
Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento  

Directory of Open Access Journals (Sweden)

Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Ferla Noeli Juarez



Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae) Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae)  


The rubber tree (Hevea brasiliensis Muell. Arg.) (Euphorbiaceae) is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae) on rubber trees, associated with the mite Tenuipalpus heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs,...

Noeli Juarez Ferla; Gilberto José de Moraes



Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento / Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including dif [...] ferent species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius concordis (Chant, 1959) and Neoseiulus anonymus (Chant & Baker, 1965), both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921), Polyphagotarsonemus latus (Banks, 1904), Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950), and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day). Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.



Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

Marcos Zatti da Silva



Biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) e sua potencialidade de predação sobre Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) / Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O presente trabalho objetivou estudar a biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira nas temperaturas de 15; 20; 25; 30 e 35°C, alimentada com Brevipalpus phoenicis (Geijskes) e pólen de Thypha sp. em condições de laboratório. Tabelas de vida de fertilidade foram calculadas para [...] determinar os parâmetros biológicos. A temperatura ideal para o desenvolvimento de A. brasiliensis foi 29°C. Os valores de T (ciclo de vida - dias), R0 e r m, na temperatura de 30°C, foram de 13,95; 16,25 e 0,20, respectivamente. A potencialidade de predação de A. brasiliensis foi estudada para as densidades populacionais de 5; 10; 20; 40 e 60 adultos de B. phoenicis a 29°C, em arenas de 3 cm de diâmetro, sobre frutos de laranja-pêra. A densidade de 20 ácaros foi suficiente para que o predador consumisse seu número máximo de presas (7,6 ácaros por dia). Densidades acima de 40 ácaros da leprose proporcionaram 4,7 ovos por dia, em comparação aos 2,5 ovos por dia obtidos na densidade de 20 ácaros da leprose. Abstract in english The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35°C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biolog [...] ical parameters. The optimal development of A. brasiliensis took place at 29°C. The values of T (time of generation - days), R0 and r m at 30°C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29°C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage.

André L., Matioli; Carlos A.L. de, Oliveira.



Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos / Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 200 [...] 2. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor), e três espécies de predadores, Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus. Abstract in english This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tre [...] e commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor), and three species of predator mites Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

Alfredo de, Gouvea; Carla Felicita, Zanella; Sergio Miguel, Mazaro; Joel, Donazzolo; Luis Francisco Angeli, Alves.



Seletividade de oito inseticidas a predadores de lagartas em citros  


O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P...

Galvan Tederson Luiz; Picanço Marcelo Coutinho; Bacci Leandro; Pereira Eliseu José Guedes; Crespo André Luiz Barreto



Insectos predadores associados à oliveira no Planalto Mirandês.  


A oliveira e atacada por mais de 250 espécies fitófagas, contudo, apenas um reduzido número apresenta importância econ6mica. A reduzida importância da maioria das espécies deve-se principalmente a acção dos factores de limitação natural, com relevância para os predadores. Com objectivo de contribuir para 0 conhecimento do complexo de insectos predadores associados a oliveira no Planalto Mirandês, entre Março e Outubro de 2005 a 2008, realizaram-se amostragens em dois olivai...

Pereira, Susana; Pereira, J. A.; Bento, Albino



Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil  

International Nuclear Information System (INIS)

Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 ?m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)


Sarcocysts in the Florida bobcat (Felis rufus floridanus). (United States)

Sarcocysts were found in the tongue, diaphragm, heart, intestinal tunica muscularis, and skeletal muscle of bobcats (Felis rufus floridanus) collected in Florida (USA). The tongue was found to be the best indicator tissue for sarcocysts (P less than 0.005). Thirty of 60 bobcats screened were found to contain sarcocysts in at least one of the muscle tissues examined. Of the positive bobcats, 28 of 28 tongues contained sarcocysts, while only 10 of 27 (37%), and 8 of 26 (31%) contained sarcocysts in the diaphragm or cardiac muscle, respectively. Although immune suppression has been suggested as a possible reason for formation of sarcocysts in some carnivores, no such correlation was evident in the bobcats. Comparisons of prey species taken by the panther and bobcat, and overlap of geographical range by the two species leave questions as to the source of infection, and the species of Sarcocystis that is infecting both felids. PMID:1548790

Anderson, A J; Greiner, E C; Atkinson, C T; Roelke, M E



Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina  


A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine



Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae)  


The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproducti...

Momen, Faten Mamdouh



Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina  


A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine



Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina. (United States)

A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included. PMID:23825448

Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine



Efeito de inseticidas em insetos predadores em culturas de algodão  


Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 60...




Interspecific interactions involving Neoseiulus californicus (Acari: Phytoseiidae) and Agistemus brasiliensis (Acari: Stigmaeidae) as predators of Brevipalpus phoenicis (Acari: Tenuipalpidae). (United States)

Brevipalpus phoenicis (Geijskes) is associated with the transmission of Citrus leprosis which is considered the main viral disease for the Brazilian citrus production. Mites of the families Stigmaeidae and Phytoseiidae coexist in various agricultural crops, often promoting the biological control of pest mites. The aim of this work was to study the interactions of Neoseiulus californicus (McGregor) (Phytoseiidae) and Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Stigmaeidae), in the presence or absence of B. phoenicis. Two experiments were carried out. In the first, a N. californicus female was placed in each leaf disc arena, with eggs of B. phoenicis and A. brasiliensis as food sources. In the second, an A. brasiliensis female was placed in each arena, with eggs of B. phoenicis and N. californicus as food sources. Adults of both predators were able to consume both types of eggs available as food sources, but they fed on considerably higher proportions of B. phoenicis than on eggs of the predator. Eggs of A. brasiliensis were not a suitable food source for N. californicus, which produced only 0.1 egg per female per day when only eggs of that species were present in the experimental unit. The results suggest that eggs of N. californicus were a suitable food source for A. brasiliensis, which oviposited 1.12 eggs per day, when only eggs of N. californicus were provided to the stigmaeid mite. The possible interactions among N. californicus, A. brasiliensis and B. phoenicis in citrus orchards are discussed. PMID:25524512

da Silva, Marcos Zatti; Sato, Mário Eidi; de Oliveira, Carlos Amadeu Leite; Nicastro, Roberto Lomba



Predadores asociados a panonychus citri mcgregor (acari: tetranychidae en la costa central del Perú  

Directory of Open Access Journals (Sweden)

Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor, Typhlodromus (Anthoseius evectus (Schuster, Typhlodromus (Anthoseius transvaalensis (Nesbitt, Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A. evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados

Alberto Daniel Guanilo



Promoter Characterization in the AT-Rich Genome of the Obligate Endosymbiont “Candidatus Blochmannia floridanus”?  


The characterization of transcriptional start sites of 14 genes encoded by the extremely AT-rich genome of “Candidatus Blochmannia floridanus” revealed a high degree of conservation with the RpoD promoter consensus sequence of the free-living relative Escherichia coli. Moreover, in agreement with the presence of the alternative heat shock sigma factor RpoH in “Ca. Blochmannia,” typical RpoH-dependent promoters were identified. However, no heat shock response resembling that of E. coli...

Stoll, Sascha; Feldhaar, Heike; Gross, Roy



Seletividade de oito inseticidas a predadores de lagartas em citros Selectivity of eight insecticides to predators of citrus caterpillars  


O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P...

Tederson Luiz Galvan; Marcelo Coutinho Picanço; Leandro Bacci; Eliseu José Guedes Pereira; André Luiz Barreto Crespo



Influence of Life Diet on the Biology and Demographic Parameters of Agistemus olivi Romeih, a Specific Predator of Eriophyid Pest Mites (Acari: Stigmaeidae and Eriophyidae). (United States)

The influence of various life diets on the biology and demographic parameters of the predatory mite, Agistemus olivi Romeih, was studied under laboratory conditions. A. olivi successfully developed and reproduced on all of the tested eriophyid mites. Feeding on Aceria mangiferae Sayed enhanced the development of A. olivi, resulted in the shortest mean generation time and was the most commensurate food for the ovipostion of the predator, as exhibited by the highest fecundity and net reproductive rate. Preying on Aculops lycopersici (Massee) gave the lowest fecundity and net reproductive rate; therefore, this prey was the least suitable for the oviposition of A. olivi. Preying on Aculus fockeui (Nalepa et Trouessart) and A. mangiferae produced higher intrinsic rates of increase and finite rates of increase for the predator in comparison to A. lycopersici, which showed the lowest value. These differences in response to various eriophyid pests should be considered for the production of healthy cultures of A. olivi. PMID:24575223

Momen, Faten Mamdouh



Promoter characterization in the AT-rich genome of the obligate endosymbiont "Candidatus Blochmannia floridanus". (United States)

The characterization of transcriptional start sites of 14 genes encoded by the extremely AT-rich genome of "Candidatus Blochmannia floridanus" revealed a high degree of conservation with the RpoD promoter consensus sequence of the free-living relative Escherichia coli. Moreover, in agreement with the presence of the alternative heat shock sigma factor RpoH in "Ca. Blochmannia," typical RpoH-dependent promoters were identified. However, no heat shock response resembling that of E. coli could be detected in "Ca. Blochmannia." PMID:19329646

Stoll, Sascha; Feldhaar, Heike; Gross, Roy



Trypsin inhibitor from edible mushroom Pleurotus floridanus active against proteases of microbial origin. (United States)

Protease inhibitors can be versatile tools mainly in the fields of medicine, agriculture and food preservative applications. Fungi have been recognized as sources of protease inhibitors, although there are only few such reports on mushrooms. This work reports the purification and characterization of a trypsin inhibitor from the fruiting body of edible mushroom Pleurotus floridanus (PfTI) and its effect on the activity of microbial proteases. The protease inhibitor was purified up to 35-fold by DEAE-Sepharose ion exchange column, trypsin-Sepharose column and Sephadex G100 column. The isoelectric point of the inhibitor was 4.4, and its molecular mass was calculated as 37 kDa by SDS-PAGE and 38.3 kDa by MALDI-TOF. Inhibitory activity confirmation was by dot-blot analysis and zymographic activity staining. The specificity of the inhibitor toward trypsin was with Ki of 1.043?×?10(-10) M. The inhibitor was thermostable up to 90 °C with maximal stability at 30 °C, active over a pH range of 4-10 against proteases from Aspergillus oryzae, Bacillus licheniformis, Bacillus sp. and Bacillus amyloliquefaciens. Results indicate the possibility of utilization of protease inhibitor from P. floridanus against serine proteases. PMID:24615526

Ali, P P Manzur; Sapna, K; Mol, K R Rekha; Bhat, Sarita G; Chandrasekaran, M; Elyas, K K



Bacteriocyte dynamics during development of a holometabolous insect, the carpenter ant Camponotus floridanus  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background The carpenter ant Camponotus floridanus harbors obligate intracellular mutualistic bacteria (Blochmannia floridanus in specialized cells, the bacteriocytes, intercalated in their midgut tissue. The diffuse distribution of bacteriocytes over the midgut tissue is in contrast to many other insects carrying endosymbionts in specialized tissues which are often connected to the midgut but form a distinct organ, the bacteriome. C. floridanus is a holometabolous insect which undergoes a complete metamorphosis. During pupal stages a complete restructuring of the inner organs including the digestive tract takes place. So far, nothing was known about maintenance of endosymbionts during this life stage of a holometabolous insect. It was shown previously that the number of Blochmannia increases strongly during metamorphosis. This implicates an important function of Blochmannia in this developmental phase during which the animals are metabolically very active but do not have access to external food resources. Previous experiments have shown a nutritional contribution of the bacteria to host metabolism by production of essential amino acids and urease-mediated nitrogen recycling. In adult hosts the symbiosis appears to degenerate with increasing age of the animals. Results We investigated the distribution and dynamics of endosymbiotic bacteria and bacteriocytes at different stages during development of the animals from larva to imago by confocal laser scanning microscopy. The number of bacteriocytes in relation to symbiont-free midgut cells varied strongly over different developmental stages. Especially during metamorphosis the relative number of bacteria-filled bacteriocytes increased strongly when the larval midgut epithelium is shed. During this developmental stage the midgut itself became a huge symbiotic organ consisting almost exclusively of cells harboring bacteria. In fact, during this phase some bacteria were also found in midgut cells other than bacteriocytes indicating a cell-invasive capacity of Blochmannia. In adult animals the number of bacteriocytes generally decreased. Conclusions During the life cycle of the animals the distribution of bacteriocytes and of Blochmannia endosymbionts is remarkably dynamic. Our data show how the endosymbiont is retained within the midgut tissue during metamorphosis thereby ensuring the maintenance of the intracellular endosymbiosis despite a massive reorganization of the midgut tissue. The transformation of the entire midgut into a symbiotic organ during pupal stages underscores the important role of Blochmannia for its host in particular during metamorphosis.

Fraunholz Martin J



Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite  


O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrad...

Pedro Renan Ferreira Picoli; Marineide Rosa Vieira; Eloisa Aparecida da Silva; Max Sander de Oliveira da Mota



Optimization and kinetic studies on treatment of textile dye wastewater using Pleurotus floridanus (United States)

Treatment of textile dye wastewater was carried using Pleurotus floridanus in a batch reactor. Response surface methodology (RSM) was used to optimize the process parameters like pH, temperature, agitation speed and dye wastewater concentration for the decolorization of textile dye wastewater. The optimum conditions for the maximum decolorization was: pH 6.6, temperature 28.8 °C, agitation speed 183 rpm and dye wastewater concentration 1:2. From the results it was found that, the linear effect of agitation speed and initial textile dye wastewater concentration were more significant than other factors for the textile dye wastewater treatment. At these optimized conditions, the maximum decolorization and COD reduction was found to be 71.2 and 80.5 %, respectively. Kinetics of textile dye degradation process was studied by various models like first order, diffusional and Singh model. From the results it was found that the degradation follows first order model with R 2 value of 0.9550.

Sathian, S.; Radha, G.; Shanmugapriya, V.; Rajasimman, M.; Karthikeyan, C.



A chromatin link to caste identity in the carpenter ant Camponotus floridanus. (United States)

In many ant species, sibling larvae follow alternative ontogenetic trajectories that generate striking variation in morphology and behavior among adults. These organism-level outcomes are often determined by environmental rather than genetic factors. Therefore, epigenetic mechanisms may mediate the expression of adult polyphenisms. We produced the first genome-wide maps of chromatin structure in a eusocial insect and found that gene-proximal changes in histone modifications, notably H3K27 acetylation, discriminate two female worker and male castes in Camponotus floridanus ants and partially explain differential gene expression between castes. Genes showing coordinated changes in H3K27ac and RNA implicate muscle development, neuronal regulation, and sensory responses in modulating caste identity. Binding sites of the acetyltransferase CBP harbor the greatest caste variation in H3K27ac, are enriched with motifs for conserved transcription factors, and show evolutionary expansion near developmental and neuronal genes. These results suggest that environmental effects on caste identity may be mediated by differential recruitment of CBP to chromatin. We propose that epigenetic mechanisms that modify chromatin structure may help orchestrate the generation and maintenance of polyphenic caste morphology and social behavior in ants. PMID:23212948

Simola, Daniel F; Ye, Chaoyang; Mutti, Navdeep S; Dolezal, Kelly; Bonasio, Roberto; Liebig, Jürgen; Reinberg, Danny; Berger, Shelley L




Directory of Open Access Journals (Sweden)

Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies




Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus). (United States)

Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization. PMID:25047482

Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric



Seletividade de oito inseticidas a predadores de lagartas em citros / Selectivity of eight insecticides to predators of citrus caterpillars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymen [...] optera: Vespidae) em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom. Abstract in english The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) and Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) was evaluated using insec [...] ticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

Tederson Luiz, Galvan; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; André Luiz Barreto, Crespo.



Seletividade de oito inseticidas a predadores de lagartas em citros Selectivity of eight insecticides to predators of citrus caterpillars  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure e Protopolybia exigua (Saussure (Hymenoptera: Vespidae em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom.The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure and Protopolybia exigua (Saussure (Hymenoptera: Vespidae was evaluated using insecticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

Tederson Luiz Galvan



Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?  


O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das regiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas fora...

Luís Cláudio Paterno Silveira; Vanda Helena Paes Bueno; Júlio Neil Cassa Louzada; Lívia Mendes Carvalho





Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidr...




Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

Marcos Rafael, Gusmão; Marcelo, Picanço; Germano L.D., Leite; Marcelo F., Moura.



Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

Marcos Rafael Gusmão



Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator  

DEFF Research Database (Denmark)

Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferases and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator.

Bonasio, Roberto; Li, Qiye



Daytime habitat selection by introduced eastern cottontail Sylvilagus floridanus and native european hare Lepus europaeus in Northern Italy. (United States)

We used radiotelemetry to investigate resting sites habitat selection by introduced eastern cottontail (Sylvilagus floridanus) and native European hare (Lepus europaeus) under sympatric conditions. We tracked 24 hares and 34 cottontails in a protected area of northwestern Italy. Hares were found in different sites every week, while cottontails used the same site for two weeks, and occasionally for longer. It is supposed that this periodic nest switching reduces the risk of predation and parasitism. Hares and cottontails forms were located in different habitats and characterized by dense vegetation cover near the ground. This cover increased from winter to summer in both species, while in autumn it continued to increase in cottontails only, and decreased in hares. Cottontails selected shrubby habitats near the river, and avoided crop fields in all seasons. Hares were more adaptive in their search, using high herbs and shrubs all year round, wheat fields in spring, maize in spring and summer, and stubbles in winter. Arguably, partial niche differentiation is necessary to allow the coexistence of similar species. In our study area, hares and cottontails differentiated in the use of resting sites habitats, presumably so as not to compete in this part of their ecological niche. PMID:21627451

Bertolino, Sandro; Montezemolo, Nicola Cordero di; Perrone, Aurelio



Effects of hatchery rearing on Florida largemouth bass Micropterus floridanus resource allocation and performance under semi-natural conditions. (United States)

This study examined the growth, activity, metabolism and post-release survival of three groups of Florida largemouth bass Micropterus floridanus: wild-caught fish, hatchery fish reared according to standard practice (hatchery standard) and hatchery fish reared under reduced and unpredictable food provisioning (hatchery manipulated). Hatchery-standard fish differed from wild-caught fish in all measured variables, including survival in semi-natural ponds. Hatchery-standard and hatchery-manipulated fish showed higher activity levels, faster growth and lower standard metabolic rates than wild-caught fish in the hatchery. Fish reared under the manipulated feeding regime showed increased metabolic rates and increased post-release growth, similar to wild-caught fish. Their activity levels and post-release survival, however, remained similar to those of hatchery-standard fish. Activity was negatively correlated with post-release survival and failure of the feed manipulation to reduce activity may have contributed to its failure to improve post-release survival. Activity and post-release survival may be influenced by characteristics of the rearing environment other than the feeding regime, such as stock density or water flow rates. PMID:25257181

Garlock, T M; Monk, C T; Lorenzen, K; Matthews, M D; St Mary, C M



Efeito de inseticidas em insetos predadores em culturas de algodão Effect of insecticides on predator insects associated with cotton  


Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 60...




Incidência de insetos fitófagos e de predadores no milho e no feijão cultivados em sistema exclusivo e consorciado  


Este trabalho foi conduzido em Coimbra, MG, no ano agrícola 1996/97 e objetivou avaliar a ocorrência de insetos fitófagos e de predadores no milho e no feijoeiro cultivados em sistema exclusivo e em policultivo. Foi realizado um cultivo de milho (25/10/1996 a 24/03/1997) e dois cultivos de feijão[o primeiro de 25/10/1996 a 20/01/1997 (cultivo "das águas") e o segundo de 25/03/1997 a 21/07/1997 (cultivo "da seca")]. Realizaram-se contagens diretas das populações de insetos fitófagos e ...

Bastos Cristina Schetino; Galvão João Carlos Cardoso; Picanço Marcelo Coutinho; Cecon Paulo Roberto; Pereira Paulo Roberto Gomes



Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for popula

Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.



Densità di Lepre (Lepus europaeus e Silvilago (Sylvilagus floridanus in ambienti planiziali  

Directory of Open Access Journals (Sweden)

Full Text Available Il silvilago (Sylvilagus floridanus è un leporide d?origine nordamericana, introdotto in Italia a partire dal 1966 a scopo venatorio. Attualmente la specie è diffusa soprattutto in Piemonte e nella parte occidentale della Lombardia. Il silvilago potrebbe interferire con l?autoctona lepre comune (Lepus europaeus, anche se i dati al riguardo sono limitati. Nell?autunno-inverno 2002-2003 abbiamo condotto dei censimenti notturni con faro in alcune aree protette lungo il fiume Po (Breme, Fontanetto Po, Pobietto e il torrente Orba (Predosa, Monferrino. I censimenti erano effettuati percorrendo con automezzo itinerari prefissati. Il territorio ai lati del percorso era illuminato con faro alogeno (100 W, segnando periodicamente l?ampiezza della fascia illuminata. L?area effettivamente censita è stata in seguito verificata mediante GIS ArcView, usando una cartografia informatizzata d?uso del suolo (1:10.000. L?uso reale del suolo al momento del censimento (esempio: arato, grano o stoppie è stato verificato durante sopralluoghi diurni. Per ogni area sono state condotte tre repliche del censimento. Di seguito sono riportate per ogni località le densità rilevate (individui/Km² rispettivamente di lepre comune e silvilago. Breme (1,7; 32,8, Fontanetto Po (0; 4,4, Pobietto (0,3; 13,9, Predosa (1,1; 19,5, Monferrino (29,6; 110,4. Solo l?area di Monferrino è risultata ospitare una popolazione di lepri con densità corrispondente a territori ad alta vocazionalità. La zona censita si trova a cavallo tra una riserva regionale e una ZRC della Provincia di Alessandria. Nella stessa area il silvilago presenta una densità elevata, ma comunque inferiore ai valori massimi riportati negli Stati Uniti. Nelle altre aree sono state osservate pochissime lepri. Tale scarsità è probabilmente legata alla presenza di popolazioni relitte e habitat non sempre idonei. Il silvilago, per quanto non abbondante come a Monferrino, è presente con popolazioni discrete almeno a Breme e Pobietto. I risultati ottenuti, oltre a confermare il declino della lepre comune, indicano una fase di espansione territoriale e demografica del silvilago lungo le aste fluviali considerate.

Sandro Bertolino



Ácaros predadores associados ao ácaro-da-erinose da lichia / Predator mites associated with the litchi erinose mite  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, [...] da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%), seguida por Phytoseius intermedius (31,2%), Euseius concordis (14,1%), Amblyseius herbicolus (8,8%) e Iphiseiodes zuluagai (3,3%). O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação. Abstract in english The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal var [...] iety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%), followed by Phytoseius intermedius (31.2%), Euseius concordis (14.1%), Amblyseius herbicolus (8.8%) and Iphiseiodes zuluagai (3.3%). Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira, Picoli; Marineide Rosa, Vieira; Eloisa Aparecida da, Silva; Max Sander de Oliveira da, Mota.



Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal variety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%, followed by Phytoseius intermedius (31.2%, Euseius concordis (14.1%, Amblyseius herbicolus (8.8% and Iphiseiodes zuluagai (3.3%. Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

Pedro Renan Ferreira Picoli



Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)  


O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R...

Luís Cláudio Paterno Silveira; Vanda Helena Paes Bueno; Leonardo Santa Rosa Pierre; Simome Martins Mendes



Predadores asociados a panonychus citri mcgregor (acari: Tetranychidae) en la costa central del Perú / Predators associated to panonychus citri Mcgregor (acari: Tetranychidae) in the central coast of Peru  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthosei [...] us) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A.) evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados. Abstract in english In the central coast of Peru, fifteen predators associated to Panonychus citri were identified: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias-Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbi [...] tt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. and Armascirus sp. Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider and Aeolothrips sp. were the acarophagous insects found. Most abundant species were: A. chungas, T.(A.) evectus and N. californicus. Furthermore, both Stethorus tridens and Stethorus histrio were frequent in fields where predator mites were absent.

Alberto Daniel, Guanilo; Norberta, Martínez.



Efeito de inseticidas em insetos predadores em culturas de algodão / Effect of insecticides on predator insects associated with cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); F [...] ipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.). Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare) no campo, e a Cycloneda sanguinea (L.), em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb.), e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs) no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório. Abstract in english To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L.) crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.); Fipronil 800 WDG (64, [...] 80 and 100 g/ha of a.i.); Endosulfan 350 EC (700 g/ha of a.i.); and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare) under field condition and to Cycloneda sanguinea (L.) under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb.), and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L.) and Doru lineare (Eschs) under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.




Efeito de inseticidas em insetos predadores em culturas de algodão Effect of insecticides on predator insects associated with cotton  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório.To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L. crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.; Fipronil 800 WDG (64, 80 and 100 g/ha of a.i.; Endosulfan 350 EC (700 g/ha of a.i.; and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare under field condition and to Cycloneda sanguinea (L. under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb., and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L. and Doru lineare (Eschs under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.





Directory of Open Access Journals (Sweden)

Full Text Available

The selectivity of insecticides for the complex of predators of the pests of cotton plant was evaluated in field experiment, in Goiânia- Goiás (Brazil, during the crop 1998/99. The experimental design was the randomized blocks with seven treatments and four repetitions (check, clorfluazuron, Bacillus thuringiensis, alanycarb, endosulfan and acephate in two amounts. The samplings were accomplished in beforeapplication, two days, seven and fourteen days after the treatment. For the obtained results (Henderson & Tilton, the products, in the decreasing order of selectivity, were: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

KEY-WORDS: Insecta; insecticides; cotton plant; predators.

A seletividade de inseticidas para o complexo das pragas do algodoeiro foi avaliada em experimento de campo, em Goiânia (GO, durante a safra 1998/99. O delineamento experimental foi em blocos ao acaso com sete tratamentos testemunha, clorfluazuron, B. thuringiensis, alanycarb, endosulfan e acephate em duas dosagens, em quatro repetições. As amostragens foram realizadas em pré-aplicação; aos dois, sete e quatorze dias após as pulverizações. Pelos resultados obtidos (fórmula de Herderson & Tilton, os produtos, na ordem decrescente de seletividade, foram: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

PALAVRAS-CHAVE: Insecta; inseticidas; algodão; predadores.

Julio Cezar Silveira Nunes




Directory of Open Access Journals (Sweden)

Full Text Available

O algodoeiro é hospedeiro de um complexo de pragas, que podem ocasionar danos às estruturas das plantas. Para o desenvolvimento sustentado, neste agroecossistema, há necessidade da implementação do Manejo Integrado das Pragas (MIP. O objetivo deste trabalho foi estudar a seletividade de inseticidas aos predadores das pragas do algodoeiro. O delineamento experimental utilizado foi o de blocos ao acaso, com nove tratamentos e quatro repetições. Os tratamentos foram aplicados aos 84 dias após a emergência. As amostragens foram feitas através do método de batida de pano, com cinco batidas ao acaso, por parcela, nas quais foram identificados e contados os predadores vivos. Os inseticidas Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1.000 g ha-1, Thiamethoxam 250 WG (200 g ha-1 e Acetamiprid 200 SP (150 g ha-1 não foram seletivos ao complexo de predadores ocorrentes, com percentagens de mortalidades que oscilaram entre moderadamente tóxicos e tóxicos. Etofenprox 300 EC (450 mL ha-1 apresentou a maior percentagem de mortalidade, em relação aos demais tratamentos inseticidas, sendo classificado como tóxico. O tratamento Flonicamid 500 WG (150 g ha-1 foi seletivo, com média de predadores semelhante à testemunha, até 8 dias após a aplicação (daa. Dentre os inseticidas testados, somente o Flonicamid 500 WG foi considerado seletivo, segundo a classificação do IOBC, pois apresentou a menor percentagem de mortalidade ao complexo de predadores ocorrentes.

PALAVRAS-CHAVE: Gossypium hirsutum L.; Insecta; inseticidas; algodão; predadores.

The cotton plant hosts a complex of pests that can damage plant structures. Its supported development, in this agroecosystem, demands the implementation of an integrated pest management (IPM system. The goal of this research was to study the selectivity of pesticides over predators of cotton plant pests. The experimental design was randomized blocks, with 9 treatments (84 days after the emergence and 4 replicates. The sampling involved the beat cloth method, with 5 beats per plot, allowing to identify and count the living predators. Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1,000 g ha-1&l

Elmo Pontes de Melo



Domácias do cafeeiro beneficiam o ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)? / Do coffee domatia benefit the predatory mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os cafeeiros apresentam domácias em suas folhas que abrigam ácaros, inclusive ácaros predadores que podem também fazer uso dessas estruturas. Neste estudo foi avaliado o efeito das domácias sobre o predador Iphiseiodes zuluagai Denmark & Muma, através da manipulação dessas estruturas em folhas de Co [...] ffea arabica L. var. Catuaí. Os testes foram realizados em arenas constituídas por folhas de cafeeiro com a face abaxial voltada para cima. Foi avaliada a sobrevivência de I. zuluagai em folhas com domácias fechadas (T1); domácias abertas contendo alimento (T2) e domácias abertas vazias (T3). Foram feitas observações a cada 24h, contabilizando-se o número de adultos vivos, local de oviposição e quantidade de ovos de I. zuluagai / tratamento. Foram observadas diferenças significativas entre os tratamentos. Nas folhas com domácias abertas (T2 e T3) foram encontrados ácaros vivos até o final do experimento, não ocorrendo o mesmo nas folhas com domácias fechadas (T1). No que se refere à oviposição de I. zuluagai, nos tratamentos em que as domácias se encontravam abertas (T2 e T3), o ácaro ovipositou preferencialmente dentro destas estruturas, enquanto nas folhas com domácias fechadas a oviposição foi feita preponderantemente à margem das folhas em contato com o algodão úmido. Os resultados indicam a importância das domácias como fonte de sobrevivência para os ácaros predadores nas plantas, sugerindo uma interação mutualística planta-predador. No café, o mutualismo planta-predador intermediado por domácias poderia ser explorado em estratégias de controle biológico natural, ao se selecionarem espécies de cafeeiro com domácias que favoreçam a presença dos ácaros predadores nas mesmas, protegendo-as contra o ataque de ácaros herbívoros nocivos. Abstract in english Coffee plants have domatia on their leaves harboring mites, and the predatory mites can also use such structures. Here we evaluated the effect of the domatia on the predatory mite Iphiseiodes zuluagai Denmark & Muma, manipulating these structures on the leaves of Coffea arabica L. var. Catuaí. The t [...] ests were done using arenas made of coffee leaves placed up side down inside petri dishes. The survivorship of I. zuluagai was evaluated when released on leaves with closed domatia (T1); leaves with open domatia plus prey (T2) and leaves with open domatia without prey (T3). The experiment was checked every 24h, measuring the number of alive adults, oviposition site and the number of I. zuluagai eggs/treatment. Significant difference was found between treatments. Mites were alive until the end of the experiments on leaves with open domatia (T2 and T3), which did not happen on leaves with closed domatia (T1). The predators oviposited preferentially inside the domatia on treatments with open domatia, and on the edge of the leaves, next to the moist cotton bordering the leaves, on the treatment with closed domatia. The results indicate the role of domatia on the survivorship of the predators on the coffee plants, suggesting a possible mutualist interactions plant-predator. On coffee crops, a mutualistic plant-predator interaction mediated by domatia could be used in practices of natural biological control, selecting coffee plants with domatia to harbor predatory mites and thereby protecting plants against harmful herbivore mites.

Cláudia H.C., Matos; Angelo, Pallini; Fredson F., Chaves; Carla, Galbiati.



First record of native predators on the invasive species Thaumastocoris peregrinus (Hemiptera:Thaumastocoridae) in Eucalyptus in Argentina / Primer registro de predadores nativos de la especie invasora Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae) en Eucalyptus en la Argentina  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: English Abstract in spanish Se han observado, repetidamente, a dos predadores nativos consumiendo a Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae), chinche del eucaliptus. Para identificar a estos predadores y corroborar si estas especies pueden utilizar a T. peregrinus como alimento aceptable, se [...] obtuvieron muestras de huevos de ambas especies de predadores del arboretum de la Universidad Nacional de Luján. Las ninfas fueron criadas por separado en condiciones de laboratorio y alimentadas ad libitum con ninfas y adultos de T. peregrinus. Se registró el número de presas consumidas diariamente y el tiempo de desarrollo. Las especies de predadores fueron identificadas como Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) y Podisus australis Berg (Hemiptera: Pentatomidae). Este trabajo presenta el primer registro de predadores nativos utilizando a esta especie invasora como fuente de alimento sobre Eucalyptus camaldulensis en la provincia de Buenos Aires, Argentina. Abstract in english Two native predators have been repeatedly observed consuming the bronze bug, Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae). To identify these predators and to corroborate whether these species can use T. peregrinus as a suitable food item, egg samples of both predator [...] species were collected from the arboretum at the Universidad Nacional de Luján. Nymphs were reared individually under laboratory conditions and fed ad libitum with nymphs and adults of T. peregrinus. The number of prey consumed daily and the development time were recorded. The predator species were identified as Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) and Podisus australis Berg (Hemiptera: Pentatomidae). This research presents the first report of native predators using this invasive species as a food resource in Eucalyptus camaldulensis forest in Buenos Aires province, Argentina.

Marina V., Santadino; María B., Riquelme Virgala; Carlos E., Coviella.



Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.



Coenosia attenuata (Dptera: Muscidae), um predador em estudo para utilização em culturas protegidas / Coenosia attenuata (Dptera: Muscidae), a predator being studied for use in greenhouses greenhouses  

Scientific Electronic Library Online (English)

Full Text Available SciELO Portugal | Language: Portuguese Abstract in portuguese Coenosia attenuata Stein, ou “mosca tigre”, predador polífago de importantes pragas agrícolas, enquanto larva e adulto, foi detectado em Portugal, pela primeira vez, em 2002, no Oeste. Para optimização da sua criação em massa, alteraram-se metodologias descritas na bibliografia. Ocorreu maior número [...] de emergências em substratos com maior número de larvas de esciarídeos e em substrato de terra misturado com fibra de coco. Estudou-se, em laboratório, o seu comportamento e capacidade de predação sobre várias espécies, incluindo parasitóides e predadores importantes em culturas protegidas, tendo predado todas as espécies testadas: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta e algumas espécies de Psycodidae. Observaram-se indícios de preferência alimentar das fêmeas de mosca tigre por moscas brancas e larvas mineiras, em relação a diglifos, e diferenças no comportamento de predação sobre moscas brancas em presença de larvas mineiras ou drosófilas. Abstract in english Coenosia attenuata Stein, or “tiger-fly”, a polyphagous predator of important agricultural pests, as larva and adult, was detected for the first time, in Portugal, in 2002, in the “Oeste” region. For mass rearing optimization, the methodologies described in literature were changed. A higher number o [...] f emergences occurred on substrates with higher number of sciarids larvae and on the substrate with soil mixed with coconut fiber. The predation capacity and behaviour of C. attenuata was studied in laboratory in relation to several species, including parasitoids and predators with an important role in protected crops. All species tested were predated: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta and some Psycodidae species. There was evidence of female preference for whiteflies and leafminers in relation to Diglyphus isaea, as well as predation behaviour differences over whiteflies when leafminers or drosophilids were present.

Joana, Martins; Cíntia, Domingos; Raquel, Nunes; André, Garcia; Cristina, Ramos; Célia, Mateus; Elisabete, Figueiredo.





Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidr...




Alguns dados bioecológicos de Pomacea haustrum (Reeve, 1856, predador-competidor de hospedeiros intermediários de Schistosoma mansoni Sambon, 1907 Some bioecological data regarding Pomacea haustrum (Reeve, 1856 predator-competitor of intermediate hosts of Schistosoma mansoni Sambon, 1907  

Directory of Open Access Journals (Sweden)

Full Text Available Foram feitas observações no laboratório e no campo, em Belo Horizonte, MG, Brasil, com a finalidade de se obter informações biológicas e ecológicas sobre Pomacea haustrum (Reeve, 1856, molusco pilídeo, competidor-predador de hospedeiros intermediários de Schistosoma mansoni Sambon 1907.Observations carried out in the laboratory and the field (Belo Horizonte, MG, Brazil offered the following biological and ecological informations Pomacea haustrum (Reeve, 1853, mollusk pilid, predator and competitor of Schistosoma mansoni intermediary host.

Roberto Milward-de-Andrade



Insetos predadores em copas de Citrus deliciosa (Rutaceae sob manejo orgânico no sul do Brasil Predatory insects in canopies of Citrus deliciosa (Rutaceae under organic management in southern Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae (16,87% e Coccidophilus sp. (Coleoptera, Coccinellidae (11,85%. A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações.The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species from ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae (16.87% and Coccidophilus sp. (Coleoptera, Coccinellidae (11.85%. The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

Rosana M. de Morais


Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis / Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure) (Hymenopter [...] a: Vespidae). Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90), calcularam-se os índices de seletividade diferencial (ISD90), de toxicidade relativa, e de tolerância relativa (ITRe90). O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75) e P. sylveirae (ISD90 = 2,95 e 3,59) em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70) em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64). B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05), e mais tolerante ao carbaril (ITRe90 = 0,14). Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04). As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis. Abstract in english This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure) (Hym [...] enoptera: Vespidae). Based on concentration-response curves and lethal concentrations for 90% of the population (LC90), the differential selectivity index (DSI90), relative toxicity index and relative tolerance index (ReTI90) were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75) and P. sylveirae (DSI90 = 2.95 and 3.59) against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70) against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64). B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05), but the opposite was observed to carbaryl (ReTI90 = 0.14). These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04). Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

André Luiz Barreto, Crespo; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; Alfredo Henrique Rocha, Gonring.



Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart (Lepidoptera: Pieridae e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90, calcularam-se os índices de seletividade diferencial (ISD90, de toxicidade relativa, e de tolerância relativa (ITRe90. O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75 e P. sylveirae (ISD90 = 2,95 e 3,59 em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70 em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64. B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05, e mais tolerante ao carbaril (ITRe90 = 0,14. Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04. As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis.This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart (Lepidoptera: Pieridae and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Based on concentration-response curves and lethal concentrations for 90% of the population (LC90, the differential selectivity index (DSI90, relative toxicity index and relative tolerance index (ReTI90 were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75 and P. sylveirae (DSI90 = 2.95 and 3.59 against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70 against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64. B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05, but the opposite was observed to carbaryl (ReTI90 = 0.14. These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04. Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

André Luiz Barreto Crespo



Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae) / Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi e [...] studar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae) alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae) em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21%) e a de atividade de postura, à 0 h (50,56% dos ovos depositados), enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%), seguido das 00 h (29,65%), 18 h (22,36%) e 6 h (16,60%). Abstract in english Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductiv [...] e behavior and predation rate of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21%) and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited) while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58%) followed by those at 12:00 AM (29.65%) 06:00 PM (22.36%) and 06:00 AM (16.60%).

Evaldo Martins, Pires; Rosenilson, Pinto; Mabio Chrisley, Lacerda; José Cola, Zanuncio; Maria do Carmo Queiroz, Fialho.



Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21% e a de atividade de postura, à 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

Evaldo Martins Pires



Percevejos predadores (Orius spp. (Hemiptera: Anthocoridade e tripes (Thysanoptera: interação no mesmo habitat? Species of Orius (Hemiptera, Anthocoridae and thrips (Thysanoptera: interaction in the same habitat?  

Directory of Open Access Journals (Sweden)

Full Text Available O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das regiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R, calculado com dados de presença/ausência das espécies (Orius e tripes no mesmo "habitat". Orius insidiosus (Say foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin e negativamente associado a Frankliniella schultzei (Trybom e Caliothrips phaseoli (Hood. Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton.The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrips species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R (presence/absence of the species in the same habitat. Orius insidiosus (Say was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin, and negatively associated with Frankliniella schultzei (Trybom and Caliothrips phaseoli (Hood. Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton.

Luís Cláudio Paterno Silveira



Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? / Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das r [...] egiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R), calculado com dados de presença/ausência das espécies (Orius e tripes) no mesmo "habitat". Orius insidiosus (Say) foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin) e negativamente associado a Frankliniella schultzei (Trybom) e Caliothrips phaseoli (Hood). Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter) esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton). Abstract in english The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrip [...] s species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R) (presence/absence of the species in the same habitat). Orius insidiosus (Say) was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin), and negatively associated with Frankliniella schultzei (Trybom) and Caliothrips phaseoli (Hood). Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter) was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton).

Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Júlio Neil Cassa, Louzada; Lívia Mendes, Carvalho.



Diversidade e abundância de artrópodes predadores associados a diferentes cultivares de algodoeiro / Diversity and abundance of predaceous arthropods associated with different cotton cultivars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de estudar a abundância e a diversidade de artrópodes predadores associados à cultura do algodoeiro e analisar a influência de fatores meteorológicos, interações entre inimigos naturais e a dinâmica populacional de coccinelídeos associados à sua principal presa, o pulgão Aphis gossypi [...] i, um experimento foi realizado na região de Ipameri (GO), no Campus da Universidade Estadual de Goiás. O delineamento experimental utilizado foi o de blocos ao acaso, com cinco tratamentos, constituídos pelas cultivares DeltaOPAL, FMX 966, FMX 993, FMX 910 e NuOPAL, em quatro repetições. Dentre os artrópodes observados na cultura do algodoeiro, os coccinelídeos e as aranhas foram os mais abundantes, nas cultivares avaliadas. As aranhas ocorreram em todo o ciclo do algodoeiro. Já os coccinelídeos aumentaram sua população, gradativamente, até 55 DAE, apresentando pico populacional aos 34 DAE, coincidindo com o pico populacional dos pulgões A. gossypii. Dentre os coccinelídeos observados nas cultivares em estudo, verificou-se que Scymnus spp. foi o gênero mais abundante no algodoeiro. Os pentatomídeos e forficulídeos predominaram dos 99 aos 128 dias após a emergência do algodão, período que corresponde à maior densidade de pragas-alvo destes insetos. Verificou-se que não houve influência dos fatores meteorológicos e nem interação negativa entre os artrópodes predadores. Abstract in english With the objective of studying the abundance and diversity of predaceous arthropods associated with cotton crop, and analyze the influence of meteorological factors, interactions between natural enemies and population dynamics of coccinellids associated with their principal prey, the aphid Aphis gos [...] sypii, an experiment was carried out in the region of Ipameri, Goiás State, Brazil, at the Universidade Estadual de Goiás campus. The experimental design was randomized blocks, with five treatments, consisting of the DeltaOPAL, FMX 966, FMX 993, FMX 910, and NuOPAL cultivars, in four replications. Among the arthropods sampled in the cotton crop, the coccinellids and spiders were the most abundant ones in the cultivars evaluated. Spiders occurred throughout the cotton cycle, while the coccinellids population increased gradually until 55 DAE, showing a population peak at 34 DAE, coinciding with the population peak of aphids (Aphis gossypii). Among the coccinellids observed in the cultivars under study, Scymnus spp. was the most abundant in cotton. The pentatomid and forficulid occurred from 99 to 128 days after the emergence of cotton, which corresponds to the highest density of target pest insects. It was not found influence of meteorological factors or negative interactions among predaceous arthropods.

Lílian Lúcia, Costa; Ivan Carlos Fernandes, Martins; Antonio Carlos, Busoli; Francisco Jorge, Cividanes.



Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) / Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar [...] os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), sorgo (Sorghum spp.), feijão (Phaseolus vulgaris L.), girassol (Helianthus annuus L.), alfafa (Medicago sativa L.), soja [Glycine max (L.) Merr.], crisântemo (Chrysanthemum spp.), tango (Solidago canadensis L.) e cartamus (Carthamus tinctorius L.) e nas plantas invasoras picão-preto (Bidens pilosa L.), caruru (Amaranthus sp.), losna-branca (Parthenium hysterophorus L.) e apaga-fogo (Alternanthera ficoidea L.). Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter) e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen. Abstract in english The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identification [...] s of the specimens was done in the laboratory. Orius insidiosus (Say) was collected on the following crops: corn (Zea mays L.), pearl millet (Pennisetum glaucum (L.) R.Br.), sorghum (Sorghum spp.), bean (Phaseolus vulgaris L.), sunflower (Helianthus annuus L.), alfalfa (Medicago sativa L.), soybean (Glycine max (L.) Merr.), chrysanthemum (Chrysanthemum spp.), tango (Solidago canadensis L.) and carthamus (Carthamus tinctorius L.). On weeds, O. insidiosus was found on farmer's friend (Bidens pilosa L.), amaranth (Amaranthus sp.), parthenium weed (Parthenium hysterophorus L.) and Joseph's coat (Alternanthera ficoidea L.). Orius thyestes Herring was found on weed plants farmer's friend, amaranth and Joseph's coat. Orius perpunctatus (Reuter) and Orius sp. were collected mainly on weed plants (farmer's friend, amaranth and Joseph's coat) and corn. Many of these plants are natural hosts for these predators, providing refuge, prey and pollen.

Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Leonardo Santa Rosa, Pierre; Simome Martins, Mendes.


Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

Liliane K., Figueira; Fernando M., Lara.



Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.




Seletividade de Inseticidas a Brevicoryne brassicae (L.) (Hemiptera: Aphididae) e ao Predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Insecticide Selectivity to Brevicoryne brassicae (L.) (Hemiptera: Aphididae) and the Predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve por objetivo estudar a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Brevicoryne brassicae (L.) (Hemiptera: Aphididae), em relação a adultos e ninfas de primeiro, segundo e terceiro estádio [...] s do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe e deltametrina foram altamente seletivos em favor de todos os estádios de desenvolvimento de D. luteipes, sendo que o mesmo ocorreu para o acefato, com exceção de ninfas de primeiro estádio do predador às quais ele é medianamente seletivo. Dimetoato foi, em geral, medianamente seletivo enquanto metamidofós e paratiom metílico foram pouco seletivos em favor do predador. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade do dimetoato (para adultos, ninfas de primeiro e segundo estádios do predador) e metamidofós (para ninfas de terceiro estádio) apresentaram as maiores inclinações, indicando que os estádios estudados apresentam resposta homogênea a esses inseticidas. Abstract in english The objective of this work was to study the selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb to first, second, and third instar nymphs and adults of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) in comparison with l [...] ast instar nymphs of the prey Brevicoryne brassicae (L.) (Hemiptera: Aphididae). Pirimicarb and deltamethrin were highly selective to all developmental stages of D. luteipes; the same was observed with acephate except for first instar nymphs to whom it showed median selectivity. Dimethoate showed median selectivity, but methamidophos and methyl parathion were low selective to the predator. Second and third instar nymphs and adults of D. luteipes were more tolerant to acephate, methyl parathion and pirimicarb than first instar nymphs. First and second instar nymphs showed similar tolerance to deltamethrin, dimethoate and methamidophos. Concentration-response curves for dimethoate (to adults and first and second instar nymphs) and methamidophos (to third instar nymphs) showed steeper slopes indicating an homogeneous response of these developmental stages to these insecticides.




Seletividade de inseticidas às diferentes fases de desenvolvimento do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Selectivity of insecticides to different developmental stages of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O predador Doru luteipes (Scudder) é um dos principais reguladores da população de Spodoptera frugiperda (J.E. Smith) e Helicoverpa zea (Boddie) na cultura de milho (Zea mays). O objetivo do trabalho foi estudar a seletividade de cinco inseticidas químicos (deltametrina, lambdacialotrina, permetrina [...] , diflubenzuron e triflumuron) e dois microbianos [Baculovirus e Bacillus thuringiensis (Berliner)] sobre as diferentes fases de desenvolvimento do predador. Ovos e ninfas dos quatro ínstares receberam os inseticidas diretamente através de um pulverizador acoplado a uma esteira rolante. Adultos do predador receberam como alimento posturas de S. frugiperda, que foram pulverizadas com os diferentes inseticidas. Para os ovos, houve um efeito letal pronunciado com os inibidores de crescimento diflubenzuron (81,8% de mortalidade) e triflumuron (78,6%), sendo este também tóxico para os ínstares ninfais (69,6%). Os inseticidas biológicos Baculovirus e B. thuringiensis foram seletivos a todas as fases do predador. A sobrevivência do predador aos inseticidas foi crescente com o instar do inseto (S = 39,5 + 7,79 I, R2² = 0,87). Os adultos foram tolerantes a todos os inseticidas (95,3% de sobrevivência). Abstract in english The earwig Doru luteipes (Scudder) is one the best natural enemies of Spodoptera frugiperda (J. E. Smith) and Helicoverpa zea (Boddie) both pests of maize (Zea mays). The objective of this work was to evaluate the selectivity of five chemical (deltamethrin, lambdacyhalothrin, permethrin, diflubenzur [...] on and triflumuron) and two microbial [Baculovirus and Bacillus thuringiensis (Berliner)] insecticides to the different developmental stages of the predator. Eggs and the four nymphal stages were sprayed using a sprayer connected to a rolling mat. Adults were fed egg masses of S.frugiperda sprayed with insecticides. Eggs of the predator were highly affected by the growth inhibitors diflubenzuron (81.8% mortality) and triflumuron (78.6%), the latter also toxic to the nymphal stages (69.6%). The bioinsecticides Baculovirus and B. thuringiensis were selective to all stages of the predator. The survivorship increased with the increase of the insect's age (S = 39,5 + 7,79 I, R2² = 0,87). Adults were tolerant to all treatments (95.3% survivorship).

Juliana C., Simões; Ivan, Cruz; Luis O., Salgado.



Ácaros predadores (Acari em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil Predators mites (Acari in native and cultivated plants of the State of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the families Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species, was met in Morus spp. (Moraceae and Tabebuia spp. (Bignoniaceae; Phaseolus vulgaris (Papilionaceae; only one species of the mite was met in Campomanesia spp. (Myrtaceae, Phaseolus vulgaris (Papilionaceae and Rosa spp. (Rosaceae. In Alamanda spp.(Apocinaceae, Ficus spp. (Moraceae, Jacaranda mimosifolia (Bignoniaceae and Solanum spp. (Solanaceae were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

Noeli Juarez Ferla



Ácaros predadores (Acari) em plantas nativas e cultivadas do Estado do Rio Grande do Sul, Brasil / Predators mites (Acari) in native and cultivated plants of the State of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This research was carried out in twenty counties of the following regions in the state of Rio Grande do Sul: Plain, Central Depression, Plateau and Coast Plain to find out the diversity of mite predators in these places. Forty-six vegetable species were sampled, thirty species of miles of the famili [...] es Anystidae, Ascidae, Cheyletidae, Cunaxidae, Phyloseiidae and Stigmaeidae were mel. The Phytoseiidae were the mite that presented the greatest diversity, being present in the majority of the sample plants. Most of the Phytoseiidae that were met belong to five species of the Euseius Wainstein, 1962 genus, the second genus of this family was Iphiseiodes DeLeon, 1966, with just one species. The Stigmaeidae come up as second family in number but fewer than Phytoseiidae. In this family, the most common mite belong to the Agistemus Sumers, 1960 genus. The biggest of the mites species (13 species), was met in Morus spp. (Moraceae) and Tabebuia spp. (Bignoniaceae); Phaseolus vulgaris (Papilionaceae); only one species of the mite was met in Campomanesia spp. (Myrtaceae), Phaseolus vulgaris (Papilionaceae) and Rosa spp. (Rosaceae). In Alamanda spp.(Apocinaceae), Ficus spp. (Moraceae), Jacaranda mimosifolia (Bignoniaceae) and Solanum spp. (Solanaceae) were met mites predators. A dichotomic key is presented to separate the families, genus and species of the mites.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Seletividade de inseticidas a Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predador de lagartas desfolhadoras de eucalipto / Selectivity of insecticides to Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predator of eucalyptus-defoliating caterpillars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares) e adultos (fêmeas e machos) do predador Podisus rostralis, empregando-se 50 (subconcentração) e 100% da concentração usada no contro [...] le de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente) do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade) e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente) do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade) e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente) do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade). A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos) e permetrina (a fêmeas) sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina. Abstract in english The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars) and adults (females and males) of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 10 [...] 0% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively). Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality), and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality). Malathion was medially selective to fifth instar nymphs (49.38% of mortality), but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality). Fenitrothion was not selective to any instar of P. rostralis (100% of mortality). The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults) and permethrin (to females) of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

Alfredo Henrique Rocha, Gonring; Marcelo Coutinho, Picanço; Germano Leão Demolin, Leite; Fábio Akiyoshi, Suinaga; José Cola, Zanuncio.



Seletividade de inseticidas a Podisus rostralis (Stal (Heteroptera: Pentatomidae predador de lagartas desfolhadoras de eucalipto Selectivity of insecticides to Podisus rostralis (Stal (Heteroptera: Pentatomidae predator of eucalyptus-defoliating caterpillars  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares e adultos (fêmeas e machos do predador Podisus rostralis, empregando-se 50 (subconcentração e 100% da concentração usada no controle de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade. A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos e permetrina (a fêmeas sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina.The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars and adults (females and males of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 100% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively. Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality, and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality. Malathion was medially selective to fifth instar nymphs (49.38% of mortality, but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality. Fenitrothion was not selective to any instar of P. rostralis (100% of mortality. The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults and permethrin (to females of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

Alfredo Henrique Rocha Gonring



Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores / Harmonia axyridis in fruit trees and impact on other predator coccinellids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006), relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinelli [...] dae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais. Abstract in english The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006), to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coc [...] cinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

Julianne, Milléo; Jana Magaly Tesserolli de, Souza; Ivana de Freitas, Barbola; Patrícia Elizabeth, Husch.



Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores Harmonia axyridis in fruit trees and impact on other predator coccinellids  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006, relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinellidae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais.The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006, to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coccinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

Julianne Milléo



Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) em diferentes temperaturas / Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae) under different temperatures  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius alatus DeLeon (Acari: Phytoseiidae) é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avalia [...] r o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e 33ºC, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30ºC mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatus em laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro. Abstract in english Euseius alatus DeLeon (Acari: Phytoseiidae) is one of the most common predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effe [...] ct of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33ºC; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility life table, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

José Wagner da Silva, Melo; Cleiton Araújo, Domingos; Andreia Serra, Galvão; Manoel Guedes Corrêa, Gondim Junior; Gilberto José de, Moraes.



Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.



Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  


O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do...

Madelaine Venzon; Maria da Consolação Rosado; Angelo Pallini; Amanda Fialho; Célia de Jesus Pereira



Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) / Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de i [...] ndivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um dos fungos Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 e 1189) e Beauveria bassiana (Bals.) Vuill. (604, 634 e 561) sobre ninfas e adultos de P. nigrispinus pelas vias de contato, residual seco e ingestão de presas contaminadas, em laboratório. M. anisopliae ocasionou maior mortalidade do predador que B. bassiana, tanto por contato como por resíduo seco do fungo. Entre as vias de infecção dos fungos o contato causou maior mortalidade do predador. Não houve confirmação de mortalidade de adultos em nenhuma das vias de infecção pelos isolados testados. A predação de larvas de Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminadas com os fungos afetou a produção de ovos das fêmeas adultas, porém o mesmo não foi constatado quando adultos alimentaram-se de presas contaminadas. Os resultados sugerem que isolados de M. anisopliae podem causar mortalidade de ninfas de P. nigrispinus por contato, enquanto os isolados de B. bassiana foram de menor impacto em todas as vias de infecção estudadas, comparados aos isolados de M. anisopliae. Abstract in english Entomopathogenic fungi and the predatory stinkbug Podisus nigrispinus (Dallas) can target simultaneously the same or different pests in agroecosystems. Topical contact during fungal dispersion or spraying, walking on plant surfaces and ingestion of contaminated prey are some of possible ways of inte [...] ractions between fungi and the predatory stinkbug. The impact of three isolates of Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 and 1189) and Beauveria bassiana (Bals.) Vuill. (604, 634 and 561) against nymphs and adults of P. nigrispinus was investigated under laboratory conditions. M. anisopliae caused higher mortality compared to B. bassiana either by topical application or by dry residue on cotton leaves. Topic contact with both fungi caused higher mortality to the predator. No mortality confirmation was reported for the adults. Nymphs fed with cotton leafworm larvae Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminated by the fungi had their reproduction affected, but this was not observed when adult predators fed on contaminated larvae. These findings suggest that isolates of M. anisopliae can cause mortality of P. nigrispinus nymphs by topical contact, while isolates of B. bassiana were less harmful by all ways of infection as compared to M. anisopliae.

Ítalo W.B., França; Edmilson J., Marques; Jorge B., Torres; José V., Oliveira.



Seletividade de inseticidas a Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predador de Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) / Selectivity of insecticides to Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predator of Ascia monuste orseis (Godart) (Lepidoptera: Pieridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom ao predador Polybia ignobilis (Haliday) em dosagens que causaram 90% de mortalidade em lagartas de 4º e 5º ínstares de Ascia monuste orseis (Godart). Os inseticidas paratiom metílico (cerca d [...] e 86% mortalidade) e carbaril (cerca de 62% de mortalidade) não foram seletivos a P. ignobilis. Os inseticidas mais seletivos foram triclorfom e permetrina (4% de mortalidade do predador). Deltametrina apresentou grau de seletividade intermediária (26% de mortalidade). Adultos de P. ignobilis com listras amareladas (38% de mortalidade) foram mais tolerantes a carbaril que adultos que não apresentavam tal característica (86%). Abstract in english The selectivity of carbaryl, deltamethrin, methyl parathion, permethrin and thrichlorfon to the predator Polybia ignobilis (Haliday) was evaluated in dosages which killed 90% of 4th and 5th instars of Ascia monuste orseis (Godart). Methyl parathion (86% average mortality) and carbaryl (62%) were not [...] selective to P. ignobilis; thrichlorfon and permethrin (4%) were more selective while deltamethrin showed intermediate selectivity (26% average mortality). Adults of P. ignobilis with yellow strips (38%) were more tolerant to carbaryl than those without this characteristic (86% average mortality).

Marcelo, Picanço; Luciano J., Ribeiro; Germano L.D., Leite; Marcos R., Gusmão.



Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa  

Directory of Open Access Journals (Sweden)

Full Text Available Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American sea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predatorio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica.

M. Florencia Grandi



A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As hidras são os representantes mais comuns dos cnidários de água doce. Em geral, estes organismos são encontrados em todos os continentes, exceto na Antártica. O presente estudo teve como objetivo obter informações mais aprofundadas sobre aspectos biológicos e ecológicos de duas espécies de Hydra n [...] ativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predação e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espécies. Os resultados indicaram que as duas espécies de Hydra não foram consumidas por nenhum dos predadores testados, os quais são usuais predadores de invertebrados em águas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espécie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de copépodos calanóides e os pequenos cladóceros, e selecionou negativamente as presas grandes, como os adultos de copépodos calanóides e os ostrácodos. Já a espécie H. salmacidis, a qual apresenta um tamanho maior, além de ter preferência pelos náuplios e copepoditos de copépodos calanóides e pequenos cladóceros, também selecionou positivamente os indivíduos adultos dos copépodos calanóides. Os resultados obtidos evidenciaram que as espécies H. viridissima e H. salmacidis provavelmente são pouco ou não são predadas em muitos ambientes naturais, sendo elas próprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos são predadores eficientes e observou-se uma relação positiva entre o tamanho da espécie de Hydra e o tamanho da presa. A seletividade alimentar destas espécies esteve relacionada com o tamanho das presas, assim como com outras características, tais como a espessura da carapaça e a eficiência de natação. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

Fernanda Cristina, Massaro; Natalia Felix, Negreiros; Odete, Rocha.



Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil / Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a ocorrência do ácaro vermelho do tomateiro (Tetranychus evansi Baker & Pritchard) e de ácaros predadores em quatro das espécies mais abundantes de solanáceas nativas do litoral de Pernambuco. Foram feitas coletas mensais de amostras de plantas de meados de setembro de 2002 a fins de maio [...] de 2003, nos municípios de Aliança, Carpina, Camaragibe, Goiana, Igarassu e Recife. Foram encontrados 5.485 ácaros pertencentes a mais de 27 espécies, das quais as mais numerosas foram as espécies fitófagas T. evansi e Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), e as espécies predadoras Asca sp. (Ascidae), Phytoseius guianensis De Leon e Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (ambos Phytoseiidae). Índices de associação negativos foram determinados entre T. evansi e quatro espécies de fitoseídeos predadores [as três mais numerosas encontradas neste estudo assim como Phytoseiulus macropilis (Banks)]. Foram também realizados testes em laboratório para se avaliar a aceitação de Tetranychus urticae Koch e T. evansi como presas àqueles predadores. Apenas P. macropilis sobreviveu e ovipositou adequadamente quando alimentado com T. urticae. Embora conseguissem se manter vivos por alguns dias quando alimentados com T. evansi, os níveis de reprodução dos quatro predadores foram muito baixos. Esses resultados indicam que embora encontrados comumente sobre solanáceas no campo, aqueles predadores alimentam-se muito pouco ou não se alimentam de T. evansi na natureza. Abstract in english The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Ca [...] maragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), and the predaceous species Asca sp. (Ascidae), Phytoseius guianensis De Leon and Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (both Phytoseiidae). Negative indexes of association were determined between T. evansi and each of four species of predaceous phytoseiids [i.e., the three most numerous species found in this study as well as Phytoseiulus macropilis (Banks)]. Laboratory tests were also conducted to evaluate the acceptability of Tetranychus urticae Koch and T. evansi as prey by the four predatory species. Only P. macropilis survived and oviposited well when fed T. urticae. Although they were able to remain alive for some days when fed T. evansi, the reproduction levels of the four predator species were very low. These results suggest that despite being commonly found on solanaceous plants in the field, these predators feed very little or do not feed at all on T. evansi in nature.

Alexsandra A., Rosa; Manoel G.C., Gondim Jr.; Komi K.M., Fiaboe; Gilberto J. de, Moraes; Markus, Knapp.



Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines, and ground cover plants. (United States)

Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the families Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) in central and south central Florida. Inner and outer canopy leaves, fruit, twigs, and trunk scrapings were sampled monthly between August 1994 and January 1996. Open flowers were sampled in March from five of the sites. Two species of eupalopsellid mites (Exothorhis caudata Summers and Saniosulus harteni (van-Dis and Ueckermann)) were identified from 252 specimens collected within citrus tree canopies within the seven citrus orchards of which 249 were E. caudata. Only two E. caudata were collected from ground cover plants within five of the seven orchards. Eight species of Stigmaeidae were identified from 5,637 specimens: Agistemus floridanus Gonzalez, A. terminalis Gonzalez, Eustigmaeus arcuata (Chandhri), E. sp. near arcuata, E. segnis (Koch), Mediostigmaeus citri (Rakha and McCoy), Stigmaeus seminudus Wood, and Zetzellia languida Gonzalez were collected from within citrus tree canopies from seven orchard sites. Agistemus floridanus was the only species in either family that was abundant with 5,483 collected from within citrus tree canopies compared with only 39 from vine or ground cover plants. A total of 431 samples from one or more of 82 vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards and one or more eupalopsellids or stigmaeids were collected from 19 of these plants. Richardia brasiliensis (Meg.) Gomez had nine A. floridanus from 5 of 25 samples collected from this plant. Solanum sp. had five A. floridanus from three samples taken. Both eupalopsellid and stigmaeid species numbers represented <1 % of the total numbers of phytoseiid species taken from the same plants. The two remaining orchards were on full herbicide programs and ground cover plants were absent. Agistemus floridanus was more abundant in the citrus orchards with on-going or recent herbicide programs compared with orchards having well-developed ground cover plants. Agistemus floridanus was most abundant on inner leaves between January and April and again during September through November. Additional collection records of E. caudata, S. harteni, A. terminalis, M. citri, Z. languida, and Zetzellia sp. near silvicola within Florida citrus orchards between 1989 and 2004 are included. Four species of Eupalopsellidae and ten species of Stigmaeidae occur within Florida citrus orchards. PMID:24771254

Childers, Carl C; Ueckermann, Eduard A



Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops  

Directory of Open Access Journals (Sweden)

Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

M.A. Watanabe



A dieta alimentar da presa Tenebrio molitor (Coleoptera: Tenebrionidae) pode afetar o desenvolvimento do predador Podisus nigrispinus (Heteroptera: Pentatomidae)? / Can the diet of the prey Tenebrio molitor (Coleoptera: Tenebrionidae) affect the development of the predator Podisus nigrispinus (Heteroptera: Pentatomidae)?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Inimigos naturais são importantes para o controle de pragas em culturas agrícolas e florestais. A criação de insetos predadores em biofábricas deve ser de baixo custo para serem utilizados em programas de Manejo Integrado de Pragas (MIP). O objetivo deste trabalho foi avaliar o desenvolvimento de Po [...] disus nigrispinus Dallas, 1851 (Heteroptera: Pentatomidae), alimentado com larvas de Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae), criadas com as seguintes dietas: farelo de trigo, ração triturada ou peletizada para aves poedeiras e fubá de milho. Foram obtidos os parâmetros de desenvolvimento e reprodução necessários para calcular a tabela de vida do predador. Os parâmetros da tabela de vida revelaram crescimento populacional em todos os tratamentos. No entanto, a taxa líquida de reprodução (Ro) de P. nigrispinus foi menor quando alimentados com larvas de T. molitor criadas com fubá de milho, mostrando ser a alimentação menos adequada para esse predador. Por proporcionar maior número total de ovos, o farelo de trigo constituiu a melhor dieta para P. nigrispinus. Estudos sobre dietas de presas alternativas são importantes, pois podem favorecer a nutrição de inimigos naturais e, consequentemente, melhorar o desempenho das criações massais em laboratório. Abstract in english Natural enemies are important for controlling pests in agricultural and forestry culture. The reproductions of predatory insects in biofactories should have low cost to be used in Integrated Pest Management Program (IPM). The objective of this study was to evaluate the development of Podisus nigrisp [...] inus Dallas, 1851 (Heteroptera: Pentatomidae) fed with Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae). The larvae of T. molitor were created with the following diets: wheat bran, shredded or pelleted poultry feed layers and corn meal. Parameters for the development and reproduction of the P. nigrispinus were obtained. Parameters of the life table show population growth in all treatments. However, the net rate of reproduction (Ro) of P. nigrispinus was lower when they were fed with larvae of T. molitor created with corn meal, which proved to be the least adequate food for this predator. By providing a larger total number of eggs, wheat bran was the best diet for P. nigrispinus. Studies on alternative prey diets are important as they may favor the nutrition of natural enemies and, consequently, improve the performance in laboratory rearing.

Claubert Wagner Guimarães de, Menezes; Silma da Silva, Camilo; Arley José, Fonseca; Sebastião Lourenço de, Assis Júnior; Diego Faustolo, Bispo; Marcus Alvarenga, Soares.



Adequabilidade de diferentes substratos à oviposição do predador Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Suitability of different substrates for oviposition of the predator Orius insidiosus (Say) (Hemiptera: Anthocoridae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Fêmeas de Orius insidiosus (Say) colocam seus ovos endofíticamente, em diversas plantas, e um obstáculo para a criação massal desse predador é a seleção de um substrato de oviposição que seja de fácil obtenção e aceito pelo inseto. O objetivo deste estudo foi avaliar a preferência e a adeqüabilidade [...] de diferentes substratos de oviposição para O. insidiosus. Os testes foram conduzidos em câmaras climatizadas reguladas a 25 ± 1°C, UR de 70 ±10% e fotofase de 12h. Os substratos avaliados quanto à preferência e adequabilidade foram caule de caruru (Amaranthus viridis L.), caule e vagem de feijão (Phaseolus vulgaris L.), vagem de feijão-de-vagem (Phaseolus vulgaris L.) e inflorescências de picão-preto (Bidens pilosa L.). Na adequabilidade também foi avaliado o caule de poaia-do-campo (Spermacoce latifola Aubl.). Fêmeas submetidas aos testes com e sem chance de escolha preferiram ovipositar em inflorescências de picão-preto. O período de pré-oviposição foi influenciado pelo tipo de substrato, sendo menor na presença da inflorescência de picão-preto (3,0 dias) e no feijão, tanto no caule (3,1dias) como na vagem (3,7 dias) comparado aos demais substratos. O período de oviposição, bem como a longevidade foram cerca de três a quatro vezes menores na presença do caule de poaia-do-campo (8,9 dias). O número total de ovos/fêmea de O. insidiosus foi maior em inflorescências de picão-preto (163,3 ovos). Os resultados indicam a adeqüabilidade das inflorescências de picão-preto como substrato de oviposição para O. insidiosus, sendo o preferido nos testes, com e sem chance de escolha, e onde as fêmeas apresentaram melhor performance reprodutiva. Abstract in english Orius insidiosus (Say) females lay eggs inside plant tissue. An obstacle for its mass rearing is the selection of a plant that is suitable and well-accept by the female for oviposition. The objectives of this work were to evaluate the preference and the suitability of different plant structures as o [...] vipositional substrates for O. insidiosus. The trials were conducted in climatic chamber at 25 ± 1°C, RH 70 ± 10% and photophase 12h. The plant sites as amaranth stem (Amaranthus virides L.), common bean's stem and pod (Phaseolus vulgaris L.), green bean's pod (Phaseolus vulgaris L.) and farmer's friend inflorescence (Bidens pilosa L.) were evaluated in no-choice and choice tests. The broadleaf button weed stem (Spermacoce latifola Aubl.) was also used to evaluate the suitability on the reproductive parameters. The females of O. insidiosus preferred to oviposit in farmer's friend inflorescence in no-choice and choice tests. The pre-oviposition period was affected by the plant site used as an ovipositional substrate, being shorter in farmer's friend inflorescence (3.0 days) and in common bean (both on stem (3.1 days) and pod (3.7 days) compared to all substrates evaluated. The oviposition period and the longevity were about three or four times shorter on broadleaf button weed stem (8.9 days). The total number of eggs/ female was higher in farmer's friend inflorescence (163.3 eggs). The results indicated the preference and suitability of farmer's friend inflorescence as an ovipositional substrate for O. insidiosus, in which the females showed better reproductive performance.

Simone M., Mendes; Vanda H.P., Bueno; Lívia M., Carvalho.



Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions  

Directory of Open Access Journals (Sweden)

Full Text Available OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada caixa, e a cada semana acrescentavam-se 100 larvas por caixa/dia, até se obter um máximo de 500 larvas/dia. Comprimento e peso dos peixes foram medidos semanalmente. RESULTADOS: Foram utilizadas 369.000 larvas no total. O Trichogaster trichopteros foi a única espécie em que ambos os sexos predaram 100% das larvas oferecidas. O Betta splendens deixou de predar apenas 15 larvas. Machos do Poecilia reticulata apresentaram baixa capacidade larvófaga quando comparados às fêmeas da mesma espécie. Em relação ao peso e tamanho o Betta splendens mostrou-se capaz de predar 523 larvas/grama/dia. CONCLUSÕES: Fêmeas e machos de Trichogaster trichopteros e de Astyanax fasciatus, e fêmeas de Betta splendens e de Poecillia sphenops foram os peixes que apresentaram maior competência para predar as larvas. Embora com competência menor, machos de Poecillia sphenops e fêmeas de Poecilia reticulata foram capazes de eliminar o número de larvas de Aedes aegypti que possam emergir durante 24 horas num criadouro, em condições naturais. Machos de Poecilia reticulata não foram predadores eficazes.OBJECTIVE: To evaluate the efficacy of fish as predators of the Aedes aegypti larvae in laboratory conditions. METHODS: The male and female of five different fish were included in the experiment. The tests to measure their consumption ability lasted five weeks for each species. Each trial involved four test tanks and four control tanks. Two control tanks contained just one fish, and the other two just larvae. Each of the test tanks contained one fish and the larvae. During the first week, 100 larvae were placed in the tank, with an additional 100 added every week, up to a maximum daily amount of 500 larvae. The length and weight of the fish were measured at the beginning and end of every week. RESULTS: A total of 369,000 larvae were used. The Trichogaster trichopteros was the only species in which both sexes ate 100% of the available larvae. The Betta splendens failed to eat only 15 larvae. The male Poecilia reticulate showed a strong capacity for larvae eating, compared with the female of the same species. In terms of weight and size, the Betta splendens proved capable of eating 523 larvae per gram of weight per day. CONCLUSIONS: The female and male Trichogaster trichopteros and Astyanax fasciatus, and the female Betta splendens and Poecilia sphenops proved to be the most effective predators of the Aedes aegypti larvae. And although the male Poecilia sphenops and female Poecilia reticulata were less effective, they were also capable of eradicating the total number of Aedes aegypti larvae that could appear over 24 hours in a breeding site under natural conditions. The male Poecilia reticulata, however, proved incapable of doing so.

Luciano Pamplona de Góes Cavalcanti



Avaliação in vitro do fungo predador de nematoides Duddingtonia flagrans sobre larvas infectantes de ciatostomíneos de equinos (Nematoda: Cyathostominae) / In vitro evaluation of nematode predacious fungus Duddingtonia flagrans on cyathostomes infective larvae of equines (Nematoda: Cyathostominae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A capacidade predatória de um isolado de fungo predador de nematoides Duddingtonia flagrans (AC001) sobre larvas infectantes de ciatostomíneos foi avaliada em condições laboratoriais em ensaio experimental em meio ágar-água 2% (AA 2%). Houve redução significativa (p [...] vas infectantes de ciatostomíneos recuperadas do meio AA2%, ao final de sete dias. Os resultados desse ensaio evidenciam que o isolado fúngico AC001 poderia ser utilizado no controle biológico de ciatostomíneos de equinos. Abstract in english The predatory capacity of one isolate of nematode-trapping fungus Duddingtonia flagrans (AC001) on infective larvae of cyathostomes was evaluated in laboratorial conditions in medium water-agar 2% (WA 2%). There was significant reduction (p [...] athostomes recovered of medium WA 2% at seven day. These results show that the isolated AC001 could be used in the biological control of cyathostomes of horses.

Braga, Fabio R.; Jackson V., Araújo; Juliana M., Araujo; André R., Silva; Rogério O., Carvalho; Artur K., Campos.



Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo  

Directory of Open Access Journals (Sweden)

Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

Maria A Medeiros



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores / Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tr [...] atamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília); cebola + milho (Zea mays L.); cebola + rúcula (Eruca sativa L.) + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento. Abstract in english The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind), and syrphid predators (Toxomerus spp.), population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatm [...] ents were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench) (Poligonaceae); onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.); onion intercropped with carrots (Daucus carota L.) Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.); onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

Paulo Antonio de Souza, Gonçalves; Carlos Roberto, Sousa e Silva.



Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop  

Directory of Open Access Journals (Sweden)

Full Text Available Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench; cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.; cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília; cebola + milho (Zea mays L.; cebola + rúcula (Eruca sativa L. + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento.The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind, and syrphid predators (Toxomerus spp., population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatments were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench (Poligonaceae; onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.; onion intercropped with carrots (Daucus carota L. Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.; onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

Paulo Antonio de Souza Gonçalves



Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939) e ácaros predadores (Phytoseiidae) / Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939) and predatory mites (Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939) (AcarirTenuipalpidae) e ácaros predadores (Phytoseiidae), em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0), acrinathrin (0,5); [...] hexythiazox (1,5); amitraz (40,0) e enxofre (225,0). Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização. Abstract in english The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939) (Acari,Tenuipalpidae) and predatory mites (Phytoseiidae) hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0), acrinathrin (0.5), hexythiaz [...] ox (1.5), amitraz (40.0) and sulphur (225.0). The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E., Sato; A., Raga; L.C., Cerávolo; A.C., Cezário; A.C., Rossi.



Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939 e ácaros predadores (Phytoseiidae Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939 and predatory mites (Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939 (AcarirTenuipalpidae e ácaros predadores (Phytoseiidae, em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0, acrinathrin (0,5; hexythiazox (1,5; amitraz (40,0 e enxofre (225,0. Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização.The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939 (Acari,Tenuipalpidae and predatory mites (Phytoseiidae hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0, acrinathrin (0.5, hexythiazox (1.5, amitraz (40.0 and sulphur (225.0. The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

M.E. Sato



Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics / Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predat [...] orio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica. Abstract in english Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American s [...] ea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.

M. Florencia, Grandi; Rocío, Loizaga de Castro; Enrique A, Crespo.



Effect of prey density on the functional and numerical responses of two species of predaceous mites (Acari: Phytoseiidae) / Efeito da densidade de presa nas respostas funcional e numérica de duas espécies de ácaros predadores (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Ácaros da família Phytoseiidae são os inimigos naturais de ácaros-praga mais importantes e estudados. Uma questão freqüentemente levantada é se os fitoseídeos podem reduzir altas densidades de ácaros fitófagos a baixos níveis. Os estudos da resposta funcional e numérica podem contribuir para respond [...] er essa pergunta. O objetivo deste trabalho foi avaliar o potencial de predação de Iphiseiodes zuluagai Denmark e Muma e Euseius alatus DeLeon (Acari: Phytoseiidae) como agentes de controle biológico do ácaro fitófago Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vetor do vírus da leprose-dos-citros e da mancha-anular do cafeeiro. Bioensaios foram realizados em laboratório. Fêmeas adultas de cada predador foram individualizadas em arenas de folha de citros com 3 cm de diâmetro. Fases imaturas de B. phoenicis foram oferecidas, como presas, nas seguintes quantidades/arena: 1, 2, 5, 10, 20, 30 e 35 (com sete repetições), 45 (quatro repetições), 55 (três repetições) e 70, 100, 125, 200 e 300 (duas repetições). O número de presas mortas e de ovos colocados pelo predador foram avaliados a cada 24h, durante oito dias. As presas mortas foram diariamente substituídas por novas presas. Para ambos os ácaros predadores foi constatada uma correlação positiva e altamente significativa entre o número de presas oferecidas e mortas. A oviposição média diária também aumentou em função do número de presas mortas. Nas densidades mais baixas, E. alatus matou mais B. phoenicis do que I. zuluagai, e o contrário foi observado nas densidades mais altas. É possível que E. alatus possa reduzir a população de B. phoenicis mesmo em baixas densidades do ácaro fitófago, e que I. zuluagai possa fazer o mesmo nas mais altas. O fato de E. alatus necessitar de menos presas que I. zuluagai sugere que sua sobrevivência possa ser maior do que a de I. zuluagai sob baixa densidade de presa. Abstract in english Phytoseiidae mites are the most important and studied natural enemies of pest mites. A question frequently raised is whether phytoseiid may reduce high densities of phytophagous mites. Studies of functional and numerical responses may help to answer this question. The aim of this work was to evaluat [...] e the potential predation success of Iphiseiodes zuluagai Denmark and Muma and Euseius alatus DeLeon (Acari: Phytoseiidae) on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vector of the citrus leprosis and the coffee ringspot viruses. Bioassays were performed in the laboratory. Adult females of each predator were isolated in arenas made with citrus leaves (3-cm diameter). Immature stages of B. phoenicis were offered as prey, at the following numbers/arena: 1, 2, 5, 10, 20, 30 and 35 (seven replicates), 45 (four replicates), 55 (three replicates) and 70, 100, 125, 200 and 300 (two replicates). The number of killed prey and of eggs laid by the predators was evaluated every 24h, during eight days. Killed prey was replaced daily by new prey. For both predatory mites, a positive and highly significant correlation was found between the numbers of prey offered and killed. The average daily oviposition rate also increased with the number of killed prey. At the lower densities, E. alatus killed and ate more B. phoenicis than I. zuluagai. The opposite was observed at the highest densities. It is possible that E. alatus can reduce B. phoenicis population even at low prey densities, and I. zuluagai can do the same also at high densities. The fact that E. alatus requires less prey than I. zuluagai suggests that its survivorship may be higher than that of I. zuluagai at low prey densities.

Paulo R., Reis; Elber O., Sousa; Adenir V., Teodoro; Marçal, Pedro Neto.



Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa / Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azad [...] iractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1) e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa. Abstract in english The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer) and on its predator Eriopis connexa (Germar). Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin) a [...] t concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1) and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1) and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine, Venzon; Maria da Consolação, Rosado; Angelo, Pallini; Amanda, Fialho; Célia de Jesus, Pereira.



Biologia de Amblyseius largoensis (Muma) (Acari: Phytoseiidae), um potencial predador de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro / Biology of Amblyseius largoensis (Muma) (Acari: Phytoseiidae), a potential predator of Aceria guerreronis Keifer (Acari: Eriophyidae) on coconut trees  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Aceria guerreronis Keifer é considerada uma das principais pragas do coqueiro no mundo. Dentre os Phytoseiidae relatados nessa cultura, Amblyseius largoensis (Muma) tem sido encontrado associado a A. guerreronis. Com o intuito de verificar se A. largoensis se alimenta de A. guerreronis, foi estudada [...] a biologia desse predador com diferentes fontes de alimento, incluindo A. guerreronis. Foram avaliadas três dietas [Tetranychus urticae Koch + pólen de mamona (Ricinus communis L.) + mel a 10%, A. guerreronis + pólen + mel e A. guerreronis isoladamente], avaliando-se o desenvolvimento, sobrevivência, oviposição, razão sexual e longevidade de A. largoensis a 27ºC, 60 ± 5% de umidade relativa e fotofase de 12h. Tabelas de vida de fertilidade foram construídas. A duração da fase imatura foi menor na dieta constituída apenas por A. guerreronis, enquanto que a fecundidade foi maior nas dietas à base de presa + pólen + mel. Não houve diferença entre os valores de sobrevivência das formas imaturas submetidas a diferentes dietas alimentares. Os parâmetros da tabela de vida de fertilidade foram superiores quando a alimentação foi constituída por A. guerreronis ou T. urticae + pólen + mel, embora o predador tenha sido capaz de completar seu ciclo biológico e se reproduzir quando alimentado exclusivamente com A. guerreronis. Os resultados sugerem que A. largoensis seja um predador de A. guerreronis em condições naturais e que possa estar desempenhando algum papel no controle dessa praga. Abstract in english Aceria guerreronis Keifer is considered one of the main pests of coconuts around the world. Amongst the Phytoseiidae recorded on this crop, Amblyseius largoensis (Muma) has been reported in association with A. guerreronis. In order to verify whether A. largoensis feeds on A. guerreronis, the biology [...] of this predator was evaluated on different food sources, including A. guerreronis. Three types of diet were tested [Tetranychus urticae Koch + castor bean (Ricinus communis L.) pollen + honey at 10%, A. guerreronis + pollen + honey, and only A. guerreronis], determining its development, survivorship, oviposition, sex ratio and longevity at 27ºC, 60 ± 5% RH 12 h photophase. Fertility life tables were constructed. The duration of the immature phase was lower when feeding only on A. guerreronis, while fecundity was higher when feeding on a prey + pollen + honey. There was no difference in relation to survivorship of the immature stages between the three diets. Parameters of fertility life tables were higher when the diet included A. guerreronis or T. urticae + pollen + honey, although the predator was able to complete its life cycle and reproduce when feeding exclusively on A. guerreronis. The results suggest that A. largoensis preys upon A. guerreronis under natural condition and that it might play some role in the control of the latter.

Andréia S., Galvão; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; José V. de, Oliveira.



Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil / Dinâmica populacional de Aceria guerreronis Keifer (Acari: Eriophyidae) e predadores associados em frutos de coqueiro no Nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Aceria guerreronis Keifer pode causar danos severos em coqueiro em vários países ao redor do mundo. Raros estudos têm sido conduzidos para determinar os ácaros predadores associados com A. guerreronis no Brasil. O objetivo deste estudo foi avaliar a prevalência de A. guerreronis e dos predadores ass [...] ociados nas brácteas e na superfície dos frutos abaixo delas, durante 12 meses, em frutos de coqueiro adulto ao longo da costa de Alagoas, Paraíba e Pernambuco, no Nordeste do Brasil. Ácaros de 10 famílias foram encontrados, contudo a espécie mais abundante foi A. guerreronis, correspondendo a 99,5% dos ácaros coletados. Dentre as espécies predadoras prevaleceram os ácaros Phytoseiidae Neoseiulus baraki (Athias-Henriot) e Neoseiulus paspalivorus (De Leon). Estes são achatados e possuem pernas curtas, características que lhes permitem invadir o habitat ocupado por A. guerreronis. Outros predadores foram encontrados, mas em número bem menor, provavelmente pela dificuldade que têm em penetrar nas áreas comumente habitadas por A. guerreronis. Contudo, essas espécies têm potencial de predação sobre o ácaro quando este sai de seu habitat preferido para se dispersar. Não se observaram correlações significativas entre os níveis de fatores abióticos e os níveis populacionais de A. guerreronis ou dos fitoseídeos associados a essa espécie. Isso provavelmente se deu devido aos efeitos simultâneo e conflitante daqueles fatores sobre os ácaros no campo, ou a diferenças significativas entre os fatores climáticos medidos no ambiente e aqueles prevalentes no habitat ocupado por A. guerreronis. Abstract in english Aceria guerreronis Keifer can cause severe damage to coconuts in several countries around the world. Rare studies have been conducted to determine the predatory mites associated with A. guerreronis in Brazil. The study evaluated the prevalence of A. guerreronis and associated predators on the bracts [...] and on the surface of the fruits underneath the bracts, for 12 months, on coconut palms grown along the coast of the States of Alagoas, Paraíba and Pernambuco, Northeastern Brazil. Mites of 10 families were found, but by far the most abundant species was A. guerreronis, corresponding to 99.5% of the mites collected. The prevailing species amongst the predators were the Phytoseiidae mites Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon). These are flat mites that have short limbs, characteristics that allow them to invade the main habitat occupied by A. guerreronis. Other predators were found, but in low numbers, due mainly to their difficulty in reaching the fruit areas most inhabited by A. guerreronis. However, these mites could prey on that pest when it leaves its preferred habitat to disperse. No significant correlations were observed between the levels of abiotic factors and the population levels of A. guerreronis or of the phytoseiids associated with it. This probably occurred due to the simultaneous and conflicting effects of those factors on the mites in the field, or to significant differences between the climatic factors measured in the environment and those prevailing in the habitat occupied by A. guerreronis.

Aleuny C., Reis; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; Rachid, Hanna; Peter, Schausberger; Late E., Lawson-Balagbo; Reginaldo, Barros.



Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

Madelaine Venzon



Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.



Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.


Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests / Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Com o objetivo de selecionar ácaros predadores com potencial de controle de ácaros fitófagos do mamão, foram realizadas, de janeiro de 1999 a fevereiro de 2000, amostragens bimensais de ácaros em dois pomares, um orgânico (Silva Jardim, RJ) e outro com controle químico de pragas, doenças e invasoras [...] (Linhares, ES). Todas as espécies presentes nas brotações laterais, folhas novas, folhas velhas e botões florais dos mamoeiros e nas folhas das plantas invasoras foram quantificadas e identificadas ao menos até família. Apesar da relativamente diversa fauna de ácaros, somente representantes de uma família de predadores, Phytoseiidae, foram encontrados. Dentre estes, Neoseiulus idaeus Denmark & Muma destacou-se por sua abundância e freqüência nas diferentes épocas do ano no pomar de Linhares, coincidindo principalmente com as flutuações na abundância dos tetraniquídeos. Tal ocorrência em um sistema de produção com grande emprego de acaricidas, aliada às características biológicas favoráveis dessa espécie, recomendam-na como candidata a agente de controle biológico de ácaros pragas do mamão, em especial Tetranychus urticae Koch. Abstract in english This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where p [...] ests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least family level. Despite the relatively diverse mite fauna, we found representatives of only one family of predacious mites, i.e. Phytoseiidae. Among these, Neoseiulus idaeus Denmark & Muma was the most abundant and frequent during all seasons in the Linhares orchard, coinciding mainly with the fluctuations in abundance of tetranychid mites. Such occurrence in a production system with large use of acaricides, together with its favorable biological traits reported in the literature, lead us to recommend this species as a good candidate for biological control of papaya mite pests, especially Tetranychus urticae Koch.

Karin F.S., Collier; Jose O.G. de, Lima; Gilberto S., Albuquerque.



Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil / O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Comensalismo entre Corydalus Latreille, 1802 (Insecta, Megaloptera, Corydalidae) e Corynoneura Winnertz, 1846 (Insecta, Diptera, Chironomidae, Orthocladiinae) foi registrado no córrego Indaiá situado a 1.380 m de altitude no Parque Nacional da Serra do Cipó (19-20ºS, 43-44ºW) e nas nascentes do rio [...] São Francisco a 1.300-1.700 m de altitude no Parque Nacional da Serra da Canastra (20º00'-20º30'S, 46º15'-47º00'W), Minas Gerais, Brasil. Setenta e oito larvas de Corydalus (tamanhos: 22-88 mm) foram coletadas: 61 no córrego Indaiá e 17 em outros córregos. Doze larvas de Corydalus (tamanhos: 22-79 mm) no córrego Indaiá e três encontradas nas nascentes do rio São Francisco (tamanhos: 38-50 mm) apresentaram larvas e pupas de Corynoneura em suas brânquias (3ª a 6ª) e algumas larvas fixadas nos segmentos abdominais de grandes Corydalus (> 25 mm). Sessenta e nove larvas de Corynoneura foram retiradas do material regurgitado por Corydalus. É importante observar que fixados aos predadores de grande tamanho corporal as presas se tornam livres de outros predadores além de serem transportados por eles. Abstract in english Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river [...] , at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were sampled: 61 in the Indaiá stream and 17 in other two streams. Twelve Corydalus larvae (22-79 mm) in the Indaiá stream and three out of 15 larvae in the headwaters of São Francisco river (38-50 mm) had Corynoneura, larvae and pupae on their gills (3rd to 6th) and a few larvae attached to the abdominal segments of larger Corydalus larvae (> 25 mm). Sixty-nine larvae of Corynoneura were found in the regurgitated material from Corydalus. It is remarkable that by attaching to larger body size predators, prey could become free from predator bouts and could also be transported by them.

Marcos, Callisto; Michael D.C., Goulart; Pablo, Moreno; Rogério P., Martins.



Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido / Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 [...] a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea. Abstract in english The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from [...] 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

Mariana Oliveira, Breda; José Vargas de, Oliveira; Edmilson Jacinto, Marques; Rachel Gonçalves, Ferreira; Mauricéa Fidelis, Santana.



Desenvolvimento e Reprodução do Predador Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Frente a Doses Subletais de Permetrina / Development and Reproduction of the Predator Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Exposed to Sublethal Doses of Permethrin  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Desenvolvimento e reprodução foram estudados no predador Podisus distinctus (Stal) submetido a doses subletais do inseticida permetrina em condições de laboratório. Ninfas de 3º instar foram submetidas a aplicação tópica de permetrina nas doses de 0; 0,0172; 0,172; 1,72; 17,2 e 172 ppb. O único parâ [...] metro significativamente afetado foi a viabilidade de ovos. Esse parâmetro teve um máximo de estímulo na dose 0,172 ppb provendo evidência do fenômeno de hormese. Abstract in english Development and reproduction were studied in the predator Podisus distinctus (Stal) subjected to sublethal doses of the insecticide permethrin under laboratory conditions. Third instar nymphs were subjected to topical application of permethrin at the doses of 0, 0.0172, 0.172, 1.72, 17.2 e 172 ppb. [...] The only parameter statisticaly different was egg viability. This parameter had the gratest increase at the dose 0.172 ppb provinding evidence for the phenomenon of hormesis.




Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.



Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae) / Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) em sua ativação ovariana. Essas ninfas receberam [...] aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml): 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml) a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese. Abstract in english Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) was investigated on ovary activation in this predator. The nymph [...] s received topical application of permethrin in the following concentrations (mg a.i./ml): 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.

W. P., Lemos; R. S., Medeiros; J. C., Zanuncio; J. E., Serrão.



Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae  

Directory of Open Access Journals (Sweden)

Full Text Available Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål (Heteroptera: Pentatomidae was investigated on ovary activation in this predator. The nymphs received topical application of permethrin in the following concentrations (mg a.i./ml: 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål (Heteroptera: Pentatomidae em sua ativação ovariana. Essas ninfas receberam aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml: 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese.

W. P. Lemos



A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

Andrew P., Gutierrez; Marina A., Pizzamiglio.



Efeito da idade das fêmeas e de fatores ambientais sobre a reprodução do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) - DOI: 10.4025/actascibiolsci.v25i2.2014 Effect of female age and environmental factors on reproduction of the predator Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) - DOI: 10.4025/actascibiolsci.v25i2.2014  


Os fatores bióticos e abióticos afetam o potencial reprodutivo dos insetos. Portanto, estudou-se o efeito da idade das fêmeas e de fatores ambientais sobre a reprodução de Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae). Adultos do predador foram criados em gaiolas de PVC, fechadas na parte superior com tecido de malha fina (organza), colocadas sobre plantas de algodão em casa-de-vegetação. A maior produção de ovos por fêmea (87,7 ovos) ocorreu aos 49 dias, e a...

Cesar Freire Carvalho; Carvalho Carlos Ecole; Brigida Souza; Luciano Pacelli Medeiros Macedo; Marcio Marcos Goussain



Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.




Seletividade de extratos de nim (Azadirachta indica A. Juss.) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) / Selectivity of neem extracts (Azadirachta indica A. Juss.) to the predatory Mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A toxicidade relativa dos extratos de folha, semente e óleo de torta de Azadirachta indica A. Juss (nim) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) foi estudada em laboratório. Foram determinadas concentrações discriminatórias (CLs99) dos extratos de folha, semente [...] e óleo de torta de nim para fêmeas adultas de Oligonychus ilicis (McGregor) (Acari: Tetranychidae), através de bioensaios de concentração-mortalidade. Arenas com 3,5 cm de diâmetro, confeccionadas com folhas de cafeeiro flutuando em água, foram impregnadas com resíduo seco dos extratos e usadas para se estimar a seletividade ao ácaro I. zuluagai. As concentrações dos extratos de nim que mataram 99% de O. ilicis, após 72h de exposição foram: 277,4; 520,9 e 10,9 mg/ml, para folha, semente e óleo de torta, respectivamente. A concentração discriminatória do extrato de óleo de torta de nim para fêmeas adultas de O. ilicis foi altamente tóxica ao ácaro I. zuluagai, as dos extratos de folha e de semente foram seletivos. Abstract in english The relative toxicity of the leaf, seed and oil neem cake extracts of Azadirachta indica A. Juss (neem) to the predatory mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) was evaluated. To verify the relative toxicity of these extracts on the predatory mite, discriminating concentrati [...] ons of the extracts were determined for adult females of the Oligonychus ilicis (McGregor) (Acari: Tetranychidae), through the method of concentration-mortality. Coffee leaf disks with 3.5 cm of the diameter were put floating on water and impregnated with dry residue of the extracts. Concentrations of neem extracts which caused mortality (99%) of O. ilicis, after 72h of exposition, were 277.4; 520.9 e 10.9 mg/ml for leaf, seed and oil neem cake, respectively. The discriminating concentration of extract of oil neem cake for O. ilicis females was highly toxic to I. zuluagai; while extract of leaf and seed were selective to the predatory mite.

Sheila A., Mourão; Júlio C.T., Silva; Raul N.C., Guedes; Madelaine, Venzon; Gulab N., Jham; Claudinei L., Oliveira; José C., Zanuncio.



Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa / Selectivity of pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas). Os agrotóxicos foram pulverizados direta [...] mente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas) se mostrou inócua (classe 1) a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2) a ovos e pupas de C. externa Abstract in english This research aimed to evaluate the effect of nineteen pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa in bioassays carried under laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase). The pesticides were directly spra [...] yed on eggs and pupae trough a Potter tower using the maximum recommended dosage for peach orchards. It was evaluated eggs and pupae viability, in addition to fecundity and fertility of adults emerged from treated pupae. The pesticides were classified to eggs according to reduction in eggs hatch, and to pupae according to the total effect into IOBC toxicity categories. Most of pesticides evaluated (8 insecticides, 8 fungicides and 2 herbicides) were harmless (category 1) to eggs and pupae, with a reduction in eggs hatch and total effect to pupae lower than 30%, except for the insecticide mineral oil, which reduced eggs hatch in 69.55% and caused a total effect of 36.22% in pupae, being therefore classified as slightly harmful (category 2) to eggs and pupae of C. externa

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Paulo Ricardo Baier, Siqueira; Ítalo Lucas de, Moraes; Cleiton Jair, Gauer.



Ácaros predadores (Acari) associados à cultura do morango (Fragaria sp., Rosaceae) e plantas próximas no Estado do Rio Grande do Sul / Predatory mites (Acari) associated with strawberry and neighboring plants in the State of Rio Grande do Sul  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste estudo foi determinar as espécies de ácaros predadores associados à cultura do morango e em plantas associadas, no estado do Rio Grande do Sul. Este estudo foi conduzido nos municípios de Bom Princípio, Capitão e Lajeado em plantações de morango da variedade Oso Grande em túnel baix [...] o. As avaliações foram feitas mensalmente entre agosto de 2002 e março de 2004. Nas plantas de morango, as amostras foram constituídas de três folhas coletadas em cada uma das 15 plantas escolhidas ao acaso, totalizando 45 folhas/campo. Nas plantas associadas, o esforço de amostragem foi de uma hora para cada planta avaliada. Ácaros das famílias Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae e Tydeidae foram observados associados com o ácaro rajado, Tetranychus urticae Koch, 1836, praga importante na região onde este estudo foi conduzido. Vinte espécies foram identificadas, 14 das quais pertencem à família Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) e Neoseiulus californicus (McGregor, 1954) foram as espécies mais comuns. Nas plantas asssociadas, a maior diversidade foi observada em Richardia sp. (seis espécies), Agerantum conyzoides L.(quatro espécies) e Sonchus oleraceus L., Bidens pilosa L.e Rumex sp. (três espécies). Uma chave docotômica é apresentada para a identificação das espécies. Abstract in english The aim of this study was to determine the species predatory mites on strawberry crop and associated plants in the State of Rio Grande do Sul. It was conducted in Bom Princípio, Capitão and Lajeado counties, in crops of strawberry Oso Grande variety in low tunnels. The evaluations were done monthly [...] between August 2002 and March 2004. In the plants of strawberry, the samples were constituted of three leaves collected in each of 15 plants taken randomly, totaling 45 leaves/field. In the associated plants, the sampling effort was of one hour for each plant evaluated. Mites of the families Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae and Tydeidae were observed associated with the two-spotted spider mite, Tetranychus urticae Koch, 1836, important pest of this crop in the region where the study was conducted. Twenty species were identified, 14 of which belong to the family Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) and Neoseiulus californicus (McGregor, 1954) were the most common species. On associated plants, the highest diversity of predatory mites was found on Richardia sp. (six mite species), Agerantum conyzoides L. (four mite species) and Sonchus oleraceus L., Bidens pilosa L. and Rumex sp. (three mite species). A dichotomous key is presented for the separation of the species collected.

Noeli Juarez, Ferla; Marla Maria, Marchetti; Dinarte, Gonçalves.


Seletividade de inseticidas, utilizados no controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) em pêssego, a Vespidae predadores / Seletivity of insecticides used for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach, to predatory Vespidae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudo-se em laboratório a seletividade dos inseticidas carbaril, deltametrina, fenitrotiom, fentiom, malatiom, nalede, paratiom metílico e triclorfom aos predadores Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) e Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) [...] em concentrações que correspondem a 50% (subdose) e 100% (dose) da recomendação para o controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) na cultura do pêssego. Nas doses recomendadas, para controle de G. molesta, os inseticidas fenitrotiom, fentiom, paratiom metílico, nalede e triclorfom não apresentaram seletividade às três espécies de Vespidae, causando 100% de mortalidade a estas, com exceção do triclorfom que matou 96,9% de P. sylveirae. Carbaril e malatiom foram seletivos em favor de P. versicolor versicolor (18,6 e 6,7% de mortalidade, respectivamente), e deltametrina em favor de P. versicolor versicolor (3,7% de mortalidade) e P. exigua (11,9% de mortalidade). P. sylveirae foi mais suscetível a deltametrina que P. exigua e P. versicolor versicolor. Já P. versicolor versicolor foi mais tolerante a malatiom e carbaril que P. sylveirae e P. exigua. Deltametrina, malatiom e nalede causaram menor mortalidade em P. sylveirae quando aplicados em subdose, sendo que o mesmo ocorreu com carbaril e malatiom para P. exigua. Abstract in english The selectivity of the insecticides carbaryl, deltamethrin, fenitrothion, fenthion, malathion, naled, methyl parathion and trichlorfon to the predators Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) and Protopolybia exigua (Saussure) was studied in laboratory using 50 [...] and 100% of the recommended dose for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach orchards. The insecticides fenitrothion, fenthion, methyl parathion, naled, and trichlorfon showed no selectivity in favour of the wasps at the full recommended dose, all of them causing 100% mortality among the predators except for trichlorfon which caused 96.9% mortality to P. sylveirae. Carbaryl and malathion were selective in favour of P. versicolor versicolor (18.6 and 6.7% mortality, respectively), and deltamethrin was selective in favour of P. versicolor versicolor (3.6% mortality) and P. exigua (11.8% mortality). P. sylveirae was more susceptible to deltamethrin than P. exigua and P. versicolor versicolor. P. versicolor versicolor was more tolerant to malathion and carbaryl than P. sylveirae and P. exigua. Deltamethrin, malathion and naled were less lethal to P. sylveirae when applied at the lower dose; while the same happened to carbaryl and malathion for P. exigua.

Alfredo H.R., Gonring; Marcelo, Picanço; Marcelo F. de, Moura; Leandro, Bacci; Cláudio H., Bruckner.



Aranhas e ácaros predadores em copas de tangerineiras Montenegrina, mantidas sob manejo orgânico, em Montenegro, RS / Spiders and predatory mites in the canopies of organically managed Montenegrina tangerine trees, in Montenegro County, RS  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O estudo objetivou o levantamento da fauna de aranhas e ácaros com hábito predador, em copas de tangerineiras (Citrus deliciosa var. Montenegrina) em pomar orgânico, situado em Montenegro, RS. Durante um ano, quinzenalmente 24 plantas eram sorteadas e avaliadas em duas regiões da copa, utilizando-se [...] um pano-de-batida (1 m²). Capturou-se o total de 3.129 indivíduos, sendo 2.559 aranhas e 570 ácaros. Em Araneae foram reconhecidas 53 espécies adultas distribuídas em oito famílias, dentre estas, as mais abundantes foram Sphecozone sp. (Linyphiidae) (21,8%) e Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9,9%). No outono observou-se a maior abundância de jovens e adultos (29,2%) e, na primavera, a maior riqueza de espécies (40). Na primavera também se registraram os maiores valores para os índices de Margalef e Shannon-Wiener, este último, porém, não diferiu significativamente dos das demais estações. Os valores de Simpson, em todas as estações foram semelhantes, indicando o mesmo grau de dominância das espécies. Em Acari registraram-se oito espécies, distribuídas em três famílias, as mais abundantes foram Leptus sp.1 (Erythraeidae) (59,4%) e Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). O outono foi a estação mais rica em número de espécies (oito). No inverno observou-se a maior abundância de indivíduos (47%) e, no verão, a menor (0,88%). Entre os ácaros, Phytoseiidae apresentou a maior riqueza. Entre as aranhas, Anyphaenidae foi a que apresentou a maior abundância e Theridiidae, a maior riqueza de espécies, seguindo assim o padrão já observado para o grupo. Abstract in english A survey was conducted to study the spider and predatory mite fauna occurring in the canopies of tangerine trees (Citrus deliciosa Tenore, cultivar Montenegrina) of an organically managed orchard, at Montenegro County, RS. During a year, fortnightly, 24 randomly trees were selected and sampled in tw [...] o canopies areas, by using a sheet of white cloth (1 m²). A total of 3,129 arachnids were collected, being 2,559 spiders and 570 mites. Based on the adults, 53 species of Araneae were recognized, belonging to eight families. Among those, the most abundant were Sphecozone sp. (Linyphiidae) (21.8%) and Chrysso pulcherrima (Mello-Leitão) (Theridiidae) (9.9%). Autumn exhibited the greatest abundance of young and adults of Araneae (29.2%) and spring was the season richest in species (40). Margalef and Shannon-Wiener diversity indexes also showed the highest values in spring. The latter index did not show differences among seasons. Simpson complementary index was equal among seasons, reflecting the same degree of species dominance. In Acari, eight species were identified in three families. The most abundant species were the mites Leptus sp.1 (Erythraeidae) (59.4%) and Amblyseius saopaulus Denmark & Muma (Phytoseiidae) (30%). Autumn was the season richest in mite species (eight). The highest abundance (47%) was observed on winter and the lowest (0.88%) on summer. Among mites, Phytoseiidae showed the highest richness. Among the spiders, Anyphaenidae was the most abundant and Theridiidae had the highest species richness, following the patterns observed for the group.

Rosana M. de, Morais; Ricardo, Ott; Ana P., Ott; Luiza R., Redaelli.



Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae) em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas / Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae) in residual toxicity persistence tests  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor), são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando expost [...] o a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA), folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus. Abstract in english Phytoseiid mites, mainly Neoseiulus californicus (McGregor), are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the ins [...] ecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA), leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p

Marcelo Gustavo, Ruiz; Gilberto José de, Moraes.



Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests  

Directory of Open Access Journals (Sweden)

Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

Marcelo Gustavo Ruiz



Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.




Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.



Acão de Inseticidas Organofosforados Utilizados no Controle de Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) Sobre o Ácaro Predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Action of Organophosphate Insecticides Used to Control Leucoptera coffeella (Guérin-Mèneville) (Lepidotera: Lyonetiidae) on the Predator Mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O controle químico apresenta vantagens como economicidade e rapidez de ação, e tem sido preferencialmente usado no controle de pragas pelos agricultores. Em contrapartida, entre as desvantagens destaca-se o largo espectro de ação dos compostos, que atingem espécies não-alvos, como inimigos naturais, [...] além de contaminarem o meio ambiente. O presente trabalho avaliou a ação dos inseticidas clorpirifós, dissulfotom, etiom e paratiom-metílico, normalmente usados para controlar o bicho-mineiro-do-cafeeiro Leucoptera coffeella (Guérin-Mèneville), sobre o ácaro predador Iphiseiodes zuluagai Denmark & Muma, agente de controle dos ácaros fitófagos Oligonychus ilicis (McGregor) e Brevipalpus phoenicis (Geijskes) em agroecossistema cafeeiro. Para verificar o efeito seletivo dos compostos sobre o ácaro predador, concentrações discriminatórias (CLs99) dos quatros inseticidas foram determinadas para o 3º instar larval de L. coffeella, através do método de bioensaios de concentração-mortalidade em papel-filtro, impregnado com resíduo seco de inseticidas. O clorpirifós causou 100% de mortalidade dos ácaros testados; o etiom e o paratiom-metílico causaram 34% e 19% de mortalidade, respectivamente. Dissulfotom foi o mais seletivo em favor do predador, não mostrando ação letal. O efeito diferenciado dos inseticidas foi desta forma verificado, e tal informação possibilita a utilização dos inseticidas seletivos no agroecossistema cafeeiro, preservando populações de I. zuluagai e favorecendo o controle biológico exercido pelo ácaro predador. Abstract in english Chemical control has been preferentially used to suppress pests by farmers mainly due to low price of the products and immediate action on target organisms. However, wide action range of the compounds, undesirable effects on non target organisms and the contamination of the environment are among the [...] disadvantages of this method of control. This study evaluated the action of the insecticides chlorpyrifos, disulfoton, ethion and methyl-parathion, normally used to control the coffee leaf-miner, Leucoptera coffeella (Guérin-Mèneville), on the predaceous mite Iphiseiodes zuluagai Denmark & Muma, a control agent of the phytophagous mites Oligonychus ilicis (McGregor) and Brevipalpus phoenicis (Geijskes) in coffee plantation. Discriminatory concentrations (LC99), established on the 3rd instar of L. coffeella, by means of the method of dry insecticide residues impregnated in filter paper, were used to verify the selectivity of the insecticides on the predaceous mite. The insecticide chlorpyrifos caused 100% of mortality in I. zuluagai. Ethion and methyl-parathion showed mortality of 34% and 19%, respectively. Disulfoton presented the highest selectivity for the mite, with no lethal action on the predator. The different effects found on the insecticides' action show that it is possible to use the selective insecticides in coffee plantation to preserve populations of I. zuluagai, thus favouring the biological control on phytophagous mite.




Identification of plant families associated with the predators Chrysoperla externa (Hagen (Neuroptera: Chrysopidae and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae using pollen grain as a natural marker Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen (Neuroptera: Chrysopidae e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae usando o pólen como marcador natural  

Directory of Open Access Journals (Sweden)

Full Text Available The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae and Chrysoperla externa (Hagen (Neuroptera: Chrysopidae, are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when predators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals and H. convergens (43 individuals were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.Os predadores Chrysoperla externa (Hagen (Neuroptera: Chrysopidae e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os predadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos e H. convergens (43 indivíduos foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo.

MA Medeiros



Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.



Biología y comportamiento de Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) como predador de Panonychus citri (McGregor) (Acari: Tetranychidae) / Biology and behavior of Amblyseius chungas Denmark & Muma (Acari: Phytoseiidae) as a predator of Panonychus citri (McGregor) (Acari: Tetranychidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Panonychus citri (McGregor) es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencia [...] l de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR). El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día. Abstract in english Panonychus citri (McGregor) is an important citrus pest in the central coast of Peru. Amblyseius chungas Denmark & Muma was the most frequent and abundant predatory mite during some surveys for natural enemies against P. citri in that region. We studied the duration of P. citri by immature stages of [...] A. chungas and analyzed its predatory behavior when female adults of A. chungas were fed with P. citri nymphs and adults. The experiments were carried out in the laboratory (20-25ºC and 70-80 % RH). Development time from egg to adult was 6.60 ± 0.57 days in females and 6.46 ± 0.44 days in males. Female adults of A. chungas fed with different densities of adults and/or nymphs of P. citri showed a functional response type II according with the classification proposed by Holling. Oviposition of A. chungas ranged from 1 to 3 eggs/day.

Alberto Daniel, Guanilo; Norberta, Martínez.



Toxicidade de produtos fitossanitários utilizados na cultura do cafeeiro a larvas de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e efeitos sobre as fases subseqüentes do desenvolvimento do predador / Toxicity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and their effects on subsequent stages of the predator  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a seletividade fisiológica de alguns produtos fitossanitários utilizados em cafeeiro a larvas de Chrysoperla externa (Hagen) e seus reflexos nas fases subseqüentes do desenvolvimento do predador. Os tratamentos avaliados, em g i.a./L de água foram: 1- endosulfam (Thiodan 350 CE - 1,75), 2 [...] - clorpirifós (Lorsban 480 CE - 1,2), 3- betaciflutrina (Turbo 50 CE - 0,013), 4- enxofre (Kumulus 800 PM - 4,0), 5- azociclotina (Peropal 250 PM - 0,31), 6- oxicloreto de cobre (Cuprogarb 500 PM - 5,0) e 7- testemunha (água). As pulverizações foram realizadas em larvas de primeiro, segundo e terceiro ínstares de C. externa, por meio de torre de Potter. Em seguida, as larvas foram individualizadas em tubos de vidro e mantidas em câmara climatizada regulada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12h. A toxicidade dos produtos foi calculada em função do seu efeito total (E) e categorizada conforme escala proposta pela IOBC. Clorpirifós e betaciflutrina foram nocivos a larvas de primeiro ínstar (E > 99%) e os demais foram seletivos. Clorpirifós foi também tóxico a larvas de segundo e terceiro ínstares, sendo os demais compostos inócuos ao predador (E Abstract in english The objective was to evaluate the selectivity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) and their effects on the subsequent developmental stages of the predator. The treatments in g a.i./L of water were: 1 - endosulfan (Thiodan 350 CE - 1.75), 2 - chlorpyrifos (Lors [...] ban 480 CE - 1.2), 3 - betacyfluthrin (Turbo 50 CE - 0.013), 4 - sulphur (Kumulus 800 PM - 4.0), 5 - azocyclotin (Peropal 250 PM - 0.31), 6 - copper oxichloride (Cuprogarb 500 PM - 5.0) and 7 - control (water). The products were sprayed on first, second and third-instar larvae using a Potter's tower. The larvae were individualized in glass tubes and maintained at 25 ± 2ºC, RH of 70 ± 10% and 12h photophase. The toxicity of the pesticides was calculated based in their total effect (E) and classified according to recommendations of IOBC. Chlorpyrifos and betacyfluthrin were harmful to first-instar larvae (E > 99%). Endosulfan, sulphur, azocyclotin and copper oxichloride were harmless to first-instar larvae and the others were selective. Chlorpyrifos was also toxic to second and third-instar larvae, and the other compounds were selective (E

Rogério A., Silva; Geraldo A., Carvalho; César F., Carvalho; Paulo R., Reis; Antônio M.A.R., Pereira; Luciano V., Cosme.



Effect of neem seed oil aqueous solutions on survival and development of the predator Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) / Efeito de soluções aquosas de óleo de sementes de nim, Azadirachta indica, na sobrevivência e desenvolvimento do predador Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os efeitos de soluções aquosas do óleo de sementes de nim sobre o predador Cycloneda sanguinea (L.), nos estágios de ovo, larva e adulto, foram avaliados em laboratório. Em um primeiro experimento, ovos e larvas de 2º ínstar foram pulverizados com as soluções de nim nas concentrações de 0; 0, 5 e 2, [...] 25 ml/l de água apresentaram mortalidade significativa (P Abstract in english The effects of the neem seed oil aqueous solutions on survival and performance of egg, larva and adult stage of the Coccinelid predator Cycloneda sanguinea (L.) were evaluated under laboratory conditions. In a first trial, eggs and 2nd-instar larvae were sprayed with the neem solutions at 0; 0.5 and [...] 2.25 ml/l and kept at 25 ± 1ºC, 70% RH and 14h photoperiod. Egg viability and duration and larvae and pupae survival were evaluated as well as the predatory capacity of the larvae, adult longevity and reproduction. Egg spraying did not affect egg hatch or larvae survival and development. When the larvae were sprayed, significant mortality was observed only at the higher concentration (P

Flávia A.C. da, Silva; Sueli S., Martinez.



Dinâmica populacional de ácaros (Acari) em erva-mate (Ilex paraguariensis St. Hil.: Aquifoliaceae) / Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho foi realizado em Dois Vizinhos, PR, com o objetivo de estudar a dinâmica populacional de ácaros fitófagos e seus predadores em plantas de erva-mate (Ilex paraguariensis St. Hil. Aquifoliaceae). Folhas de diferentes partes da planta foram coletadas de agosto de 2001 a julho de 2002, e o [...] s ácaros presentes foram contados sob microscópio estereoscópico. Foram encontradas associadas às plantas de erva-mate duas espécies de ácaros fitófagos Dichopelmus notus Keifer, e Oligonychus yothersi (McGregor), e três espécies de predadores identificados como sendo Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp. O ácaro D. notus ocorreu em maior número na face inferior de folhas, em folhas maduras e em folhas dos estratos inferior e médio. O. yothersi predominou em folhas maduras. A concentração de E. concordis e I. zuluagai sempre foi maior na face inferior de folhas, em folhas maduras, em folhas dos estratos inferior e médio e na região interna da copa. Os ácaros D. notus, O. yothersi, E. concordis e I. zuluagai tiveram picos populacionais em período de temperatura amena e baixa precipitação pluviométrica. A maior densidade populacional de Agistemus sp. ocorreu na face inferior das folhas e seu pico populacional ocorreu em período de alta temperatura e precipitação pluviométrica elevada. Abstract in english The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samp [...] les from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain.

Alfredo de, Gouvea; Luiz C., Boaretto; Carla F., Zanella; Luis F.A., Alves.



Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker / Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os p [...] redadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos) e H. convergens (43 indivíduos) foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo. Abstract in english The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when p [...] redators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals) and H. convergens (43 individuals) were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.

MA, Medeiros; PA, Ribeiro; HC, Morais; M, Castelo Branco; ER, Sujii; ML., Salgado-Laboriau.



Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) / Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiu [...] lus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.). A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos. Abstract in english The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L) and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L) over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus m [...] acropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.). The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann, Schlesener; Adriane Fonseca, Duarte; Milton Fernando Cabezas, Guerrero; Uemerson Silva da, Cunha; Dori Edson, Nava.



Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

Daniele Cristine Hoffmann Schlesener



Ocorrência de Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) e do predador Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) em Myrtus communis L. (Myrtaceae), em Pinheiral, RJ / Occurrence of Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) and of the predator Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) on Myrtus communis L. (Myrtaceae), in Pinheiral County, Rio de Janeiro, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O) da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um [...] total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1) M. communis pode ser indicada como planta isca; (2) esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3) a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4) a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo) e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação), com diferenças significativas em P Abstract in english The evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W) of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 96 [...] 5 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1) M. communis may be indicated as plant bait; (2) this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3) the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4) the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases) and 1.03.76 and 1.0-3.98 (in blooming/fructification), with significant differences at P

Edson Henrique de, Azeredo; William Costa, Rodrigues; Paulo Cesar Rodrigues, Cassino.



Ocorrência de Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae e do predador Pentilia egena (Mulsant (Coleoptera, Coccinelidae em Myrtus communis L. (Myrtaceae, em Pinheiral, RJ Occurrence of Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae and of the predator Pentilia egena (Mulsant (Coleoptera, Coccinelidae on Myrtus communis L. (Myrtaceae, in Pinheiral County, Rio de Janeiro, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1 M. communis pode ser indicada como planta isca; (2 esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3 a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4 a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação, com diferenças significativas em PThe evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 965 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1 M. communis may be indicated as plant bait; (2 this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3 the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4 the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases and 1.03.76 and 1.0-3.98 (in blooming/fructification, with significant differences at P< 0.01.

Edson Henrique de Azeredo



Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

Márla Maria, Marchetti; Noeli Juarez, Ferla.



Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil Diversity and population fluctuation of mites (Acari in blackberry (Rubus fruticosus, Rosaceae in the state of Rio Grande do Sul, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae, raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9% and Tetranychidae (13.9%, composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2.1% and Phytoseiidae (0.4% were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae the most common predaceous species.

Márla Maria Marchetti



Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez Ferla



Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

Noeli Juarez, Ferla; Gilberto José de, Moraes.



Contribuição ao conhecimento de alguns Ithomiidae brasileiros, predadores de Solanáceas (Lep., Rhopalocera)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english This paper is a small contribution to the knowledge of some species of brazilian Ithomiidae (Lep., Rhop.). The Author, during the year 1950, had an oportunity to study the development of the following species: Mechanitis lysimnia Fabr. Mechanitis polymnia casabranca Hsch. Dircenna dero Hübn. Methona [...] themisto (Hübn.) The three first species live, in Piracicaba (State of São Paulo, Brasil), on Solanum variabile Mart., damaging its leaves, Mechanitis polymnia casàbranca being a serious enemy of this medicinal plant. The Author presents some notes on the biological cycle of M. lysimnia, which confirm D'Almeida's observations. Methona themisto is an old pest of Brunfelsia hopeana Benth. In Argentine, according to Hayward's observations, it occurs on Brunfelsia pauciflora Benth. The biology of this species previously has been studied by Figueiredo (1939). In Piracicaba it is not an enemy of B. hopeana on which it is reported to be so harmful elsewhere. The Author's observations were made in the Laboratory of Zoology of the Escola Superior de Agricultura "Luiz de Queiroz" in order to protect the larvae from the attack of their possible natural enemies. Notwithstanding, the Mechanitis polymnia casabranca caterpillars were attacked by an interesting Salticidae, identified by Hélio Camargo as Hasarius adan-soni (Audouin, 1827).

Luiz Gonzaga E., Lordello.


Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

Héctor Guerra, Hernández.



Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae)  


Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcular...




Peces del río Paraná Medio Predadores de una Especie Invasora: Limnoperna Fortunei (Bivalvia, Mytilidae)  


Limnoperna fortunei (Dunker, 1857), es hallada en Argentina en 1991, alcanzando actualmente una amplia distribución y alta densidad en la llanura aluvial del río Parana, causando problemas en instalaciones de tomas de agua de ciudades ubicadas sobre el rio. Dado el consumo de almejas autóctonas por peces de la región, se formuló la siguiente hipótesis general: Limnoperna fortunei es predada en sus distintos estadios de desarrollo por especies ícticas del rio Paraná Medio. Los objetivo...

Montalto, Luciana; Oliveros, Olga B.; Ezcurra Drago, Ine?s; Demonte, Lucio Danilo



Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) occurrence in Rio de Janeiro coast, Brazil  


Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia).The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and...

Oliveira, Lydia M. S.; Oshiro, Li?dia M. Y.



Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) na costa do Rio de Janeiro, Brasil / Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae) occurrence in Rio de Janeiro coast, Brazil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia). [...] Abstract in english The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia). [...

Lydia M. S., Oliveira; Lídia M. Y., Oshiro.



Diversidade de ácaros (Arachnida: Acari) em Coffea arabica L. cv. Mundo Novo, nos municípios de Jeriquara e Garça, Estado de São Paulo / Diversity of mites (Arachnida: Acari) on Coffea arabica L. cv. 'Mundo Novo' in Jeriquara and Garça counties, state of São Paulo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O presente estudo teve como objetivo caracterizar a diversidade de ácaros em cafeeiros da cultivar Mundo Novo em duas importantes regiões produtoras (Jeriquara e Garça) do Estado de São Paulo. Para tanto, foram coletadas amostras quinzenais de folhas, ramos e frutos, entre abril de 2001 e junho de 2 [...] 003, do terço médio de 10 plantas tomadas ao acaso em cada campo. De cada planta foram tomadas 12 folhas (cada uma do terceiro ou quarto par a partir da extremidade distal de um ramo), 12 ramos (25 cm apicais) e 100 frutos. Foram coletados no total 13.052 ácaros nos dois locais estudados, sendo 7.155 em Jeriquara e 5.897 em Garça. De um total de 108 espécies de ácaros coletados de plantas de café neste estudo, 45 espécies foram observadas em ambos os locais estudados, que apresentaram similaridade de 56%. O número de espécies encontradas exclusivamente em Jeriquara (47) foi aproximadamente três vezes superior ao número de espécies observadas somente em Garça (16). Em Jeriquara, a diversidade foi maior tanto na superfície das folhas, quanto nas domácias, ramos e frutos. Nos dois locais estudados, Brevipalpus phoenicis (Geijskes, 1939) e Oligonychus ilicis (McGregor 1919) foram as espécies de fitófagos mais abundantes e freqüentes. Os estigmeídeos e fitoseídeos foram os ácaros predadores mais abundantes e freqüentes em ambos locais. As espécies mais abundantes e freqüentes de predadores foram Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970 e Euseius concordis (Chant 1959) em Jeriquara; e Z. malvinae, E. citrifolius e E. concordis em Garça. Abstract in english The objective of this study was to characterize the diversity of mites on coffee plants of the Mundo Novo cultivar in two important coffee producing areas (Jeriquara and Garça) in the state of São Paulo. Samples of leaves, branches and fruits were fortnightly collected, from April 2001 to June 2003, [...] from the middle third of 10 plants randomly taken from each field. Twelve leaves (each leaf from the third or forth pair from the distal part of each branch), 12 branches (apical 25 cm) and 100 fruits. A total of 13,052 specimens were collected in the two studied places, 7,155 in Jeriquara and 5,897 in Garça. From a total of 108 mite species collected from coffee plants in this study, forty five species were collected in both studied fields, which presented 56% of similarity. The number of species found exclusively in Jeriquara (47) was approximately three times higher than the number of species observed only in Garça (16). For Jeriquara, the diversity of mites on surface of leaves, as well as in domatia, and on branches and fruits was higher than for Garça. In both studied areas, Brevipalpus phoenicis (Geijskes, 1939) and Oligonychus ilicis (McGregor 1919) were the most abundant and frequent phytophagous mite species. Stigmaeids and phytoseiids were the most abundant and frequent predaceous mites in both localities. The most abundant and frequent predaceous species were Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002, Zetzellia malvinae Matioli, Ueckermann & Oliveira, 2002, Euseius citrifolius Denmark & Muma, 1970, and Euseius concordis (Chant 1959) in Jeriquara; and Z. malvinae, E. citrifolius and E. concordis in Garça.

Jeferson L. de C., Mineiro; Mário E., Sato; Adalton, Raga; Valter, Arthur; Gilberto J. de, Moraes; Fernando de O., Sarreta; Alex, Carrijo.


Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos  


A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuv...

Alves P.H.; Araújo J.V.; Guimarães M.P.; Assis R.C. L.; Sarti P.; Campos A.K.



Compatibilidade entre Beauveria bassiana e o predador Chrysoperla externa em laboratório Compatibility between Beauveria bassiana and the predator Chrysoperla externa in laboratory  


O objetivo deste trabalho foi avaliar os efeitos do fungo Beauveria bassiana sobre ovos e larvas de Chrysoperla externa. Ovos com até 24 horas de idade e insetos no 1º, 2º e 3º ínstares foram imersos em suspensões fúngicas de 1,0x10(4) a 1,0x10(8) conídios mL-1. Não houve efeito do fungo sobre a viabilidade dos ovos. Larvas de terceiro ínstar foram afetadas por B. bassiana, e as suspensões de 1,0x10(7) e 1,0x10(8) conídios mL-1 interferiram nos parâmetros avaliados.The object...

Luis Gustavo Amorim Pessoa; Ricardo Sousa Cavalcanti; Alcides Moino Júnior; Brígida de Souza



Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae) Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae)  


Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcular...




Seletividade de agroquímicos ao ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Testes de efeito adverso de agroquímicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratório, utilizando o método residual de contato com pulverização em superfície de vidro. Foram testados 42 produtos químicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reprodução do ácaro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao ácaro (combinação da mortalidade e efeito na reprodução) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram inócuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidróxido de cobre, naled, oxicloreto de cobre, óxido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao ácaro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, óleo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.



Hypoxic environments as refuge against predatory fish in the Amazonian floodplains Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas  

Directory of Open Access Journals (Sweden)

Full Text Available Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pressure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1 but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação, devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1, mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p < 0,001; gl = 1. Isto indica que ambientes com baixa concentração de oxigênio dissolvido podem de fato funcionar como locais de refúgio contra peixes piscívoros nas várzeas amazônicas.

MB. Anjos



Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae) / Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e [...] Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris. Abstract in english Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae) is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveir [...] ae (Hymenoptera: Vespidae) was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90) of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.




Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae  

Directory of Open Access Journals (Sweden)

Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae. Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90 calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris.Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveirae (Hymenoptera: Vespidae was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90 of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.




Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro Physiologic selectivity of inseticides to wasps predators of the coffee leafminer  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentrações que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae was studied, in laboratory, using 50% and 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.




Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro / Physiologic selectivity of inseticides to wasps predators of the coffee leafminer  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) em concentrações que corresp [...] ondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem. Abstract in english The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) was studied, in laboratory, using 50% and [...] 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.




Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.




Downeshela oliveirai, a new neotropical predaceous midge from northern Brazil (Diptera, Ceratopogonidae Downeshela oliveirai, uma nova espécie neotropical de ceratopogonídeo predador para a região norte do Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available A new species of Downeshelea Wirth & Grogan, 1988, D. oliveirai, is described and illustrated based on male and female characteristics. The specimens were collected in Rondônia and Pará states, northern Brazil.Uma nova espécie de Downeshelea Wirth & Grogan, 1988, D. oliveirai, é descrita e ilustrada baseada nas características dos machos e fêmeas. Os espécimes foram coletados nos estados de Rondônia e Pará, região norte do Brasil.

Maria L. Felippe-Bauer



Downeshela oliveirai, a new neotropical predaceous midge from northern Brazil (Diptera, Ceratopogonidae) Downeshela oliveirai, uma nova espécie neotropical de ceratopogonídeo predador para a região norte do Brasil  


A new species of Downeshelea Wirth & Grogan, 1988, D. oliveirai, is described and illustrated based on male and female characteristics. The specimens were collected in Rondônia and Pará states, northern Brazil.Uma nova espécie de Downeshelea Wirth & Grogan, 1988, D. oliveirai, é descrita e ilustrada baseada nas características dos machos e fêmeas. Os espécimes foram coletados nos estados de Rondônia e Pará, região norte do Brasil.

Felippe-bauer, Maria L.; Silva, Cristiane S.



Downeshela oliveirai, a new neotropical predaceous midge from northern Brazil (Diptera, Ceratopogonidae) / Downeshela oliveirai, uma nova espécie neotropical de ceratopogonídeo predador para a região norte do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Uma nova espécie de Downeshelea Wirth & Grogan, 1988, D. oliveirai, é descrita e ilustrada baseada nas características dos machos e fêmeas. Os espécimes foram coletados nos estados de Rondônia e Pará, região norte do Brasil. [...] Abstract in english A new species of Downeshelea Wirth & Grogan, 1988, D. oliveirai, is described and illustrated based on male and female characteristics. The specimens were collected in Rondônia and Pará states, northern Brazil. [...

Maria L., Felippe-Bauer; Cristiane S., Silva.



Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium  

Directory of Open Access Journals (Sweden)

Full Text Available The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control, the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000. In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (PA viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 (controle, os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000. No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P< 0,01 do que os animais dos grupos 2 e 3 e a diferença no final do experimento foi próxima de 100%. Os OPGs dos animais do grupo 4 permaneceram altos até o primeiro tratamento estratégico com ivermectina. Os resultados do grupo 1 e 4 diferiram significativamente (P< 0,05 daqueles dos grupos 2 e 3 a partir de dezembro de 2000. Concluiu-se que a aplicação de pellets de M. thaumasium nesta dosagem e periodicidade de aplicação tornaram os tratamentos anti-helmínticos desnecessários.

Jackson Victor de Araújo



Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.



Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae  

Directory of Open Access Journals (Sweden)

Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

Rodolfo Vargas Castilhos



Influência da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseídeos predadores associados / Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese [...] Abstract in english Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O.ilicis on [...] its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark & Muma, Euseius citrifolius Denmark & Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O.ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I.zuluagai and eggs and larvae by E.citrifolius was lower. For A.herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O.ilicis altogether, webbing reduced the predation potential of I.zuluagai and E. citrifolius, but not of A. herbicolus.

Renato A, Franco; Paulo R, Reis; Mauricio S, Zacarias; Daniel C, Oliveira.



Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima, respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável.

JMF. Penha



Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil / Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima [...] , respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável. Abstract in english Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and se [...] venth largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.

JMF., Penha; LAF., Mateus.



Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae  

Directory of Open Access Journals (Sweden)

Full Text Available Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A, Monacrosporium sinense (isolado SF 470, Monacrosporium appendiculatum (isolado CGI, Arthrobotrys robusta (isolado I 31, Arthrobotrys cladodes (isolado CG 719 e Duddingtonia flagrans (isolado CG 768 foram avaliados em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05 durante os cinco dias do ensaio. Estruturas reprodutivas (conídios foram encontradas em todos os isolados no quinto dia. Todos os fungos testados são promissores para serem utilizados no controle biológico de Cooperia sp. e Oesophagostomum sp., parasitos de bovinos.Six isolates of nematophagous fungi Monacrosporium thaumasium (isolate NF 34A, Monacrosporium sinense (isolate SF 470, Monacrosporium appendiculatum (isolate CGI, Arthrobotrys robusta (isolate I 31, Arthrobotrys cladodes (isolate CG 719 and Duddingtonia flagrans (isolate CG 768 were evaluated under laboratory conditions regarding the capacity to entrap infective Cooperia sp. and Oesophagostomum sp. larvae. In the in vitro tests the fungi tested were equally efficient to prey the nematodes (P<0.05 during the five days of the experiment. Reproductive structures (conidia from all isolates were visualized in 5th day. All fungal isolates were efficient in the control of bovine Cooperia sp. and Oesophagostomum sp. parasites.

J.V. Araújo



Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. / Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A), Monacrosporium sinense (isolado SF 470), Monacrosporium appendiculatum (isolado CGI), Arthrobotrys robusta (isolado I 31), Arthrobotrys cladodes (isolado CG 719) e Duddingtonia flagrans (isolado CG 768) foram avaliados [...] em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05) durante os cinco dias do ensaio. Estruturas reprodutivas (conídios) foram encontradas em todos os isolados no quinto dia. Todos os fungos testados são promissores para serem utilizados no controle biológico de Cooperia sp. e Oesophagostomum sp., parasitos de bovinos. Abstract in english Six isolates of nematophagous fungi Monacrosporium thaumasium (isolate NF 34A), Monacrosporium sinense (isolate SF 470), Monacrosporium appendiculatum (isolate CGI), Arthrobotrys robusta (isolate I 31), Arthrobotrys cladodes (isolate CG 719) and Duddingtonia flagrans (isolate CG 768) were evaluated [...] under laboratory conditions regarding the capacity to entrap infective Cooperia sp. and Oesophagostomum sp. larvae. In the in vitro tests the fungi tested were equally efficient to prey the nematodes (P

J.V., Araújo; R.C.L., Assis; A.K., Campos; M.A., Mota.



Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937)  


A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuv...

Alves, P. H.; Arau?jo, J. V.; Guimara?es, M. P.; Assis, R. C. L.; Sarti, P.; Campos, A. K.



Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

Marcos Zatti da Silva



Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae) Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae)  


Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) was investigated on ovary activation in this predator. The nymphs received topical application of permethrin in the following concentrations (mg a.i./ml): 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg ma...

Lemos, W. P.; Medeiros, R. S.; Zanuncio, J. C.; Serra?o, J. E.



Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados  

Energy Technology Data Exchange (ETDEWEB)

Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail:; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail:; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail:; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)



ClEST cluster :Cl_singleton1806 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton1806 traf3 -interacting protein 1 Cimex lectularius nuclear gene 414 GCACCAAAACCAAGAG ... AGAAGGTATACAGCAGTTAACTAGAGCGACGAACCCTCTG mb01023 1 TRAF3 -interacting protein 1 [Camponotus floridanus] EFN7 ...


ClEST cluster :Cl_singleton2329 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton2329 long-chain fatty acid ... transport protein 4 Cimex lectularius nuclear gene 469 CT ... TAGCACAAGTGTTCCATAATGCT mb23072 1 Long-chain fatty acid ... transport protein 4 [Camponotus floridanus] EFN719 ...


ClEST cluster :Cl_singleton0472 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...


ClEST cluster :Cl_singleton1196 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_singleton1196 presenilin ... homolog Cimex lectularius nuclear gene 413 ATTCGTAGGTTTATCTCAAAGAAAA ... TATCGCTCTGCTTATTGGTCGTCGTAGCTACAATGAACAA fw02039 1 Presenilin -like protein [Camponotus floridanus] EFN66569 4.29 ...


ClEST cluster :Clmt_contig0038 [ClEST  

Lifescience Database Archive (English)

Full Text Available Clmt_contig0038 mitochondrial processing peptidase beta subunit mitochondrial gene 572 TGGCAGATT ... subunit beta [Camponotus floridanus] EFN65875 1.2E-90 ... GO:0005875 GO:0008121 GO:0008270 GO:0005750 GO:003 ...


O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.



Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural  


The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when predators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens a...

Ma, Medeiros; Pa, Ribeiro; Hc, Morais; Castelo Branco, M.; Er, Sujii; Ml, Salgado-laboriau



Ocorrência de Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) e do predador Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) em Myrtus communis L. (Myrtaceae), em Pinheiral, RJ Occurrence of Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) and of the predator Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) on Myrtus communis L. (Myrtaceae), in Pinheiral County, Rio de Janeiro, Brazil  


As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O) da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1) M. communis pode ser indicada como planta isca; (2) esta planta pode ser culti...

Edson Henrique de Azeredo; William Costa Rodrigues; Paulo Cesar Rodrigues Cassino



First record of Aspergillus flavus as a fungal pathogen of reduviid predator, Rhynocoris marginatus (Fab. (Hemiptera: Reduviidae  

Directory of Open Access Journals (Sweden)

Resumo. O fungo entomófago, Aspergillus flavus Raper and Fennell é registrado como um patógeno do reduviídeo predador Rhynocoris marginatus (Fab. (Hemiptera: Reduviidae, em agroecossistema natural do distrito de Tirunelveli, Tamil Nadu pela primeira vez.

Kitherian Sahayaraj



Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A.  


Abstract Background Wild birds contribute to maintenance and dissemination of vectors and microbes, including those that impact human, domestic animal, and wildlife health. Here we elucidate roles of wild passerine birds, eastern cottontail rabbits (Sylvilagus floridanus), and Ixodes dentatus ticks in enzootic cycles of two spirochetes, Borrelia miyamotoi and B. andersonii in a region of Michigan where the zoonotic pathogen B. burgdorfe...

Hamer Sarah A; Hickling Graham J; Keith Rich; Sidge Jennifer L; Walker Edward D; Tsao Jean I



NUEVOS REGISTROS DE CANGREJOS DEL GÉNERO PALICUS (PHILIPPI, 1838)(CRUSTACEA: DECAPODA: BRACHYURA: PALICIDAE) PARA EL MAR CARIBE COLOMBIANO / New records of the crabs of the genus Palicus (Philippi, 1838) (Crustacea: Decapoda: Brachyura: Palicidae) from the Caribbean coast of Colombia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish Se amplía el ámbito geográfico para Palicus floridanus y se registran por primera vez cinco especies de la familia Palicidae colectadas en el mar Caribe colombiano durante el crucero INVEMAR-Macrofauna I, entre 1998 y 1999, a lo largo de la franja superior del talud continental (300 y 500 m de profu [...] ndidad). Con las de este trabajo, en el área se han reportado seis especies: P. alternatus Rathbun, 1897; P. cursor A. Milne-Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, y P. sicus A. Milne-Edwards, 1880. En la costa caribe colombiana el único registro previo para la familia era P. alternatus. Abstract in english A new range extension of Palicus floridanus and five new records of Palicidae are presented, the samples are collected from the Colombian Caribbean coast during the cruise of INVEMAR-Macrofauna I between 1998 and 1999, along the upper continental Slope (300 and 500 m deep). Six species have now been [...] recorded from the area: P. alternatus Rathbun, 1897; P. cursor A. Milne- Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, and P. sicus A. Milne-Edwards, 1880. Previously, P. alternatus was the only member of the family reported for this area before this study.

Adriana, Bermúdez; Norella, Cruz; Gabriel R, Navas S; Hernando, Campos.



ClEST cluster :Cl_contig0419 [ClEST  

Lifescience Database Archive (English)

Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...


Tempo and mode of early gene loss in endosymbiotic bacteria from insects  


Abstract Background Understanding evolutionary processes that drive genome reduction requires determining the tempo (rate) and the mode (size and types of deletions) of gene losses. In this study, we analysed five endosymbiotic genome sequences of the gamma-proteobacteria (three different Buchnera aphidicola strains, Wigglesworthia glossinidia, Blochmannia floridanus) to test if gene loss could be driven by the selective importance of genes. We used...

Fj, Silva; Schaber J; Rispe C; Delmotte F; Moya A.



Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae  

Directory of Open Access Journals (Sweden)

Full Text Available Attack behavior of the predator Podisus rostralis (Stäl (Heteroptera: Pentatomidae adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack behavior: (1 Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2 Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl (Heteroptera: Pentatomidae tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae. Dez adultos do predador, com 24 horas de idade, foram observados durante duas horas acompanhando-se os seguintes comportamentos de ataque: (1 Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2 Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas.

Walkymário Paulo Lemos



Thermocouple design for measuring temperatures of small insects. (United States)

Contact thermocouples often are used to measure surface body temperature changes of insects during cold exposure. However, small temperature changes of minute insects can be difficult to detect, particularly during the measurement of supercooling points. We developed two thermocouple designs, which use 0.51 mm diameter or 0.127 mm diameter copper-constantan wires, to improve our ability to resolve insect exotherms. We tested the designs with adults from three parasitoid species: Tetrastichus planipennisi, Spathius agrili, and S. floridanus. These species are thermocouples than thick-gauge thermocouples for the smallest species tested, T. planipennisi. This difference was not apparent for larger species S. agrili and S. floridanus. Thermocouple design did not affect the mean supercooling point for any of the species. The cradle thermocouple design developed with the fine gauge wire was reusable and allowed for easy insect recovery after cold exposure. PMID:23812316

Hanson, A A; Venette, R C



Cortisol and aldosterone comparisons of cottontail rabbits collected by shooting, trapping, and falconry. (United States)

Cortisol and aldosterone levels were measured in plasma of eastern cottontail rabbits (Sylvilagus floridanus) collected by three different methods, i.e., shooting, live-trapping and falconry. Cortisol levels ranged from near 0 to 27.5 micrograms/100 ml and aldosterone from near 0 to 220 ng/100 ml. Shot animals had significantly lower cortisol concentrations than those taken by either of the other methods. Trapped cottontails also had significantly lower aldosterone levels. PMID:3981742

Hamilton, G D; Weeks, H P



Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB) after Fungal and Phosphoric Acid Pretreatment  


Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydra...

Taherzadeh, Mohammad J.; Cahyanto, Muhammad N.; Claes Niklasson; Ria Millati; Siti Syamsiah; Ishola, Mofoluwake M.; Isroi



Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Wernegreen Jennifer J




Directory of Open Access Journals (Sweden)

Full Text Available En este artículo se muestra la disipatividad en una clase de sistema dinámico que modela la competencia entre n especies de predadores por una presa singular que se regenera. Este resultado es una generalización de la prueba presentada en [1] para modelos n-dimensiónales con respuesta funcional tipo Holling II.






Se ha revisado la bibliografía que existe sobre Samastacus spinifrons junto a otros datos accesibles al autor, con el objetivo de actualizar el conocimiento biológico de la especie. Se analiza y se entrega información sobre: sistemática, distribución geográfica, hábitat, características fisicoquímicas del agua, variación morfológica, tamaño, relación talla-peso, biología reproductiva, estructura demográfica, migraciones, hábitos alimentarios, predadores, epibiontes, enfermedad...

Rudolph, Erich H.



Seletividade fisiológica de inseticidas aos inimigos naturais de Plutella xylostella (L.) (Lepidoptera: Plutellidae) em brássicas Insecticide physiological selectivity to natural enemies of Plutella xylostella (L.) (Lepidoptera: Plutellidae) in Brassicae  


A conservação de inimigos naturais é um componente fundamental no manejo integrado de pragas. Neste trabalho, estudou-se a seletividade de sete inseticidas usados no manejo de Plutella xylostella (L.) (Lepidoptera: Plutellidae) ao parasitóide Oomyzus sokolowskii (Kurdjumov) (Hymenoptera: Eulophidae) e aos predadores Discodon sp. (Coleoptera: Cantharidae) e Lasiochilus sp. (Hemiptera: Anthocoridae). Os organofosforados metamidofós e paratiom metílico e o carbamato carbaril foram altament...

Leandro Bacci; Marcelo Coutinho Picanço; Ézio Marques da Silva; Júlio Cláudio Martins; Mateus Chediak; Maria Elisa Sena



Ocorrência de anormalidades morfológicas externas em caranguejos marinhos (Decapoda, Brachyura) no litoral norte do Estado de São Paulo=Occurrence of external morphological abnormalities in marine crabs (Decapoda, Brachyura) from north coast of the São Paulo State  


Deformidades e anormalidades em crustáceos têm sido associadas a fatores genéticos, problemas ocorridos durante a muda, danos causados por ectobiontes, predadores ou estresse ambiental causado por produtos químicos. Espécimes de caranguejos coletados no litoral de São Paulo apresentaram anormalidades no corpo. Estes caranguejos pertencem às seguintes espécies: Callinectes ornatus (Ordway, 1863), Arenaeus cribrarius (Lamarck, 1818) e Leurocyclus tuberculosus (H. Milne Edwards & Lucas, ...

Eduardo Antonio Bolla Junior; Rafael de Rocco Gomes; José Carlos Silva; Gustavo Monteiro Teixeira; Adilson Fransozo



Fatores que afetam artrópodes associados a cinco acessos de ginseng-brasileiro (Pfaffia glomerata) em Montes Claros, Estado de Minas Gerais = Factors affecting arthropods associated with five accessions of Brazilian ginseng (Pfaffia glomerata) in Montes Claros, Brazil  


O objetivo deste trabalho foi identificar artrópodes associados a cinco acessos ('NDS', 'COVB', 'NAT', 'ROST' e 'GSD1') de Pfaffia glomerata, bem como o efeito de clima, dossel, face foliar, tricomas e inimigos naturais sobre a entomofauna. Dos artrópodes observados, Aphis gossypii (Hemiptera: Aphididae), Diabrotica speciosa (Coleoptera: Chrysomelidae) e Tetranychus ludeni (Acari: Tetranychidae) apresentaram maior densidade populacional. Dos inimigos naturais observados, ácaros predadores ...

Germano Leão Demolin Leite; Mayra Pimenta; Péricles Leonardo Fernandes; Ronnie Von Santos Veloso; Ernane Ronnie Martins



Entomofauna do amendoal em modo de produção biológico: principais espécies e sua abundância estacional.  


A produção de amêndoa em modo de produção biológico tem uma expressão significativa no norte interior de Portugal. Contudo, o conhecimento da entomofauna associada à amendoeira é muito escasso. Com o presente trabalho pretendeu-se, identificar as principais pragas e predadores, sua abundância e distribuição estacional, num amendoal em modo de produção biológico na região de Trás-os-Montes.

Pereira, J. A.; Pereira, Susana; Santos, So?nia A. P.; Bento, Albino



Exigências térmicas e tabela de vida de fertilidade de Amblyseius largoensis Thermal requirements and fertility life table of the Amblyseius largoensis  


Amblyseius largoensis (Muma) (Acari: Phytoseiidae) é uma espécie de ampla distribuição, ocorrendo em regiões tropicais e subtropicais, freqüentemente associada a plantas perenes, sendo um dos principais predadores de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro (Cocos nucifera L.). O objetivo deste trabalho foi determinar as exigências térmicas de A. largoensis alimentado com uma combinação de Tetranychus urticae Koch (Acari: Tetranychidae), pólen de Ricinus communis ...

Andréia Serra Galvão; Manoel Guedes Corrêa Gondim Junior; Gilberto José de Moraes; José Vargas Oliveira



Association between Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) and Bidens rubifolia Kunth (Asterales, Asteraceae)  


The association between the assassin bug Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) and the plant Bidens rubifolia Kunth (Asterales, Asteraceae) is related. Associação entre Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) e Bidens rubifolia Kunth (Asterales, Asteraceae) Resumo. Relata-se a associação entre o percevejo predador Zelus versicolor (Herrich-Schäffer) (Hemiptera, Reduviidae, Harpactorinae) e a planta Bidens rub...

Hélcio Gil-Santana; Ruy Alves



Zoophytophagy in predatory Hemiptera  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sob [...] re enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase) e percevejos fitófagos alimentarem de presas (peptidase). Abstract in english Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variabilit [...] y in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase) and herbivores taking prey (peptidase).

Jorge Braz, Torres; David W., Boyd.



Zoophytophagy in predatory Hemiptera  

Directory of Open Access Journals (Sweden)

Full Text Available Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variability in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase and herbivores taking prey (peptidase.Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sobre enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase e percevejos fitófagos alimentarem de presas (peptidase.

Jorge Braz Torres



Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impala [...] tabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto), somente pistas químicas (experimento de risco indireto) e ausência completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

Renan N., Costa; Fausto, Nomura.



Entomofauna em capítulos de picão-preto Entomofauna in floyer heads of common blackjack  


A ocorrência de insetos fitófagos e de himenópteros parasitóides a eles associados, presentes em capítulos de Bidens pilosa são descritas para as condições do município de Botucatu, SP. Foram encontrados predadores de sementes da ordem Diptera, pertencentes aos gêneros Dioxyna, Melanagromysa e outro não identificado. As moscas Dioxyna depositam seus ovos no interior dos aquênios em estágios iniciais de desenvolvimento, permanecendo no interior do fruto até a emergência do adult...

Maimoni-rodella, Rita C. S.; Neder, Lucia T. C.; Fidalgo, Adriana O.; Yanagizawa, Yuriko A. N. P.



Parasitism of Palmistichus elaeisis Delvare & LaSalle, 1993 on pupae of Methona themisto (Hübner, [1818]) reared on two hosts (Lepidoptera: Nymphalidae; Hymenoptera: Eulophidae)  


Estudios anteriores indicaron que las larvas de Methona themisto (Hübner, [1818]) (Lepidoptera: Nymphalidae) muestran un marcado color amarillo para evitar ser víctimas de predadores. Por añadidura estas larvas absorben compuestos secundarios al alimentarse de plantas de Brunfelsia uniflora (Pohl) D. Don (Solanaceae), aunque esto no evita que las pupas sean parasitadas por Palmistichus elaeisis Delvare & LaSalle, 1993 (Hymenoptera: Eulophidae). El objeto de este estudio era valorar en el l...

Tavares, W. S.; Hansson, C.; Mielke, O. H. H.; J. E. Serr\\u00E3o; Zanuncio, J. C.



Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) no combate à Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarandá Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda  


Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002,...

Ana Paula Félix; António Miguel Franquinho Aguiar; Celestina Brazão; Paula Rocha



Toxicidade diferencial de agrotóxicos utilizados em citros para Neoseiulus californicus, Euseius concordis e Brevipalpus phoenicis Differential toxicity of pesticides used on citrus to Neoseiulus californicus, Euseius concordis and Brevipalpus phoenicis  


Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) é considerada uma das principais pragas em citros no Brasil, devido à transmissão do vírus da leprose dos citros e à necessidade de frequentes aplicações de acaricidas para seu controle. Assim, objetivou-se comparar a toxicidade dos principais agrotóxicos utilizados em citros no Brasil, sobre populações de B. phoenicis e de ácaros predadores das espécies Neoseiuluscalifornicus (McGregor) e Euseius concordis (Chant) (Acari: Ph...

Marcos Zatti da Silva; Mário Eidi Sato; Carlos Amadeu Leite de Oliveira; Débora Soller Rais



Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae  


Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do pre...

Leandro Bacci; Picanc?o, Marcelo C.; Marcos Rafael Gusmão; Barreto, Robert W.; Tederson Luiz Galvan



Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas  


Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do pre...

Bacci Leandro; Picanço Marcelo C.; Gusmão Marcos Rafael; Barreto Robert W.; Galvan Tederson Luiz



Las arañas en agroecosistemas: bioindicadores terrestres de calidad ambiental  


Las arañas son predadores generalistas en ecosistemas terrestres, ampliamente utilizadas en estudios de biodiversidad. En el último siglo, el paisaje de Uruguay se transformó en un mosaico de áreas formadas por ambientes naturales y agroecosistemas. ¿Qué nivel de cambio se espera hallar en la comunidad de arañas si las áreas de estudio están próximas? ¿Qué porcentaje de especies nativas serán reemplazadas con la plantación? ¿Cómo afecta esto a la biodiversidad local? Se realiz...

Miguel Simó; Álvaro Laborda; Carolina Jorge; Manuel Castro



Predação de sementes de plantas daninhas em áreas cultivadas Weed seeds predation in cultivaded fields  


Na investigação das relações ecológicas entre as espécies, observou-se que certos animais, principalmente insetos, alimentavam-se de sementes de plantas daninhas antes e depois da sua deiscência, reduzindo a entrada de sementes no banco de sementes do solo e, portanto, a quantidade total de propágulos disponíveis à germinação. Em situações favoráveis à atividade dos predadores, o consumo de sementes pode ser significativo, chegando a 90% do total de sementes produzidas. Esse p...

Alvadi Antonio Balbinot Jr; Nilson Gilberto Fleck; Dirceu Agostinetto; Mauro Antonio Rizzardi



Espécies de formigas que interagem com as sementes de Mabea fistulifera Mart. (Euphorbiaceae) Interaction between ant species and seeds of Mabea fistulifera Mart. (Euphorbiaceae)  


As formigas, quando atraídas por um apêndice nutritivo, produzido na semente de certas plantas, podem exercer o papel de agente predador ou dispersor das sementes. No processo de dispersão, grande número desses insetos pode interagir com sementes de determinada planta. O objetivo deste trabalho foi identificar as espécies de formigas em contato com sementes de Mabea fistulifera Mart. - uma espécie arbórea e colonizadora em áreas antrópicas no Brasil - e o tipo de interação desses i...

Ethel Fernandes de Oliveira Peternelli; Terezinha Maria Castro Della Lucia; Sebastião Venâncio Martins



Predação de sementes de plantas daninhas em áreas cultivadas  


Na investigação das relações ecológicas entre as espécies, observou-se que certos animais, principalmente insetos, alimentavam-se de sementes de plantas daninhas antes e depois da sua deiscência, reduzindo a entrada de sementes no banco de sementes do solo e, portanto, a quantidade total de propágulos disponíveis à germinação. Em situações favoráveis à atividade dos predadores, o consumo de sementes pode ser significativo, chegando a 90% do total de sementes produzidas. Esse p...

Balbinot Jr. Alvadi Antonio; Fleck Nilson Gilberto; Agostinetto Dirceu; Rizzardi Mauro Antonio



Un modelo trófico preliminar del ecosistema pelágico del norte de Chile (18°20’S-24°00’S) A preliminary trophic model of the pelagic ecosystem in northern Chile (18°20’S-24°00’S)  


Se construye un modelo ecotrófico con balance de masa para cuantificar los flujos de energía/materia e interacciones tróficas en la trama trófica del ecosistema pelágico del norte de Chile, en el año 1989. El modelo incluye 13 grupos funcionales, siendo la mayoría de ellos recursos pesqueros, aunque considera especies de la fauna acompañante de la pesquería industrial de cerco, fitoplancton, zooplancton, detritos y predadores tope. Se utiliza el modelo y paquete computacional Ecopath...

Marianela Medina; Hugo Arancibia; Sergio Neira



Effect of temperature and prey in the biology of Scymnus subvillosus (Goeze) (Coleoptera: Coccinellidae)  


Scymnus subvillosus (Goeze) é um predador afidífago presente no Arquipélago dos Açores (Portugal), que ocorre em baixas densidades., recentemente, foi observado a explorar Melanaphis donacis (Passerini) em Arundo donax L. O Scymnus spp., embora menos estudadas, têm sido nos últimos anos, alvo de investigação na perspectiva da sua utilização como agentes de controlo biológico. Este estudo teve como objetivo determinar os efeitos concomitantes de quatro temperaturas constantes (15° ...

Sebastia?o, Dalila Carla Barbosa



Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera na Serra dos Carajás, Pará, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajás, Pará state, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predação e a existência de defesas contra a ação de predadores. Foi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

Cecília Lomônaco



Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds  


O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-ov...

Walter Santos Evangelista Júnior; Manoel Guedes Correa Gondim Junior; Jorge Braz Torres; Edmilson Jacinto Marques



Predação por coccinelídeos e crisopídeo influenciada pela teia de Tetranychus evansi Predation by coccinellids and chrysopid species influenced by Tetranychus evansi webbing  


O objetivo deste trabalho foi avaliar o efeito da teia produzida por Tetranychus evansi (Acari: Tetranychidae) na eficiência de predação por coccinelídeos Cycloneda sanguinea e Eriopis connexa e pelo crisopídeo Chrysoperla externa. A eficiência em predar as fêmeas de T. evansi na presença e na ausência de sua teia em discos de folhas de tomateiro com ácaros foi avaliada para cada instar das diferentes espécies de predadores. Foi observado efeito negativo da teia produzida por T. ev...

Madelaine Venzon; Felipe Lemos; Renato de Almeida Sarmento; Maria Consolação Rosado; Angelo Pallini



A protecção integrada na Universidade dos Açores. Investigação fundamental e aplicada com vista ao controlo de pragas agrícolas  


O Centro de Luta Biológica, é formado por três secções: Entomoparasitologia, Predadores Entomófagos e Entomopatologia, que desenvolvem investigação científica fundamental e aplicada, em cooperação com organismos regionais, nacionais e internacionais no âmbito de programas de luta integrada dos insectos nocivos às culturas. A partir da análise do funcionamento das biocenoses procede-se a ensaios de campo para o controlo de Mythimna unipuncta, Lobesia botrana e Ostrinia nubilal...

Tavares, Joa?o; Schanderl, Henrique; Simo?es, Nelson; Garcia, Vasco



Incremento da sirfideofauna do olival: efeito da vegetação natural no fomento da proteção biológica contra pragas da cultura  


As larvas de sirfídeo têm potencial como agentes de luta biológica e, no olival, podem ser particularmente importantes como predadores naturais de Euphyllura olivina (Costa) (algodão-da-oliveira). Os sirfídeos adultos alimentam-se de pólen, néctar e meladas, o primeiro é uma fonte de proteína, para os machos na espermatogénese e para as fêmeas na maturação dos ovários e produção de ovos e o segundo e terceiro uma fonte de energia. Assim, a implementação de recursos floristic...

Pinheiro, Lara Alina Almeida



Riscos online : uma análise compreensiva dos perfis de vulnerabilidade  


Na actual realidade social, a Internet e as novas tecnologias fazem parte constituinte do quotidiano dos adolescentes, bem como das suas interacções sociais, permitindo um alargamento não só das suas redes sociais, como também a rapidez de comunicação e informação. No entanto, o acesso desregrado a este tipo de novas tecnologias acarreta a exposição a uma multiplicidade de riscos, sendo eles, o bullying, predadores sexuais, acesso a sites de conteúdo inapropriado, fornecimento de ...

Ferreira, Fa?tima Abreu; Martins, Paula Marques; Gonc?alves, Rui Abrunhosa



Toxicidade de acaricidas a ovos e adultos de Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae) Toxicity of acaricides to eggs and adults of Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae)  


Objetivou-se, neste trabalho, avaliar o efeito de treze acaricidas sobre ovos e adultos de Ceraeochrysa cubana (Hagen, 1861). Os acaricidas foram pulverizados por meio de torre de Potter, nas concentrações recomendadas para o controle de ácaros na cultura dos citros. Os ensaios foram conduzidos sob condições controladas de 25 ± 2º C, umidade relativa de 70 ± 10% e fotofase de 12 horas. Os acaricidas não foram tóxicos ao predador em sua fase de ovo. Em relação aos adultos, o carbos...

Geraldo Andrade Carvalho; César Freire Carvalho; Márcio do Nascimento Ferreira



Parasites of cottontail rabbits of southern Illinois. (United States)

Fifteen species of parasites including Haemaphysalis leporispalustris, Ixodes dentatus, Amblyomma americanum, Cediopsylla simplex, Odontopsyllus multispinosus, Cuterebra sp., Obeliscoides cuniculi, Trichostrongylus calcaratus, Trichostrongylus affinis, Longistriata noviberiae, Dermatoxys veligera, Trichuris sp., Mosgovoyia sp., Taenia pisiformis, and Hasstilesia tricolor as well as coccidia oocysts were collected from 96 cottontail rabbits (Sylvilagus floridanus) confined to a pen in southern Illinois in 1983 and 1984. The diversity of parasites and the intensities of infections were similar to published reports on free-ranging populations. Most variations in parasite abundances were attributable to season. Few lesions were seen in association with parasitism. PMID:1491303

Lepitzki, D A; Woolf, A; Bunn, B M



Metabolic Changes in Broad Bean Infected by Botrytis fabae in Response to Mushroom Spent Straw  


Spent wheat straw (after cultivation of oyster mushroom, Pleurotus floridanus) was infested into the soil at different concentrations (1, 2, 5% w/w) to study its effect on the growth of broad bean (Vicia faba) susceptible to Botrytis fabae. In addition, the effect of spraying the plant with its water extract was also studied. In seedling stage, the non infected broad bean plants treated with 1 and 2% spent straw (ss) showed an increase in shoot length and at 5% ss as well...

Amira; El-fallal, A.; Fatma; Migahed, F.



The chemistry of antipredator defense by secondary compounds in neotropical lepidoptera: facts, perspectives and caveats  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Defesas químicas em lepidópteros contra predadores têm sido observadas desde o século XIX. O caso clássico de proteção química contra predadores é o da borboleta monarca, Danaus plexippus, cuja larva seqüestra cardenolidas de sua planta hospedeira Asclepias curassavica e transfere-as para os adultos [...] tornando-os impalatáveis para pássaros. Entretanto diversas outras substâncias podem estar envolvidas na proteção química de lepidópteros neotropicais (glicosídeos iridóides, glicosídeos cianogênicos, glicosinolatos, alcalóides pirrolizidínicos e tropânicos, ácidos aristolóquicos, inibidores de glicosidase, pirazinas). Esses compostos podem ser seqüestrados da planta hospedeira larval, obtidos de fontes vegetais visitadas por adultos ou biossintetizados de novo. Os lepidópteros conhecidos como impalatáveis para predadores vertebrados e/ou invertebrados são as borboletas Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae e Acraeinae (Nymphalidae) e mariposas Arctiidae. Entretanto informações sobre as substâncias que são responsáveis pela impalatabilidade e como elas são adquiridas nem sempre são obtidas. Esse artigo de revisão aborda principalmente observações de campo e laboratório sobre a rejeição de borboletas e mariposas neotropicais por predadores, correlações entre impalatabilidade e substâncias químicas encontradas nos insetos e bioensaios que demonstrem a atividade dessas substâncias contra predadores. Perspectivas são sugeridas para esses tópicos. Abstract in english Chemical defense against predation in butterflies and moths has been studied since nineteenth century. A classical example is that of the larvae of the monarch butterfly Danaus plexippus, which feed on leaves of Asclepias curassavica (Asclepiadaceae), sequestering cardenolides. The adults are protec [...] ted against predation by birds. Several other substances may be involved in chemical defense, such as iridoid glycosides, cyanogenic glycosides, glucosinolates, pyrrolizidine and tropane alkaloids, aristolochic acids, glycosidase inhibitors and pyrazines. The acquisition of these substances by lepidopterans can be due to sequestration from larval or adult host plants or de novo biosynthesis. Many Lepidoptera are known to be unpalatable, including the butterflies Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae and Acraeinae (Nymphalidae), and Arctiidae moths, but knowledge of the chemical substances responsible for property is often scarce. This review discusses mainly three topics: field and laboratory observations on rejection of butterflies and moths by predators, correlation between unpalatability and chemicals found in these insects, and bioassays that test the activity of these chemicals against predators. Perspectives and future directions are suggested for this subject.

José R., Trigo.



Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação  

Directory of Open Access Journals (Sweden)

Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

Cristiano S. de Azevedo



Fish ladders: safe fish passage or hotspot for predation?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results sugge

Angelo Antonio, Agostinho; Carlos Sergio, Agostinho; Fernando Mayer, Pelicice; Elineide Eugênio, Marques.



Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

Cristiano S. de, Azevedo; Robert J., Young.



Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.

Mueller Martin J



Genetically modified corn on fall armyworm and earwig populations under field conditions / Milho geneticamente modificado e sua ação sobre a lagarta-do-cartucho e tesourinha em condições de campo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se o efeito do milho geneticamente modificado MON810 sobre o inseto praga Spodoptera frugiperda (J.E. Smith) e o seu predador Doru luteipes (Scudder) em condições de campo no Brasil. As avaliações foram conduzidas em campos de milho MON810, comparadas com milho convencional com e sem aplicaç [...] ão de inseticidas, em quatro safras na região de Barretos, SP. Foram avaliados os danos de S. frugiperda em plantas e a contagem do número de lagartas de S. frugiperda e de adultos e ninfas do predador D. luteipes em plantas de milho. Verificou-se uma menor porcentagem de danos de S. frugiperda e os menores números médios de lagartas (pequenas e grandes) no milho MON810. Não foram observadas diferenças (P>0,05) entre os tratamentos na abundância do predador D. luteipes em plantas de milho. A segunda época de plantio apresentou as maiores porcentagens de danos de S. frugiperda e as menores médias do número de tesourinhas coletadas. O milho MON810 foi efetivo no controle de S. frugiperda e a abundância do predador D. luteipes foi similar nos três tratamentos, em condições de campo. Abstract in english The effects of corn MON810 on the Spodoptera frugiperda (J.E. Smith) and the earwig Doru luteipes (Scudder) were tested under field conditions in Brazil. Results from MON810 corn fields were compared with those fields of conventional corn with and without the application of insecticides in four harv [...] ests in the region of Barretos, SP. It was assessed the damage to S. frugiperda via direct counts of the number of fall armyworms and adults and nymphs of the predator D. luteipes on corn plants. The rate of S. frugiperda damage and the average numbers of larvae (large and small) were lower in the MON810 corn field relative to the control plot. There were no differences (P>0.05) between treatments regarding the predator abundance in corn plants. The second crop season ("safrinha") showed the greatest extent of S. frugiperda damage and the lowest average abundance of earwigs. MON810 was effective in controlling S. frugiperda and abundance of predator D. luteipes was similar in the three treatments under field conditions.

Marina Regina, Frizzas; Sinval, Silveira Neto; Charles Martins de, Oliveira; Celso, Omoto.



Integração da resistência de plantas e predação por Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o manejo de Schizaphis graminum (Rondani) (Hemiptera: Aphididae) em sorgo / Integration of varietal resistance and predation by Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the management of Schizaphis graminum (Rondani) (Hemiptera: Aphididae) on sorghum  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A integração entre plantas resistentes e agentes de controle biológico pode ser uma alternativa viável para o manejo do pulgão-verde, Schizaphis graminum (Rondani), na cultura do sorgo. Experimentos foram conduzidos com a finalidade de avaliar o efeito de quatro genótipos de sorgo: GR 11111 e TX 430 [...] x GR 111 (resistentes), GB 3B (moderadamente resistente), e BR 007B (suscetível), sobre o controle biológico do pulgão S. graminum realizado pelo predador Chrysoperla externa (Hagen). Para isso, avaliaram-se diferentes níveis de infestação de S. graminum, na presença e ausência do predador, em casa-de-vegetação e a viabilidade de controle de S. graminum no campo. O efeito do predador foi notado 25 dias após a infestação, proporcionando maior crescimento das plantas e menores danos. Os danos também foram menores nos genótipos resistentes e aumentaram com a elevação dos níveis de infestação, sendo menores na presença do predador C. externa. Em condições de campo, a integração dos dois métodos de controle proporcionou 83% de redução de danos, quando se utilizou o genótipo resistente TX 430 x GR 111, que foi considerado o mais promissor dentre os estudados. Abstract in english The integration of plant resistance and biological control agent can be a viable alternative to the management of the greenbug, Schizaphis graminum (Rondani), on sorghum. Experiments were conducted to evaluate the effect of four sorghum genotypes: GR 11111 and TX 430 x GR 111 (resistants), GB 3B (mo [...] derately resistant), and BR 007B (susceptible), on the biological control of S. graminum by the predator lacewing, Chrysoperla externa (Hagen). Different levels of infestation, in presence or absence of the predator were studied in greenhouse, and the viability of S. graminum control was evaluated under field conditions. The effect of the predator was observed 25 days after infestation, resulting in higher percentage of plant growth and lower damage. Damage was lower in resistant genotypes and increased with higher levels of infestation, being low in presence of predator C. externa. In field conditions, plant damage was reduced in 83%, when the genotype TX 430 x GR 111 was used in association with C. externa.

Liliane K., Figueira; Fernando M., Lara; Ivan, Cruz; José M., Waquil.





En una finca ecológica (FE) y una convencional (FC) se comparó el comportamiento de poblaciones de babosas y su relación con algunos carábidos predadores, la presencia de arvenses, prácticas agrícolas y la productividad de cuatro variedades de lechuga (

Cordoba Vargas Cindy Alexandra; León Sicard Tomás Enrique



Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model / Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predação  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Plantas em frutificação atraem visitas freqüentes de aves que comem frutos e tendem a ser manchas previsíveis para um predador. Conseqüentemente, o risco de ataque de um predador aumenta com o tempo de permanência de uma ave frugívora em uma planta com frutos. Neste estudo, testamos se espécies de a [...] ves grandes e crípticas passam mais tempo por visita de alimentação em plantas em frutificação que espécies pequenas e conspícuas. Obtivemos dados da literatura para oito espécies de plantas do Cerrado e também de observações em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae). Procuramos por uma relação positiva entre o tempo médio de visita e o comprimento total das espécies de aves, considerando a cor das espécies como uma co-variável. A duração das visitas de espécies grandes e crípticas foi maior que a duração de visitas de aves pequenas e conspícuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes são menos comuns. Aves crípticas, por sua vez, devem ser difíceis de serem detectadas por predadores e, conseqüentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provêm apoio à hipótese de que espécies de aves vulneráveis passam menos tempo forrageando em plantas com frutos. Abstract in english Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per f [...] eeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae). We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.

Igor Aurélio, Silva; Rodolfo Antônio de, Figueiredo; Dalva Maria da Silva, Matos.



Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predação  

Directory of Open Access Journals (Sweden)

Full Text Available Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per feeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae. We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.Plantas em frutificação atraem visitas freqüentes de aves que comem frutos e tendem a ser manchas previsíveis para um predador. Conseqüentemente, o risco de ataque de um predador aumenta com o tempo de permanência de uma ave frugívora em uma planta com frutos. Neste estudo, testamos se espécies de aves grandes e crípticas passam mais tempo por visita de alimentação em plantas em frutificação que espécies pequenas e conspícuas. Obtivemos dados da literatura para oito espécies de plantas do Cerrado e também de observações em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae. Procuramos por uma relação positiva entre o tempo médio de visita e o comprimento total das espécies de aves, considerando a cor das espécies como uma co-variável. A duração das visitas de espécies grandes e crípticas foi maior que a duração de visitas de aves pequenas e conspícuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes são menos comuns. Aves crípticas, por sua vez, devem ser difíceis de serem detectadas por predadores e, conseqüentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provêm apoio à hipótese de que espécies de aves vulneráveis passam menos tempo forrageando em plantas com frutos.

Igor Aurélio Silva



Dieta e dispersão de sementes por Cerdocyon thous (Linnaeus) (Carnívora, Canidae), em um fragmento florestal no Paraná, Brasil Diet and seed dispersal by Cerdocyon thous (Linnaeus) in a forest fragment in Paraná (Carnivora, Canidae)  


Embora o cachorro-do-mato, Cerdocyon thous (Linnaeus, 1706), seja um Canidae relativamente comum, não há muita informação sobre sua dieta e seu papel como dispersor de sementes nos diferentes habitats onde ocorre. O objetivo deste trabalho foi o de reportar a dieta de C. thous e sua importância como dispersor e/ou predador de sementes, e ainda testar a taxa de germinação de sementes após passar pelo trato digestório do animal. O estudo foi realizado em um fragmento (680 ha) de Flores...

Rocha, Vlamir J.; Dos Reis, Nelio R.; Sekiama, Margareth L.



Presencia de Gambusia affinis (Baird & Girard, 1853 en un humedal boscoso del Sur de Chile. Posibles implicancias sobre la fauna local de invertebrados.  

Directory of Open Access Journals (Sweden)

Full Text Available Las especies invasoras son la principal causa de pérdida debiodiversidad del planeta, producto de la depredación que afecta a la faunalocal mediante competencia, hibridación, alteración del hábitat y transmisiónde enfermedades. En este estudio se describe la posible implicancia del pezmosquito sobre la fauna de invertebrados en un humedal boscoso presente en laregión de la Araucanía, Chile. Los resultados nos indican la presencia de Gambusia affinis en todos los sitios demuestreo, destacándose su gran adaptabilidad a la temperatura y pH. El roldepredador de Gambusia affinis sobremosquitos, puede favorecer al desarrollo de sus larvas, al consumirinvertebrados predadores de éstas, influyendo en la estructura trófica de lascomunidades.

L. Parra-Coloma



Predation as a Mortality Factor in Populations of the Spittlebug, Deois flavopicta Stål (Homoptera: Cercopidae) / A Predação Como Fator de Mortalidade em Populações da Cigarrinha-das-Pastagens, Deois flavopicta Stål (Homoptera: Cercopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A cigarrinha-das-pastagens Deois flavopicta Stål é a principal praga de pastagens cultivadas nos Cerrados do Brasil Central. O inseto apresenta distribuição sazonal com três gerações anuais discretas durante a estação chuvosa (setembro-abril) e população sincronizada de ovos diapáusicos durante a es [...] tação seca (maio-agosto). Experimentos em pastagens cultivadas mostraram que predadores não-específicos foram capazes de alterar significativamente as taxas de mortalidade de ovos diapáusicos e ninfas de D. flavopicta. Predação foi um fator de mortalidade independente da densidade, reduzindo os ovos diapáusicos em aproximadamente 60% e ninfas de 20% a 47%. A taxa de mortalidade das ninfas resultante da predação não variou significativamente entre a primeira e a segunda geração anual. No entanto, a mortalidade de ninfas na terceira geração foi significativamente mais baixa, fato relacionado ao maior grau de agregação das ninfas em refúgios espaciais. Observações diretas de interações predador-presa nas pastagens sugerem que, potencialmente, as formigas representam o grupo que mais contribui para a mortalidade observada, embora esse impacto deva ainda ser verificado experimentalmente. Taxas de mortalidade mais altas em ovos e ninfas de D. flavopicta expostos aos predadores indicam que a predação pode ser um fator importante na determinação da população de adultos. Desta forma, práticas de manejo das pastagens que perturbam a comunidade de predadores podem resultar em densidades mais altas das cigarrinhas. Abstract in english The spittlebug, Deois flavopicta Stål, is the main pest in cultivated pastures of the "Cerrados" (savanna) in the central region of Brazil. The insect has three discrete generations during the rainy season (September-April) and a synchronized population of diapausing eggs during the dry season (May- [...] August). Experiments in cultivated pastures showed that nonspecific predators were able to affect significantly the mortality rates of diapausing eggs and nymphs of D. flavopicta. Predation was a density independent mortality factor that reduced diapausing eggs by approximately 60% and nymphs by 20% to 47%. The nymph mortality rate due to predation did not differ during the first and the second generations of the year. For the third generation however, the mortality rate was lower, related to a greater degree of nymphal aggregation in spatial refuges. Our direct observations indicate that among the types of predators in pastures, ants potentially make the greatest contribution to mortality, although their impact needs experimental verification. High rates of mortality of eggs and nymphs of D. flavopicta exposed to predators indicate that predation can be an important factor determining the size of adult populations. Therefore, management practices that disturb the predator community may increase the population densities of the spittlebug.




Fat body morphology of Eriopis connexa (coleoptera, coccinelidae) in function of two alimentary sources  


This work investigated the influence of two alimentary sources: aphids and mites, in the morphology of the fat body of E. connexa. Results showed that fat body cells of individuals fed with aphids presented areas more than three folds higher (511 ± 98,7µm²) than those of beetles fed with mites (162 ± 34,9µm²). Histochemical tests showed that nutrient amount stored in fat body was higher in lady-beetles fed on aphids.Joaninhas são eficazes predadores de artrópodes atuan...

Renato Almeida Sarmento; Hamilton Gomes de Oliveira; Anderson Mathias Holtz; Solange Marques da Silva; José Eduardo Serrão; Ângelo Pallini



Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas). O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus ( [...] Dallas) (Hemiptera, Pentatomidae), é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae) e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume) durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%). Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão. Abstract in english Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas). Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the inter [...] action of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas) (Hemiptera, Pentatomidae) has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v) during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20%) ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.

Walter S., Evangelista Junior; Roberta L., Santos; Jorge B., Torres; José C., Zanuncio.



Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae) em plantas hospedeiras / Feeding preference and performance of Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) among host plants  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae), caruru, Amaranthus lividus L. (Amaranthaceae) e [...] feijão, Phaseolus vulgaris L. (Fabaceae). Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos) e ganho de peso (28 a 30% do peso vivo) foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas. Abstract in english The choice between cotton, Gossypium hirsutum L. (Malvaceae), green bean, Phaseolus vulgaris L. (Fabaceae) and pigweed, Amaranthus lividus L. (Amaranthaceae) and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret) (Hemiptera, Penta [...] tomidae) adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes) and weight gain (28 to 30% of body weight) were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

Roberta R., Coelho; Antônio F. S. L., Veiga; Jorge B., Torres.


Controle de Brevipalpus phoenicis (Geijskes, 1939) e Oligonychus ilicis (McGregor, 1917) (Acari: Tenuipalpidae, Tetranychidae) em cafeeiro e o impacto sobre ácaros benéficos: II - Spirodiclofen e Azocyclotin Control of Brevipalpus phoenicis (Geijskes, 1939) and Oligonychus ilicis (McGregor, 1917) (Acari: Tenuipalpidae, Tetranychidae) in coffee plants and the impact on beneficial mites: II - Spirodiclofen and Azocyclotin  


O ácaro Brevipalpus phoenicis (Geijskes) é importante em cafeeiro (Coffea spp.) por ser o vetor do vírus da mancha-anular, doença responsável por queda de folhas e má qualidade da bebida do café, e o ácaro-vermelho Oligonychus ilicis (McGregor) por reduzir a área foliar de fotossíntese. Ácaros da família Phytoseiidae, de várias espécies, são eficientes predadores associados aos ácaros-praga. Conduziu-se este trabalho com o objetivo de estudar o controle dos ácaros-praga com s...

Paulo Rebelles Reis; Marçal Pedro Neto; Renato André Franco



New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae) alimentando-se de nectário extrafloral. A alimentação de Exoplectra miniata (Germar) em nectários extraflorais de Inga edulis Mart. foi observada em Nova Friburgo, Rio de Janeiro, Brasil. Este é o primeiro registro deste comportam [...] ento para Exoplectrini. Abstract in english New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries. Feeding by Exoplectra miniata (Germar) on extrafloral nectaries of Inga edulis Mart. was observed in Nova Friburgo, Rio de Janeiro, Brazil. This is the first record of this behavior for Exoplectrini [...] .

Lúcia M., Almeida; Geovan H., Corrêa; José A., Giorgi; Paschoal C., Grossi.



First report of Obeliscoides cuniculi in European brown hare (Lepus europaeus). (United States)

Obeliscoides cuniculi is a New World nematode parasite of the Trichostrongilidae family infecting the gastric tract of different domestic and wild Lagomorph species. This parasite is reported for the first time from a European brown hare (Lepus europaeus). The nematodes isolated from the gastro-intestinal tract were identified using the primary characteristics used to differentiate the species of this genus as adults morphology (length and thickness) and other characteristics of spicules, cervical papillae, cuticular ridges and striations. In the Italian study area, the European brown hare lives in sympatry with the eastern cottontail (Sylvilagus floridanus), species in which the nematode was previously isolated; therefore, the possibility of a cross-infestation must be considered. PMID:21484345

Tizzani, Paolo; Menzano, Arianna; Catalano, Stefano; Rossi, Luca; Meneguz, Pier Giuseppe



Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia ao longo da costa do estado do Rio de Janeiro, Brasil Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia along the coast of Rio de Janeiro State, Brazil  

Directory of Open Access Journals (Sweden)

Full Text Available In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is characterized by the dominance of Lyrodus floridanus (Bartsch, 1922; Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917 and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

Andrea de O. R. Junqueira



Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica  

Directory of Open Access Journals (Sweden)

Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la documentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.Diversity and microstructure of quitons (Mollusca: Polyplacophora from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon 1886; S. purpurascens (C.B. Adams 1845; Acanthopleura granulate (Gmelin 1791; Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893. This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889. Rev. Biol. Trop. 59 (1: 129-136. Epub 2011 March 01.

Cedar I García-Ríos



Diversidad y microestructura de quitones (Mollusca: Polyplacophora) del Caribe de Costa Rica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Costa Rica | Language: Spanish Abstract in spanish Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la do [...] cumentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon, 1886); S. purpurascens (C.B. Adams, 1845); Acanthopleura granulata (Gmelin, 1791); Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893). Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889). Abstract in english Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four coll [...] ection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulate (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). Rev. Biol. Trop. 59 (1): 129-136. Epub 2011 March 01.

Cedar I, García-Ríos; Migdalia, Álvarez-Ruiz.



Interação tritrófica entre Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), Eucalyptus e lagartas de Thyrinteina arnobia (Stoll) (Lepidoptera: Geometridae): I visitação / Tritrophic interaction: visits of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) to species of Eucalyptus Injuried by Thyrinteina arnobia (Stoll) (Lepidoptera: Geometridae) larvae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a interação tritrófica envolvendo o predador Podisus nigrispinus (Dallas) e cinco espécies de Eucalyptus injuriadas por lagartas de Thyrinteina arnobia (Stoll). P. nigrispinus visitou mais plantas de E. pellita do que de outras espécies e a área da superfície foliar mostrou ser o fator pr [...] imário (r = 0,88) envolvido na interação. A presença do herbívoro na planta induziu o maior número de visitas do predador, sugerindo uma interação entre a planta hospedeira e o herbívoro, provavelmente mediada por cairomônios. Abstract in english The tritrophic interaction among the predator bug Podisus nigrispinus (Dallas) and five species of Eucalyptus damaged by Thyrinteina arnobia (Stoll) larvae was evaluated. P. nigrispinus visited more E. pellita than the other plant species and the leaf surface area was the primary factor (r=0,88) inv [...] olved in such interaction. The presence of the herbivore on the plant elicited the highest number of visits of P. nigripinus, suggesting that there is an interaction between host plant-herbivore, problably mediated by kairomones.

Maria das G, Cavalcanti; Evaldo F., Vilela; Álvaro E., Eiras; José C., Zanuncio; Marcelo C., Picanço.



Predation on Tropidurus hispidus (Squamata: Tropiduridae) by Lasiodora klugi (Aranea: Theraphosidae) in the semiarid caatinga region of northeastern Brazil / Predação sobre Tropidurus hispidus (Squamata: Tropiduridae) por Lasiodora klugi (Aranea: Theraphosidae) na região de caatinga semiárida do nordeste do Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Um evento de predação sobre Tropidurus hispidus (Tropiduridae) pela aranha caranguejeira Lasiodora klugi (Theraphosidae) foi observado em área de caatinga arbórea no nordeste do Brasil. Artrópodes são potenciais predadores de pequenos vertebrados e pesquisadores têm relatado eventos de predação envo [...] lvendo aranhas e herpetofauna em regiões neotropicais. Portanto, a presente comunicação breve é o segundo caso de predação de aranha sobre lagartos do gênero Tropidurus no Brasil e o primeiro para as caatingas semiáridas, reforçando a argumentação de que grandes aranhas possuem um papel relevante como predadores desses animais. Abstract in english A predation event on Tropidurus hispidus (Tropiduridae) by the crab spider Lasiodora klugi (Theraphosidae) was observed in an arboreal caatinga area in northeastern Brazil. Arthropods are potential predators of small vertebrates and researchers have reported predation events involving spiders and he [...] rpetofauna in Neotropical regions. As such, the present short communication is the second case of predation of spiders on Tropidurus lizards in Brazil, and the first for the semiarid caatinga, reinforcing the argument that large spiders have relevant roles as predators of these animals.

Washington Luiz Silva, Vieira; Maria Betânia Ribeiro, Gonçalves; Rômulo Pantoja, Nóbrega.



A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates  

Directory of Open Access Journals (Sweden)

Full Text Available Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos peixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores.

Cristina Sazima



A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae) from dry forest in Brazil and new occurrence records for other Heimbrinae / Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae) de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Os limites geográficos de Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 e H. parallela Stage & Snelling, 1986 são estendidos com base no material examinado das coleções entomológicas do Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Bra [...] sil) e do Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brasil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) é descrita, ilustrada e comparada com a única espécie conhecida desse gênero, S. cordobensis Stage & Snelling, 1986. Uma chave para os gêneros de Heimbrinae e para as espécies de Symbra é fornecida. Abstract in english The geographic ranges of Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão [...] Preto, SP, Brazil) of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.

Daniell Rodrigo Rodrigues, Fernandes; Rogéria Inês Rosa, Lara; Nelson Wanderley, Perioto.



Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish  

Directory of Open Access Journals (Sweden)

Full Text Available The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medusa was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa estava sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação.

Roberta Martini Bonaldo



The glassy sweepers' way: seeking a versatile wrasse to be cleaned  

Directory of Open Access Journals (Sweden)

Full Text Available Diurnal reef fishes compose the bulk of clients that seek cleaner fishes' services, but some nocturnal species that shelter at daytime also seek the cleaners. While doing so the nocturnal clients must leave their hiding places and thus they get exposed to potential diurnal predators. We report here on the cleaning interactions between a daytime cleaner wrasse (Thalassoma noronhanum and a night time active client (Pempheris schomburgki that usually remains sheltered at daytime. We recorded P. schomburgki leaving their shelter at daytime and heading towards T. noronhanum, whenever the cleaner swam by the shelter. Since T. noronhanum is able to tend temporary cleaning station near the safety of the shelters of its clients, P. schomburgki lessens a possible risk of predation by seeking this versatile cleaner.Peixes recifais diurnos compõem a maioria dos clientes nas estações de peixes limpadores. Entretanto, algumas espécies com hábitos noturnos também procuram os peixes limpadores, ficando expostas a potenciais predadores diurnos quando precisam deixar seus abrigos. Registramos aqui as interações de limpeza entre um labrídeo diurno (Thalassoma noronhanum e um cliente com hábitos noturnos (Pempheris schomburgki, que permanece abrigado durante o dia. Esta espécie de cliente deixa seu abrigo durante o dia e nada em direção a T. noronhanum quando este limpador desloca-se próximo aos esconderijos. Uma vez que T. noronhanum é capaz de manter estações de limpeza temporárias, próximas aos abrigos dos clientes, P. schomburgki diminui uma possível exposição aos predadores quando procura esta espécie versátil de limpador.

Cristina Sazima



Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851 (Heteroptera: Pentatomidae with salt and amino acids solutions supplementary diet  

Directory of Open Access Journals (Sweden)

Full Text Available This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae. Both solutions showed deleterious effects on nymph survival, adult weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae. Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, longevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores.

Simone Patrícia Carneiro Freitas



Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851) (Heteroptera: Pentatomidae) with salt and amino acids solutions supplementary diet  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl) no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae). Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, lon [...] gevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores. Abstract in english This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae). Both solutions showed deleterious effects on nymph survival, adult [...] weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.

Simone Patrícia Carneiro, Freitas; Walter Santos, Evangelista Júnior; José Cola, Zanuncio; José Eduardo, Serrão.



Fat body morphology of Eriopis connexa (coleoptera, coccinelidae) in function of two alimentary sources  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Joaninhas são eficazes predadores de artrópodes atuando diretamente sobre certas pragas e alimentando-se de parte ou de todo o corpo da presa. Dentre os coccinelídeos, Eriopis connexa possui uma posição de destaque no controle de pulgões. Os coccinelídeos por serem predadores generalistas, apresenta [...] m uma variabilidade na escolha de presas, alimentando-se também de ácaros. No Brasil, trabalhos realizados com E. connexa, apenas relatam a sua ocorrência, sendo assim este trabalho objetivou investigar a influência de duas fontes alimentares: pulgões e ácaros, na morfologia do corpo gorduroso de E. connexa. Os resultados mostraram que as células do corpo gorduroso dos indivíduos alimentados com pulgões apresentaram áreas mais de três vezes superiores (511 ± 98,7µm²) que as das células do corpo gorduroso de indivíduos alimentados com ácaros (162 ± 34,9µm²). Além disso, testes histoquímicos demonstraram que a quantidade de nutrientes estocados no corpo gorduroso também foi superior em indivíduos alimentados com pulgões. Abstract in english This work investigated the influence of two alimentary sources: aphids and mites, in the morphology of the fat body of E. connexa. Results showed that fat body cells of individuals fed with aphids presented areas more than three folds higher (511 ± 98,7µm²) than those of beetles fed with mites (162 [...] ± 34,9µm²). Histochemical tests showed that nutrient amount stored in fat body was higher in lady-beetles fed on aphids.

Renato de Almeida, Sarmento; Hamilton Gomes de, Oliveira; Anderson Mathias, Holtz; Solange Marques da, Silva; José Eduardo, Serrão; Ângelo, Pallini.



Fat body morphology of Eriopis connexa (coleoptera, coccinelidae in function of two alimentary sources  

Directory of Open Access Journals (Sweden)

Full Text Available This work investigated the influence of two alimentary sources: aphids and mites, in the morphology of the fat body of E. connexa. Results showed that fat body cells of individuals fed with aphids presented areas more than three folds higher (511 ± 98,7µm² than those of beetles fed with mites (162 ± 34,9µm². Histochemical tests showed that nutrient amount stored in fat body was higher in lady-beetles fed on aphids.Joaninhas são eficazes predadores de artrópodes atuando diretamente sobre certas pragas e alimentando-se de parte ou de todo o corpo da presa. Dentre os coccinelídeos, Eriopis connexa possui uma posição de destaque no controle de pulgões. Os coccinelídeos por serem predadores generalistas, apresentam uma variabilidade na escolha de presas, alimentando-se também de ácaros. No Brasil, trabalhos realizados com E. connexa, apenas relatam a sua ocorrência, sendo assim este trabalho objetivou investigar a influência de duas fontes alimentares: pulgões e ácaros, na morfologia do corpo gorduroso de E. connexa. Os resultados mostraram que as células do corpo gorduroso dos indivíduos alimentados com pulgões apresentaram áreas mais de três vezes superiores (511 ± 98,7µm² que as das células do corpo gorduroso de indivíduos alimentados com ácaros (162 ± 34,9µm². Além disso, testes histoquímicos demonstraram que a quantidade de nutrientes estocados no corpo gorduroso também foi superior em indivíduos alimentados com pulgões.

Renato de Almeida Sarmento



A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae from dry forest in Brazil and new occurrence records for other Heimbrinae Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae  

Directory of Open Access Journals (Sweden)

Full Text Available The geographic ranges of Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.Os limites geográficos de Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 e H. parallela Stage & Snelling, 1986 são estendidos com base no material examinado das coleções entomológicas do Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brasil e do Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brasil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae é descrita, ilustrada e comparada com a única espécie conhecida desse gênero, S. cordobensis Stage & Snelling, 1986. Uma chave para os gêneros de Heimbrinae e para as espécies de Symbra é fornecida.

Daniell Rodrigo Rodrigues Fernandes



Energy density of freshwater Patagonian organisms / Densidad energética de los organismos Patagónicos de agua dulce  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: English Abstract in spanish La densidad energética de los organismos puede ser utilizada con distintos fines como evaluar la calidad de la dieta, comparar la importancia de distintas presas para un predador, corregir las tasas de evacuación gástrica de modelos, explicar el comportamiento de forrajeo de ciertos predadores o det [...] erminar su estado fisiológico. Consiste en un parámetro fundamental para el modelado bioenergético de ecosistemas. En este trabajo estimamos la densidad energética de los principales grupos de los ecosistemas de agua dulce de la Patagonia, incluyendo peces, crustáceos, gasterópodos, oligoquetos e insectos. Encontramos que los peces (5048-5789 Cal/g) es el grupo energéticamente más denso seguido de los insectos (5062-5232), crustáceos (3364-3994), oligoquetos (3471) y finalmente los gasterópodos (1143). Abstract in english We assessed by using a bomb calorimeter the energy density of the main species of Patagonian freshwater ecosystems, including fish, crustaceans, gastropods, oligochaetes, and insects. Fish (5048-5789 Cal/g) were the most energy density group, followed by insects (5062- 5232), crustaceans (3364-3994) [...] , oligochaetes (3471) and gastropods (1143). These data consist on the first direct energy density estimations of freshwater species and are intended as a baseline information for modelling the energy fluxes in Patagonian freshwater ecosystems.

Javier, Ciancio; Miguel, Pascual.



Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil  

Directory of Open Access Journals (Sweden)

Full Text Available The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical contact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A predator and kairomones present and B predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A predator and kairomones absent and B the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity and food (algae did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do contato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A predador e "kairomones" presentes e B predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A predador e "kairomones" ausentes e B igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica e alimento (algas não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones".

WJ. Minto



Estado actual y conservación de aves pelágicas que utilizan la plataforma continental argentina como área de alimentación / Status and conservation of pelagic birds using the Argentinean continental shelf as a foraging area  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: Spanish Abstract in spanish La importancia de la plataforma continental argentina no está solamente vinculada con su extensión sino también con su elevada productividad, lo que hace que sea utilizada como área de alimentación por un importante número y biomasa de predadores tope marinos que se reproducen en la costa y en secto [...] res insulares alejados del continente. Entre estos predadores tope, las aves pelágicas se destacan por sus extraordinarias habilidades de vuelo y sus extensos viajes de alimentación o migratorios de varios miles de kilómetros. La distribución de estas aves (y otros predadores tope marinos) a lo largo de la plataforma no es uniforme, presentando mayores concentraciones en áreas donde las características oceanográficas promueven elevadas abundancias de presas. Generalmente se observa un mayor número de individuos agregados cerca de frentes con gradientes de temperatura horizontales que sobre áreas térmicamente más homogéneas. Si bien algunas poblaciones de aves pelágicas sufren actualmente problemas relacionados con la contaminación, el disturbio humano y la degradación ambiental, los problemas de conservación más importantes parecen provenir de impactos sufridos en áreas reproductivas por la presencia de predadores introducidos y en el mar por los efectos negativos de la interacción con las pesquerías. La plataforma continental argentina tiene importancia global y juega un papel clave en el mantenimiento de aves y mamíferos marinos provenientes de regiones adyacentes y remotas. Existe una urgente necesidad de renovar la información disponible sobre la distribución de predadores tope en la plataforma para definir las áreas más importantes. El análisis combinado de esos datos con la distribución del esfuerzo pesquero y la explotación de recursos no renovables será crucial para desarrollar e implementar programas adecuados de conservación y manejo. Abstract in english The importance of the Argentinean continental shelf is not only linked with its extension but also to its high productivity. That's why this area is extensively used as foraging area by a large number and biomass of top predators both breeding in the continental shores and in islands away from the c [...] ontinent. Among these top predators, seabirds have remarkable flying abilities and perform extensive foraging and migratory trips, in the order of thousands of kilometers. The distribution of these birds (and other marine top predators) along the continental shelf is not uniform, with higher densities in those areas where the oceanographic characteristics promote prey concentration; more predators are usually aggregated close to frontal systems characterized by horizontal thermal gradients. In spite of some seabird populations currently suffering conservation problems allied with pollution, human disturbance and habitat degradation, the most important issues seem to be related to the introduction of predators in breeding areas, and to the negative effects of the interaction with fisheries. The Argentinean continental shelf has global importance and plays a key role in the maintenance of seabird and marine mammal populations, both local and those coming from adjacent and remote areas. There is an urgent need of gathering and analyzing new information on the distribution of top predators along the continental shelf in order to define important areas. The combined analysis of these data with the distribution of fishing effort and the exploitation of non renewable resources will be crucial to the adequate development and implementation of conservation and management programs.

Marco, Favero; María Patricia, Silva Rodríguez.



Fish ladders: safe fish passage or hotspot for predation?  

Directory of Open Access Journals (Sweden)

Full Text Available Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmonids during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladder environment, which is associated with injuries suffered along the ladder course and the presence of multiple predator groups with different predation strategies, transformed the fish corridor into a hotspot for predation.Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embora a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predaç??o em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil, buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003. Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às inj

Angelo Antonio Agostinho



Biological aspects and predatory capacity of Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) fed on Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) reared on cotton genotypes / Aspectos biológicos e capacidade predatória de Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) alimentado com Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) criada em genótipos de algodoeiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Plantas hospedeiras podem influenciar indiretamente as características biológicas do predador, de maneira positiva ou negativa, ressaltando assim a importância de estudos relacionando o efeito de cultivares sobre o terceiro nível trófico. Este trabalho avalia os aspectos biológicos e a capacidade pr [...] edatória de adultos de Podisus nigrispinus alimentados com lagartas de Alabama argillacea criadas em genótipos de algodoeiro. Diariamente o predador foi alimentado com lagartas de quarto ínstar criadas com folhas de algodoeiro CNPA Precoce 1 (média pilosidade), CNPA 9211-31 (alto teor de gossipol), CNPA 9211-41 (teor médio de gossipol) e GL2 GL3 (sem gossipol). Essas plantas oferecidas como alimento às lagartas não influenciaram os períodos de pré-oviposição, oviposição e pós-oviposição e a capacidade de oviposição do predador. O peso médio das fêmeas foi maior (126,2 mg) quando elas foram alimentadas com lagartas de A. argillacea criadas em folhas do genótipo GL2 GL3, em comparação com aquele (96,2 mg) de fêmeas que se alimentaram de lagartas criadas em folhas do genótipo CNPA 9211-41. A longevidade de fêmeas do predador variou de 30,7 a 31,5 dias, enquanto que a dos machos apresentou intervalo de variação de 38,0 a 66,3 dias. Fêmeas de P. nigrispinus predaram, em média, de 125,2 a 184,0 lagartas, durante a fase adulta, enquanto os machos predaram no mínimo 135,7 e no máximo 205,0 lagartas. Para o controle de A. argillacea, a utilização de plantas resistentes em associação com P. nigrispinus é viável, pois genótipos resistentes não influenciam negativamente as características biológicas do predador. Abstract in english Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus [...] adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute), CNPA 9211-31 (high gossypol level), CNPA 9211-41 (medium gossypol level) and GL2 GL3 (gossypol glandless). The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg) when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg) of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.

Terezinha Monteiro dos, Santos; Arlindo Leal, Boiça Jr..



Suitability of leguminous cover crop pollens as food source for the green lacewing Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) / Adequação do pólen de leguminosas utilizadas em adubação verde como fonte de alimento para Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A diversificação das culturas com plantas que forneçam pólen nutricionalmente adequado para predadores pode reduzir a população de pragas pelo aumento da efetividade dos predadores. Neste trabalho, avaliou-se a viabilidade nutricional de polens de leguminosas utilizadas como adubação verde, para o c [...] risopídeo Chrysoperla externa (Hagen), comumente encontrado em agroecossistemas cafeeiros. Os adubos verdes testados foram guandu e crotalária, leguminosas utilizadas em sistemas orgânicos de café. Adultos de C. externa recém-emergidos foram criados em dietas contendo pólen de guandu, de crotalária e de mamona (controle). O sucesso reprodutivo de C. externa foi avaliado nas dietas de pólen e quando mel foi adicionado ao pólen, para se verificar a necessidade do predador por fonte extra de carboidratos. A taxa de crescimento populacional do predador foi semelhante nas dietas de pólen de guandu e de crotalária. No entanto, a taxa aumentou significativamente quando mel foi adicionado às dietas. Fêmeas alimentadas com pólen de guandu e mel e com pólen de crotalária e mel tiveram crescimento superior ao das alimentadas com pólen de mamona e mel. Fêmeas alimentadas somente com pólen de mamona ou somente com mel não ovipositaram. Os polens de guandu e de crotalária foram igualmente adequados para C. externa, especialmente quando foram complementados com mel. Os resultados sugerem que para aumentar a efetividade dos predadores, os sistemas orgânicos de café deveriam ser diversificados com plantas que forneçam pólen em combinação com plantas que forneçam néctar. Abstract in english Diversification of crops with species that provide suitable pollen for predators may reduce pest population on crops by enhancing predator effectiveness. In this paper we evaluated the suitability of leguminous cover crop pollens to the predatory green lacewing Chrysoperla externa (Hagen). The preda [...] tor is commonly found in coffee agroecosystems and the plant species tested were pigeon pea and sunn hemp, which are used in organic coffee systems. Newly emerged females and males of C. externa were reared on diets containing pollen of pigeon pea, sunn hemp, or castor bean, used as a control. The reproductive success of C. externa was evaluated when females fed the pollen species and when honey was added to the diets, to verify the predator need for an extra carbohydrate source. Similar intrinsic growth rates were found for females fed on pigeon pea pollen and on sunn hemp pollen but these rates increased significantly when honey was added to the diets. Females fed with pigeon pea pollen plus honey and with sunn hemp pollen plus honey had higher intrinsic growth rates than those fed with castor bean pollen plus honey. Females fed on castor bean pollen only or on honey only, did not oviposit. Leguminous pollen species were equally suitable for C. externa especially when they were complemented with honey. The results suggest that to successfully enhance predator effectiveness, organic coffee plantation should be diversified with plant providing pollen in combination with plant providing nectar.

Madelaine, Venzon; Maria C., Rosado; Denise E., Euzébio; Brígida, Souza; José H., Schoereder.



Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) remember antipredator training? / Emas Rhea americana Linnaeus (Rheiformes, Rheidae) se lembram do treinamento anti-predação?  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas [...] em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas) e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável. Abstract in english The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 c [...] aptive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone) and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.

Cristiano S. de, Azevedo; Robert J., Young.



Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?  

Directory of Open Access Journals (Sweden)

Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

Cristiano S. de Azevedo



Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae) on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil / Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae) sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do cont [...] ato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A) predador e "kairomones" presentes e B) predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A) predador e "kairomones" ausentes e B) igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica) e alimento (algas) não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens) realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones". Abstract in english The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical co [...] ntact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A) predator and kairomones present and B) predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A) predator and kairomones absent and B) the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity) and food (algae) did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens) showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.

WJ., Minto; MS., Arcifa; A., Perticarrari.



Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi  

Directory of Open Access Journals (Sweden)

Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores Agropastoril (Agriflor, em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução.Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão das Flores Agropastoril (Agriflor, in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.




Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi / Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores A [...] gropastoril (Agriflor), em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução. Abstract in english Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão d [...] as Flores Agropastoril (Agriflor), in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.




Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato / Critical analysis of the neural systems organizing innate fear responses  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistem [...] as neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento), este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo. Abstract in english Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While th [...] ese shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing), it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

Newton Sabino, Canteras.



Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato / Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP) na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/sema [...] na), MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos) e testemunha (sem aplicação de inseticidas e fungicidas). O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) e Liriomyza spp. (Diptera: Agromyzidae) às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), seguido de T. absoluta e Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae), larvas de Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae), adultos de Staphylinidae (Coleoptera), Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera) e Phlaeothripidae (Thysanoptera). Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] e Bethylidae (Goniozus nigrifemur Ashmead), além de Diptera: Tachinidae. Abstract in english The objective of this work was to evaluate the impact of integrated pest management (IPM) in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides), [...] IPM (spraying when action thresholds were achieved), and control (no pesticide was applied). IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and Liriomyza spp. (Diptera: Agromyzidae) to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), followed by T. absoluta and Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae), Cycloneda sanguinea larva (L.) (Coleoptera: Coccinellidae), Staphylinidae adults (Coleoptera), Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera), and Phlaeothripidae (Thysanoptera). The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] and Bethylidae (Goniozus nigrifemur Ashmead), besides Tachinidae (Diptera).

Moacyr Mascarenhas Motta, Miranda; Marcelo Coutinho, Picanço; José Cola, Zanuncio; Leandro, Bacci; Ézio Marques da, Silva.



Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas / Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência tot [...] al de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas. Abstract in english This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods unde [...] r partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

Walter Santos, Evangelista Júnior; Manoel Guedes Correa, Gondim Junior; Jorge Braz, Torres; Edmilson Jacinto, Marques.



Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas.This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods under partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

Walter Santos Evangelista Júnior



Acarofauna associada a frutos de coqueiro (Cocos nucifera L.) de algumas localidades das Américas / Acarofauna associated with coconut fruits (Cocos nucifera L.) from some localities in America  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Neste trabalho foram identificados ácaros fitófagos e predadores associados a frutos de coqueiro de localidades do Brasil, Colômbia, Cuba, EUA, México e Venezuela. Foram encontradas três espécies de ácaros fitófagos (duas Eriophyidae, uma Tarsonemidae), quatro espécies de ácaros predadores (duas Asc [...] idae, duas Phytoseiidae), e duas espécies de hábito alimentar pouco conhecido (uma Eupodidae, uma Tydeidae). Aceria guerreronis Keifer (Eriophyidae) foi encontrada nas amostras de Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe e São Paulo, Brasil; e também de Cuba, EUA, México e Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) foi encontrada em amostras do Rio de Janeiro, São Paulo e Sergipe, Brasil; da Colômbia e do México. O tarsonemídeo Steneotarsonemus furcatus De Leon foi coletado em frutos provenientes de Alagoas, Minas Gerais, Rio de Janeiro e Sergipe. Os sintomas observados em frutos infestados por esses ácaros fitófagos foram descritos. As espécies de Ascidae encontradas foram Proctolaelaps longipilis Chant e Proctolaelaps sp.; e as de Phytoseiidae foram Typhlodromus (Anthoseius) ornatus (Denmark & Muma) e Typhlodromalus manihoti (Moraes). Provavelmente essas espécies de ácaros predadores foram registradas, pela primeira vez, em frutos de coqueiro, no mundo. Abstract in english Phytophagous and predatory mites associated with fruits of coconut from Brazil, Colombia, Mexico, USA and Venezuela were identified in this study. Three species of phytophagous mites (two Eriophyidae, one Tarsonemidae), four species of predatory mites (two Ascidae, two Phytoseiidae), and two species [...] with unknown feeding habit (one Eupodidae, one Tydeidae) were found. Aceria guerreronis Keifer (Eriophyidae) were found in samples from Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe and São Paulo, Brazil; and also from Cuba, Mexico, USA and Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) was found in samples from Rio de Janeiro, São Paulo and Sergipe, Brazil, from Colombia and from Mexico. The tarsonemid Steneotarsonemus furcatus De Leon was found on fruits from Alagoas, Minas Gerais, Rio de Janeiro, Sergipe, Brazil. Symptoms observed on fruits infested by these phytophagous mites were described. The Ascidae species found were Proctolaelaps longipilis Chant and Proctolaelaps sp.; and the Phytoseiidae species were Typhlodromus (Anthoseius) ornatus (Denmark & Muma) and Typhlodromalus manihoti (Moraes). For our knowledge, these predator species were registered for the first time from coconut fruits around the world.

Denise, Návia; Gilberto J. de, Moraes; Antonio C., Lofego; Carlos H.W., Flechtmann.



Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato Critical analysis of the neural systems organizing innate fear responses  

Directory of Open Access Journals (Sweden)

Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While these shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing, it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

Newton Sabino Canteras



Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo / Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fo [...] tofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as quais estavam posicionadas sobre disco foliar (4 cm) de cada cultivar ('White Reagan' e'Yellow Snowdon') em camada de ágar-água . Na avaliação da oviposição foram utilizados pecíolos de cada cultivar como substrato de oviposição e ovos de Anagasta kuehniella (Zeller, 1879) como alimento. O predador completou seu desenvolvimento alimentando-se somente de A. gossypii presente em ambas as cultivares. A duração da fase ninfal de O. insidiosus foi de 21,1 e 18,3 dias, em 'White Reagan' e 'Yellow Snowdon', respectivamente. O consumo de A. gossypii por fêmeas foi maior (P Abstract in english This work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832) feeding on Aphis gossypii Glover, 1877 as weel as its oviposition behavior on two crysanthemum cut cultivars. The trials were conducted in climatic chamber at 25±1ºC, RH 70±10% and 12h photophase. Ny [...] mphs of the predator, less than 24h old, were kept individualy in petri dishes (5cm) with 20 nymphs of A. gossypii (1st, 2nd and 3rt instars) on leaf disc (4cm) of each cultivar ("White Reagan" and "Yellow Snowdon") in a layer of agar-water (1%). Petiole of each crysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879). The predador complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on "White Reagan" and "Yellow Snowdon", respectively. The consumption of the females of O. insidiosus was higher (P

Maria da Conceição M., Soglia; Vanda Helena Paes, Bueno; Lívia Mendes, Carvalho.



Entomofauna em capítulos de picão-preto Entomofauna in floyer heads of common blackjack  

Directory of Open Access Journals (Sweden)

Full Text Available A ocorrência de insetos fitófagos e de himenópteros parasitóides a eles associados, presentes em capítulos de Bidens pilosa são descritas para as condições do município de Botucatu, SP. Foram encontrados predadores de sementes da ordem Diptera, pertencentes aos gêneros Dioxyna, Melanagromysa e outro não identificado. As moscas Dioxyna depositam seus ovos no interior dos aquênios em estágios iniciais de desenvolvimento, permanecendo no interior do fruto até a emergência do adulto. Melanagromysa localiza-se entre as flores centrais desenvolvendose externamente aos aquênios. Foram observadas oscilações cíclicas e acopladas entre as curvas de abundância dos fitófagos e dos himenópteros parasitóides.Phytophagous diptera and parasitoid hymenoptera occurence on flower heads of Bidens pilosa are related at Botucatu, SP, southeastern Brazil. Seed predators were three diptera genera, Dioxyna, Melanagromyza and an unidentified one. The larvae and pupa of Dioxyna and Melanagromyza develop inside and between the central achenes, respectively. Coupled ciclic oscillations were observed in phytophagous and parasitoid abundance.

Rita C.S. Maimoni-Rodella



Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiológica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Doru luteipes (SCUDDER, 1876) é um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservação é necessária a utilização de inseticidas seletivos a S. frugiperda e inócuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposição aos resíduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas após o tratamento. Os inseticidas foram classificados segundo índices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi inócuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposição de D. luteipes aos resíduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivência de adultos após o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram inócuos. Devido à baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservação dessa espécie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetação e campo para comprovação de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

Ana Carolina Maciel, Redoan; Geraldo Andrade, Carvalho; Ivan, Cruz; Maria de Lourdes Corrêa, Figueiredo; Rafael Braga da, Silva.



Eficiência de Chrysoperla externa (Hagen, 1861)(Neuroptera: Chrysopidae) no controle de Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) em pimentão (Capsicum annum L.) / Efficiency of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) in the Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) population reduction in sweet pepper (Capsicum annum L.)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, con [...] tendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente. Abstract in english The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs conta [...] ining 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

Leonardo Rodrigues, Barbosa; César Freire de, Carvalho; Brígida, Souza; Alexander Machado, Auad.



TANINOS CONDENSADOS DE Ephedra breana phil. -EphedraceaE-  

Directory of Open Access Journals (Sweden)

Full Text Available Este trabajo aborda el estudio de los taninos condensados (proantocianidinas de Ephedra breana Phil. Se estudiaron comparativamente los extractos metanólicos de los tallos aéreos herbáceos y lignificados. En los tallos herbáceos se determinó la presencia de prodelfinidina, que se encuentra principalmente bajo la forma de compuestos de alto peso molecular (polímeros, mientras que en los tallos lignificados se detectó proapigeninidina (una 3-desoxi-proantocianidina bajo la forma de monómero y oligómeros. Se determinaron diferencias cuali-cuantitativas cuando se compararon los tallos herbáceos y lignificados. Se considera que la elevada concentración de taninos en los tallos herbáceos constituye un posible mecanismo de defensa contra los predadores. Por otro lado, debido a su estructura química, los taninos condensados presentes en los tallos aéreos herbáceos podrían actuar, además, como agentes antioxidantes.

Rafael A. Ricco



Biologia de Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) predando Plutella xylostella (L.) (Lepidoptera: Plutellidae) / Biology of Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) Preying on Plutella x ylostella (L.) (Lepidoptera: Plutellidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) é um predador encontrado em vários agroecossistemas, predando insetos pequenos e de tegumento mole. Seu alto potencial reprodutivo e elevada capacidade de busca o tornam capazes de predar ovos e larvas de Plutella xylostella (L.) (Lepidoptera: Plu [...] tellidae) nas partes mais internas da cabeça do repolho, onde outros inimigos naturais não conseguem. Essas características podem favorecer a utilização desse predador no controle biológico dessa praga. Neste trabalho, o objetivo é avaliar o desenvolvimento, reprodução e capacidade de predação de C. claveri, quando ovos e larvas de P. xylostella foram ofertados em condições de laboratório. Foram avaliadas as seguintes dietas: 1) ovos; 2) larvas de segundo ínstar; 3) ovos + larvas de segundo ínstar. O desenvolvimento e a viabilidade das formas imaturas de C. claveri foi melhor nas dietas que continham ovos da presa. A oviposição e longevidade também foram maiores nessas dietas, independentemente da presença de larvas. Contudo, o tipo de dieta não afetou a razão sexual e o peso das larvas no oitavo dia de vida. Em média, cada larva de C. claveri foi capaz de predar 1611 ovos ou 135 larvas de segundo ínstar de P. xylostella durante seu desenvolvimento. O predador foi capaz de aumentar a população 218 vezes a cada 42 dias, alimentando-se, exclusivamente, de ovos da presa. Concluiu-se que o predador apresenta potencial para ser utilizado no controle biológico de P. xylostella. Abstract in english Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) is a predator found in several agricultural ecosystems and it preys on small and soft body insects. Its high reproductive potential and forage capacity makes it able of preying eggs and larvae of Plutella xylostella (L.) (Lepidoptera: Plutellidae) [...] internally hidden on cabbage head, where other natural enemies usually do not reach. These characteristics are important when choosing this predator to be used within biological control programs. This search evaluated the C. claveri development, reproduction, as well as the consumption of P. xylostella eggs and larvae under laboratory conditions. Therefore, it was evaluated the following diets: 1) eggs; 2) larvae of second ínstar; 3) eggs + larvae of second ínstar. The development and the viability of the immature forms of C. claveri were better in the diets containing eggs of P. xylostella. Also, the egg laying and adult longevity were greater with these diets, independently of the larvae presence. However, the diet type did not affect the sexual rate and the weight of the larvae after eight days of living. On average, each C. claveri larva was able of preying 1611 eggs or 135 second-ínstar larvae of P. xylostella during its development. The predator was able to increase its population 218 times after 42 days, feeding exclusively on P. xylostella eggs. Based on these results, this predator presents a great potential of being used within biological control programs of P. xylostella.

Mauricélia Ferreira, Almeida; Reginaldo, Barros; Manoel Guedes Corrêa, Gondim Júnior; Sérgio de, Freitas; Antônio Lourenço, Bezerra.




Directory of Open Access Journals (Sweden)

Full Text Available The present work describes biological aspects of species caught with pelagic longline off Rio Grande do Sul State, Brazil, between 30ºS to 35ºS. Results point this area as a possible feeding ground of pelagic predators like sharks, swordfish and tunas. Data revealed this area as a parturition location for females blue sharks Prionace glauca. O presente trabalho descreve aspectos da biologia das espécies capturadas com espinhel pelágico na região oceânica frente ao Estado do Rio Grande do Sul, Brasil, cobrindo a área entre 30ºS e 35ºS. Os resultados indicam o uso da área como possível sítio de alimentação para grandes predadores pelágicos como tubarões, espadartes e atuns. Os dados indicam ainda a área como um local utilizado por fêmeas de tubarão-azul Prionace glauca para o parto.




Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas / Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Der [...] maptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes), dimetoato (para adultos e ninfas de primeiro e segundo estádios), paratiom metílico (para ninfas de primeiro e terceiro estádio) e acefato (para adultos), apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae. Abstract in english The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer) (Homoptera: Aphididae) and on first, second, and third instar nymphs and adults of the Doru [...] luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes), for dimethoate (to adults and first and second instar nymphs of the predator), for methyl parathion (to first and third instar nymphs of the predator), and for acephate (to adults of the predator) showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro, Bacci; Marcelo C., Picanço; Marcos Rafael, Gusmão; Robert W., Barreto; Tederson Luiz, Galvan.



Toxicidade Diferencial de Agroquímicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro / Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroquímicos a populações de ácaros das espécies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fêmeas adult [...] as de N. californicus foram tratadas através de pulverização direta utilizando torre de Potter. O ácaro predador N. californicus mostrou tolerância igual ou superior a T. urticae a diversos produtos, em condições de laboratório. A maior diferença foi observada para o acaricida propargite, para o qual o ácaro predador mostrou-se 25,1 vezes mais tolerante que o ácaro rajado. Este fitoseídeo também se mostrou 4,7; 2,9 e 2,5 vezes mais tolerante que o ácaro rajado, a clorfenapir, fempiroximate e ciexatim, respectivamente. No teste de toxicidade residual de agroquímicos, a pulverização foi realizada em canteiros de morango. Foram coletados folíolos em diferentes períodos após a aplicação e infestados artificialmente com fêmeas adultas de N. californicus. As avaliações de mortalidade foram realizadas 48h ou 72h após a infestação. Fempiroximate, fempropatrim, dimetoato, propargite, enxofre e benomil mostraram-se inócuos a N. californicus. Clorfenapir, ciexatim e abamectim foram significativamente prejudiciais ao ácaro predador causando mortalidades iniciais entre 37,5% e 57,5%. A utilização de ácaros predadores como desta população de N. californicus, que apresenta baixa suscetibilidade a diversos agroquímicos, poderia ser muito útil em programas de manejo de T. urticae em morangueiro no Brasil Abstract in english This work aimed to evaluate the differential toxicity of pesticides to populations of the mite species Neoseiulus californicus (McGregor) and Tetranychus urticae Koch collected from commercial crops of strawberry (Fragaria sp.) in Atibaia county, State of São Paulo, Brazil. In the test of acute toxi [...] city of pesticides, adult females of N. californicus received the pesticide treatment under Potter spray tower. The predaceous mite N. californicus showed the same or higher tolerance than T. urticae to various pesticides in laboratory. The highest difference was observed to the acaricide propargite, for which the predaceous mite was 25.1 times more tolerant than the two-spotted spider mite. This phytoseiid was also 4.7, 2.9 and 2.5 times more tolerant than T. urticae to chlorfenapyr, fenpyroximate, and cyhexatin, respectively. In the test of residual toxicity of pesticides, the chemicals were sprayed on plants of strawberry in the field. Leaves were collected after different periods from the treatment and artificially infested with adult females of N. californicus. The mortality was assessed 48h or 72h after treatment. Fenpyroximate, fenpropathrin, dimethoate, propargite, sulphur, and benomyl were innocuous to N. californicus. Chlorfenapyr, cyhexatin, and abamectin were significantly harmful to the predaceous mite causing initial mortality rates between 37.5% and 57.5%. The use of predaceous mites like of this population of N. californicus, which presents low susceptibility to various pesticides can be very useful for programs of management of T. urticae on strawberry in Brazil.




Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse  

Directory of Open Access Journals (Sweden)

Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan' em casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method" e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande, e o restante incluíram F. gemina (Bagnall, Frankliniella sp., Caliothrips phaseoli (Hood e Haplothrips gowdeyi (Franklin. Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%, sendo também coletados Myzus persicae (Sulzer e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.. Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas.Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan' in commercial greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande (>90%, F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood and Haplothrips gowdeyi (Franklin were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover (>80%, Myzus persicae (Sulzer and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson, and the predators Chrysoperla sp., Cycloneda sanguinea (L. and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

Lívia Mendes Carvalho



Palm harvesting affects seed predation of Euterpe edulis, a threatened palm of the Brazilian Atlantic Forest Extração de palmito afeta a predação de sementes de Euterpe edulis, uma palmeira ameaçada da Mata Atlântica  

Directory of Open Access Journals (Sweden)

Full Text Available The palm tree Euterpe edulis is endemic to the Atlantic Forest, where it constitutes an economically important forest product. The often unplanned and illegal harvesting of palm hearts has led to drastic reductions in the populations of E. edulis in many areas where this palm used to be the dominant understorey tree species. We investigated the effects of harvesting on seed and seedling predation of E. edulis. We tested the predictions of the dominance-predation hypothesis according to which predator satiation leads to an inverse relationship between the amount of predation and the dominance of a tree species. During two consecutive years, seeds were set experimentally on an unharvested (> 250 adult palms/ha and a neighboring harvested site (few, if any, adult palms located in the Atlantic Forest of SE Brazil. Seedling mortality was studied at both sites for a six-month period in each of two consecutive years. Seed predation caused by rodents was higher at the harvested site, while insects caused more damage to seeds placed at the unharvested site. The proportion of seeds preyed upon by rodents varied annually, while insect predation did not. Seedling mortality did not differ between harvested and unharvested sites. The dominance-predation hypothesis was confirmed for generalist rodent seed predators, but not for specialist insect predators. This result shows that density-dependent mortality, not only at the individual level but also at the population-level scale, is a function of the class of predators and their types of foraging behavior.O palmito-jussara, Euterpe edulis, é uma árvore endêmica da Mata Atlântica e constitui-se em produto extrativista economicamente importante. A exploração ilegal e descuidada do palmito tem levado a drásticas reduções em suas populações ao longo de toda sua distribuição, que outrora fora abundante. Neste estudo investigamos o efeito da extração do palmito sobre a predação de suas sementes e plântulas por roedores e insetos. Especificamente, testamos a hipótese segundo a qual, em razão da saciação dos predadores, deve haver relação inversa entre a magnitude da predação sobre as sementes e a abundância da planta em determinada área. Durante dois anos consecutivos, sementes de E. edulis foram colocadas em uma área preservada (> 250 indivíduos adultos de E. edulis/ha e em uma área vizinha explorada com baixíssima densidade de plantas adultas, ambas localizadas na Mata Atlântica do Estado de São Paulo. A mortalidade das plântulas foi estudada e comparada entre ambas as áreas por um período de seis meses. A predação das sementes por roedores foi maior na área explorada que na área preservada e variou entre os anos. A predação por insetos foi maior na área preservada e não variou entre os anos. A mortalidade das plântulas foi similar em ambas as áreas. A relação inversa entre a abundância da planta e a predação de suas sementes foi confirmada para predadores generalistas (roedores, mas não para predadores especializados (insetos. Os resultados mostram que a mortalidade de sementes dependente de densidade, não apenas em nível individual, como já demonstrado, mas também em escala populacional, depende do tipo de predador considerado.

M. A. Pizo



Palm harvesting affects seed predation of Euterpe edulis, a threatened palm of the Brazilian Atlantic Forest / Extração de palmito afeta a predação de sementes de Euterpe edulis, uma palmeira ameaçada da Mata Atlântica  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O palmito-jussara, Euterpe edulis, é uma árvore endêmica da Mata Atlântica e constitui-se em produto extrativista economicamente importante. A exploração ilegal e descuidada do palmito tem levado a drásticas reduções em suas populações ao longo de toda sua distribuição, que outrora fora abundante. N [...] este estudo investigamos o efeito da extração do palmito sobre a predação de suas sementes e plântulas por roedores e insetos. Especificamente, testamos a hipótese segundo a qual, em razão da saciação dos predadores, deve haver relação inversa entre a magnitude da predação sobre as sementes e a abundância da planta em determinada área. Durante dois anos consecutivos, sementes de E. edulis foram colocadas em uma área preservada (> 250 indivíduos adultos de E. edulis/ha) e em uma área vizinha explorada com baixíssima densidade de plantas adultas, ambas localizadas na Mata Atlântica do Estado de São Paulo. A mortalidade das plântulas foi estudada e comparada entre ambas as áreas por um período de seis meses. A predação das sementes por roedores foi maior na área explorada que na área preservada e variou entre os anos. A predação por insetos foi maior na área preservada e não variou entre os anos. A mortalidade das plântulas foi similar em ambas as áreas. A relação inversa entre a abundância da planta e a predação de suas sementes foi confirmada para predadores generalistas (roedores), mas não para predadores especializados (insetos). Os resultados mostram que a mortalidade de sementes dependente de densidade, não apenas em nível individual, como já demonstrado, mas também em escala populacional, depende do tipo de predador considerado. Abstract in english The palm tree Euterpe edulis is endemic to the Atlantic Forest, where it constitutes an economically important forest product. The often unplanned and illegal harvesting of palm hearts has led to drastic reductions in the populations of E. edulis in many areas where this palm used to be the dominant [...] understorey tree species. We investigated the effects of harvesting on seed and seedling predation of E. edulis. We tested the predictions of the dominance-predation hypothesis according to which predator satiation leads to an inverse relationship between the amount of predation and the dominance of a tree species. During two consecutive years, seeds were set experimentally on an unharvested (> 250 adult palms/ha) and a neighboring harvested site (few, if any, adult palms) located in the Atlantic Forest of SE Brazil. Seedling mortality was studied at both sites for a six-month period in each of two consecutive years. Seed predation caused by rodents was higher at the harvested site, while insects caused more damage to seeds placed at the unharvested site. The proportion of seeds preyed upon by rodents varied annually, while insect predation did not. Seedling mortality did not differ between harvested and unharvested sites. The dominance-predation hypothesis was confirmed for generalist rodent seed predators, but not for specialist insect predators. This result shows that density-dependent mortality, not only at the individual level but also at the population-level scale, is a function of the class of predators and their types of foraging behavior.

M. A., Pizo; E. M., Vieira.



Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor (Acari: phytoseiidae  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulverizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The products' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

Marcos Zatti da Silva



Inseticidas seletivos à tesourinha Doru luteipes (Scudder utilizados no controle do pulgão verde em brássicas Selective insecticides to the earwing Doru luteipes (Scudder used for controlling the green peach aphid in Brassicae  

Directory of Open Access Journals (Sweden)

Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer (Homoptera: Aphididae, em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes, dimetoato (para adultos e ninfas de primeiro e segundo estádios, paratiom metílico (para ninfas de primeiro e terceiro estádio e acefato (para adultos, apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae.The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer (Homoptera: Aphididae and on first, second, and third instar nymphs and adults of the Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes, for dimethoate (to adults and first and second instar nymphs of the predator, for methyl parathion (to first and third instar nymphs of the predator, and for acephate (to adults of the predator showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

Leandro Bacci



Mite diversity on plants of different families found in the Brazilian Atlantic Forest / Diversidade de ácaros em plantas de diferentes famílias encontrada na Mata Atlântica Brasileira  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este trabalho relata a ocorrência de ácaros predominantemente predadores, fitófagos e de hábitos alimentares variados em plantas encontradas na Mata Atlântica. O objetivo foi estimar o possível papel da vegetação da Mata Atlântica como reservatório desses grupos de ácaros que são também encontrados [...] em plantas de importância agrícola. Foram tomadas amostras de 187 espécies de plantas pertencentes a 73 famílias em três tipos de vegetação da Mata Atlântica, de fevereiro de 2001 a outubro de 2002, obtendo-se o total de 2.887 ácaros pertencentes a 163 morfo-espécies de 16 famílias. A diversidade de ácaros foi alta, especialmente dos predadores; estes corresponderam a 1.562 espécimes de 92 morfo-espécies. Dentro desse grupo, Phytoseiidae representou 71% dos espécimes e 62% das morfo-espécies. Os ácaros fitófagos corresponderam a 836 espécimes de 36 espécies. Nesse grupo, a maior proporção de espécimes (61%) correspondeu aos Tenuipalpidae, enquanto a maior proporção de espécies (64%) correspondeu aos Tetranychidae. Os ácaros com hábitos alimentares variados corresponderam a 491 espécimes de 36 morfo-espécies. Dentro desse grupo, a maior proporção de espécimes (52%) correspondeu aos Ascidae e a maior proporção de morfo-espécies (42%) correspondeu aos Tydeinae (família Tydeidae). Alta abundância e riqueza de morfo-espécies de ácaros predominantemente predadores, fitófagos e de hábitos alimentares variados foram observados em 17, cinco e nove espécies de plantas, respectivamente. Os resultados obtidos sugerem a importância das plantas da vegetação estudada como reservatório de ácaros predadores. Abstract in english This work reports the occurrence of mites predominantly predatory, phytophagous and with varied feeding habits on plants of the Atlantic Forest vegetation type of the State of São Paulo. The objective was to estimate the possible role of the Atlantic Forest vegetation as reservoir of these groups of [...] mites which are also found on plants of agricultural importance. Samples were taken from 187 plant species belonging to 73 families in three vegetation types of the Atlantic Forest from February of 2001 to October of 2002. A total of 2,887 mites belonging to 163 morpho-species of 16 families were collected. Mite diversity was high, especially of predatory mites; these corresponded to 1,562 specimens of 92 morpho-species. Within this group, Phytoseiidae comprised 71% of the specimens and 62% of the morpho-species. Phytophagous mites comprised 836 specimens of 36 morpho-species. Within this group, Tenuipalpidae comprised the larger proportion of specimens (61%) whereas Tetranychidae corresponded to the larger proportion of morpho-species (64%). Mites with varied feeding habits corresponded to 491 specimens of 36 morpho-species. In this group, the larger proportion of specimens (52%) consisted of Ascidae and the larger proportion of morpho-species (42%) consisted of Tydeinae (family Tydeidae). High abundance and high morpho-species richness of mites of predominantly predatory, phytophagous and variable feeding habits were observed on 17, five and nine plant species, respectively. The results obtained suggest the importance of plants of the studied vegetation as reservoirs of predatory mites.

Tatiane M.M.G. de, Castro; Gilberto J. de, Moraes.




Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador car [...] nívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación. Abstract in english The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore [...] in freshwater communities of the South-American altiplano.

Jonathan A, Guzmán; Walter, Sielfeld.



Directory of Open Access Journals (Sweden)

Full Text Available Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador carnívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación.The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore in freshwater communities of the South-American altiplano.

Jonathan A Guzmán



Localização de presas à curta distância por Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): o papel dos aleloquímicos dos ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Acari: Tetranychidae) e da planta hospedeira, Malus domestica (Borkham) / Short-distance prey location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): the role of the allelochemicals from two phytophagous mites, Panonychus ulmi(Koch) and Tetranychus urticae Koch (Acari: Tetranychidae), and their host plant, Malus domestica (Borkham)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Para conhecer os estímulos olfativos à curta distância que Neoseiulus californicus (McGregor) usa para encontrar seu alimento, isto é, os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch, estudaram-se as respostas deste ácaro predador em relação aos aleloquímicos voláteis oriundos [...] tanto das duas espécies de presa como de sua planta hospedeira, Malus domestica (Borkham). Na extremidade de um braço da trilha em Y foi introduzido um disco de folha sadia de macieira (= controle) e na outra um dos oito tipos de estímulo (= tratamento) seguintes: 1) folha sadia, 2) folha sadia com a presa, 3) folha sadia com cairomônios da presa, 4) folha sadia com a presa e seus cairomônios, 5) folha atacada limpa, 6) folha atacada com a presa, 7) folha atacada com cairomônios da presa e 8) folha atacada com a presa e seus cairomônios. Para cada tratamento, observou-se a direção do deslocamento do ácaro predador e analisou-se sua porcentagem de resposta. Para localizar P. ulmi, N. californicus orientou-se pelos estímulos oriundos de folhas sadias com a presa e seus cairomônios (T4), folhas atacadas com cairomônios da presa (T7) e folhas atacadas com a presa e seus cairomônios (T8). Com relação a T. urticae, o ácaro predador respondeu significativamente aos estímulos oriundos de folhas sadias com cairomônios da presa (T3) e de folhas sadias com a presa e seus cairomônios (T4), assim como de todas as combinações com folhas atacadas (T5-8). Estes resultados demonstram que os voláteis emanados pelos ácaros fitófagos, por seus subprodutos e pela planta por eles atacada, em conjunto ou isoladamente, são importantes fontes de informação para N. californicus localizar T. urticae à curta distância. Por outro lado, somente a combinação de dois ou mais estímulos olfativos parece sinalizar a localização de P. ulmi para o ácaro predador, principalmente se os cairomônios de suas fezes, ovos e exúvias estiveram incluídos em tal mistura. Abstract in english To understand how Neoseiulus californicus (McGregor) locates its prey, i.e. Panonychus ulmi (Koch) and Tetranychus urticae Koch, we studied the predator's short-distance responses to the volatile allelochemicals associated with these two phytophagous mites and their host plant, Malus domestica (Bork [...] ham). At the end of one branch of a Y-shape runway we placed an uninfested apple leaf disk (= control) and, at the other end, one of the eight following types of stimulus (= treatments): 1) uninfested leaf, 2) uninfested leaf + prey, 3) uninfested leaf + prey kairomones, 4) uninfested leaf + prey + prey kairomones, 5) infested leaf, 6) infested leaf + prey, 7) infested leaf + prey kairomones, and 8) infested leaf + prey + prey kairomones. We observed the predator's searching behavior on the runway and analyzed its percentage of response to each of the above stimuli. When P. ulmi was tested, significantly more predators went to the end of the branch with uninfested leaves and prey with its kairomones (T4), infested leaves and prey kairomones (T7), and infested leaves and prey with its kairomones (T8). In relation to T. urticae, the predaceous mite showed significant responses to uninfested leaves with prey kairomones (T3) and to uninfested leaves and prey with its kairomones (T4), as well as to all infested leaf combinations (T5-8). These results indicate that the volatiles associated with the phytophagous mites, their byproducts, and the host plant, either separately or combined, play an important role on the short-distance location of T. urticae by N. californicus. On the other hand, only a combination of two or more of those stimuli appear to signal the location of nearby colonies of P. ulmi to the predaceous mite, specially when the kairomones from their feces, eggs, and exuviae are included in such blend.

Karin F.S., Collier; Álvaro E., Eiras; Gilberto S., Albuquerque; Jacquelyn L., Blackmer; Marilaine C., Araújo; Lino B., Monteiro.



Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação / Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan') em [...] casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method") e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande), e o restante incluíram F. gemina (Bagnall), Frankliniella sp., Caliothrips phaseoli (Hood) e Haplothrips gowdeyi (Franklin). Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%), sendo também coletados Myzus persicae (Sulzer) e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say) foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson) e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.). Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas. Abstract in english Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan') in commercial [...] greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande) (>90%), F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood) and Haplothrips gowdeyi (Franklin) were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover) (>80%), Myzus persicae (Sulzer) and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say) was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson), and the predators Chrysoperla sp., Cycloneda sanguinea (L.) and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

Lívia Mendes, Carvalho; Vanda Helena Paes, Bueno; Simone Martins, Mendes.


New gall midges (Diptera, Cecidomyiidae associated with two species of Eugenia (Myrtaceae Novos mosquitos de galhas (Diptera, Cecidomyiidae associadas a duas espécies de Eugenia (Myrtaceae  

Directory of Open Access Journals (Sweden)

Full Text Available Jorgenseniella eugeniae, gen. nov., sp. nov. and Dasineura marginalis, sp. nov. are described based on material obtained from leaf galls on Eugenia umbelliflora and E. rotundifolia (Myrtaceae. Illustrations of adults, immature stages and galls are given. Trotteria sp. (inquiline and Lestodiplosis sp. (predator are associated with the galling species. Ecological aspects of galls and gall midge species are also presented.Jorgenseniella eugeniae, gen. nov., sp. nov. e Dasineura marginalis, sp. nov. são descritos com base em material obtido de galhas foliares em Eugenia umbelliflora e E. rotundifolia (Myrtaceae. Ilustrações dos adultos, fases imaturas e galhas são fornecidas. Trotteria sp. (inquilino e Lestodiplosis sp. (predador estão associados com as espécies galhadoras. Aspectos ecológicos das galhas e das espécies de cecidógenos são também apresentados.

Valéria Cid Maia



New gall midges (Diptera, Cecidomyiidae) associated with two species of Eugenia (Myrtaceae) / Novos mosquitos de galhas (Diptera, Cecidomyiidae) associadas a duas espécies de Eugenia (Myrtaceae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Jorgenseniella eugeniae, gen. nov., sp. nov. e Dasineura marginalis, sp. nov. são descritos com base em material obtido de galhas foliares em Eugenia umbelliflora e E. rotundifolia (Myrtaceae). Ilustrações dos adultos, fases imaturas e galhas são fornecidas. Trotteria sp. (inquilino) e Lestodiplosis [...] sp. (predador) estão associados com as espécies galhadoras. Aspectos ecológicos das galhas e das espécies de cecidógenos são também apresentados. Abstract in english Jorgenseniella eugeniae, gen. nov., sp. nov. and Dasineura marginalis, sp. nov. are described based on material obtained from leaf galls on Eugenia umbelliflora and E. rotundifolia (Myrtaceae). Illustrations of adults, immature stages and galls are given. Trotteria sp. (inquiline) and Lestodiplosis [...] sp. (predator) are associated with the galling species. Ecological aspects of galls and gall midge species are also presented.

Valéria Cid, Maia; Pedro de Araújo Lima, Constantino; Ricardo Ferreira, Monteiro.



Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas Acarofauna in physic nut culture and associated spontaneous weeds  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas por meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos.The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

Wilton Pires da Cruz



Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas / Acarofauna in physic nut culture and associated spontaneous weeds  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas po [...] r meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos. Abstract in english The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from [...] physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

Wilton Pires da, Cruz; Renato Almeida, Sarmento; Adenir Vieira, Teodoro; Eduardo Andrea Lemus, Erasmo; Marçal, Pedro Neto; Maíra, Ignacio; Diogenis Fontenele, Ferreira Junior.



Consumo alimentar de Chrysoperla externa sobre as diferentes fases de desenvolvimento de Dysmicoccus brevipes, em laboratório / Food consumption of Chrysoperla externa in different developmental phases of Dysmicoccus brevipes, under laboratory conditions  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Estudou-se o consumo e preferência alimentar de larvas de Chrysoperla externa Hagen, 1861 (Neuroptera: Chrysopidae) em laboratório à temperatura de 25±2°C, 70±10% UR e 12 horas de fotofase, utilizando como presa a cochonilha-do-abacaxi (Dysmicoccus brevipes Cockerell, 1893, Hemiptera: Pseudococcidae [...] ). Durante a fase larval do predador foram consumidas, em média, 70, 50 e 15,8 cochonilhas do primeiro, segundo e terceiro ínstar, respectivamente, e 10 fêmeas adultas, num total de 145,8 indivíduos. Do número total de cochonilhas, 51% foram consumidos durante o terceiro ínstar do predador. O alto número de cochonilhas consumido demonstra que a C. externa apresenta potencial para ser utilizada no controle biológico da cochonilha D. brevipes. Abstract in english The food consumption and preference of larvae of Chrysoperla externa Hagen, 1861 (Neuroptera: Chrysopidae) larval were studied in laboratory under 25±2°C, 70±10% RH and 12 hours photophase, utilizing the pineapple mealybug (Dysmicoccus brevipes Cockerell, 1893, Hemiptera: Pseudococcidae) as a prey. [...] The results showed that the predator's larval phases consumed on average of 70, 50 and 15,8 mealybugs of the first, second and third instar, respectively, and 10 adult females amounting to 145,8 individuals. It was noticed that 51% of the total number of mealybugs were consumed during the predator third instar. The high number of mealybugs consumed shows that C. externa presents a potential to be utilized in biological control of the mealybug D. brevipes.

Rita de Cássia Rodrigues, Gonçalves-Gervásio; Lenira Viana Costa, Santa-Cecília.



First record of the fireworm Hermodice carunculata (Annelida, Polychaeta) preying on colonies of the fire coral Millepora alcicornis (Cnidaria, Hydrozoa) / Primeiro registro do verme de fogo Hermodice carunculata (Annelida, Polychaeta) predando colônias do coral de fogo Millepora alcicornis (Cnidaria, Hydrozoa)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese O poliqueta Hermodice carunculata é um voraz predador de vários organismos bentônicos e um dos grupos preferenciais na sua dieta é o dos cnidários. No presente trabalho se apresenta o primeiro registro de predação do verme de fogo sobre o hidrocoral Millepora alcicornis. O verme engolfa os ramos ter [...] minais do hidrocoral e fica vários minutos raspando a superfície e retirando os tecidos moles. Apesar deste hidrocoral ser um dos representantes mais comuns dos recifes do norte e nordeste brasileiros e de albergar uma vasta comunidade associada, nunca tinha sido registrada esta associação. Esta nova descoberta alerta na necessidade de se estudar esta associação já que geralmente os danos ocasionados pelo poliqueta são irreversíveis e dependendo da quantidade de predadores pode alterar a saúde dos recifes ou modificar os componentes da comunidade recifal. Abstract in english The polychaete Hermodice carunculata is a voracious predator of several benthic organisms and one of the preferential groups in its diet is that of the cnidarians. This note presents the first record of a fireworm preying on the calcified hydroid Millepora alcicornis. The fireworm engulfs the termin [...] al branches of the fire coral and spends several minutes scraping the surface and removing the soft tissues. Despite this being one of the most common calcified hydroids of the Brazilian northern and northeastern regions (and home to a vast associated community), this kind of association had never been recorded. This discovery points to the need of studying such associations because the damage caused by this polychaete is irreversible and depending on the amount of predators might alter reefs' health or modify the components of the reef community.

Carlos Daniel, Pérez; Paula Braga, Gomes.



Incidência de ácaros em cafeeiro cv. Catuaí Amarelo / Mite fauna on coffee plants cv. Catuaí Amarelo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Este trabalho teve como objetivo estudar a diversidade de ácaros presentes em cafeeiro (Coffea arabica L.), no município de Atibaia, Estado de São Paulo. O estudo foi realizado em cafeeiro cultivar Catuaí Amarelo com aproximadamente 15 anos de idade. Foram demarcadas 60 plantas na cultura, das quais [...] se coletaram folhas, ramos e frutos para a avaliação das espécies de ácaros existentes. Vinte e uma espécies de ácaros pertencentes a 14 famílias foram encontradas, sendo a maior diversidade observada nos ramos. As duas principais espécies fitófagas foram Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) e Oligonychus yothersi (McGregor) (Tetranychidae). Dentre os predadores, os ácaros da família Phytoseiidae e Bdellidae foram os mais abundantes. Iphiseiodes zuluagai Denmark & Muma foi o predador mais abundante, tanto em folhas como em ramos. Bdella sp. (Bdellidae) foi outra espécie muito abundante observada nos ramos. Abstract in english The objective of this work was to study the diversity of mites found on a coffee (Coffea arabica L.) plantation located in Atibaia County, State of Sao Paulo, Brazil. The study was carried out on a near 15 year old plantation of 'Catuaí Amarelo'. From 60 marked coffee plants, leaves, branches and be [...] rries were collected to evaluate the species of mites present on the plants. Twenty one species of mites belonging to 14 families were found. The highest diversity was observed on branches. The most abundant phytophagous species were Brevipalpus phoenicis (Geijskes) (Tenuipalpidae) and Oligonychus yothersi (McGregor) (Tetranychidae). Among the predators, the mites of the families Phytoseiidae and Bdellidae were the most abundant. The phytoseiid Iphiseiodes zuluagai Denmark and Muma predominated on leaves as well as on branches. Bdella sp. (Bdellidae) was also mostly present on branches.

Jeferson Luiz de Carvalho, Mineiro; Mário Eidi, Sato; Adalton, Raga; Miguel Francisco de, Souza Filho; Sheila, Spongoski.


The almost invisible league: crypsis and association between minute fishes and shrimps as a possible defence against visually hunting predators  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Camuflagem é um dos tipos de defesa mais bem distribuídos entre os animais que vivem no substrato, sendo a transparência geralmente encontrada em organismos pelágicos. Ambos os tipos de defesa são considerados como eficientes contra predadores visualmente orientados. Apresentamos três conjuntos de e [...] spécies de peixes e camarões de tamanhos similares, que aparentemente dependem da camuflagem e transparência para escapar de potenciais predadores. Em uma das associações, há uma transição de coloração críptica ou translúcida para transparente, de acordo com a posição que cada espécie ocupa no habitat. A semelhança entre peixes e camarões é aqui considerada como um tipo de associação protetiva, similar a mimetismo numérico ou social. Além disso, sugerimos que o conjunto pode conter elementos similares ao mimetismo Batesiano. Abstract in english Camouflage is one of the most widespread defence modes used by substrate-dwelling animals, whereas transparency is generally found in open-water organisms. Both these defence types are regarded as effective against visually guided predators. We present here three assemblages of similarly-sized fresh [...] water fish and shrimp species which apparently rely on camouflage and transparency to evade some of their potential predators. In one of the associations, there is a transition from cryptic colours and translucency to transparency of the component species according to the position each of them occupies in the habitat. The likeness between the fishes and the shrimps is here regarded as a type of protective association similar to numerical or social mimicry. Additionally, we suggest that the assemblage may contain Batesian-like mimicry components.

Lucélia Nobre, Carvalho; Jansen, Zuanon; Ivan, Sazima.



Feeding of Acestrorhynchus lacustris (Characidae: a post impoundment studies on Itaipu reservoir, upper Paraná River, PR  

Directory of Open Access Journals (Sweden)

Full Text Available With objective to know feeding spectrum of Acestrorhynchus lacustris (Reinhardt, 1874, a middle size predator in different places of influence area of Itaipu reservoir, stomach contents were analyzed. Samples were collected from March 1984 to February 1989 from Itaipu Reservoir and its adjacent areas. Its fed mainly on fishes, but it was an opportunistic (consumed 17 species of prey. Despite of the wide feeding spectrum, few preys were dominant in the diet, according to the different habitats sampled. As a result, it significant spatial differences in the diet was observed. Was observed through "Detrented Correspondence Analysis" (DCA these were divided into three groups in relation with diet: preys from upstream, with higher scores; preys from the reservoir, with intermediate scores; and preys from a tributary with smaller scores. This discrimination may be a function of prey availability in each habitat. The mean size of preys consumed increased with the size of the predator, as well as the variance, i. e. the largest fish also consumed small preys.Com o objetivo de conhecer o espectro alimentar de Acestrorhynchus lacustris (Reinhardt, 1874, um predador de médio porte, em diferentes locais da área de influência do reservatório de Itaipu, foram analisados conteúdos estomacais coletados no período de março/84 a fevereiro/89. Os dados evidenciaram tratar-se de uma espécie exclusivamente piscívora, porém oportunista, visto que consumiu 17 espécies de peixes-presa. Apesar do amplo espectro alimentar, poucas presas se destacaram nos distintos ambientes amostrados, resultando em diferenças significativas entre suas dietas. A análise de correspondência (DCA discriminou espacialmente três grupos; montante, com maiores escores; reservatório, com valores intermediários e tributário com menores valores, provavelmente em função dos tipos de presas disponíveis em cada ambiente. O tamanho das presas ingeridas aumenta com o crescimento do predador, porém os maiores exemplares não descartam peixes de pequeno porte de sua dieta.

Norma Segatti Hahn




Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish El control biológico a través de predadores es observado como una alternativa promisoria al control químico de plagas. Phytoseiulus macropilis se ha encontrado asociado a poblaciones del ácaro rayado Tetranychus urticae en plantaciones de fresa en el estado de Minas Gerais, Brasil. En este trabajo s [...] e evaluó a través de experimento de olfatometria los efectos subletales de la azadirachtina sobre la capacidad de P. macropilis en detectar volátiles de plantas de fresa infestadas con T. urticae. Los resultados muestran que el ácaro predador P. macropilis puede diferenciar entre olores de plantas de fresa no atacadas y plantas de fresa atacadas por T. urticae. La azadirachtina en la concentración de 0,31 mg i.a/L no interfirió en la respuesta olfativa de P. macropilis alimentado de presas asperjadas. Abstract in english The biological control through predators is seen as a promising alternative to chemical insect pest control. Phytoseiulus macropilis has been found associated with populations of the striped mite, Tetranychus urticae in strawberry plantations in the state of Minas Gerais, Brazil. In this work, the s [...] ublethal effects of azadirachtina on the natural ability of P. macropilis to detect volatile compounds from strawberry plants infested with T. urticae was evaluated by using olfactometry assays. The results show that P. macropilis predatory mite can distinguish odors from non-attacked strawberry plants and those from strawberry plants attacked by T. urticae. Azadirachtina at a concentration of 0.31 mg i.a/L did not interfere in the olfactory response of P. macropilis fed with sprinkled striped mites.

Alberto, Soto G; Angelo, Pallini; Lemos, Felipe.



Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) no combate à Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarandá / Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda  

Scientific Electronic Library Online (English)

Full Text Available SciELO Portugal | Language: Portuguese Abstract in portuguese Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. [...] insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina está a ser criado em laboratório e largado em jacarandás infestados com o objectivo de combater a cochonilha-dojacarandá através da luta biológica clássica. Referem-se as largadas de H. pantherina e o sistema de monitorização adoptado para verificar a aclimatação do predador. Abstract in english The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal), are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Fürsch, was [...] imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

Ana Paula, Félix; António Miguel Franquinho, Aguiar; Celestina, Brazão; Paula, Rocha.



Acción de los cebos granulados sobre los invertebrados edáficos / Effects of granulated baits on soil invertebrates  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: Spanish Abstract in spanish Los cebos granulados en base a Metaldehído y/o Carbaryl son utilizados para el control de babosas (Mollusca: Pulmonata) y bicho bolita (Crustacea: Isopoda). Sin embargo, es escasa la información sobre el efecto que causan sobre la abundancia de los grupos funcionales. En este trabajo se evaluó el ef [...] ecto de los cebos Dual Acay (Metaldehído 4%+Carbaryl 8%), Molusquicida Acay y Clartex (Metaldehído 4 y 5%), MataBibos Acay y Clartex BB (Carbaryl 8%) sobre los detrítivoros, predadores, herbívoros y omnívoros a los 7, 10, 23 y 37 días después de la aplicación de los cebos (DDA). Los detritívoros no difirieron entre los tratamientos a los 7, 10, 23 y 37 DDA (p> 0,05). Los predadores a los 7 y 23 DDA no mostraron diferencias (p> 0,05) en cambio, sí a los 10 y 37 DDA (p 0,05), mientras que, sí a los 23 y 37 DDA (p Abstract in english Granulated baits based on Metaldehyde and/or Carbaryl are used for the control of slugs (Mollusca: Pulmonata) and woodlices (Crustacea: Isopoda). However, the information on the effect that they cause on abundance of functional groups is scarce. In this study, the effect of Dual Acay baits (Metaldeh [...] yde 4%+Carbaryl 8%), Molluscicide Acay and Clartex (Metaldehyde 4 and 5%), MataBibos BB Acay and Clartex BB (Carbaryl 8%) was evaluated on the following functional groups: detritivores, predators, herbivores and omnivores 7, 10, 23 and 37 days after bait application (DAA). Detritivores did not differ between treatments at 7, 10, 23 and 37 DAA (p> 0.05). Predators 7 and 23 DAA showed no differences (p> 0.05); however, at 10 and 37 DAA an increase in the number of spiders was observed respect to carabids (p 0.05); whereas, 23 and 37 DDA significant differences were observed (p

Carla, Salvio; Pablo Luis, Manetti; Natalia Liliana, Clemente; Alicia Noemí, López.



First report of interaction of nematophagous fungi on Libyostrongylus douglassii (Nematoda: Trichostrongylidae Primeiro relato da interação de fungos nematófagos sobre Libyostrongylus douglassii (Nematoda: Trichostrongilidae  

Directory of Open Access Journals (Sweden)

Full Text Available Libyostrongylus douglassii is a gastrointestinal nematode parasite of ostriches that can cause up to 50% mortality in young birds. The objective of this study was to compare the predatory capacity of two isolates of the predatory fungi Duddingtonia flagrans (AC001 and CG722 isolates and one of Arthrobotrys cladodes (CG719 on infective larvae (L3 of L. douglassii under laboratory conditions, in 2% water-agar medium. The results showed that the fungi tested were effective in preying upon the L3 of L. douglassii (P 0.05 during the seven days of experimental testing. In comparison with the control, without fungus, there were significant decreases (P Libyostrongylus douglassii é um nematóide parasito gastrintestinal de avestruzes que pode causar até 50% de mortalidade em aves jovens. O objetivo deste trabalho foi comparar a capacidade predatória de dois isolados de fungos predadores Duddingtonia flagrans (isolados AC001 e CG722 e um Arthrobotrys cladodes (CG719 sobre larvas infectantes (L3 de L. douglassii em condições laboratoriais, em meio ágar–água 2%. Os resultados demonstraram que os fungos testados foram eficientes em predar as L3 de L. douglassii (P 0,05 durante os sete dias do ensaio experimental. Em comparação ao controle, sem fungo, houve uma redução significativa (P < 0,05 de 85,2% (AC001; 81,2% (CG722 e 89,2% (C719 na média de L3 recuperadas nas placas do grupo tratado com os isolados testados. No presente trabalho, os três isolados de fungos predadores D. flagrans (AC001 e CG722 e A. cladodes (CG719 foram eficientes na destruição in vitro das L3 de L. douglassii.

Fabio Ribeiro Braga



Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa esta [...] va sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação. Abstract in english The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami) associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medus [...] a was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.

Roberta Martini, Bonaldo; João Paulo, Krajewski; Ivan, Sazima.



The glassy sweepers' way: seeking a versatile wrasse to be cleaned  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Peixes recifais diurnos compõem a maioria dos clientes nas estações de peixes limpadores. Entretanto, algumas espécies com hábitos noturnos também procuram os peixes limpadores, ficando expostas a potenciais predadores diurnos quando precisam deixar seus abrigos. Registramos aqui as interações de li [...] mpeza entre um labrídeo diurno (Thalassoma noronhanum) e um cliente com hábitos noturnos (Pempheris schomburgki), que permanece abrigado durante o dia. Esta espécie de cliente deixa seu abrigo durante o dia e nada em direção a T. noronhanum quando este limpador desloca-se próximo aos esconderijos. Uma vez que T. noronhanum é capaz de manter estações de limpeza temporárias, próximas aos abrigos dos clientes, P. schomburgki diminui uma possível exposição aos predadores quando procura esta espécie versátil de limpador. Abstract in english Diurnal reef fishes compose the bulk of clients that seek cleaner fishes' services, but some nocturnal species that shelter at daytime also seek the cleaners. While doing so the nocturnal clients must leave their hiding places and thus they get exposed to potential diurnal predators. We report here [...] on the cleaning interactions between a daytime cleaner wrasse (Thalassoma noronhanum) and a night time active client (Pempheris schomburgki) that usually remains sheltered at daytime. We recorded P. schomburgki leaving their shelter at daytime and heading towards T. noronhanum, whenever the cleaner swam by the shelter. Since T. noronhanum is able to tend temporary cleaning station near the safety of the shelters of its clients, P. schomburgki lessens a possible risk of predation by seeking this versatile cleaner.

Cristina, Sazima; João Paulo, Krajewski; Roberta Martini, Bonaldo; Ivan, Sazima.



Predação por coccinelídeos e crisopídeo influenciada pela teia de Tetranychus evansi / Predation by coccinellids and chrysopid species influenced by Tetranychus evansi webbing  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi avaliar o efeito da teia produzida por Tetranychus evansi (Acari: Tetranychidae) na eficiência de predação por coccinelídeos Cycloneda sanguinea e Eriopis connexa e pelo crisopídeo Chrysoperla externa. A eficiência em predar as fêmeas de T. evansi na presença e na ausên [...] cia de sua teia em discos de folhas de tomateiro com ácaros foi avaliada para cada instar das diferentes espécies de predadores. Foi observado efeito negativo da teia produzida por T. evansi na eficiência de predação do segundo e do terceiro instar de C. externa. Quanto à E. connexa, somente a predação pelo último instar foi influenciada negativamente pela presença da teia. A predação pelas larvas de primeiro e terceiro instar de C. sanguinea foi significativamente menor na presença da teia; no entanto, o resultado foi contrário para o quarto instar. O efeito da teia de T. evansi como mecanismo de defesa varia conforme a espécie e o estágio de desenvolvimento do predador. Abstract in english The aim of this work was to evaluate the effect of the webbing produced by Tetranychus evansi (Acari: Tetranychidae) on the predation efficiency of Cycloneda sanguinea and Eriopis connexa coccinellids and of the Chrysoperla externa chrysopid. The predation efficiency on T. evansi females with and wi [...] thout webbing on tomato leaf discs was evaluated for each juvenile stage of the different predator species tested. There was a negative effect of T. evansi webbing on the predation efficiency of the second and third C. externa juvenile stages. Regarding E. connexa, only the predation by the oldest juvenile stage was negatively affected by the webbing. The predation efficiency of the first and the third juvenile stages of C. sanguinea was lower in the presence of webbing, but the opposite was observed for the fourth stage. The defensive role of T. evansi webbing varies according to the predator species and their developmental stage.

Madelaine, Venzon; Felipe, Lemos; Renato Almeida, Sarmento; Maria Consolação, Rosado; Angelo, Pallini.



Predação por coccinelídeos e crisopídeo influenciada pela teia de Tetranychus evansi Predation by coccinellids and chrysopid species influenced by Tetranychus evansi webbing  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi avaliar o efeito da teia produzida por Tetranychus evansi (Acari: Tetranychidae na eficiência de predação por coccinelídeos Cycloneda sanguinea e Eriopis connexa e pelo crisopídeo Chrysoperla externa. A eficiência em predar as fêmeas de T. evansi na presença e na ausência de sua teia em discos de folhas de tomateiro com ácaros foi avaliada para cada instar das diferentes espécies de predadores. Foi observado efeito negativo da teia produzida por T. evansi na eficiência de predação do segundo e do terceiro instar de C. externa. Quanto à E. connexa, somente a predação pelo último instar foi influenciada negativamente pela presença da teia. A predação pelas larvas de primeiro e terceiro instar de C. sanguinea foi significativamente menor na presença da teia; no entanto, o resultado foi contrário para o quarto instar. O efeito da teia de T. evansi como mecanismo de defesa varia conforme a espécie e o estágio de desenvolvimento do predador.The aim of this work was to evaluate the effect of the webbing produced by Tetranychus evansi (Acari: Tetranychidae on the predation efficiency of Cycloneda sanguinea and Eriopis connexa coccinellids and of the Chrysoperla externa chrysopid. The predation efficiency on T. evansi females with and without webbing on tomato leaf discs was evaluated for each juvenile stage of the different predator species tested. There was a negative effect of T. evansi webbing on the predation efficiency of the second and third C. externa juvenile stages. Regarding E. connexa, only the predation by the oldest juvenile stage was negatively affected by the webbing. The predation efficiency of the first and the third juvenile stages of C. sanguinea was lower in the presence of webbing, but the opposite was observed for the fourth stage. The defensive role of T. evansi webbing varies according to the predator species and their developmental stage.

Madelaine Venzon



Custo da produção de Orius insidiosus como agente de controle biológico Production cost of Orius insidiosus as biological control agent  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi estimar o custo de produção por indivíduo do predador Orius insidiosus (Say, levando-se em consideração um modelo de criação em laboratório. Nos cálculos, considerou-se uma produção de 33.000 percevejos mês-1, dos quais 14,5% foram para manutenção da criação e o restante, ou seja, 28.272 indivíduos, para comercialização. Os preços dos materiais e equipamentos utilizados na criação foram cotados em dólares americanos na proporção de R$ 2,84 por US$ 1,00. O custo estimado de cada percevejo predador foi da ordem de US$ 0,069, levando-se em consideração custos fixos e variáveis. Este custo é um parâmetro decisivo na criação massal de Orius insidiosus e em sua utilização como agente de controle em programas de controle biológico de tripes.The objective of this work was to estimate the individual production cost of the predator Orius insidiosus (Say in laboratory. A rearing model of O. insidiosus in laboratory was used to reach production of 33,000 individuals month-1, using 14.5% to maintain the predator rearing in the laboratory and 28,272 individuals for commercialization. The prices of different materials and equipments used on predator rearing were fixed at US$ 1.00 = R$ 2.84. The estimated cost for production of each adult predator was US$ 0.069, taking all the fixed and variable costs. This parameter is crucial to support O. insidiosus mass rearing, and to use this predator as biocontrol agent in biological control program of thrips.

Simone Martins Mendes



Custo da produção de Orius insidiosus como agente de controle biológico / Production cost of Orius insidiosus as biological control agent  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi estimar o custo de produção por indivíduo do predador Orius insidiosus (Say), levando-se em consideração um modelo de criação em laboratório. Nos cálculos, considerou-se uma produção de 33.000 percevejos mês-1, dos quais 14,5% foram para manutenção da criação e o restan [...] te, ou seja, 28.272 indivíduos, para comercialização. Os preços dos materiais e equipamentos utilizados na criação foram cotados em dólares americanos na proporção de R$ 2,84 por US$ 1,00. O custo estimado de cada percevejo predador foi da ordem de US$ 0,069, levando-se em consideração custos fixos e variáveis. Este custo é um parâmetro decisivo na criação massal de Orius insidiosus e em sua utilização como agente de controle em programas de controle biológico de tripes. Abstract in english The objective of this work was to estimate the individual production cost of the predator Orius insidiosus (Say) in laboratory. A rearing model of O. insidiosus in laboratory was used to reach production of 33,000 individuals month-1, using 14.5% to maintain the predator rearing in the laboratory an [...] d 28,272 individuals for commercialization. The prices of different materials and equipments used on predator rearing were fixed at US$ 1.00 = R$ 2.84. The estimated cost for production of each adult predator was US$ 0.069, taking all the fixed and variable costs. This parameter is crucial to support O. insidiosus mass rearing, and to use this predator as biocontrol agent in biological control program of thrips.

Simone Martins, Mendes; Vanda Helena Paes, Bueno; Lívia Mendes, Carvalho; Ricardo Pereira, Reis.



Efeito do manejo de plantas daninhas sobre Neoseiulus californicus (Acari:Phytoseiidae) em pomar de macieira / Effect of weed management on Neoseiulus californicus (Acari:Phytoseiidae) in apple orchard  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Avaliou-se a influência do manejo de plantas daninhas sobre o deslocamento de ácaros tetraniquídeos (Panonychus ulmi e Tetranychus urticae) e do ácaro predador Neoseiulus californicus em um pomar de macieira 'Gala', onde foi implantado o controle biológico do ácaro vermelho, P. ulmi, por meio de lib [...] erações massais de N. californicus. As parcelas tiveram as plantas daninhas manejadas de três formas: sem manejo, com roçadas manuais e com herbicidas. As populações de ácaros foram avaliadas sobre as plantas daninhas, Plantago tormentosa e Erigeron sp, e sobre as folhas de macieira. As maiores populações de N. californicus foram observadas nas parcelas onde os manejos proporcionaram desenvolvimento de plantas daninhas na linha de plantio. Na parcela manejada com herbicida, houve maior população de ácaros tetraniquídeos sobre as macieiras, provavelmente, devido ao reduzido número de N. californicus. P. tormentosa foi o hospedeiro preferencial do ácaro predador. Concluiu-se que o manejo de plantas daninhas, na linha de plantio das macieiras, assume um importante papel no equilíbrio entre as populações de ácaros. Abstract in english The influence of weed management on tetranychid mites (Panonychus ulmi and Tetranychus urticae) and phytoseids movement was evaluated. Neoseiulus californicus populations were released in an apple orchard for biological control of tetranychid mites. Three kinds of weed management were used: no weed [...] control at all, manual control and control with herbicide. The mites were evaluated in Plantago tormentosa, Erigeron sp, and apple tree leaves. The highest population of N. californicus was observed where weed was not controlled. Tetranychid mites populations were abundant on apple trees when herbicide was used, probably due to the low population of N. californicus. P. tormentosa was the preferred host of phytoseids. The conclusion was that weed management plays an important role in the regulation of mite species in apple orchards.

Lino Bittencourt, Monteiro; Luiz, Belli; Alexander de, Souza; André Luiz, Werner.



Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae) on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae) parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae) / Desenvolvimento ninfal e preferência alimentar de Podisus maculiventris (Heteroptera: Pentatomidae) em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae) parasitados ou não por Trichogramma brassicae (Hymenoptera: Trichogrammatidae)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Avaliou-se a predação de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa) ou não por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos às ninfas de P. maculiventris como alimento. Esse Pentatomidae só atingiu a fase [...] adulta quando se alimentou de ovos não parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criação desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estádio. Em teste de escolha, ninfas desse predador mostraram preferência por ovos não parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que é possível associar o uso de P. maculiventris com liberações de T. brassicae em programas de controle de lepidópteros pragas, Abstract in english Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae), parasitised or not by Trichogramma brassicae (pupae stage). Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventr [...] is as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that it is possible to combine the use of P. maculiventris with releases of T. brassicae in control programs of lepidopteran pests.

H. N., Oliveira; P., De Clercq; J. C., Zanuncio; D., Pratissoli; E. P., Pedruzzi.
