes superior ao número de espécies observadas somente em Garça (16). Em Jeriquara, a diversidade foi maior tanto na superfície das folhas, quanto nas domácias, ramos e frutos. Nos dois locais estudados, Brevipalpus phoenicis (Geijskes, 1939) e Oligonychus ilicis (McGregor 1919) foram as espécies de fitófagos mais abundantes e freqüentes. Os estigmeídeos e fitoseídeos foram os ácaros predadores mais abundantes e freqüentes em ambos locais. As espécies mais abundantes e freqüentes de predadores foram Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970 e Euseius concordis (Chant 1959) em Jeriquara; e Z. malvinae, E. citrifolius e E. concordis em Garça. Abstract in english The objective of this study was to characterize the diversity of mites on coffee plants of the Mundo Novo cultivar in two important coffee producing areas (Jeriquara and Garça) in the state of São Paulo. Samples of leaves, branches and fruits were fortnightly collected, from April 2001 to June 2003, [...] from the middle third of 10 plants randomly taken from each field. Twelve leaves (each leaf from the third or forth pair from the distal part of each branch), 12 branches (apical 25 cm) and 100 fruits. A total of 13,052 specimens were collected in the two studied places, 7,155 in Jeriquara and 5,897 in Garça. From a total of 108 mite species collected from coffee plants in this study, forty five species were collected in both studied fields, which presented 56% of similarity. The number of species found exclusively in Jeriquara (47) was approximately three times higher than the number of species observed only in Garça (16). For Jeriquara, the diversity of mites on surface of leaves, as well as in domatia, and on branches and fruits was higher than for Garça. In both studied areas, Brevipalpus phoenicis (Geijskes, 1939) and Oligonychus ilicis (McGregor 1919) were the most abundant and frequent phytophagous mite species. Stigmaeids and phytoseiids were the most abundant and frequent predaceous mites in both localities. The most abundant and frequent predaceous species were Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970, and Euseius concordis (Chant 1959) in Jeriquara; and Z. malvinae, E. citrifolius and E. concordis in Garça.

Jeferson L. de C., Mineiro; Mário E., Sato; Adalton, Raga; Valter, Arthur; Gilberto J. de, Moraes; Fernando de O., Sarreta; Alex, Carrijo.

130

Ocorrência e flutuação populacional de ácaros associados a seringais vizinhos de fragmentos de cerrado / Occurrence and fluctuation of mite populations associated with rubber tree crop neighbor of fragments of cerrado  

Scientific Electronic Library Online (English)

Full Text Available O conhecimento básico da ocorrência sazonal dos ácaros pode fornecer dados para elaboração de programas de manejo ecológico a serem implantados com sucesso no futuro. O objetivo deste estudo foi determinar a riqueza de espécies e a sazonalidade da acarofauna presente em dois campos de seringueira vi [...] zinhos de áreas nativas, no município de Itiquira, MT. Ao longo de um ano, foram realizadas 25 coletas quantitativas em seringueiras vizinhas a dois fragmentos de Cerrado (Cerradão e Mata Ripária). Foram registrados 199.380 ácaros, de 48 espécies, pertencentes a 15 famílias. Dessas, 13 espécies são fitófagas, 18 predadoras e 17 micófagas ou de hábito alimentar desconhecido. Três espécies fitófagas representaram mais de 97% dos ácaros coletados: Phyllocoptruta seringueirae Feres (80,8%), Tenuipalpus heveae Baker (12,7%) e Calacarus heveae Feres (3,6%). Entre os predadores, os mais abundantes foram Agistemus sp., Scirula sp. e Euseius concordis (Chant). Vinte e oito espécies foram comuns aos dois cultivos. As famílias que tiveram o maior número de espécies coletadas na área vizinha ao Cerradão foram, Tydeidae (7), Tarsonemidae (6), Eriophyidae e Phytoseiidae (4) e, na área próxima à Mata Ripária, Tydeidae (9) e Phytoseidae (8). A presença de vegetação vizinha aos seringais deve ser a causa do grande número de espécies de ácaros classificadas como acidentais encontradas neste estudo. As maiores abundâncias e riquezas de espécies ocorreram no final do período chuvoso e início da estação seca. Abstract in english The basic knowledge of the seasonal occurrence of mites can supply data for elaboration of programs of ecological management to be implanted with success in the future. The objective of this study was to determine the species richness and the seasonality of mites present in two areas of rubber tree [...] crops neighboring to native areas in Itiquira, MT. Along one year, 25 quantitative samplings were accomplished in rubber tree crop neighboring to two fragments of Cerrado (Cerradão and Mata Ripária). There were registered 199,380 mites, of 48 species, belonging to 15 families. Of those, 13 species are phytophagous, 18 predators and 17 mycophagous or of unknown alimentary habit. Three phytophagous species represented more than 97% of the mites collected: Phyllocoptruta seringueirae Feres (80.8%), Tenuipalpus heveae Baker (12.7%) and Calacarus heveae Feres (3.6%). Among the predators, the most abundant species were Agistemus sp., Scirula sp. and Euseius concordis (Chant). Twenty-eight species were common to both crops. The families that had the largest number of species collected in the neighboring area to Cerradão were Tydeidae (7), Tarsonemidae (6), Eriophyidae and Phytoseiidae (4), and in the area close to Mata Ripária, Tydeidae (9) and Phytoseiidae (8). The presence of vegetation near the crop should explain the great number of species of mites classified as accidental found in this study. The largest abundances and species richness occurred in the end of the rainy season and beginning of the dry season.

Peterson R., Demite; Reinaldo J.F., Feres.

2007-02-01

131

Seletividade de agroquímicos ao ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available Testes de efeito adverso de agroquímicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratório, utilizando o método residual de contato com pulverização em superfície de vidro. Foram testados 42 produtos químicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reprodução do ácaro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao ácaro (combinação da mortalidade e efeito na reprodução) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram inócuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidróxido de cobre, naled, oxicloreto de cobre, óxido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao ácaro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, óleo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.

1998-06-01

132

Hypoxic environments as refuge against predatory fish in the Amazonian floodplains Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas  

Directory of Open Access Journals (Sweden)

Full Text Available Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pressure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1 but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação, devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1, mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p < 0,001; gl = 1. Isto indica que ambientes com baixa concentração de oxigênio dissolvido podem de fato funcionar como locais de refúgio contra peixes piscívoros nas várzeas amazônicas.

MB. Anjos

2008-02-01

133

Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro / Physiologic selectivity of inseticides to wasps predators of the coffee leafminer  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) em concentrações que corresp [...] ondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem. Abstract in english The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) was studied, in laboratory, using 50% and [...] 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.

MARCOS RAFAEL, GUSMÃO; MARCELO, PICANÇO; ALFREDO HENRIQUE ROCHA, GONRING; MARCELO FIALHO, MOURA.

2000-04-01

134

Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae) / Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e [...] Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris. Abstract in english Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae) is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveir [...] ae (Hymenoptera: Vespidae) was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90) of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

MARCELO FIALHO DE, MOURA; MARCELO, PICANÇO; ALFREDO HENRIQUE ROCHA, GONRING; CLÁUDIO HORST, BRUCKNER.

2000-02-01

135

Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Scientific Electronic Library Online (English)

Full Text Available Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.

FRANSCINELY, APARECIDA DE ASSIS; JAIR, CAMPOS MORAES; LUÍS CLAUDIO, PATERNO SILVEIRA; JONAS, FRANCOSO; AMANDA MARIA, NASCIMENTO; CRISTIANA, SILVEIRA ANTUNES.

2012-06-01

136

Identificação de predadores de Orphulella punctata (de Geer (Orthoptera, Acrididae através da serologia Serological technique for identifying Orphulella punctata (de Geer (Orthoptera, Acrididae predators  

Directory of Open Access Journals (Sweden)

Full Text Available Females of Orphulella punctata (de Geer, 1794 were captured in the field and kept in cages with food and boxes filled with moist soil for oviposition. The eggs, macerated with 0,85% saline solution and centrifugated, were used as the immunizing antigen for obtention of the specific antiserum (AS-O. Rabbits were immunized by the linphonodule injection method with two injections of this antigen, with an interval of 15 days between the 1st and 2nd inoculations. Serological tests were performed using double diffusion in agar gel with homologous and heterologous antigens. Specific serological reactions were obtained 14 days after the 1st inoculation. The antiserum of the 30th day gave 5, 2-4 and 1-4 precipitation lines respectively with eggs, female and male antigen. Such differences can be attributed to the high specificity of AS-O. Positive reaction was observed with arachnids and mirmeleontids captured in the field, indicating the predation on O. punctata.

Marta Cassaro-Silva

2001-03-01

137

Uso de serologia na identificação de predadores de Orphulella punctata (De Geer) (Orthoptera: Acrididae) / Use of serology to identify predators of Orphulella punctata (De Geer) (Orthoptera: Acrididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Serological techniques were used to study Orphulella punctata (De Geer) predators. For preparation of antiserum, rabbits were immunized by the limphonodule injection method with antigens obtained from O. punctata male. Serological tests were performed using double diffusion in agar gel. Specific ser [...] ological reactions were obtained 13 days after the 1st inoculation. After the 2nd inoculation 5 precipitation lines were observed. In the reactions with female antigens there were 2-4 lines, while egg antigens showed 2 lines. These variations in the number of lines were attributed to different physiological states and to ontogeny. Positive reactions were observed for spiders and chrysopids captured in the field.

José E., Serrão; Marta da, Silva; Carlos R., Sousa-Silva; Josué M., Pacheco.

1997-08-01

138

Biología y comportamiento de Polistes erythrocephalus Ltr. (Hyrnenoptera: vespidae, predador del "Gusano cachón" de la yuca Erinnyis ello L. (Lepidoptera: Sphingidae  

Directory of Open Access Journals (Sweden)

Full Text Available El ciclo de vida de Polistes erythrocephalus (latitud 3° 3D' N, longitud 76° 22' 21" W; 965 m.s.n.m.; 23.7° tiene una duración de 110 días, oscilando entre 91 y 131 días. La capacidad de predación en jaulas de malla (2.5 x 2.5 x 2.5 m depende del número de larvas. El consumo diario máximo fue de 1.3, el mínimo de 0.08 y el promedio de O.5larvasde E. ello (11 y 111 instar. No se encontraron machos en nidos menores de 50 celdas y en mayores de 50 celdas el número de machos incrementa con el crecimiento del nido llegando a ser casi igual al de las hembras. De 412 nidos el17 % estaban parasitados por Oxysarcodexia sp., (Diptera: Sacophagidae siendo el enemigo natural más frecuente de larvas y pupas de Polistes. Este insecto es a su vez parasitado por los himenópteros Pachyneuron sp. (Pteromalidae y Brachymeria conica Ashmead (Chalcididae.The duration average of the cycle life of P. erythrocephalus (Iatitude 3°30'N, longitude 76°22'21"W; 965 altitude; 23.7°C was 110 days and ranged between91 and 131 days. Predatory capacity depends on the number of larva. The maximum number of larva consumed by one Polistes larva per day was 1.3 and the minimum was 0.08 with a mean of 0.5 hornworm larva (11 y III instar. Males were not found in nests with less than 50 cells. In nests with more than 50 cells the number of males increase with increasing number of cells until they equal the number of female. Of the 412 nests examined, 17 % were attached by Oxysarcodexia sp [(Diptera: sarcophaqidae. This insect is in turn parasitized by several hymenoptera such as Pachyneuron sp (Pteromalidae y Brachymeria conica (Chalcididea.

Bellotti Anthony C.

1986-03-01

139

Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados  

Energy Technology Data Exchange (ETDEWEB)

Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail: r.franco@bioagri.com.br; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail: paulo.rebelles@epamig.ufla.br; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail: zacarias@epamig.ufla.br; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)

2010-01-15

140

Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium  

Directory of Open Access Journals (Sweden)

Full Text Available The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control, the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000. In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (PA viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 (controle, os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000. No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P< 0,01 do que os animais dos grupos 2 e 3 e a diferença no final do experimento foi próxima de 100%. Os OPGs dos animais do grupo 4 permaneceram altos até o primeiro tratamento estratégico com ivermectina. Os resultados do grupo 1 e 4 diferiram significativamente (P< 0,05 daqueles dos grupos 2 e 3 a partir de dezembro de 2000. Concluiu-se que a aplicação de pellets de M. thaumasium nesta dosagem e periodicidade de aplicação tornaram os tratamentos anti-helmínticos desnecessários.

Jackson Victor de Araújo

2004-04-01

141

Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.

2011-03-01

142

Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae  

Directory of Open Access Journals (Sweden)

Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

Rodolfo Vargas Castilhos

2011-03-01

143

Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 inócuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.

2006-08-01

144

Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil / Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima [...] , respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável. Abstract in english Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and se [...] venth largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.

JMF., Penha; LAF., Mateus.

2007-02-01

145

Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da Silva

2006-08-01

146

Efeito do intervalo de alimentação na reprodução e na longevidade do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of feeding intervals on reproduction and longevity of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O efeito do intervalo de alimentação em fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), foi estudado a 24 ± 3ºC, UR de 70 ± 10 % e fotofase de 12 horas. Os tratamentos consistiram no fornecimento de larvas de Musca domestica L. (Diptera: Muscidae), durante 24 horas a cada um, doi [...] s, quatro, oito ou 16 dias. Fêmeas de P. nigrispinus, alimentadas a cada um, dois e quatro dias, produziram maior número de ovos (225,4; 184,6 e 135,3 ovos, respectivamente), que aquelas alimentadas à cada oito ou 16 dias (8,3 e 0,0 ovos, respectivamente). A longevidade das fêmeas que receberam presa a cada quatro dias (43,0 dias), foi maior do que aquelas alimentadas a cada oito ou 16 dias (27,3 e 10,6 dias). Abstract in english The effect of feeding intervals on Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females was studied. Females were fed during 24 hours after either one, two, four, eight or 16 days with Musca domestica L. (Diptera: Muscidae) larvae at 24 ± 3º C, 70 ± 10% RH and photophase of 12 hours. Fem [...] ales of P. nigrispinus fed every one, two and four days produced higher number of eggs (225.4, 184.6 and 135.3 eggs, respectively) than those fed every eight or 16 days (8.3 and 0.0 eggs, respectively). Females fed every four days lived longer (43.0 days) than those fed every eight or 16 days (27.3 and 10.6 days).

Adrián J., Molina-Rugama; José C., Zanuncio; Dirceu, Pratissoli; Ivan, Cruz.

1998-03-01

147

Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

OpenAIRE

Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was ...

Medeiros, Maria A.; Sujii, Edison R.; Morais, Helena C.

2009-01-01

148

Influência da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseídeos predadores associados / Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids  

Scientific Electronic Library Online (English)

Full Text Available [...] Abstract in english Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O.ilicis on [...] its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark & Muma, Euseius citrifolius Denmark & Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O.ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I.zuluagai and eggs and larvae by E.citrifolius was lower. For A.herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O.ilicis altogether, webbing reduced the predation potential of I.zuluagai and E. citrifolius, but not of A. herbicolus.

Renato A, Franco; Paulo R, Reis; Mauricio S, Zacarias; Daniel C, Oliveira.

2010-02-01

149

Efeito da escassez de presa na sobrevivência e reprodução do predador Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) / Effect of prey shortage on the reproduction and longevity of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O efeito da escassez de presas no desempenho de fêmeas de Supputius cincticeps (Stål) foi estudado a 24,6 ± 0,7ºC, umidade relativa de 80 ± 4% e fotoperíodo de 12h. Larvas de Tenebrio molitor L. foram fornecidas às fêmeas durante 24h, a cada um, dois, quatro, seis ou oito dias; pedaços de vagem de f [...] eijão (Phaseolus vulgaris L.) foram fornecidos em todos os tratamentos de forma contínua. A porcentagem de fêmeas com posturas, o período de oviposição e o número de posturas, de ovos e de ninfas diminuíram com o aumento do intervalo sem presa. Entretanto, os períodos de pré-oviposição e de pós-oviposição aumentaram à medida que o alimento tornou-se menos freqüente, enquanto a longevidade e o número de ovos por postura não foram afetados pelo regime de presas. Os resultados sugerem uma compensação entre a longevidade e a fecundidade (redução da segunda para manter a primeira), o que pode contribuir para o estabelecimento e a sobrevivência de S. cincticeps em condições de escassez de presa. Abstract in english The effect of prey shortage on the performance of Supputius cincticeps (Stål) females was evaluated at 24.6 ± 0.7ºC, 80 ± 4% RH and 12h photophase. Larvae of Tenebrio molitor L. were offered to the females during 24h every one, two, four, six or eight days; pieces of green bean (Phaseolus vulgaris L [...] .) were offered continuously. The percentage of females with egg masses, oviposition period, and the number of egg masses, eggs and nymphs decreased with the increase in the interval without prey, whereas the periods of pre- and pos-oviposition increased. On the other hand, longevity and number of eggs per egg mass were not affected by the prey regimen. The results suggest a trade-off between longevity and fecundity (reduction of fecundity to maintain longevity), which could contribute to the establishment and survival of S. cincticeps during periods of prey scarcity.

Sheila A., Mourão; José C., Zanuncio; Adrián J., Molina-Rugama; Evaldo F., Vilela; Mábio C., Lacerda.

2003-09-01

150

Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae), em três presas alternativas / Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae), in three alternative preys  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae) were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae) catterpilars; T2 - Musca domestica (Diptera, Muscidae) larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae) larva. Longevity [...] and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

José Cola, Zanuncio; Joaquim Efigênio M, Leite; João Batista, Alves; Germi Porto, Santos.

151

Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae, em três presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae, in three alternative preys  

Directory of Open Access Journals (Sweden)

Full Text Available Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae catterpilars; T2 - Musca domestica (Diptera, Muscidae larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae larva. Longevity and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

José Cola Zanuncio

1993-01-01

152

Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?  

OpenAIRE

Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebr...

Rafael Braga da Silva; Alberto Soares Corrêa; Terezinha Maria Castro Della Lucia; Alexandre Igor Azevedo Pereira; Ivan Cruz; José Cola Zanuncio

2012-01-01

153

ClEST cluster :Clmt_singleton0081 [ClEST  

Lifescience Database Archive (English)

Full Text Available Clmt_singleton0081 ww domain-containing oxidoreductase ... mitochondrial gene 663 TAATGACAGGTGCAGTGT ... CAATCAGTTAAAAACTTTG mb07046 1 WW domain-containing oxidoreductase ... [Camponotus floridanus] EFN73055 4.1778E-81 GO:004 ...

154

ClEST cluster :Cl_singleton1770 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton1770 phenylalanine hydroxylase Cimex lectularius nuclear gene 581 TCAGGGTGTTCCATCCGA ... CCCTTACTGACGTCCTCAATAGGGTCTTATAA fw23079 1 Protein henna ... [Camponotus floridanus] EFN61629 2.5294E-102 GO:00 ...

155

ClEST cluster :Cl_singleton2092 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton2092 glutamate--cysteine ligase ... regulatory subunit Cimex lectularius nuclear gene 59 ... TGGTTCAGCTTGGTCTCGCT mb12052 1 Glutamate--cysteine ligase ... regulatory subunit [Camponotus floridanus] EFN6834 ...

156

ClEST cluster :Cl_singleton1794 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton1794 adam ... 17-like protease Cimex lectularius nuclear gene 267 CCATGCATACACGGGTTTTGTA ... CTATCCGGGGAGTACATATCGGATAATCAATGATGAATTA fw24084 1 ADAM ... 17-like protease [Camponotus floridanus] EFN73099 ...

157

ClEST cluster :Cl_singleton0472 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

158

ClEST cluster :Cl_singleton0200 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton0200 protein tyrosine phosphatase -like protein ptplad1 Cimex lectularius nuclear gen ... TGTATCTAGTGTTTTACAATTTG fb10084 1 Protein tyrosine phosphatase -like protein ptplad1 [Camponotus floridanus] EFN67 ...

159

ClEST cluster :Cl_singleton0146 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton0146 enhancer of ... rudimentary homolog Cimex lectularius nuclear gene 692 CAGAATCCAAAC ... ACATGTACATTTTGACTTAAAAGGAAAAAAA fb08017 1 Enhancer of ... rudimentary-like protein [Camponotus floridanus] E ...

160

ClEST cluster :Cl_singleton2329 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton2329 long-chain fatty acid transport ... protein 4 Cimex lectularius nuclear gene 469 CT ... CAAGTGTTCCATAATGCT mb23072 1 Long-chain fatty acid transport ... protein 4 [Camponotus floridanus] EFN71922 1.29436 ...

161

ClEST cluster :Clmt_contig0038 [ClEST  

Lifescience Database Archive (English)

Full Text Available Clmt_contig0038 mitochondrial processing peptidase beta subunit mitochondrial gene 572 TGGCAGATT ... subunit beta [Camponotus floridanus] EFN65875 1.2E-90 ... GO:0005875 GO:0008121 GO:0008270 GO:0005750 GO:003 ...

162

El uso de otolitos y huesos de la cabeza para la identificación de dos especies del género Merluccius, en estudios de predador-presa / The use of otoliths and bones of the head for the identification of two species of the genus Merluccius, in studies of prey-predator  

Scientific Electronic Library Online (English)

Full Text Available [...] Abstract in english A comparative osteological analysis of 6 bones and the sagitta otolith in Merluccius hubbsi and M. australis, two species that live in Southwest Atlantic, has been carried out. The objective was to contribute to identifying these two species as prey in the diet studies, and further description of th [...] ese bony elements for a better taxonomic identification. Fresh bones disarticulation techniques were used. Potentially diagnostic features were observed for discrimination of species in the following elements: urohyal, maxilla, premaxilla, dentary, quadrate, hyomandibular, and the sagitta otolith.

Sergio Matías, Delpiani; Mariano, González-Castro; Juan Martín, Díaz de Astarloa.

2012-08-01

163

O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.

2004-09-01

164

Parasitismo natural em ovos crisopídeos Natural egg parasitism of chrysopids  

OpenAIRE

Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os objetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliç...

Maria Alice Medeiros

2009-01-01

165

PUNTOS DE BIFURCACIÓN ZIP EN MODELOS DEPREDADOR PRESA DEGENERADOS  

Directory of Open Access Journals (Sweden)

Full Text Available En el presente artículo de investigación se demuestra que los modelos degenerados del tipo dos predadores compitiendo por una presa que se regenera los cuales son modelados por un sistema tridimensional no lineal de ecuaciones diferenciales y que satisfacen las condiciones planteadas por Butter-Farkas: los puntos de bifurcación que definen la existencia de la bifurcación Zip coinciden aún en el caso en que la respuesta funcional de los predadores son diferentes.

CARLOS MARIO ESCOBAR CALLEJAS

2010-01-01

166

Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae) em plantas hospedeiras Feeding preference and performance of Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) among host plants  

OpenAIRE

O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae), caruru, Amaranthus lividus L. (Amaranthaceae) e feijão, Phaseolus vulgaris L. (Fabaceae). Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alim...

Coelho, Roberta R.; Veiga, Anto?nio F. S. L.; Torres, Jorge B.

2009-01-01

167

Domácias e seu papel na defesa das plantas  

OpenAIRE

Domácias são pequenas estruturas presentes na face inferior das folhas de diversas plantas de importância agrícola e têm sido descritas por serem tipicamente habitadas por ácaros (predadores e fungívoros) que provêm benefícios às plantas. São estruturas extremamente complexas e não apresentam qualquer função fisiológica conhecida. Tem sido postulado que os ácaros se beneficiam das domácias pela obtenção de um local seguro para reprodução e proteção contra predadores e q...

Matos Cláudia Helena Cysneiros; Pallini Angelo; Bellini Luiz Luciano; Freitas Rita Cristina Pereira de

2006-01-01

168

Domácias e seu papel na defesa das plantas Domatia mediating plant defense  

OpenAIRE

Domácias são pequenas estruturas presentes na face inferior das folhas de diversas plantas de importância agrícola e têm sido descritas por serem tipicamente habitadas por ácaros (predadores e fungívoros) que provêm benefícios às plantas. São estruturas extremamente complexas e não apresentam qualquer função fisiológica conhecida. Tem sido postulado que os ácaros se beneficiam das domácias pela obtenção de um local seguro para reprodução e proteção contra predadores e q...

Cláudia Helena Cysneiros Matos; Angelo Pallini; Luiz Luciano Bellini; Rita Cristina Pereira de Freitas

2006-01-01

169

[Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)].  

Science.gov (United States)

The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samples from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain. PMID:17352075

de Gouvea, Alfredo; Boaretto, Luiz C; Zanella, Carla F; Alves, Luis F A

2006-01-01

170

Distribuição vertical de Teredinidae (Mollusca, Bivalvia em Portogallo, Angra dos Reis, Rio de Janeiro, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available Para estudar a distribuição vertical de Teredinidae em Angras dos Reis, RJ, foram construídos 30 coletores de laminado de pinho (Araucária sp., submersos (10 de cada a profundidades de 0,2, 2 e 4 m, respectivamente. Das espécies coletadas, Lyrodus floridanus foi a única a diminuir em abundância com a profundidade. As outras espécies não apresentaram diferenças significantes no número de indivíduos em relação às três profundidades ensaiadas.In order to study the vertical distribution of Teredinidae at Angra dos Reis, State of Rio de Janeiro, Brazil, 30 collectors of wood sheets (Araucária sp. were submerged (10 at each depth at 0,2, 2 and 4 m, respectively. Among the species collected, Lyrodus floridanus was the only one that did not whow significant variation in number of individuals in relation to depth. All the other species were unaffected, in number of individuals, by the different depths tested.

Maria Júlia Martins Silva

1988-07-01

171

Distribuição vertical de Teredinidae (Mollusca, Bivalvia) em Portogallo, Angra dos Reis, Rio de Janeiro, Brasil  

Scientific Electronic Library Online (English)

Full Text Available Para estudar a distribuição vertical de Teredinidae em Angras dos Reis, RJ, foram construídos 30 coletores de laminado de pinho (Araucária sp.), submersos (10 de cada) a profundidades de 0,2, 2 e 4 m, respectivamente. Das espécies coletadas, Lyrodus floridanus foi a única a diminuir em abundância co [...] m a profundidade. As outras espécies não apresentaram diferenças significantes no número de indivíduos em relação às três profundidades ensaiadas. Abstract in english In order to study the vertical distribution of Teredinidae at Angra dos Reis, State of Rio de Janeiro, Brazil, 30 collectors of wood sheets (Araucária sp.) were submerged (10 at each depth) at 0,2, 2 and 4 m, respectively. Among the species collected, Lyrodus floridanus was the only one that did not [...] whow significant variation in number of individuals in relation to depth. All the other species were unaffected, in number of individuals, by the different depths tested.

Maria Júlia, Martins Silva; Sérgio Henrique Gonçalves da, Silva; Andréa de Oliveira Ribeiro, Junqueira.

1988-07-01

172

Exigências térmicas e tabela de vida de fertilidade de Amblyseius largoensis Thermal requirements and fertility life table of the Amblyseius largoensis  

OpenAIRE

Amblyseius largoensis (Muma) (Acari: Phytoseiidae) é uma espécie de ampla distribuição, ocorrendo em regiões tropicais e subtropicais, freqüentemente associada a plantas perenes, sendo um dos principais predadores de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro (Cocos nucifera L.). O objetivo deste trabalho foi determinar as exigências térmicas de A. largoensis alimentado com uma combinação de Tetranychus urticae Koch (Acari: Tetranychidae), pólen de Ricinus communis ...

Andréia Serra Galvão; Manoel Guedes Corrêa Gondim Junior; Gilberto José de Moraes; José Vargas Oliveira

2008-01-01

173

SOBRE LA BIOLOGIA DEL CAMARON DE RIO SAMASTACUS SPINIFRONS (PHILIPPI 1882) (DECAPODA, PARASTACIDAE) ON THE BIOLOGY OF THE FRESHWATER CRAYFISH SAMASTACUS SPINIFRONS (PHILIPPI 1882) (DECAPODA, PARASTACIDAE)  

OpenAIRE

Se ha revisado la bibliografía que existe sobre Samastacus spinifrons junto a otros datos accesibles al autor, con el objetivo de actualizar el conocimiento biológico de la especie. Se analiza y se entrega información sobre: sistemática, distribución geográfica, hábitat, características fisicoquímicas del agua, variación morfológica, tamaño, relación talla-peso, biología reproductiva, estructura demográfica, migraciones, hábitos alimentarios, predadores, epibiontes, enfermedad...

Rudolph, Erich H.

2002-01-01

174

Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Wernegreen Jennifer J

2010-12-01

175

Distribuição vertical de Teredinidae (Mollusca, Bivalvia) em Portogallo, Angra dos Reis, Rio de Janeiro, Brasil  

OpenAIRE

Para estudar a distribuição vertical de Teredinidae em Angras dos Reis, RJ, foram construídos 30 coletores de laminado de pinho (Araucária sp.), submersos (10 de cada) a profundidades de 0,2, 2 e 4 m, respectivamente. Das espécies coletadas, Lyrodus floridanus foi a única a diminuir em abundância com a profundidade. As outras espécies não apresentaram diferenças significantes no número de indivíduos em relação às três profundidades ensaiadas.In order to study the vertical dist...

Maria Júlia Martins Silva; Sérgio Henrique Gonçalves da Silva; Andréa de Oliveira Ribeiro Junqueira

1988-01-01

176

Discovery of Defense- and Neuropeptides in Social Ants by Genome-Mining  

OpenAIRE

Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant), Camponotus floridanus (carpenter ant) and Harpegnathos saltator (basal genus). Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulato...

Gruber, Christian W.; Muttenthaler, Markus

2012-01-01

177

Pathogenesis of Herpesvirus sylvilagus infection in cottontail rabbits.  

OpenAIRE

Experimental infection with Herpesvirus sylvilagus produces clinical and histopathologic changes in its natural host, the cottontail rabbit (Sylvilagus floridanus), similar to those observed in humans acutely infected with Epstein-Barr virus (EBV). Twenty-seven seronegative cottontail rabbits were infected with Herpesvirus sylvilagus and all developed antibodies within 10 days. Neutralizing antibody was detected as early as 7 days after infection. Virus was isolated from blood mononuclear cel...

Hesselton, R. M.; Yang, W. C.; Medveczky, P.; Sullivan, J. L.

1988-01-01

178

Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A.  

OpenAIRE

Abstract Background Wild birds contribute to maintenance and dissemination of vectors and microbes, including those that impact human, domestic animal, and wildlife health. Here we elucidate roles of wild passerine birds, eastern cottontail rabbits (Sylvilagus floridanus), and Ixodes dentatus ticks in enzootic cycles of two spirochetes, Borrelia miyamotoi and B. andersonii in a region of Michigan where the zoonotic pathogen B. burgdorferi co-circulates. Methods Over a four-year period, wild b...

Hamer Sarah A; Hickling Graham J; Keith Rich; Sidge Jennifer L; Walker Edward D; Tsao Jean I

2012-01-01

179

Food webs of Mediterranean coastal wetlands  

OpenAIRE

En aquesta tesi doctoral s'han estudiat els efectes directes i indirectes de dos tipus d'espècies claus de la comunitat aquàtica dels aiguamolls de l'Empordà (aiguamolls costaners mediterranis amb una xarxa tròfica senzilla). S'han realitzat experiments al camp utilitzant microcosmos i mesocosmos i els resultats han estat analitzats mitjançant tres aproximacions: la taxonòmica, la funcional i la de mides. S'ha comprovat que en situacions amb absència de predadors i dominància d'una ú...

Compte Ciurana, Jordi

2010-01-01

180

DIETA DE ORESTIAS AGASSII (CUVIER & VALENCIENNES, 1846) (TELEOSTEI: CYPRINIDONTIDAE) DEL SALAR DEL HUASCO, NORTE DE CHILE DIET OF ORESTIAS AGASSII (CUVIER & VAIENCIENNES, 1846) (TELEOSTEI: CYPRINIDONTIDAE) OF "EL HUASCO" SALT LAKE, HIGH ANDES OF NORTHERN CHILE  

OpenAIRE

Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador carnívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación.The diet of Orestias agassii from fresh water springs associated to El Huasco Salt La...

Guzma?n, Jonathan A.; Walter Sielfeld

2009-01-01

181

Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera) na Serra dos Carajás, Pará, Brasil / Legume seed damage by bruchids (Insecta: Coleoptera) in Serra dos Carajás, Pará state, Brazil  

Scientific Electronic Library Online (English)

Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae), Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae) e Phaseolus linearis H.B.K. (Fabaceae) para investigar a taxa de predação e a existência de defesas contra a ação de predadores. F [...] oi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas. Abstract in english Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae), Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae) and Phaseolus linearis H.B.K. (Fabaceae), was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by [...] bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

Cecília, Lomônaco.

1994-12-01

182

Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera na Serra dos Carajás, Pará, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajás, Pará state, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predação e a existência de defesas contra a ação de predadores. Foi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

Cecília Lomônaco

1994-12-01

183

Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system  

OpenAIRE

A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado ...

Maria Alice Medeiros; Edison Ryoiti Sujii; Helena Castanheira de Morais

2011-01-01

184

Metabolic Changes in Broad Bean Infected by Botrytis fabae in Response to Mushroom Spent Straw  

OpenAIRE

Spent wheat straw (after cultivation of oyster mushroom, Pleurotus floridanus) was infested into the soil at different concentrations (1, 2, 5% w/w) to study its effect on the growth of broad bean (Vicia faba) susceptible to Botrytis fabae. In addition, the effect of spraying the plant with its water extract was also studied. In seedling stage, the non infected broad bean plants treated with 1 and 2% spent straw (ss) showed an increase in shoot length and at 5% ss as well as upon spraying wit...

Amira; El-fallal, A.; Fatma; Migahed, F.

2003-01-01

185

Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen) juveniles exposed to waterborne ammonia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferent [...] es concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie. Abstract in english Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predatio [...] n. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.

Paula, Weber; Carina, Vogel; Carla, Lang; Bernardo, Baldisserotto.

186

The chemistry of antipredator defense by secondary compounds in neotropical lepidoptera: facts, perspectives and caveats  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Defesas químicas em lepidópteros contra predadores têm sido observadas desde o século XIX. O caso clássico de proteção química contra predadores é o da borboleta monarca, Danaus plexippus, cuja larva seqüestra cardenolidas de sua planta hospedeira Asclepias curassavica e transfere-as para os adultos [...] tornando-os impalatáveis para pássaros. Entretanto diversas outras substâncias podem estar envolvidas na proteção química de lepidópteros neotropicais (glicosídeos iridóides, glicosídeos cianogênicos, glicosinolatos, alcalóides pirrolizidínicos e tropânicos, ácidos aristolóquicos, inibidores de glicosidase, pirazinas). Esses compostos podem ser seqüestrados da planta hospedeira larval, obtidos de fontes vegetais visitadas por adultos ou biossintetizados de novo. Os lepidópteros conhecidos como impalatáveis para predadores vertebrados e/ou invertebrados são as borboletas Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae e Acraeinae (Nymphalidae) e mariposas Arctiidae. Entretanto informações sobre as substâncias que são responsáveis pela impalatabilidade e como elas são adquiridas nem sempre são obtidas. Esse artigo de revisão aborda principalmente observações de campo e laboratório sobre a rejeição de borboletas e mariposas neotropicais por predadores, correlações entre impalatabilidade e substâncias químicas encontradas nos insetos e bioensaios que demonstrem a atividade dessas substâncias contra predadores. Perspectivas são sugeridas para esses tópicos. Abstract in english Chemical defense against predation in butterflies and moths has been studied since nineteenth century. A classical example is that of the larvae of the monarch butterfly Danaus plexippus, which feed on leaves of Asclepias curassavica (Asclepiadaceae), sequestering cardenolides. The adults are protec [...] ted against predation by birds. Several other substances may be involved in chemical defense, such as iridoid glycosides, cyanogenic glycosides, glucosinolates, pyrrolizidine and tropane alkaloids, aristolochic acids, glycosidase inhibitors and pyrazines. The acquisition of these substances by lepidopterans can be due to sequestration from larval or adult host plants or de novo biosynthesis. Many Lepidoptera are known to be unpalatable, including the butterflies Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae and Acraeinae (Nymphalidae), and Arctiidae moths, but knowledge of the chemical substances responsible for property is often scarce. This review discusses mainly three topics: field and laboratory observations on rejection of butterflies and moths by predators, correlation between unpalatability and chemicals found in these insects, and bioassays that test the activity of these chemicals against predators. Perspectives and future directions are suggested for this subject.

José R., Trigo.

2000-12-01

187

Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen juveniles exposed to waterborne ammonia  

Directory of Open Access Journals (Sweden)

Full Text Available Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predation. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferentes concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie.

Paula Weber

2012-01-01

188

Descubrimiento de mamíferos fósiles de edad Lujanense (Pleistoceno tardío en el "Desierto" de La Tatacoa (Huila, Colombia Descubrimiento de mamíferos fósiles de edad Lujanense (Pleistoceno tardío en el "Desierto" de La Tatacoa (Huila, Colombia  

Directory of Open Access Journals (Sweden)

Full Text Available A small sedimentary basin, at the Los Hoyos locality, has been discovered with in the Tatacoa "desert". Taxonomic studies are not yet complete but at least two forms related to living species have been identified: Sylvilagus aff. floridanus and Tayassu aft. tajacu. A third form is referred to family Gomphotheriidae. Based on this small fauna, the locality can be correlated with the Lujanian Land Mammal "Age". Aspects of the paleoecology and paleogeography of the locality are also brieflydiscussed. Se da a conocer el descubrimiento de una pequeña cuenca sedimentaria con mamíferos fósiles, en el lugar denominado Los Hoyos, dentro del ámbito del "desierto" de La Tatacoa. Aunque los estudios taxonómicos de los fósiles no están aún completos, no cabe duda de que se trata, de dos formas afines a especies vivientes, identificadas como Sylvilagus aff. floridanus y Tayassu aff. tajacu , y una tercera forma, referida a la familia Gomphotheriidae. Con base en esta pequeña fauna, se data el yacimiento como de edad Lujanense, además se anotan brevemente aspectos paleoecológicos y paleogeográficos.

Villaroel A. Carlos

1989-09-01

189

Influence of customized cooking methods on the phenolic contents and antioxidant activities of selected species of oyster mushrooms (Pleurotus spp.).  

Science.gov (United States)

Nutritional value of cooked food has been considered to be lower compared to the fresh produce. However, many reports showed that processed fruits and vegetables including mushrooms may retain antioxidant activity. Pleurotus spp. as one of the edible mushroom are in great demand globally and become one of the most popular mushrooms grown worldwide with 25-fold increase in production from 1960-2009. The effects of three different cooking methods (boiling, microwave and pressure cooking) on the antioxidant activities of six different types of oyster mushrooms (Pleurotus eryngii, P citrinopileatus, P. cystidiosus P. flabellatus, P. floridanus and P. pulmonarius) were assessed. Free radical scavenging (DPPH) and reducing power (TEAC) were used to evaluate the antioxidant activities and the total phenolic contents were determined by Folin-Ciocalteu reagent. Pressure cooking improved the scavenging abilities of P. floridanus (>200 %), P. flabellatus (117.6 %), and P. pulmonarius (49.1 %) compared to the uncooked samples. On the other hand, the microwaved Pleurotus eryngii showed 17 % higher in the TEAC value when compared to the uncooked sample. There was, however, no correlation between total phenolic content and antioxidant activities. There could be presence of other bioactive components in the processed mushrooms that may have contributed to the antioxidant activity. These results suggested that customized cooking method can be used to enhance the nutritional value of mushrooms and promote good health. PMID:25892809

Tan, Yee-Shin; Baskaran, Asweni; Nallathamby, Neeranjini; Chua, Kek-Heng; Kuppusamy, Umah Rani; Sabaratnam, Vikineswary

2015-05-01

190

Nestmate recognition in ants is possible without tactile interaction  

Science.gov (United States)

Ants of the genus Camponotus are able to discriminate recognition cues of colony members (nestmates) from recognition cues of workers of a different colony (non-nestmates) from a distance of 1 cm. Free moving, individual Camponotus floridanus workers encountered differently treated dummies on a T-bar and their behavior was recorded. Aggressive behavior was scored as mandibular threat towards dummies. Dummies were treated with hexane extracts of postpharyngeal glands (PPGs) from nestmates or non-nestmates which contain long-chain hydrocarbons in ratios comparable to what is found on the cuticle. The cuticular hydrocarbon profile bears cues which are essential for nestmate recognition. Although workers were prevented from antennating the dummies, they showed significantly less aggressive behavior towards dummies treated with nestmate PPG extracts than towards dummies treated with non-nestmate PPG extracts. In an additional experiment, we show that cis-9-tricosene, an alkene naturally not found in C. floridanus’ cuticular profile, is behaviorally active and can interfere with nestmate recognition when presented together with a nestmate PPG extract. Our study demonstrates for the first time that the complex multi-component recognition cues can be perceived and discriminated by ants at close range. We conclude that contact chemosensilla are not crucial for nestmate recognition since tactile interaction is not necessary.

Brandstaetter, Andreas Simon; Endler, Annett; Kleineidam, Christoph Johannes

2008-07-01

191

Fish ladders: safe fish passage or hotspot for predation?  

Scientific Electronic Library Online (English)

Full Text Available Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladd

Angelo Antonio, Agostinho; Carlos Sergio, Agostinho; Fernando Mayer, Pelicice; Elineide Eugênio, Marques.

2012-10-01

192

Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação  

Directory of Open Access Journals (Sweden)

Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

Cristiano S. de Azevedo

2006-03-01

193

Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

Cristiano S. de, Azevedo; Robert J., Young.

2006-03-01

194

Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.)], em Presidente Prudente, estado de São Paulo / Mite diversity in peach cultivars [Prunus persica (L.)], in Presidente Prudente, State of São Paulo, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram colet [...] adas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas. Abstract in english This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talism [...] ã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni, Montes; Adalton, Raga; Aparecida Conceição, Boliani; Jeferson Luiz Carvalho, Mineiro; Pedro César dos, Santos.

2010-06-01

195

Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.], in Presidente Prudente, State of São Paulo, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas.This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

Sônia Maria Nalesso Marangoni Montes

2010-06-01

196

Head triangulation as anti-predatory mechanism in snakes / Triangulação da cabeça como mecanismo anti-predação em serpentes  

Scientific Electronic Library Online (English)

Full Text Available Mecanismos anti-predação em serpentes são diversos e complexos, incluindo comportamentos miméticos. Algumas serpentes triangulam a cabeça, possivelmente mimetizando outras serpentes mais perigosas. No entanto, são escassos os estudos demonstrando a eficiência deste comportamento frente a predadores [...] naturais. O objetivo deste estudo foi verificar, utilizando serpentes artificiais, se os indivíduos com cabeça triangular são menos suscetíveis ao ataque de predadores e, se o ataque predatório é direcionado à cabeça das serpentes. Serpentes artificiais foram dispostas sistematicamente na margem de uma estrada. A taxa de modelos atacados foi 48,71%. O número de ataques em modelos de cabeça arredondada foi significativamente maior do que nos modelos com cabeça triangular. Houve diferença significativa entre as partes atacadas nas serpentes quando comparados aos diferentes formatos de cabeça. Portanto, as serpentes que possuem triangulação da cabeça podem ser um alvo menos frequente de ataques por predadores do que as que não possuem esse tipo de comportamento. Abstract in english Anti-predator mechanisms in snakes are diverse and complex, including mimetic behavior. Some snakes triangulate their head, probably mimicking other more dangerous snakes. However, there is a lack of studies that demonstrate the effectiveness of this behavior with natural predators. The aim of this [...] study was to verify, using artificial snakes, if snakes with triangular heads are less susceptible to attack by predators, and if predatory attack is targeted to the head of serpents. Artificial snakes were systematically arranged on a road border. The rate of attacked models was 48.71%. Number of attacks on models with rounded head was significantly higher than in models with triangular head. There was a significant difference between the places of attack on the snakes in relation to different head shapes. Therefore, snakes that have head triangulation may be a less frequent target of attacks by predators than those without such behavior.

197

Ecological Roles of Coleoptera Associated with Carcasses in Caatinga  

Directory of Open Access Journals (Sweden)

Resumo. O papel ecológico da coleopterofauna associada a carcaças de porcos em uma área de Caatinga foi examinado. Para captura desses insetos foram utilizadas armadilhas do tipo bandeja, pitfall e Shannon modificada, durante duas estações (seca e chuvosa. 4.851 coleópteros foram coletados, pertencentes a 19 famílias e 88 espécies. A categoria ecológica mais abundante foi predador/parasita (72,7%, seguida por onívoro (15,1%, necrófago (10,9% e incidental (1,3%. Futuros estudos sobre biologia das espécies predadoras/parasitas são necessários para se determinar sua possível utilidade forense na estimativa do intervalo pós-morte.

Wellington Santos

2013-12-01

198

Genetically modified corn on fall armyworm and earwig populations under field conditions / Milho geneticamente modificado e sua ação sobre a lagarta-do-cartucho e tesourinha em condições de campo  

Scientific Electronic Library Online (English)

Full Text Available Avaliou-se o efeito do milho geneticamente modificado MON810 sobre o inseto praga Spodoptera frugiperda (J.E. Smith) e o seu predador Doru luteipes (Scudder) em condições de campo no Brasil. As avaliações foram conduzidas em campos de milho MON810, comparadas com milho convencional com e sem aplicaç [...] ão de inseticidas, em quatro safras na região de Barretos, SP. Foram avaliados os danos de S. frugiperda em plantas e a contagem do número de lagartas de S. frugiperda e de adultos e ninfas do predador D. luteipes em plantas de milho. Verificou-se uma menor porcentagem de danos de S. frugiperda e os menores números médios de lagartas (pequenas e grandes) no milho MON810. Não foram observadas diferenças (P>0,05) entre os tratamentos na abundância do predador D. luteipes em plantas de milho. A segunda época de plantio apresentou as maiores porcentagens de danos de S. frugiperda e as menores médias do número de tesourinhas coletadas. O milho MON810 foi efetivo no controle de S. frugiperda e a abundância do predador D. luteipes foi similar nos três tratamentos, em condições de campo. Abstract in english The effects of corn MON810 on the Spodoptera frugiperda (J.E. Smith) and the earwig Doru luteipes (Scudder) were tested under field conditions in Brazil. Results from MON810 corn fields were compared with those fields of conventional corn with and without the application of insecticides in four harv [...] ests in the region of Barretos, SP. It was assessed the damage to S. frugiperda via direct counts of the number of fall armyworms and adults and nymphs of the predator D. luteipes on corn plants. The rate of S. frugiperda damage and the average numbers of larvae (large and small) were lower in the MON810 corn field relative to the control plot. There were no differences (P>0.05) between treatments regarding the predator abundance in corn plants. The second crop season ("safrinha") showed the greatest extent of S. frugiperda damage and the lowest average abundance of earwigs. MON810 was effective in controlling S. frugiperda and abundance of predator D. luteipes was similar in the three treatments under field conditions.

Marina Regina, Frizzas; Sinval, Silveira Neto; Charles Martins de, Oliveira; Celso, Omoto.

2014-02-01

199

Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae) em plantas hospedeiras / Feeding preference and performance of Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) among host plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae), caruru, Amaranthus lividus L. (Amaranthaceae) e [...] feijão, Phaseolus vulgaris L. (Fabaceae). Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos) e ganho de peso (28 a 30% do peso vivo) foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas. Abstract in english The choice between cotton, Gossypium hirsutum L. (Malvaceae), green bean, Phaseolus vulgaris L. (Fabaceae) and pigweed, Amaranthus lividus L. (Amaranthaceae) and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret) (Hemiptera, Penta [...] tomidae) adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes) and weight gain (28 to 30% of body weight) were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

Roberta R., Coelho; Antônio F. S. L., Veiga; Jorge B., Torres.

200

Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas). O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus ( [...] Dallas) (Hemiptera, Pentatomidae), é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae) e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume) durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%). Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão. Abstract in english Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas). Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the inter [...] action of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas) (Hemiptera, Pentatomidae) has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v) during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20%) ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.

Walter S., Evangelista Junior; Roberta L., Santos; Jorge B., Torres; José C., Zanuncio.

2011-06-01

201

Influência de tricomas glandulares de Solanum berthaultii na predação de Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) em Myzus persicae (Sulzer) (Homoptera: Aphididae) / Influence of glandular trichomes of Solanum berthaultii on the predation of Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) on Myzus persicae (Sulzer) (Homoptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a influência dos tricomas glandulares da batata Solanum berthaultii no desenvolvimento larval, mortalidade e capacidade de predação de Scymnus (Pullus) argentinicus (Weise) sobre o pulgão Myzus persicae (Sulzer). Verificou-se que o desenvolvimento larval do predador foi interrompido pela [...] alta mortalidade (89%) no 1° ínstar, provavelmente pela ação dos tricomas glandulares de S. berthaultii. Quando o predador foi liberado nos diferentes ínstares e adultos, observou-se mortalidade larval no 1°, 2° e 3° ínstares em S. berthaultii pela ação dos tricomas glandulares, sendo que o 4° ínstar e adulto não foram afetados. Em S. tuberosum não foi observada mortalidade do predador. A capacidade de predação de S. (Pullus) argentinicus foi significativamente superior na batata S. tuberosum em relação a S. berthaultii em todos os ínstares e adultos. A mortalidade de M. persicae foi superior em S. tuberosum (por predação) em relação aos valores observados em S. berthaultii (pela ação combinada do predador e tricomas glandulares). Abstract in english The effect of glandular trichomes of wild potato plant Solanum berthaultii, on larval development, survival and prey capacity of Scymnus (Pullus) argentinicus (Weise) on the aphid Myzus persicae (Sulzer) was studied. The larval development of the predator was interrupted due the high mortality (89%) [...] on the 1st instar, probably due to the action of glandular trichomes of S. berthaultii. It was observed also mortality of 1st, 2nd and 3rd instars when S. argentinicus was liberated on S. berthaultii. The 4th instar and the adult stage of the predator were not affected by the glandular trichomes. It was not observed mortality of S. argentinicus on S. tuberosum and the prey capacity of S. (Pullus) argentinicus was significantly higher on S. tuberosum when compared to S. berthaultii, in all instars and adult. The mortality of M. persicae was higher in S. tuberosum (by predation) when compared to S. berthaultii (by the combined action of predator and glandular trichomes).

Daniel C., Gamarra; Vanda H. P., Bueno; Jair C., Moraes; Alexander M., Auad.

1998-03-01

202

Integração da resistência de plantas e predação por Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o manejo de Schizaphis graminum (Rondani) (Hemiptera: Aphididae) em sorgo / Integration of varietal resistance and predation by Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the management of Schizaphis graminum (Rondani) (Hemiptera: Aphididae) on sorghum  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A integração entre plantas resistentes e agentes de controle biológico pode ser uma alternativa viável para o manejo do pulgão-verde, Schizaphis graminum (Rondani), na cultura do sorgo. Experimentos foram conduzidos com a finalidade de avaliar o efeito de quatro genótipos de sorgo: GR 11111 e TX 430 [...] x GR 111 (resistentes), GB 3B (moderadamente resistente), e BR 007B (suscetível), sobre o controle biológico do pulgão S. graminum realizado pelo predador Chrysoperla externa (Hagen). Para isso, avaliaram-se diferentes níveis de infestação de S. graminum, na presença e ausência do predador, em casa-de-vegetação e a viabilidade de controle de S. graminum no campo. O efeito do predador foi notado 25 dias após a infestação, proporcionando maior crescimento das plantas e menores danos. Os danos também foram menores nos genótipos resistentes e aumentaram com a elevação dos níveis de infestação, sendo menores na presença do predador C. externa. Em condições de campo, a integração dos dois métodos de controle proporcionou 83% de redução de danos, quando se utilizou o genótipo resistente TX 430 x GR 111, que foi considerado o mais promissor dentre os estudados. Abstract in english The integration of plant resistance and biological control agent can be a viable alternative to the management of the greenbug, Schizaphis graminum (Rondani), on sorghum. Experiments were conducted to evaluate the effect of four sorghum genotypes: GR 11111 and TX 430 x GR 111 (resistants), GB 3B (mo [...] derately resistant), and BR 007B (susceptible), on the biological control of S. graminum by the predator lacewing, Chrysoperla externa (Hagen). Different levels of infestation, in presence or absence of the predator were studied in greenhouse, and the viability of S. graminum control was evaluated under field conditions. The effect of the predator was observed 25 days after infestation, resulting in higher percentage of plant growth and lower damage. Damage was lower in resistant genotypes and increased with higher levels of infestation, being low in presence of predator C. externa. In field conditions, plant damage was reduced in 83%, when the genotype TX 430 x GR 111 was used in association with C. externa.

Liliane K., Figueira; Fernando M., Lara; Ivan, Cruz; José M., Waquil.

2003-09-01

203

Mercúrio total em cação comercializado em São Paulo - SP, Brasil  

OpenAIRE

Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislaç?...

Morales-aizpuru?a, Isabel C.; Tenuta-filho, Alfredo; Sakuma, Alice M.; Zenebon, Odair

1999-01-01

204

Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas  

Directory of Open Access Journals (Sweden)

Full Text Available Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas. Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the interaction of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20% ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas. O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae, é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%. Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão.

Walter S. Evangelista Junior

2011-06-01

205

The relationship between winter egg counts of the European red mite Panonychus ulmi (Acari: Tetranychidae) and its summer abundance in a reduced spray orchard.  

Science.gov (United States)

We studied the relationship between counts of Panonychus ulmi (Koch) winter eggs per bud and mite-days per leaf accumulated in early to mid-summer on 92-96 apple trees in an orchard in Quebec, Canada. Stepwise regression was used to compute mite-days in the 4 year (1992-1995) data set using winter egg density, cumulative rainfall (R), cumulative degree-days (D), squared values of R and of D, and the product RD as potential predictors. Degree-days were accumulated above 10.1 degrees C, the minimum threshold of development for P. ulmi in Eastern Canada. The 4-year model that gave the best fit included terms for winter eggs, rainfall, R2, and the product RD, and explained 76% of the variation in mite-days. When the 4-year model was applied to each year's data separately, winter eggs, adjusted for current year rainfall and degree-days, were always highly significant predictors of mite-days. These significant effects of weather indicate that estimation of potential economic loss should take account of rainfall and heat units, as well as the density of winter eggs. Predators, including the stigmaeid, Agistemus fleschneri Summers, and occasional low numbers of phytoseiids, did not have any evident within-season effect on mite-days but their appearance in July-September of 1994 was followed by a ten-fold decrease in the mean density of winter eggs in 1995 compared with the previous spring. This reduction contrasted with increasing densities each successive spring from 1992 to 1994, which followed summers when predators were scarce or absent. PMID:17611807

Bostanian, Noubar J; Hardman, John Michael; Racette, Gaétan; Franklin, Jeffrey L

2007-01-01

206

Syllidae (Annelida, Polychaeta) from the Caribbean coast of Venezuela  

Science.gov (United States)

Abstract Venezuela possesses a great variety of coastal environments allowing for a high diversity of marine species. However, systematic studies on marine invertebrates are scarce, especially on polychaetes. The family Syllidae is poorly known, and only 14 genera and 42 species have been reported from this country. A total of 13 genera and 26 species the Syllidae were identified from benthic samples collected on different substrata of the northeastern coast of Venezuela. Of these, seven genera and 16 species constitute new records for Venezuela: Odontosyllis guillermoi, Syllides floridanus, Salvatoria clavata, Salvatoria limbata, Sphaerosyllis longicauda, Parapionosyllis longicirrata, Trypanosyllis parvidentata, Trypanosyllis vittigera, Opisthosyllis sp., Syllis amica, Syllis armillaris, Syllis gracilis, Syllis pseudoarmillaris, Syllis vittata, Parasphaerosyllis indica and Myrianida convoluta. PMID:21998503

Liñero-Arana, Ildefonso; Díaz Díaz, Oscarn

2011-01-01

207

First report of Obeliscoides cuniculi in European brown hare (Lepus europaeus).  

Science.gov (United States)

Obeliscoides cuniculi is a New World nematode parasite of the Trichostrongilidae family infecting the gastric tract of different domestic and wild Lagomorph species. This parasite is reported for the first time from a European brown hare (Lepus europaeus). The nematodes isolated from the gastro-intestinal tract were identified using the primary characteristics used to differentiate the species of this genus as adults morphology (length and thickness) and other characteristics of spicules, cervical papillae, cuticular ridges and striations. In the Italian study area, the European brown hare lives in sympatry with the eastern cottontail (Sylvilagus floridanus), species in which the nematode was previously isolated; therefore, the possibility of a cross-infestation must be considered. PMID:21484345

Tizzani, Paolo; Menzano, Arianna; Catalano, Stefano; Rossi, Luca; Meneguz, Pier Giuseppe

2011-09-01

208

Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia ao longo da costa do estado do Rio de Janeiro, Brasil Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia along the coast of Rio de Janeiro State, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is characterized by the dominance of Lyrodus floridanus (Bartsch, 1922; Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917 and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

Andrea de O. R. Junqueira

1989-01-01

209

Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia) ao longo da costa do estado do Rio de Janeiro, Brasil / Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia) along the coast of Rio de Janeiro State, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is c [...] haracterized by the dominance of Lyrodus floridanus (Bartsch, 1922); Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917) and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

Andrea de O. R., Junqueira; Sergio Henrique G. da, Silva; Maria Júlia M., Silva.

210

Domácias e seu papel na defesa das plantas / Domatia mediating plant defense  

Scientific Electronic Library Online (English)

Full Text Available Domácias são pequenas estruturas presentes na face inferior das folhas de diversas plantas de importância agrícola e têm sido descritas por serem tipicamente habitadas por ácaros (predadores e fungívoros) que provêm benefícios às plantas. São estruturas extremamente complexas e não apresentam qualqu [...] er função fisiológica conhecida. Tem sido postulado que os ácaros se beneficiam das domácias pela obtenção de um local seguro para reprodução e proteção contra predadores e que as plantas também se beneficiam pela redução do ataque de herbívoros ou patógenos. Assim, ecologistas têm hipotetizado que as domácias mediam uma associação mutualística entre as plantas e os ácaros que protegem as folhas. Nesta revisão, é discutido o papel das domácias na defesa das plantas contra pequenos artrópodes. Abstract in english Leaf domatia are small structures found on the underside of the leaves of many plants of agricultural importance. Domatia have been described to be typically inhabited by mites (predators and fungivorous) that provide benefits to the plant. The structures can be extremely complex and seem to have an [...] unknown physiological function. It has been postulated that mites may get some benefit from leaf domatia by securing a safe place for reproduction and refuge from predators. Additionally, plants get benefits via reduced herbivory or pathogen attack. Hence, ecologists have hypothesized that domatia mediate a mutualistic association between plants and their bodyguard mites. In this review we discussed the pivotal role of the domatia in plant defenses against small arthropods.

Cláudia Helena Cysneiros, Matos; Angelo, Pallini; Luiz Luciano, Bellini; Rita Cristina Pereira de, Freitas.

1021-10-01

211

Predation on Tropidurus hispidus (Squamata: Tropiduridae) by Lasiodora klugi (Aranea: Theraphosidae) in the semiarid caatinga region of northeastern Brazil / Predação sobre Tropidurus hispidus (Squamata: Tropiduridae) por Lasiodora klugi (Aranea: Theraphosidae) na região de caatinga semiárida do nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Um evento de predação sobre Tropidurus hispidus (Tropiduridae) pela aranha caranguejeira Lasiodora klugi (Theraphosidae) foi observado em área de caatinga arbórea no nordeste do Brasil. Artrópodes são potenciais predadores de pequenos vertebrados e pesquisadores têm relatado eventos de predação envo [...] lvendo aranhas e herpetofauna em regiões neotropicais. Portanto, a presente comunicação breve é o segundo caso de predação de aranha sobre lagartos do gênero Tropidurus no Brasil e o primeiro para as caatingas semiáridas, reforçando a argumentação de que grandes aranhas possuem um papel relevante como predadores desses animais. Abstract in english A predation event on Tropidurus hispidus (Tropiduridae) by the crab spider Lasiodora klugi (Theraphosidae) was observed in an arboreal caatinga area in northeastern Brazil. Arthropods are potential predators of small vertebrates and researchers have reported predation events involving spiders and he [...] rpetofauna in Neotropical regions. As such, the present short communication is the second case of predation of spiders on Tropidurus lizards in Brazil, and the first for the semiarid caatinga, reinforcing the argument that large spiders have relevant roles as predators of these animals.

Washington Luiz Silva, Vieira; Maria Betânia Ribeiro, Gonçalves; Rômulo Pantoja, Nóbrega.

2012-12-01

212

Dieta de Leopardus colocolo (Carnivora: Felidae en la Reserva Nacional de Junín, Junín, Perú  

Directory of Open Access Journals (Sweden)

Full Text Available Este estudio caracteriza la dieta de Leopardus colocolo en los alrededores del lago Junín, en el centro del Perú, a partir de los restos de las presas presentes en 43 heces. El origen de las heces del predador se determinó a partir del ADN mitocondrial de las células epiteliales intestinales adheridas a la superficie de las heces, utilizando como marcador la región de control. Los restos de las presas fueron identificados utilizando literatura especializada y la comparación con especímenes de colección, identificando un total of 14 ítems alimenticios pertenecientes a mamíferos de las familias Cricetidae (6, Chinchillidae (1 y Caviidae (1 y aves de las familias Anatidae (3 y Rallidae (2, y un grupo de aves no identificadas (1. Los roedores fueron el principal componente de la dieta de L. colocolo, en frecuencia y biomasa, seguido por las aves. Entre los ítems alimenticios consumidos, el roedor cricétido pequeño Calomys sp. fue el más frecuente; sin embargo, el mayor aporte de biomasa relativa fue proporcionado por el roedor mediano Cavia tschudii. La amplitud de nicho obtenida fue baja (Bsta= 0.17, indicando una dieta especializada. Nuestros resultados confirman que, como ocurre con la mayoría de felinos pequeños neotropicales, L. colocolo es un predador especializado en la captura de vertebrados, principalmente mamíferos pequeños. No se registró variación estacional en la dieta y el análisis de las clases de edad de los roedores cricétidos mostró que los adultos fueron los más consumidos. Se infiere que L. colocolo tiene un patrón de actividad diurno y nocturno.

Ursula Fajardo

2014-05-01

213

Efeito do manejo de plantas daninhas sobre Neoseiulus californicus (Acari:Phytoseiidae em pomar de macieira  

Directory of Open Access Journals (Sweden)

Full Text Available Avaliou-se a influência do manejo de plantas daninhas sobre o deslocamento de ácaros tetraniquídeos (Panonychus ulmi e Tetranychus urticae e do ácaro predador Neoseiulus californicus em um pomar de macieira 'Gala', onde foi implantado o controle biológico do ácaro vermelho, P. ulmi, por meio de liberações massais de N. californicus. As parcelas tiveram as plantas daninhas manejadas de três formas: sem manejo, com roçadas manuais e com herbicidas. As populações de ácaros foram avaliadas sobre as plantas daninhas, Plantago tormentosa e Erigeron sp, e sobre as folhas de macieira. As maiores populações de N. californicus foram observadas nas parcelas onde os manejos proporcionaram desenvolvimento de plantas daninhas na linha de plantio. Na parcela manejada com herbicida, houve maior população de ácaros tetraniquídeos sobre as macieiras, provavelmente, devido ao reduzido número de N. californicus. P. tormentosa foi o hospedeiro preferencial do ácaro predador. Concluiu-se que o manejo de plantas daninhas, na linha de plantio das macieiras, assume um importante papel no equilíbrio entre as populações de ácaros.

Monteiro Lino Bittencourt

2002-01-01

214

Interação tritrófica entre Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), Eucalyptus e lagartas de Thyrinteina arnobia (Stoll) (Lepidoptera: Geometridae): I visitação / Tritrophic interaction: visits of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) to species of Eucalyptus Injuried by Thyrinteina arnobia (Stoll) (Lepidoptera: Geometridae) larvae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a interação tritrófica envolvendo o predador Podisus nigrispinus (Dallas) e cinco espécies de Eucalyptus injuriadas por lagartas de Thyrinteina arnobia (Stoll). P. nigrispinus visitou mais plantas de E. pellita do que de outras espécies e a área da superfície foliar mostrou ser o fator pr [...] imário (r = 0,88) envolvido na interação. A presença do herbívoro na planta induziu o maior número de visitas do predador, sugerindo uma interação entre a planta hospedeira e o herbívoro, provavelmente mediada por cairomônios. Abstract in english The tritrophic interaction among the predator bug Podisus nigrispinus (Dallas) and five species of Eucalyptus damaged by Thyrinteina arnobia (Stoll) larvae was evaluated. P. nigrispinus visited more E. pellita than the other plant species and the leaf surface area was the primary factor (r=0,88) inv [...] olved in such interaction. The presence of the herbivore on the plant elicited the highest number of visits of P. nigripinus, suggesting that there is an interaction between host plant-herbivore, problably mediated by kairomones.

Maria das G, Cavalcanti; Evaldo F., Vilela; Álvaro E., Eiras; José C., Zanuncio; Marcelo C., Picanço.

2000-12-01

215

Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851 (Heteroptera: Pentatomidae with salt and amino acids solutions supplementary diet  

Directory of Open Access Journals (Sweden)

Full Text Available This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae. Both solutions showed deleterious effects on nymph survival, adult weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae. Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, longevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores.

Simone Patrícia Carneiro Freitas

2006-05-01

216

Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851) (Heteroptera: Pentatomidae) with salt and amino acids solutions supplementary diet  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl) no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae). Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, lon [...] gevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores. Abstract in english This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae). Both solutions showed deleterious effects on nymph survival, adult [...] weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.

Simone Patrícia Carneiro, Freitas; Walter Santos, Evangelista Júnior; José Cola, Zanuncio; José Eduardo, Serrão.

2006-05-01

217

Energy density of freshwater Patagonian organisms / Densidad energética de los organismos Patagónicos de agua dulce  

Scientific Electronic Library Online (English)

Full Text Available La densidad energética de los organismos puede ser utilizada con distintos fines como evaluar la calidad de la dieta, comparar la importancia de distintas presas para un predador, corregir las tasas de evacuación gástrica de modelos, explicar el comportamiento de forrajeo de ciertos predadores o det [...] erminar su estado fisiológico. Consiste en un parámetro fundamental para el modelado bioenergético de ecosistemas. En este trabajo estimamos la densidad energética de los principales grupos de los ecosistemas de agua dulce de la Patagonia, incluyendo peces, crustáceos, gasterópodos, oligoquetos e insectos. Encontramos que los peces (5048-5789 Cal/g) es el grupo energéticamente más denso seguido de los insectos (5062-5232), crustáceos (3364-3994), oligoquetos (3471) y finalmente los gasterópodos (1143). Abstract in english We assessed by using a bomb calorimeter the energy density of the main species of Patagonian freshwater ecosystems, including fish, crustaceans, gastropods, oligochaetes, and insects. Fish (5048-5789 Cal/g) were the most energy density group, followed by insects (5062- 5232), crustaceans (3364-3994) [...] , oligochaetes (3471) and gastropods (1143). These data consist on the first direct energy density estimations of freshwater species and are intended as a baseline information for modelling the energy fluxes in Patagonian freshwater ecosystems.

Javier, Ciancio; Miguel, Pascual.

2006-06-01

218

Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish  

Directory of Open Access Journals (Sweden)

Full Text Available The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medusa was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa estava sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação.

Roberta Martini Bonaldo

2004-06-01

219

A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae) from dry forest in Brazil and new occurrence records for other Heimbrinae / Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae) de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae  

Scientific Electronic Library Online (English)

Full Text Available Os limites geográficos de Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 e H. parallela Stage & Snelling, 1986 são estendidos com base no material examinado das coleções entomológicas do Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Bra [...] sil) e do Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brasil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) é descrita, ilustrada e comparada com a única espécie conhecida desse gênero, S. cordobensis Stage & Snelling, 1986. Uma chave para os gêneros de Heimbrinae e para as espécies de Symbra é fornecida. Abstract in english The geographic ranges of Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão [...] Preto, SP, Brazil) of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.

Daniell Rodrigo Rodrigues, Fernandes; Rogéria Inês Rosa, Lara; Nelson Wanderley, Perioto.

2012-12-01

220

Períodos de ausência de presas e estabilidade do controle biológico do ácaro-rajado / Periods of prey absence and stability of the spider mite biological control  

Scientific Electronic Library Online (English)

Full Text Available O objetivo deste trabalho foi avaliar os parâmetros biológicos do ácaro predador Phytoseiulus macropilis na ausência de alimento por períodos de um a seis dias. Foram avaliados: o número de ovos por fêmea ao dia; o número total de ovos; a longevidade de fêmeas; e a razão sexual dos descendentes. Fêm [...] eas que ficaram por mais de três dias sem alimento apresentaram queda em todas variáveis biológicas avaliadas. O predador P. macropilis somente se estabelecerá em campo se as manchas ocupadas pelo ácaro-rajado não estiverem muito distantes umas das outras. Abstract in english The objective of this work was to access the biological parameters of the predator mite Phytoseiulus macropilis in the food absence for periods of one or more days. Data evaluated were: egg number per female per day; total number of eggs; longevity of females; and the offspring sex rate. Female in s [...] tarvation for three or more days showed decrease in all biological variables. P. macropilis only will settle in the field if patch populations occupied by spider mite are not very distant from each other.

Hamilton, Oliveira; Vanessa, Duarte; Daniela, Rezende; Marcos Antônio Matiello, Fadini; Angelo, Pallini.

1207-12-01

221

Caracterização da microfauna em estação de tratamento de esgotos do tipo lodos ativados: um instrumento de avaliação e controle do processo Microfauna characterization in activated sludge wastewater treatment plant: an instrument of assessment and control of process  

Directory of Open Access Journals (Sweden)

Full Text Available A microfauna presente em uma ETE por lodos ativados foi caracterizada, correlacionada com parâmetros físico-químicos e utilizada em modelos existentes de avaliação de sistemas. Durante 351 dias o lodo ativado manteve-se estável com flocos compactos, pequenos e com poucos filamentos. Os protozoários predominantes no lodo foram as tecamebas e os ciliados predadores de flocos, indicando estabilidade do sistema. Os métodos propostos em literatura, baseados no IBL, na densidade total da microfauna e na relação entre ciliados predadores de flocos e ciliados fixos, mostraram-se eficientes para o diagnóstico das condições depurativas do sistema. A análise qualitativa do lodo, englobando o tamanho, quantidade de filamentos, compactação e a identificação das espécies dominantes, foi suficiente para uma caracterização imediata das condições depurativas do sistema de tratamento.Microfauna found in an activated sludge WTP was characterized, correlated to the physical-chemical parameters and used in existing assessment models. During 351 days, the activated sludge remained stable with compacted and small poorly filamentous flocs. It was composed mainly by testate amoebas and crawling ciliates that indicated the stability of the system. The application of the existent system evaluation models to microfauna (SBI, crawling ciliate/attached ciliate relation and total density was found to be efficient for the assessment of the system depurative conditions. The sludge qualitative analysis, which included the flocs size, amount of filaments, compacting and the identification of the dominant microfauna species, was enough to an immediate diagnosis of the treatment system depurative conditions.

Alessandra Pellizzaro Bento

2005-12-01

222

Diversidad y microestructura de quitones (Mollusca: Polyplacophora) del Caribe de Costa Rica  

Scientific Electronic Library Online (English)

Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la do [...] cumentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon, 1886); S. purpurascens (C.B. Adams, 1845); Acanthopleura granulata (Gmelin, 1791); Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893). Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889). Abstract in english Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four coll [...] ection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulate (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). Rev. Biol. Trop. 59 (1): 129-136. Epub 2011 March 01.

Cedar I, García-Ríos; Migdalia, Álvarez-Ruiz.

2011-03-01

223

Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica  

Directory of Open Access Journals (Sweden)

Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la documentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.Diversity and microstructure of quitons (Mollusca: Polyplacophora from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon 1886; S. purpurascens (C.B. Adams 1845; Acanthopleura granulate (Gmelin 1791; Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893. This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889. Rev. Biol. Trop. 59 (1: 129-136. Epub 2011 March 01.

Cedar I García-Ríos

2011-03-01

224

Estado actual y conservación de aves pelágicas que utilizan la plataforma continental argentina como área de alimentación / Status and conservation of pelagic birds using the Argentinean continental shelf as a foraging area  

Scientific Electronic Library Online (English)

Full Text Available La importancia de la plataforma continental argentina no está solamente vinculada con su extensión sino también con su elevada productividad, lo que hace que sea utilizada como área de alimentación por un importante número y biomasa de predadores tope marinos que se reproducen en la costa y en secto [...] res insulares alejados del continente. Entre estos predadores tope, las aves pelágicas se destacan por sus extraordinarias habilidades de vuelo y sus extensos viajes de alimentación o migratorios de varios miles de kilómetros. La distribución de estas aves (y otros predadores tope marinos) a lo largo de la plataforma no es uniforme, presentando mayores concentraciones en áreas donde las características oceanográficas promueven elevadas abundancias de presas. Generalmente se observa un mayor número de individuos agregados cerca de frentes con gradientes de temperatura horizontales que sobre áreas térmicamente más homogéneas. Si bien algunas poblaciones de aves pelágicas sufren actualmente problemas relacionados con la contaminación, el disturbio humano y la degradación ambiental, los problemas de conservación más importantes parecen provenir de impactos sufridos en áreas reproductivas por la presencia de predadores introducidos y en el mar por los efectos negativos de la interacción con las pesquerías. La plataforma continental argentina tiene importancia global y juega un papel clave en el mantenimiento de aves y mamíferos marinos provenientes de regiones adyacentes y remotas. Existe una urgente necesidad de renovar la información disponible sobre la distribución de predadores tope en la plataforma para definir las áreas más importantes. El análisis combinado de esos datos con la distribución del esfuerzo pesquero y la explotación de recursos no renovables será crucial para desarrollar e implementar programas adecuados de conservación y manejo. Abstract in english The importance of the Argentinean continental shelf is not only linked with its extension but also to its high productivity. That's why this area is extensively used as foraging area by a large number and biomass of top predators both breeding in the continental shores and in islands away from the c [...] ontinent. Among these top predators, seabirds have remarkable flying abilities and perform extensive foraging and migratory trips, in the order of thousands of kilometers. The distribution of these birds (and other marine top predators) along the continental shelf is not uniform, with higher densities in those areas where the oceanographic characteristics promote prey concentration; more predators are usually aggregated close to frontal systems characterized by horizontal thermal gradients. In spite of some seabird populations currently suffering conservation problems allied with pollution, human disturbance and habitat degradation, the most important issues seem to be related to the introduction of predators in breeding areas, and to the negative effects of the interaction with fisheries. The Argentinean continental shelf has global importance and plays a key role in the maintenance of seabird and marine mammal populations, both local and those coming from adjacent and remote areas. There is an urgent need of gathering and analyzing new information on the distribution of top predators along the continental shelf in order to define important areas. The combined analysis of these data with the distribution of fishing effort and the exploitation of non renewable resources will be crucial to the adequate development and implementation of conservation and management programs.

Marco, Favero; María Patricia, Silva Rodríguez.

2005-08-01

225

Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae) on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil / Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae) sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do cont [...] ato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A) predador e "kairomones" presentes e B) predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A) predador e "kairomones" ausentes e B) igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica) e alimento (algas) não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens) realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones". Abstract in english The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical co [...] ntact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A) predator and kairomones present and B) predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A) predator and kairomones absent and B) the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity) and food (algae) did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens) showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.

WJ., Minto; MS., Arcifa; A., Perticarrari.

2010-02-01

226

Suitability of leguminous cover crop pollens as food source for the green lacewing Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) / Adequação do pólen de leguminosas utilizadas em adubação verde como fonte de alimento para Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A diversificação das culturas com plantas que forneçam pólen nutricionalmente adequado para predadores pode reduzir a população de pragas pelo aumento da efetividade dos predadores. Neste trabalho, avaliou-se a viabilidade nutricional de polens de leguminosas utilizadas como adubação verde, para o c [...] risopídeo Chrysoperla externa (Hagen), comumente encontrado em agroecossistemas cafeeiros. Os adubos verdes testados foram guandu e crotalária, leguminosas utilizadas em sistemas orgânicos de café. Adultos de C. externa recém-emergidos foram criados em dietas contendo pólen de guandu, de crotalária e de mamona (controle). O sucesso reprodutivo de C. externa foi avaliado nas dietas de pólen e quando mel foi adicionado ao pólen, para se verificar a necessidade do predador por fonte extra de carboidratos. A taxa de crescimento populacional do predador foi semelhante nas dietas de pólen de guandu e de crotalária. No entanto, a taxa aumentou significativamente quando mel foi adicionado às dietas. Fêmeas alimentadas com pólen de guandu e mel e com pólen de crotalária e mel tiveram crescimento superior ao das alimentadas com pólen de mamona e mel. Fêmeas alimentadas somente com pólen de mamona ou somente com mel não ovipositaram. Os polens de guandu e de crotalária foram igualmente adequados para C. externa, especialmente quando foram complementados com mel. Os resultados sugerem que para aumentar a efetividade dos predadores, os sistemas orgânicos de café deveriam ser diversificados com plantas que forneçam pólen em combinação com plantas que forneçam néctar. Abstract in english Diversification of crops with species that provide suitable pollen for predators may reduce pest population on crops by enhancing predator effectiveness. In this paper we evaluated the suitability of leguminous cover crop pollens to the predatory green lacewing Chrysoperla externa (Hagen). The preda [...] tor is commonly found in coffee agroecosystems and the plant species tested were pigeon pea and sunn hemp, which are used in organic coffee systems. Newly emerged females and males of C. externa were reared on diets containing pollen of pigeon pea, sunn hemp, or castor bean, used as a control. The reproductive success of C. externa was evaluated when females fed the pollen species and when honey was added to the diets, to verify the predator need for an extra carbohydrate source. Similar intrinsic growth rates were found for females fed on pigeon pea pollen and on sunn hemp pollen but these rates increased significantly when honey was added to the diets. Females fed with pigeon pea pollen plus honey and with sunn hemp pollen plus honey had higher intrinsic growth rates than those fed with castor bean pollen plus honey. Females fed on castor bean pollen only or on honey only, did not oviposit. Leguminous pollen species were equally suitable for C. externa especially when they were complemented with honey. The results suggest that to successfully enhance predator effectiveness, organic coffee plantation should be diversified with plant providing pollen in combination with plant providing nectar.

Madelaine, Venzon; Maria C., Rosado; Denise E., Euzébio; Brígida, Souza; José H., Schoereder.

2006-06-01

227

Biological aspects and predatory capacity of Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) fed on Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) reared on cotton genotypes / Aspectos biológicos e capacidade predatória de Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) alimentado com Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) criada em genótipos de algodoeiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Plantas hospedeiras podem influenciar indiretamente as características biológicas do predador, de maneira positiva ou negativa, ressaltando assim a importância de estudos relacionando o efeito de cultivares sobre o terceiro nível trófico. Este trabalho avalia os aspectos biológicos e a capacidade pr [...] edatória de adultos de Podisus nigrispinus alimentados com lagartas de Alabama argillacea criadas em genótipos de algodoeiro. Diariamente o predador foi alimentado com lagartas de quarto ínstar criadas com folhas de algodoeiro CNPA Precoce 1 (média pilosidade), CNPA 9211-31 (alto teor de gossipol), CNPA 9211-41 (teor médio de gossipol) e GL2 GL3 (sem gossipol). Essas plantas oferecidas como alimento às lagartas não influenciaram os períodos de pré-oviposição, oviposição e pós-oviposição e a capacidade de oviposição do predador. O peso médio das fêmeas foi maior (126,2 mg) quando elas foram alimentadas com lagartas de A. argillacea criadas em folhas do genótipo GL2 GL3, em comparação com aquele (96,2 mg) de fêmeas que se alimentaram de lagartas criadas em folhas do genótipo CNPA 9211-41. A longevidade de fêmeas do predador variou de 30,7 a 31,5 dias, enquanto que a dos machos apresentou intervalo de variação de 38,0 a 66,3 dias. Fêmeas de P. nigrispinus predaram, em média, de 125,2 a 184,0 lagartas, durante a fase adulta, enquanto os machos predaram no mínimo 135,7 e no máximo 205,0 lagartas. Para o controle de A. argillacea, a utilização de plantas resistentes em associação com P. nigrispinus é viável, pois genótipos resistentes não influenciam negativamente as características biológicas do predador. Abstract in english Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus [...] adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute), CNPA 9211-31 (high gossypol level), CNPA 9211-41 (medium gossypol level) and GL2 GL3 (gossypol glandless). The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg) when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg) of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.

Terezinha Monteiro dos, Santos; Arlindo Leal, Boiça Jr..

2002-12-01

228

Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?  

Directory of Open Access Journals (Sweden)

Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

Cristiano S. de Azevedo

2006-03-01

229

Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) remember antipredator training? / Emas Rhea americana Linnaeus (Rheiformes, Rheidae) se lembram do treinamento anti-predação?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas [...] em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas) e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável. Abstract in english The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 c [...] aptive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone) and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.

Cristiano S. de, Azevedo; Robert J., Young.

2006-03-01

230

Diet of four annual killifishes: an intra and interspecific comparison  

Scientific Electronic Library Online (English)

Full Text Available Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias [...] da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae), Ephemeroptera (especialmente Betidae), e larvas de Coleoptera (especialmente Dytiscidae). Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação. Abstract in english We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lago [...] on basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae), Ephemeroptera (especially Betidae), and coleopteran larvae (especially Dytiscidae). Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.

Gabriel, Laufer; Matías, Arim; Marcelo, Loureiro; Juan Manuel, Piñeiro-Guerra; Sabrina, Clavijo-Baquet; César, Fagúndez.

2009-03-01

231

Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro  

Directory of Open Access Journals (Sweden)

Full Text Available The objective of this work was to evaluate the impact of integrated pest management (IPM in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides, IPM (spraying when action thresholds were achieved, and control (no pesticide was applied. IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick (Lepidoptera: Gelechiidae and Liriomyza spp. (Diptera: Agromyzidae to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen. (Lepidoptera: Crambidae, followed by T. absoluta and Spodoptera eridania (Cr. (Lepidoptera: Noctuidae. The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae, Cycloneda sanguinea larva (L. (Coleoptera: Coccinellidae, Staphylinidae adults (Coleoptera, Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae, Formicidae (Hymenoptera, and Phlaeothripidae (Thysanoptera. The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp., Trichogrammatidae [Trichogramma pretiosum (Riley] and Bethylidae (Goniozus nigrifemur Ashmead, besides Tachinidae (Diptera.O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/semana, MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos e testemunha (sem aplicação de inseticidas e fungicidas. O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick (Lepidoptera: Gelechiidae e Liriomyza spp. (Diptera: Agromyzidae às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen. (Lepidoptera: Crambidae, seguido de T. absoluta e Spodoptera eridania (Cr. (Lepidoptera: Noctuidae. As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae, larvas de Cycloneda sanguinea (L. (Coleoptera: Coccinellidae, adultos de Staphylinidae (Coleoptera, Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae, Formicidae (Hymenoptera e Phlaeothripidae (Thysanoptera. Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp., Trichogrammatidae [Trichogramma pretiosum (Riley] e Bethylidae (Goniozus nigrifemur Ashmead, além de Diptera: Tachinidae.

Moacyr Mascarenhas Motta Miranda

2005-02-01

232

Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato / Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP) na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/sema [...] na), MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos) e testemunha (sem aplicação de inseticidas e fungicidas). O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) e Liriomyza spp. (Diptera: Agromyzidae) às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), seguido de T. absoluta e Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae), larvas de Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae), adultos de Staphylinidae (Coleoptera), Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera) e Phlaeothripidae (Thysanoptera). Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] e Bethylidae (Goniozus nigrifemur Ashmead), além de Diptera: Tachinidae. Abstract in english The objective of this work was to evaluate the impact of integrated pest management (IPM) in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides), [...] IPM (spraying when action thresholds were achieved), and control (no pesticide was applied). IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and Liriomyza spp. (Diptera: Agromyzidae) to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), followed by T. absoluta and Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae), Cycloneda sanguinea larva (L.) (Coleoptera: Coccinellidae), Staphylinidae adults (Coleoptera), Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera), and Phlaeothripidae (Thysanoptera). The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] and Bethylidae (Goniozus nigrifemur Ashmead), besides Tachinidae (Diptera).

Moacyr Mascarenhas Motta, Miranda; Marcelo Coutinho, Picanço; José Cola, Zanuncio; Leandro, Bacci; Ézio Marques da, Silva.

2005-02-01

233

Biological control of phytophagous arthropods in the physic nut tree Jatropha curcas L. in Brazil / Controle biológico de artrópodes fitófagos em Pinhão Manso Jatropha curcas L. no Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Jatropha curcas possui alto teor de óleo biocombustível que poderia substituir os combustíveis poluentes, possuindo grande potencial para o cultivo em larga escala de monocultivos no sistema convencional. Nós exploramos a ocorrência, a distribuição espacial e a resposta funcional das principais esp [...] écies fitófagas e seus inimigos naturais com potencial para controle biológico conservativo. Começamos a amostragem de fitófagos e predadores quando o J. curcas atingiu seis meses de idade. As espécies fitófagas mais frequentes foram ninfas e adultos Empoasca kraemeri, seguido por Frankliniella schultzei e Myzus persicae. Dentre os predadores, Ricoseius loxochelis, Iphiseioides zuluagai, Araneidae, Psyllobora vigintimaculata (larv), Psyllobora vigintimaculata (adulto) e Anthicus sp. foram as mais frequentes. Os parasitoides mais comuns foram das famílias Encyrtidae e Braconidae. As maiores densidades de E. kraemeri fitófagos e F. schultzei nas bordas da cultura de J. curcas seguem padrões espaciais semelhantes aos de inimigos naturais de I. zuluagai e A. sp. Esses artrópodes podem ser considerados eficientes predadores de estágios imaturos de E. kraemeri e F. schultzei em J. curcas. Abstract in english Jatropha curcas has a high biofuel oil content, which could replace polluting fuels, and has great potential for large scale monoculture cultivation in the conventional system. We explored the occurrence, spatial distribution and the functional response of the main phytophagous species of this plan [...] t and their natural enemies to explore the potential for conservative biological control. We began sampling phytophagous species and predators when J. curcas plants were six months old. The most common species of phytophagous insects were nymphs and adults of Empoasca kraemeri, followed by Frankliniella schultzei and Myzus persicae. Among the predators, Ricoseius loxocheles, Iphiseioides zuluagai, Araneidae, larvae and adults of Psyllobora vigintimaculata and Anthicus sp. were the most frequently encountered. The most common parasitoids were the families Encyrtidae and Braconidae. The highest densities of E. kraemeri and F. schultzei on the edges of the J. curcas crop follow spatial patterns similar to those of their natural enemies I. zuluagai and Anthicus sp. These arthropods can be considered efficient predators of immature stages of E. kraemeri and F. schultzei on J. curcas.

Flávio Lemes, Fernandes; Maria Elisa de Sena, Fernandes; Elisângela Novais, Lopes; Madelaine, Venzon; Juno Ferreira da Silva, Diniz; Luís Antônio dos Santos, Dias.

2015-03-01

234

Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores Agropastoril (Agriflor, em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução.Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão das Flores Agropastoril (Agriflor, in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.

LINO B. MONTEIRO

2002-08-01

235

Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi / Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi  

Scientific Electronic Library Online (English)

Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores A [...] gropastoril (Agriflor), em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução. Abstract in english Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão d [...] as Flores Agropastoril (Agriflor), in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.

LINO B., MONTEIRO.

2002-08-01

236

Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river  

Directory of Open Access Journals (Sweden)

Full Text Available The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro following changes in abundance of a forage fish (Moenkhausia dichroura during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (State of Mato Grosso, Brazil from March 2000 to February 2001 (period I and from March 2003 to February 2004 (period II. The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.O objetivo deste estudo foi investigar alterações na dieta de um peixe piscívoro (Acestrorhynchus pantaneiro após mudanças na abundância de um peixe forrageiro (Moenkhausia dichroura durante a colonização de um reservatório. Os peixes foram amostrados mensalmente entre março/2000 e fevereiro/2001 (período I e março/2003 e fevereiro/2004 (período II, no reservatório de Manso (Mato Grosso, Brasil. A abundância de M. dichroura foi significativamente diferente entre os períodos, representando 9,6% dos indivíduos no período I e 66,4% no período II. No período I A. pantaneiro consumiu 41 presas, enquanto que no período II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no período I representava apenas 15%. A relação entre o tamanho do predador e da presa foi positiva em ambos os períodos, porém significativamente diferente. No período II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura. Os resultados mostraram que A. pantaneiro consumiu, no período II, a presa mais abundante e disponível, alterando a composição de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alterações provavelmente causaram um decréscimo nos custos energéticos associados à procura da presa, maximizando o ganho de energia do predador.

Geuza Cantanhêde

2008-12-01

237

Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas / Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência tot [...] al de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas. Abstract in english This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods unde [...] r partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

Walter Santos, Evangelista Júnior; Manoel Guedes Correa, Gondim Junior; Jorge Braz, Torres; Edmilson Jacinto, Marques.

2004-05-01

238

Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato / Critical analysis of the neural systems organizing innate fear responses  

Scientific Electronic Library Online (English)

Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistem [...] as neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento), este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo. Abstract in english Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While th [...] ese shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing), it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

Newton Sabino, Canteras.

2003-12-01

239

Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato Critical analysis of the neural systems organizing innate fear responses  

Directory of Open Access Journals (Sweden)

Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While these shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing, it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

Newton Sabino Canteras

2003-12-01

240

Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas.This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods under partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

Walter Santos Evangelista Júnior

2004-05-01

241

Acarofauna associada a frutos de coqueiro (Cocos nucifera L.) de algumas localidades das Américas / Acarofauna associated with coconut fruits (Cocos nucifera L.) from some localities in America  

Scientific Electronic Library Online (English)

Full Text Available Neste trabalho foram identificados ácaros fitófagos e predadores associados a frutos de coqueiro de localidades do Brasil, Colômbia, Cuba, EUA, México e Venezuela. Foram encontradas três espécies de ácaros fitófagos (duas Eriophyidae, uma Tarsonemidae), quatro espécies de ácaros predadores (duas Asc [...] idae, duas Phytoseiidae), e duas espécies de hábito alimentar pouco conhecido (uma Eupodidae, uma Tydeidae). Aceria guerreronis Keifer (Eriophyidae) foi encontrada nas amostras de Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe e São Paulo, Brasil; e também de Cuba, EUA, México e Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) foi encontrada em amostras do Rio de Janeiro, São Paulo e Sergipe, Brasil; da Colômbia e do México. O tarsonemídeo Steneotarsonemus furcatus De Leon foi coletado em frutos provenientes de Alagoas, Minas Gerais, Rio de Janeiro e Sergipe. Os sintomas observados em frutos infestados por esses ácaros fitófagos foram descritos. As espécies de Ascidae encontradas foram Proctolaelaps longipilis Chant e Proctolaelaps sp.; e as de Phytoseiidae foram Typhlodromus (Anthoseius) ornatus (Denmark & Muma) e Typhlodromalus manihoti (Moraes). Provavelmente essas espécies de ácaros predadores foram registradas, pela primeira vez, em frutos de coqueiro, no mundo. Abstract in english Phytophagous and predatory mites associated with fruits of coconut from Brazil, Colombia, Mexico, USA and Venezuela were identified in this study. Three species of phytophagous mites (two Eriophyidae, one Tarsonemidae), four species of predatory mites (two Ascidae, two Phytoseiidae), and two species [...] with unknown feeding habit (one Eupodidae, one Tydeidae) were found. Aceria guerreronis Keifer (Eriophyidae) were found in samples from Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe and São Paulo, Brazil; and also from Cuba, Mexico, USA and Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) was found in samples from Rio de Janeiro, São Paulo and Sergipe, Brazil, from Colombia and from Mexico. The tarsonemid Steneotarsonemus furcatus De Leon was found on fruits from Alagoas, Minas Gerais, Rio de Janeiro, Sergipe, Brazil. Symptoms observed on fruits infested by these phytophagous mites were described. The Ascidae species found were Proctolaelaps longipilis Chant and Proctolaelaps sp.; and the Phytoseiidae species were Typhlodromus (Anthoseius) ornatus (Denmark & Muma) and Typhlodromalus manihoti (Moraes). For our knowledge, these predator species were registered for the first time from coconut fruits around the world.

Denise, Návia; Gilberto J. de, Moraes; Antonio C., Lofego; Carlos H.W., Flechtmann.

2005-04-01

242

Biologia de Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae predando Plutella xylostella (L. (Lepidoptera: Plutellidae Biology of Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae Preying on Plutella x ylostella (L. (Lepidoptera: Plutellidae  

Directory of Open Access Journals (Sweden)

Full Text Available Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae é um predador encontrado em vários agroecossistemas, predando insetos pequenos e de tegumento mole. Seu alto potencial reprodutivo e elevada capacidade de busca o tornam capazes de predar ovos e larvas de Plutella xylostella (L. (Lepidoptera: Plutellidae nas partes mais internas da cabeça do repolho, onde outros inimigos naturais não conseguem. Essas características podem favorecer a utilização desse predador no controle biológico dessa praga. Neste trabalho, o objetivo é avaliar o desenvolvimento, reprodução e capacidade de predação de C. claveri, quando ovos e larvas de P. xylostella foram ofertados em condições de laboratório. Foram avaliadas as seguintes dietas: 1 ovos; 2 larvas de segundo ínstar; 3 ovos + larvas de segundo ínstar. O desenvolvimento e a viabilidade das formas imaturas de C. claveri foi melhor nas dietas que continham ovos da presa. A oviposição e longevidade também foram maiores nessas dietas, independentemente da presença de larvas. Contudo, o tipo de dieta não afetou a razão sexual e o peso das larvas no oitavo dia de vida. Em média, cada larva de C. claveri foi capaz de predar 1611 ovos ou 135 larvas de segundo ínstar de P. xylostella durante seu desenvolvimento. O predador foi capaz de aumentar a população 218 vezes a cada 42 dias, alimentando-se, exclusivamente, de ovos da presa. Concluiu-se que o predador apresenta potencial para ser utilizado no controle biológico de P. xylostella.Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae is a predator found in several agricultural ecosystems and it preys on small and soft body insects. Its high reproductive potential and forage capacity makes it able of preying eggs and larvae of Plutella xylostella (L. (Lepidoptera: Plutellidae internally hidden on cabbage head, where other natural enemies usually do not reach. These characteristics are important when choosing this predator to be used within biological control programs. This search evaluated the C. claveri development, reproduction, as well as the consumption of P. xylostella eggs and larvae under laboratory conditions. Therefore, it was evaluated the following diets: 1 eggs; 2 larvae of second ínstar; 3 eggs + larvae of second ínstar. The development and the viability of the immature forms of C. claveri were better in the diets containing eggs of P. xylostella. Also, the egg laying and adult longevity were greater with these diets, independently of the larvae presence. However, the diet type did not affect the sexual rate and the weight of the larvae after eight days of living. On average, each C. claveri larva was able of preying 1611 eggs or 135 second-ínstar larvae of P. xylostella during its development. The predator was able to increase its population 218 times after 42 days, feeding exclusively on P. xylostella eggs. Based on these results, this predator presents a great potential of being used within biological control programs of P. xylostella.

Mauricélia Ferreira Almeida

2009-04-01

243

Inseticidas seletivos à tesourinha Doru luteipes (Scudder utilizados no controle do pulgão verde em brássicas Selective insecticides to the earwing Doru luteipes (Scudder used for controlling the green peach aphid in Brassicae  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer (Homoptera: Aphididae, em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes, dimetoato (para adultos e ninfas de primeiro e segundo estádios, paratiom metílico (para ninfas de primeiro e terceiro estádio e acefato (para adultos, apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae.The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer (Homoptera: Aphididae and on first, second, and third instar nymphs and adults of the Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes, for dimethoate (to adults and first and second instar nymphs of the predator, for methyl parathion (to first and third instar nymphs of the predator, and for acephate (to adults of the predator showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro Bacci

2002-06-01

244

Toxicidade Diferencial de Agroquímicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro / Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroquímicos a populações de ácaros das espécies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fêmeas adult [...] as de N. californicus foram tratadas através de pulverização direta utilizando torre de Potter. O ácaro predador N. californicus mostrou tolerância igual ou superior a T. urticae a diversos produtos, em condições de laboratório. A maior diferença foi observada para o acaricida propargite, para o qual o ácaro predador mostrou-se 25,1 vezes mais tolerante que o ácaro rajado. Este fitoseídeo também se mostrou 4,7; 2,9 e 2,5 vezes mais tolerante que o ácaro rajado, a clorfenapir, fempiroximate e ciexatim, respectivamente. No teste de toxicidade residual de agroquímicos, a pulverização foi realizada em canteiros de morango. Foram coletados folíolos em diferentes períodos após a aplicação e infestados artificialmente com fêmeas adultas de N. californicus. As avaliações de mortalidade foram realizadas 48h ou 72h após a infestação. Fempiroximate, fempropatrim, dimetoato, propargite, enxofre e benomil mostraram-se inócuos a N. californicus. Clorfenapir, ciexatim e abamectim foram significativamente prejudiciais ao ácaro predador causando mortalidades iniciais entre 37,5% e 57,5%. A utilização de ácaros predadores como desta população de N. californicus, que apresenta baixa suscetibilidade a diversos agroquímicos, poderia ser muito útil em programas de manejo de T. urticae em morangueiro no Brasil Abstract in english This work aimed to evaluate the differential toxicity of pesticides to populations of the mite species Neoseiulus californicus (McGregor) and Tetranychus urticae Koch collected from commercial crops of strawberry (Fragaria sp.) in Atibaia county, State of São Paulo, Brazil. In the test of acute toxi [...] city of pesticides, adult females of N. californicus received the pesticide treatment under Potter spray tower. The predaceous mite N. californicus showed the same or higher tolerance than T. urticae to various pesticides in laboratory. The highest difference was observed to the acaricide propargite, for which the predaceous mite was 25.1 times more tolerant than the two-spotted spider mite. This phytoseiid was also 4.7, 2.9 and 2.5 times more tolerant than T. urticae to chlorfenapyr, fenpyroximate, and cyhexatin, respectively. In the test of residual toxicity of pesticides, the chemicals were sprayed on plants of strawberry in the field. Leaves were collected after different periods from the treatment and artificially infested with adult females of N. californicus. The mortality was assessed 48h or 72h after treatment. Fenpyroximate, fenpropathrin, dimethoate, propargite, sulphur, and benomyl were innocuous to N. californicus. Chlorfenapyr, cyhexatin, and abamectin were significantly harmful to the predaceous mite causing initial mortality rates between 37.5% and 57.5%. The use of predaceous mites like of this population of N. californicus, which presents low susceptibility to various pesticides can be very useful for programs of management of T. urticae on strawberry in Brazil.

MÁRIO E., SATO; MARCOS DA, SILVA; LEANDRA R., GONÇALVES; MIGUEL F. DE, SOUZA FILHO; ADALTON, RAGA.

2002-07-01

245

Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas / Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Der [...] maptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes), dimetoato (para adultos e ninfas de primeiro e segundo estádios), paratiom metílico (para ninfas de primeiro e terceiro estádio) e acefato (para adultos), apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae. Abstract in english The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer) (Homoptera: Aphididae) and on first, second, and third instar nymphs and adults of the Doru [...] luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes), for dimethoate (to adults and first and second instar nymphs of the predator), for methyl parathion (to first and third instar nymphs of the predator), and for acephate (to adults of the predator) showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro, Bacci; Marcelo C., Picanço; Marcos Rafael, Gusmão; Robert W., Barreto; Tederson Luiz, Galvan.

2002-06-01

246

Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate / Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system  

Scientific Electronic Library Online (English)

Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância dess [...] es fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1) coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2) exposição de ovos sentinelas no campo por 72 horas; 3) ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3), evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate. Abstract in english The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick) (Lep.: Gelechiidae) affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining). The objective of the present work was to quantify the role of each factor in the surviv [...] orship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1) tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2) tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3) cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32%) than those kept in the field (methodology 2 and 3). However, under field conditions (method 2 and 3) by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

Maria Alice de, Medeiros; Edison Ryoiti, Sujii; Helena Castanheira de, Morais.

247

Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick (Lepidoptera: Gelechiidae on organic tomato system and on conventional tomato system  

Directory of Open Access Journals (Sweden)

Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick (Lep.: Gelechiidae está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1 coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2 exposição de ovos sentinelas no campo por 72 horas; 3 ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3, evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate.The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick (Lep.: Gelechiidae affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining. The objective of the present work was to quantify the role of each factor in the survivorship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1 tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2 tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3 cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32% than those kept in the field (methodology 2 and 3. However, under field conditions (method 2 and 3 by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

Maria Alice de Medeiros

2011-01-01

248

Dinámica de polifenoles y estudio anatomo-histoquímico en Schinus longifolius (Lindl. Speg. (Anacardiaceae en respuesta a la infección por Calophya mammifex (Hemiptera - Calophyidae  

Directory of Open Access Journals (Sweden)

Full Text Available Se analizaron los fenoles totales, taninos totales, proantocianidinas, flavonoides totales y ácidos hidroxicinámicos totales de hojas sanas y agallas de Schinus longifolius (Lindl. Speg. (Anacardiaceae infectado por Calophya mammifex (Hemiptera - Calophyidae. La agalla presenta una variación cuali-cuantitativa de los polifenoles estudiados, con una disminución de los fenoles, taninos, flavonoides y ácidos hidroxicinámicos y un aumento en el contenido de proantocianidinas, cuyo monómero se transforma en cianidina luego del clivaje ácido. Se realizó además un análisis anatómico de la agalla donde se encontraron acúmulos de esclereidas y un mayor desarrollo vascular respecto de la hoja sana y un ensayo histoquímico que mostró una expresión diferencial de metabolitos polifenólicos en sus tejidos. C. mammifex utiliza la agalla como refugio contra las condiciones climáticas adversas y predadores y provee además de alimento con menos compuestos potencialmente perjudiciales en las etapas tempranas de su desarrollo.

Ignacio AGUDELO

2013-01-01

249

Localização de presas à curta distância por Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): o papel dos aleloquímicos dos ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Acari: Tetranychidae) e da planta hospedeira, Malus domestica (Borkham) / Short-distance prey location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): the role of the allelochemicals from two phytophagous mites, Panonychus ulmi(Koch) and Tetranychus urticae Koch (Acari: Tetranychidae), and their host plant, Malus domestica (Borkham)  

Scientific Electronic Library Online (English)

Full Text Available Para conhecer os estímulos olfativos à curta distância que Neoseiulus californicus (McGregor) usa para encontrar seu alimento, isto é, os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch, estudaram-se as respostas deste ácaro predador em relação aos aleloquímicos voláteis oriundos [...] tanto das duas espécies de presa como de sua planta hospedeira, Malus domestica (Borkham). Na extremidade de um braço da trilha em Y foi introduzido um disco de folha sadia de macieira (= controle) e na outra um dos oito tipos de estímulo (= tratamento) seguintes: 1) folha sadia, 2) folha sadia com a presa, 3) folha sadia com cairomônios da presa, 4) folha sadia com a presa e seus cairomônios, 5) folha atacada limpa, 6) folha atacada com a presa, 7) folha atacada com cairomônios da presa e 8) folha atacada com a presa e seus cairomônios. Para cada tratamento, observou-se a direção do deslocamento do ácaro predador e analisou-se sua porcentagem de resposta. Para localizar P. ulmi, N. californicus orientou-se pelos estímulos oriundos de folhas sadias com a presa e seus cairomônios (T4), folhas atacadas com cairomônios da presa (T7) e folhas atacadas com a presa e seus cairomônios (T8). Com relação a T. urticae, o ácaro predador respondeu significativamente aos estímulos oriundos de folhas sadias com cairomônios da presa (T3) e de folhas sadias com a presa e seus cairomônios (T4), assim como de todas as combinações com folhas atacadas (T5-8). Estes resultados demonstram que os voláteis emanados pelos ácaros fitófagos, por seus subprodutos e pela planta por eles atacada, em conjunto ou isoladamente, são importantes fontes de informação para N. californicus localizar T. urticae à curta distância. Por outro lado, somente a combinação de dois ou mais estímulos olfativos parece sinalizar a localização de P. ulmi para o ácaro predador, principalmente se os cairomônios de suas fezes, ovos e exúvias estiveram incluídos em tal mistura. Abstract in english To understand how Neoseiulus californicus (McGregor) locates its prey, i.e. Panonychus ulmi (Koch) and Tetranychus urticae Koch, we studied the predator's short-distance responses to the volatile allelochemicals associated with these two phytophagous mites and their host plant, Malus domestica (Bork [...] ham). At the end of one branch of a Y-shape runway we placed an uninfested apple leaf disk (= control) and, at the other end, one of the eight following types of stimulus (= treatments): 1) uninfested leaf, 2) uninfested leaf + prey, 3) uninfested leaf + prey kairomones, 4) uninfested leaf + prey + prey kairomones, 5) infested leaf, 6) infested leaf + prey, 7) infested leaf + prey kairomones, and 8) infested leaf + prey + prey kairomones. We observed the predator's searching behavior on the runway and analyzed its percentage of response to each of the above stimuli. When P. ulmi was tested, significantly more predators went to the end of the branch with uninfested leaves and prey with its kairomones (T4), infested leaves and prey kairomones (T7), and infested leaves and prey with its kairomones (T8). In relation to T. urticae, the predaceous mite showed significant responses to uninfested leaves with prey kairomones (T3) and to uninfested leaves and prey with its kairomones (T4), as well as to all infested leaf combinations (T5-8). These results indicate that the volatiles associated with the phytophagous mites, their byproducts, and the host plant, either separately or combined, play an important role on the short-distance location of T. urticae by N. californicus. On the other hand, only a combination of two or more of those stimuli appear to signal the location of nearby colonies of P. ulmi to the predaceous mite, specially when the kairomones from their feces, eggs, and exuviae are included in such blend.

Karin F.S., Collier; Álvaro E., Eiras; Gilberto S., Albuquerque; Jacquelyn L., Blackmer; Marilaine C., Araújo; Lino B., Monteiro.

2000-12-01

250

Biologia de Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) predando Plutella xylostella (L.) (Lepidoptera: Plutellidae) / Biology of Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) Preying on Plutella x ylostella (L.) (Lepidoptera: Plutellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) é um predador encontrado em vários agroecossistemas, predando insetos pequenos e de tegumento mole. Seu alto potencial reprodutivo e elevada capacidade de busca o tornam capazes de predar ovos e larvas de Plutella xylostella (L.) (Lepidoptera: Plu [...] tellidae) nas partes mais internas da cabeça do repolho, onde outros inimigos naturais não conseguem. Essas características podem favorecer a utilização desse predador no controle biológico dessa praga. Neste trabalho, o objetivo é avaliar o desenvolvimento, reprodução e capacidade de predação de C. claveri, quando ovos e larvas de P. xylostella foram ofertados em condições de laboratório. Foram avaliadas as seguintes dietas: 1) ovos; 2) larvas de segundo ínstar; 3) ovos + larvas de segundo ínstar. O desenvolvimento e a viabilidade das formas imaturas de C. claveri foi melhor nas dietas que continham ovos da presa. A oviposição e longevidade também foram maiores nessas dietas, independentemente da presença de larvas. Contudo, o tipo de dieta não afetou a razão sexual e o peso das larvas no oitavo dia de vida. Em média, cada larva de C. claveri foi capaz de predar 1611 ovos ou 135 larvas de segundo ínstar de P. xylostella durante seu desenvolvimento. O predador foi capaz de aumentar a população 218 vezes a cada 42 dias, alimentando-se, exclusivamente, de ovos da presa. Concluiu-se que o predador apresenta potencial para ser utilizado no controle biológico de P. xylostella. Abstract in english Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) is a predator found in several agricultural ecosystems and it preys on small and soft body insects. Its high reproductive potential and forage capacity makes it able of preying eggs and larvae of Plutella xylostella (L.) (Lepidoptera: Plutellidae) [...] internally hidden on cabbage head, where other natural enemies usually do not reach. These characteristics are important when choosing this predator to be used within biological control programs. This search evaluated the C. claveri development, reproduction, as well as the consumption of P. xylostella eggs and larvae under laboratory conditions. Therefore, it was evaluated the following diets: 1) eggs; 2) larvae of second ínstar; 3) eggs + larvae of second ínstar. The development and the viability of the immature forms of C. claveri were better in the diets containing eggs of P. xylostella. Also, the egg laying and adult longevity were greater with these diets, independently of the larvae presence. However, the diet type did not affect the sexual rate and the weight of the larvae after eight days of living. On average, each C. claveri larva was able of preying 1611 eggs or 135 second-ínstar larvae of P. xylostella during its development. The predator was able to increase its population 218 times after 42 days, feeding exclusively on P. xylostella eggs. Based on these results, this predator presents a great potential of being used within biological control programs of P. xylostella.

Mauricélia Ferreira, Almeida; Reginaldo, Barros; Manoel Guedes Corrêa, Gondim Júnior; Sérgio de, Freitas; Antônio Lourenço, Bezerra.

2009-04-01

251

Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor) (Acari: phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor) em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulve [...] rizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor) under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The produc [...] ts' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

Marcos Zatti da, Silva; Caralos Amadeu Leite de, Oliveira.

2007-04-01

252

Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulverizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The products' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

Marcos Zatti da Silva

2007-04-01

253

Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiológica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available Doru luteipes (SCUDDER, 1876) é um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservação é necessária a utilização de inseticidas seletivos a S. frugiperda e inócuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposição aos resíduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas após o tratamento. Os inseticidas foram classificados segundo índices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi inócuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposição de D. luteipes aos resíduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivência de adultos após o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram inócuos. Devido à baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservação dessa espécie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetação e campo para comprovação de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

Ana Carolina Maciel, Redoan; Geraldo Andrade, Carvalho; Ivan, Cruz; Maria de Lourdes Corrêa, Figueiredo; Rafael Braga da, Silva.

2013-12-01

254

Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae no combate à Orthezia insignis Browne (Homoptera: Ortheziidae em jacarandá Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae to control Orthezia insignis Browne (Homoptera: Ortheziidae on blue jacaranda  

Directory of Open Access Journals (Sweden)

Full Text Available Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina está a ser criado em laboratório e largado em jacarandás infestados com o objectivo de combater a cochonilha-dojacarandá através da luta biológica clássica. Referem-se as largadas de H. pantherina e o sistema de monitorização adoptado para verificar a aclimatação do predador.The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal, are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Fürsch, was imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

Ana Paula Félix

2008-12-01

255

Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) no combate à Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarandá / Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda  

Scientific Electronic Library Online (English)

Full Text Available SciELO Portugal | Language: Portuguese Abstract in portuguese Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. [...] insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina está a ser criado em laboratório e largado em jacarandás infestados com o objectivo de combater a cochonilha-dojacarandá através da luta biológica clássica. Referem-se as largadas de H. pantherina e o sistema de monitorização adoptado para verificar a aclimatação do predador. Abstract in english The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal), are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Fürsch, was [...] imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

Ana Paula, Félix; António Miguel Franquinho, Aguiar; Celestina, Brazão; Paula, Rocha.

2008-12-01

256

First record of the fireworm Hermodice carunculata (Annelida, Polychaeta) preying on colonies of the fire coral Millepora alcicornis (Cnidaria, Hydrozoa) / Primeiro registro do verme de fogo Hermodice carunculata (Annelida, Polychaeta) predando colônias do coral de fogo Millepora alcicornis (Cnidaria, Hydrozoa)  

Scientific Electronic Library Online (English)

Full Text Available O poliqueta Hermodice carunculata é um voraz predador de vários organismos bentônicos e um dos grupos preferenciais na sua dieta é o dos cnidários. No presente trabalho se apresenta o primeiro registro de predação do verme de fogo sobre o hidrocoral Millepora alcicornis. O verme engolfa os ramos ter [...] minais do hidrocoral e fica vários minutos raspando a superfície e retirando os tecidos moles. Apesar deste hidrocoral ser um dos representantes mais comuns dos recifes do norte e nordeste brasileiros e de albergar uma vasta comunidade associada, nunca tinha sido registrada esta associação. Esta nova descoberta alerta na necessidade de se estudar esta associação já que geralmente os danos ocasionados pelo poliqueta são irreversíveis e dependendo da quantidade de predadores pode alterar a saúde dos recifes ou modificar os componentes da comunidade recifal. Abstract in english The polychaete Hermodice carunculata is a voracious predator of several benthic organisms and one of the preferential groups in its diet is that of the cnidarians. This note presents the first record of a fireworm preying on the calcified hydroid Millepora alcicornis. The fireworm engulfs the termin [...] al branches of the fire coral and spends several minutes scraping the surface and removing the soft tissues. Despite this being one of the most common calcified hydroids of the Brazilian northern and northeastern regions (and home to a vast associated community), this kind of association had never been recorded. This discovery points to the need of studying such associations because the damage caused by this polychaete is irreversible and depending on the amount of predators might alter reefs' health or modify the components of the reef community.

Carlos Daniel, Pérez; Paula Braga, Gomes.

2012-06-01

257

Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas / Acarofauna in physic nut culture and associated spontaneous weeds  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas po [...] r meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos. Abstract in english The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from [...] physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

Wilton Pires da, Cruz; Renato Almeida, Sarmento; Adenir Vieira, Teodoro; Eduardo Andrea Lemus, Erasmo; Marçal, Pedro Neto; Maíra, Ignacio; Diogenis Fontenele, Ferreira Junior.

2012-03-01

258

Caracterização da microfauna em estação de tratamento de esgotos do tipo lodos ativados: um instrumento de avaliação e controle do processo / Microfauna characterization in activated sludge wastewater treatment plant: an instrument of assessment and control of process  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A microfauna presente em uma ETE por lodos ativados foi caracterizada, correlacionada com parâmetros físico-químicos e utilizada em modelos existentes de avaliação de sistemas. Durante 351 dias o lodo ativado manteve-se estável com flocos compactos, pequenos e com poucos filamentos. Os protozoários [...] predominantes no lodo foram as tecamebas e os ciliados predadores de flocos, indicando estabilidade do sistema. Os métodos propostos em literatura, baseados no IBL, na densidade total da microfauna e na relação entre ciliados predadores de flocos e ciliados fixos, mostraram-se eficientes para o diagnóstico das condições depurativas do sistema. A análise qualitativa do lodo, englobando o tamanho, quantidade de filamentos, compactação e a identificação das espécies dominantes, foi suficiente para uma caracterização imediata das condições depurativas do sistema de tratamento. Abstract in english Microfauna found in an activated sludge WTP was characterized, correlated to the physical-chemical parameters and used in existing assessment models. During 351 days, the activated sludge remained stable with compacted and small poorly filamentous flocs. It was composed mainly by testate amoebas and [...] crawling ciliates that indicated the stability of the system. The application of the existent system evaluation models to microfauna (SBI, crawling ciliate/attached ciliate relation and total density) was found to be efficient for the assessment of the system depurative conditions. The sludge qualitative analysis, which included the flocs size, amount of filaments, compacting and the identification of the dominant microfauna species, was enough to an immediate diagnosis of the treatment system depurative conditions.

Alessandra Pellizzaro, Bento; Pablo Heleno, Sezerino; Luiz Sergio, Philippi; Valeria, Reginatto; Flavio Rubens, Lapolli.

2005-12-01

259

RESPUESTA DE Phytoseiulus macropilis Banks A VOLÁTILES PRODUCIDOS POR PLANTAS DE FRESA ATACADAS POR Tetranychus urticae Koch ASPERJADOS CON AZADIRACHTINA / RESPONSE OF Phytoseiulus macropilis Banks TO VOLATILES PRODUCED BY STRAWBERRY PLANTS ATTACKED BY Tetranychus urticae Koch SPRINKLED WITH AZADIRACHTINA  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish El control biológico a través de predadores es observado como una alternativa promisoria al control químico de plagas. Phytoseiulus macropilis se ha encontrado asociado a poblaciones del ácaro rayado Tetranychus urticae en plantaciones de fresa en el estado de Minas Gerais, Brasil. En este trabajo s [...] e evaluó a través de experimento de olfatometria los efectos subletales de la azadirachtina sobre la capacidad de P. macropilis en detectar volátiles de plantas de fresa infestadas con T. urticae. Los resultados muestran que el ácaro predador P. macropilis puede diferenciar entre olores de plantas de fresa no atacadas y plantas de fresa atacadas por T. urticae. La azadirachtina en la concentración de 0,31 mg i.a/L no interfirió en la respuesta olfativa de P. macropilis alimentado de presas asperjadas. Abstract in english The biological control through predators is seen as a promising alternative to chemical insect pest control. Phytoseiulus macropilis has been found associated with populations of the striped mite, Tetranychus urticae in strawberry plantations in the state of Minas Gerais, Brazil. In this work, the s [...] ublethal effects of azadirachtina on the natural ability of P. macropilis to detect volatile compounds from strawberry plants infested with T. urticae was evaluated by using olfactometry assays. The results show that P. macropilis predatory mite can distinguish odors from non-attacked strawberry plants and those from strawberry plants attacked by T. urticae. Azadirachtina at a concentration of 0.31 mg i.a/L did not interfere in the olfactory response of P. macropilis fed with sprinkled striped mites.

Alberto, Soto G; Angelo, Pallini; Lemos, Felipe.

2013-12-01

260

Efeito do manejo de plantas daninhas sobre Neoseiulus californicus (Acari:Phytoseiidae) em pomar de macieira / Effect of weed management on Neoseiulus californicus (Acari:Phytoseiidae) in apple orchard  

Scientific Electronic Library Online (English)

Full Text Available Avaliou-se a influência do manejo de plantas daninhas sobre o deslocamento de ácaros tetraniquídeos (Panonychus ulmi e Tetranychus urticae) e do ácaro predador Neoseiulus californicus em um pomar de macieira 'Gala', onde foi implantado o controle biológico do ácaro vermelho, P. ulmi, por meio de lib [...] erações massais de N. californicus. As parcelas tiveram as plantas daninhas manejadas de três formas: sem manejo, com roçadas manuais e com herbicidas. As populações de ácaros foram avaliadas sobre as plantas daninhas, Plantago tormentosa e Erigeron sp, e sobre as folhas de macieira. As maiores populações de N. californicus foram observadas nas parcelas onde os manejos proporcionaram desenvolvimento de plantas daninhas na linha de plantio. Na parcela manejada com herbicida, houve maior população de ácaros tetraniquídeos sobre as macieiras, provavelmente, devido ao reduzido número de N. californicus. P. tormentosa foi o hospedeiro preferencial do ácaro predador. Concluiu-se que o manejo de plantas daninhas, na linha de plantio das macieiras, assume um importante papel no equilíbrio entre as populações de ácaros. Abstract in english The influence of weed management on tetranychid mites (Panonychus ulmi and Tetranychus urticae) and phytoseids movement was evaluated. Neoseiulus californicus populations were released in an apple orchard for biological control of tetranychid mites. Three kinds of weed management were used: no weed [...] control at all, manual control and control with herbicide. The mites were evaluated in Plantago tormentosa, Erigeron sp, and apple tree leaves. The highest population of N. californicus was observed where weed was not controlled. Tetranychid mites populations were abundant on apple trees when herbicide was used, probably due to the low population of N. californicus. P. tormentosa was the preferred host of phytoseids. The conclusion was that weed management plays an important role in the regulation of mite species in apple orchards.

Lino Bittencourt, Monteiro; Luiz, Belli; Alexander de, Souza; André Luiz, Werner.

2002-12-01

261

Incidência de ácaros em cafeeiro cv. Catuaí Amarelo Mite fauna on coffee plants cv. Catuaí Amarelo  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L., no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes (Tenuipalpidae e Oligonychus yothersi (McGregor (Tetranychidae. Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae foi outra espécie muito abundante observada nos ramos.The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L. plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and berries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes (Tenuipalpidae and Oligonychus yothersi (McGregor (Tetranychidae. Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae was also mostly present on branches.

Jeferson Luiz de Carvalho Mineiro

2008-01-01

262

Predação por coccinelídeos e crisopídeo influenciada pela teia de Tetranychus evansi Predation by coccinellids and chrysopid species influenced by Tetranychus evansi webbing  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar o efeito da teia produzida por Tetranychus evansi (Acari: Tetranychidae na eficiência de predação por coccinelídeos Cycloneda sanguinea e Eriopis connexa e pelo crisopídeo Chrysoperla externa. A eficiência em predar as fêmeas de T. evansi na presença e na ausência de sua teia em discos de folhas de tomateiro com ácaros foi avaliada para cada instar das diferentes espécies de predadores. Foi observado efeito negativo da teia produzida por T. evansi na eficiência de predação do segundo e do terceiro instar de C. externa. Quanto à E. connexa, somente a predação pelo último instar foi influenciada negativamente pela presença da teia. A predação pelas larvas de primeiro e terceiro instar de C. sanguinea foi significativamente menor na presença da teia; no entanto, o resultado foi contrário para o quarto instar. O efeito da teia de T. evansi como mecanismo de defesa varia conforme a espécie e o estágio de desenvolvimento do predador.The aim of this work was to evaluate the effect of the webbing produced by Tetranychus evansi (Acari: Tetranychidae on the predation efficiency of Cycloneda sanguinea and Eriopis connexa coccinellids and of the Chrysoperla externa chrysopid. The predation efficiency on T. evansi females with and without webbing on tomato leaf discs was evaluated for each juvenile stage of the different predator species tested. There was a negative effect of T. evansi webbing on the predation efficiency of the second and third C. externa juvenile stages. Regarding E. connexa, only the predation by the oldest juvenile stage was negatively affected by the webbing. The predation efficiency of the first and the third juvenile stages of C. sanguinea was lower in the presence of webbing, but the opposite was observed for the fourth stage. The defensive role of T. evansi webbing varies according to the predator species and their developmental stage.

Madelaine Venzon

2009-09-01

263

Predação por coccinelídeos e crisopídeo influenciada pela teia de Tetranychus evansi / Predation by coccinellids and chrysopid species influenced by Tetranychus evansi webbing  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar o efeito da teia produzida por Tetranychus evansi (Acari: Tetranychidae) na eficiência de predação por coccinelídeos Cycloneda sanguinea e Eriopis connexa e pelo crisopídeo Chrysoperla externa. A eficiência em predar as fêmeas de T. evansi na presença e na ausên [...] cia de sua teia em discos de folhas de tomateiro com ácaros foi avaliada para cada instar das diferentes espécies de predadores. Foi observado efeito negativo da teia produzida por T. evansi na eficiência de predação do segundo e do terceiro instar de C. externa. Quanto à E. connexa, somente a predação pelo último instar foi influenciada negativamente pela presença da teia. A predação pelas larvas de primeiro e terceiro instar de C. sanguinea foi significativamente menor na presença da teia; no entanto, o resultado foi contrário para o quarto instar. O efeito da teia de T. evansi como mecanismo de defesa varia conforme a espécie e o estágio de desenvolvimento do predador. Abstract in english The aim of this work was to evaluate the effect of the webbing produced by Tetranychus evansi (Acari: Tetranychidae) on the predation efficiency of Cycloneda sanguinea and Eriopis connexa coccinellids and of the Chrysoperla externa chrysopid. The predation efficiency on T. evansi females with and wi [...] thout webbing on tomato leaf discs was evaluated for each juvenile stage of the different predator species tested. There was a negative effect of T. evansi webbing on the predation efficiency of the second and third C. externa juvenile stages. Regarding E. connexa, only the predation by the oldest juvenile stage was negatively affected by the webbing. The predation efficiency of the first and the third juvenile stages of C. sanguinea was lower in the presence of webbing, but the opposite was observed for the fourth stage. The defensive role of T. evansi webbing varies according to the predator species and their developmental stage.

Madelaine, Venzon; Felipe, Lemos; Renato Almeida, Sarmento; Maria Consolação, Rosado; Angelo, Pallini.

1086-10-01

264

Biologia comparada de Nusalala uruguaya (Navás, 1923) (Neuroptera; Hemerobiidae) alimentada com diferentes espécies de afídeos: I. Fase de larva / Comparative biology of Nusalala uruguaya (Navás, 1923) (Neuroptera; Hemerobiidae) fed with different aphid species: I. Larval stage  

Scientific Electronic Library Online (English)

Full Text Available A fase larval do predador Nusalala uruguaya (Navás, 1923) alimentada com pulgão-preto-dos-citros Toxoptera citricidus (Kirk), pulgão-da-couve Brevicoryne brassicae (L.) e pulgão-do-picao Dactynotus sp. foi estudada, em condições de laboratório à 25 ± 2°C, UR de 70±10% e fotofase de 14 horas. A espéc [...] ie de presa consumida afetou a fase larval do predador, influenciando a duração e a viabilidade de cada instar, a largura da cápsula cefálica, o peso e o tamanho de suas larvas. Dactynotus sp. foi a espécie mais consumida e que propiciou o melhor desenvolvimento larval, sendo que T. citricidus acarretou 100% de mortalidade no primeiro instar. As larvas de N. uruguaya somente se alimentaram de pre-ovos e larvas da sua própria espécie. Abstract in english The biology of the immature stages of the brown lacewing Nusalala uruguaya (Navás, 1923) was studied under laboratory conditions of 25 ± 2°C temperature, 70 ± 10% RH and photophase of 14 hours, using aphids of the species Toxoptera citricidus (Kirk), Brevicoryne brassicae (L.) and Dactynotus sp. as [...] diets. Prey species affected brown lacewing larval stage development, as indicated by the length and viability of each larval instar, the head capsule width, and the weight and the length of the larvae body. Dactynotus sp. was the most consumed species and gave the best insect development whereas T. citricidus caused 100% mortality during the first instar. Brown lacewing larvae fed only on live aphids and showed a canibalistic behavior eating eggs and larvae of its own species.

B., Souza; J.C., Matioli; A.I., Ciociola.

265

Parasitismo natural em ovos crisopídeos / Natural egg parasitism of chrysopids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os ob [...] jetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliças, em campos de milho-doce, de setembro/1997 a fevereiro/1998. Os ovos de crisopídeos foram coletados semanalmente, sendo individualizados em cápsulas de gelatina até a emergência da larva e/ou do parasitóide. Foram coletados 800 ovos de crisopídeos, sendo que em 71% dos ovos, as larvas sobreviveram; 9% dos ovos foram considerados inviáveis e 20% foram parasitados por seis espécies de microhimenópteros. Destes, 57% foram parasitados por Telenomus sp. (Scelionidae), 32% por Trichogramma pretiosum (Trichogrammatidae), 6% por Oencyrtus chrysopae Crawford (Encyrtidae) e 5% por Aprostocetus sp. (Eulophidae). Abstract in english Most predators, in general, have generalist habits and can be used as biological control agents in several crops. Predator survival is affected by several factors, such as occurrence of parasitoids. The main purpose of this research was to identify the parasitoids of chrysopids, especially egg paras [...] itoids and their level of parasitism. The samples were taken in a sweet-corn field at Embrapa Hortaliças from September/1997 to February/1998. The chrysopids eggs were collected weekly and then individualized in gelatine capsules until larval or parasitoid emergency. A total of 800 eggs were collected. The predator emerged from 71% of the eggs, 9% were inviable eggs and the other 20% were parasitized by six species of microhymenopterans. Among these, 57% were parasitized by Telenomus sp. (Scelionidae), 32% were parasitized by Trichogramma pretiosum (Trichogrammatidae), 6% by Oencyrtus chrysopae Crawford (Encyrtidae) and 5% by Aprostocetus sp. (Eulophidae).

Maria Alice de, Medeiros.

2009-02-01

266

Parasitismo natural em ovos crisopídeos Natural egg parasitism of chrysopids  

Directory of Open Access Journals (Sweden)

Full Text Available Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os objetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliças, em campos de milho-doce, de setembro/1997 a fevereiro/1998. Os ovos de crisopídeos foram coletados semanalmente, sendo individualizados em cápsulas de gelatina até a emergência da larva e/ou do parasitóide. Foram coletados 800 ovos de crisopídeos, sendo que em 71% dos ovos, as larvas sobreviveram; 9% dos ovos foram considerados inviáveis e 20% foram parasitados por seis espécies de microhimenópteros. Destes, 57% foram parasitados por Telenomus sp. (Scelionidae, 32% por Trichogramma pretiosum (Trichogrammatidae, 6% por Oencyrtus chrysopae Crawford (Encyrtidae e 5% por Aprostocetus sp. (Eulophidae.Most predators, in general, have generalist habits and can be used as biological control agents in several crops. Predator survival is affected by several factors, such as occurrence of parasitoids. The main purpose of this research was to identify the parasitoids of chrysopids, especially egg parasitoids and their level of parasitism. The samples were taken in a sweet-corn field at Embrapa Hortaliças from September/1997 to February/1998. The chrysopids eggs were collected weekly and then individualized in gelatine capsules until larval or parasitoid emergency. A total of 800 eggs were collected. The predator emerged from 71% of the eggs, 9% were inviable eggs and the other 20% were parasitized by six species of microhymenopterans. Among these, 57% were parasitized by Telenomus sp. (Scelionidae, 32% were parasitized by Trichogramma pretiosum (Trichogrammatidae, 6% by Oencyrtus chrysopae Crawford (Encyrtidae and 5% by Aprostocetus sp. (Eulophidae.

Maria Alice de Medeiros

2009-02-01

267

Defensive repertoire of Xenodon dorbignyi (Serpentes, Dipsadidae) / Repertório defensivo de Xenodon dorbignyi (Serpentes, Dipsadidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A capacidade de uma espécie em defender-se da ação de um predador esta diretamente relacionada à sua sobrevivência. Nesse sentido, os mecanismos de interação presa/predador são elementos importantes da história natural das espécies. Neste estudo foi avaliado o repertório defensivo da cobra-nariguda [...] (Xenodon dorbignyi), a partir da simulação de ataques predatórios na natureza. Foram observadas nove unidades comportamentais defensivas, sendo os movimentos erráticos, achatamento do corpo, triangulação da cabeça e display caudal os comportamentos mais freqüentemente exibidos. Não foram detectadas diferenças na estratégia defensiva entre os sexos ou entre indivíduos em diferentes estados reprodutivos. Os resultados sugerem que X. dorbignyi possui a capacidade de avaliar o nível de ameaça imposto pelo agressor, sendo o comportamento críptico, o achatamento do corpo e a fuga as estratégias defensivas primárias, com os demais displays representando respostas secundárias ao ataque predatório. Os resultados reforçam a hipótese de que X. dorbignyi represente simultaneamente um mímico de Micrurus e Bothrops. Abstract in english The ability of a species to defend itself against a predator is directly correlated with its survivorship. Thus, prey/predator interaction mechanisms are important elements of the natural history of species. In this study, we examined the defensive repertoire of the South-American hognose snake (Xen [...] odon dorbignyi) through simulations of predator attacks in the field. Nine defensive displays were observed. The most frequently observed displays were erratic movements, body flattening, head triangulation and tail display. No differences were detected in the defensive strategies shown by males and females, regardless of their reproductive state. Our findings suggest that X. dorbignyi has the ability to evaluate the level of threat imposed by the aggressor, with cryptic behavior, body flattening and locomotor escape as the primary defensive strategies, with other displays used as secondary responses to a predator attack. Our results support the hypothesis that X. dorbignyi is a mimic of both Micrurus and Bothrops.

Alexandro Marques, Tozetti; Roberto Baptista de, Oliveira; Glaucia Maria Funk, Pontes.

2009-09-01

268

Influência de sistemas de produção sobre a ocorrência de inimigos naturais de afídeos em pomares de pessegueiros em Araucária-PR / Influence of systems of production on the occurrence of natural enemies of aphids on orchards of peach trees in Araucaria-PR  

Scientific Electronic Library Online (English)

Full Text Available A pressão da sociedade tem forçado a adoção de sistemas de produção de frutas mais sustentáveis e de menor impacto ambiental. O objetivo deste trabalho foi verificar a influência dos sistemas de produção de Boas Práticas Agrícolas (BPA) e Convencional (PC) sobre a diversidade de inimigos naturais de [...] afídeos presentes em seis pomares de pessegueiros no município de Araucária-PR, de julho de 2005 a setembro de 2006. O levantamento do número de inimigos naturais foi realizado por meio de cinco métodos de amostragens: visual em plantas de pessegueiros e em plantas invasoras; armadilhas Möericke; funil e adesivas. No sistema BPA, foram coletados mais espécimes de inimigos naturais (53%), em relação aos pomares PCs (46%), havendo a ocorrência, em ambos, de predadores das famílias Syrphidae, Coccinellidae e Chrysopidae e parasitóides da ordem Hymenoptera. Do total de inimigos naturais coletados, verificou-se a ocorrência de maior quantidade de predadores de afídeos. Abstract in english The pressure of the society has forced the adoption of more sustainable fruit production systems and with less environmental impact. The objective of this work was to verify the influence of production systems of Good Agricultural Practices (GAP) and Conventional Production (CP), about the diversity [...] of natural enemies of aphids present on six orchards of peach trees in the city of Araucaria, PR, from July 2005 to September 2006. The evaluation of the number of natural enemies of aphid's species was made by means of five sampling methods: visual in plants of peach trees; visual in invading plants; yellow water traps of Möericke type; funnel and adhesive traps. In the system GPA, more specimens of natural enemies had been collected (53%) in relation to orchards CP (46%), having the occurrence, in both orchards, of predators of the Syrphidae, Coccinellidae and Chrysopidae family and parasitoids of Hymenoptera order. Concerning the total of collected natural enemies, it was verified the greatest occurrence of aphid predators.

Joselia Maria, Schuber; Lino Bittencourt, Monteiro; Alex Sandro, Poltronieri; Nerio Aparecido, Cardoso; Louise Larissa, May de Mio.

2008-06-01

269

Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa esta [...] va sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação. Abstract in english The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami) associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medus [...] a was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.

Roberta Martini, Bonaldo; João Paulo, Krajewski; Ivan, Sazima.

2004-06-01

270

Incidência de ácaros em cafeeiro cv. Catuaí Amarelo / Mite fauna on coffee plants cv. Catuaí Amarelo  

Scientific Electronic Library Online (English)

Full Text Available Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L.), no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais [...] se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) e Oligonychus yothersi (McGregor) (Tetranychidae). Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae) foi outra espécie muito abundante observada nos ramos. Abstract in english The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L.) plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and be [...] rries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) and Oligonychus yothersi (McGregor) (Tetranychidae). Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae) was also mostly present on branches.

Jeferson Luiz de Carvalho, Mineiro; Mário Eidi, Sato; Adalton, Raga; Miguel Francisco de, Souza Filho; Sheila, Spongoski.

271

Effect of female weight on reproductive potential of the predator Brontocoris tabidus (Signoret, 1852) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este trabalho apresenta a fecundidade de fêmeas do predador Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) de duas classes de peso, objetivando avaliar qual delas apresenta melhor produtividade em criações mantidas em laboratório. Machos e fêmeas foram alimentadas, desde o estádio ninfal [...] , com pupas do besouro Tenebrio molitor L. (Coleoptera: Tenebrionidae). Fêmeas de B. tabidus pesando entre 95 e 150 mg e entre 160 e 220 mg constituíram as duas classes de peso. O período de oviposição e os números de posturas, de ovos e ninfas por fêmea de B. tabidus foram maiores naquelas fêmeas pertencentes à classe mais pesada, enquanto os períodos de pré-oviposição, entre posturas, incubação dos ovos e número de ovos por postura, bem como a percentagem de eclosão de ninfas e a longevidade dos adultos foram semelhantes entre ambas as classes de peso. Fêmeas mais pesadas de B. tabidus apresentaram maior número de ovos por fêmea e por esta razão devem ser utilizadas em programas de criação massal deste predador. Abstract in english The objective of this work was to determine the fecundity of the predator Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) females of two weight classes aiming to define, which one presented higher productivity in the laboratory. Males and females of B. tabidus were reared from nymphs fed [...] with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae in laboratory. Females of B. tabidus weighting 95 to 150 mg and those with 160 to 220 mg constituted two treatments. Oviposition period and numbers of egg masses, eggs and nymphs per female of B. tabidus were higher in the treatment with heavier females, while the periods of preoviposition, between egg mass laying, egg incubation and number of eggs per egg mass, besides the percentage of nymphs hatched and adult longevity were similar between treatments. Heavier females of B. tabidus presented better productivity and for this reason they should be used in programs of mass rearing this predator.

Isaias, Oliveira; José Cola, Zanuncio; José Eduardo, Serrão; Teresinha Vinha, Zanuncio; Tobias Baruc Moreira, Pinon; Maria do Carmo Queiroz, Fialho.

2005-03-01

272

Potencial reprodutivo de Supputius cincticeps (Stal (Heteroptera: Pentatomidae influenciado pelo peso do corpo da fêmea - DOI: 10.4025/actascibiolsci.v25i1.2081 Reproductive potential of the predator Supputius cincticeps (Heteroptera: Pentatomidae affected by female body weight - DOI: 10.4025/actascibiolsci.v25i1.2081  

Directory of Open Access Journals (Sweden)

Full Text Available O potencial reprodutivo de fêmeas de Supputius cincticeps (Stal (Heteroptera: Pentatomidae de duas classes de peso foi avaliado. Machos e fêmeas desse predador foram obtidos de ninfas alimentadas com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. Foram analisadas fêmeas com peso inferior a 45 mg (fêmeas leves e superior a 60 mg (fêmeas pesadas. A longevidade e os períodos de pré-oviposição, oviposição e pós-oviposição foram semelhantes entre fêmeas das duas classes de peso, enquanto aquelas mais pesadas apresentaram maior número de posturas, ovos, ovos/postura e ninfas. Períodos entre posturas e de incubação dos ovos foram menores para fêmeas com peso superior a 60mg. Esses resultados são discutidos em relação ao uso de fêmeas mais pesadas de S. cincticeps para aumentar a produção em criação massal desse predadorThe reproductive potential of Supputius cincticeps (Stal (Heteroptera: Pentatomidae females of two weight classes was evaluated with males and females of this predator obtained from nymphs fed on Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae. Females of S. cincticeps weighing less than 45 mg (light females and more than 60 mg (heavy females constituted the treatments. Pre-oviposition, oviposition and post-oviposition periods besides adult longevity were similar between treatments while number of egg masses, eggs, eggs/egg mass and number of nymphs hatched were higher for heavier females. Periods between egg mass laying and egg incubation were shorter for insects of the last treatment. These results are discussed in relation to the use of heavier females of S. cincticeps to improve mass rearing of this predator in laboratory

Jose Eduardo Serrão

2003-04-01

273

Effect of female weight on reproductive potential of the predator Brontocoris tabidus (Signoret, 1852 (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available The objective of this work was to determine the fecundity of the predator Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae females of two weight classes aiming to define, which one presented higher productivity in the laboratory. Males and females of B. tabidus were reared from nymphs fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in laboratory. Females of B. tabidus weighting 95 to 150 mg and those with 160 to 220 mg constituted two treatments. Oviposition period and numbers of egg masses, eggs and nymphs per female of B. tabidus were higher in the treatment with heavier females, while the periods of preoviposition, between egg mass laying, egg incubation and number of eggs per egg mass, besides the percentage of nymphs hatched and adult longevity were similar between treatments. Heavier females of B. tabidus presented better productivity and for this reason they should be used in programs of mass rearing this predator.Este trabalho apresenta a fecundidade de fêmeas do predador Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae de duas classes de peso, objetivando avaliar qual delas apresenta melhor produtividade em criações mantidas em laboratório. Machos e fêmeas foram alimentadas, desde o estádio ninfal, com pupas do besouro Tenebrio molitor L. (Coleoptera: Tenebrionidae. Fêmeas de B. tabidus pesando entre 95 e 150 mg e entre 160 e 220 mg constituíram as duas classes de peso. O período de oviposição e os números de posturas, de ovos e ninfas por fêmea de B. tabidus foram maiores naquelas fêmeas pertencentes à classe mais pesada, enquanto os períodos de pré-oviposição, entre posturas, incubação dos ovos e número de ovos por postura, bem como a percentagem de eclosão de ninfas e a longevidade dos adultos foram semelhantes entre ambas as classes de peso. Fêmeas mais pesadas de B. tabidus apresentaram maior número de ovos por fêmea e por esta razão devem ser utilizadas em programas de criação massal deste predador.

Isaias Oliveira

2005-03-01

274

Fototrampeo de mamíferos en la Sierra Nanchititla, México: abundancia relativa y patrón de actividad  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish La conservación de las especies y su manejo adecuado dependen de la disponibilidad de información sobre sus poblaciones, por ello es importante estudiar aspectos como la abundancia y el patrón de actividad. En esta investigación se utilizaron trampas-cámara para obtener índices de abundancia relativ [...] a y establecer el patrón de actividad de los mamíferos medianos y grandes de la Sierra Nanchititla, México. El trabajo se llevó a cabo durante el periodo de diciembre de 2003 a mayo de 2006, con un esfuerzo total de 4 305 días-trampa. Se obtuvieron 897 fotografías de 19 especies, las más abundantes fueron: Nasua narica, Sylvilagus floridanus y Urocyon cinereoargenteus, de acuerdo con el índice de abundancia relativa (IAR, número de registros independientes/100 días trampa), coincidiendo con estudios basados en métodos indirectos. El patrón de actividad de las especies registradas mostraron que el 67% son de hábitos nocturnos. Algunas especies mostraron diferencias con los patrones mencionados por otros autores, las cuales se relacionan principalmente con la estacionalidad, la disponibilidad de recursos y el sexo de los individuos Abstract in english Mammals’ camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns. Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity [...] pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days), and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. Rev. Biol. Trop. 59 (1): 373-383. Epub 2011 March 01.

Octavio, Monroy-Vilchis; Martha M, Zarco-González; Clarita, Rodríguez-Soto; Leroy, Soria-Díaz; Vicente, Urios.

2011-03-01

275

Fototrampeo de mamíferos en la Sierra Nanchititla, México: abundancia relativa y patrón de actividad  

Directory of Open Access Journals (Sweden)

Full Text Available La conservación de las especies y su manejo adecuado dependen de la disponibilidad de información sobre sus poblaciones, por ello es importante estudiar aspectos como la abundancia y el patrón de actividad. En esta investigación se utilizaron trampas-cámara para obtener índices de abundancia relativa y establecer el patrón de actividad de los mamíferos medianos y grandes de la Sierra Nanchititla, México. El trabajo se llevó a cabo durante el periodo de diciembre de 2003 a mayo de 2006, con un esfuerzo total de 4 305 días-trampa. Se obtuvieron 897 fotografías de 19 especies, las más abundantes fueron: Nasua narica, Sylvilagus floridanus y Urocyon cinereoargenteus, de acuerdo con el índice de abundancia relativa (IAR, número de registros independientes/100 días trampa, coincidiendo con estudios basados en métodos indirectos. El patrón de actividad de las especies registradas mostraron que el 67% son de hábitos nocturnos. Algunas especies mostraron diferencias con los patrones mencionados por otros autores, las cuales se relacionan principalmente con la estacionalidad, la disponibilidad de recursos y el sexo de los individuosMammals’ camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns. Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days, and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. Rev. Biol. Trop. 59 (1: 373-383. Epub 2011 March 01.

Octavio Monroy-Vilchis

2011-03-01

276

Metazoan parasites of the channel catfish (Ictalurus punctatus) from three dams in Nuevo Leon, Mexico / Metazoarios parásitos del bagre de canal (Ictalurus punctatus) de tres presas en Nuevo León, México  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: English Abstract in spanish El bagre de canal (Ictalurus punctatus) es una de las especies que destacan a nivel mundial en la acuacultura. Aunque la presencia de esta especie es cada vez mayor en la industria pesquera, su fauna parasitaria en México ha recibido escasa atención. Esta investigación tiene como objetivos obtener i [...] nformación sobre la prevalencia y abundancia de la fauna parasitaria de I. punctatus y contribuir al inventario nacional de los parásitos de este hospedero. El estudio se realizó en tres presas del estado de Nuevo León: Cerro Prieto, Rodrigo Gómez y El Cuchillo-Solidaridad. Fueron registradas siete especies de helmintos y una especie de copépodo de 24 I. punctactus. Los resultados obtenidos consisten en un total de 4,687 parásitos, de los cuales 108 fueron endoparásitos y 4,579 ectoparásitos. Los resultados demuestran una gran diversidad de helmintos parásitos, incluyendo a Ligictaluridus floridanus, Corallobothrium fimbriatum y un nuevo registro de localidad para Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp. y el copepodo Ergasilus cerastes, así como un nuevo registro de hospedero y localidad para Spinitectus tabascoensis, originalmente descrito en Ictalurus furcatus en Tabasco al sur de México. Abstract in english The freshwater channel catfish (Ictalurus punctatus, Rafinesque, 1818) is one of the world-wide highlight species in aquaculture. Despite the growing presence of this fish in the farming industry, its parasitic fauna is rarely studied in Mexico. This survey was designed to provide insight into the o [...] ccurrence and abundance of parasitic fauna of I. punctatus and to contribute to the national inventory of parasites of this fish. This study was performed at the following three dams in the state of Nuevo Leon, Mexico: Cerro Prieto, Rodrigo Gomez, and El Cuchillo-Solidaridad. Seven helminths and 1 copepod species were recorded from the 24 I. punctatus collected. This record consists of a total of 4,687 parasites, of which 108 were endoparasites and 4,579 ectoparasites. Our findings demonstrate a great diversity of helminth parasites, including Ligictaluridus floridanus, and Corallobothrium fimbriatum, and new locality records for Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp., the copepod Ergasilus cerastes, and a new host and distribution record was reported for Spinitectus tabascoensis, originally described from I. furcatus from Tabasco, southern Mexico.

Lucio, Galaviz-Silva; Zinnia Judith, Molina-Garza; Baldemar, Escobar-González; Francisco Javier, Iruegas-Buentello.

2013-12-01

277

Genome rearrangement distances and gene order phylogeny in gamma-Proteobacteria.  

Science.gov (United States)

Genome rearrangements have been studied in 30 gamma-proteobacterial complete genomes by comparing the order of a reduced set of genes on the chromosome. This set included those genes fulfilling several characteristics, the main ones being that an ortholog was present in every genome and that none of them had been acquired by horizontal gene transfer. Genome rearrangement distances were estimated based on either the number of breakpoints or the minimal number of inversions separating two genomes. Breakpoint and inversion distances were highly correlated, indicating that inversions were the main type of rearrangement event in gamma-Proteobacteria. In general, the progressive increase in sequence-based distances between genome pairs was associated with the increase in their rearrangement-based distances but with several groups of distances not following this pattern. Compared with free-living enteric bacteria, the lineages of Pasteurellaceae were evolving, on average, to relatively higher rates of between 2.02 and 1.64, while the endosymbiotic bacterial lineages of Buchnera aphidicola and Wigglesworthia glossinidia were evolving at moderately higher rates of 1.38 and 1.35, respectively. Because we know that the rearrangement rate in the Bu. aphidicola lineage was close to zero during the last 100-150 Myr of evolution, we deduced that a much higher rate took place in the first period of lineage evolution after the divergence of the Escherichia coli lineage. On the other hand, the lineage of the endosymbiont Blochmannia floridanus did present an almost identical rate to free-living enteric bacteria, indicating that the increase in the genome rearrangement rate is not a general change associated with bacterial endosymbiosis. Phylogenetic reconstruction based on rearrangement distances showed a different topology from the one inferred by sequence information. This topology broke the proposed monophyly of the three endosymbiotic lineages and placed Bl. floridanus as a closer relative to E. coli than Yersinia pestis. These results indicate that the phylogeny of these insect endosymbionts is still an open question that will require the development of specific phylogenetic methods to confirm whether the sisterhood of the three endosymbiotic lineages is real or a consequence of a long-branch attraction phenomenon. PMID:15772379

Belda, Eugeni; Moya, Andrés; Silva, Francisco J

2005-06-01

278

Roadkills of vertebrates in Venezuela / Vertebrados mortos em estradas na Venezuela  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-o [...] utubro). Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae), durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 raposas Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766) (Myrmecophagidae), 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae). Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae). Abstract in english This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October). During five passages on [...] this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae) during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758) (Myrmecophagidae), 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae). Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae).

Jan, Pinowski.

2005-03-01

279

Roadkills of vertebrates in Venezuela Vertebrados mortos em estradas na Venezuela  

Directory of Open Access Journals (Sweden)

Full Text Available This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October. During five passages on this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758 (Myrmecophagidae, 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae. Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-outubro. Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae, durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 raposas Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766 (Myrmecophagidae, 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae. Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.

Jan Pinowski

2005-03-01

280

Prevalence of antibodies to Toxoplasma gondii in wild mammals of Missouri and east central Kansas: biologic and ecologic considerations of transmission.  

Science.gov (United States)

Sera from 273 wild mammals from Missouri and Kansas (USA), collected between December 1974 and December 1987, were tested for the presence of antibodies to Toxoplasma gondii using the Sabin-Feldman dye test. Sixty-five (24%) had antibodies at titers of > or = 1:8, including 38 (66%) of 58 carnivores, 14 (15%) of 94 omnivores, 13 (11%) of 117 herbivores, and none of four insectivores. The prevalence of antibodies in mice (Mus musculus and Peromyscus spp.) and rats (Rattus norvegicus and Sigmodon hispidus) was low (3%), while medium sized herbivores such as squirrels (Sciurus spp.), rabbits (Sylvilagus floridanus), and muskrats (Ondatra zibethicus) had prevalences of about 18%. Red foxes (Vulpes fulva) and mink (Mustela vison) had the highest prevalence of antibodies with frequencies of 90 and 66%, respectively. In 32 attempts to isolate Toxoplasma gondii from wild mammals with positive (> or = 1:4) titers, only six (19%) were successful: a gray squirrel (Sciurus carolinensis), a beaver (Castor canadensis), an opossum (Didelphis marsupialis), a red fox and two mink. These findings are consistent with the hypothesis that the probability of infection with Toxoplasma gondii, and therefore prevalence of antibodies in wildlife, is greatest in carnivores. PMID:7563419

Smith, D D; Frenkel, J K

1995-01-01

281

Experimental infection of vertebrates of the Pocomoke Cypress Swamp, Maryland with Keystone and Jamestown Canyon viruses.  

Science.gov (United States)

Experimental studies were conducted to assess the susceptibility of white-tailed deer (Odocoileus virginianus), gray squirrels (Sciurus carolinensis), and cottontail rabbits (Sylvilagus floridanus) to Jamestown Canyon (JC) and/or Keystone (KEY) virus infection. Viremia occurred in 5 of 6 deer inoculated with JC virus; however, all deer developed KEY virus neutralizing antibody. Based on the observation that antibody elicited by primary infection of deer with either KEY or JC virus exhibited partial heterologous neutralization in vitro, cross-challenge experiments were performed in these animals. Keystone virus failed to infect deer 30 days post primary JC virus infection; however, deer became infected when challenged with KEY virus 80 days after the initial JC virus infection as indicated by a substantial increase in antibody titer. Similarly, JC virus failed to produce viremia in immune animals infected with KEY virus 80 days previously, although 2 of the 3 animals challenged had serological evidence of infection. Three field-collected cottontail rabbits with no evidence of KEY antibody were readily susceptible to KEY virus infection and developed viremias of 1-4 days' duration; rabbits with KEY virus antibody did not develop viremia upon KEY virus challenge. Eight antibody-negative field-collected gray squirrels became viremic following injection with KEY virus; however, a comparable group of squirrels did not become viremic when injected with JC virus. PMID:453437

Watts, D M; Tammariello, R F; Dalrymple, J M; Eldridge, B F; Russell, P K; Top, F H

1979-03-01

282

Análisis comparativo de la alimentación del gato montés (Lynx Rufus en dos diferentes ambientes de México  

Directory of Open Access Journals (Sweden)

Full Text Available En el presente trabajo se analiza, en forma comparativa, la alimentación del gato montés en dos localidades con ambientes diferentes: la primera es el predio ?El Plomito?, Sonora, con vegetación de matorrales áridos, y la segunda es la Sierra del Ajusco, en el sur de la Cuenca de México, donde predominan los bosques de coníferas. Mediante el análisis de 197 y 922 excretas, se identificaron 18 y 28 presas diferentes, respectivamente. En ambas localidades, los grupos de especies presa que aportaron mayor biomasa a la alimentación del gato montés fueron los lagomorfos, con 74.2% en El Plomito y 70.0% en El Ajusco, y los roedores con 18.9 y 18.7%, en el mismo orden. En El Plomito la presa más importante fue Sylvilagus audubonii (35.5%, seguida por Lepus sp. (31.5%, Neotoma albigula (14.0%, Odocoileussp. (2.9% y Spermophilus variegatus (1.7%. En El Ajusco la presa más importante fue Sylvilagus floridanus(41.6%, seguida por Sylvilagus cunicularius (15.4%, Romerolagus diazi (12.3%, Cratogeomys merriami (5.1% y Sciurus aureogaster (4.9%. Los resultados obtenidos apoyan la teoría de que el gato montés, al igual que las otras especies de linces, es un depredador especialista en la caza de lagomorfos.

Marcelo Aranda

2002-01-01

283

Great horned owl (Bubo virginianus) dietary exposure to PCDD/DF in the Tittabawassee River floodplain in Midland, Michigan, USA.  

Science.gov (United States)

Soils and sediments in the floodplain of the Tittabawassee River downstream of Midland, Michigan, USA contain elevated concentrations of polychlorinated dibenzofurans (PCDF) and polychlorinated dibenzo-p-dioxins (PCDD). As a long-lived, resident top predator, the great horned owl (Bubo virginianus; GHO) has the potential to be exposed to bioaccumulative compounds such as PCDD/DF. Site-specific components of the GHO diet were collected along 115 km of the Tittabawassee, Pine, Chippewa, and Saginaw Rivers during 2005 and 2006. The site-specific GHO biomass-based diet was dominated by cottontail rabbits (Sylvilagus floridanus) and muskrats (Ondatra zibethicus). Incidental soil ingestion and cottontail rabbits were the primary contributors of PCDD/DF to the GHO diet. The great horned owl daily dietary exposure estimates were greater in the study area (SA) (3.3 to 5.0 ng 2,3,7,8-TCDD equivalents (TEQ(WHO-avian))/kg body wt/d) than the reference area (RA) (0.07 ng TEQ(WHO-Avian)/kg body wt/d). Hazard quotients (HQs) based on central tendency estimates of the average daily dose and no-observable-adverse effect level (NOAEL) for the screech owl and uncertainty factors were <1.0 for both the RA and the SA. Hazard quotients based on upper end estimates of the average daily dose and NOAEL were <1.0 in the RA and up to 3.4 in the SA. PMID:20872700

Coefield, Sarah J; Zwiernik, Matthew J; Fredricks, Timothy B; Seston, Rita M; Nadeau, Michael W; Tazelaar, Dustin L; Moore, Jeremy N; Kay, Denise P; Roark, Shaun A; Giesy, John P

2010-10-01

284

Reproductive and biochemical biomarkers in largemouth bass sampled downstream of a pulp and paper mill in Florida  

Science.gov (United States)

The objective of this study was to evaluate the effects of bleached/unbleached kraft mill effluents (B/UKME) on the reproductive parameters of free-ranging Florida largemouth bass (Micropterus salmoides floridanus). The reproductive parameters measured included gonadosomatic index (GSI), histological evaluation of gonads, and plasma concentrations of vitellogenin (VTG), 17??-estradiol, and 11-ketotestosterone (11-KT). Hepatic ethoxyresorufin-O-deethylase (EROD) activity was measured as a marker of exposure to cytochrome P450-inducing agents in these effluents. Endpoints were compared among adult bass sampled from tributary and mainstream effluent-contaminated and reference sites. Females sampled from the site closest to the mill outfall had a significant five-fold increase in EROD activity compared to bass sampled from reference streams. Although sex hormones were significantly reduced in bass from exposed sites, there were no differences in VTG and GSI across sites. The absence of organism-level responses was probably not related to a lack of sensitivity, as previous studies in our laboratory have shown that bass exposed to these effluents exhibit changes in GSI and in other measures associated with reproductive success. In females, inverse relationships were observed between VTG and GSI and EROD activity. These relationship, however, were not consistent within all of the sites studied. Collectively, our findings indicate that hepatic EROD induction is an effective marker of B/UKME exposure in largemouth bass and that it might be associated with antiestrogenic effects in this species. ?? 2003 Elsevier Inc. All rights reserved.

Sepulveda, M.S.; Gallagher, E.P.; Wieser, C.M.; Gross, T.S.

2004-01-01

285

Discovery of defense- and neuropeptides in social ants by genome-mining.  

Science.gov (United States)

Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant), Camponotus floridanus (carpenter ant) and Harpegnathos saltator (basal genus). Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins) and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae) and supports recent findings in Tribolium castaneum (red flour beetle) and Nasonia vitripennis (parasitoid wasp), and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee), another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family) and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value. PMID:22448224

Gruber, Christian W; Muttenthaler, Markus

2012-01-01

286

[Mammals' camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns].  

Science.gov (United States)

Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days), and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. PMID:21516657

Monroy-Vilchis, Octavio; Zarco-González, Martha M; Rodríguez-Soto, Clarita; Soria-Díaz, Leroy; Urios, Vicente

2011-03-01

287

Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.  

Science.gov (United States)

Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations. PMID:25758336

Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

2015-01-01

288

Bioinformatic characterization and gene expression pattern of apoptosis inhibitor from Macrobrachium rosenbergii challenged with infectious hypodermal and hematopoietic necrosis virus.  

Science.gov (United States)

Apoptosis is genetically programmed cellular killing processes that execute unnecessary or infected cells. It plays an important role in embryogenesis, homeostasis, insect metamorphosis and immunity. Apoptosis inhibitor (MrIAP) was sequenced from the freshwater giant prawn Macrobrachium rosenbergii using Illumina Solexa Genome Analyzer Technique. MrIAP consisted of 1753 base pair nucleotides encoded 535 polypeptide with an estimated molecular mass of 60 kDa. MrIAP amino acid sequence contains IAP superfamily domain between 5 and 490. The deduced amino acid sequences of the MrIAP were aligned with the other IAP family members. The highest sequence similarity was observed in IAP-5 from ant Camponotus floridanus (67%) followed by IAP from body louse Pediculus humanus corporis (66%) and the lowest (62%) in IAP-5 isoform-5 from common chimpanzee Pan troglodytes and IAP-5 from Aedes aegypti. The IAP phylogenetic tree showed that MrIAP closely related to other arthropod blacklegged tick Ixodes scapularis, formed a sister group with IAP from a hemichordate acorn worm Saccoglossus kowalevskii and finally clustered together with IAPs from fish groups. The quantitative real time PCR analysis revealed that significantly (P infection in M. rosenbergii. PMID:21945707

Arockiaraj, Jesu; Vanaraja, Puganeshwaran; Easwvaran, Sarasvathi; Singh, Arun; Othman, Rofina Yasmin; Bhassu, Subha

2011-12-01

289

Ticks (Acari: Ixodidae) collected from small and medium-sized Kansas mammals.  

Science.gov (United States)

Seven species of hard-bodied ticks were collected from 20 species of small and medium-sized mammals in Kansas; Amblyomma americanum L., Dermacentor variabilis (Say), Haemaphysalis leporispalustris (Packard), Ixodes cookei Packard, I. kingi Bishopp, I. sculptus Neumann, and I. texanus Banks. Dermacentor variabilis was found statewide, A. americanum only in the eastern one-third of the state, and the Ixodes spp. and H. leporispalustris were widely scattered. The most common tick found was D. variabilis, both by itself and in association with other ticks. Mammals that ticks were collected from included Canis latrans Say, Cynomys ludovicianus ludovicianus (Ord), Didelphis virginianus Kerr, Geomys bursarius (Shaw), Lynx rufus (Schreber), Marmota monax bunkeri Black, Mephitis mephitis (Schreber), Microtus ochrogaster (Wagner), Mus musculus L., Peromyscus leucopus (Rafinesque), P. maniculatus (Wagner), Procyon lotor hirtus Nelson and Goldman, Reithrodontomys megalotis (Baird), Sciurus niger rufiventer Geoffroy, Sigmodon hispidus texianus (Audubon and Bachman), Sylvilagus floridanus (J. A. Allen), Taxidea taxus taxus (Schreber), and Vulpes velox velox (Say). PMID:8057327

Brillhart, D B; Fox, L B; Upton, S J

1994-05-01

290

Habitats and trophic relationships of Chironomidae insect larvae from the Sepotuba River basin, Pantanal of Mato Grosso, Brazil / Hábitats e relações tróficas de insetos Chironomidae da bacia do Rio Sepotuba, Pantanal de Mato Grosso, Brasil  

Scientific Electronic Library Online (English)

Full Text Available Hábitats bênticos estão ligados por processos físicos e são elementos essenciais na avaliação da dinâmica de distribuição de insetos dípteros Chironomidae e seu papel em ecossistemas aquáticos. Este trabalho apresenta os resultados dos padrões de distribuição de larvas de Chironomidae em 38 locais q [...] ue são abundantes na área de estudo, habitando o substrato do canal principal do rio, cachoeiras, córregos tributários, lagoas de planície de inundação, e reservatórios ao longo do Rio Sepotuba de sua desembocadura ao Rio Paraguai e na região de cabeceira. Um total de 1,247 larvas foi registrada. O táxons mais abundantes foram Polypedilum (Tripodura) sp. (25.2%), Cricotopus sp.3 (23.0%) e Tanytarsus sp. (15.0%). Fissimentum desiccatum foi encontrado somente no reservatório; Fissimentum sp.2 e Tanytarsus cf. T. obiriciae sp.2 nas lagoas de planície de inundação, e Goeldichironomus sp. no canal principal. A baixa diversidade dos locais S06 e S35 foi causada pela exclusiva presença da espécie Cricotopus sp.3, sozinha ou junta com um ou outro táxon (Tanytarsus sp., Djalmabatista sp.3). Coletores-filtradores representaram 16%, coletores-catadores 15%, predadores 11% e raspadores somente 1%. Os predadores dominaram no canal secundário (±88 ind/m2), correspondendo a 40% do total deste grupo. Cryptochironomus sp.2 (34%) e Ablasbemyia gr. annulata (26%) foram os mais abundantes entre os predadores. As diferenças ao longo do curso do rio foram decisivas para a formação de comunidades distintas e descontínuas e os limites tornam óbvios pertinentes às interrelações entre as populações na comunidade, como por exemplo, competição por alimento e hábitat. Abstract in english Benthic habitats are linked by physical processes and are essential elements in assessing of the distribution dynamics of Chironomidae dipteran insects and their role in aquatic ecosystems. This work presents results of distribution patterns of chironomids larvae in 38 sites that are abundant in the [...] study site, inhabiting the substrate of the main river channel, rapids, tributary brook, floodplain lakes and reservoir along the Sepotuba River from its mouth at the Paraguay River to the headwater region. A total of 1,247 larvae was registered. The most abundant taxa were Polypedilum (Tripodura) sp. (25.2%), Cricotopus sp.3 (23.0%) and Tanytarsus sp. (15.0%). Fissimentum desiccatum were found only in the reservoir; Fissimentum sp.2 and Tanytarsus cf. T. obiriciae sp.2 in floodplain lakes, and Goeldichironomus sp. in the main channel. The low diversity of the sites S06 and S35 is caused by the near-exclusive presence of the species Cricotopus sp.3, alone or together with one or another taxon (Tanytarsus sp., Djalmabatista sp.3). Collectors-filterers represent 16%, collectors-gatherers 15%, predators 11% and scrapers only 1%. The predators dominated in the secondary channel (±88 ind/m2), corresponding to 40% of the total of this group. Cryptochironomus sp.2 (34%) and Ablasbemyia gr. annulata (26%) were the most abundant among the predators. The differences along the river course are decisive for the formation of distinct or discontinuous communities and the limits become obvious though the interrelations between the populations in the community, as for instance, competition for food and habitats.

CMM., Butakka; M., Grzybkowska; GD., Pinha; AM., Takeda.

2014-05-01

291

Impact and Selectivity of Insecticides to Predators and Parasitoids  

Directory of Open Access Journals (Sweden)

Full Text Available Problems with the use of insecticides has brought losses, such as, negative impact on natural enemies. When these beneficial insects reduce cause the eruption of pests and resurgence it’s more common. Thus principles of conservation these arthropods are extremely important in the biological natural control of pests, so that these enemies may present a high performance. Because of the negative impacts caused by insecticides on agriculture and their harmful effects on natural enemies, the objective of this article is to approach two important subjects, divided into three parts. Part I relates to the description of the main crop pests and their natural enemies; Part II involves the impact of insecticides on predators and parasitoids and Part III focuses on the selectivity of several groups of insecticides to natural enemies. Before spraying insecticides, it is necessary to choose a product that is efficient to pests and selective to natural enemies. So, it is indispensable to identify correctly the groups and species of natural enemies, since insecticides have an impact on their survival, growth, development, reproduction (sexual ratio, fecundity, longevity and fertility, and behavior (motility, orientation, feeding, oviposition and learning of insects. The mechanisms of toxicity and selectivity of insecticides are related to the properties of higher or lower solubility and molecular weight. Besides, characteristics of the cuticular composition of the integument of natural enemies are extremely important in the selectivity of a product or the tolerance of a certain predator or parasitoid to this molecules.Impacto e Seletividade de Inseticidas para Predadores e ParasitóidesResumo.Dentre os problemas advindos do uso de inseticidas, a destruição de inimigos naturais é fator importante. Estes insetos benéficos podem reduzir problemas de erupção de pragas secundárias, ressurgência de pragas e manter a praga abaixo do nível de dano econômico. Dessa forma a conservação de inimigos naturais, para que os mesmos exerçam alta performance frente às pragas, é de extrema importância em controle biológico de pragas. Método de controle essencial utilizados nos programas de manejo integrado de pragas. Tendo em vista os impactos negativos dos inseticidas na agricultura e os seus efeitos adversos sobre os inimigos naturais, este artigo visa abordar dois assuntos importantes, que para isso é dividido em três partes. A parte I relacionada com o reconhecimento das principais pragas agrícolas e seus inimigos naturais; a parte II envolve o impacto dos inseticidas sobre os predadores e parasitóides e a parte III abordará sobre a seletividade dos diversos grupos de inseticidas aos inimigos naturais. Antes de se pulverizar inseticida é necessário a escolha de um produto que seja seletivo e eficiente, assim torna-se imprescindível identificar de forma correta os grupos e espécies de inimigos naturais. Uma vez que os inseticidas apresentam impacto sobre a sobrevivência, o crescimento e desenvolvimento, na reprodução (razão sexual, fecundidade, longevidade e fertilidade, no comportamento (mobilidade, orientação, alimentação, oviposição e aprendizado. Os mecanismos de toxicidade e seletividade dos inseticidas estão relacionados às propriedades de maior ou menor solubilidade e peso molecular. Além disso, características da composição cuticular do integumento dos inimigos naturais são de extrema importância na seletividade de um produto ou a tolerância de determinado predador ou parasitóide.

Flávio Lemes Fernandes

2010-04-01

292

Aspectos biológicos da fase adulta de Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) oriunda de larvas alimentadas com Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) / Biological aspects of the adult stage of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) originating from the larvae fed Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae)  

Scientific Electronic Library Online (English)

Full Text Available Objetivou-se estudar alguns aspectos biológicos da fase adulta de Chrysoperla externa (Hagen) quando as larvas desse predador foram alimentadas com ninfas e fêmeas adultas de Planococcus citri (Risso). O experimento foi conduzido em câmara climatizada regulada a 25 ± 1 ºC, 70 ± 10% de UR e fotofase [...] de 12 horas. Os adultos de C. externa cujas larvas foram alimentadas com ninfas nos três ínstares e fêmeas adultas da cochonilha, foram separados por sexo e 25 casais foram individualizados em gaiolas determinando-se a razão sexual, período de pré-oviposição, capacidade de oviposição diária e total durante 40 dias consecutivos, longevidade, período embrionário e viabilidade de ovos. Constatou-se que as ninfas nos três ínstares e fêmeas adultas fornecidas como alimento, não afetaram a razão sexual, período de pré-oviposição, período embrionário e longevidade dos adultos de C. externa. A produção diária e total de ovos por C. externa foi afetada pelo tipo de alimento fornecido ao predador durante a fase de larva, observando-se uma maior produção quando os casais foram alimentados na fase de larva com fêmeas adultas da cochonilha. Analisando-se a produção de ovos, observou-se uma maior concentração de oviposição nos primeiros dez dias do período reprodutivo, decrescendo nas avaliações seguintes. Foram obtidas porcentagens maiores de ovos viáveis e menores de inviáveis e inférteis, porém, não diferiram em função do alimento fornecido ao predador na fase de larva. Abstract in english It was aimed to study some biological aspects in the adult stage of Chrysoperla externa (Hagen) when the larvae of predator were fed both nymphs and adult females of Planococcus citri (Risso). The experiment was conducted in climate chamber at 25 ± 1°C, 70 ± 10% of RH and 12-h photophase. The adults [...] of C. externa whose larvae were fed nymphs at the three instars and adult females of mealybug were separated by sex and 25 couples were individualized in cages of PVC determining sex ratio, pre-oviposition period, daily and total oviposition for 40 days on end, longevity, embryonic period and survival rate of eggs. It was found that the nymphs at the three instars and adult females given as food did not affect sex ratio, pre-oviposition period, embryonic period and longevity of adults of C. externa. The daily and total egg production by C. externa was affected by the sort of food given to the predator during the larval stage, observing a greater production when the couples were fed at the larval stage with adults females of mealybug. By assessing egg production, a higher concentration of oviposition on the first ten days of the reproductive period was found, decreasing in the next evaluations. The survival rates of eggs not differ in function of feed in the different stages of development of prey that was consumed by differents predator larvae stage.

Gerane Celly Dias, Bezerra; Lenira Viana Costa, Santa-Cecília; César Freire, Carvalho; Brígida, Souza.

2006-08-01

293

Aspectos biológicos da fase adulta de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae oriunda de larvas alimentadas com Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae Biological aspects of the adult stage of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae originating from the larvae fed Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se estudar alguns aspectos biológicos da fase adulta de Chrysoperla externa (Hagen quando as larvas desse predador foram alimentadas com ninfas e fêmeas adultas de Planococcus citri (Risso. O experimento foi conduzido em câmara climatizada regulada a 25 ± 1 ºC, 70 ± 10% de UR e fotofase de 12 horas. Os adultos de C. externa cujas larvas foram alimentadas com ninfas nos três ínstares e fêmeas adultas da cochonilha, foram separados por sexo e 25 casais foram individualizados em gaiolas determinando-se a razão sexual, período de pré-oviposição, capacidade de oviposição diária e total durante 40 dias consecutivos, longevidade, período embrionário e viabilidade de ovos. Constatou-se que as ninfas nos três ínstares e fêmeas adultas fornecidas como alimento, não afetaram a razão sexual, período de pré-oviposição, período embrionário e longevidade dos adultos de C. externa. A produção diária e total de ovos por C. externa foi afetada pelo tipo de alimento fornecido ao predador durante a fase de larva, observando-se uma maior produção quando os casais foram alimentados na fase de larva com fêmeas adultas da cochonilha. Analisando-se a produção de ovos, observou-se uma maior concentração de oviposição nos primeiros dez dias do período reprodutivo, decrescendo nas avaliações seguintes. Foram obtidas porcentagens maiores de ovos viáveis e menores de inviáveis e inférteis, porém, não diferiram em função do alimento fornecido ao predador na fase de larva.It was aimed to study some biological aspects in the adult stage of Chrysoperla externa (Hagen when the larvae of predator were fed both nymphs and adult females of Planococcus citri (Risso. The experiment was conducted in climate chamber at 25 ± 1°C, 70 ± 10% of RH and 12-h photophase. The adults of C. externa whose larvae were fed nymphs at the three instars and adult females of mealybug were separated by sex and 25 couples were individualized in cages of PVC determining sex ratio, pre-oviposition period, daily and total oviposition for 40 days on end, longevity, embryonic period and survival rate of eggs. It was found that the nymphs at the three instars and adult females given as food did not affect sex ratio, pre-oviposition period, embryonic period and longevity of adults of C. externa. The daily and total egg production by C. externa was affected by the sort of food given to the predator during the larval stage, observing a greater production when the couples were fed at the larval stage with adults females of mealybug. By assessing egg production, a higher concentration of oviposition on the first ten days of the reproductive period was found, decreasing in the next evaluations. The survival rates of eggs not differ in function of feed in the different stages of development of prey that was consumed by differents predator larvae stage.

Gerane Celly Dias Bezerra

2006-08-01

294

Velocidade da água e a distribuição de larvas e pupas de Chirostilbia pertinax (Kollar) (Diptera, Simuliidae) e macroinvertebrados associados / Water velocity and the distribution of larvae and pupae of Chirostilbia pertinax (Kollar) (Diptera, Simuliidae) and associated macroinvertebrates  

Scientific Electronic Library Online (English)

Full Text Available O presente trabalho objetivou investigar a relação entre a velocidade da água e a distribuição dos estágios imaturos de Chirostilbia pertinax (Kollar, 1832) e os macroinvertebrados bentônicos associados. As coletas foram realizadas em cinco pontos, no trecho superior do Rio dos Sinos, no Estado do R [...] io Grande do Sul. A fauna bentônica foi amostrada com substratos artificiais, que permaneceram instalados nos locais de maior corenteza d'água por períodos de 14 dias. Antes do recolhimento dos substratos foram realizadas medidas de velocidade d'água no local da sua instalação. Essas medidas foram agrupadas em três classes: baixa (0,20 a 0,63 m/s), média (0,64 a 1,07 m/s) e alta (1,08 a 1,50 m/s) para posterior relação com a distribuição da fauna coletada. Para avaliar a influência da velocidade de água sobre a distribuição dos macroinvertebrados e a abundância de C. pertinax foi realizada uma regressão múltipla. As coletas resultaram em 39.598 indivíduos, sendo 33.418 simulídeos e 6.180 macroinvertebrados associados. Entre os simulídeos 5.704 espécimes correspondem a larvas do último ínstar e pupas, dos quais 828 são de C. pertinax. Quanto à distribuição dessa espécie, 30,8% ocorreram na classe de baixa velocidade d'água, 24,9% na velocidade média e 44,3% na alta velocidade. Foi observado que a abundância de C. petinax aumenta à medida que os macroinvertebrados predadores diminuem e os organismos não predadores aumentam (GLM, R² = 0,207; F 2,50 = 6,536; P = 0,003). Esses resultados revelam que os imaturos de C. pertinax têm uma tendência em ocupar um microhábitat com menor ocorrência de predadores. Abstract in english The objective of the current study was to evaluate the distribution of the immature stages of Chirostilbia pertinax (Kollar, 1832) and associated bentic macroinvertebrates in relation to water velocity. This study was carried out on the upper course of Sinos river, in Rio Grande do Sul. Seasonal col [...] lections of larvae and pupae of black flies and associated benthic fauna were carried out at five places. In all sampling sites artificial substrates were installed, remaining submersed for 14 days in places of great water flow. Before removing the substrates the flow speeds on the collection sites were measured. To assess the distinct distribution patterns of the benthic fauna, the flow speed was divided in three classes: slow (0.20 - 0.63 m/s), medium (0.64 - 1.07 m/s) and fast (1.08 - 1.50 m/s). A total of 39,598 specimens were collected, from which