
Sample records for predadores agistemus floridanus

  1. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  2. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.


    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  3. Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Matioli, Andre L. [Instituto Biologico, Campinas, SP (Brazil). Lab. de Entomologia Economica], e-mail:; Pallini, Angelo [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal], e-mail:; Tavares, Mara G. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral], e-mail:


    Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute ({+-} 360 {mu}m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

  4. Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil

    International Nuclear Information System (INIS)

    Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 ?m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

  5. Replication of the Endosymbiotic Bacterium Blochmannia floridanus Is Correlated with the Developmental and Reproductive Stages of Its Ant Host


    Wolschin, Florian; Hölldobler, Bert; Gross, Roy; Zientz, Evelyn


    The dynamics of replication of the intracellular endosymbiotic bacterium Blochmannia floridanus was determined during the larval development of its host ant Camponotus floridanus by real-time quantitative PCR. The bacteria were found to proliferate during pupation and immediately after the eclosion of the imagines (adult ants). In older workers the number of bacteria present in the midgut bacteriocytes decreased significantly. In contrast, the bacterial population in the ovaries was dependent...

  6. Reproductive biology and adaptability of the invasive alien freshwater Amphipod Crangonyx floridanus (Crustacea: Amphipoda, Crangonyctidae). (United States)

    Tojo, Koji; Tanaka, Yoshiki; Kuranishi, Ryoichi B; Kanada, Shoji


    We studied the reproductive biology and adaptability of the alien freshwater crangonyctid amphipod Crangonyx floridanus, currently inhabiting a large portion of Japan, both in the field and under controlled laboratory conditions. In the Chikuma River population of this alien amphipod, egg-bearing individuals were found throughout the year. In terms of egg maturation cycle, egg development (during embryogenesis), and egg count per ovipositional cycle, these amphipods display a very efficient reproductive system. This study also established their adaptability to a wide range of water temperatures (primarily 4-20 degrees C, however in some cases, these individuals are able to survive at up to 30 degrees C). C. floridanus's strong capacity to adapt to broad and variable environmental conditions is certainly contributing to its high rate of population increase, and rapid dispersion throughout Japan. PMID:20528160

  7. Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus

    Directory of Open Access Journals (Sweden)

    Moya Andres


    Full Text Available Abstract Background There is an increasing interest to better understand endosymbiont capabilities in insects both from an ecological point of view and for pest control. Blochmannia floridanus provides important nutrients for its host, the ant Camponotus, while the bacterium in return is provided with a niche to proliferate. Blochmannia floridanus proteins and metabolites are difficult to study due to its endosymbiontic life style; however, its complete genome sequence became recently available. Results Improved sequence analysis algorithms, databanks and gene and pathway context methods allowed us to reveal new information on various enzyme and pathways from the Blochmannia floridanus genome sequence [EMBL-ID BX248583]. Furthermore, these predictions are supported and linked to experimental data for instance from structural genomics projects (e.g. Bfl341, Bfl 499 or available biochemical data on proteins from other species which we show here to be related. We were able to assign a confirmed or at least a putative molecular function for 21 from 27 previously conserved hypothetical proteins. For 48 proteins of 66 with a previous putative assignment the function was further clarified. Several of these proteins occur in many proteobacteria and are found to be conserved even in the compact genome of this endosymbiont. To extend and re-test predictions and links to experimentally verified protein functions, functional clusters and interactions were assembled. These included septum initiation and cell division (Bfl165, Bfl303, Bfl248 et al.; translation; transport; the ubiquinone (Bfl547 et al., the inositol and nitrogen pathways. Conclusion Taken together, our data allow a better and more complete description of the pathway capabilities and life style of this typical endosymbiont.

  8. Analysis of and function predictions for previously conserved hypothetical or putative proteins in Blochmannia floridanus (United States)

    Gaudermann, Peter; Vogl, Ina; Zientz, Evelyn; Silva, Francisco J; Moya, Andres; Gross, Roy; Dandekar, Thomas


    Background There is an increasing interest to better understand endosymbiont capabilities in insects both from an ecological point of view and for pest control. Blochmannia floridanus provides important nutrients for its host, the ant Camponotus, while the bacterium in return is provided with a niche to proliferate. Blochmannia floridanus proteins and metabolites are difficult to study due to its endosymbiontic life style; however, its complete genome sequence became recently available. Results Improved sequence analysis algorithms, databanks and gene and pathway context methods allowed us to reveal new information on various enzyme and pathways from the Blochmannia floridanus genome sequence [EMBL-ID BX248583]. Furthermore, these predictions are supported and linked to experimental data for instance from structural genomics projects (e.g. Bfl341, Bfl 499) or available biochemical data on proteins from other species which we show here to be related. We were able to assign a confirmed or at least a putative molecular function for 21 from 27 previously conserved hypothetical proteins. For 48 proteins of 66 with a previous putative assignment the function was further clarified. Several of these proteins occur in many proteobacteria and are found to be conserved even in the compact genome of this endosymbiont. To extend and re-test predictions and links to experimentally verified protein functions, functional clusters and interactions were assembled. These included septum initiation and cell division (Bfl165, Bfl303, Bfl248 et al.); translation; transport; the ubiquinone (Bfl547 et al.), the inositol and nitrogen pathways. Conclusion Taken together, our data allow a better and more complete description of the pathway capabilities and life style of this typical endosymbiont. PMID:16401340

  9. Eimeria azul sp. n. (protozoa: Eimeriidae) from the eastern cottontail, Sylvilagus floridanus, in Pennsylvania. (United States)

    Wiggins, J P; Rothenbacher, H


    Eimeria azul sp. n. is described from the cottontail rabbit, Sylvilagus floridanus, in central Pennsylvania. The oval oocysts are 19.5--27.0 micrometer by 15.0--19.0 (mean - 22.9 X 16.7 micrometer). The fusiform sporocysts are 7.8--14.0 micrometer by 3.3--6.5 micrometer (mean = 11.8 X 5.8 micrometer). A Stieda Body is present. There is no micropyle, oocyst residuum or polar granule. The sporocyst has a residuum which is variable in appearance. The oocysts are characterized by a blue tint when viewed with an apochromatic objective lens. PMID:480068

  10. Bacteriocyte dynamics during development of a holometabolous insect, the carpenter ant Camponotus floridanus

    Directory of Open Access Journals (Sweden)

    Fraunholz Martin J


    Full Text Available Abstract Background The carpenter ant Camponotus floridanus harbors obligate intracellular mutualistic bacteria (Blochmannia floridanus in specialized cells, the bacteriocytes, intercalated in their midgut tissue. The diffuse distribution of bacteriocytes over the midgut tissue is in contrast to many other insects carrying endosymbionts in specialized tissues which are often connected to the midgut but form a distinct organ, the bacteriome. C. floridanus is a holometabolous insect which undergoes a complete metamorphosis. During pupal stages a complete restructuring of the inner organs including the digestive tract takes place. So far, nothing was known about maintenance of endosymbionts during this life stage of a holometabolous insect. It was shown previously that the number of Blochmannia increases strongly during metamorphosis. This implicates an important function of Blochmannia in this developmental phase during which the animals are metabolically very active but do not have access to external food resources. Previous experiments have shown a nutritional contribution of the bacteria to host metabolism by production of essential amino acids and urease-mediated nitrogen recycling. In adult hosts the symbiosis appears to degenerate with increasing age of the animals. Results We investigated the distribution and dynamics of endosymbiotic bacteria and bacteriocytes at different stages during development of the animals from larva to imago by confocal laser scanning microscopy. The number of bacteriocytes in relation to symbiont-free midgut cells varied strongly over different developmental stages. Especially during metamorphosis the relative number of bacteria-filled bacteriocytes increased strongly when the larval midgut epithelium is shed. During this developmental stage the midgut itself became a huge symbiotic organ consisting almost exclusively of cells harboring bacteria. In fact, during this phase some bacteria were also found in midgut cells other than bacteriocytes indicating a cell-invasive capacity of Blochmannia. In adult animals the number of bacteriocytes generally decreased. Conclusions During the life cycle of the animals the distribution of bacteriocytes and of Blochmannia endosymbionts is remarkably dynamic. Our data show how the endosymbiont is retained within the midgut tissue during metamorphosis thereby ensuring the maintenance of the intracellular endosymbiosis despite a massive reorganization of the midgut tissue. The transformation of the entire midgut into a symbiotic organ during pupal stages underscores the important role of Blochmannia for its host in particular during metamorphosis.

  11. Invasive species and their parasites: eastern cottontail rabbit Sylvilagus floridanus and Trichostrongylus affinis (Graybill, 1924) from Northwestern Italy. (United States)

    Tizzani, P; Catalano, S; Rossi, L; Duignan, P J; Meneguz, P G


    The eastern cottontail Sylvilagus floridanus is a native American lagomorph. Within the genus Sylvilagus, the eastern cottontail is the species with the widest distribution. From 1950s, the species was introduced to several European countries. A rapid territorial expansion of the introduced eastern cottontails has been observed in many areas of Italy. The eastern cottontail has been demonstrated to play a main role as carrier of exotic parasites. To date, three nematode species, exotic in Italian ecosystems, have been reported from introduced S. floridanus. However, its parasite fauna biodiversity is richer in native populations of the American continent. The aim of this work was to further investigate the gastrointestinal parasites of S. floridanus, to evaluate the potential presence of other exotic species. During 2010, 101 hosts were examined, and three nematodes were collected from their digestive tract. Two parasite species (Obeliscoides cuniculi, Trichostrongylus calcaratus) were already reported in Italy; the isolation of Trichostrongylus affinis is instead the first report of this nematode in Italy and in Europe as a whole. This study wants to highlight the great risks related to the introduction of allochthonous species. The impact of the invasion by alien animal species may be particularly severe for public and animal health, due to the potential introduction of new pathogens. The good number of exotic parasites found in introduced eastern cottontails, together with the few sanitary surveys carried out, suggests that an epidemiological survey, with specimens from multiple localities on a wider geographic range, could lead to interesting findings on parasites of native and alien lagomorphs in Europe. PMID:24481904

  12. Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus). (United States)

    Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric


    Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization. PMID:25047482

  13. Evaluation of the eastern cottontail Sylvilagus floridanus as an amplifying vertebrate host for Cache Valley virus (Bunyaviridae) in Indiana. (United States)

    Blackmore, Carina G M; Grimstad, Paul R


    To evaluate the importance of eastern cottontails (Sylvilagus floridanus) as amplifying hosts for Cache Valley virus (CVV), we tested hunter-provided blood samples from northern Indiana for specific neutralizing (N) antibodies against this mosquito-borne bunya-virus. Samples were collected during the winter of 1994-95. Two seronegative eastern cottontails, captured in July 1995, were also infected with CVV by subcutaneous inoculation, and two others were infected by allowing CVV-infected mosquitoes to feed on them. The results indicate that eastern cottontails probably are not important amplifying hosts for CVV. The prevalence of N antibodies against CVV was low (6.0%, n=82) among the hunter-killed animals. Low viremia (CVV. PMID:18263839

  14. Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação


    Campos Artur Kanadani; Mota Marcelo de Andrade; Araújo Jackson Victor; Cecon Paulo Roberto


    Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente...

  15. Local feeding specialization of the red fox (Vulpes vulpes) in response to eastern cottontail (Sylvilagus floridanus) introduction (NW Italy)


    Alessandro Balestrieri; Luigi Remonti; Claudio Prigioni


    Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus) on the food habits of the red fox (Vulpes vulpes), between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115) in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989). Comparison included also the diet of badgers (...

  16. Caracterización del comportamiento y las señales vibratorias en Euthyrhynchus floridanus (Hemiptera: Pentatomidae) durante el cortejo y la cópula / Characterization of the behavioral and vibrational signals in Euthyrhynchus floridanus (Hemiptera: Pentatomidae) during courtship and copulation

    Scientific Electronic Library Online (English)

    R. Daniel, Briceño.


    Full Text Available Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) es una especie neotropical perteneciente a la familia Pentatomidae con más de 4 000 especies descritas, y se distribuye desde la Florida hasta Brasil. Este estudio describe el comportamiento sexual y reporta por primera vez la producción [...] de vibraciones de sustrato por machos y hembras durante el comportamiento precopulatorio y la cópula. Se grabó tanto el comportamiento de cortejo y de cópula como las diversas señales producidas utilizando un cartucho fonográfico, conectado a una cámara de video. Posteriormente se reprodujo las vibraciones de las hembras en ausencia de estas y se registró las respuestas de los machos. Se distinguieron al menos tres vibraciones de sustrato distintas para los machos y una para las hembras, y se caracterizaron por ser señales de baja frecuencia que van desde los 127 hasta 180Hz. Las sonidos de los machos en E. floridianus fueron significativamente diferentes en la frecuencia, duración y número de pulsos tanto en el cortejo como en la cópula para los sonidos de ronroneo y tamborileo. La producción de sonidos en esta especie se asoció principalmente con comportamientos estimulatorios- mecánicos durante el cortejo y copula. Patrones de comportamiento y su relación con las vibraciones del sustrato sugiere que estas señales pueden ser importantes para los machos en el contexto de la localización de su compañera y la selección sexual. Abstract in english Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) is a neotropical species belonging to the family Pentatomidae with over 4 000 species described, and is distributed from Florida to Brazil. This study describes the sexual behavior and reported for the first time the production of substra [...] te vibrations by males and females during copulatory behavior and mating. Courtship and copulatory behavior, as well as the diverse signals, were recorded with a phonographic cartridge connected to a video camera. Female vibrations were reproduced in the absence of females and the responses by males were recorded. At least three types of substrate vibrations were distinguished in males and one in females, and these signals were characterized by their low frequency, varying from 127 to 180Hz. The sounds of E. floridianus males were significantly different in frequency, duration and number of pulses, both in courtship and in copulation, for the purring and drumming sounds. The production of sounds in this species is associated principally with mechanical, stimulatory behavior during courtship and copulation. Patterns of behavior and their relation to substrate vibrations suggest that these signals are important for the males in the context of mate location and sexual selection.

  17. Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator (United States)

    Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny


    SUMMARY Background Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferase and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator. Results In the ant genomes, methylcytosines are found both in CpG and non-CpG contexts and are strongly enriched at exons of active genes. Changes in exonic DNA methylation correlate with alternative splicing events such as exon skipping and alternative splice site selection. Several genes exhibit caste-specific and developmental changes in DNA methylation that are conserved between the two species, including genes involved in reproduction, telomere maintenance, and noncoding RNA metabolism. Several loci are methylated and expressed monoallelically, and in some cases the choice of methylated allele depends on the caste. Conclusions These first ant methylomes and their intra- and inter-species comparison reveal an exonic methylation pattern that points to a connection between DNA methylation and splicing. The presence of monoallelic DNA methylation and the methylation of non-CpG sites in all samples suggest roles in genome regulation in these social insects, including the intriguing possibility of parental or caste-specific genomic imprinting. PMID:22885060

  18. A new species of Paraheligmonella (Nematoda, Heligmonellidae, parasite of Sylvilagus floridanus (Leporidae from Costa Rica Una especie nueva de Paraheligmonella (Nematoda, Heligmonellidae, parásita de Sylvilagus floridanus (Leporidae en Costa Rica

    Directory of Open Access Journals (Sweden)

    María Celina Digiani


    Full Text Available Paraheligmonella lamothei n. sp. (Heligmonellidae: Heligmonellinae is described from the small intestine of a cottontail, Sylvilagus floridanus (Allen, 1890 (Leporidae, from Costa Rica. New morphological data on the synlophe and caudal bursa of Paraheligmonella romerolagi (Gibbons and Kumar, 1980, the most similar species, are also provided. The new species differs from P. romerolagi, parasitic of Romerolagus diazi (Ferrari-Pérez, 1893 from Mexico, mainly by the characters of the caudal bursa and the synlophe of the female within the posterior region of body. Males of P. lamothei n. sp. possess a caudal bursa not bell-shaped, with a pattern of type 2-2-1 for right lobe and 2-3 with a tendency to type 2-2-1 for left lobe, whereas males of P. romerolagi possess a bell-shaped caudal bursa, with a pattern of type 2-2-1 with a tendency to type 4-1 for both lobes. In P. lamothei n. sp. rays 3 are slightly longer than rays 2 and the genital cone is poorly developed, whereas in P. romerolagi rays 3 are much longer than rays 2 and the genital cone is large and bulbous. Females of P. lamothei n. sp. possess, at ovejector level, ventral and latero-ventral ridges hypertrophied and dorsal ridges reduced, whereas at the same level, females of P. romerolagi possess lateral ridges hypertrophied and dorsal and ventral ridges reduced. Additionally, hypertrophied cuticular ridges posterior to the vulva are present in P. lamothei n. sp., but absent in P. romerolagi.Se describe Paraheligmonella lamothei n. sp., parásita del intestino delgado de Sylvilagus floridanus (Allen, 1890 (Leporidae de Costa Rica. Se aportan además datos nuevos morfológicos sobre el synlophe y la bolsa caudal de Paraheligmonella romerolagi (Gibbons y Kumar, 1980, la especie morfológicamente más parecida. La especie nueva se diferencia de P. romerolagi, parásita de Romerolagus diazi (Ferrari-Pérez, 1893 de México, principalmente por caracteres de la bursa caudal y el synlophe de la hembra en la región posterior del cuerpo. Los machos de P. lamothei n. sp. poseen una bursa caudal sin forma de campana, con un patrón de tipo 2-2-1 para el lóbulo derecho y 2-3 con tendencia a tipo 2-2-1 para el lóbulo izquierdo, mientras que los machos de P. romerolagi poseen una bursa en forma de campana, con un patrón de tipo 2-2-1 con tendencia a tipo 4-1 para ambos lóbulos. En P. lamothei n. sp. los rayos 3 son ligeramente más largos que los rayos 2 y el cono genital está poco desarrollado, mientras que en P. romerolagi los rayos 3 son mucho más largos que los rayos 2 y el cono genital es grande y bulboso. Las hembras de P. lamothei n. sp. poseen, a la altura del oviyector, las crestas cuticulares ventrales y latero-ventrales hipertrofiadas y las dorsales y laterales reducidas, mientras que a la misma altura, las hembras de P. romerolagi poseen las crestas laterales hipertrofiadas y las dorsales y ventrales reducidas. Adicionalmente, las crestas cuticulares hipertrofiadas posteriores a la vulva en P. lamothei n. sp., están ausentes en P. romerolagi.

  19. A new species of Paraheligmonella (Nematoda, Heligmonellidae), parasite of Sylvilagus floridanus (Leporidae) from Costa Rica / Una especie nueva de Paraheligmonella (Nematoda, Heligmonellidae), parásita de Sylvilagus floridanus (Leporidae) en Costa Rica

    Scientific Electronic Library Online (English)

    María Celina, Digiani; Ramón A., Carreño; Marie-Claude, Durette-Desset.


    Full Text Available Se describe Paraheligmonella lamothei n. sp., parásita del intestino delgado de Sylvilagus floridanus (Allen, 1890) (Leporidae) de Costa Rica. Se aportan además datos nuevos morfológicos sobre el synlophe y la bolsa caudal de Paraheligmonella romerolagi (Gibbons y Kumar, 1980), la especie morfológic [...] amente más parecida. La especie nueva se diferencia de P. romerolagi, parásita de Romerolagus diazi (Ferrari-Pérez, 1893) de México, principalmente por caracteres de la bursa caudal y el synlophe de la hembra en la región posterior del cuerpo. Los machos de P. lamothei n. sp. poseen una bursa caudal sin forma de campana, con un patrón de tipo 2-2-1 para el lóbulo derecho y 2-3 con tendencia a tipo 2-2-1 para el lóbulo izquierdo, mientras que los machos de P. romerolagi poseen una bursa en forma de campana, con un patrón de tipo 2-2-1 con tendencia a tipo 4-1 para ambos lóbulos. En P. lamothei n. sp. los rayos 3 son ligeramente más largos que los rayos 2 y el cono genital está poco desarrollado, mientras que en P. romerolagi los rayos 3 son mucho más largos que los rayos 2 y el cono genital es grande y bulboso. Las hembras de P. lamothei n. sp. poseen, a la altura del oviyector, las crestas cuticulares ventrales y latero-ventrales hipertrofiadas y las dorsales y laterales reducidas, mientras que a la misma altura, las hembras de P. romerolagi poseen las crestas laterales hipertrofiadas y las dorsales y ventrales reducidas. Adicionalmente, las crestas cuticulares hipertrofiadas posteriores a la vulva en P. lamothei n. sp., están ausentes en P. romerolagi. Abstract in english Paraheligmonella lamothei n. sp. (Heligmonellidae: Heligmonellinae) is described from the small intestine of a cottontail, Sylvilagus floridanus (Allen, 1890) (Leporidae), from Costa Rica. New morphological data on the synlophe and caudal bursa of Paraheligmonella romerolagi (Gibbons and Kumar, 1980 [...] ), the most similar species, are also provided. The new species differs from P. romerolagi, parasitic of Romerolagus diazi (Ferrari-Pérez, 1893) from Mexico, mainly by the characters of the caudal bursa and the synlophe of the female within the posterior region of body. Males of P. lamothei n. sp. possess a caudal bursa not bell-shaped, with a pattern of type 2-2-1 for right lobe and 2-3 with a tendency to type 2-2-1 for left lobe, whereas males of P. romerolagi possess a bell-shaped caudal bursa, with a pattern of type 2-2-1 with a tendency to type 4-1 for both lobes. In P. lamothei n. sp. rays 3 are slightly longer than rays 2 and the genital cone is poorly developed, whereas in P. romerolagi rays 3 are much longer than rays 2 and the genital cone is large and bulbous. Females of P. lamothei n. sp. possess, at ovejector level, ventral and latero-ventral ridges hypertrophied and dorsal ridges reduced, whereas at the same level, females of P. romerolagi possess lateral ridges hypertrophied and dorsal and ventral ridges reduced. Additionally, hypertrophied cuticular ridges posterior to the vulva are present in P. lamothei n. sp., but absent in P. romerolagi.

  20. Seletividade de oito inseticidas a predadores de lagartas em citros / Selectivity of eight insecticides to predators of citrus caterpillars

    Scientific Electronic Library Online (English)

    Tederson Luiz, Galvan; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; André Luiz Barreto, Crespo.


    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymen [...] optera: Vespidae) em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom. Abstract in english The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) and Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) was evaluated using insec [...] ticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

  1. Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores

    Directory of Open Access Journals (Sweden)

    Gonçalves Paulo Antonio de Souza


    Full Text Available Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench; cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.; cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília; cebola + milho (Zea mays L.; cebola + rúcula (Eruca sativa L. + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento.

  2. Microtriatoma pratai sherlock & Guitton, 1982 é sinônimo do Hemíptero predador Aradomorpha Championi Lent & Wygodzinsky, 1944 (Reduviidae, Reduviidae): notas


    Herman Lent


    Microtriatoma pratai Sherlock & Guitton, 1982 não pertence a este gênero de Triatominae. Não é inseto hematófago. Pertence ao gênero Aradomorpha Champion, 1899 e à espécie A. championi descrita por Lent & Wygodzinsky em 1944, inseto predador da subfamília Reduviidae.Microtriatoma pratai Sherlock & Guitton, 1982 is not a species of this genus of the subfamily Triatominae. It is not hematophagous. I identify it as Aradomorpha championi Lent & Wygodzinsky, 1944, a predator insect of the subfamil...

  3. Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids

    Scientific Electronic Library Online (English)

    Marcos Rafael, Gusmão; Marcelo, Picanço; Germano L.D., Leite; Marcelo F., Moura.


    Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

  4. Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa

    Directory of Open Access Journals (Sweden)

    Rodolfo Vargas Castilhos


    Full Text Available Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas. Os agrotóxicos foram pulverizados diretamente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas se mostrou inócua (classe 1 a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2 a ovos e pupas de C. externa

  5. Local feeding specialization of the red fox (Vulpes vulpes in response to eastern cottontail (Sylvilagus floridanus introduction (NW Italy

    Directory of Open Access Journals (Sweden)

    Alessandro Balestrieri


    Full Text Available Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus on the food habits of the red fox (Vulpes vulpes, between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115 in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989. Comparison included also the diet of badgers (Meles meles, considered as potential competitors for food resources. Alien lagomorphs (mean percent volume, Vm% = 68% represented by far the most exploited resource, only three other food items reaching values of mean percent volume barely higher than 5%. Cottontails frequency of occurrence did not vary according either to season or to their reproductive cycle (II-IX vs. X-I, whilst diet niche breadth varied inversely proportional to the use of this key-resource. Overall fox trophic niche breadth varied from 0.64 in 1988-89 to 0.31 in 1998-00 (B, Levin’s index. These findings led us to consider the feeding habits of the fox in the study area as a result of local specialization of a typical generalist carnivore, according to the predictions of optimal foraging theory. No variation occurred in the badger niche breadth since cottontail introduction, whilst niche overlap between foxes and badgers decreased from 0.59 to 0.13 (O, Pianka’s index, possibly reducing competition for food in summer. Riassunto Specializzazione alimentare a livello locale della Volpe Vulpes vulpes in risposta all’introduzione del Silvilago Sylvilagus floridanus (Italia nord occidentale. Per valutare gli effetti dell’introduzione del Silvilago (Sylvilagus floridanus sul comportamento alimentare della volpe (Vulpes vulpes, nel periodo giugno 1998-febbraio 2000, la dieta del carnivoro è stata definita tramite l’analisi di 115 feci raccolte nella Riserva Naturale “Garzaia di Valenza” (Provincia di Alessandria, Italia nord occidentale di circa 250 ha. I risultati ottenuti sono stati confrontati con quelli conseguiti nella medesima area prima dell’introduzione del Silvilago, oltre che con quelli disponibili sulla dieta del Tasso (Meles meles, che può essere ritenuto un potenziale competitore per le risorse alimentari. I lagomorfi sono risultati la categoria alimentare maggiormente consumata (volume medio percentuale, Vm% = 68%, mentre solo tre altre categorie hanno raggiunto valori di Vm di poco superiori al 5%. Non sono emerse variazioni stagionali o relative al periodo riproduttivo (febbraio-settembre vs. ottobre-gennaio del Silvilago, anche se l’ampiezza di nicchia complessiva è risultata inversamente proporzionale al consumo di lagomorfi. L’ampiezza di nicchia della Volpe è scesa da 0,64 nel 1988-89 a 0,31 nel 1998-00. Nel complesso, la dieta della Volpe nell’area di studio può essere considerata l’espressione di una specializzazione a livello locale, così come previsto dalla teoria del foraggiamento ottimale. Non è emersa alcuna variazione per l’ampiezza di nicchia del Tasso, mentre il grado di sovrapposizione (indice di Pianka tra il mustelide e la Volpe è nettamente diminuito (da 0,59 a 0,13. In questi termini la specializzazione della Volpe potrebbe rendere minima la competizione alimentare con il Tasso, in particolar modo in estate, quando la siccità limita la disponibilità di lombrichi.


    Directory of Open Access Journals (Sweden)

    Alberto Daniel Guanilo


    Full Text Available Panonychus citri (McGregor es una plaga importante en los cítricos de la costa central del Perú. Amblyseius chungas Denmark & Muma fue el ácaro predador más frecuente y abundante asociado a P. citri durante unas búsquedas realizadas en esa región. Para evaluar a A. chungas como controlador potencial de P. citri en cítricos, se estudió la duración de los estadios inmaduros de A. chungas y analizó el comportamiento predador de las hembras adultas de A. chungas cuando éstas se alimentan de ninfas y adultos P. citri como presa. Los experimentos fueron realizados en el laboratorio (20-25ºC y 70-80% HR. El tiempo de desarrollo del huevo hasta la emergencia del adulto fue de 6.60 ± 0.57 y 6.46 ± 0.44 días en hembras y machos, respectivamente. Las hembras adultas de A. chungas alimentadas a diferentes densidades de hembras adultas y/o ninfas de P. citri como presa presentaron una respuesta funcional de tipo II basada en la clasificación propuesta por Holling. La oviposición fue de 1 a 3 huevos por día.

  7. Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes

    Scientific Electronic Library Online (English)

    Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.


    Full Text Available Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for population dynamics of predators and prey and their implication

  8. Efeito de inseticidas em insetos predadores em culturas de algodão Effect of insecticides on predator insects associated with cotton

    Directory of Open Access Journals (Sweden)



    Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório.To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L. crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.; Fipronil 800 WDG (64, 80 and 100 g/ha of a.i.; Endosulfan 350 EC (700 g/ha of a.i.; and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare under field condition and to Cycloneda sanguinea (L. under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb., and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L. and Doru lineare (Eschs under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.


    Directory of Open Access Journals (Sweden)

    Julio Cezar Silveira Nunes


    Full Text Available

    The selectivity of insecticides for the complex of predators of the pests of cotton plant was evaluated in field experiment, in Goiânia- Goiás (Brazil, during the crop 1998/99. The experimental design was the randomized blocks with seven treatments and four repetitions (check, clorfluazuron, Bacillus thuringiensis, alanycarb, endosulfan and acephate in two amounts. The samplings were accomplished in beforeapplication, two days, seven and fourteen days after the treatment. For the obtained results (Henderson & Tilton, the products, in the decreasing order of selectivity, were: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    KEY-WORDS: Insecta; insecticides; cotton plant; predators.

    A seletividade de inseticidas para o complexo das pragas do algodoeiro foi avaliada em experimento de campo, em Goiânia (GO, durante a safra 1998/99. O delineamento experimental foi em blocos ao acaso com sete tratamentos testemunha, clorfluazuron, B. thuringiensis, alanycarb, endosulfan e acephate em duas dosagens, em quatro repetições. As amostragens foram realizadas em pré-aplicação; aos dois, sete e quatorze dias após as pulverizações. Pelos resultados obtidos (fórmula de Herderson & Tilton, os produtos, na ordem decrescente de seletividade, foram: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    PALAVRAS-CHAVE: Insecta; inseticidas; algodão; predadores.

  10. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis

    Scientific Electronic Library Online (English)

    Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.


    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

  11. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Harley Nonato de Oliveira


    Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

  12. Coenosia attenuata (Dptera: Muscidae), um predador em estudo para utilização em culturas protegidas / Coenosia attenuata (Dptera: Muscidae), a predator being studied for use in greenhouses greenhouses

    Scientific Electronic Library Online (English)

    Joana, Martins; Cíntia, Domingos; Raquel, Nunes; André, Garcia; Cristina, Ramos; Célia, Mateus; Elisabete, Figueiredo.


    Full Text Available Coenosia attenuata Stein, ou “mosca tigre”, predador polífago de importantes pragas agrícolas, enquanto larva e adulto, foi detectado em Portugal, pela primeira vez, em 2002, no Oeste. Para optimização da sua criação em massa, alteraram-se metodologias descritas na bibliografia. Ocorreu maior número [...] de emergências em substratos com maior número de larvas de esciarídeos e em substrato de terra misturado com fibra de coco. Estudou-se, em laboratório, o seu comportamento e capacidade de predação sobre várias espécies, incluindo parasitóides e predadores importantes em culturas protegidas, tendo predado todas as espécies testadas: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta e algumas espécies de Psycodidae. Observaram-se indícios de preferência alimentar das fêmeas de mosca tigre por moscas brancas e larvas mineiras, em relação a diglifos, e diferenças no comportamento de predação sobre moscas brancas em presença de larvas mineiras ou drosófilas. Abstract in english Coenosia attenuata Stein, or “tiger-fly”, a polyphagous predator of important agricultural pests, as larva and adult, was detected for the first time, in Portugal, in 2002, in the “Oeste” region. For mass rearing optimization, the methodologies described in literature were changed. A higher number o [...] f emergences occurred on substrates with higher number of sciarids larvae and on the substrate with soil mixed with coconut fiber. The predation capacity and behaviour of C. attenuata was studied in laboratory in relation to several species, including parasitoids and predators with an important role in protected crops. All species tested were predated: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta and some Psycodidae species. There was evidence of female preference for whiteflies and leafminers in relation to Diglyphus isaea, as well as predation behaviour differences over whiteflies when leafminers or drosophilids were present.


    Directory of Open Access Journals (Sweden)

    Elmo Pontes de Melo


    Full Text Available

    O algodoeiro é hospedeiro de um complexo de pragas, que podem ocasionar danos às estruturas das plantas. Para o desenvolvimento sustentado, neste agroecossistema, há necessidade da implementação do Manejo Integrado das Pragas (MIP. O objetivo deste trabalho foi estudar a seletividade de inseticidas aos predadores das pragas do algodoeiro. O delineamento experimental utilizado foi o de blocos ao acaso, com nove tratamentos e quatro repetições. Os tratamentos foram aplicados aos 84 dias após a emergência. As amostragens foram feitas através do método de batida de pano, com cinco batidas ao acaso, por parcela, nas quais foram identificados e contados os predadores vivos. Os inseticidas Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1.000 g ha-1, Thiamethoxam 250 WG (200 g ha-1 e Acetamiprid 200 SP (150 g ha-1 não foram seletivos ao complexo de predadores ocorrentes, com percentagens de mortalidades que oscilaram entre moderadamente tóxicos e tóxicos. Etofenprox 300 EC (450 mL ha-1 apresentou a maior percentagem de mortalidade, em relação aos demais tratamentos inseticidas, sendo classificado como tóxico. O tratamento Flonicamid 500 WG (150 g ha-1 foi seletivo, com média de predadores semelhante à testemunha, até 8 dias após a aplicação (daa. Dentre os inseticidas testados, somente o Flonicamid 500 WG foi considerado seletivo, segundo a classificação do IOBC, pois apresentou a menor percentagem de mortalidade ao complexo de predadores ocorrentes.

    PALAVRAS-CHAVE: Gossypium hirsutum L.; Insecta; inseticidas; algodão; predadores.

    The cotton plant hosts a complex of pests that can damage plant structures. Its supported development, in this agroecosystem, demands the implementation of an integrated pest management (IPM system. The goal of this research was to study the selectivity of pesticides over predators of cotton plant pests. The experimental design was randomized blocks, with 9 treatments (84 days after the emergence and 4 replicates. The sampling involved the beat cloth method, with 5 beats per plot, allowing to identify and count the living predators. Clotianidin 500 WP (200 g ha-1, Carbosulfan 400 SC (400 mL ha-1, Benfuracarb 400 EC (450 mL ha-1, Cartap hydrochloride 500 SP (1,000 g ha-1, Thiamethoxam 250 WG (200 g ha-1, and Acetamiprid 200 SP (150 g ha-1 were not selective for the complex of the predators identified, with mortality percentages ranging from moderately toxic to toxic. Etofenprox 300 EC (450 mL ha-1 was the most toxic pesticide, when compared to the others treatments. The Flonicamid 500 WG (150 g ha-1 treatment was selective, with average of predators similar to the control, until 8 days after spraying. Among the pesticides evaluated, only Flonicamid 500 WG was considered selective, according to the IOBC classification, because it showed the lowest mortality percentage for the complex of predators identified.

    KEY-WORDS: Gossypium hirsutum L.; insecta; pesticides; cotton plant; predators.

  14. Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    Evaldo Martins Pires


    Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21% e a de atividade de postura, à 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

  15. Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis

    Directory of Open Access Journals (Sweden)

    André Luiz Barreto Crespo


    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart (Lepidoptera: Pieridae e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90, calcularam-se os índices de seletividade diferencial (ISD90, de toxicidade relativa, e de tolerância relativa (ITRe90. O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75 e P. sylveirae (ISD90 = 2,95 e 3,59 em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70 em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64. B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05, e mais tolerante ao carbaril (ITRe90 = 0,14. Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04. As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis.This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart (Lepidoptera: Pieridae and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Based on concentration-response curves and lethal concentrations for 90% of the population (LC90, the differential selectivity index (DSI90, relative toxicity index and relative tolerance index (ReTI90 were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75 and P. sylveirae (DSI90 = 2.95 and 3.59 against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70 against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64. B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05, but the opposite was observed to carbaryl (ReTI90 = 0.14. These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04. Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

  16. Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis / Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis

    Scientific Electronic Library Online (English)

    André Luiz Barreto, Crespo; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; Alfredo Henrique Rocha, Gonring.


    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure) (Hymenopter [...] a: Vespidae). Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90), calcularam-se os índices de seletividade diferencial (ISD90), de toxicidade relativa, e de tolerância relativa (ITRe90). O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75) e P. sylveirae (ISD90 = 2,95 e 3,59) em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70) em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64). B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05), e mais tolerante ao carbaril (ITRe90 = 0,14). Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04). As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis. Abstract in english This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure) (Hym [...] enoptera: Vespidae). Based on concentration-response curves and lethal concentrations for 90% of the population (LC90), the differential selectivity index (DSI90), relative toxicity index and relative tolerance index (ReTI90) were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75) and P. sylveirae (DSI90 = 2.95 and 3.59) against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70) against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64). B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05), but the opposite was observed to carbaryl (ReTI90 = 0.14). These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04). Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

  17. Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa Diversity of aphids and their parasitoids and predators in alfalfa crop

    Directory of Open Access Journals (Sweden)



    Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA, em Lavras, MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC.This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.

  18. Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa / Diversity of aphids and their parasitoids and predators in alfalfa crop

    Scientific Electronic Library Online (English)



    Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA), em Lavras, [...] MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC. Abstract in english This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioa [...] phis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.

  19. Insetos predadores em copas de Citrus deliciosa (Rutaceae sob manejo orgânico no sul do Brasil Predatory insects in canopies of Citrus deliciosa (Rutaceae under organic management in southern Brazil

    Directory of Open Access Journals (Sweden)

    Rosana M. de Morais

    Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae (16,87% e Coccidophilus sp. (Coleoptera, Coccinellidae (11,85%. A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações.The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species from ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae (16.87% and Coccidophilus sp. (Coleoptera, Coccinellidae (11.85%. The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

  20. Insetos predadores em copas de Citrus deliciosa (Rutaceae) sob manejo orgânico no sul do Brasil / Predatory insects in canopies of Citrus deliciosa (Rutaceae) under organic management in southern Brazil

    Scientific Electronic Library Online (English)

    Rosana M. de, Morais; Aline, Barcellos; Luiza R., Redaelli.


    Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 [...] espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae) (16,87%) e Coccidophilus sp. (Coleoptera, Coccinellidae) (11,85%). A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações. Abstract in english The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species fr [...] om ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae) (16.87%) and Coccidophilus sp. (Coleoptera, Coccinellidae) (11.85%). The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

  1. Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes

    Scientific Electronic Library Online (English)

    Liliane K., Figueira; Fernando M., Lara.


    Full Text Available O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

  2. Seletividade de Inseticidas a Brevicoryne brassicae (L.) (Hemiptera: Aphididae) e ao Predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Insecticide Selectivity to Brevicoryne brassicae (L.) (Hemiptera: Aphididae) and the Predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)

    Scientific Electronic Library Online (English)



    Full Text Available Este trabalho teve por objetivo estudar a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Brevicoryne brassicae (L.) (Hemiptera: Aphididae), em relação a adultos e ninfas de primeiro, segundo e terceiro estádio [...] s do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe e deltametrina foram altamente seletivos em favor de todos os estádios de desenvolvimento de D. luteipes, sendo que o mesmo ocorreu para o acefato, com exceção de ninfas de primeiro estádio do predador às quais ele é medianamente seletivo. Dimetoato foi, em geral, medianamente seletivo enquanto metamidofós e paratiom metílico foram pouco seletivos em favor do predador. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade do dimetoato (para adultos, ninfas de primeiro e segundo estádios do predador) e metamidofós (para ninfas de terceiro estádio) apresentaram as maiores inclinações, indicando que os estádios estudados apresentam resposta homogênea a esses inseticidas. Abstract in english The objective of this work was to study the selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb to first, second, and third instar nymphs and adults of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) in comparison with l [...] ast instar nymphs of the prey Brevicoryne brassicae (L.) (Hemiptera: Aphididae). Pirimicarb and deltamethrin were highly selective to all developmental stages of D. luteipes; the same was observed with acephate except for first instar nymphs to whom it showed median selectivity. Dimethoate showed median selectivity, but methamidophos and methyl parathion were low selective to the predator. Second and third instar nymphs and adults of D. luteipes were more tolerant to acephate, methyl parathion and pirimicarb than first instar nymphs. First and second instar nymphs showed similar tolerance to deltamethrin, dimethoate and methamidophos. Concentration-response curves for dimethoate (to adults and first and second instar nymphs) and methamidophos (to third instar nymphs) showed steeper slopes indicating an homogeneous response of these developmental stages to these insecticides.

  3. Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)

    Scientific Electronic Library Online (English)



    Full Text Available O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.

  4. Seletividade de inseticidas às diferentes fases de desenvolvimento do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Selectivity of insecticides to different developmental stages of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)

    Scientific Electronic Library Online (English)

    Juliana C., Simões; Ivan, Cruz; Luis O., Salgado.


    Full Text Available O predador Doru luteipes (Scudder) é um dos principais reguladores da população de Spodoptera frugiperda (J.E. Smith) e Helicoverpa zea (Boddie) na cultura de milho (Zea mays). O objetivo do trabalho foi estudar a seletividade de cinco inseticidas químicos (deltametrina, lambdacialotrina, permetrina [...] , diflubenzuron e triflumuron) e dois microbianos [Baculovirus e Bacillus thuringiensis (Berliner)] sobre as diferentes fases de desenvolvimento do predador. Ovos e ninfas dos quatro ínstares receberam os inseticidas diretamente através de um pulverizador acoplado a uma esteira rolante. Adultos do predador receberam como alimento posturas de S. frugiperda, que foram pulverizadas com os diferentes inseticidas. Para os ovos, houve um efeito letal pronunciado com os inibidores de crescimento diflubenzuron (81,8% de mortalidade) e triflumuron (78,6%), sendo este também tóxico para os ínstares ninfais (69,6%). Os inseticidas biológicos Baculovirus e B. thuringiensis foram seletivos a todas as fases do predador. A sobrevivência do predador aos inseticidas foi crescente com o instar do inseto (S = 39,5 + 7,79 I, R2² = 0,87). Os adultos foram tolerantes a todos os inseticidas (95,3% de sobrevivência). Abstract in english The earwig Doru luteipes (Scudder) is one the best natural enemies of Spodoptera frugiperda (J. E. Smith) and Helicoverpa zea (Boddie) both pests of maize (Zea mays). The objective of this work was to evaluate the selectivity of five chemical (deltamethrin, lambdacyhalothrin, permethrin, diflubenzur [...] on and triflumuron) and two microbial [Baculovirus and Bacillus thuringiensis (Berliner)] insecticides to the different developmental stages of the predator. Eggs and the four nymphal stages were sprayed using a sprayer connected to a rolling mat. Adults were fed egg masses of S.frugiperda sprayed with insecticides. Eggs of the predator were highly affected by the growth inhibitors diflubenzuron (81.8% mortality) and triflumuron (78.6%), the latter also toxic to the nymphal stages (69.6%). The bioinsecticides Baculovirus and B. thuringiensis were selective to all stages of the predator. The survivorship increased with the increase of the insect's age (S = 39,5 + 7,79 I, R2² = 0,87). Adults were tolerant to all treatments (95.3% survivorship).

  5. Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores / Harmonia axyridis in fruit trees and impact on other predator coccinellids

    Scientific Electronic Library Online (English)

    Julianne, Milléo; Jana Magaly Tesserolli de, Souza; Ivana de Freitas, Barbola; Patrícia Elizabeth, Husch.


    Full Text Available O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006), relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinelli [...] dae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais. Abstract in english The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006), to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coc [...] cinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

  6. Seletividade de inseticidas a Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predador de lagartas desfolhadoras de eucalipto / Selectivity of insecticides to Podisus rostralis (Stal) (Heteroptera: Pentatomidae) predator of eucalyptus-defoliating caterpillars

    Scientific Electronic Library Online (English)

    Alfredo Henrique Rocha, Gonring; Marcelo Coutinho, Picanço; Germano Leão Demolin, Leite; Fábio Akiyoshi, Suinaga; José Cola, Zanuncio.


    Full Text Available O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares) e adultos (fêmeas e machos) do predador Podisus rostralis, empregando-se 50 (subconcentração) e 100% da concentração usada no contro [...] le de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente) do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade) e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente) do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade) e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente) do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade). A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos) e permetrina (a fêmeas) sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina. Abstract in english The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars) and adults (females and males) of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 10 [...] 0% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively). Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality), and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality). Malathion was medially selective to fifth instar nymphs (49.38% of mortality), but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality). Fenitrothion was not selective to any instar of P. rostralis (100% of mortality). The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults) and permethrin (to females) of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

  7. Reproductive characteristics of the predator Podisus nigrispinus fed with an insect resistant soybean variety Características reprodutivas do predador Podisus nigrispinus alimentado com variedade de soja resistente a insetos

    Directory of Open Access Journals (Sweden)

    Fausto da Costa Matos Neto


    Full Text Available The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1 females of P. nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae caterpillars reared on leaves of this variety; T2 females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.O objetivo desta pesquisa foi avaliar o efeito do genótipo IAC 17, resistente a insetos, nas características reprodutivas de fêmeas de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae, utilizando o genótipo susceptível UFV 16 como controle. Os tratamentos foram: T1 fêmeas de P. nigrispinus alimentadas com plantas de UFV 16 e lagartas de Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, criadas em folhas desta cultivar; T2 fêmeas de P. nigrispinus alimentadas com plantas de IAC 17, e lagartas de A. gemmatalis, criadas em folhas desta cultivar. Avaliou-se a longevidade das fêmeas, períodos de pré-oviposição, oviposição e pós-oviposição, número de ovos e de posturas/fêmea, peso dos ovos, intervalo entre posturas, número de ovos/postura, porcentagem de ovos eclodidos, número de ninfas/fêmea e número total de presas mortas/fêmea de P. nigrispinus. A maioria das características avaliadas mostrou resultados semelhantes entre tratamentos, exceto o período de oviposição, que foi mais longo para fêmeas criadas no genótipo resistente que no susceptível, e a porcentagem de fêmeas que ovipositaram antes de morrer, que foi menor na IAC 17. Além disso, o genótipo IAC 17 causou maior mortalidade de fêmeas de P. nigrispinus no início de sua fase adulta e distribuição mais uniforme da produção de ovos ao longo do período adulto desse predador. Por outro lado, os resultados não sugerem efeito desse genótipo na prole do predador.

  8. Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) em diferentes temperaturas / Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae) under different temperatures

    Scientific Electronic Library Online (English)

    José Wagner da Silva, Melo; Cleiton Araújo, Domingos; Andreia Serra, Galvão; Manoel Guedes Corrêa, Gondim Junior; Gilberto José de, Moraes.


    Full Text Available Euseius alatus DeLeon (Acari: Phytoseiidae) é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avalia [...] r o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e 33ºC, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30ºC mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatus em laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro. Abstract in english Euseius alatus DeLeon (Acari: Phytoseiidae) is one of the most common predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effe [...] ct of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33ºC; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility life table, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

  9. Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl (Heteroptera:Pentatomidae Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl (Heteroptera:Pentatomidae

    Directory of Open Access Journals (Sweden)

    Francisco Roberto de Azevedo


    Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl. Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molitor com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps.The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl. The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius cincticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

  10. Dark clouds and their silver linings: exotic generalist predators in augmentative biological control / Das nuvens escuras um raio de luz: controle biológico por aumento da população de predadores generalistas exóticos

    Scientific Electronic Library Online (English)



    Full Text Available Vários artrópodos predadores polífagos estão disponíveis para uso em controle biológico pelo aumento da população, com o objetivo de controlar ácaros e insetos-praga em ampla variedade de culturas. Muitos desses predadores não são nativos da área onde serão introduzidos. Neste artigo discutem-se os [...] beneficios e os riscos do uso de predadores generalistas exóticos como agentes de biocontrole. O fato de os predadores polífagos serem criados facilmente em alimento não-natural e poderem ser usados contra diferentes espécies de pragas, faz com que eles se tornem atrativos para comercialização. Predadores polífagos ou fitófagos facultativos apresentam menor dificuldade em se manterem na presença de baixas populações das presas e podem ser introduzidos nas culturas antes que a praga-alvo esteja presente, evitando o crescimento de populações de pragas que possam causar danos econômicos. Por outro lado, espécies generalistas podem interferir com outras espécies benéficas na cultura e espécies facultativas podem, excepcionalmente, causar danos às culturas. O uso de inimigos naturais não-nativos pode envolver riscos ambientais. Procedimentos para a avaliação de riscos, enfocando principalmente a amplitude de hospedeiros, têm sido implementados em um número crescente de países. A avaliação da especificidade hospedeira, entretanto, deve ser conduzida em condições reais. Em adição, a adequabilidade do clima, a habilidade de dispersão de um predador importado e a presença de seus inimigos naturais na área de introdução são fatores importantes quando se avaliam os riscos ambientais. As normas reguladoras são essenciais mas não devem dificultar a implementação do controle biológico como alternativa ao controle químico de pragas. Abstract in english Several polyphagous arthropod predators are commercially available for augmentative biological control targeting mite and insect pests in a variety of cropping systems. A number of these predators are not native to the area of release. The current paper discusses benefits and risks of using exotic g [...] eneralist predators as biocontrol agents. The fact that polyphagous predators are easily reared on unnatural foods and can be used against different pest species makes them attractive for commercialization. Polyphagous or facultatively phytophagous predators have less difficulty in maintaining their populations at low prey densities and can sometimes be introduced in the crop before the target pest is present, thus preventing the buildup of pest populations before economic damage is done. On the other hand, generalists may interfere with the action of other beneficials in the crop, and facultative plant feeding by predatory arthropods exceptionally causes crop damage. The use of non-native natural enemies may entail environmental risks. In a growing number of countries, risk assessment procedures are being implemented that are largely focused on host range testing. It is emphasized, however, that the experimental evaluation of host specificity should be done under realistic conditions. Furthermore, climatic matching and dispersal ability of an imported predator and the presence of its natural enemies in the area of introduction are important factors to be considered when assessing environmental risks. Regulation is essential but should not hamper the implementation of biological control as an alternative to chemical pest control.

  11. Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae.

    Directory of Open Access Journals (Sweden)

    Anderson Mathias Holtz


    Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e afertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto.

  12. Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) / Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Ítalo W.B., França; Edmilson J., Marques; Jorge B., Torres; José V., Oliveira.


    Full Text Available Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de i [...] ndivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um dos fungos Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 e 1189) e Beauveria bassiana (Bals.) Vuill. (604, 634 e 561) sobre ninfas e adultos de P. nigrispinus pelas vias de contato, residual seco e ingestão de presas contaminadas, em laboratório. M. anisopliae ocasionou maior mortalidade do predador que B. bassiana, tanto por contato como por resíduo seco do fungo. Entre as vias de infecção dos fungos o contato causou maior mortalidade do predador. Não houve confirmação de mortalidade de adultos em nenhuma das vias de infecção pelos isolados testados. A predação de larvas de Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminadas com os fungos afetou a produção de ovos das fêmeas adultas, porém o mesmo não foi constatado quando adultos alimentaram-se de presas contaminadas. Os resultados sugerem que isolados de M. anisopliae podem causar mortalidade de ninfas de P. nigrispinus por contato, enquanto os isolados de B. bassiana foram de menor impacto em todas as vias de infecção estudadas, comparados aos isolados de M. anisopliae. Abstract in english Entomopathogenic fungi and the predatory stinkbug Podisus nigrispinus (Dallas) can target simultaneously the same or different pests in agroecosystems. Topical contact during fungal dispersion or spraying, walking on plant surfaces and ingestion of contaminated prey are some of possible ways of inte [...] ractions between fungi and the predatory stinkbug. The impact of three isolates of Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 and 1189) and Beauveria bassiana (Bals.) Vuill. (604, 634 and 561) against nymphs and adults of P. nigrispinus was investigated under laboratory conditions. M. anisopliae caused higher mortality compared to B. bassiana either by topical application or by dry residue on cotton leaves. Topic contact with both fungi caused higher mortality to the predator. No mortality confirmation was reported for the adults. Nymphs fed with cotton leafworm larvae Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminated by the fungi had their reproduction affected, but this was not observed when adult predators fed on contaminated larvae. These findings suggest that isolates of M. anisopliae can cause mortality of P. nigrispinus nymphs by topical contact, while isolates of B. bassiana were less harmful by all ways of infection as compared to M. anisopliae.

  13. Atração do predador Doru luteipes (Scudder (Dermaptera: Forficulidae por estímulos olfativos de dietas alternativas em laboratório Attraction of the predator Doru luteipes (Scudder (Dermaptera: Forficulidae by olfactory stimulus of alternative diets in the laboratory

    Directory of Open Access Journals (Sweden)

    Mariana Campana Nonino


    Full Text Available Doru luteipes consome lagartas de Spodoptera frugiperda, que é atualmente a principal praga da cultura do milho no Brasil. Normalmente, se 70% das plantas tivessem o predador, a praga seria mantida abaixo do nível de dano econômico. Entretanto, o predador ocorre após a praga danificar as plantas. Assim, a disponibilidade de materiais que atraíssem e antecipassem a presença do predador na lavoura poderia reduzir populações da praga. Desta forma, estudou-se em laboratório a atratividade de dietas artificiais para machos e fêmeas do predador D. luteipes. Os tratamentos foram: pupa desidratada e moída do bicho-da-seda; pólen misto, nas quantidades de 0,05; 0,1; 0,2; 0,5 e 1,0g para ambas as dietas. Em olfatômetro, os estímulos da dieta foram comparados à testemunha. Foram realizadas 30 repetições. Os resultados mostraram que houve atratividade tanto para machos quanto para fêmeas. Em geral, a atração foi aumentada com o aumento da quantidade das dietas. Estudos adicionais foram propostos para testar a viabilidade do uso dos materiais como estratégia de manejo da praga no campo.Doru luteipes consumes larvae of Spodoptera frugiperda, which is at this moment the main pest of maize crop in Brazil. In general, if 70% of the plants had this predator the pest would be kept under the threshold of economic damage. However, the predator occurs after the pest damages the plants. Thus, the availability of materials that would attract and anticipate the presence of predator in the field,could reduce pest populations. In such a way, it was studied in the laboratory the attractiveness of artificial diets for males and females of the D. luteipes. The treatments were: ground dehydrated pupa of the silk worm and pollen mixture in the amounts of 0.05, 0.1, 0.2, 0.5 e 1.0g, for both the diets The diet stimulus were compared to control using a olfactometer. In general, attraction increased with rising amounts of the diets. Further investigations were proposed to test the viability of the usage of the materials to manage the pest in the field.

  14. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa

    Directory of Open Access Journals (Sweden)

    M. Florencia Grandi


    Full Text Available Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American sea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predatorio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica.

  15. Seletividade de inseticidas a Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predador de Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) / Selectivity of insecticides to Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predator of Ascia monuste orseis (Godart) (Lepidoptera: Pieridae)

    Scientific Electronic Library Online (English)

    Marcelo, Picanço; Luciano J., Ribeiro; Germano L.D., Leite; Marcos R., Gusmão.


    Full Text Available Avaliou-se a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom ao predador Polybia ignobilis (Haliday) em dosagens que causaram 90% de mortalidade em lagartas de 4º e 5º ínstares de Ascia monuste orseis (Godart). Os inseticidas paratiom metílico (cerca d [...] e 86% mortalidade) e carbaril (cerca de 62% de mortalidade) não foram seletivos a P. ignobilis. Os inseticidas mais seletivos foram triclorfom e permetrina (4% de mortalidade do predador). Deltametrina apresentou grau de seletividade intermediária (26% de mortalidade). Adultos de P. ignobilis com listras amareladas (38% de mortalidade) foram mais tolerantes a carbaril que adultos que não apresentavam tal característica (86%). Abstract in english The selectivity of carbaryl, deltamethrin, methyl parathion, permethrin and thrichlorfon to the predator Polybia ignobilis (Haliday) was evaluated in dosages which killed 90% of 4th and 5th instars of Ascia monuste orseis (Godart). Methyl parathion (86% average mortality) and carbaryl (62%) were not [...] selective to P. ignobilis; thrichlorfon and permethrin (4%) were more selective while deltamethrin showed intermediate selectivity (26% average mortality). Adults of P. ignobilis with yellow strips (38%) were more tolerant to carbaryl than those without this characteristic (86% average mortality).

  16. A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.

    Scientific Electronic Library Online (English)

    Fernanda Cristina, Massaro; Natalia Felix, Negreiros; Odete, Rocha.


    Full Text Available As hidras são os representantes mais comuns dos cnidários de água doce. Em geral, estes organismos são encontrados em todos os continentes, exceto na Antártica. O presente estudo teve como objetivo obter informações mais aprofundadas sobre aspectos biológicos e ecológicos de duas espécies de Hydra n [...] ativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predação e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espécies. Os resultados indicaram que as duas espécies de Hydra não foram consumidas por nenhum dos predadores testados, os quais são usuais predadores de invertebrados em águas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espécie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de copépodos calanóides e os pequenos cladóceros, e selecionou negativamente as presas grandes, como os adultos de copépodos calanóides e os ostrácodos. Já a espécie H. salmacidis, a qual apresenta um tamanho maior, além de ter preferência pelos náuplios e copepoditos de copépodos calanóides e pequenos cladóceros, também selecionou positivamente os indivíduos adultos dos copépodos calanóides. Os resultados obtidos evidenciaram que as espécies H. viridissima e H. salmacidis provavelmente são pouco ou não são predadas em muitos ambientes naturais, sendo elas próprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos são predadores eficientes e observou-se uma relação positiva entre o tamanho da espécie de Hydra e o tamanho da presa. A seletividade alimentar destas espécies esteve relacionada com o tamanho das presas, assim como com outras características, tais como a espessura da carapaça e a eficiência de natação. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

  17. A dieta alimentar da presa Tenebrio molitor (Coleoptera: Tenebrionidae) pode afetar o desenvolvimento do predador Podisus nigrispinus (Heteroptera: Pentatomidae)? / Can the diet of the prey Tenebrio molitor (Coleoptera: Tenebrionidae) affect the development of the predator Podisus nigrispinus (Heteroptera: Pentatomidae)?

    Scientific Electronic Library Online (English)

    Claubert Wagner Guimarães de, Menezes; Silma da Silva, Camilo; Arley José, Fonseca; Sebastião Lourenço de, Assis Júnior; Diego Faustolo, Bispo; Marcus Alvarenga, Soares.


    Full Text Available Inimigos naturais são importantes para o controle de pragas em culturas agrícolas e florestais. A criação de insetos predadores em biofábricas deve ser de baixo custo para serem utilizados em programas de Manejo Integrado de Pragas (MIP). O objetivo deste trabalho foi avaliar o desenvolvimento de Po [...] disus nigrispinus Dallas, 1851 (Heteroptera: Pentatomidae), alimentado com larvas de Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae), criadas com as seguintes dietas: farelo de trigo, ração triturada ou peletizada para aves poedeiras e fubá de milho. Foram obtidos os parâmetros de desenvolvimento e reprodução necessários para calcular a tabela de vida do predador. Os parâmetros da tabela de vida revelaram crescimento populacional em todos os tratamentos. No entanto, a taxa líquida de reprodução (Ro) de P. nigrispinus foi menor quando alimentados com larvas de T. molitor criadas com fubá de milho, mostrando ser a alimentação menos adequada para esse predador. Por proporcionar maior número total de ovos, o farelo de trigo constituiu a melhor dieta para P. nigrispinus. Estudos sobre dietas de presas alternativas são importantes, pois podem favorecer a nutrição de inimigos naturais e, consequentemente, melhorar o desempenho das criações massais em laboratório. Abstract in english Natural enemies are important for controlling pests in agricultural and forestry culture. The reproductions of predatory insects in biofactories should have low cost to be used in Integrated Pest Management Program (IPM). The objective of this study was to evaluate the development of Podisus nigrisp [...] inus Dallas, 1851 (Heteroptera: Pentatomidae) fed with Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae). The larvae of T. molitor were created with the following diets: wheat bran, shredded or pelleted poultry feed layers and corn meal. Parameters for the development and reproduction of the P. nigrispinus were obtained. Parameters of the life table show population growth in all treatments. However, the net rate of reproduction (Ro) of P. nigrispinus was lower when they were fed with larvae of T. molitor created with corn meal, which proved to be the least adequate food for this predator. By providing a larger total number of eggs, wheat bran was the best diet for P. nigrispinus. Studies on alternative prey diets are important as they may favor the nutrition of natural enemies and, consequently, improve the performance in laboratory rearing.

  18. Adequabilidade de diferentes substratos à oviposição do predador Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Suitability of different substrates for oviposition of the predator Orius insidiosus (Say) (Hemiptera: Anthocoridae)

    Scientific Electronic Library Online (English)

    Simone M., Mendes; Vanda H.P., Bueno; Lívia M., Carvalho.


    Full Text Available Fêmeas de Orius insidiosus (Say) colocam seus ovos endofíticamente, em diversas plantas, e um obstáculo para a criação massal desse predador é a seleção de um substrato de oviposição que seja de fácil obtenção e aceito pelo inseto. O objetivo deste estudo foi avaliar a preferência e a adeqüabilidade [...] de diferentes substratos de oviposição para O. insidiosus. Os testes foram conduzidos em câmaras climatizadas reguladas a 25 ± 1°C, UR de 70 ±10% e fotofase de 12h. Os substratos avaliados quanto à preferência e adequabilidade foram caule de caruru (Amaranthus viridis L.), caule e vagem de feijão (Phaseolus vulgaris L.), vagem de feijão-de-vagem (Phaseolus vulgaris L.) e inflorescências de picão-preto (Bidens pilosa L.). Na adequabilidade também foi avaliado o caule de poaia-do-campo (Spermacoce latifola Aubl.). Fêmeas submetidas aos testes com e sem chance de escolha preferiram ovipositar em inflorescências de picão-preto. O período de pré-oviposição foi influenciado pelo tipo de substrato, sendo menor na presença da inflorescência de picão-preto (3,0 dias) e no feijão, tanto no caule (3,1dias) como na vagem (3,7 dias) comparado aos demais substratos. O período de oviposição, bem como a longevidade foram cerca de três a quatro vezes menores na presença do caule de poaia-do-campo (8,9 dias). O número total de ovos/fêmea de O. insidiosus foi maior em inflorescências de picão-preto (163,3 ovos). Os resultados indicam a adeqüabilidade das inflorescências de picão-preto como substrato de oviposição para O. insidiosus, sendo o preferido nos testes, com e sem chance de escolha, e onde as fêmeas apresentaram melhor performance reprodutiva. Abstract in english Orius insidiosus (Say) females lay eggs inside plant tissue. An obstacle for its mass rearing is the selection of a plant that is suitable and well-accept by the female for oviposition. The objectives of this work were to evaluate the preference and the suitability of different plant structures as o [...] vipositional substrates for O. insidiosus. The trials were conducted in climatic chamber at 25 ± 1°C, RH 70 ± 10% and photophase 12h. The plant sites as amaranth stem (Amaranthus virides L.), common bean's stem and pod (Phaseolus vulgaris L.), green bean's pod (Phaseolus vulgaris L.) and farmer's friend inflorescence (Bidens pilosa L.) were evaluated in no-choice and choice tests. The broadleaf button weed stem (Spermacoce latifola Aubl.) was also used to evaluate the suitability on the reproductive parameters. The females of O. insidiosus preferred to oviposit in farmer's friend inflorescence in no-choice and choice tests. The pre-oviposition period was affected by the plant site used as an ovipositional substrate, being shorter in farmer's friend inflorescence (3.0 days) and in common bean (both on stem (3.1 days) and pod (3.7 days) compared to all substrates evaluated. The oviposition period and the longevity were about three or four times shorter on broadleaf button weed stem (8.9 days). The total number of eggs/ female was higher in farmer's friend inflorescence (163.3 eggs). The results indicated the preference and suitability of farmer's friend inflorescence as an ovipositional substrate for O. insidiosus, in which the females showed better reproductive performance.

  19. Toxoplasmosis Silvestre: relación presa-predador y papel funcional de pequeños felinos silvestres neotropicales en la transmisión -resumen-

    Directory of Open Access Journals (Sweden)

    William A Cañón-Franco


    Full Text Available Pequeños felinos neotropicales se ubican en el tope de la cadena alimenticia y‚ aunque críticamente amenazados‚ ocho especies de felinos son relativamente abundantes en el continente americano‚ sin embargo‚ pocos estudios biológicos sobre la circulación de agentes infecciosos han sido realizados. Para determinar el papel epidemiológico que cumplen las poblaciones de felinos silvestres en la transmisión de la Toxoplasmosis en la región sur de Brasil (estado de Rio Grande do Sul‚ fue determinada la frecuencia molecular de Toxoplasma gondii. La amplificación del marcador ITS1 fue posible en 31 de los 90 felinos analizados (34‚4%‚ de las especies Puma yagouaroundi (9/22‚ Leopardus geoffroyi (6/22‚ Leopardus tigrinus (8/28‚ Leopardus wiedii (6/10‚ Leopardus pardalis (1/1 y Leopardus colocolo (1/7. Dos nuevos genotipos de T. gondii fueron caracterizados por PCR-RFLP (Lw#31Tn - Py#21Sm y el genotipo Py#56Br previamente descrito en gatos domésticos‚ perros y chigüiros del Brasil. Adicionalmente‚ fue parcialmente caracterizado el genotipo I (Py#36Sm‚ evidenciando la circulación ambiental y su posible relación en la presentación de toxoplasmosis ocular en humanos. Los resultados demuestran que pequeños felinos silvestres tienen un papel importante en la transmisión de la toxoplasmosis en la interfase animales domésticos-silvestres‚ por lo que no se descarta la posible hibridación con genotipos urbanos. La carnivoría y las relaciones presa-predador son fundamentales en la transmisión horizontal de Toxoplasma. Aunque existan variaciones biogeográficas y estacionales en la dieta de los felinos silvestres‚ aproximadamente 40% a 80%‚ corresponde a pequeños mamíferos no voladores (marsupiales y roedores. El estudio de la dinámica de transmisión en diferentes niveles tróficos es de gran interés para la comprensión ecológica del ciclo silvestre de este parásito. Esta propuesta se fundamenta en evaluar el impacto de variables biológicas de las especies predadas (edad‚ sexo‚ peso y dieta y de variables ecológicas (uso vertical y horizontal del espacio‚ densidad de la especie‚ tiempo de vida y distribución en el bioma en la toxoplasmosis silvestre en tres diferentes biomas del estado de Mato Grosso (Brasil. Actualmente‚ están siendo analizados tejidos de roedores (géneros Necromys‚ Oecomys‚ Oligoryzomys‚ Oryzomys‚ Oxymycterus‚ Proechimys‚ Calomys‚ Cavia‚ Holochilus‚ Necromys‚ Oecomys‚ marsupiales (géneros Philander‚ Didelphis‚ Marmosa‚ Marmosops‚ Metachirus‚ Micoureus‚ Monodidelphis y de otros mamíferos silvestres de la región (Familia Felidae‚ Canidae‚ Myrmecophagidae‚ Cebidae‚ Dasypodidae‚ Mustelidae. Los resultados parciales de la investigación demuestran la circulación de Toxoplasma entre carnívoros (Cerdocyon thous y primates (Sapajus sp‚ con resultados negativos para las demás especies en estudio‚ indicando que otros niveles biológicos participan en la transmisión.

  20. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?

    Directory of Open Access Journals (Sweden)

    Rafael Braga da Silva


    Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae e Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior, apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores

  1. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo

    Scientific Electronic Library Online (English)

    Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.


    Full Text Available Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

  2. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics / Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa

    Scientific Electronic Library Online (English)

    M. Florencia, Grandi; Rocío, Loizaga de Castro; Enrique A, Crespo.


    Full Text Available Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predat [...] orio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica. Abstract in english Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American s [...] ea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.

  3. Efeito da utilização de acaricidas em citros, sobre a população de Brevipalpus phoenicis (Geijskes, 1939 e ácaros predadores (Phytoseiidae Effect of acaricide utilization in citrus on the population of Brevipalpus phoenicis (Geijskes, 1939 and predatory mites (Phytoseiidae

    Directory of Open Access Journals (Sweden)

    M.E. Sato


    Full Text Available Foi conduzido experimento com o objetivo de estudar o efeito de alguns acaricidas sobre Brevipalpus phoenicis (Geijskes,1939 (AcarirTenuipalpidae e ácaros predadores (Phytoseiidae, em citros. Os produtos testados e as dosagens em g i.a./100 / de água foram: fenpyroximate (5,0, acrinathrin (0,5; hexythiazox (1,5; amitraz (40,0 e enxofre (225,0. Os acaricidas fenpyroximate, acrinathrin e hexythiazox foram eficientes contra B. phoenicis até 127 dias após a aplicação, enquanto que, o enxofre e o amitraz apresentaram bom controle até 92 e 58 dias após o tratamento, respectivamente. O hexythiazox foi praticamente inócuo aos ácaros predadores mas os demais acaricidas foram significativamente prejudiciais a estes ácaros. Os produtos enxofre, fenpyroximate e acrinathrin induziram reduções na população de fitoseíídeos até 58 dias, porém o amitraz apresentou reduções até 92 dias após a pulverização.The experiment was carried out in order to study the effects of some acaricides on Brevipalpus phoenicis (Geijskes,1939 (Acari,Tenuipalpidae and predatory mites (Phytoseiidae hi citrus. The products tested and dosages in g AI/ 100 / of water were: fenpyroximate (5.0, acrinathrin (0.5, hexythiazox (1.5, amitraz (40.0 and sulphur (225.0. The acaricides fenpyroximate, acrinathrin and hexythiazox were efficient against B. phoenicis up to 127 days from the application date, whereas sulphur and amitraz presented good control up to 92 days and 58 days after treatment, respectively. Hexythiazox was fairly innocuous to predatory mites but, the remaining acaricides caused significant mortality to these mites. The pesticides sulphur, fenpyroximate and acrinathrin induced reductions of the population of phytoseid mites up to 58 days, but amitraz showed reductions up to 92 days after application.

  4. Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis

    Scientific Electronic Library Online (English)

    Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.

    Full Text Available O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

  5. Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa

    Directory of Open Access Journals (Sweden)

    Madelaine Venzon


    Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

  6. Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil

    Scientific Electronic Library Online (English)

    Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.


    Full Text Available Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

  7. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil


    Noeli Juarez Ferla; Gilberto José de Moraes


    Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. ano...

  8. Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake / Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical

    Scientific Electronic Library Online (English)

    MS., Arcifa; TC., Bunioto; A., Perticarrari; WJ., Minto.


    Full Text Available O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD) em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi av [...] aliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade) foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso. Abstract in english The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocer [...] ans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity) were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.

  9. Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae and Corydalus Latreille (Megaloptera, Corydalidae in Southeastern Brazil O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae e Corydalus Latreille (Megaloptera, Corydalidae no Sudeste do Brasil

    Directory of Open Access Journals (Sweden)

    Marcos Callisto


    Full Text Available Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW and in the headwaters of São Francisco river, at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W, in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm were sampled: 61 in the Indaiá stream and 17 in other two streams. Twelve Corydalus larvae (22-79 mm in the Indaiá stream and three out of 15 larvae in the headwaters of São Francisco river (38-50 mm had Corynoneura, larvae and pupae on their gills (3rd to 6th and a few larvae attached to the abdominal segments of larger Corydalus larvae (> 25 mm. Sixty-nine larvae of Corynoneura were found in the regurgitated material from Corydalus. It is remarkable that by attaching to larger body size predators, prey could become free from predator bouts and could also be transported by them.Comensalismo entre Corydalus Latreille, 1802 (Insecta, Megaloptera, Corydalidae e Corynoneura Winnertz, 1846 (Insecta, Diptera, Chironomidae, Orthocladiinae foi registrado no córrego Indaiá situado a 1.380 m de altitude no Parque Nacional da Serra do Cipó (19-20ºS, 43-44ºW e nas nascentes do rio São Francisco a 1.300-1.700 m de altitude no Parque Nacional da Serra da Canastra (20º00'-20º30'S, 46º15'-47º00'W, Minas Gerais, Brasil. Setenta e oito larvas de Corydalus (tamanhos: 22-88 mm foram coletadas: 61 no córrego Indaiá e 17 em outros córregos. Doze larvas de Corydalus (tamanhos: 22-79 mm no córrego Indaiá e três encontradas nas nascentes do rio São Francisco (tamanhos: 38-50 mm apresentaram larvas e pupas de Corynoneura em suas brânquias (3ª a 6ª e algumas larvas fixadas nos segmentos abdominais de grandes Corydalus (> 25 mm. Sessenta e nove larvas de Corynoneura foram retiradas do material regurgitado por Corydalus. É importante observar que fixados aos predadores de grande tamanho corporal as presas se tornam livres de outros predadores além de serem transportados por eles.

  10. Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil / O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil

    Scientific Electronic Library Online (English)

    Marcos, Callisto; Michael D.C., Goulart; Pablo, Moreno; Rogério P., Martins.


    Full Text Available Comensalismo entre Corydalus Latreille, 1802 (Insecta, Megaloptera, Corydalidae) e Corynoneura Winnertz, 1846 (Insecta, Diptera, Chironomidae, Orthocladiinae) foi registrado no córrego Indaiá situado a 1.380 m de altitude no Parque Nacional da Serra do Cipó (19-20ºS, 43-44ºW) e nas nascentes do rio [...] São Francisco a 1.300-1.700 m de altitude no Parque Nacional da Serra da Canastra (20º00'-20º30'S, 46º15'-47º00'W), Minas Gerais, Brasil. Setenta e oito larvas de Corydalus (tamanhos: 22-88 mm) foram coletadas: 61 no córrego Indaiá e 17 em outros córregos. Doze larvas de Corydalus (tamanhos: 22-79 mm) no córrego Indaiá e três encontradas nas nascentes do rio São Francisco (tamanhos: 38-50 mm) apresentaram larvas e pupas de Corynoneura em suas brânquias (3ª a 6ª) e algumas larvas fixadas nos segmentos abdominais de grandes Corydalus (> 25 mm). Sessenta e nove larvas de Corynoneura foram retiradas do material regurgitado por Corydalus. É importante observar que fixados aos predadores de grande tamanho corporal as presas se tornam livres de outros predadores além de serem transportados por eles. Abstract in english Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river [...] , at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were sampled: 61 in the Indaiá stream and 17 in other two streams. Twelve Corydalus larvae (22-79 mm) in the Indaiá stream and three out of 15 larvae in the headwaters of São Francisco river (38-50 mm) had Corynoneura, larvae and pupae on their gills (3rd to 6th) and a few larvae attached to the abdominal segments of larger Corydalus larvae (> 25 mm). Sixty-nine larvae of Corynoneura were found in the regurgitated material from Corydalus. It is remarkable that by attaching to larger body size predators, prey could become free from predator bouts and could also be transported by them.

  11. Desenvolvimento e Reprodução do Predador Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Frente a Doses Subletais de Permetrina / Development and Reproduction of the Predator Podisus distinctus (Stal) (Heteroptera: Pentatomidae) Exposed to Sublethal Doses of Permethrin

    Scientific Electronic Library Online (English)



    Full Text Available Desenvolvimento e reprodução foram estudados no predador Podisus distinctus (Stal) submetido a doses subletais do inseticida permetrina em condições de laboratório. Ninfas de 3º instar foram submetidas a aplicação tópica de permetrina nas doses de 0; 0,0172; 0,172; 1,72; 17,2 e 172 ppb. O único parâ [...] metro significativamente afetado foi a viabilidade de ovos. Esse parâmetro teve um máximo de estímulo na dose 0,172 ppb provendo evidência do fenômeno de hormese. Abstract in english Development and reproduction were studied in the predator Podisus distinctus (Stal) subjected to sublethal doses of the insecticide permethrin under laboratory conditions. Third instar nymphs were subjected to topical application of permethrin at the doses of 0, 0.0172, 0.172, 1.72, 17.2 e 172 ppb. [...] The only parameter statisticaly different was egg viability. This parameter had the gratest increase at the dose 0.172 ppb provinding evidence for the phenomenon of hormesis.

  12. A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia

    Scientific Electronic Library Online (English)

    Andrew P., Gutierrez; Marina A., Pizzamiglio.


    Full Text Available O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

  13. Ovary development, egg production and oviposition for mated and virgin females of the predator Podisus nigrispinus (Heteroptera: Pentatomidae) / Desenvolvimento ovariano, produção de ovos e oviposição de fêmeas virgens ou acasaladas do predador Podisus nigrispinus (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Marcus Alvarenga, Soares; Joana Darc, Batista; José Cola, Zanuncio; José, Lino-Neto; José Eduardo, Serrão.


    Full Text Available Insetos Asopinae são predadores generalistas e Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) é a espécie mais estudada desse grupo no Brasil. O objetivo foi avaliar o desenvolvimento ovariano, a produção de ovos e a oviposição de fêmeas de P. nigrispinus virgens ou acasaladas. Cinco fêmea [...] s com 24 horas de idade foram dissecadas e os ovários foram analisados. Quinze fêmeas desse predador foram acasaladas (T1) e outras 15 foram individualizadas sem acasalamento (T2). Os ovários de cinco fêmeas por tratamento foram dissecados e os ovos maduros e em formação foram contados. Cinco fêmeas virgens de P. nigrispinus com 20 dias de idade foram também analisadas. Fêmeas de P. nigrispinus com 24 horas de idade apresentaram baixo desenvolvimento ovariano, sem evidencia de produção de ovócitos. As fêmeas do tratamento T1 apresentaram ovários completamente desenvolvidos, com 22,67 ± 7,26 ovos maduros e 31,33 ± 1,33 ovos em processo de maturação. Ovários de fêmeas do tratamento T2 apresentaram uma quantidade baixa de ovos nos primeiros estágios de maturação (15 ± 1,73). Fêmeas do tratamento T2, dissecadas aos 20 dias, apresentaram 28,33 ± 2,31 e 15 ± 1,96 ovos maduros e imaturos, respectivamente. Fêmeas de P. nigrispinus iniciam a ovogênese e a maturação dos ovos logo após a emergência, porém o acasalamento é importante para manter a produção dos ovos e a oviposição. Abstract in english The Asopinae insects are generalist predators, and Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is the most studied species of this group in Brazil. The objective was to study ovarian development, egg production and oviposition of mated and virgin P. nigrispinus females. Five 24-hours-ol [...] d females were dissected and the ovaries were analyzed. Fifteen females of this predator were mated (T1), and another fifteen were individualized without mating (T2). The ovaries of five females per treatment were dissected and mature and immature eggs were counted. Five virgin females of P. nigrispinus at twenty days old were also analyzed. Twenty-four-hours-old P. nigrispinus females had low ovary development without the evidence of oocyte production. The females of the T1 had completely developed ovaries, with 22.67 ± 7.26 mature eggs and 31.33 ± 1.33 oocytes in the maturation process. Ovaries of females of T2 had a lower quantity of eggs in the early maturation stage (15 ± 1.73). Females of T2 that were dissected at day 20 had 28.33 ± 2.31 and 15 ± 1.96 mature and immature eggs, respectively. Podisus nigrispinus females begin oogenesis and egg maturation soon after their emergence but mating is important to maintain egg production and oviposition.

  14. Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil

    Scientific Electronic Library Online (English)

    A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.


    Full Text Available O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

  15. Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    W. P. Lemos


    Full Text Available Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål (Heteroptera: Pentatomidae was investigated on ovary activation in this predator. The nymphs received topical application of permethrin in the following concentrations (mg a.i./ml: 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål (Heteroptera: Pentatomidae em sua ativação ovariana. Essas ninfas receberam aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml: 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese.

  16. Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae) / Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    W. P., Lemos; R. S., Medeiros; J. C., Zanuncio; J. E., Serrão.


    Full Text Available Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) em sua ativação ovariana. Essas ninfas receberam [...] aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml): 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml) a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese. Abstract in english Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) was investigated on ovary activation in this predator. The nymph [...] s received topical application of permethrin in the following concentrations (mg a.i./ml): 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.

  17. Alternative plants hosts of legume aphids and predators in the province of León, Spain / Plantas hospedadoras alternativas de áfidos de leguminosas y sus predadores, en la provincia de León (España)

    Scientific Electronic Library Online (English)

    Isabel, Bertolaccini; Etelvina, Núñez-Pérez; Emilio Jorge, Tizado.


    Full Text Available Durante los meses de primavera, verano y otoño de 1998 y 1999 se observaron al azar cultivos de leguminosas, y las plantas espontáneas marginales e intercalares, en la provincia de León (España). Los cultivos muestreados fueron: Medicago sativa, Phaseolus vulgaris,Pisum sativum, Cicer arietinum, Tri [...] folium repens, Vicia fava, Trifoliumpratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolio y Lens esculenta. Se observaron 23 familias de plantas espontáneas, en ellas y en los cultivos se identificaron los áfidos, su densidad poblacional y de los predadores de las familias Coccinellidae, Syrphidae Chrysopidae. Las familias con mayores registros de los enemigos naturales de los pulgones fueron: Apiaceae, Asteraceae y Chenopodiaceae para Syrphidae y Coccinellidae. Se concluye que el manejo de los agrosistemas, mediante la manipulación de las plantas espontáneas, constituiría un recurso a tener en cuenta para incrementar el potencial de los enemigos naturales de los áfidos plaga de los cultivos de leguminosas. Abstract in english The study was done during the spring, summer and fall of 1998 and 1999. Samples were taken at random from legume crops and spontaneous plants adjacent to them in the province of León (Spain). Observations were made on the following crops: Medicago sativa, Phaseolus vulgaris, Pisum sativum, Cicer ari [...] etinum, Trifolium repens, Vicia fava, Trifolium pratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolius and Lens esculenta. Twenty three families of spontaneous plants were observed. The aphid species and their population densities on the spontaneous plants and crop plants were recorded, as was the presence of members of the families Coccinellidae, Syrphidae and Chrysopidae. The plant families Brassicaceae, Asteraceae and Chenopodiaceae had the greatest numbers of these natural enemies of aphids the manipulation of spontaneous plants in agrosystems is a potential means of increasing populations of natural enemies of aphid pests in legume crops.

  18. Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa / Selectivity of pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa

    Scientific Electronic Library Online (English)

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Paulo Ricardo Baier, Siqueira; Ítalo Lucas de, Moraes; Cleiton Jair, Gauer.


    Full Text Available Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas). Os agrotóxicos foram pulverizados direta [...] mente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas) se mostrou inócua (classe 1) a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2) a ovos e pupas de C. externa Abstract in english This research aimed to evaluate the effect of nineteen pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa in bioassays carried under laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase). The pesticides were directly spra [...] yed on eggs and pupae trough a Potter tower using the maximum recommended dosage for peach orchards. It was evaluated eggs and pupae viability, in addition to fecundity and fertility of adults emerged from treated pupae. The pesticides were classified to eggs according to reduction in eggs hatch, and to pupae according to the total effect into IOBC toxicity categories. Most of pesticides evaluated (8 insecticides, 8 fungicides and 2 herbicides) were harmless (category 1) to eggs and pupae, with a reduction in eggs hatch and total effect to pupae lower than 30%, except for the insecticide mineral oil, which reduced eggs hatch in 69.55% and caused a total effect of 36.22% in pupae, being therefore classified as slightly harmful (category 2) to eggs and pupae of C. externa


    Directory of Open Access Journals (Sweden)

    Érico Amaral


    Full Text Available

    Esta nota prévia apresenta alguns dados bionômicos do predador de abelhas Apiomerus nigrilobus Stal, 1872 obtidos sob condições de laboratório. O estudo foi realizado no Departamento de Entomologia da Escola Superior de Agricultura “Luiz de Queiroz” da Universidade do Estado de São Paulo, no período de março de 1972 a dezembro de 1973. O ciclo biológico médico constatado para este predador foi de 246 dias. Os autores apresentam três quadros que resumem os dados obtidos.

    This preliminary note presents some bionomics data of the honeybee predator Apiomerus nigrilobus Stal, 1872 obtained in laboratory. The study was conducted at the Agricultural College ";Luiz de Queiroz” U.S.P. — São Pau1o, Brazil, from March 1972 to December 1973. The evolutionary cycle of this predator, on an average, is 246 days. A table is presented showing the results.

  20. Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants

    Scientific Electronic Library Online (English)



    Full Text Available Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.

  1. Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Márla Maria Marchetti


    Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.

  2. Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests

    Directory of Open Access Journals (Sweden)

    Marcelo Gustavo Ruiz


    Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

  3. Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton

    Scientific Electronic Library Online (English)



    Full Text Available Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.

  4. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo

    Directory of Open Access Journals (Sweden)

    Maria A Medeiros


    Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

  5. Dinâmica populacional de ácaros (Acari) em erva-mate (Ilex paraguariensis St. Hil.: Aquifoliaceae) / Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)

    Scientific Electronic Library Online (English)

    Alfredo de, Gouvea; Luiz C., Boaretto; Carla F., Zanella; Luis F.A., Alves.


    Full Text Available Este trabalho foi realizado em Dois Vizinhos, PR, com o objetivo de estudar a dinâmica populacional de ácaros fitófagos e seus predadores em plantas de erva-mate (Ilex paraguariensis St. Hil. Aquifoliaceae). Folhas de diferentes partes da planta foram coletadas de agosto de 2001 a julho de 2002, e o [...] s ácaros presentes foram contados sob microscópio estereoscópico. Foram encontradas associadas às plantas de erva-mate duas espécies de ácaros fitófagos Dichopelmus notus Keifer, e Oligonychus yothersi (McGregor), e três espécies de predadores identificados como sendo Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp. O ácaro D. notus ocorreu em maior número na face inferior de folhas, em folhas maduras e em folhas dos estratos inferior e médio. O. yothersi predominou em folhas maduras. A concentração de E. concordis e I. zuluagai sempre foi maior na face inferior de folhas, em folhas maduras, em folhas dos estratos inferior e médio e na região interna da copa. Os ácaros D. notus, O. yothersi, E. concordis e I. zuluagai tiveram picos populacionais em período de temperatura amena e baixa precipitação pluviométrica. A maior densidade populacional de Agistemus sp. ocorreu na face inferior das folhas e seu pico populacional ocorreu em período de alta temperatura e precipitação pluviométrica elevada. Abstract in english The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samp [...] les from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain.

  6. Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)

    Scientific Electronic Library Online (English)

    M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.


    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

  7. Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests

    Directory of Open Access Journals (Sweden)

    Ivan Carlos Corso


    Full Text Available Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquisa de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93 e percevejos (4/3/93. A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também n��o foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias.A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993 or the stink bug complex (3/4/1993. Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

  8. Toxicidade de produtos fitossanitários utilizados na cultura do cafeeiro a larvas de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e efeitos sobre as fases subseqüentes do desenvolvimento do predador / Toxicity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and their effects on subsequent stages of the predator

    Scientific Electronic Library Online (English)

    Rogério A., Silva; Geraldo A., Carvalho; César F., Carvalho; Paulo R., Reis; Antônio M.A.R., Pereira; Luciano V., Cosme.


    Full Text Available Avaliou-se a seletividade fisiológica de alguns produtos fitossanitários utilizados em cafeeiro a larvas de Chrysoperla externa (Hagen) e seus reflexos nas fases subseqüentes do desenvolvimento do predador. Os tratamentos avaliados, em g i.a./L de água foram: 1- endosulfam (Thiodan 350 CE - 1,75), 2 [...] - clorpirifós (Lorsban 480 CE - 1,2), 3- betaciflutrina (Turbo 50 CE - 0,013), 4- enxofre (Kumulus 800 PM - 4,0), 5- azociclotina (Peropal 250 PM - 0,31), 6- oxicloreto de cobre (Cuprogarb 500 PM - 5,0) e 7- testemunha (água). As pulverizações foram realizadas em larvas de primeiro, segundo e terceiro ínstares de C. externa, por meio de torre de Potter. Em seguida, as larvas foram individualizadas em tubos de vidro e mantidas em câmara climatizada regulada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12h. A toxicidade dos produtos foi calculada em função do seu efeito total (E) e categorizada conforme escala proposta pela IOBC. Clorpirifós e betaciflutrina foram nocivos a larvas de primeiro ínstar (E > 99%) e os demais foram seletivos. Clorpirifós foi também tóxico a larvas de segundo e terceiro ínstares, sendo os demais compostos inócuos ao predador (E Abstract in english The objective was to evaluate the selectivity of pesticides used in coffee crops to larvae of Chrysoperla externa (Hagen) and their effects on the subsequent developmental stages of the predator. The treatments in g a.i./L of water were: 1 - endosulfan (Thiodan 350 CE - 1.75), 2 - chlorpyrifos (Lors [...] ban 480 CE - 1.2), 3 - betacyfluthrin (Turbo 50 CE - 0.013), 4 - sulphur (Kumulus 800 PM - 4.0), 5 - azocyclotin (Peropal 250 PM - 0.31), 6 - copper oxichloride (Cuprogarb 500 PM - 5.0) and 7 - control (water). The products were sprayed on first, second and third-instar larvae using a Potter's tower. The larvae were individualized in glass tubes and maintained at 25 ± 2ºC, RH of 70 ± 10% and 12h photophase. The toxicity of the pesticides was calculated based in their total effect (E) and classified according to recommendations of IOBC. Chlorpyrifos and betacyfluthrin were harmful to first-instar larvae (E > 99%). Endosulfan, sulphur, azocyclotin and copper oxichloride were harmless to first-instar larvae and the others were selective. Chlorpyrifos was also toxic to second and third-instar larvae, and the other compounds were selective (E

  9. Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker / Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural

    Scientific Electronic Library Online (English)

    MA, Medeiros; PA, Ribeiro; HC, Morais; M, Castelo Branco; ER, Sujii; ML., Salgado-Laboriau.


    Full Text Available Os predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) são frequentemente observados em cultivos de hortaliças, especialmente tomateiros, bem como sobre flores de diversas plantas próximas aos cultivos. Sabe-se que os p [...] redadores, quando se alimentam de pólen e néctar, aumentam a sua longevidade e a sua capacidade reprodutiva. O objetivo deste trabalho foi identificar as plantas que poderiam servir de fonte de pólen para as espécies selecionadas, com vistas a desenvolver estratégias para atrair e manter estas espécies em cultivos de hortaliças, especialmente de tomateiro. Adultos de C. externa (53 indivíduos) e H. convergens (43 indivíduos) foram coletados em 2005 no campo experimental da Embrapa Hortaliças, Brasília, Distrito Federal. Os insetos foram processados pelo método de acetólise e os grãos de pólen, extraídos e identificados. Um total de 11335 grãos de pólen, pertencentes a 21 famílias foi identificado para C. externa, enquanto que 46 grãos de pólen, pertencentes a dez famílias botânicas, foram identificados para H. convergens. O pólen da família Poaceae foi o mais abundante para C. externa, e o pólen da família Asteraceae foi o mais comum para H. convergens. A importância relativa do pólen de diferentes espécies de plantas como recursos alimentares para cada espécie predadora dá indicações da importância da flora dentro e no entorno da cultura para o estabelecimento das populações desses predadores e incremento do controle biológico conservativo. Abstract in english The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when p [...] redators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens and C. externa in order to develop strategies to attract and keep these predators in vegetable fields like the tomato crop. Adults of C. externa (53 individuals) and H. convergens (43 individuals) were collected in fields from 2004-2005 at Embrapa Hortaliças, Brasília, Federal District. The insects were processed by the acetolysis method and pollen from them was extracted and identified. A total of 11335 grains of pollen belonging to 21 families were extracted from C. externa. A total of 46 pollen grains belonging to ten families were extracted from H. convergens. The Poaceae family was the most abundant one for C. externa while Asteraceae was the commonest pollen for H. convergens. The importance of pollen from different plant species as a food resource for each predator species gives an indication of the importance of plant community structure inside and around crop fields for the establishment of these predator populations and to enhance conservation biological control.

  10. Efeito da suplementação de folhas de Eucalyptus urophylla no desenvolvimento e reprodução do predador Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) / Effect of supplementary feeding on Eucalyptus urophylla leaves in the development and reproduction of the predatory bug Supputius cincticeps (Stal) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Sebastião L., Assis Jr.; Teresinha V., Zanuncio; Germi P., Santos; José C., Zanuncio.


    Full Text Available Avaliou-se o efeito da alimentação suplementar de folhas de Eucalyptus urophylla, no desenvolvimento e reprodução de Supputius cincticeps (Stal) em laboratório. S. cincticeps foi alimentado com Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) ou T. molitor mais mudas de E. urophylla. A inclusão da [...] planta na alimentação de S. cincticeps, aumentou sua taxa líquida de reprodução Ro (de 7,15 para 24,05), a razão infinitesimal rm (de 0,034 para 0,052), e a razão finita de aumento populacional 1 (de 1,035 para 1,053), em relação ao uso isolado da presa. Conseguiu-se, ainda, aumentar os índices de sobrevivência, a longevidade e a expectativa de vida média para metade da população (ex50), sendo 50,8 e 64,9 dias para os percevejos alimentados com presa e com presa e planta, respectivamente. O predador S. cincticeps apresentou hábitos alimentares que incluem fitofagia e a inclusão da planta na sua dieta, foi vantajosa para a sua criação massal. Abstract in english The effect of supplementary feeding of Supputius cincticeps (Stal) on Eucalyptus urophylla leaves was evaluated in the laboratory. S. cincticeps was fed with Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) larvae or T. molitor larvae plus E. urophylla. The inclusion of this plant for S. cincticeps [...] feeding increased its net reproductive rate (Ro) from 7.15 to 24.05, its infinitesimal ratio (rm) from 0.034 to 0.052, and the finite population increase (1) from 1.035 to 1.053, compared to feeding only with the prey. S. cincticeps fed both plant and prey showed higher survival rate, longevity, and life span for half of the population (ex50), which was 50.8 and 64.9 for bugs fed the prey, and prey and plant, respectively. The inclusion of the plant also increased the reproduction rate of S. cincticeps, thus being recommended for mass rearing of this predator.

  11. Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil

    Scientific Electronic Library Online (English)

    Márla Maria, Marchetti; Noeli Juarez, Ferla.


    Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

  12. Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)

    Scientific Electronic Library Online (English)

    Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.


    Full Text Available Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

  13. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae

    Directory of Open Access Journals (Sweden)

    Daniele Cristine Hoffmann Schlesener


    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

  14. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla


    Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

  15. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil

    Scientific Electronic Library Online (English)

    Noeli Juarez, Ferla; Gilberto José de, Moraes.


    Full Text Available Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

  16. Composição faunística de insetos predadores em fragmento florestal e em área de hortaliças na região de Jaboticabal, Estado de São Paulo - DOI: 10.4025/actascibiolsci.v25i2.2015 Faunal composition of predator insects in forest fragment and area of vegetables in Jaboticabal region, state of São Paulo, Brazil - DOI: 10.4025/actascibiolsci.v25i2.2015

    Directory of Open Access Journals (Sweden)

    Luciano Kenji Sakemi


    Full Text Available Efetuou-se um levantamento populacional em área de fragmento florestal e em área de hortaliças, entre novembro de 1996 a fevereiro/1998, visando determinar as espécies de insetos predadores e a influência de fatores abióticos. A amostragem foi efetuada semanalmente por meio de armadilha luminosa, aplicando-se aos resultados análise faunística e correlação simples com temperatura, umidade relativa e precipitação. No fragmento florestal foi observado maior semelhança na abundância de espécies do que na área de hortaliças, mas neste hábitat capturou-se maior número de indivíduos (95%. As espécies Metius sp., Polpochila impressifrons (Dej., Eulissus sp. e Doru sp. foram predominantes nas duas áreas, evidenciando a importância dessas espécies como predadoras de pragas de hortaliças. Arthrostictus speciosus (Dej. e Leptotrachelus sp. predominaram no fragmento florestal, o mesmo ocorrendo com Paederus sp. na área de hortaliças. Esta espécie deve preferir locais abertos e quentes, enquanto A. speciosus e Leptotrachelus sp. podem estar melhor adaptadas para locais escuros e úmidos de florestasA population survey was carried out in a forest fragment and in an area of vegetables, from November/1996 to February/1998, aiming to determine the predator insect species and the influence of abiotic factors. The samples were taken weekly by light traps. The results were evaluated using faunistic analysis and simple correlation with temperature, relative humidity and rainfall. In the forest fragment higher similarity in the abundance of species was observed comparing to the area of vegetables, but the largest number of captured individuals (95% occurred in this last habitat. Metius sp., Polpochila impressifrons (Dej., Eulissus sp. and Doru sp. were predominant species in both areas, evidencing they may play an important role as pest predators in areas of vegetables. Arthrostictus speciosus (Dej. and Leptotrachelus sp. predominated in the forest fragment, and the same was observed with Paederus sp. in the vegetable area. This species is probably adapted for open and hot places, while A. speciosus and Leptotrachelus sp. can be adapted for dark and humid places of forests

  17. Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010

    Scientific Electronic Library Online (English)

    Héctor Guerra, Hernández.


    Full Text Available Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

  18. Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro

    Directory of Open Access Journals (Sweden)



    Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentrações que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.

  19. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Rodolfo Vargas Castilhos


    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.

  20. Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937 no controle de nematóides de bovinos

    Directory of Open Access Journals (Sweden)

    Alves P.H.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937 foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001. No grupo B (controle, as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P<0,05 do que as do grupo A e a diferença entre o OPG dos animais dos grupos A e B, no final do experimento, foi de 88,8%. O gênero Cooperia foi o mais prevalente em ambas as pastagens. Conclui-se que a aplicação de pellets de M. thaumasium na dosagem e periodicidade de aplicação usadas foi eficiente no controle de nematóides parasitos gastrintestinais de bovinos.

  1. Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae) / Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae)

    Scientific Electronic Library Online (English)



    Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e [...] Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris. Abstract in english Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae) is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveir [...] ae (Hymenoptera: Vespidae) was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90) of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

  2. Inducers of resistance in potato and its effects on defoliators and predatory insects Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores

    Directory of Open Access Journals (Sweden)



    Full Text Available The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised complete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM; and 4 - 1.15% diatomaceous earth (DE. Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM, y 4 - 1,15% tierra de diatomeas (DE. Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo.

  3. Identificação de predadores de Orphulella punctata (de Geer) (Orthoptera, Acrididae) através da serologia / Serological technique for identifying Orphulella punctata (de Geer) (Orthoptera, Acrididae) predators

    Scientific Electronic Library Online (English)

    Marta, Cassaro-Silva; José Eduardo, Serrão; Carlos, Sousa-Silva; Josué, Marques-Pacheco.


    Full Text Available [...] Abstract in english Females of Orphulella punctata (de Geer, 1794) were captured in the field and kept in cages with food and boxes filled with moist soil for oviposition. The eggs, macerated with 0,85% saline solution and centrifugated, were used as the immunizing antigen for obtention of the specific antiserum (AS-O) [...] . Rabbits were immunized by the linphonodule injection method with two injections of this antigen, with an interval of 15 days between the 1st and 2nd inoculations. Serological tests were performed using double diffusion in agar gel with homologous and heterologous antigens. Specific serological reactions were obtained 14 days after the 1st inoculation. The antiserum of the 30th day gave 5, 2-4 and 1-4 precipitation lines respectively with eggs, female and male antigen. Such differences can be attributed to the high specificity of AS-O. Positive reaction was observed with arachnids and mirmeleontids captured in the field, indicating the predation on O. punctata.

  4. Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro / Physiologic selectivity of inseticides to wasps predators of the coffee leafminer

    Scientific Electronic Library Online (English)



    Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) em concentrações que corresp [...] ondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem. Abstract in english The selectivity of the insecticides chlorpyrifos, deltamethrin, dimethoate, ethion, monocrothophos and permethrin to the predatory wasps Apoica pallens Fab., Brachygastra lecheguana Latreille and Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae) was studied, in laboratory, using 50% and [...] 100% of the dosages used for controlling the coffee leafminer, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae). Deltamethrin was selective in favour of P. versicolor versicolor and A. pallens. Ethion showed median selectivity in favour of P. versicolor versicolor and A. pallens and good selectivity to B. lecheguana. The other insecticides were not selective in favour of the predatory wasps. The order of tolerance to deltamethrin was: P. versicolor versicolor > A. pallens > B. lecheguana. To ethion, the order was: B. lecheguana > P. versicolor versicolor > A. pallens. Chlorpyrifos, deltamethrin, dimethoate, monocrothophos and permethrin presented similar toxicity to the wasps in both dosages used. On the other hand ethion reduced its impact on A. pallens and P. versicolor versicolor when applied in subdosages.

  5. Seletividade de agroquímicos ao ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.


    Full Text Available Testes de efeito adverso de agroquímicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratório, utilizando o método residual de contato com pulverização em superfície de vidro. Foram testados 42 produtos químicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reprodução do ácaro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao ácaro (combinação da mortalidade e efeito na reprodução) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram inócuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidróxido de cobre, naled, oxicloreto de cobre, óxido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao ácaro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, óleo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

  6. Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae

    Directory of Open Access Journals (Sweden)



    Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae. Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90 calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris.Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveirae (Hymenoptera: Vespidae was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90 of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

  7. Comportamento de corte e cópula do predador Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) em laboratório / Courtship and copulation behavior of the predator Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) in laboratory

    Scientific Electronic Library Online (English)

    Fernando A. C., Mendonça; Marliton R., Barreto; Sebastião, Assis Jr.; Alberto L., Marsaro Jr..


    Full Text Available [...] Abstract in english The mating behavior of the predator Supputius cincticeps (Stal) was investigated in the laboratory. Courtship and copulation descriptions were based on direct observations of 40 virgin couples. Results showed that males begun courtship by moving the antennae and walking toward females, immediately a [...] fter they noticed their presence. Then, males mounted females and tried to copulate. In many cases, males were rejected by females. When copulation was successful, males placed the edeagus into females, turned 180º and assumed a position opposite to the female.

  8. Identificação de predadores de Orphulella punctata (de Geer) (Orthoptera, Acrididae) através da serologia Serological technique for identifying Orphulella punctata (de Geer) (Orthoptera, Acrididae) predators


    Marta Cassaro-Silva; José Eduardo Serrão; Carlos Sousa-Silva; Josué Marques-Pacheco


    Females of Orphulella punctata (de Geer, 1794) were captured in the field and kept in cages with food and boxes filled with moist soil for oviposition. The eggs, macerated with 0,85% saline solution and centrifugated, were used as the immunizing antigen for obtention of the specific antiserum (AS-O). Rabbits were immunized by the linphonodule injection method with two injections of this antigen, with an interval of 15 days between the 1st and 2nd inoculations. Serological tests were performed...

  9. In vitro evaluation of nematophagous fungi patogenicity against nematode of domestic animals/ Avaliação in vitro da patogenicidade de fungos predadores de nematóides parasitos de animais domésticos

    Directory of Open Access Journals (Sweden)

    Alvimar José da Costa


    Full Text Available Biological control is a promising alternative for the control of pre-parasitic stages through the action of nematophagous fungi’s. The present study evaluated in vitro the patogenicity of both Arthrobotrys musiformis and A. conoides fungi on “infective larvae (or L3 state larvae” of Haemonchus contortus, L3 larvae of Ancylostoma spp. And larvated eggs of the nematode Ascaridia galli. Nine groups were formed: six treated groups (G1A and G2A: L3 of H. contortus; G1B and G2B: L3 of Ancylostoma spp.; G1C and G2C: larvated eggs of A. galli, being that G1 with A. musiformis and G2 with A. conoides and three untreated groups (G3A, G3B and G3C: larvae of H. contortus, Ancylostoma spp. And eggs of A. galli, respectively, without fungi. Each treatment had ten repetitions (ten Petri dishes with an average of 120 larvae of H. contortus and 200 larvae of Ancylostoma spp. and, approximately, 100 larvated A. galli eggs. The results showed A. musiformis plundered 66% and 94% of Ancylostoma spp. L3 larvae and H. contortus L3 larvae, respectively. While that A. conoides plundered 51,7% and 89,4% at the same larvae. The nematophagous fungi evaluated have not presented any predation type on A. galli larvated eggs. Afterwards, both are promising fungi as to their use for biological control of parasitic helminths of animal hosts.O controle biológico é uma alternativa promissora no controle dos estágios pré-parasitários de helmintos, por meio da ação de fungos nematófagos. Com este propósito, o presente estudo avaliou in vitro a patogenicidade dos fungos Arthrobotrys musiformis e A. conoides sobre larvas infectantes de Haemonchus contortus, Ancylostoma spp. e ovos larvados de Ascaridia galli. Foram utilizados nove grupos: seis tratamentos (G1A e G2A: L3 de H. contortus; G1B e G2B: L3 de Ancylostoma spp.; G1C e G2C: ovos larvados de A. galli, com A. musiformis (G1 e A. conoides (G2, respectivamente e três testemunhos (G3A, G3B e G3C: larvas de H. contortus, Ancylostoma spp. e ovos de A. galli, respectivamente, na ausência do fungo. Cada tratamento constou de dez repetições (placas de Petri, de 90mm de diâmetro, com média de 120 larvas de H. contortus, 200 larvas de Ancylostoma spp. e média de 100 ovos de A. galli. Os resultados demostraram que A. musiformis predou 66,33% e 94,44% das larvas infectantes de Ancylostoma spp. e H. contortus, respectivamente. Enquanto que A. conoides predou 51,76% e 89,39% das mesmas larvas. Os fungos nematófagos avaliados não apresentaram predação sobre ovos larvados de A. galli. Portanto, ambos os fungos mostraram-se promissores quanto a sua utilização no biocontrole desses helmintos parasitos de animais domésticos.

  10. Gluttonous predators: how to estimate prey size when there are too many prey Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande

    Directory of Open Access Journals (Sweden)

    MS. Araújo


    Full Text Available Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites. This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.O tamanho das presas é uma importante dimensão do nicho trófico. Em estudos de ecologia alimentar, os itens alimentares são geralmente medidos individualmente com o uso de paquímetro ou ocular micrométrica. Entre os anfíbios e répteis, há espécies que consomem grande número de itens alimentares pequenos (e.g. formigas, cupins. Esse grande número, por sua vez, torna a estimativa do tamanho das presas consumidas uma tarefa difícil. Desenvolvemos um método para colher subamostras dos conteúdos estomacais desses animais com o objetivo de obter estimativas de tamanho das presas. Especificamente, desenvolvemos um protocolo baseado em uma rotina de bootstrap que permite a obtenção de subamostras com erro de precisão de no máximo 5% e confiança de 95%. Esse método deve diminuir o esforço amostral e facilitar estudos futuros sobre os hábitos alimentares de anfíbios e répteis, além de fornecer um meio de obter estimativas precisas de tamanho de presas.

  11. Gluttonous predators: how to estimate prey size when there are too many prey / Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande

    Scientific Electronic Library Online (English)

    MS., Araújo; A., Pinheiro; SF., Reis.


    Full Text Available O tamanho das presas é uma importante dimensão do nicho trófico. Em estudos de ecologia alimentar, os itens alimentares são geralmente medidos individualmente com o uso de paquímetro ou ocular micrométrica. Entre os anfíbios e répteis, há espécies que consomem grande número de itens alimentares pequ [...] enos (e.g. formigas, cupins). Esse grande número, por sua vez, torna a estimativa do tamanho das presas consumidas uma tarefa difícil. Desenvolvemos um método para colher subamostras dos conteúdos estomacais desses animais com o objetivo de obter estimativas de tamanho das presas. Especificamente, desenvolvemos um protocolo baseado em uma rotina de bootstrap que permite a obtenção de subamostras com erro de precisão de no máximo 5% e confiança de 95%. Esse método deve diminuir o esforço amostral e facilitar estudos futuros sobre os hábitos alimentares de anfíbios e répteis, além de fornecer um meio de obter estimativas precisas de tamanho de presas. Abstract in english Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high int [...] ake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

  12. Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae, em três presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae, in three alternative preys

    Directory of Open Access Journals (Sweden)

    José Cola Zanuncio


    Full Text Available Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae catterpilars; T2 - Musca domestica (Diptera, Muscidae larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae larva. Longevity and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

  13. Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil

    Directory of Open Access Journals (Sweden)

    JMF. Penha


    Full Text Available Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima, respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável.

  14. Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil / Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil

    Scientific Electronic Library Online (English)

    JMF., Penha; LAF., Mateus.


    Full Text Available A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima [...] , respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável. Abstract in english Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and se [...] venth largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.

  15. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Rodolfo Vargas Castilhos


    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

  16. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium

    Directory of Open Access Journals (Sweden)

    Jackson Victor de Araújo


    Full Text Available The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control, the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000. In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (PA viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 (controle, os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000. No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P< 0,01 do que os animais dos grupos 2 e 3 e a diferença no final do experimento foi próxima de 100%. Os OPGs dos animais do grupo 4 permaneceram altos até o primeiro tratamento estratégico com ivermectina. Os resultados do grupo 1 e 4 diferiram significativamente (P< 0,05 daqueles dos grupos 2 e 3 a partir de dezembro de 2000. Concluiu-se que a aplicação de pellets de M. thaumasium nesta dosagem e periodicidade de aplicação tornaram os tratamentos anti-helmínticos desnecessários.

  17. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo


    Maria A Medeiros; Edison R Sujii; Helena C. Morais


    Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was ...

  18. Efeito antagônico de fungos predadores dos gêneros Monacrosporium, Arthrobotrys e Duddingtonia sobre larvas infectantes de Cooperia sp. e Oesophagostomum sp. Antagonistic effect of nematophagous fungi Monacrosporium, Arthrobotrys and Duddingtonia on infective Cooperia sp. and Oesophagostomum sp. larvae


    Araújo, J. V.; R.C.L. Assis; A.K. Campos; M.A. Mota


    Seis isolados dos fungos nematófagos Monacrosporium thaumasium (isolado NF 34A), Monacrosporium sinense (isolado SF 470), Monacrosporium appendiculatum (isolado CGI), Arthrobotrys robusta (isolado I 31), Arthrobotrys cladodes (isolado CG 719) e Duddingtonia flagrans (isolado CG 768) foram avaliados em laboratório quanto à capacidade de predar larvas infectantes de Cooperia sp. e Oesophagostomum sp. Nos testes in vitro, os fungos foram eficientes em predar os nematóides (P0,05) durante os cinc...

  19. Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)




    Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed flocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time wit...

  20. Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil


    JMF. Penha; LAF. Mateus


    Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Gr...

  1. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.


    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

  2. Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

  3. Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.


    Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 inócuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

  4. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium / Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium

    Scientific Electronic Library Online (English)

    Jackson Victor de, Araújo; Marcos Pezzi, Guimarães; Artur Kanadani, Campos; Nilo Chaves de, Sá; Priscilla, Sarti; Rafaela Carolina Lopes, Assis.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 [...] (controle), os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000). No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg) em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P Abstract in english The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (co [...] ntrol), the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000). In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg) on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (P

  5. Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos / Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937)

    Scientific Electronic Library Online (English)

    P.H., Alves; J.V., Araújo; M.P., Guimarães; R.C. L., Assis; P., Sarti; A.K., Campos.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de C [...] ynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001). No grupo B (controle), as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG) e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P Abstract in english The viability of a formulation of the fungus Monacrosporium thaumasium (Drechsler, 1937) was evaluated for the biological control of bovine gastrointestinal nematode parasites. Two groups of seven female calves each, Holstein ´ Zebu crossbred, four to six months of age, were placed in Cynodon dactil [...] on pastures. In group A, each animal received via oral 20g of pellets of M. thaumasium twice a week during a four-month period that began with the onset of the rainy season (October, 2001). In group B (control), the calves did not receive any treatment. The counts of eggs per gram of faeces (EPG) for animals of the group B were significantly greater (P

  6. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium


    Jackson Victor Araújo; Marcos Pezzi Guimarães; Artur Kanadani Campos; Nilo Chaves de Sá; Priscilla Sarti; Rafaela Carolina Lopes Assis


    The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control), the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rai...

  7. Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937)


    P.H. Alves; Araújo, J. V.; M.P. Guimarães; R.C.L. Assis; P. Sarti; A.K. Campos


    A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro...

  8. Evaluación del interés de productores ganaderos en el control selectivo y eficiente de predadores en la Patagonia Austral / Evaluation of the interest of southern Patagonian ranchers toward selective and efficient predator control methods

    Scientific Electronic Library Online (English)

    Arantxa, GARCÍA BREA; Sonia Cristina, ZAPATA; Diego Esteban, PROCOPIO; Rolando, MARTÍNEZ PECK; Alejandro, TRAVAINI.


    Full Text Available Elaboramos una encuesta con el fin de evaluar el interés de los productores ganaderos por incorporar prácticas selectivas de control basándonos en la caracterización del sistema de producción ganadera de Santa Cruz y su relación con la predación por el zorro colorado (Lycalopex culpaeus). Para los e [...] ncuestados (n = 90) la carga ovina actual está por debajo de la óptima, lo que es consistente con el hecho de que para la mayoría (73%) la ganadería sólo representa una parte de sus ingresos. El nivel de pérdida de corderos por predación de zorros colorados varía entre el 5% y el 50% de la producción anual y esta tasa se ha mantenido en los últimos años, a pesar de que el 56% de los encuestados percibe un aumento en la abundancia de zorros en sus campos en los últimos 10 años. Las actitudes negativas de los productores hacia el zorro colorado se reflejaron en el hecho de que su control continúa siendo una práctica habitual para el 73% de los encuestados incluso en establecimientos sin producción. El uso de veneno es o ha sido utilizado por la mayoría de los productores (74%) a pesar de su prohibición. Sin embargo, el 91% de los encuestados estaría dispuesto a reemplazar sus prácticas por métodos de control selectivos y eficientes. Este es un punto importante para incentivar el uso de métodos alternativos de control, como cebos tóxicos administrados selectivamente, lo que permitiría el abandono de las prácticas tradicionales tan nocivas para la conservación de la biodiversidad. Abstract in english Sheep ranchers (n = 90) were surveyed to evaluate their interest in the incorporation of predator selective control methods. We based our survey on the characterization of the sheep ranching system of Santa Cruz province and its relationship with culpeo fox (Lycalopex culpaeus) predation. For a larg [...] e percentage of producers (73%), the carrying capacity at present is under the optimal, which is consistent with the fact that sheep ranching represents only a part of their income. Lamb losses due to culpeo foxes predation vary between 5% and 50% of the annual lamb production, and these percentages did not vary during the last years in spite of the perceiving, by 53% of ranchers, of an increment in foxes abundance. Ranchers tend to exaggerate real losses of their lambs due to predation, although they recognize that there are other causes that could facilitate it. Nevertheless, fox control, including poisoning as a method, is still a current practice even in those ranches without sheep. The 90% of the sheep ranchers showed a good willingness to replace their current practices by selective and efficient control methods. This is an important point to encourage the use of selective control methods, like toxic baits delivered in a selective way, which would allow the abandonment of the traditional practices so dangerous to biodiversity conservation.

  9. Influência da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseídeos predadores associados / Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids

    Scientific Electronic Library Online (English)

    Renato A, Franco; Paulo R, Reis; Mauricio S, Zacarias; Daniel C, Oliveira.


    Full Text Available [...] Abstract in english Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O.ilicis on [...] its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark & Muma, Euseius citrifolius Denmark & Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O.ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I.zuluagai and eggs and larvae by E.citrifolius was lower. For A.herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O.ilicis altogether, webbing reduced the predation potential of I.zuluagai and E. citrifolius, but not of A. herbicolus.

  10. Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil


    Marcos Callisto; Michael D.C. Goulart; Pablo Moreno; MARTINS, ROGÉRIO P.


    Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river, at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were sampled: 61 in ...

  11. Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests; Efeito de doses e de refugio sobre a seletividade de inseticidas a predadores e parasitoides de pragas de soja

    Energy Technology Data Exchange (ETDEWEB)

    Corso, Ivan Carlos; Gazzoni, Decio Luiz; Nery, Manoel Eugenio [EMBRAPA, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja]. E-mail:


    A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the EMBRAPA-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvet bean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed. (author)

  12. Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados

    Energy Technology Data Exchange (ETDEWEB)

    Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail:; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail:; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail:; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)


    Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

  13. ClEST cluster :Cl_singleton2092 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2092 glutamate--cysteine ligase regulatory ... subunit Cimex lectularius nuclear gene 59 ... GCTTGGTCTCGCT mb12052 1 Glutamate--cysteine ligase regulatory ... subunit [Camponotus floridanus] EFN68341 1.32105E- ...

  14. ClEST cluster :Cl_singleton1907 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1907 26s proteasome non-atpase regulatory ... subunit 12 Cimex lectularius nuclear gene ... TGACCAGATGCCTA mb06054 1 26S proteasome non-ATPase regulatory ... subunit 12 [Camponotus floridanus] EFN66912 5.6027 ...

  15. ClEST cluster :Cl_singleton2329 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2329 long-chain fatty acid transport ... protein 4 Cimex lectularius nuclear gene 469 CT ... CAAGTGTTCCATAATGCT mb23072 1 Long-chain fatty acid transport ... protein 4 [Camponotus floridanus] EFN71922 1.29436 ...

  16. ClEST cluster :Cl_singleton1794 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1794 adam 17-like protease ... Cimex lectularius nuclear gene 267 CCATGCATACACGGGTTTTGTA ... ACATATCGGATAATCAATGATGAATTA fw24084 1 ADAM 17-like protease ... [Camponotus floridanus] EFN73099 1.43838E-33 GO:00 ...

  17. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  18. ClEST cluster :Cl_singleton1654 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1654 zinc ... transporter zip11-like Cimex lectularius nuclear gene 411 TTAAATGTCAACAGCG ... GGCCATATGCATTCATTCCAGCCTGTGTTGGGTTTCTACT fw20018 1 Zinc ... transporter ZIP11 [Camponotus floridanus] EFN60394 ...

  19. Ocorrência de moscas brancas (Hemiptera: Aleyrodidae) e do predador Delphastus pusillus (LeConte) (Coleoptera: Coccinellidae) em mamoeiro (Carica papaya L.) sob cultivo em ambiente protegido / Whiteflies (Hemiptera: Aleyrodidae) and the predator Delphastus pusillus (Le Conte) (Coleoptera: Coccinellidae) on papaya tree (Carica papaya L.) grown under screened conditions

    Scientific Electronic Library Online (English)

    Marineide R., Vieira; Luiz S., Correa.


    Full Text Available Em fevereiro e outubro de 1998, na área experimental da Fazenda de Ensino e Pesquisa da UNESP no município de Selvíria-MS (latitude 20° 22' S, longitude 51° 22' W, altitude 335 m), foi constatada a presença de mosca branca em mamoeiro cultivar Baixinho de Santa Amália, plantado no interior de um tel [...] ado com malha de 2 x 2 mm. Essa área fazia parte de um experimento visando determinar o efeito do cultivo em ambiente protegido sobre o desenvolvimento das plantas, a produção de frutos e a ocorrência do mosaico do mamoeiro. Nas duas ocasiões os insetos foram enviados ao Centro de Recursos Genéticos e Biotecnologia (CENARGEN) da EMBRAPA para identificação. Na primeira infestação o material foi identificado como Trialeurodes sp. e na infestação de outubro como Bemisia tabaci biótipo B . Nos dois casos havia grande quantidade de ninfas nas folhas maduras e de adultos nas folhas novas. Para Trialeurodes sp. foi realizada uma contagem de ninfas em dezoito folhas, em cinco áreas de 1 cm² por folha, distribuídas ao acaso, encontrando-se a média de 7,6 ninfas por cm². Como conseqüência da presença das duas espécies, o único dano observado foi um intenso desenvolvimento de fumagina recobrindo completamente a superfície das folhas, que acabaram por secar e cair. A infestação de B. tabaci biótipo B foi controlada pela presença de larvas e adultos do coccinelídeo Delphastus pusillus (LeConte) que alimentavam-se vorazmente das ninfas presentes. Abstract in english We report the presence of whitefly species at the Experimental Farm of UNESP, located in Selvíria, state of Mato Grosso do Sul, Brazil ( 20°22' latitude S, 51°22' longitude W, altitude 335 m), in February and October 1998. These insects were found on papaya trees cultivar Baixinho de Santa Amália, g [...] rown under screened conditions (2 mm x 2 mm mash). The goal of the original experiment was to determine the effect of growing the cultivar under a protected environment on the development of the trees, fruit production and incidence of the "papaya ringspot virus". Whitefly specimens were sent to the Center of Genetic Resources and Biotechnology (CENARGEN) of EMBRAPA, for identification. The specimens collected in February were identified as Trialeurodes sp. and those collected in October were recognized as Bemisia tabaci biotype B. In both ocasions there were great numbers of nymphs on mature leaves and of adults on young leaves. We counted the number of Trialeurodes nymphs in eighteen leaves, in five areas of 1 cm² per leaf, distributed at random, where we found an average of 7.6 nymphs/cm². The only damage associated with the presence of whitefly of both species was the intense development of `sooty molds', covering completely the leaves, which wilted and fell. The infestation of B. tabaci biotype B was controlled by larvae and adults of the coccinellid Delphastus pusillus (LeConte), which fed avidly on the whitefly nymphs.

  20. O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)

    Scientific Electronic Library Online (English)

    Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.


    Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

  1. ClEST cluster :Cl_contig0419 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...

  2. NUEVOS REGISTROS DE CANGREJOS DEL GÉNERO PALICUS (PHILIPPI, 1838)(CRUSTACEA: DECAPODA: BRACHYURA: PALICIDAE) PARA EL MAR CARIBE COLOMBIANO / New records of the crabs of the genus Palicus (Philippi, 1838) (Crustacea: Decapoda: Brachyura: Palicidae) from the Caribbean coast of Colombia

    Scientific Electronic Library Online (English)

    Adriana, Bermúdez; Norella, Cruz; Gabriel R, Navas S; Hernando, Campos.


    Full Text Available Se amplía el ámbito geográfico para Palicus floridanus y se registran por primera vez cinco especies de la familia Palicidae colectadas en el mar Caribe colombiano durante el crucero INVEMAR-Macrofauna I, entre 1998 y 1999, a lo largo de la franja superior del talud continental (300 y 500 m de profu [...] ndidad). Con las de este trabajo, en el área se han reportado seis especies: P. alternatus Rathbun, 1897; P. cursor A. Milne-Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, y P. sicus A. Milne-Edwards, 1880. En la costa caribe colombiana el único registro previo para la familia era P. alternatus. Abstract in english A new range extension of Palicus floridanus and five new records of Palicidae are presented, the samples are collected from the Colombian Caribbean coast during the cruise of INVEMAR-Macrofauna I between 1998 and 1999, along the upper continental Slope (300 and 500 m deep). Six species have now been [...] recorded from the area: P. alternatus Rathbun, 1897; P. cursor A. Milne- Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, and P. sicus A. Milne-Edwards, 1880. Previously, P. alternatus was the only member of the family reported for this area before this study.


    Directory of Open Access Journals (Sweden)



    Full Text Available En el presente artículo de investigación se demuestra que los modelos degenerados del tipo dos predadores compitiendo por una presa que se regenera los cuales son modelados por un sistema tridimensional no lineal de ecuaciones diferenciales y que satisfacen las condiciones planteadas por Butter-Farkas: los puntos de bifurcación que definen la existencia de la bifurcación Zip coinciden aún en el caso en que la respuesta funcional de los predadores son diferentes.

  4. Dinâmica populacional de bruquíneos (Coleoptera, Chrysomelidae) em Senna multijuga (Rich.) H. S. Irwin & Barneby (Caesalpinaceae) Population dynamics of bruchines (Coleoptera, Chrysomelidae) in Senna multijuga (Rich.) H. S. Irwin & Barneby (Caesalpinaceae)


    Lisiane Taiatella Sari; Cibele Stramare Ribeiro-Costa; James J. Roper


    Senna multijuga (Rich.) H. S. Irwin & Barneby (Caesalpinaceae) é uma planta ornamental comum no sudeste do Brasil, suscetível ao dano por bruquíneos predadores de sementes. Com o objetivo de identificar os predadores de suas sementes e determinar seus ciclos populacionais, frutos de cinco árvores foram coletados em 2000 e 2001 e acondicionados em casa de vegetação até a emergência de adultos. Os bruquíneos foram identificados como Sennius crudelis Ribeiro-Costa & Reynaud, 1998, S. puncticolli...

  5. Parasitismo natural em ovos crisopídeos Natural egg parasitism of chrysopids


    Maria Alice Medeiros


    Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os objetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliças, em camp...

  6. Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae

    Directory of Open Access Journals (Sweden)

    Renan N. Costa


    Full Text Available Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impalatabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824, podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto, somente pistas químicas (experimento de risco indireto e ausência completa de sinais de predadores (controle. Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos.

  7. Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae

    Directory of Open Access Journals (Sweden)

    Walkymário Paulo Lemos


    Full Text Available Attack behavior of the predator Podisus rostralis (Stäl (Heteroptera: Pentatomidae adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack behavior: (1 Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2 Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl (Heteroptera: Pentatomidae tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae. Dez adultos do predador, com 24 horas de idade, foram observados durante duas horas acompanhando-se os seguintes comportamentos de ataque: (1 Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2 Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas.

  8. Discovery of Defense- and Neuropeptides in Social Ants by Genome-Mining


    Gruber, Christian W.; Muttenthaler, Markus


    Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant), Camponotus floridanus (carpenter ant) and Harpegnathos saltator (basal genus). Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulato...

  9. Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

    Directory of Open Access Journals (Sweden)

    Wernegreen Jennifer J


    Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

  10. Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB) after Fungal and Phosphoric Acid Pretreatment


    Mohammad J Taherzadeh; Muhammad N. Cahyanto; Claes Niklasson; Ria Millati; Siti Syamsiah; Mofoluwake M. Ishola; Isroi


    Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydra...

  11. Nestmate recognition in ants is possible without tactile interaction


    Brandstaetter, Andreas Simon; Endler, Annett; Kleineidam, Christoph


    Ants of the genus Camponotus are able to discriminate recognition cues of colony members (nestmates) from recognition cues of workers of a different colony (non-nestmates) from a distance of 1 cm. Free moving,individual Camponotus floridanus workers encountered differently treated dummies on a T-bar and their behavior was recorded. Aggressive behavior was scored as mandibularthreat towards dummies. Dummies were treated with hexane extracts of postpharyngeal glands (PPGs) from nestmates or non...

  12. Anisaldehyde production and aryl-alcohol oxidase and dehydrogenase activities in ligninolytic fungi of the genus Pleurotus.


    A. Gutiérrez; Caramelo, L; Prieto, A.; Martínez, M.J.; Martínez, A.T.


    A variety of simple aromatic compounds were identified in liquid cultures of the basidiomycetes Pleurotus cornucopiae, P. eryngii, P. floridanus, P. pulmonarius, P. ostreatus, and P. sajor-caju by using gas chromatography-mass spectrometry. Such compounds were detected in fungal cultures on lignin- and straw-containing media, but it was found that they were also produced in the absence of aromatic precursors. Anisylic and hydroxybenzylic compounds (such as alcohols, aldehydes, and acids) were...

  13. Estudos anatômicos e histológicos sôbre a subfamília Triatominae (Heteroptera, reduviidae): XIX parte: estudo comparado das mandíbulas de vários Triatominae e outros Reduviidae

    Scientific Electronic Library Online (English)

    Rudolf, Barth.


    Full Text Available Descreve-se, nesta publicação, as mandíbulas de 8 espécies de Triatominae e de 8 de outros Heteroptera, do grupo dos predadores, focalizando a forma e a armação da parte apical. Os caracteres permitem diferenciar entre um tipo hematófago e um predador. Nos hematófagos conseguimos diferenciar os 3 gê [...] neros estudados pela forma e armação das mandíbulas; não é possível, porém, a classificação das espécies pelas mandíbulas, porque as diferenças, sendo mesmo específicas, não são suficientemente significativas. Forma e armação dos estiletes dos dois tipos estão relacionadas, diretamente, com os costumes dos animais no ato de alimentação.

  14. Predation on Leptinopterus Hope species (Coleoptera, Lucanidae by three species of Reduviidae (Hemiptera, Heteroptera in the Atlantic Forest, Brazil

    Directory of Open Access Journals (Sweden)

    Paschoal Grossi


    Resumo. Relata-se a ocorrência de predação natural de Leptinopterus burmeisteri Arrow e Leptinopterus femoratus (Olivier (Coleoptera, Lucanidae, Lucaninae por Zelurus angularis (Stål (Reduviinae, Apiomerus mutabilis Costa Lima, Seabra & Hathaway e Apiomerus nigricollis Stål (Apiomerinae (Hemiptera, Reduviidae no Estado de São Paulo, Brasil. Dados adicionais sobre hábitos predadores de A. nigricollis são apresentados também.

  15. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate

    Directory of Open Access Journals (Sweden)

    Maria Alice de Medeiros


    Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick (Lep.: Gelechiidae está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1 coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2 exposição de ovos sentinelas no campo por 72 horas; 3 ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3, evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate.



    Erich H Rudolph


    Se ha revisado la bibliografía que existe sobre Samastacus spinifrons junto a otros datos accesibles al autor, con el objetivo de actualizar el conocimiento biológico de la especie. Se analiza y se entrega información sobre: sistemática, distribución geográfica, hábitat, características fisicoquímicas del agua, variación morfológica, tamaño, relación talla-peso, biología reproductiva, estructura demográfica, migraciones, hábitos alimentarios, predadores, epibiontes, enfermedades, métodos de c...


    Directory of Open Access Journals (Sweden)

    José H. Pedrosa-Macedo


    Full Text Available Com o objetivo de verificar a distribuição, independente do efeito de cada componente, contou-se posturas, larvas sadias, predadas ou parasitadas de Oncideres impluviata em galhos de bracatinga (Mimosa scabrella Benth.. O levantamento foi realizado no período de 1984/85, em Almirante Tamandaré, Paraná. Para o estudo da distribuição das larvas e de imimigos naturais foi medida a distância da base do galho até o ponto onde se encontrava cada larva sadia ou parasitada, galeria vazia ou predador. Os resultados demostraram que as larvas se concentram a partir dos 10,0 cm do ponto base do galho, estendendo-se até 40,0 cm, com uma concentração máxima entre 10,0 e 20,0 cm. Os predadores e parasitas apresentam uma concentração não coincidente, sendo que os parasitas concentram-se entre 20, e 30,0 cm e os predadores entre 10,0 e 20,0 cm a partir da base. Pelos resultados obtidos conclui-se que as larvas se estabelecem numa posição onde encontram as melhores condições de sobrevivência, ao passo que os parasitas e predadores estão na depend~encia das condições intrinsecas de cada espécie em função das condições ideais da fase de desenvolvimento dos hospedeiros ou presas.

  18. Modelo matemático para la enfermedad del dengue


    Mosquera, Luis; Perea, Milton


    En este artículo describimos la dinámica de transmisión de unserotipo de virus del dengue, incluyendo el control biológico del vector hembra adulto (de Aedes Aegypti) mediante un predador acuático.

  19. Parasites of cottontail rabbits of southern Illinois. (United States)

    Lepitzki, D A; Woolf, A; Bunn, B M


    Fifteen species of parasites including Haemaphysalis leporispalustris, Ixodes dentatus, Amblyomma americanum, Cediopsylla simplex, Odontopsyllus multispinosus, Cuterebra sp., Obeliscoides cuniculi, Trichostrongylus calcaratus, Trichostrongylus affinis, Longistriata noviberiae, Dermatoxys veligera, Trichuris sp., Mosgovoyia sp., Taenia pisiformis, and Hasstilesia tricolor as well as coccidia oocysts were collected from 96 cottontail rabbits (Sylvilagus floridanus) confined to a pen in southern Illinois in 1983 and 1984. The diversity of parasites and the intensities of infections were similar to published reports on free-ranging populations. Most variations in parasite abundances were attributable to season. Few lesions were seen in association with parasitism. PMID:1491303

  20. On the relation amongst limnological factors and fish abundance in reservoirs at semiarid region / Relação entre características limnológicas e abundância de peixes em reservatórios da região semiárida

    Scientific Electronic Library Online (English)

    Ronaldo César, Gurgel-Lourenço; Carlos Alberto de Sousa, Rodrigues-Filho; Ronaldo, Angelini; Danielle Sequeira, Garcez; Jorge Iván, Sánchez-Botero.


    Full Text Available Objetivo: Avaliar os possíveis padrões temporais nictemerais e sazonais na assembleia íctica em relação a aspectos limnológicos e fatores bióticos em dois reservatórios no semiárido Nordeste do Brasil. Métodos Peixes foram amostrados com redes de espera em ciclos nictemerais nos períodos seco e chu [...] voso em dois reservatórios (Paulo Sarasate /PS e Edson Queiroz /EQ). O conteúdo estomacal das espécies predadoras foi avaliado. As variáveis limnológicas foram submetidas a uma PCA, enquanto suas relações com a abundância de peixes foi determinada por uma CCA. Padrões temporais relativos à abundância de espécies de peixes foram detectados com nMDS. Resultados Temperatura e oxigênio dissolvido segregaram fisico-quimicamente os reservatórios. Níveis de turbidez e clorofila-a diferiram entre os períodos do ano, e a abundância relativa das espécies diferiram entre os reservatórios. Predadores foram mais abundantes no PS, enquanto detritívoros foram mais abundantes no EQ. Triportheus signatus e Plagioscion squamosissimus foram as espécies mais abundantes em ambos os reservatórios. No geral, a abundância de predadores foi positivamente relacionada com altas temperaturas e oxigênio dissolvido (PS>EQ) e negativamente associada com turbidez. Os padrões de atividades de P. squamosissimus não podem ser explicados por flutuações nas variáveis ambientais. Espécies não predadoras tenderam a se agruparem aos vetores clorofila-a, pH e turbidez. Predadores apresentaram dieta mais diversificada no PS de acordo com a disponibilidade de alimento, enquanto predadores no EQ consumiram somente peixe e camarão. Padrões nictemerais variaram para algumas espécies dependendo do reservatório. Em geral, no PS predadores foram mais ativos durante as horas iluminadas do dia, enquanto não predadores foram mais ativos após o escurecer. Entretanto, no EQ predadores e não predadores mostraram padrões nictemerais de atividades similares. Independentemente do reservatório, predadores foram mais abundantes no período chuvoso. Nenhuma tendência sazonal foi observada para espécies não predadoras. Conclusões Diferenças limnológicas entre PS e EQ influenciaram padrões temporais na abundância das espécies. Abstract in english Aim: To evaluate possible nycthemeral and seasonal temporal patterns in fish assemblage associated with limnological aspects and biotic factors in two reservoirs in semarid Northeastern Brazil. Methods Fish were sampled with gillnets in nycthemeral cycles throughout the dry and rainy season in two [...] reservoirs (Paulo Sarasate/PS and Edson Queiroz/EQ). The stomach contents of the predator species were surveyed. The limnological variables were submitted to principal components analysis, while their relation to fish abundance was determined by canonical correspondence analysis. Temporal patterns in relative fish species abundance were detected with nMDS. Results Temperature and dissolved oxygen levels segregated the reservoirs physico-chemically. Turbidity and chlorophyll-a levels differed between seasons, and the relative abundance of species differed between the reservoirs. Predators were more abundant in PS, while detritivores were more abundant in EQ. Triportheus signatus and Plagioscion squamosissimus were the most abundant species in both reservoirs. In general, predator abundance was positively associated with high temperature and dissolved oxygen (PS>EQ) and negatively associated with turbidity. The activity patterns of P. squamosissimus could not be explained by fluctuations in environmental variables. Non-predators tended to cluster around the vectors chlorophyll-a, pH and turbidity. Predators had a more diversified diet in PS in accordance with food availability, while predators in EQ ate only fish and shrimp. Nycthemeral patterns varied for the same species depending on the reservoir. Generally, in PS predators were more active during daylight hours while non-predators were more active after dark. However, in EQ predators and non-predators displayed

  1. Zoophytophagy in predatory Hemiptera

    Directory of Open Access Journals (Sweden)

    Jorge Braz Torres


    Full Text Available Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variability in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase and herbivores taking prey (peptidase.Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sobre enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase e percevejos fitófagos alimentarem de presas (peptidase.

  2. Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)

    Scientific Electronic Library Online (English)

    Renan N., Costa; Fausto, Nomura.


    Full Text Available Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impala [...] tabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto), somente pistas químicas (experimento de risco indireto) e ausência completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

  3. Zoophytophagy in predatory Hemiptera

    Scientific Electronic Library Online (English)

    Jorge Braz, Torres; David W., Boyd.


    Full Text Available Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sob [...] re enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase) e percevejos fitófagos alimentarem de presas (peptidase). Abstract in english Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variabilit [...] y in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase) and herbivores taking prey (peptidase).

  4. Influence of customized cooking methods on the phenolic contents and antioxidant activities of selected species of oyster mushrooms (Pleurotus spp.). (United States)

    Tan, Yee-Shin; Baskaran, Asweni; Nallathamby, Neeranjini; Chua, Kek-Heng; Kuppusamy, Umah Rani; Sabaratnam, Vikineswary


    Nutritional value of cooked food has been considered to be lower compared to the fresh produce. However, many reports showed that processed fruits and vegetables including mushrooms may retain antioxidant activity. Pleurotus spp. as one of the edible mushroom are in great demand globally and become one of the most popular mushrooms grown worldwide with 25-fold increase in production from 1960-2009. The effects of three different cooking methods (boiling, microwave and pressure cooking) on the antioxidant activities of six different types of oyster mushrooms (Pleurotus eryngii, P citrinopileatus, P. cystidiosus P. flabellatus, P. floridanus and P. pulmonarius) were assessed. Free radical scavenging (DPPH) and reducing power (TEAC) were used to evaluate the antioxidant activities and the total phenolic contents were determined by Folin-Ciocalteu reagent. Pressure cooking improved the scavenging abilities of P. floridanus (>200 %), P. flabellatus (117.6 %), and P. pulmonarius (49.1 %) compared to the uncooked samples. On the other hand, the microwaved Pleurotus eryngii showed 17 % higher in the TEAC value when compared to the uncooked sample. There was, however, no correlation between total phenolic content and antioxidant activities. There could be presence of other bioactive components in the processed mushrooms that may have contributed to the antioxidant activity. These results suggested that customized cooking method can be used to enhance the nutritional value of mushrooms and promote good health. PMID:25892809

  5. Nestmate recognition in ants is possible without tactile interaction (United States)

    Brandstaetter, Andreas Simon; Endler, Annett; Kleineidam, Christoph Johannes


    Ants of the genus Camponotus are able to discriminate recognition cues of colony members (nestmates) from recognition cues of workers of a different colony (non-nestmates) from a distance of 1 cm. Free moving, individual Camponotus floridanus workers encountered differently treated dummies on a T-bar and their behavior was recorded. Aggressive behavior was scored as mandibular threat towards dummies. Dummies were treated with hexane extracts of postpharyngeal glands (PPGs) from nestmates or non-nestmates which contain long-chain hydrocarbons in ratios comparable to what is found on the cuticle. The cuticular hydrocarbon profile bears cues which are essential for nestmate recognition. Although workers were prevented from antennating the dummies, they showed significantly less aggressive behavior towards dummies treated with nestmate PPG extracts than towards dummies treated with non-nestmate PPG extracts. In an additional experiment, we show that cis-9-tricosene, an alkene naturally not found in C. floridanus’ cuticular profile, is behaviorally active and can interfere with nestmate recognition when presented together with a nestmate PPG extract. Our study demonstrates for the first time that the complex multi-component recognition cues can be perceived and discriminated by ants at close range. We conclude that contact chemosensilla are not crucial for nestmate recognition since tactile interaction is not necessary.

  6. Consumo alimentar de Chrysoperla externa sobre as diferentes fases de desenvolvimento de Dysmicoccus brevipes, em laboratório

    Directory of Open Access Journals (Sweden)

    Gonçalves-Gervásio Rita de Cássia Rodrigues


    Full Text Available Estudou-se o consumo e preferência alimentar de larvas de Chrysoperla externa Hagen, 1861 (Neuroptera: Chrysopidae em laboratório à temperatura de 25±2°C, 70±10% UR e 12 horas de fotofase, utilizando como presa a cochonilha-do-abacaxi (Dysmicoccus brevipes Cockerell, 1893, Hemiptera: Pseudococcidae. Durante a fase larval do predador foram consumidas, em média, 70, 50 e 15,8 cochonilhas do primeiro, segundo e terceiro ínstar, respectivamente, e 10 fêmeas adultas, num total de 145,8 indivíduos. Do número total de cochonilhas, 51% foram consumidos durante o terceiro ínstar do predador. O alto número de cochonilhas consumido demonstra que a C. externa apresenta potencial para ser utilizada no controle biológico da cochonilha D. brevipes.

  7. Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera na Serra dos Carajás, Pará, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajás, Pará state, Brazil

    Directory of Open Access Journals (Sweden)

    Cecília Lomônaco


    Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predação e a existência de defesas contra a ação de predadores. Foi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

  8. A força de um olhar a partir do sul

    Scientific Electronic Library Online (English)

    Laura Cavalcante, Padilha.


    Full Text Available O artigo se debruça sobre um conjunto de quatro obras do escritor angolano Pepetela, a saber, Muana Puó (1969); Mayombe (1971); A geração da utopia (1992) e Predadores (2005). Partindo da primeira delas, Muana Puó, abordar-se-á o fato de que em tais obras se dá, além do enlace entre o estético e o é [...] tico, um encadeamento de ordem temática pelo qual se evidencia, de modo cada vez mais acidamente crítico e contundente, o projeto político do autor e seu compromisso com os imperativos que o movem. Tais imperativos acabam, quase sempre, por conflitar com a ordem política hegemônica em seu país, antes e depois da independência de 1975, como mostrará a leitura de Predadores, romance-fecho do percurso proposto e do próprio artigo. Abstract in english This article focuses on a set of four works of the Angolan writer Pepetela, namely, Muana Puó (1969); Mayombe (1971); A geração da utopia (1992) and Predadores (2005). Beginning with the first one, Muana Puó, we think by the fact that in such books there is, besides the enlace of esthetical and ethi [...] cal, a linkage in thematic order in which is clear, by a developing citric criticism and positive way, the political project of the author and his commitment to the imperatives that move him. Those imperatives happens to, almost always, be in conflict to the hegemonic policy in his country, before and after the independence in 1975, as will be shown when we read Predadores, romance-closure of the route proposed and the actual article.

  9. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system


    Maria Alice Medeiros; Edison Ryoiti Sujii; Helena Castanheira de Morais


    A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema o...

  10. Inseticidas seletivos à tesourinha Doru luteipes (Scudder utilizados no controle do pulgão verde em brássicas

    Directory of Open Access Journals (Sweden)

    Bacci Leandro


    Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer (Homoptera: Aphididae, em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes, dimetoato (para adultos e ninfas de primeiro e segundo estádios, paratiom metílico (para ninfas de primeiro e terceiro estádio e acefato (para adultos, apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae.

  11. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae) from dry forest in Brazil and new occurrence records for other Heimbrinae Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae) de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae


    Daniell Rodrigo Rodrigues Fernandes; Rogéria Inês Rosa Lara; Nelson Wanderley Perioto


    The geographic ranges of Heimbra opaca (Ashmead, 1894), H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil) of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil). Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae) is described, illustrated...

  12. Histomorfologia do órgão acessório de perfuração de Thais haemastoma (Mollusca, Gastropoda) Histology of the accessory boring organ in Thais haemastoma (Mollusca, Gastropoda)


    Ana Valêsca P. Lima; Inês X. Martins


    Os representantes da família Thaididae são organismos predadores de outros moluscos, perfurando suas conchas pela ação alternada de secreção oriunda do "Accessory Boring Organ" (ABO) e por raspagem através da rádula. Nesta família, o ABO está localizado na porção ventral mediano-anterior do pé. Os animais examinados neste estudo foram coletados na praia do Futuro, Fortaleza, em seguida levados ao laboratório para fixação e posterior tratamento histológico rotineiro. A porção glandular do ABO ...

  13. Predação de ninhos de Trachemys dorbigni (Duméril & Bibron) (Testudines, Emydidae) no extremo sul do Brasil Nest predation of Trachemys dorbigni (Duméril & Bibron) (Testudines, Emydidae) in Southern Brazil


    Fernanda A. Gonçalves; Sonia Z. Cechin; Alex Bager


    Ninhos da tartaruga tigre-d'água, Trachemys dorbigni, foram monitorados durante a estação reprodutiva de 2005/2006 para avaliar as taxas de predação e a variação temporal destas; identificar as espécies predadoras, sua importância na destruição dos ninhos e determinar a influência da dispersão dos ninhos sobre a predação, no extremo sul do Brasil. Dos 58 ninhos monitorados, 98% (n = 57) foram destruídos por predadores. Eventos de predação ocorreram predominantemente nas primeiras 48 horas apó...

  14. The chemistry of antipredator defense by secondary compounds in neotropical lepidoptera: facts, perspectives and caveats

    Scientific Electronic Library Online (English)

    José R., Trigo.


    Full Text Available Defesas químicas em lepidópteros contra predadores têm sido observadas desde o século XIX. O caso clássico de proteção química contra predadores é o da borboleta monarca, Danaus plexippus, cuja larva seqüestra cardenolidas de sua planta hospedeira Asclepias curassavica e transfere-as para os adultos [...] tornando-os impalatáveis para pássaros. Entretanto diversas outras substâncias podem estar envolvidas na proteção química de lepidópteros neotropicais (glicosídeos iridóides, glicosídeos cianogênicos, glicosinolatos, alcalóides pirrolizidínicos e tropânicos, ácidos aristolóquicos, inibidores de glicosidase, pirazinas). Esses compostos podem ser seqüestrados da planta hospedeira larval, obtidos de fontes vegetais visitadas por adultos ou biossintetizados de novo. Os lepidópteros conhecidos como impalatáveis para predadores vertebrados e/ou invertebrados são as borboletas Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae e Acraeinae (Nymphalidae) e mariposas Arctiidae. Entretanto informações sobre as substâncias que são responsáveis pela impalatabilidade e como elas são adquiridas nem sempre são obtidas. Esse artigo de revisão aborda principalmente observações de campo e laboratório sobre a rejeição de borboletas e mariposas neotropicais por predadores, correlações entre impalatabilidade e substâncias químicas encontradas nos insetos e bioensaios que demonstrem a atividade dessas substâncias contra predadores. Perspectivas são sugeridas para esses tópicos. Abstract in english Chemical defense against predation in butterflies and moths has been studied since nineteenth century. A classical example is that of the larvae of the monarch butterfly Danaus plexippus, which feed on leaves of Asclepias curassavica (Asclepiadaceae), sequestering cardenolides. The adults are protec [...] ted against predation by birds. Several other substances may be involved in chemical defense, such as iridoid glycosides, cyanogenic glycosides, glucosinolates, pyrrolizidine and tropane alkaloids, aristolochic acids, glycosidase inhibitors and pyrazines. The acquisition of these substances by lepidopterans can be due to sequestration from larval or adult host plants or de novo biosynthesis. Many Lepidoptera are known to be unpalatable, including the butterflies Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae and Acraeinae (Nymphalidae), and Arctiidae moths, but knowledge of the chemical substances responsible for property is often scarce. This review discusses mainly three topics: field and laboratory observations on rejection of butterflies and moths by predators, correlation between unpalatability and chemicals found in these insects, and bioassays that test the activity of these chemicals against predators. Perspectives and future directions are suggested for this subject.

  15. Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen) juveniles exposed to waterborne ammonia

    Scientific Electronic Library Online (English)

    Paula, Weber; Carina, Vogel; Carla, Lang; Bernardo, Baldisserotto.

    Full Text Available Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferent [...] es concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie. Abstract in english Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predatio [...] n. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.

  16. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia

    Directory of Open Access Journals (Sweden)

    Mueller Martin J


    Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.

  17. Avaliação da infestação e diversidade de Teredinidae (Mollusca - Bivalvia ao longo da costa do estado do Rio de Janeiro, Brasil Evaluation of the infestation and diversity of Teredinidae (Mollusca - Bivalvia along the coast of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Andrea de O. R. Junqueira


    Full Text Available In order to evaluate the diversity and infestation level of Teredinidae wood-boring molluscs, ten satations were chosen along the coast of Rio de Janeiro State. Using five pine-wood panels in each station, it was possible to distinguish five areas according to species dominance. Ilha Grande Bay is characterized by the dominance of Lyrodus floridanus (Bartsch, 1922; Sepetiba Bay, by Bankia fimbriatula Moll & Roch, 1931, Tijuca Lagoon by Teredo navalis Linnaeus, 1758; Guanabara Bay by Notoredo knoxi (Bartsch, 1917 and Araruama Lagoon by Teredo furcifera Martens, 1894. Specific composition and dominance of these species were due mainly to abiotic factors such as salinity whereas infestation level was associated not only to salinity but also to other factors such as the quantity and quality of fouling, the presence of larval dispersion focus and the wood supply in each area.

  18. Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica

    Directory of Open Access Journals (Sweden)

    Cedar I García-Ríos


    Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la documentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.

  19. [Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica]. (United States)

    García-Ríos, Cedar I; Alvarez-Ruiz, Migdalia


    Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulata (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). PMID:21516641

  20. Syllidae (Annelida, Polychaeta) from the Caribbean coast of Venezuela (United States)

    Liñero-Arana, Ildefonso; Díaz Díaz, Oscarn


    Abstract Venezuela possesses a great variety of coastal environments allowing for a high diversity of marine species. However, systematic studies on marine invertebrates are scarce, especially on polychaetes. The family Syllidae is poorly known, and only 14 genera and 42 species have been reported from this country. A total of 13 genera and 26 species the Syllidae were identified from benthic samples collected on different substrata of the northeastern coast of Venezuela. Of these, seven genera and 16 species constitute new records for Venezuela: Odontosyllis guillermoi, Syllides floridanus, Salvatoria clavata, Salvatoria limbata, Sphaerosyllis longicauda, Parapionosyllis longicirrata, Trypanosyllis parvidentata, Trypanosyllis vittigera, Opisthosyllis sp., Syllis amica, Syllis armillaris, Syllis gracilis, Syllis pseudoarmillaris, Syllis vittata, Parasphaerosyllis indica and Myrianida convoluta. PMID:21998503

  1. Cuticular Hydrocarbon Pheromones for Social Behavior and Their Coding in the Ant Antenna

    Directory of Open Access Journals (Sweden)

    Kavita R. Sharma


    Full Text Available The sophisticated organization of eusocial insect societies is largely based on the regulation of complex behaviors by hydrocarbon pheromones present on the cuticle. We used electrophysiology to investigate the detection of cuticular hydrocarbons (CHCs by female-specific olfactory sensilla basiconica on the antenna of Camponotus floridanus ants through the utilization of one of the largest family of odorant receptors characterized so far in insects. These sensilla, each of which contains multiple olfactory receptor neurons, are differentially sensitive to CHCs and allow them to be classified into three broad groups that collectively detect every hydrocarbon tested, including queen and worker-enriched CHCs. This broad-spectrum sensitivity is conserved in a related species, Camponotus laevigatus, allowing these ants to detect CHCs from both nestmates and non-nestmates. Behavioral assays demonstrate that these ants are excellent at discriminating CHCs detected by the antenna, including enantiomers of a candidate queen pheromone that regulates the reproductive division of labor.

  2. Cuticular Hydrocarbon Pheromones for Social Behavior and Their Coding in the Ant Antenna. (United States)

    Sharma, Kavita R; Enzmann, Brittany L; Schmidt, Yvonne; Moore, Dani; Jones, Graeme R; Parker, Jane; Berger, Shelley L; Reinberg, Danny; Zwiebel, Laurence J; Breit, Bernhard; Liebig, Jürgen; Ray, Anandasankar


    The sophisticated organization of eusocial insect societies is largely based on the regulation of complex behaviors by hydrocarbon pheromones present on the cuticle. We used electrophysiology to investigate the detection of cuticular hydrocarbons (CHCs) by female-specific olfactory sensilla basiconica on the antenna of Camponotus floridanus ants through the utilization of one of the largest family of odorant receptors characterized so far in insects. These sensilla, each of which contains multiple olfactory receptor neurons, are differentially sensitive to CHCs and allow them to be classified into three broad groups that collectively detect every hydrocarbon tested, including queen and worker-enriched CHCs. This broad-spectrum sensitivity is conserved in a related species, Camponotus laevigatus, allowing these ants to detect CHCs from both nestmates and non-nestmates. Behavioral assays demonstrate that these ants are excellent at discriminating CHCs detected by the antenna, including enantiomers of a candidate queen pheromone that regulates the reproductive division of labor. PMID:26279569

  3. Diversidad y microestructura de quitones (Mollusca: Polyplacophora) del Caribe de Costa Rica

    Scientific Electronic Library Online (English)

    Cedar I, García-Ríos; Migdalia, Álvarez-Ruiz.


    Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la do [...] cumentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon, 1886); S. purpurascens (C.B. Adams, 1845); Acanthopleura granulata (Gmelin, 1791); Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893). Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889). Abstract in english Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four coll [...] ection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulate (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). Rev. Biol. Trop. 59 (1): 129-136. Epub 2011 March 01.

  4. Diversidad y microestructura de quitones (Mollusca: Polyplacophora del Caribe de Costa Rica

    Directory of Open Access Journals (Sweden)

    Cedar I García-Ríos


    Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la documentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon, 1886; S. purpurascens (C.B. Adams, 1845; Acanthopleura granulata (Gmelin, 1791; Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893. Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889.Diversity and microstructure of quitons (Mollusca: Polyplacophora from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845; Ischnoplax pectinata (Sowerby 1840; Stenoplax boogii (Haddon 1886; S. purpurascens (C.B. Adams 1845; Acanthopleura granulate (Gmelin 1791; Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893. This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889. Rev. Biol. Trop. 59 (1: 129-136. Epub 2011 March 01.

  5. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação

    Scientific Electronic Library Online (English)

    Cristiano S. de, Azevedo; Robert J., Young.


    Full Text Available As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

  6. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação

    Directory of Open Access Journals (Sweden)

    Cristiano S. de Azevedo


    Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

  7. Fish ladders: safe fish passage or hotspot for predation?

    Scientific Electronic Library Online (English)

    Angelo Antonio, Agostinho; Carlos Sergio, Agostinho; Fernando Mayer, Pelicice; Elineide Eugênio, Marques.


    Full Text Available Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladd

  8. Mites and leaf domatia: no evidence of mutualism in Coffea arabica plants / Ácaros e domácias foliares: sem evidências de mutualismo em plantas de Coffea arabica

    Scientific Electronic Library Online (English)

    Gustavo Quevedo, Romero; Rodrigo Damasco, Daud; Adriana Trevizoli, Salomão; Luiz Fernando, Martins; Reinaldo José Fazzio, Feres; Woodruff Whitman, Benson.


    Full Text Available Domácias são pequenas estruturas presentes na junção entre as nervuras principal e secundárias das folhas de muitas espécies de plantas, que podem mediar interações mutualísticas entre ácaros e plantas. Em experimento, nós bloqueamos as domácias em formato de covas de folhas novas e velhas de Coffea [...] arabica L. com gotas de resina, a fim de investigar o seu papel i) na abundância de ácaros na comunidade e ii) nos danos foliares. Mais de 77% dos ácaros coletados são predadores, enquanto 19 e 3,3% são onívoros e fitófagos, respectivamente. Não houve influência do bloqueio das domácias tanto na abundância quanto nos danos foliares. Entretanto, os ácaros predadores e micófagos foram mais abundantes nas folhas novas do que nas velhas; os ácaros fitófagos ocorreram em pequena densidade e ocuparam somente as plantas com domácias abertas. A ausência de mutualismo entre os ácaros e plantas de C. arabica pode ter ocorrido porque as entradas das domácias analisadas eram muito pequenas, não permitindo a entrada dos predadores fitoseídeos nessas estruturas. Abstract in english We conducted experiments by blocking off pit-like domatia from old and new leaves of Coffea arabica L., using tiny resin drops, to investigate the role of domatia on i) mite abundance at the community level and on ii) leaf damages. More than 77% of the mites collected were predators, whereas 19 and [...] 3.3% were omnivores and phytophages, respectively. Domatia blockage treatment had no influence either on mite abundances or leaf damages. However, predatory and omnivorous mites were more abundant on new than on the old leaves; phytophagous mites occurred at very low density and occupied only plants having open domatia. The absence of mutualism between mites and C. arabica probably occurred because the entrances of domatia were too small and did not enable the entry of fitoseid predators in these structures.

  9. Dinámica trófica, estrategias de consumo y alteraciones óseas en la sabana africana: resumen de un proyecto de investigación etoarqueológico (1991-1993

    Directory of Open Access Journals (Sweden)

    Domínguez-Rodrigo, Manuel


    Full Text Available The main results of a broad etho-archaeological research carried out in East Africa are succintly exposed. These provide an accurate explanation of the behavior exhibited by the main savanna and steppe predators with regard fo the process of carcass consumption, thereby creating a referential framework that can be useful for taphonomists. Carnivore behavior is accounted for in terms of its contextual variability, due to the changing selective pressure according to trophic dynamics. Therefore, the adaptive patterns of each predator are discussed and special emphasis is laid on the role played by ecology in shaping their behavior. Initial consumption strategies, bone accumulating agencies and contexts, the predatory range of each predator and bone modification patterns are the main subjects treated. As an innovative complement to these issues, the spatial analysis of bon

    Se exponen los principales resultados de un amplio proyecto de investigación etoarqueológica llevado a cabo en África oriental. Estos sirven de base para la interpretación del comportamiento de los predadores de sabana y estepa, con respecto al proceso de consumo de sus presas, creando al mismo tiempo un marco referencial de gran utilidad para la Tafonomía. El comportamiento de los carnívoros se explica en términos de su variabilidad contextual, debida a la modificación de la presión selectiva según la dinámica trófica. Por consiguiente, se discuten los principales patrones adaptativos de estos predadores y se pone especial énfasis en el papel jugado por la ecología en la conducta que exhibe cada uno de ellos. Las principales cuestiones tratadas son las estrategias iniciales de consumo, los agentes y contextos que generan acumulaciones óseas, el espectro cinegético de cada carnívoro y los patrones de alteración ósea. Como complemento innovador a estos temas, se presenta también el análisis espacial de dispersión de restos debido a la acción de los predadores en la desarticulación y consumo de carcasas.


    Directory of Open Access Journals (Sweden)

    Anderson Mathias Holtz


    Full Text Available Têm-se buscado alternativas para o controle de pragas no setor florestal. Uma possibilidade é a utilização do controle biológico com predadores e parasitóides. O objetivo deste trabalho foi avaliar o parasitismo de diferentes espécies de Trichogramma em ovos de P. nigrispinus. Foram colados em retângulos de cartolina azul celeste 15 ovos, de P. nigrispinus, com um dia de idade. Foram utilizados ovos de uma mesma postura em cada tratamento. As cartelas contendo os ovos do predador foram expostas ao parasitismo de fêmeas de cinco espécies de Trichogramma por 24 horas. Como testemunha, foram utilizados ovos de P. nigrispinus que não foi submetido a presença do parasitóide. Não houve emergência de adultos do parasitóide oriundos desses ovos e a viabilidade não foi afetada por nenhuma das cinco espécies utilizadas. O predador P. nigrispinus e o parasitóide Trichogramma podem ser utilizados em programas de controle biológico.Alternatives for the control of pests in forest sectors have been searched. A possibility is the use of the biological control with predators and parasitoids. The objective of this work was to evaluate the parasitism of different Trichogramma species in P. nigrispinus egges. For each treatment fifteen P. nigrispinus egges, of the same posture, with one day of age, were agglutinated in rectangles of celestial blue cardboard. They were exposed to the parasitism of 5 female Trichogramma species for 24 hours. Besides those that underwent the tests, P. nigrispinus egges that were not submitted to the parasitoid presence were used. There were parasitoid adults’ that originated from of those eggs born and the viability of all of the five species used was not affected. The predator P. nigrispinus and the parasitoid Trichogramma can be used in programs of biological control.

  11. Composição acarina em diferentes cultivares de pessegueiros [Prunus persica (L.], em Presidente Prudente, estado de São Paulo Mite diversity in peach cultivars [Prunus persica (L.], in Presidente Prudente, State of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Sônia Maria Nalesso Marangoni Montes


    Full Text Available Objetivou-se, nesta pesquisa, estudar a ocorrência natural de ácaros fitófagos e predadores em diferentes cultivares de pessegueiro, no município de Presidente Prudente-SP, Brasil. O estudo foi realizado no período de dezembro de 2002 a fevereiro de 2006. Amostras quinzenais de 72 folhas foram coletadas ao acaso, de pessegueiros das cultivares Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 e Aurora 2. Coletou-se um total de 2.594 ácaros, sendo 2.092 fitófagos, 403 predadores e 99 de hábitos alimentares pouco conhecidos, com 35 espécies de ácaros de 16 famílias. Aculus fockeui ocorreu de maneira esporádica, não causando danos visíveis às plantas. A família Phytoseiidae apresentou a maior abundância e o maior número de indivíduos. O predador Euseius citrifolius foi o mais abundante. Não houve preferência dos ácaros nas cultivares de pessegueiro avaliadas.This study aimed to investigate the occurrence of phytophagous and predator mites in peach cultivars in Presidente Prudente municipality, State of São Paulo, Brazil. The survey was conducted from 2002 December to 2006 February. Leaf samples were collected fortnightly of 72 sheets of cultivars Talismã, Doçura 2, Dourado 2, Tropical, Aurora 1 and Aurora 2. It was recovered 2594 mites, among 2092 phytophagous, 403 predators and 99 of dietary habits few knowledge. It was collected 35 mite species belong to 16 families. Aculus fockeui occurred on a sporadic season, causing no visible damage to the plants. In the case of phytoseids, Euseius citrifolius was the most abundant predator species. No preference of mites was detected among the peach cultivars.

  12. Aspectos biológicos de Coccidophilus citricola Brèthes, 1905 (Coleoptera: Coccinellidae) Biological aspects of Coccidophilus citricola Brèthes, 1905 (Coleoptera: Coccinellidae)


    Ricardo Adaime da Silva; Antonio Carlos Busoli; Norton Rodrigues Chagas Filho


    Os aspectos biológicos do predador Coccidophilus citricola foram estudados sob condições controladas (temperatura de 24±2ºC, 70±10% de UR e 12 horas de fotofase), utilizando como alimento a cochonilha Aspidiotus nerii. Os valores registrados para duração e viabilidade foram: período embrionário (9,54 dias e 78,33%); 1º estádio larval (4,22 dias e 90,00%); 2º estádio larval (2,85 dias e 100,00%); 3º estádio larval (2,94 dias e 97,22%); 4° estádio larval (3...

  13. Mercúrio total em cação comercializado em São Paulo - SP, Brasil




    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislação, expondo os cons...

  14. Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas

    Directory of Open Access Journals (Sweden)

    Walter S. Evangelista Junior


    Full Text Available Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas. Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the interaction of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20% ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas. O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae, é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%. Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão.

  15. Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars


    Maria da Conceição M. Soglia; Vanda Helena Paes Bueno; Lívia Mendes Carvalho


    Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fotofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as...

  16. Feeding visit time of fruit-eating birds in Cerrado plants: revisiting the predation risk model Tempo de visita de aves que comem frutos em plantas de Cerrado: revisitando o modelo do risco de predação

    Directory of Open Access Journals (Sweden)

    Igor Aurélio Silva


    Full Text Available Fruiting plants that attract frequent visits by fruit-eating birds tend to be predictable patches for a predator. Consequently, the risk of a predator attack increases the longer a bird stays on a fruiting plant. We tested whether large and cryptic species of fruit-eating birds spend more time per feeding visit than smaller and conspicuous ones in fruiting plants of the Brazilian Cerrado. Data were obtained from the literature for eight fruiting plant species and from field observations of birds feeding on fruits of Zanthoxylum rhoifolium (Rutaceae. We searched for a positive linear relationship between the mean visit time and the total length of the species, considering bird color as a covariate. Feeding visits of the large and cryptic bird species lasted longer than feeding visits of small and conspicuous species. Large birds may be safer from predators because large predators are less common. Cryptic birds may be difficult to be detected by predators and, consequently, may be less likely to be attacked by predators than conspicuous birds. Thus, our results provide support to the hypothesis that vulnerable bird species spend less time foraging in fruiting plants.Plantas em frutificação atraem visitas freqüentes de aves que comem frutos e tendem a ser manchas previsíveis para um predador. Conseqüentemente, o risco de ataque de um predador aumenta com o tempo de permanência de uma ave frugívora em uma planta com frutos. Neste estudo, testamos se espécies de aves grandes e crípticas passam mais tempo por visita de alimentação em plantas em frutificação que espécies pequenas e conspícuas. Obtivemos dados da literatura para oito espécies de plantas do Cerrado e também de observações em campo de aves que se alimentam de frutos de Zanthoxylum rhoifolium (Rutaceae. Procuramos por uma relação positiva entre o tempo médio de visita e o comprimento total das espécies de aves, considerando a cor das espécies como uma co-variável. A duração das visitas de espécies grandes e crípticas foi maior que a duração de visitas de aves pequenas e conspícuas. Aves grandes devem correr menos risco de serem predadas porque predadores grandes são menos comuns. Aves crípticas, por sua vez, devem ser difíceis de serem detectadas por predadores e, conseqüentemente, a probabilidade de serem atacadas deve ser menor. Portanto, nossos resultados provêm apoio à hipótese de que espécies de aves vulneráveis passam menos tempo forrageando em plantas com frutos.

  17. Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae em plantas hospedeiras Feeding preference and performance of Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae among host plants

    Directory of Open Access Journals (Sweden)

    Roberta R. Coelho


    Full Text Available O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae, caruru, Amaranthus lividus L. (Amaranthaceae e feijão, Phaseolus vulgaris L. (Fabaceae. Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos e ganho de peso (28 a 30% do peso vivo foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas.The choice between cotton, Gossypium hirsutum L. (Malvaceae, green bean, Phaseolus vulgaris L. (Fabaceae and pigweed, Amaranthus lividus L. (Amaranthaceae and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes and weight gain (28 to 30% of body weight were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

  18. Mercúrio total em cação comercializado em São Paulo - SP, Brasil Total mercury contents in shark species commercialized in São Paulo-SP, Brazil




    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislação, expondo os cons...

  19. Dieta e dispersão de sementes por Cerdocyon thous (Linnaeus) (Carnívora, Canidae), em um fragmento florestal no Paraná, Brasil Diet and seed dispersal by Cerdocyon thous (Linnaeus) in a forest fragment in Paraná (Carnivora, Canidae)


    Vlamir J. Rocha; Nelio R. dos Reis; Margareth L. Sekiama


    Embora o cachorro-do-mato, Cerdocyon thous (Linnaeus, 1706), seja um Canidae relativamente comum, não há muita informação sobre sua dieta e seu papel como dispersor de sementes nos diferentes habitats onde ocorre. O objetivo deste trabalho foi o de reportar a dieta de C. thous e sua importância como dispersor e/ou predador de sementes, e ainda testar a taxa de germinação de sementes após passar pelo trato digestório do animal. O estudo foi realizado em um fragmento (680 ha) de Floresta Estaci...

  20. Food webs of Mediterranean coastal wetlands


    Compte Ciurana, Jordi


    En aquesta tesi doctoral s'han estudiat els efectes directes i indirectes de dos tipus d'espècies claus de la comunitat aquàtica dels aiguamolls de l'Empordà (aiguamolls costaners mediterranis amb una xarxa tròfica senzilla). S'han realitzat experiments al camp utilitzant microcosmos i mesocosmos i els resultats han estat analitzats mitjançant tres aproximacions: la taxonòmica, la funcional i la de mides. S'ha comprovat que en situacions amb absència de predadors i dominància d'una única espè...

  1. Genetically modified corn on fall armyworm and earwig populations under field conditions / Milho geneticamente modificado e sua ação sobre a lagarta-do-cartucho e tesourinha em condições de campo

    Scientific Electronic Library Online (English)

    Marina Regina, Frizzas; Sinval, Silveira Neto; Charles Martins de, Oliveira; Celso, Omoto.


    Full Text Available Avaliou-se o efeito do milho geneticamente modificado MON810 sobre o inseto praga Spodoptera frugiperda (J.E. Smith) e o seu predador Doru luteipes (Scudder) em condições de campo no Brasil. As avaliações foram conduzidas em campos de milho MON810, comparadas com milho convencional com e sem aplicaç [...] ão de inseticidas, em quatro safras na região de Barretos, SP. Foram avaliados os danos de S. frugiperda em plantas e a contagem do número de lagartas de S. frugiperda e de adultos e ninfas do predador D. luteipes em plantas de milho. Verificou-se uma menor porcentagem de danos de S. frugiperda e os menores números médios de lagartas (pequenas e grandes) no milho MON810. Não foram observadas diferenças (P>0,05) entre os tratamentos na abundância do predador D. luteipes em plantas de milho. A segunda época de plantio apresentou as maiores porcentagens de danos de S. frugiperda e as menores médias do número de tesourinhas coletadas. O milho MON810 foi efetivo no controle de S. frugiperda e a abundância do predador D. luteipes foi similar nos três tratamentos, em condições de campo. Abstract in english The effects of corn MON810 on the Spodoptera frugiperda (J.E. Smith) and the earwig Doru luteipes (Scudder) were tested under field conditions in Brazil. Results from MON810 corn fields were compared with those fields of conventional corn with and without the application of insecticides in four harv [...] ests in the region of Barretos, SP. It was assessed the damage to S. frugiperda via direct counts of the number of fall armyworms and adults and nymphs of the predator D. luteipes on corn plants. The rate of S. frugiperda damage and the average numbers of larvae (large and small) were lower in the MON810 corn field relative to the control plot. There were no differences (P>0.05) between treatments regarding the predator abundance in corn plants. The second crop season ("safrinha") showed the greatest extent of S. frugiperda damage and the lowest average abundance of earwigs. MON810 was effective in controlling S. frugiperda and abundance of predator D. luteipes was similar in the three treatments under field conditions.

  2. Ecologia e conservação de felinos no pantanal do Brasil


    Porfírio, Grasiela Edith de Oliveira


    A rápida conversão dos habitats e a degradação ambiental têm atingido números alarmantes no Pantanal colocando em risco toda a sua biodiversidade. Soma-se a esse cenário o fato do bioma contar com poucas unidades de conservação, que juntas não ultrapassam 10% do território. Os felinos, como predadores, desempenham um papel vital para o bom funcionamento dos ecossistemas, entretanto são espécies que necessitam de grandes áreas, possuem baixas densidades populacionas e, geralmente são demasiada...

  3. Efeitos da aplicação de agrotóxicos utilizados na produção integrada de maçã sobre pupas de Chrysoperla externa Effects of pesticides application used in integrated apple production on Chrysoperla externa pupae


    Alexandre Pinho Moura; Geraldo Andrade Carvalho; Olinto Lasmar; Valéria Fonseca Moscardini; Denise Tourino Rezende


    Devido à grande importância de Chrysoperla externa (Neuroptera: Chrysopidae) como agente de controle biológico de artrópodes-praga na cultura da macieira no Brasil, avaliaram-se os efeitos dos agrotóxicos (g i.a. L-1) abamectina (0,02), carbaril (1,73), enxofre (4,80), fenitrotiona (0,75), metidationa (0,40) e triclorfom (1,50) em pupas desse predador, oriundas de Bento Gonçalves e Vacaria, Rio Grande do Sul, bem como sobre o desenvolvimento dos adultos obtidos e sua reprodução. A aplicação d...

  4. Integração da resistência de plantas e predação por Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o manejo de Schizaphis graminum (Rondani) (Hemiptera: Aphididae) em sorgo / Integration of varietal resistance and predation by Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the management of Schizaphis graminum (Rondani) (Hemiptera: Aphididae) on sorghum

    Scientific Electronic Library Online (English)

    Liliane K., Figueira; Fernando M., Lara; Ivan, Cruz; José M., Waquil.


    Full Text Available A integração entre plantas resistentes e agentes de controle biológico pode ser uma alternativa viável para o manejo do pulgão-verde, Schizaphis graminum (Rondani), na cultura do sorgo. Experimentos foram conduzidos com a finalidade de avaliar o efeito de quatro genótipos de sorgo: GR 11111 e TX 430 [...] x GR 111 (resistentes), GB 3B (moderadamente resistente), e BR 007B (suscetível), sobre o controle biológico do pulgão S. graminum realizado pelo predador Chrysoperla externa (Hagen). Para isso, avaliaram-se diferentes níveis de infestação de S. graminum, na presença e ausência do predador, em casa-de-vegetação e a viabilidade de controle de S. graminum no campo. O efeito do predador foi notado 25 dias após a infestação, proporcionando maior crescimento das plantas e menores danos. Os danos também foram menores nos genótipos resistentes e aumentaram com a elevação dos níveis de infestação, sendo menores na presença do predador C. externa. Em condições de campo, a integração dos dois métodos de controle proporcionou 83% de redução de danos, quando se utilizou o genótipo resistente TX 430 x GR 111, que foi considerado o mais promissor dentre os estudados. Abstract in english The integration of plant resistance and biological control agent can be a viable alternative to the management of the greenbug, Schizaphis graminum (Rondani), on sorghum. Experiments were conducted to evaluate the effect of four sorghum genotypes: GR 11111 and TX 430 x GR 111 (resistants), GB 3B (mo [...] derately resistant), and BR 007B (susceptible), on the biological control of S. graminum by the predator lacewing, Chrysoperla externa (Hagen). Different levels of infestation, in presence or absence of the predator were studied in greenhouse, and the viability of S. graminum control was evaluated under field conditions. The effect of the predator was observed 25 days after infestation, resulting in higher percentage of plant growth and lower damage. Damage was lower in resistant genotypes and increased with higher levels of infestation, being low in presence of predator C. externa. In field conditions, plant damage was reduced in 83%, when the genotype TX 430 x GR 111 was used in association with C. externa.

  5. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae from dry forest in Brazil and new occurrence records for other Heimbrinae

    Directory of Open Access Journals (Sweden)

    Daniell Rodrigo Rodrigues Fernandes


    Full Text Available The geographic ranges of Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.

  6. Dieta de Liolaemus ruibali Donoso Barros(Iguania:Liolaeminae en la Reserva de Usos Múltiples Don Carmelo, San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Héctor J. Villavicencio


    Full Text Available Se estudió la dieta de Liolaemus ruibali en la reserva de Usos Múltiples Don Carmelo, Provincia de San Juan. Se analizaron los estómagos e intestinos de 12 individuos, determinando el rol de cada presa mediante el cálculo del índice de importancia relativa y la amplitud trófica mediante el índice de Levins. Hemíptera fue la categoría alimentaria más importante. Otra categoría alimentaria importante fue Formicidae. La dieta está constituida además por vegetales (Lycium chanar y Ephedra breana. El análisis indica que Liolaemus ruibali es un predador pasivo y omnívoro.

  7. Ecological Roles of Coleoptera Associated with Carcasses in Caatinga

    Directory of Open Access Journals (Sweden)

    Wellington Santos


    Resumo. O papel ecológico da coleopterofauna associada a carcaças de porcos em uma área de Caatinga foi examinado. Para captura desses insetos foram utilizadas armadilhas do tipo bandeja, pitfall e Shannon modificada, durante duas estações (seca e chuvosa. 4.851 coleópteros foram coletados, pertencentes a 19 famílias e 88 espécies. A categoria ecológica mais abundante foi predador/parasita (72,7%, seguida por onívoro (15,1%, necrófago (10,9% e incidental (1,3%. Futuros estudos sobre biologia das espécies predadoras/parasitas são necessários para se determinar sua possível utilidade forense na estimativa do intervalo pós-morte.

  8. Energy density of freshwater Patagonian organisms / Densidad energética de los organismos Patagónicos de agua dulce

    Scientific Electronic Library Online (English)

    Javier, Ciancio; Miguel, Pascual.


    Full Text Available La densidad energética de los organismos puede ser utilizada con distintos fines como evaluar la calidad de la dieta, comparar la importancia de distintas presas para un predador, corregir las tasas de evacuación gástrica de modelos, explicar el comportamiento de forrajeo de ciertos predadores o det [...] erminar su estado fisiológico. Consiste en un parámetro fundamental para el modelado bioenergético de ecosistemas. En este trabajo estimamos la densidad energética de los principales grupos de los ecosistemas de agua dulce de la Patagonia, incluyendo peces, crustáceos, gasterópodos, oligoquetos e insectos. Encontramos que los peces (5048-5789 Cal/g) es el grupo energéticamente más denso seguido de los insectos (5062-5232), crustáceos (3364-3994), oligoquetos (3471) y finalmente los gasterópodos (1143). Abstract in english We assessed by using a bomb calorimeter the energy density of the main species of Patagonian freshwater ecosystems, including fish, crustaceans, gastropods, oligochaetes, and insects. Fish (5048-5789 Cal/g) were the most energy density group, followed by insects (5062- 5232), crustaceans (3364-3994) [...] , oligochaetes (3471) and gastropods (1143). These data consist on the first direct energy density estimations of freshwater species and are intended as a baseline information for modelling the energy fluxes in Patagonian freshwater ecosystems.

  9. Domácias e seu papel na defesa das plantas Domatia mediating plant defense

    Directory of Open Access Journals (Sweden)

    Cláudia Helena Cysneiros Matos


    Full Text Available Domácias são pequenas estruturas presentes na face inferior das folhas de diversas plantas de importância agrícola e têm sido descritas por serem tipicamente habitadas por ácaros (predadores e fungívoros que provêm benefícios às plantas. São estruturas extremamente complexas e não apresentam qualquer função fisiológica conhecida. Tem sido postulado que os ácaros se beneficiam das domácias pela obtenção de um local seguro para reprodução e proteção contra predadores e que as plantas também se beneficiam pela redução do ataque de herbívoros ou patógenos. Assim, ecologistas têm hipotetizado que as domácias mediam uma associação mutualística entre as plantas e os ácaros que protegem as folhas. Nesta revisão, é discutido o papel das domácias na defesa das plantas contra pequenos artrópodes.Leaf domatia are small structures found on the underside of the leaves of many plants of agricultural importance. Domatia have been described to be typically inhabited by mites (predators and fungivorous that provide benefits to the plant. The structures can be extremely complex and seem to have an unknown physiological function. It has been postulated that mites may get some benefit from leaf domatia by securing a safe place for reproduction and refuge from predators. Additionally, plants get benefits via reduced herbivory or pathogen attack. Hence, ecologists have hypothesized that domatia mediate a mutualistic association between plants and their bodyguard mites. In this review we discussed the pivotal role of the domatia in plant defenses against small arthropods.

  10. Predation on Tropidurus hispidus (Squamata: Tropiduridae) by Lasiodora klugi (Aranea: Theraphosidae) in the semiarid caatinga region of northeastern Brazil / Predação sobre Tropidurus hispidus (Squamata: Tropiduridae) por Lasiodora klugi (Aranea: Theraphosidae) na região de caatinga semiárida do nordeste do Brasil

    Scientific Electronic Library Online (English)

    Washington Luiz Silva, Vieira; Maria Betânia Ribeiro, Gonçalves; Rômulo Pantoja, Nóbrega.


    Full Text Available Um evento de predação sobre Tropidurus hispidus (Tropiduridae) pela aranha caranguejeira Lasiodora klugi (Theraphosidae) foi observado em área de caatinga arbórea no nordeste do Brasil. Artrópodes são potenciais predadores de pequenos vertebrados e pesquisadores têm relatado eventos de predação envo [...] lvendo aranhas e herpetofauna em regiões neotropicais. Portanto, a presente comunicação breve é o segundo caso de predação de aranha sobre lagartos do gênero Tropidurus no Brasil e o primeiro para as caatingas semiáridas, reforçando a argumentação de que grandes aranhas possuem um papel relevante como predadores desses animais. Abstract in english A predation event on Tropidurus hispidus (Tropiduridae) by the crab spider Lasiodora klugi (Theraphosidae) was observed in an arboreal caatinga area in northeastern Brazil. Arthropods are potential predators of small vertebrates and researchers have reported predation events involving spiders and he [...] rpetofauna in Neotropical regions. As such, the present short communication is the second case of predation of spiders on Tropidurus lizards in Brazil, and the first for the semiarid caatinga, reinforcing the argument that large spiders have relevant roles as predators of these animals.

  11. Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851 (Heteroptera: Pentatomidae with salt and amino acids solutions supplementary diet

    Directory of Open Access Journals (Sweden)

    Simone Patrícia Carneiro Freitas


    Full Text Available This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae. Both solutions showed deleterious effects on nymph survival, adult weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae. Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, longevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores.

  12. Dieta de Leopardus colocolo (Carnivora: Felidae en la Reserva Nacional de Junín, Junín, Perú

    Directory of Open Access Journals (Sweden)

    Ursula Fajardo


    Full Text Available Este estudio caracteriza la dieta de Leopardus colocolo en los alrededores del lago Junín, en el centro del Perú, a partir de los restos de las presas presentes en 43 heces. El origen de las heces del predador se determinó a partir del ADN mitocondrial de las células epiteliales intestinales adheridas a la superficie de las heces, utilizando como marcador la región de control. Los restos de las presas fueron identificados utilizando literatura especializada y la comparación con especímenes de colección, identificando un total of 14 ítems alimenticios pertenecientes a mamíferos de las familias Cricetidae (6, Chinchillidae (1 y Caviidae (1 y aves de las familias Anatidae (3 y Rallidae (2, y un grupo de aves no identificadas (1. Los roedores fueron el principal componente de la dieta de L. colocolo, en frecuencia y biomasa, seguido por las aves. Entre los ítems alimenticios consumidos, el roedor cricétido pequeño Calomys sp. fue el más frecuente; sin embargo, el mayor aporte de biomasa relativa fue proporcionado por el roedor mediano Cavia tschudii. La amplitud de nicho obtenida fue baja (Bsta= 0.17, indicando una dieta especializada. Nuestros resultados confirman que, como ocurre con la mayoría de felinos pequeños neotropicales, L. colocolo es un predador especializado en la captura de vertebrados, principalmente mamíferos pequeños. No se registró variación estacional en la dieta y el análisis de las clases de edad de los roedores cricétidos mostró que los adultos fueron los más consumidos. Se infiere que L. colocolo tiene un patrón de actividad diurno y nocturno.

  13. Controller design techniques for the Lotka-Volterra nonlinear system

    Scientific Electronic Library Online (English)

    Magno Enrique Mendoza, Meza; Amit, Bhaya; Eugenius, Kaszkurewicz.


    Full Text Available Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies). Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe [...] em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional). Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico. Abstract in english A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species). In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, tha [...] t the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.

  14. Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish

    Directory of Open Access Journals (Sweden)

    Roberta Martini Bonaldo


    Full Text Available The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medusa was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa estava sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação.

  15. Does the association of young fishes with jellyfishes protect from predation?A report on a failure case due to damage to the jellyfish

    Scientific Electronic Library Online (English)

    Roberta Martini, Bonaldo; João Paulo, Krajewski; Ivan, Sazima.


    Full Text Available A associação entre peixes e medusas é considerada uma simbiose temporária que protegeria os peixes contra predadores. Relatamos aqui a predação oportunista de juvenis de xixarro Trachurus lathami, associados à medusa Chrysaora lactea, pelo badejo-mira Mycteroperca acutirostris enquanto a medusa esta [...] va sendo danificada. Os eventos de predação ocorreram quando um casal do peixe-porco Stephanolepis hispidus se aproximou da medusa para alimentar-se de pequenas porções da sua umbrela. A alimentação dos peixes-porcos causou um distúrbio momentâneo na associação defensiva, percebido e aproveitado pelo atento badejo-mira, um predador versátil e oportunista. Antes e depois do distúrbio, a proteção conferida aos peixes juvenis pela medusa mostrou ser efetiva, fortalecendo a hipótese de função defensiva desta associação. Abstract in english The fish-jellyfish association is regarded as a temporary symbiosis believed to protect the fishes from predators. Here we report on juvenile scads (Trachurus lathami) associated with the jellyfish Chrysaora lactea, opportunistically preyed on by the grouper Mycteroperca acutirostris while the medus [...] a was being damaged. The predation instances occurred when a couple of the filefish Stephanolepis hispidus approached the jellyfish to nibble on its umbrella. The feeding of the filefish caused a momentary disturbance of the defensive association, perceived and capitalised on by the watchful grouper, an opportunistic and versatile hunter. Before and after the disturbance, the protection offered to the young fish by the jellyfish showed to be effective, which strengthens the hypothesis of defensive function of this association.

  16. Controller design techniques for the Lotka-Volterra nonlinear system

    Directory of Open Access Journals (Sweden)

    Magno Enrique Mendoza Meza


    Full Text Available A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species. In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, that the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies. Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional. Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico.

  17. A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates

    Directory of Open Access Journals (Sweden)

    Cristina Sazima


    Full Text Available Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos peixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores.

  18. Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae) on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil / Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae) sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil

    Scientific Electronic Library Online (English)

    WJ., Minto; MS., Arcifa; A., Perticarrari.


    Full Text Available O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do cont [...] ato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A) predador e "kairomones" presentes e B) predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A) predador e "kairomones" ausentes e B) igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica) e alimento (algas) não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens) realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones". Abstract in english The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical co [...] ntact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A) predator and kairomones present and B) predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A) predator and kairomones absent and B) the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity) and food (algae) did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens) showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.

  19. Fish ladders: safe fish passage or hotspot for predation?

    Directory of Open Access Journals (Sweden)

    Angelo Antonio Agostinho


    Full Text Available Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmonids during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladder environment, which is associated with injuries suffered along the ladder course and the presence of multiple predator groups with different predation strategies, transformed the fish corridor into a hotspot for predation.Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embora a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predaç??o em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil, buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003. Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às inj

  20. Suitability of leguminous cover crop pollens as food source for the green lacewing Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) / Adequação do pólen de leguminosas utilizadas em adubação verde como fonte de alimento para Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Madelaine, Venzon; Maria C., Rosado; Denise E., Euzébio; Brígida, Souza; José H., Schoereder.


    Full Text Available A diversificação das culturas com plantas que forneçam pólen nutricionalmente adequado para predadores pode reduzir a população de pragas pelo aumento da efetividade dos predadores. Neste trabalho, avaliou-se a viabilidade nutricional de polens de leguminosas utilizadas como adubação verde, para o c [...] risopídeo Chrysoperla externa (Hagen), comumente encontrado em agroecossistemas cafeeiros. Os adubos verdes testados foram guandu e crotalária, leguminosas utilizadas em sistemas orgânicos de café. Adultos de C. externa recém-emergidos foram criados em dietas contendo pólen de guandu, de crotalária e de mamona (controle). O sucesso reprodutivo de C. externa foi avaliado nas dietas de pólen e quando mel foi adicionado ao pólen, para se verificar a necessidade do predador por fonte extra de carboidratos. A taxa de crescimento populacional do predador foi semelhante nas dietas de pólen de guandu e de crotalária. No entanto, a taxa aumentou significativamente quando mel foi adicionado às dietas. Fêmeas alimentadas com pólen de guandu e mel e com pólen de crotalária e mel tiveram crescimento superior ao das alimentadas com pólen de mamona e mel. Fêmeas alimentadas somente com pólen de mamona ou somente com mel não ovipositaram. Os polens de guandu e de crotalária foram igualmente adequados para C. externa, especialmente quando foram complementados com mel. Os resultados sugerem que para aumentar a efetividade dos predadores, os sistemas orgânicos de café deveriam ser diversificados com plantas que forneçam pólen em combinação com plantas que forneçam néctar. Abstract in english Diversification of crops with species that provide suitable pollen for predators may reduce pest population on crops by enhancing predator effectiveness. In this paper we evaluated the suitability of leguminous cover crop pollens to the predatory green lacewing Chrysoperla externa (Hagen). The preda [...] tor is commonly found in coffee agroecosystems and the plant species tested were pigeon pea and sunn hemp, which are used in organic coffee systems. Newly emerged females and males of C. externa were reared on diets containing pollen of pigeon pea, sunn hemp, or castor bean, used as a control. The reproductive success of C. externa was evaluated when females fed the pollen species and when honey was added to the diets, to verify the predator need for an extra carbohydrate source. Similar intrinsic growth rates were found for females fed on pigeon pea pollen and on sunn hemp pollen but these rates increased significantly when honey was added to the diets. Females fed with pigeon pea pollen plus honey and with sunn hemp pollen plus honey had higher intrinsic growth rates than those fed with castor bean pollen plus honey. Females fed on castor bean pollen only or on honey only, did not oviposit. Leguminous pollen species were equally suitable for C. externa especially when they were complemented with honey. The results suggest that to successfully enhance predator effectiveness, organic coffee plantation should be diversified with plant providing pollen in combination with plant providing nectar.

  1. Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?

    Directory of Open Access Journals (Sweden)

    Cristiano S. de Azevedo


    Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

  2. Estado actual y conservación de aves pelágicas que utilizan la plataforma continental argentina como área de alimentación / Status and conservation of pelagic birds using the Argentinean continental shelf as a foraging area

    Scientific Electronic Library Online (English)

    Marco, Favero; María Patricia, Silva Rodríguez.


    Full Text Available La importancia de la plataforma continental argentina no está solamente vinculada con su extensión sino también con su elevada productividad, lo que hace que sea utilizada como área de alimentación por un importante número y biomasa de predadores tope marinos que se reproducen en la costa y en secto [...] res insulares alejados del continente. Entre estos predadores tope, las aves pelágicas se destacan por sus extraordinarias habilidades de vuelo y sus extensos viajes de alimentación o migratorios de varios miles de kilómetros. La distribución de estas aves (y otros predadores tope marinos) a lo largo de la plataforma no es uniforme, presentando mayores concentraciones en áreas donde las características oceanográficas promueven elevadas abundancias de presas. Generalmente se observa un mayor número de individuos agregados cerca de frentes con gradientes de temperatura horizontales que sobre áreas térmicamente más homogéneas. Si bien algunas poblaciones de aves pelágicas sufren actualmente problemas relacionados con la contaminación, el disturbio humano y la degradación ambiental, los problemas de conservación más importantes parecen provenir de impactos sufridos en áreas reproductivas por la presencia de predadores introducidos y en el mar por los efectos negativos de la interacción con las pesquerías. La plataforma continental argentina tiene importancia global y juega un papel clave en el mantenimiento de aves y mamíferos marinos provenientes de regiones adyacentes y remotas. Existe una urgente necesidad de renovar la información disponible sobre la distribución de predadores tope en la plataforma para definir las áreas más importantes. El análisis combinado de esos datos con la distribución del esfuerzo pesquero y la explotación de recursos no renovables será crucial para desarrollar e implementar programas adecuados de conservación y manejo. Abstract in english The importance of the Argentinean continental shelf is not only linked with its extension but also to its high productivity. That's why this area is extensively used as foraging area by a large number and biomass of top predators both breeding in the continental shores and in islands away from the c [...] ontinent. Among these top predators, seabirds have remarkable flying abilities and perform extensive foraging and migratory trips, in the order of thousands of kilometers. The distribution of these birds (and other marine top predators) along the continental shelf is not uniform, with higher densities in those areas where the oceanographic characteristics promote prey concentration; more predators are usually aggregated close to frontal systems characterized by horizontal thermal gradients. In spite of some seabird populations currently suffering conservation problems allied with pollution, human disturbance and habitat degradation, the most important issues seem to be related to the introduction of predators in breeding areas, and to the negative effects of the interaction with fisheries. The Argentinean continental shelf has global importance and plays a key role in the maintenance of seabird and marine mammal populations, both local and those coming from adjacent and remote areas. There is an urgent need of gathering and analyzing new information on the distribution of top predators along the continental shelf in order to define important areas. The combined analysis of these data with the distribution of fishing effort and the exploitation of non renewable resources will be crucial to the adequate development and implementation of conservation and management programs.

  3. A new rabbit species (sylvilagus, Mammalia: leporidae from the lowlands of venezuela

    Directory of Open Access Journals (Sweden)

    Pedro Durant


    Full Text Available A new species of Venezuelan rabbit of the genus Sylvilagus from Fundo Millano (08º 46'N and 69º 56'W and Chorrosco Bajo (08º 05'N and 69º 18'W, between 190 and 120 masl, state of Barinas, is described based on: 1. Body and skull measurements. 2. Coloration patterns of the pelage. 3. Arrangement and length of the color hair bands of dorsal, lateral, ventral nuchal, and gular patches. Body and cranial measurements, and some color patterns of the new species, Sylvilagus varynaensis, were compared with those of the closest relative groups such as S. brasiliensis (from Venezuela and Brazil, S. b. meridensis from the Venezuelan paramos, and three of the most representative groups of S. floridanus (S. f. continentis, S. f. orinoci, and S. f. valenciae. Most of the values recorded for these parameters were significally higher for the new species (P Se describe una especie nueva de conejo silvestre de Venezuela procedente del Fundo Millano (08º 46’ N y 69º 56’ W entre 120 y 180 m de altitud y Chorrosco Bajo (08º 05'N and 69º 18'W, entre 190 y 120 de altitud, en el estado Barinas. La descripción se basó en: 1. Medidas corporales y craneales. 2. Patrones de coloración del pelaje. 3. Organización y longitud de las bandas de color del pelo de las regiones dorsal, lateral, ventral, nucal y mancha gular. Las medidas corporales, craneales y algunos de los patrones de coloración de la nueva especie, Sylvilagus varynaensis, fueron comparados con las de los grupos más cercanos, como S. brasiliensis (de Venezuela y de Brasil, S. b. meridensis de los páramos venezolanos y tres de los grupos más representativos de S. floridanus (S. f. continentis, S. f. orinoci, S. f. valenciae. La mayoría de los valores registrados en estas medidas fueron significativamente más altos (P < 0.005; "t" de Student en la nueva especie de conejo. El Análisis de Componentes Principales y de Agrupación de los datos registrados para las características craneales indicaron que S. varynaensis es el conejo silvestre de mayor tamaño de Venezuela, de coloración más oscura, de cráneo más alargado y con arreglo diferente de las bandas de color del pelo en varias regiones corporales.

  4. The effect of low salinity on teredinids

    Directory of Open Access Journals (Sweden)

    Cristine C. Barreto


    Full Text Available Teredinids survival in low salinities was determined in aquaria. Panels previously immersed in Ponta de Leste, Ilha Grande Bay, Rio de Janeiro, were transferred to aquaria with salinities ranging from 5.0 to 15.0 Practical Salinity Unities (PSU. The waters of Ilha Grande Bay receive a large amount of wood from the marginal rainforest vegetation, being suitable for the development of teredinids. The coastal areas of the bay are subjected to wide salinity fluctuations due to strong and sudden tropical storms. Eleven different species of teredinids were found in the panels. The critical salinity concentration for the survival of the two most common species was 11.93 PSU for Lyrodus floridanus and 12.90 PSU for Teredo furcifera. The effect of time on the mortality of teredinids at low salinities is also discussed.A sobrevivência de moluscos bivalves perfurantes de madeira da família Teredinidae foi avaliada a partir de sua manutenção em aquários de baixa salinidade. Painéis de madeira previamente imersos em Ponta de Leste, Baía da Ilha Grande, RJ, foram transferidos para aquários, contendo água do mar, cujas concentrações salinas variaram de 5,0 a 15,0 PSU. A Baía da Ilha Grande recebe uma grande quantidade de madeira da vegetação marginal de Mata Atlântica, o que torna o ambiente particularmente favorável ao desenvolvimento de teredinídeos. As áreas costeiras da baía estão sujeitas a grandes variações salinas decorrentes de tempestades tropicais que ocorrem súbita e intensamente. A salinidade crítica à sobrevivência das duas espécies mais comuns nos painéis foi de 11,93, para Lyrodus floridanus e 12,90 para Teredo furcifera. O efeito do tempo na mortalidade dos teredinídeos, quando sujeitos a baixas salinidades, foi discutido.

  5. Ocorrência e recrutamento larval de Teredinidae (Mollusca, Bivalvia) na região do Sistema Costeiro Cananéia-Iguape, São Paulo, Brasil / The occurrence and larval recruitment of Teredinidae (Mollusca, Bivalvia) in Cananeia-Iguape Coastal System, São Paulo, Brazil

    Scientific Electronic Library Online (English)

    Daniela T. de, Moraes; Clemente, Coelho Jr.; Rafael C. G. da, Cruz; Sônia G. B. C., Lopes.


    Full Text Available A ocorrência e o recrutamento larval de Teredinidae na região do Sistema Costeiro Cananéia-Iguape foram acompanhados por doze meses utilizando-se coletores laminados de pinho, instalados em três estações dentro do bosque de mangue (mediolitoral) e em uma estação, localizada no infralitoral. No mangu [...] ezal, a colonização por larvas de teredinídeos ocorreu após quatro meses de permanência dos coletores na estação mais frequentemente inundada pela maré e somente após oito meses nas duas estações com menor frequência de inundação. No infralitoral, após quatro meses, os coletores já estavam consideravelmente danificados. Ao longo do experimento, houve um decréscimo no número de teredinídeos, especialmente no infralitoral, ocasionado possivelmente pela competição por alimento e espaço entre teredinídeos e foladídeos. Foram encontrados 2.658 indivíduos, sendo 704 de Teredinidae e 1.954 de Pholadidae. Entre os teredinídeos, Bankia fimbriatula foi a espécie mais abundante tanto no infralitoral quanto no manguezal, seguida de Bankia gouldi e Lyrodus floridanus que ocorreram somente no infralitoral, e Nausitora fusticula encontrada somente no manguezal. Martesia striata, único foladídeo, ocorreu somente no infralitoral. Abstract in english The occurrence and larval settlement of Teredinidae in Cananéia-Iguape Coastal System were observed for one year, by using laminated pinewood panels installed in three stations inside the mangrove forest (intertidal zone) and in one station, in the infralittoral. In the mangrove forest, the larval c [...] olonization occurred after four months in the most frequently flooded station and after eight months in the two less frequent flooded stations. In the infralittoral, the panels were highly infested after four months. Along the experiment, the number of individuals decreased, especially in the infralittoral, possibly due to competition between teredinids and pholadids for wood. Bankia fimbriatula was the most abundant teredinid, occurring in the infralittoral and in the mangrove area, followed by Bankia gouldi and Lyrodus floridanus, which occurred only in the infralittoral and Nausitora fusticula which was found only in the mangrove forest. In total, 704 individuals of Teredinidae were collected. Martesia striata, the single pholadid, was found in the infralittoral, and totaled 2,658 individuals.

  6. Metazoan parasites of the channel catfish (Ictalurus punctatus) from three dams in Nuevo Leon, Mexico / Metazoarios parásitos del bagre de canal (Ictalurus punctatus) de tres presas en Nuevo León, México

    Scientific Electronic Library Online (English)

    Lucio, Galaviz-Silva; Zinnia Judith, Molina-Garza; Baldemar, Escobar-González; Francisco Javier, Iruegas-Buentello.


    Full Text Available El bagre de canal (Ictalurus punctatus) es una de las especies que destacan a nivel mundial en la acuacultura. Aunque la presencia de esta especie es cada vez mayor en la industria pesquera, su fauna parasitaria en México ha recibido escasa atención. Esta investigación tiene como objetivos obtener i [...] nformación sobre la prevalencia y abundancia de la fauna parasitaria de I. punctatus y contribuir al inventario nacional de los parásitos de este hospedero. El estudio se realizó en tres presas del estado de Nuevo León: Cerro Prieto, Rodrigo Gómez y El Cuchillo-Solidaridad. Fueron registradas siete especies de helmintos y una especie de copépodo de 24 I. punctactus. Los resultados obtenidos consisten en un total de 4,687 parásitos, de los cuales 108 fueron endoparásitos y 4,579 ectoparásitos. Los resultados demuestran una gran diversidad de helmintos parásitos, incluyendo a Ligictaluridus floridanus, Corallobothrium fimbriatum y un nuevo registro de localidad para Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp. y el copepodo Ergasilus cerastes, así como un nuevo registro de hospedero y localidad para Spinitectus tabascoensis, originalmente descrito en Ictalurus furcatus en Tabasco al sur de México. Abstract in english The freshwater channel catfish (Ictalurus punctatus, Rafinesque, 1818) is one of the world-wide highlight species in aquaculture. Despite the growing presence of this fish in the farming industry, its parasitic fauna is rarely studied in Mexico. This survey was designed to provide insight into the o [...] ccurrence and abundance of parasitic fauna of I. punctatus and to contribute to the national inventory of parasites of this fish. This study was performed at the following three dams in the state of Nuevo Leon, Mexico: Cerro Prieto, Rodrigo Gomez, and El Cuchillo-Solidaridad. Seven helminths and 1 copepod species were recorded from the 24 I. punctatus collected. This record consists of a total of 4,687 parasites, of which 108 were endoparasites and 4,579 ectoparasites. Our findings demonstrate a great diversity of helminth parasites, including Ligictaluridus floridanus, and Corallobothrium fimbriatum, and new locality records for Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp., the copepod Ergasilus cerastes, and a new host and distribution record was reported for Spinitectus tabascoensis, originally described from I. furcatus from Tabasco, southern Mexico.

  7. Density and habitat requirements of sympatric hares and cottontails in northern Italy

    Directory of Open Access Journals (Sweden)

    Anna Vidus Rosin


    Full Text Available Abstract From 2005 to 2009, densities and habitat selection by the European hare (Lepus europaeus and Eastern cottontail (Sylvilagus floridanus were assessed during feeding activity in an intensively cultivated area in northern Italy. Hare average density (74 ind./km2 was comparable to the highest values reported for European farming areas. Preand post-breeding density fluctuated widely across the study years, probably as a consequence of changes in the carrying capacity of the study area. Cottontail population size progressively increased, as expected for a recently introduced species supported by high reproductive performances. Hares used both crops and spontaneous vegetation during their feeding activity. Conversely, cottontails avoided winter cereals and preferred to feed on alfalfa. Our results suggest that simplified agro-ecosystems cannot maintain high density hare populations even at a short time scale. Landscape heterogeneity could enhance the chances of coexistence between the two lagomorphs.
    Riassunto Densità ed esigenze ecologiche della lepre e del silvilago in condizioni di simpatria in Italia settentrionale Tra il 2005 e il 2009, la densità e l’uso del habitat durante l’attività di alimentazione da parte della Lepre europea (Lepus europaeus e del Silvilago (Sylvilagus floridanus sono stati indagati in un’area intensamente coltivata nell’Italia settentrionale. La densità media della lepre nell’area di studio (74 ind./km2 corrisponde ai valori maggiori riportati per le aree agricole europee. Le densità pre- e post riproduttive della lepre hanno mostrato sensibili fluttuazioni durante il periodo di studio, probabilmente dovute ai cambiamenti stagionali della capacità portante dell’area di studio. L’abbondanza del silvilago è aumentata durante gli ultimi tre anni di studio, come prevedibile per una specie, a bassa densità, ben adattata agli ambienti agricoli e supportata da una elevata performance riproduttiva. Durante l’attività di alimentazione, le lepri hanno utilizzato sia le coltivazioni sia la vegetazione spontanea. Invece, il silvilago ha evitato i cereali autunnali e selezionato l’erba medica. I risultati suggeriscono che ambienti agricoli semplificati non sono in grado di mantenere popolazioni di lepre ad alte densità nemmeno per brevi periodi di tempo. Ambienti eterogenei potrebbero favorire la coesistenza tra le due specie di lagomorfi.


  8. Roadkills of vertebrates in Venezuela Vertebrados mortos em estradas na Venezuela

    Directory of Open Access Journals (Sweden)

    Jan Pinowski


    Full Text Available This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October. During five passages on this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758 (Myrmecophagidae, 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae. Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-outubro. Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae, durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 raposas Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766 (Myrmecophagidae, 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae. Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.

  9. Roadkills of vertebrates in Venezuela / Vertebrados mortos em estradas na Venezuela

    Scientific Electronic Library Online (English)

    Jan, Pinowski.


    Full Text Available Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-o [...] utubro). Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae), durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 raposas Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766) (Myrmecophagidae), 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae). Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae). Abstract in english This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October). During five passages on [...] this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae) during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758) (Myrmecophagidae), 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae). Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae).

  10. Colonization of artificial substrata by teredinid larvae released from a previously infested focus at Ilha Grande Bay, RJ

    Directory of Open Access Journals (Sweden)

    Ricardo Silva Varotto


    Full Text Available The colonization pattern of wooden panels by teredinid larvae released from a previously infested focus was investigated. Panels were placed at different distances (1, 10, 20m and in different directions from the focus. The colonization experiment took place at Parcel do Aleijado, Ilha Grande Bay, RJ. The focus remained immersed in nearly surface water, by the coast, during three months for infestation by teredinids. After this period, it was transferred to the study site. The infested focus and colonization panels remained in water, 10m deep, for three months more. Total density and density of the dominant species were considered for each group of panels. Five teredinid species were found: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. The dominant species was Teredo furcifera (76.6%. Significant differences were only observed between directions for total teredinids and for dominant species density. Results concerning the dominant species Teredo furcifera were even more expressive and suggested the occurrence of a local water circulation pattern.Foi estudado o padrão de colonização de larvas de teredinídeo liberadas a partir de um foco previamente infestado. Coletores foram posicionados a diferentes distâncias (1m, 10m, 20m e em diferentes sentidos a partir do foco. O experimento de colonização foi realizado junto ao Parcel do Aleijado, Baía da Ilha Grande, RJ. O foco permaneceu imerso próximo à superfície, junto à costa, durante 3 meses para infestação por teredinídeos. Após este período, foi tranferido para a área de estudo. O foco infestado e os coletores permaneceram imersos, a 10m de profundidade, por mais 3 meses. Foram consideradas a densidade total e a densidade da espécie dominante para cada grupo de coletores. Foram encontradas 5 espécies de teredinídeos: Bankia fimbriatula, Bankia gouldi, Lyrodus floridanus, Lyrodus massa and Teredo furcifera. A espécie dominante foi Teredo furcifera (76,6%. Diferenças significativas foram observadas somente entre os diferentes sentidos, para o valor total de teredinídeos e para a densidade da espécie dominante. Os resultados envolvendo a espécie dominante Teredo furcifera foram ainda mais expressivos e sugerem a ocorrência de um padrão local de circulação de água.

  11. Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato / Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro

    Scientific Electronic Library Online (English)

    Moacyr Mascarenhas Motta, Miranda; Marcelo Coutinho, Picanço; José Cola, Zanuncio; Leandro, Bacci; Ézio Marques da, Silva.


    Full Text Available O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP) na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/sema [...] na), MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos) e testemunha (sem aplicação de inseticidas e fungicidas). O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) e Liriomyza spp. (Diptera: Agromyzidae) às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), seguido de T. absoluta e Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae), larvas de Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae), adultos de Staphylinidae (Coleoptera), Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera) e Phlaeothripidae (Thysanoptera). Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] e Bethylidae (Goniozus nigrifemur Ashmead), além de Diptera: Tachinidae. Abstract in english The objective of this work was to evaluate the impact of integrated pest management (IPM) in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides), [...] IPM (spraying when action thresholds were achieved), and control (no pesticide was applied). IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and Liriomyza spp. (Diptera: Agromyzidae) to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), followed by T. absoluta and Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae), Cycloneda sanguinea larva (L.) (Coleoptera: Coccinellidae), Staphylinidae adults (Coleoptera), Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera), and Phlaeothripidae (Thysanoptera). The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] and Bethylidae (Goniozus nigrifemur Ashmead), besides Tachinidae (Diptera).

  12. Diet of four annual killifishes: an intra and interspecific comparison

    Directory of Open Access Journals (Sweden)

    Gabriel Laufer


    Full Text Available We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lagoon basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae, Ephemeroptera (especially Betidae, and coleopteran larvae (especially Dytiscidae. Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae, Ephemeroptera (especialmente Betidae, e larvas de Coleoptera (especialmente Dytiscidae. Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação.

  13. Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo / Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars

    Scientific Electronic Library Online (English)

    Maria da Conceição M., Soglia; Vanda Helena Paes, Bueno; Lívia Mendes, Carvalho.


    Full Text Available Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fo [...] tofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as quais estavam posicionadas sobre disco foliar (4 cm) de cada cultivar ('White Reagan' e'Yellow Snowdon') em camada de ágar-água . Na avaliação da oviposição foram utilizados pecíolos de cada cultivar como substrato de oviposição e ovos de Anagasta kuehniella (Zeller, 1879) como alimento. O predador completou seu desenvolvimento alimentando-se somente de A. gossypii presente em ambas as cultivares. A duração da fase ninfal de O. insidiosus foi de 21,1 e 18,3 dias, em 'White Reagan' e 'Yellow Snowdon', respectivamente. O consumo de A. gossypii por fêmeas foi maior (P Abstract in english This work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832) feeding on Aphis gossypii Glover, 1877 as weel as its oviposition behavior on two crysanthemum cut cultivars. The trials were conducted in climatic chamber at 25±1ºC, RH 70±10% and 12h photophase. Ny [...] mphs of the predator, less than 24h old, were kept individualy in petri dishes (5cm) with 20 nymphs of A. gossypii (1st, 2nd and 3rt instars) on leaf disc (4cm) of each cultivar ("White Reagan" and "Yellow Snowdon") in a layer of agar-water (1%). Petiole of each crysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879). The predador complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on "White Reagan" and "Yellow Snowdon", respectively. The consumption of the females of O. insidiosus was higher (P

  14. Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi / Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi

    Scientific Electronic Library Online (English)



    Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores A [...] gropastoril (Agriflor), em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução. Abstract in english Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão d [...] as Flores Agropastoril (Agriflor), in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.

  15. Biological control of phytophagous arthropods in the physic nut tree Jatropha curcas L. in Brazil / Controle biológico de artrópodes fitófagos em Pinhão Manso Jatropha curcas L. no Brasil

    Scientific Electronic Library Online (English)

    Flávio Lemes, Fernandes; Maria Elisa de Sena, Fernandes; Elisângela Novais, Lopes; Madelaine, Venzon; Juno Ferreira da Silva, Diniz; Luís Antônio dos Santos, Dias.


    Full Text Available Jatropha curcas possui alto teor de óleo biocombustível que poderia substituir os combustíveis poluentes, possuindo grande potencial para o cultivo em larga escala de monocultivos no sistema convencional. Nós exploramos a ocorrência, a distribuição espacial e a resposta funcional das principais esp [...] écies fitófagas e seus inimigos naturais com potencial para controle biológico conservativo. Começamos a amostragem de fitófagos e predadores quando o J. curcas atingiu seis meses de idade. As espécies fitófagas mais frequentes foram ninfas e adultos Empoasca kraemeri, seguido por Frankliniella schultzei e Myzus persicae. Dentre os predadores, Ricoseius loxochelis, Iphiseioides zuluagai, Araneidae, Psyllobora vigintimaculata (larv), Psyllobora vigintimaculata (adulto) e Anthicus sp. foram as mais frequentes. Os parasitoides mais comuns foram das famílias Encyrtidae e Braconidae. As maiores densidades de E. kraemeri fitófagos e F. schultzei nas bordas da cultura de J. curcas seguem padrões espaciais semelhantes aos de inimigos naturais de I. zuluagai e A. sp. Esses artrópodes podem ser considerados eficientes predadores de estágios imaturos de E. kraemeri e F. schultzei em J. curcas. Abstract in english Jatropha curcas has a high biofuel oil content, which could replace polluting fuels, and has great potential for large scale monoculture cultivation in the conventional system. We explored the occurrence, spatial distribution and the functional response of the main phytophagous species of this plan [...] t and their natural enemies to explore the potential for conservative biological control. We began sampling phytophagous species and predators when J. curcas plants were six months old. The most common species of phytophagous insects were nymphs and adults of Empoasca kraemeri, followed by Frankliniella schultzei and Myzus persicae. Among the predators, Ricoseius loxocheles, Iphiseioides zuluagai, Araneidae, larvae and adults of Psyllobora vigintimaculata and Anthicus sp. were the most frequently encountered. The most common parasitoids were the families Encyrtidae and Braconidae. The highest densities of E. kraemeri and F. schultzei on the edges of the J. curcas crop follow spatial patterns similar to those of their natural enemies I. zuluagai and Anthicus sp. These arthropods can be considered efficient predators of immature stages of E. kraemeri and F. schultzei on J. curcas.

  16. Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds

    Directory of Open Access Journals (Sweden)

    Walter Santos Evangelista Júnior


    Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas.This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods under partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

  17. Activity, habitat use, feeding behavior, and diet of four sympatric species of Serranidae (Actinopterygii: Perciformes) in southeastern Brazil

    Scientific Electronic Library Online (English)

    Fernando Zaniolo, Gibran.


    Full Text Available Diplectrum formosum, Diplectrum radiale (micholes-da-areia), Epinephelus marginatus (garoupa-verdadeira) e Mycteroperca acutirostris (badejo-mira) são quatro espécies simpátricas que pertencem à família Serranidae, de reconhecida importância ecológica e comercial. Este estudo analisou a alimentação [...] destas quatro espécies de peixes no Canal de São Sebastião, Estado de São Paulo (sudeste do Brasil), comparando suas dietas, o uso do habitat e algumas características morfológicas relacionadas ao comportamento alimentar e a distribuição vertical na coluna d'água. Estes quatro serranídeos são predadores oportunistas que utilizam um total de nove táticas diferentes para capturar suas presas, alimentando-se principalmente de crustáceos durante o dia e crepúsculo, e permanecendo estacionários e inativos durante a noite. Um estudo ecomorfológico foi empregado para testar seu valor preditivo. Foi verificado que tal abordagem deve ser utilizada com cautela e sempre complementada com observações diretas no ambiente. Apesar de morfologicamente e comportamentalmente muito semelhantes, D. formosum e D. radiale mostraram divergências com relação ao tipo de substrato preferido pelos maiores indivíduos, que são exclusivamente predadores de espreita. Por outro lado, E. marginatus mostrou possuir hábitos de vida mais sedentários do que M. acutirostris, o mais versátil predador dentre as espécies estudadas. As espécies de Diplectrum estudadas, assim como E. marginatus, podem ser classificadas como serranídeos bentônicos, enquanto que M. acutirostris pode ser classificada como uma espécie nectobentônica. Abstract in english Diplectrum formosum (the sand perch), Diplectrum radiale (the aquavina), Epinephelus marginatus (the dusky grouper) and Mycteroperca acutirostris (the comb grouper) are four sympatric serranid of remarkable ecological and commercial importance. This study investigated the feeding of these four speci [...] es in the São Sebastião Channel, São Paulo State (southeastern Brazil), comparing their diet, habitat utilization and morphological features related to foraging. These four serranids are opportunistic visual predators that use a total of nine different tactics to capture their preys, feed mostly on crustaceans during the day and twilight, and keep stationary and quiescent at night. The ecomorphological study was conducted to test its predictive value to infer lifestyles. It was verified that such analysis should be used carefully and must be complemented by field observations. Although morphologically and behaviorally very similar, D. formosum and D. radiale showed different preferences to the substratum type used by large individuals, which are exclusively sit-and-wait predators. On the other hand, E. marginatus displayed more sedentary habits than M. acutirostris, the most versatile predator from the studied species. The studied species of Diplectrum and E. marginatus can be regarded as benthic serranids, while M. acutirostris could be viewed as a nektobenthic species.

  18. Activity, habitat use, feeding behavior, and diet of four sympatric species of Serranidae (Actinopterygii: Perciformes in southeastern Brazil

    Directory of Open Access Journals (Sweden)

    Fernando Zaniolo Gibran


    Full Text Available Diplectrum formosum (the sand perch, Diplectrum radiale (the aquavina, Epinephelus marginatus (the dusky grouper and Mycteroperca acutirostris (the comb grouper are four sympatric serranid of remarkable ecological and commercial importance. This study investigated the feeding of these four species in the São Sebastião Channel, São Paulo State (southeastern Brazil, comparing their diet, habitat utilization and morphological features related to foraging. These four serranids are opportunistic visual predators that use a total of nine different tactics to capture their preys, feed mostly on crustaceans during the day and twilight, and keep stationary and quiescent at night. The ecomorphological study was conducted to test its predictive value to infer lifestyles. It was verified that such analysis should be used carefully and must be complemented by field observations. Although morphologically and behaviorally very similar, D. formosum and D. radiale showed different preferences to the substratum type used by large individuals, which are exclusively sit-and-wait predators. On the other hand, E. marginatus displayed more sedentary habits than M. acutirostris, the most versatile predator from the studied species. The studied species of Diplectrum and E. marginatus can be regarded as benthic serranids, while M. acutirostris could be viewed as a nektobenthic species.Diplectrum formosum, Diplectrum radiale (micholes-da-areia, Epinephelus marginatus (garoupa-verdadeira e Mycteroperca acutirostris (badejo-mira são quatro espécies simpátricas que pertencem à família Serranidae, de reconhecida importância ecológica e comercial. Este estudo analisou a alimentação destas quatro espécies de peixes no Canal de São Sebastião, Estado de São Paulo (sudeste do Brasil, comparando suas dietas, o uso do habitat e algumas características morfológicas relacionadas ao comportamento alimentar e a distribuição vertical na coluna d'água. Estes quatro serranídeos são predadores oportunistas que utilizam um total de nove táticas diferentes para capturar suas presas, alimentando-se principalmente de crustáceos durante o dia e crepúsculo, e permanecendo estacionários e inativos durante a noite. Um estudo ecomorfológico foi empregado para testar seu valor preditivo. Foi verificado que tal abordagem deve ser utilizada com cautela e sempre complementada com observações diretas no ambiente. Apesar de morfologicamente e comportamentalmente muito semelhantes, D. formosum e D. radiale mostraram divergências com relação ao tipo de substrato preferido pelos maiores indivíduos, que são exclusivamente predadores de espreita. Por outro lado, E. marginatus mostrou possuir hábitos de vida mais sedentários do que M. acutirostris, o mais versátil predador dentre as espécies estudadas. As espécies de Diplectrum estudadas, assim como E. marginatus, podem ser classificadas como serranídeos bentônicos, enquanto que M. acutirostris pode ser classificada como uma espécie nectobentônica.

  19. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Scientific Electronic Library Online (English)

    Geuza, Cantanhêde; Norma Segatti, Hahn; Rosemara, Fugi; Éder André, Gubiani.


    Full Text Available O objetivo deste estudo foi investigar alterações na dieta de um peixe piscívoro (Acestrorhynchus pantaneiro) após mudanças na abundância de um peixe forrageiro (Moenkhausia dichroura) durante a colonização de um reservatório. Os peixes foram amostrados mensalmente entre março/2000 e fevereiro/2001 [...] (período I) e março/2003 e fevereiro/2004 (período II), no reservatório de Manso (Mato Grosso, Brasil). A abundância de M. dichroura foi significativamente diferente entre os períodos, representando 9,6% dos indivíduos no período I e 66,4% no período II. No período I A. pantaneiro consumiu 41 presas, enquanto que no período II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no período I representava apenas 15%. A relação entre o tamanho do predador e da presa foi positiva em ambos os períodos, porém significativamente diferente. No período II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura). Os resultados mostraram que A. pantaneiro consumiu, no período II, a presa mais abundante e disponível, alterando a composição de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alterações provavelmente causaram um decréscimo nos custos energéticos associados à procura da presa, maximizando o ganho de energia do predador. Abstract in english The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro) following changes in abundance of a forage fish (Moenkhausia dichroura) during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (Stat [...] e of Mato Grosso, Brazil) from March 2000 to February 2001 (period I) and from March 2003 to February 2004 (period II). The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura) in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.

  20. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Directory of Open Access Journals (Sweden)

    Geuza Cantanhêde


    Full Text Available The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro following changes in abundance of a forage fish (Moenkhausia dichroura during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (State of Mato Grosso, Brazil from March 2000 to February 2001 (period I and from March 2003 to February 2004 (period II. The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.O objetivo deste estudo foi investigar alterações na dieta de um peixe piscívoro (Acestrorhynchus pantaneiro após mudanças na abundância de um peixe forrageiro (Moenkhausia dichroura durante a colonização de um reservatório. Os peixes foram amostrados mensalmente entre março/2000 e fevereiro/2001 (período I e março/2003 e fevereiro/2004 (período II, no reservatório de Manso (Mato Grosso, Brasil. A abundância de M. dichroura foi significativamente diferente entre os períodos, representando 9,6% dos indivíduos no período I e 66,4% no período II. No período I A. pantaneiro consumiu 41 presas, enquanto que no período II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no período I representava apenas 15%. A relação entre o tamanho do predador e da presa foi positiva em ambos os períodos, porém significativamente diferente. No período II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura. Os resultados mostraram que A. pantaneiro consumiu, no período II, a presa mais abundante e disponível, alterando a composição de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alterações provavelmente causaram um decréscimo nos custos energéticos associados à procura da presa, maximizando o ganho de energia do predador.

  1. Influence of habitat modification on the intestinal helminth community ecology of cottontail rabbit populations. (United States)

    Boggs, J F; McMurry, S T; Leslie, D M; Engle, D M; Lochmiller, R L


    The influence of five brush management treatments using the herbicides tebuthiuron and triclopyr, with or without prescribed burning, on the intestinal helminth community of cottontail rabbits (Sylvilagus floridanus) was studied in 1987 on the Cross Timbers Experimental Range in Payne County, Oklahoma (USA). Six helminth species were found (Dermatoxys veligera, Trichostrongylus calcaratus, Passalurus nonanulatus, Wellcomia longejector, Taenia pisiformis cystercercus, and Mosgovoyia pectinata americana) in 102 rabbits (88 adult and 14 juveniles) collected over two seasons (winter and summer). Prevalence of M. pectinata americana in cottontail rabbits was significantly greater in untreated control pastures than herbicide treated pastures in winter, while prevalence of T. pisiformis was significantly greater in burned than unburned pastures. Abundances of helminth species in the intestinal tract of cottontail rabbits were unaffected by brush treatments. Mosgovoyia pectinata americana abundance demonstrated a highly significant increase from winter to summer; conversely, abundance of all oxyurid pinworms combined (D. veligera, P. nonanulatus, W. longejector) was significantly higher in winter than summer. Helminth community dynamics were significantly influenced by season, but were unaffected by brush treatments. Habitat modification could have influenced cestode transmission by altering the ecology of invertebrate and vertebrate hosts. PMID:2338720

  2. Análisis comparativo de la alimentación del gato montés (Lynx Rufus en dos diferentes ambientes de México

    Directory of Open Access Journals (Sweden)

    Marcelo Aranda


    Full Text Available En el presente trabajo se analiza, en forma comparativa, la alimentación del gato montés en dos localidades con ambientes diferentes: la primera es el predio ?El Plomito?, Sonora, con vegetación de matorrales áridos, y la segunda es la Sierra del Ajusco, en el sur de la Cuenca de México, donde predominan los bosques de coníferas. Mediante el análisis de 197 y 922 excretas, se identificaron 18 y 28 presas diferentes, respectivamente. En ambas localidades, los grupos de especies presa que aportaron mayor biomasa a la alimentación del gato montés fueron los lagomorfos, con 74.2% en El Plomito y 70.0% en El Ajusco, y los roedores con 18.9 y 18.7%, en el mismo orden. En El Plomito la presa más importante fue Sylvilagus audubonii (35.5%, seguida por Lepus sp. (31.5%, Neotoma albigula (14.0%, Odocoileussp. (2.9% y Spermophilus variegatus (1.7%. En El Ajusco la presa más importante fue Sylvilagus floridanus(41.6%, seguida por Sylvilagus cunicularius (15.4%, Romerolagus diazi (12.3%, Cratogeomys merriami (5.1% y Sciurus aureogaster (4.9%. Los resultados obtenidos apoyan la teoría de que el gato montés, al igual que las otras especies de linces, es un depredador especialista en la caza de lagomorfos.

  3. Ocorrência e recrutamento larval de Teredinidae (Mollusca, Bivalvia na região do Sistema Costeiro Cananéia-Iguape, São Paulo, Brasil

    Directory of Open Access Journals (Sweden)

    Daniela T. de Moraes


    Full Text Available A ocorrência e o recrutamento larval de Teredinidae na região do Sistema Costeiro Cananéia-Iguape foram acompanhados por doze meses utilizando-se coletores laminados de pinho, instalados em três estações dentro do bosque de mangue (mediolitoral e em uma estação, localizada no infralitoral. No manguezal, a colonização por larvas de teredinídeos ocorreu após quatro meses de permanência dos coletores na estação mais frequentemente inundada pela maré e somente após oito meses nas duas estações com menor frequência de inundação. No infralitoral, após quatro meses, os coletores já estavam consideravelmente danificados. Ao longo do experimento, houve um decréscimo no número de teredinídeos, especialmente no infralitoral, ocasionado possivelmente pela competição por alimento e espaço entre teredinídeos e foladídeos. Foram encontrados 2.658 indivíduos, sendo 704 de Teredinidae e 1.954 de Pholadidae. Entre os teredinídeos, Bankia fimbriatula foi a espécie mais abundante tanto no infralitoral quanto no manguezal, seguida de Bankia gouldi e Lyrodus floridanus que ocorreram somente no infralitoral, e Nausitora fusticula encontrada somente no manguezal. Martesia striata, único foladídeo, ocorreu somente no infralitoral.

  4. Discovery of defense- and neuropeptides in social ants by genome-mining. (United States)

    Gruber, Christian W; Muttenthaler, Markus


    Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant), Camponotus floridanus (carpenter ant) and Harpegnathos saltator (basal genus). Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins) and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae) and supports recent findings in Tribolium castaneum (red flour beetle) and Nasonia vitripennis (parasitoid wasp), and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee), another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family) and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value. PMID:22448224

  5. Great horned owl (Bubo virginianus) dietary exposure to PCDD/DF in the Tittabawassee River floodplain in Midland, Michigan, USA. (United States)

    Coefield, Sarah J; Zwiernik, Matthew J; Fredricks, Timothy B; Seston, Rita M; Nadeau, Michael W; Tazelaar, Dustin L; Moore, Jeremy N; Kay, Denise P; Roark, Shaun A; Giesy, John P


    Soils and sediments in the floodplain of the Tittabawassee River downstream of Midland, Michigan, USA contain elevated concentrations of polychlorinated dibenzofurans (PCDF) and polychlorinated dibenzo-p-dioxins (PCDD). As a long-lived, resident top predator, the great horned owl (Bubo virginianus; GHO) has the potential to be exposed to bioaccumulative compounds such as PCDD/DF. Site-specific components of the GHO diet were collected along 115 km of the Tittabawassee, Pine, Chippewa, and Saginaw Rivers during 2005 and 2006. The site-specific GHO biomass-based diet was dominated by cottontail rabbits (Sylvilagus floridanus) and muskrats (Ondatra zibethicus). Incidental soil ingestion and cottontail rabbits were the primary contributors of PCDD/DF to the GHO diet. The great horned owl daily dietary exposure estimates were greater in the study area (SA) (3.3 to 5.0 ng 2,3,7,8-TCDD equivalents (TEQ(WHO-avian))/kg body wt/d) than the reference area (RA) (0.07 ng TEQ(WHO-Avian)/kg body wt/d). Hazard quotients (HQs) based on central tendency estimates of the average daily dose and no-observable-adverse effect level (NOAEL) for the screech owl and uncertainty factors were <1.0 for both the RA and the SA. Hazard quotients based on upper end estimates of the average daily dose and NOAEL were <1.0 in the RA and up to 3.4 in the SA. PMID:20872700

  6. Structural changes of oil palm empty fruit bunch (OPEFB) after fungal and phosphoric acid pretreatment. (United States)

    Isroi; Ishola, Mofoluwake M; Millati, Ria; Syamsiah, Siti; Cahyanto, Muhammad N; Niklasson, Claes; Taherzadeh, Mohammad J


    Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI) of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB's cellulose by 4, 6.3, and 7.4 folds, respectively. PMID:23247371

  7. Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB after Fungal and Phosphoric Acid Pretreatment

    Directory of Open Access Journals (Sweden)

    Mohammad J. Taherzadeh


    Full Text Available Oil palm empty fruit bunch (OPEFB was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydrate, which is associated with crystallinity of cellulose of OPEFB. Lateral Order Index (LOI of OPEFB with no pretreatment, with fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 2.77, 1.42, 0.67, and 0.60, respectively. Phosphoric acid pretreatment showed morphological changes of OPEFB, indicated by the damage of fibre structure into smaller particle size. The fungal-, phosphoric acid-, and fungal followed by phosphoric acid pretreatments have improved the digestibility of OPEFB’s cellulose by 4, 6.3, and 7.4 folds, respectively.

  8. Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiológica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)

    Scientific Electronic Library Online (English)

    Ana Carolina Maciel, Redoan; Geraldo Andrade, Carvalho; Ivan, Cruz; Maria de Lourdes Corrêa, Figueiredo; Rafael Braga da, Silva.


    Full Text Available Doru luteipes (SCUDDER, 1876) é um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservação é necessária a utilização de inseticidas seletivos a S. frugiperda e inócuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposição aos resíduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas após o tratamento. Os inseticidas foram classificados segundo índices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi inócuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposição de D. luteipes aos resíduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivência de adultos após o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram inócuos. Devido à baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservação dessa espécie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetação e campo para comprovação de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

  9. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate / Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system

    Scientific Electronic Library Online (English)

    Maria Alice de, Medeiros; Edison Ryoiti, Sujii; Helena Castanheira de, Morais.

    Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância dess [...] es fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1) coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2) exposição de ovos sentinelas no campo por 72 horas; 3) ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3), evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate. Abstract in english The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick) (Lep.: Gelechiidae) affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining). The objective of the present work was to quantify the role of each factor in the surviv [...] orship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1) tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2) tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3) cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32%) than those kept in the field (methodology 2 and 3). However, under field conditions (method 2 and 3) by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

  10. Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse

    Directory of Open Access Journals (Sweden)

    Lívia Mendes Carvalho


    Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan' em casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method" e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande, e o restante incluíram F. gemina (Bagnall, Frankliniella sp., Caliothrips phaseoli (Hood e Haplothrips gowdeyi (Franklin. Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%, sendo também coletados Myzus persicae (Sulzer e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.. Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas.Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan' in commercial greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande (>90%, F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood and Haplothrips gowdeyi (Franklin were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover (>80%, Myzus persicae (Sulzer and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson, and the predators Chrysoperla sp., Cycloneda sanguinea (L. and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

  11. Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação / Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse

    Scientific Electronic Library Online (English)

    Lívia Mendes, Carvalho; Vanda Helena Paes, Bueno; Simone Martins, Mendes.

    Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan') em [...] casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method") e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande), e o restante incluíram F. gemina (Bagnall), Frankliniella sp., Caliothrips phaseoli (Hood) e Haplothrips gowdeyi (Franklin). Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%), sendo também coletados Myzus persicae (Sulzer) e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say) foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson) e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.). Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas. Abstract in english Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan') in commercial [...] greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande) (>90%), F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood) and Haplothrips gowdeyi (Franklin) were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover) (>80%), Myzus persicae (Sulzer) and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say) was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson), and the predators Chrysoperla sp., Cycloneda sanguinea (L.) and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

  12. Eficiência de Chrysoperla externa (Hagen, 1861(Neuroptera: Chrysopidae no controle de Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae em pimentão (Capsicum annum L. Efficiency of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae in the Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae population reduction in sweet pepper (Capsicum annum L.

    Directory of Open Access Journals (Sweden)

    Leonardo Rodrigues Barbosa


    Full Text Available Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, contendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente.The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs containing 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

  13. Faunistic survey of sandstone caves from Altinópolis region, São Paulo State, Brazil

    Scientific Electronic Library Online (English)

    Douglas, Zeppelini Filho; Alexandre Cunha, Ribeiro; Guilherme Cunha, Ribeiro; Maria Paula Aguiar, Fracasso; Marcelo Monetti, Pavani; Otto Müller Patrão, Oliveira; Sérgio Adriano de, Oliveira; Antonio Carlos, Marques.

    Full Text Available A fauna de oito cavernas areníticas da região de Altinópolis (província espeleológica arenítica da Serra Geral, Estado de São Paulo, Sudeste do Brasil) foi amostrada. Nossos resultados aumentaram o conhecimento faunístico prévio da região, com o registro de 15 novas ocorrências para cavernas brasile [...] iras e 26 para cavernas brasileiras em arenito. A fauna é caracterizada por um grande número de detritívoros/carnívoros tais como grilos e baratas, diversos predadores tais como aranhas e heterópteros no guano de morcego. Abstract in english The fauna of eight sandstone caves of the region of Altinópolis, (Serra Geral Arenitic Speleological province, São Paulo State, Southeastern Brazil) was surveyed. Our results improve the previous faunistic knowledge of the region, recording 15 new occurrences for Brazilian caves and 26 for Brazilian [...] sandstone caves. The fauna is characterized by a large number of detritivores/omnivores such as crickets and cockroaches, and several predators like spiders and heteropterans in bat guano.


    Directory of Open Access Journals (Sweden)



    Full Text Available The present work describes biological aspects of species caught with pelagic longline off Rio Grande do Sul State, Brazil, between 30ºS to 35ºS. Results point this area as a possible feeding ground of pelagic predators like sharks, swordfish and tunas. Data revealed this area as a parturition location for females blue sharks Prionace glauca. O presente trabalho descreve aspectos da biologia das espécies capturadas com espinhel pelágico na região oceânica frente ao Estado do Rio Grande do Sul, Brasil, cobrindo a área entre 30ºS e 35ºS. Os resultados indicam o uso da área como possível sítio de alimentação para grandes predadores pelágicos como tubarões, espadartes e atuns. Os dados indicam ainda a área como um local utilizado por fêmeas de tubarão-azul Prionace glauca para o parto.

  15. Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas / Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae

    Scientific Electronic Library Online (English)

    Leandro, Bacci; Marcelo C., Picanço; Marcos Rafael, Gusmão; Robert W., Barreto; Tederson Luiz, Galvan.


    Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Der [...] maptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes), dimetoato (para adultos e ninfas de primeiro e segundo estádios), paratiom metílico (para ninfas de primeiro e terceiro estádio) e acefato (para adultos), apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae. Abstract in english The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer) (Homoptera: Aphididae) and on first, second, and third instar nymphs and adults of the Doru [...] luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes), for dimethoate (to adults and first and second instar nymphs of the predator), for methyl parathion (to first and third instar nymphs of the predator), and for acephate (to adults of the predator) showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

  16. Toxicidade de formulações de nim (Azadirachta indica A. Juss.) ao ácaro-rajado e a Euseius alatus De Leon e Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae) / Toxicity of neem (Azadirachta indica A. Juss) formulations for twospotted spider mite and Euseius alatus De Leon and Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Hilda M., Brito; Manoel G.C., Gondim Jr.; José V. de, Oliveira; Cláudio A.G. da, Câmara.


    Full Text Available A toxicidade de formulações comerciais de nim a Tetranychus urticae Koch (Acari: Tetranychidae) e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks) foi estudada. A toxicidade tópica foi avaliada com três formulações comerciais (Natuneem, Neemseto e Callneem) e com o [...] extrato de sementes de nim, todos na concentração de 1%, em comparação ao acaricida padrão, abamectina na concentração de 0,3ml/L e ao tratamento controle com água destilada. Com base no melhor efeito tópico sobre T. urticae, a formulação Neemseto foi selecionada para avaliar diferentes concentrações sobre ovos, e o efeito residual e repelente sobre adultos desses ácaros. O tratamento dos ovos consistiu na imersão em diluições de Neemseto por cinco segundos; e o efeito residual e repelente sobre adultos foi avaliado pela imersão de discos de folha nas diluições também por cinco segundos. A toxicidade de Neemseto a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. Neemseto foi repelente para T. urticae e E. alatus, quando testados nas concentrações 0,25; 0,50 e 1,00%, mas não afetou P. macropilis. A fecundidade de T. urticae foi reduzida significativamente por Neemseto em todas as concentrações, enquanto para os ácaros predadores, redução significante na fecundidade foi observada apenas nas maiores concentrações. Assim, nas formulações testadas, Neemseto foi o mais eficiente para o ácaro-rajado e provocou, relativamente, menor impacto aos ácaros predadores estudados. Abstract in english The toxicity of selected commercial formulations of neem on Tetranychus urticae Koch (Acari: Tetranychidae) and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) was studied. Topical toxicity was tested with the commercial formulations (Natuneem, Neemseto and Callneem) a [...] nd extract of neem's seeds at concentration 1%, compared to the standard acaricide abamectin at concentration of 0.3 ml/L and the control treatment (distilled water). Based on the best performance against T. urticae through topical contact, the formulation Neemseto was selected to be evaluated using different concentrations against eggs, and residual and repellent effects on adults of the mites. Egg treatment consisted of dipping eggs into Neemseto dilutions and control treatment for five seconds. In addition, residual and repellent effects of Neemseto for adult mites consisted of using leaf discs dipped into the dilutions for five seconds. The toxicity of Neemseto on eggs and adults was greater for T. urticae compared to the toxicity observed for the predatory mites. Neemseto was repellent for T. urticae and E. alatus when tested at the concentrations of 0.25, 0.50 and 1.0%, and did not affect P. macropilis. Neemseto using all concentrations, while for the predatory mites significant reduction of mite fecundity was only observed at the largest concentrations reduced the fecundity of T. urticae significantly. So Neemseto, among tested neem formulations, performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites studied.

  17. Toxicidade Diferencial de Agroquímicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro / Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry

    Scientific Electronic Library Online (English)



    Full Text Available Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroquímicos a populações de ácaros das espécies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fêmeas adult [...] as de N. californicus foram tratadas através de pulverização direta utilizando torre de Potter. O ácaro predador N. californicus mostrou tolerância igual ou superior a T. urticae a diversos produtos, em condições de laboratório. A maior diferença foi observada para o acaricida propargite, para o qual o ácaro predador mostrou-se 25,1 vezes mais tolerante que o ácaro rajado. Este fitoseídeo também se mostrou 4,7; 2,9 e 2,5 vezes mais tolerante que o ácaro rajado, a clorfenapir, fempiroximate e ciexatim, respectivamente. No teste de toxicidade residual de agroquímicos, a pulverização foi realizada em canteiros de morango. Foram coletados folíolos em diferentes períodos após a aplicação e infestados artificialmente com fêmeas adultas de N. californicus. As avaliações de mortalidade foram realizadas 48h ou 72h após a infestação. Fempiroximate, fempropatrim, dimetoato, propargite, enxofre e benomil mostraram-se inócuos a N. californicus. Clorfenapir, ciexatim e abamectim foram significativamente prejudiciais ao ácaro predador causando mortalidades iniciais entre 37,5% e 57,5%. A utilização de ácaros predadores como desta população de N. californicus, que apresenta baixa suscetibilidade a diversos agroquímicos, poderia ser muito útil em programas de manejo de T. urticae em morangueiro no Brasil Abstract in english This work aimed to evaluate the differential toxicity of pesticides to populations of the mite species Neoseiulus californicus (McGregor) and Tetranychus urticae Koch collected from commercial crops of strawberry (Fragaria sp.) in Atibaia county, State of São Paulo, Brazil. In the test of acute toxi [...] city of pesticides, adult females of N. californicus received the pesticide treatment under Potter spray tower. The predaceous mite N. californicus showed the same or higher tolerance than T. urticae to various pesticides in laboratory. The highest difference was observed to the acaricide propargite, for which the predaceous mite was 25.1 times more tolerant than the two-spotted spider mite. This phytoseiid was also 4.7, 2.9 and 2.5 times more tolerant than T. urticae to chlorfenapyr, fenpyroximate, and cyhexatin, respectively. In the test of residual toxicity of pesticides, the chemicals were sprayed on plants of strawberry in the field. Leaves were collected after different periods from the treatment and artificially infested with adult females of N. californicus. The mortality was assessed 48h or 72h after treatment. Fenpyroximate, fenpropathrin, dimethoate, propargite, sulphur, and benomyl were innocuous to N. californicus. Chlorfenapyr, cyhexatin, and abamectin were significantly harmful to the predaceous mite causing initial mortality rates between 37.5% and 57.5%. The use of predaceous mites like of this population of N. californicus, which presents low susceptibility to various pesticides can be very useful for programs of management of T. urticae on strawberry in Brazil.

  18. Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor (Acari: phytoseiidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulverizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The products' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  19. Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor) (Acari: phytoseiidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Caralos Amadeu Leite de, Oliveira.


    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor) em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulve [...] rizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor) under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The produc [...] ts' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  20. Efeitos do sistema de plantio e da consorciação soja-milho sobre artrópodes capturados no solo

    Directory of Open Access Journals (Sweden)

    Cividanes Francisco Jorge


    Full Text Available O objetivo deste estudo foi avaliar os efeitos do plantio direto e da consorciação soja [Glycine max (L. Merrill] e milho (Zea mays L. sobre artrópodes que vivem no solo. Os tratamentos constituíram um fatorial 3 x 2 (monocultura de soja, monocultura de milho, consorciação soja-milho x plantio direto, plantio convencional em blocos casualizados com quatro repetições; as amostragens foram efetuadas com armadilhas de solo, durante 1996 a 1998. Resultados estatisticamente significativos em pelo menos uma safra indicaram que o plantio direto foi favorável a predadores, como formigas (Brachymyrmex sp., Camponotus spp. e Ectatomma sp., carabídeos (Metius sp. e aranhas (Lycosidae. A consorciação soja-milho aumentou o número de Acrididae, enquanto a presença do milho favoreceu a ocorrência de Dermaptera em sistemas de consorciação soja-milho.


    Directory of Open Access Journals (Sweden)

    Jonathan A Guzmán


    Full Text Available Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador carnívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación.The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore in freshwater communities of the South-American altiplano.

  2. Eficiência de Chrysoperla externa (Hagen, 1861)(Neuroptera: Chrysopidae) no controle de Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) em pimentão (Capsicum annum L.) / Efficiency of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) in the Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) population reduction in sweet pepper (Capsicum annum L.)

    Scientific Electronic Library Online (English)

    Leonardo Rodrigues, Barbosa; César Freire de, Carvalho; Brígida, Souza; Alexander Machado, Auad.


    Full Text Available Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, con [...] tendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente. Abstract in english The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs conta [...] ining 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

  3. Biologia de Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) predando Plutella xylostella (L.) (Lepidoptera: Plutellidae) / Biology of Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) Preying on Plutella x ylostella (L.) (Lepidoptera: Plutellidae)

    Scientific Electronic Library Online (English)

    Mauricélia Ferreira, Almeida; Reginaldo, Barros; Manoel Guedes Corrêa, Gondim Júnior; Sérgio de, Freitas; Antônio Lourenço, Bezerra.


    Full Text Available Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) é um predador encontrado em vários agroecossistemas, predando insetos pequenos e de tegumento mole. Seu alto potencial reprodutivo e elevada capacidade de busca o tornam capazes de predar ovos e larvas de Plutella xylostella (L.) (Lepidoptera: Plu [...] tellidae) nas partes mais internas da cabeça do repolho, onde outros inimigos naturais não conseguem. Essas características podem favorecer a utilização desse predador no controle biológico dessa praga. Neste trabalho, o objetivo é avaliar o desenvolvimento, reprodução e capacidade de predação de C. claveri, quando ovos e larvas de P. xylostella foram ofertados em condições de laboratório. Foram avaliadas as seguintes dietas: 1) ovos; 2) larvas de segundo ínstar; 3) ovos + larvas de segundo ínstar. O desenvolvimento e a viabilidade das formas imaturas de C. claveri foi melhor nas dietas que continham ovos da presa. A oviposição e longevidade também foram maiores nessas dietas, independentemente da presença de larvas. Contudo, o tipo de dieta não afetou a razão sexual e o peso das larvas no oitavo dia de vida. Em média, cada larva de C. claveri foi capaz de predar 1611 ovos ou 135 larvas de segundo ínstar de P. xylostella durante seu desenvolvimento. O predador foi capaz de aumentar a população 218 vezes a cada 42 dias, alimentando-se, exclusivamente, de ovos da presa. Concluiu-se que o predador apresenta potencial para ser utilizado no controle biológico de P. xylostella. Abstract in english Ceraeochrysa claveri Navás (Neuroptera: Chrysopidae) is a predator found in several agricultural ecosystems and it preys on small and soft body insects. Its high reproductive potential and forage capacity makes it able of preying eggs and larvae of Plutella xylostella (L.) (Lepidoptera: Plutellidae) [...] internally hidden on cabbage head, where other natural enemies usually do not reach. These characteristics are important when choosing this predator to be used within biological control programs. This search evaluated the C. claveri development, reproduction, as well as the consumption of P. xylostella eggs and larvae under laboratory conditions. Therefore, it was evaluated the following diets: 1) eggs; 2) larvae of second ínstar; 3) eggs + larvae of second ínstar. The development and the viability of the immature forms of C. claveri were better in the diets containing eggs of P. xylostella. Also, the egg laying and adult longevity were greater with these diets, independently of the larvae presence. However, the diet type did not affect the sexual rate and the weight of the larvae after eight days of living. On average, each C. claveri larva was able of preying 1611 eggs or 135 second-ínstar larvae of P. xylostella during its development. The predator was able to increase its population 218 times after 42 days, feeding exclusively on P. xylostella eggs. Based on these results, this predator presents a great potential of being used within biological control programs of P. xylostella.

  4. Uso de recursos alimentares por peixes imaturos e adultos de espécies piscívoras em uma planície de inundação neotropical / Use of food resources by juveniles and adults of piscivorous fish species in a neotropical floodplain

    Scientific Electronic Library Online (English)

    André Nogueira, Bozza; Norma Segatti, Hahn.


    Full Text Available Este estudo teve como objetivo avaliar o uso dos recursos alimentares por indivíduos imaturos e adultos de Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis, da planície de inundação do alto [...] Rio Paraná, coletados trimestralmente entre março de 2007 e dezembro de 2008. Foi avaliada a composição quantitativa da dieta através da obtenção do volume das presas (% volume) e amplitude de nicho trófico de cada uma das espécies, bem como as inter-relações tróficas entre elas, através da similaridade entre as dietas e tamanho das presas. A dieta das seis espécies foi composta por peixes-presa (42 espécies), crustáceos e insetos, sendo que todas elas, com exceção de P. corruscans, mostraram alterações ontogenéticas. A amplitude de nicho foi maior para H. aff. malabaricus adultos e menor para P. corruscans adultos e P. squamosissimus imaturos. A similaridade na dieta foi maior para aquelas espécies que consumiram Characidae e menor para P. squamosissimus imaturos, os quais consumiram preferencialmente crustáceos. Houve correlação positiva entre o tamanho da presa e do predador, porém cada espécie consumiu presas de tamanhos diferentes, mostrando que elas não são correlacionadas. Os resultados demonstraram que as seis espécies consumiram peixes desde as fases imaturas, porém com pouca similaridade intra e inter-específica na dieta para a maioria delas, e que o tamanho das presas consumidas aumentou em relação ao tamanho do predador e foi variável entre as espécies. Assim, a dieta dos predadores depende da distribuição e colonização das espécies-presas no ambiente, morfologia e comportamento alimentar tanto das presas quanto dos predadores. Abstract in english The aim of this study was to evaluate the use of food resources by juveniles and adults of Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis from the upper Paraná River floodplain, sampled q [...] uarterly between March 2007 and December 2008. The quantitative trophic composition was obtained by prey volume (% volume) and diet niche breadth of each piscivorous species, as well as trophic relationships among them through diet similarity and prey size. The diet of the species was composed of fish-preys (42 species), crustaceans and insects, with ontogenetic diet changes, except to P. corruscans. The niche breadth was high to H. aff. malabaricus adults and low to P. corruscans adults and P. squamosissimus juveniles. Diet similarity was high to Characidae species consumers and low to P. squamosissimus juveniles, which consumed mainly crustaceans. Positive correlation was found between prey and predator size, however, each piscivorous species consumed different prey sizes, showing no correlation among them. Results showed that the six species consumed fish since juveniles, however, with low diet similarity intra and inter specific to most of them, and the prey size consumed increased in relation to predator size and varied among species. Thus, the piscivorous species diet depends of prey species distribution and colonization, morphology and feeding behavior of the prey as well as the predator.

  5. TANINOS CONDENSADOS DE Ephedra breana phil. -EphedraceaE-

    Directory of Open Access Journals (Sweden)

    Rafael A. Ricco


    Full Text Available Este trabajo aborda el estudio de los taninos condensados (proantocianidinas de Ephedra breana Phil. Se estudiaron comparativamente los extractos metanólicos de los tallos aéreos herbáceos y lignificados. En los tallos herbáceos se determinó la presencia de prodelfinidina, que se encuentra principalmente bajo la forma de compuestos de alto peso molecular (polímeros, mientras que en los tallos lignificados se detectó proapigeninidina (una 3-desoxi-proantocianidina bajo la forma de monómero y oligómeros. Se determinaron diferencias cuali-cuantitativas cuando se compararon los tallos herbáceos y lignificados. Se considera que la elevada concentración de taninos en los tallos herbáceos constituye un posible mecanismo de defensa contra los predadores. Por otro lado, debido a su estructura química, los taninos condensados presentes en los tallos aéreos herbáceos podrían actuar, además, como agentes antioxidantes.

  6. Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas / Acarofauna in physic nut culture and associated spontaneous weeds

    Scientific Electronic Library Online (English)

    Wilton Pires da, Cruz; Renato Almeida, Sarmento; Adenir Vieira, Teodoro; Eduardo Andrea Lemus, Erasmo; Marçal, Pedro Neto; Maíra, Ignacio; Diogenis Fontenele, Ferreira Junior.


    Full Text Available O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas po [...] r meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos. Abstract in english The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from [...] physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

  7. Effect of female weight on reproductive potential of the predator Brontocoris tabidus (Signoret, 1852 (Heteroptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    Isaias Oliveira


    Full Text Available The objective of this work was to determine the fecundity of the predator Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae females of two weight classes aiming to define, which one presented higher productivity in the laboratory. Males and females of B. tabidus were reared from nymphs fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in laboratory. Females of B. tabidus weighting 95 to 150 mg and those with 160 to 220 mg constituted two treatments. Oviposition period and numbers of egg masses, eggs and nymphs per female of B. tabidus were higher in the treatment with heavier females, while the periods of preoviposition, between egg mass laying, egg incubation and number of eggs per egg mass, besides the percentage of nymphs hatched and adult longevity were similar between treatments. Heavier females of B. tabidus presented better productivity and for this reason they should be used in programs of mass rearing this predator.Este trabalho apresenta a fecundidade de fêmeas do predador Brontocoris tabidus (Signoret (Heteroptera: Pentatomidae de duas classes de peso, objetivando avaliar qual delas apresenta melhor produtividade em criações mantidas em laboratório. Machos e fêmeas foram alimentadas, desde o estádio ninfal, com pupas do besouro Tenebrio molitor L. (Coleoptera: Tenebrionidae. Fêmeas de B. tabidus pesando entre 95 e 150 mg e entre 160 e 220 mg constituíram as duas classes de peso. O período de oviposição e os números de posturas, de ovos e ninfas por fêmea de B. tabidus foram maiores naquelas fêmeas pertencentes à classe mais pesada, enquanto os períodos de pré-oviposição, entre posturas, incubação dos ovos e número de ovos por postura, bem como a percentagem de eclosão de ninfas e a longevidade dos adultos foram semelhantes entre ambas as classes de peso. Fêmeas mais pesadas de B. tabidus apresentaram maior número de ovos por fêmea e por esta razão devem ser utilizadas em programas de criação massal deste predador.

  8. Potencial reprodutivo de Supputius cincticeps (Stal (Heteroptera: Pentatomidae influenciado pelo peso do corpo da fêmea - DOI: 10.4025/actascibiolsci.v25i1.2081 Reproductive potential of the predator Supputius cincticeps (Heteroptera: Pentatomidae affected by female body weight - DOI: 10.4025/actascibiolsci.v25i1.2081

    Directory of Open Access Journals (Sweden)

    Jose Eduardo Serrão


    Full Text Available O potencial reprodutivo de fêmeas de Supputius cincticeps (Stal (Heteroptera: Pentatomidae de duas classes de peso foi avaliado. Machos e fêmeas desse predador foram obtidos de ninfas alimentadas com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. Foram analisadas fêmeas com peso inferior a 45 mg (fêmeas leves e superior a 60 mg (fêmeas pesadas. A longevidade e os períodos de pré-oviposição, oviposição e pós-oviposição foram semelhantes entre fêmeas das duas classes de peso, enquanto aquelas mais pesadas apresentaram maior número de posturas, ovos, ovos/postura e ninfas. Períodos entre posturas e de incubação dos ovos foram menores para fêmeas com peso superior a 60mg. Esses resultados são discutidos em relação ao uso de fêmeas mais pesadas de S. cincticeps para aumentar a produção em criação massal desse predadorThe reproductive potential of Supputius cincticeps (Stal (Heteroptera: Pentatomidae females of two weight classes was evaluated with males and females of this predator obtained from nymphs fed on Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae. Females of S. cincticeps weighing less than 45 mg (light females and more than 60 mg (heavy females constituted the treatments. Pre-oviposition, oviposition and post-oviposition periods besides adult longevity were similar between treatments while number of egg masses, eggs, eggs/egg mass and number of nymphs hatched were higher for heavier females. Periods between egg mass laying and egg incubation were shorter for insects of the last treatment. These results are discussed in relation to the use of heavier females of S. cincticeps to improve mass rearing of this predator in laboratory

  9. Parasitismo natural em ovos crisopídeos Natural egg parasitism of chrysopids

    Directory of Open Access Journals (Sweden)

    Maria Alice de Medeiros


    Full Text Available Os predadores, em geral, apresentam hábitos generalistas e por isso podem ser usados em programas de controle biológico, em diferentes agroecossistemas. A sobrevivência dos predadores é afetada por diversos fatores, como, por exemplo, a presença de parasitóides. Este trabalho foi conduzido com os objetivos de identificar os parasitóides de crisopídeos, especialmente os parasitóides de ovos, e determinar o nível de parasitismo natural. As amostragens foram feitas na Embrapa Hortaliças, em campos de milho-doce, de setembro/1997 a fevereiro/1998. Os ovos de crisopídeos foram coletados semanalmente, sendo individualizados em cápsulas de gelatina até a emergência da larva e/ou do parasitóide. Foram coletados 800 ovos de crisopídeos, sendo que em 71% dos ovos, as larvas sobreviveram; 9% dos ovos foram considerados inviáveis e 20% foram parasitados por seis espécies de microhimenópteros. Destes, 57% foram parasitados por Telenomus sp. (Scelionidae, 32% por Trichogramma pretiosum (Trichogrammatidae, 6% por Oencyrtus chrysopae Crawford (Encyrtidae e 5% por Aprostocetus sp. (Eulophidae.Most predators, in general, have generalist habits and can be used as biological control agents in several crops. Predator survival is affected by several factors, such as occurrence of parasitoids. The main purpose of this research was to identify the parasitoids of chrysopids, especially egg parasitoids and their level of parasitism. The samples were taken in a sweet-corn field at Embrapa Hortaliças from September/1997 to February/1998. The chrysopids eggs were collected weekly and then individualized in gelatine capsules until larval or parasitoid emergency. A total of 800 eggs were collected. The predator emerged from 71% of the eggs, 9% were inviable eggs and the other 20% were parasitized by six species of microhymenopterans. Among these, 57% were parasitized by Telenomus sp. (Scelionidae, 32% were parasitized by Trichogramma pretiosum (Trichogrammatidae, 6% by Oencyrtus chrysopae Crawford (Encyrtidae and 5% by Aprostocetus sp. (Eulophidae.

  10. Diet of the chola guitarfish, Rhinobatos percellens (Rhinobatidae), in the Paranaguá Estuarine complex

    Scientific Electronic Library Online (English)

    Wanessa P.D. do, Carmo; Hugo, Bornatowski; Elton C., Oliveira; Luís L., Fávaro.


    Full Text Available A raia viola, Rhinobatos percellens, é um dos batoídeos mais capturados na costa brasileira, e é um importante predador da comunidade bêntica. Estômagos de R. percellens foram amostrados no complexo estuarino de Paranaguá (Março/2006 a Março/2007 e Outubro/2008 a Setembro/2009). Os estômagos obtidos [...] foram utilizados para descrever a dieta de R. percellens, e verificar se há diferenças sazonais e ontogenéticas em sua alimentação nesta área estuarina. A análise geral mostrou uma dieta especializada com a predominância de três espécies em seu conteúdo alimentar: Leptochela serratorbita, restos de Caridea e Ogyrides alphaerostris. Análises ontogenéticas e sazonais não revelaram diferenças significantes no consumo de alimento. Estes dados revelam que R. percellens é um predador especialista em L. serratorbita, e este alimento é consumido por todas as classes de tamanho. Abstract in english The chola guitarfish, Rhinobatos percellens, is one of the most-captured batoids on the Brazilian coast, and an important predator of benthic community. Stomachs from R. percellens were sampled in the Paranaguá estuarine complex (March/2006 to March/2007 and October/2008 to September/2009). The stom [...] achs obtained were used for describing the diet of R. percellens, and verifying if there are seasonal and ontogenetic differences in their feeding into the estuarine area. The general analysis showed a specialized diet with a predominance of three species in food contents: Leptochela serratorbita, Caridea remains and Ogyrides alphaerostris. Ontogenetic and seasonal analysis did not reveal significant differences in the food consumption. These data reveal that R. percellens is a specialist predator of L. serratorbita, and this food component is consumed by all size classes.

  11. Efeito do manejo de plantas daninhas sobre Neoseiulus californicus (Acari:Phytoseiidae) em pomar de macieira / Effect of weed management on Neoseiulus californicus (Acari:Phytoseiidae) in apple orchard

    Scientific Electronic Library Online (English)

    Lino Bittencourt, Monteiro; Luiz, Belli; Alexander de, Souza; André Luiz, Werner.


    Full Text Available Avaliou-se a influência do manejo de plantas daninhas sobre o deslocamento de ácaros tetraniquídeos (Panonychus ulmi e Tetranychus urticae) e do ácaro predador Neoseiulus californicus em um pomar de macieira 'Gala', onde foi implantado o controle biológico do ácaro vermelho, P. ulmi, por meio de lib [...] erações massais de N. californicus. As parcelas tiveram as plantas daninhas manejadas de três formas: sem manejo, com roçadas manuais e com herbicidas. As populações de ácaros foram avaliadas sobre as plantas daninhas, Plantago tormentosa e Erigeron sp, e sobre as folhas de macieira. As maiores populações de N. californicus foram observadas nas parcelas onde os manejos proporcionaram desenvolvimento de plantas daninhas na linha de plantio. Na parcela manejada com herbicida, houve maior população de ácaros tetraniquídeos sobre as macieiras, provavelmente, devido ao reduzido número de N. californicus. P. tormentosa foi o hospedeiro preferencial do ácaro predador. Concluiu-se que o manejo de plantas daninhas, na linha de plantio das macieiras, assume um importante papel no equilíbrio entre as populações de ácaros. Abstract in english The influence of weed management on tetranychid mites (Panonychus ulmi and Tetranychus urticae) and phytoseids movement was evaluated. Neoseiulus californicus populations were released in an apple orchard for biological control of tetranychid mites. Three kinds of weed management were used: no weed [...] control at all, manual control and control with herbicide. The mites were evaluated in Plantago tormentosa, Erigeron sp, and apple tree leaves. The highest population of N. californicus was observed where weed was not controlled. Tetranychid mites populations were abundant on apple trees when herbicide was used, probably due to the low population of N. californicus. P. tormentosa was the preferred host of phytoseids. The conclusion was that weed management plays an important role in the regulation of mite species in apple orchards.

  12. Influência de sistemas de produção sobre a ocorrência de inimigos naturais de afídeos em pomares de pessegueiros em Araucária-PR / Influence of systems of production on the occurrence of natural enemies of aphids on orchards of peach trees in Araucaria-PR

    Scientific Electronic Library Online (English)

    Joselia Maria, Schuber; Lino Bittencourt, Monteiro; Alex Sandro, Poltronieri; Nerio Aparecido, Cardoso; Louise Larissa, May de Mio.


    Full Text Available A pressão da sociedade tem forçado a adoção de sistemas de produção de frutas mais sustentáveis e de menor impacto ambiental. O objetivo deste trabalho foi verificar a influência dos sistemas de produção de Boas Práticas Agrícolas (BPA) e Convencional (PC) sobre a diversidade de inimigos naturais de [...] afídeos presentes em seis pomares de pessegueiros no município de Araucária-PR, de julho de 2005 a setembro de 2006. O levantamento do número de inimigos naturais foi realizado por meio de cinco métodos de amostragens: visual em plantas de pessegueiros e em plantas invasoras; armadilhas Möericke; funil e adesivas. No sistema BPA, foram coletados mais espécimes de inimigos naturais (53%), em relação aos pomares PCs (46%), havendo a ocorrência, em ambos, de predadores das famílias Syrphidae, Coccinellidae e Chrysopidae e parasitóides da ordem Hymenoptera. Do total de inimigos naturais coletados, verificou-se a ocorrência de maior quantidade de predadores de afídeos. Abstract in english The pressure of the society has forced the adoption of more sustainable fruit production systems and with less environmental impact. The objective of this work was to verify the influence of production systems of Good Agricultural Practices (GAP) and Conventional Production (CP), about the diversity [...] of natural enemies of aphids present on six orchards of peach trees in the city of Araucaria, PR, from July 2005 to September 2006. The evaluation of the number of natural enemies of aphid's species was made by means of five sampling methods: visual in plants of peach trees; visual in invading plants; yellow water traps of Möericke type; funnel and adhesive traps. In the system GPA, more specimens of natural enemies had been collected (53%) in relation to orchards CP (46%), having the occurrence, in both orchards, of predators of the Syrphidae, Coccinellidae and Chrysopidae family and parasitoids of Hymenoptera order. Concerning the total of collected natural enemies, it was verified the greatest occurrence of aphid predators.

  13. Feeding of Pellona flavipinnis (Clupeiformes, Pristigasteridaein a Central Amazonian floodplain Dieta de Pellona flavipinnis (Clupeiformes, Pristigasteridae em planície alagada da Amazônia Central

    Directory of Open Access Journals (Sweden)

    Sandra S. Moreira-Hara


    Full Text Available The feeding habits of Pellona flavipinnis (Valenciennes, 1836 at Catalão, a floodplain area on the Brazilian Central Amazon was studied. Data was obtained during three hydrological cycles, between September 1999 and September 2003. Diet composition, daily and seasonal variation in the feeding activity and the relationship between predator's size and its prey were analyzed. Almost 80% of the food consumed has autochthonous origin and diet was composed basically by insects and fish. Juvenile fish predominated in the stomach contents of all size classes but there was no significant relationship between predator's size and its prey. Pellona flavipinnis may be considered a carnivorous species which feeds mainly on juvenile (young-of-the-year specimens of other fish. More intense feeding activity occurred at night and in the high water period.Os hábitos alimentares de Pellona flavipinnis (Valenciennes, 1836 de uma área de várzea na Amazônia Central, Catalão, foram estudados. Foram utilizados dados referentes a três ciclos hidrológicos, entre setembro de 1999 e setembro de 2003. Foram analisados a dieta, a atividade alimentar diária e sazonal e a relação entre o comprimento da presa e o do predador. Cerca de 80% dos alimentos consumidos eram de origem autóctone e a dieta composta basicamente de insetos e peixes. Peixes juvenis predominaram nos conteúdos estomacais de exemplares de todas as classes de tamanho, mas não houve relação significativa entre o tamanho do predador e o das presas consumidas. Pellona flavipinnis pode ser considerada uma espécie carnívora que se alimenta principalmente de indivíduos juvenis de outras espécies de peixes. A atividade alimentar foi maior durante a noite e no período da cheia.

  14. Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae no combate à Orthezia insignis Browne (Homoptera: Ortheziidae em jacarandá Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae to control Orthezia insignis Browne (Homoptera: Ortheziidae on blue jacaranda

    Directory of Open Access Journals (Sweden)

    Ana Paula Félix


    Full Text Available Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina está a ser criado em laboratório e largado em jacarandás infestados com o objectivo de combater a cochonilha-dojacarandá através da luta biológica clássica. Referem-se as largadas de H. pantherina e o sistema de monitorização adoptado para verificar a aclimatação do predador.The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal, are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Fürsch, was imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

  15. Sentinels in Saltator atricollis (Passeriformes: Emberizidae Sentinelas em Saltator atricollis (Passeriformes: Emberizidae

    Directory of Open Access Journals (Sweden)



    Full Text Available I studied the existence of sentinels in Saltator atricollis in a 'campo-cerrado' (Brazilian savanna during the breeding seasons of 1994-95 and 1995-96. Groups of this species consisted of two to seven birds (N = 25. Sentinels were present (mean ± sd 62% ± 9% of the time, and most sentinel bouts lasted from less than one to six minutes (although in some occasions for more than 30 min.. Overlap of two or more sentinels occurred on average only 3.2% of the time with birds on guard. Sentinels commonly gave contact calls in the beginning and/or at the end of a sentinel bout. The group size had no effect on time with sentinels. However the encounter rate between raptors and groups significantly influenced the time guarded. The results of this study suggests that the ability of sentinels to detect predators may play a central role as an anti-predator device.Estudei a existência de sentinelas em S. atricollis em campo-cerrado, nas estações reprodutivas de 1994-95 e 1995-96. Os grupos de S. atricollis continham de dois a sete indivíduos (N = 25. Os sentinelas vigiaram os grupos (média ± dp por 62% ± 9% do tempo, sendo que a maioria dos turnos de vigilância durou de menos de um a seis minutos (em alguns casos se extenderam por mais de 30 min.. Dois ou mais sentinelas vigiaram simultaneamente, em média, apenas 3,2% do tempo vigiado. Os sentinelas comumente emitiam chamados de contato quando iniciavam e/ou terminavam um turno de vigilância. O tamanho dos grupos não apresentou relação com o tempo vigiado. Por outro lado, a taxa de encontros entre predadores aéreos e grupos influenciou significativamente o tempo vigiado. A habilidade dos sentinelas em perceber predadores provavelmente apresenta uma função relevante, conferindo vantagens antipredatórias aos grupos dessa espécie.

  16. Sentinels in Saltator atricollis (Passeriformes: Emberizidae) / Sentinelas em Saltator atricollis (Passeriformes: Emberizidae)

    Scientific Electronic Library Online (English)



    Full Text Available Estudei a existência de sentinelas em S. atricollis em campo-cerrado, nas estações reprodutivas de 1994-95 e 1995-96. Os grupos de S. atricollis continham de dois a sete indivíduos (N = 25). Os sentinelas vigiaram os grupos (média ± dp) por 62% ± 9% do tempo, sendo que a maioria dos turnos de vigilâ [...] ncia durou de menos de um a seis minutos (em alguns casos se extenderam por mais de 30 min.). Dois ou mais sentinelas vigiaram simultaneamente, em média, apenas 3,2% do tempo vigiado. Os sentinelas comumente emitiam chamados de contato quando iniciavam e/ou terminavam um turno de vigilância. O tamanho dos grupos não apresentou relação com o tempo vigiado. Por outro lado, a taxa de encontros entre predadores aéreos e grupos influenciou significativamente o tempo vigiado. A habilidade dos sentinelas em perceber predadores provavelmente apresenta uma função relevante, conferindo vantagens antipredatórias aos grupos dessa espécie. Abstract in english I studied the existence of sentinels in Saltator atricollis in a 'campo-cerrado' (Brazilian savanna) during the breeding seasons of 1994-95 and 1995-96. Groups of this species consisted of two to seven birds (N = 25). Sentinels were present (mean ± sd) 62% ± 9% of the time, and most sentinel bouts l [...] asted from less than one to six minutes (although in some occasions for more than 30 min.). Overlap of two or more sentinels occurred on average only 3.2% of the time with birds on guard. Sentinels commonly gave contact calls in the beginning and/or at the end of a sentinel bout. The group size had no effect on time with sentinels. However the encounter rate between raptors and groups significantly influenced the time guarded. The results of this study suggests that the ability of sentinels to detect predators may play a central role as an anti-predator device.

  17. Acción de los cebos granulados sobre los invertebrados edáficos / Effects of granulated baits on soil invertebrates

    Scientific Electronic Library Online (English)

    Carla, Salvio; Pablo Luis, Manetti; Natalia Liliana, Clemente; Alicia Noemí, López.


    Full Text Available Los cebos granulados en base a Metaldehído y/o Carbaryl son utilizados para el control de babosas (Mollusca: Pulmonata) y bicho bolita (Crustacea: Isopoda). Sin embargo, es escasa la información sobre el efecto que causan sobre la abundancia de los grupos funcionales. En este trabajo se evaluó el ef [...] ecto de los cebos Dual Acay (Metaldehído 4%+Carbaryl 8%), Molusquicida Acay y Clartex (Metaldehído 4 y 5%), MataBibos Acay y Clartex BB (Carbaryl 8%) sobre los detrítivoros, predadores, herbívoros y omnívoros a los 7, 10, 23 y 37 días después de la aplicación de los cebos (DDA). Los detritívoros no difirieron entre los tratamientos a los 7, 10, 23 y 37 DDA (p> 0,05). Los predadores a los 7 y 23 DDA no mostraron diferencias (p> 0,05) en cambio, sí a los 10 y 37 DDA (p 0,05), mientras que, sí a los 23 y 37 DDA (p Abstract in english Granulated baits based on Metaldehyde and/or Carbaryl are used for the control of slugs (Mollusca: Pulmonata) and woodlices (Crustacea: Isopoda). However, the information on the effect that they cause on abundance of functional groups is scarce. In this study, the effect of Dual Acay baits (Metaldeh [...] yde 4%+Carbaryl 8%), Molluscicide Acay and Clartex (Metaldehyde 4 and 5%), MataBibos BB Acay and Clartex BB (Carbaryl 8%) was evaluated on the following functional groups: detritivores, predators, herbivores and omnivores 7, 10, 23 and 37 days after bait application (DAA). Detritivores did not differ between treatments at 7, 10, 23 and 37 DAA (p> 0.05). Predators 7 and 23 DAA showed no differences (p> 0.05); however, at 10 and 37 DAA an increase in the number of spiders was observed respect to carabids (p 0.05); whereas, 23 and 37 DDA significant differences were observed (p

  18. First record of the fireworm Hermodice carunculata (Annelida, Polychaeta) preying on colonies of the fire coral Millepora alcicornis (Cnidaria, Hydrozoa) / Primeiro registro do verme de fogo Hermodice carunculata (Annelida, Polychaeta) predando colônias do coral de fogo Millepora alcicornis (Cnidaria, Hydrozoa)

    Scientific Electronic Library Online (English)

    Carlos Daniel, Pérez; Paula Braga, Gomes.


    Full Text Available O poliqueta Hermodice carunculata é um voraz predador de vários organismos bentônicos e um dos grupos preferenciais na sua dieta é o dos cnidários. No presente trabalho se apresenta o primeiro registro de predação do verme de fogo sobre o hidrocoral Millepora alcicornis. O verme engolfa os ramos ter [...] minais do hidrocoral e fica vários minutos raspando a superfície e retirando os tecidos moles. Apesar deste hidrocoral ser um dos representantes mais comuns dos recifes do norte e nordeste brasileiros e de albergar uma vasta comunidade associada, nunca tinha sido registrada esta associação. Esta nova descoberta alerta na necessidade de se estudar esta associação já que geralmente os danos ocasionados pelo poliqueta são irreversíveis e dependendo da quantidade de predadores pode alterar a saúde dos recifes ou modificar os componentes da comunidade recifal. Abstract in english The polychaete Hermodice carunculata is a voracious predator of several benthic organisms and one of the preferential groups in its diet is that of the cnidarians. This note presents the first record of a fireworm preying on the calcified hydroid Millepora alcicornis. The fireworm engulfs the termin [...] al branches of the fire coral and spends several minutes scraping the surface and removing the soft tissues. Despite this being one of the most common calcified hydroids of the Brazilian northern and northeastern regions (and home to a vast associated community), this kind of association had never been recorded. This discovery points to the need of studying such associations because the damage caused by this polychaete is irreversible and depending on the amount of predators might alter reefs' health or modify the components of the reef community.

  19. Feeding of Acestrorhynchus lacustris (Characidae): a post impoundment studies on Itaipu reservoir, upper Paraná River, PR

    Scientific Electronic Library Online (English)

    Norma Segatti, Hahn; Rosilene Luciana, Delariva; Valdirene Esgarbosa, Loureiro.

    Full Text Available Com o objetivo de conhecer o espectro alimentar de Acestrorhynchus lacustris (Reinhardt, 1874), um predador de médio porte, em diferentes locais da área de influência do reservatório de Itaipu, foram analisados conteúdos estomacais coletados no período de março/84 a fevereiro/89. Os dados evidenciar [...] am tratar-se de uma espécie exclusivamente piscívora, porém oportunista, visto que consumiu 17 espécies de peixes-presa. Apesar do amplo espectro alimentar, poucas presas se destacaram nos distintos ambientes amostrados, resultando em diferenças significativas entre suas dietas. A análise de correspondência (DCA) discriminou espacialmente três grupos; montante, com maiores escores; reservatório, com valores intermediários e tributário com menores valores, provavelmente em função dos tipos de presas disponíveis em cada ambiente. O tamanho das presas ingeridas aumenta com o crescimento do predador, porém os maiores exemplares não descartam peixes de pequeno porte de sua dieta. Abstract in english With objective to know feeding spectrum of Acestrorhynchus lacustris (Reinhardt, 1874), a middle size predator in different places of influence area of Itaipu reservoir, stomach contents were analyzed. Samples were collected from March 1984 to February 1989 from Itaipu Reservoir and its adjacent are [...] as. Its fed mainly on fishes, but it was an opportunistic (consumed 17 species of prey). Despite of the wide feeding spectrum, few preys were dominant in the diet, according to the different habitats sampled. As a result, it significant spatial differences in the diet was observed. Was observed through "Detrented Correspondence Analysis" (DCA) these were divided into three groups in relation with diet: preys from upstream, with higher scores; preys from the reservoir, with intermediate scores; and preys from a tributary with smaller scores. This discrimination may be a function of prey availability in each habitat. The mean size of preys consumed increased with the size of the predator, as well as the variance, i. e. the largest fish also consumed small preys.

  20. Feeding of Pellona flavipinnis (Clupeiformes, Pristigasteridae)in a Central Amazonian floodplain / Dieta de Pellona flavipinnis (Clupeiformes, Pristigasteridae) em planície alagada da Amazônia Central

    Scientific Electronic Library Online (English)

    Sandra S., Moreira-Hara; Jansen A. S., Zuanon; Sidineia A., Amadio.


    Full Text Available Os hábitos alimentares de Pellona flavipinnis (Valenciennes, 1836) de uma área de várzea na Amazônia Central, Catalão, foram estudados. Foram utilizados dados referentes a três ciclos hidrológicos, entre setembro de 1999 e setembro de 2003. Foram analisados a dieta, a atividade alimentar diária e sa [...] zonal e a relação entre o comprimento da presa e o do predador. Cerca de 80% dos alimentos consumidos eram de origem autóctone e a dieta composta basicamente de insetos e peixes. Peixes juvenis predominaram nos conteúdos estomacais de exemplares de todas as classes de tamanho, mas não houve relação significativa entre o tamanho do predador e o das presas consumidas. Pellona flavipinnis pode ser considerada uma espécie carnívora que se alimenta principalmente de indivíduos juvenis de outras espécies de peixes. A atividade alimentar foi maior durante a noite e no período da cheia. Abstract in english The feeding habits of Pellona flavipinnis (Valenciennes, 1836) at Catalão, a floodplain area on the Brazilian Central Amazon was studied. Data was obtained during three hydrological cycles, between September 1999 and September 2003. Diet composition, daily and seasonal variation in the feeding activ [...] ity and the relationship between predator's size and its prey were analyzed. Almost 80% of the food consumed has autochthonous origin and diet was composed basically by insects and fish. Juvenile fish predominated in the stomach contents of all size classes but there was no significant relationship between predator's size and its prey. Pellona flavipinnis may be considered a carnivorous species which feeds mainly on juvenile (young-of-the-year) specimens of other fish. More intense feeding activity occurred at night and in the high water period.

  1. Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae Desenvolvimento ninfal e preferência alimentar de Podisus maculiventris (Heteroptera: Pentatomidae em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae parasitados ou não por Trichogramma brassicae (Hymenoptera: Trichogrammatidae

    Directory of Open Access Journals (Sweden)

    H. N. Oliveira


    Full Text Available Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae, parasitised or not by Trichogramma brassicae (pupae stage. Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventris as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that it is possible to combine the use of P. maculiventris with releases of T. brassicae in control programs of lepidopteran pests.Avaliou-se a predação de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa ou não por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos às ninfas de P. maculiventris como alimento. Esse Pentatomidae só atingiu a fase adulta quando se alimentou de ovos não parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criação desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estádio. Em teste de escolha, ninfas desse predador mostraram preferência por ovos não parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que é possível associar o uso de P. maculiventris com liberações de T. brassicae em programas de controle de lepidópteros pragas,


    Scientific Electronic Library Online (English)

    Alberto, Soto G; Angelo, Pallini; Lemos, Felipe.


    Full Text Available El control biológico a través de predadores es observado como una alternativa promisoria al control químico de plagas. Phytoseiulus macropilis se ha encontrado asociado a poblaciones del ácaro rayado Tetranychus urticae en plantaciones de fresa en el estado de Minas Gerais, Brasil. En este trabajo s [...] e evaluó a través de experimento de olfatometria los efectos subletales de la azadirachtina sobre la capacidad de P. macropilis en detectar volátiles de plantas de fresa infestadas con T. urticae. Los resultados muestran que el ácaro predador P. macropilis puede diferenciar entre olores de plantas de fresa no atacadas y plantas de fresa atacadas por T. urticae. La azadirachtina en la concentración de 0,31 mg i.a/L no interfirió en la respuesta olfativa de P. macropilis alimentado de presas asperjadas. Abstract in english The biological control through predators is seen as a promising alternative to chemical insect pest control. Phytoseiulus macropilis has been found associated with populations of the striped mite, Tetranychus urticae in strawberry plantations in the state of Minas Gerais, Brazil. In this work, the s [...] ublethal effects of azadirachtina on the natural ability of P. macropilis to detect volatile compounds from strawberry plants infested with T. urticae was evaluated by using olfactometry assays. The results show that P. macropilis predatory mite can distinguish odors from non-attacked strawberry plants and those from strawberry plants attacked by T. urticae. Azadirachtina at a concentration of 0.31 mg i.a/L did not interfere in the olfactory response of P. macropilis fed with sprinkled striped mites.

  3. Luta biológica clássica com Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) no combate à Orthezia insignis Browne (Homoptera: Ortheziidae) em jacarandá / Biological control with Hyperaspis pantherina Fürsch (Coleoptera: Coccinellidae) to control Orthezia insignis Browne (Homoptera: Ortheziidae) on blue jacaranda

    Scientific Electronic Library Online (English)

    Ana Paula, Félix; António Miguel Franquinho, Aguiar; Celestina, Brazão; Paula, Rocha.


    Full Text Available Os jacarandás e várias plantas ornamentais que ornamentam passeios e áreas ajardinadas da cidade do Funchal encontram-se infestados pela cochonilha Orthezia insignis Browne. Para combater esta praga foi importada do Quénia, uma joaninha, Hyperaspis pantherina Fürsch. Este predador é específico de O. [...] insignis e tem sido utilizado, com sucesso em programas de luta biológica, em vários países de África, no Peru, Hawai e na Ilha de Santa Helena. Na Ilha da Madeira, desde Julho de 2002, H. pantherina está a ser criado em laboratório e largado em jacarandás infestados com o objectivo de combater a cochonilha-dojacarandá através da luta biológica clássica. Referem-se as largadas de H. pantherina e o sistema de monitorização adoptado para verificar a aclimatação do predador. Abstract in english The Jacaranda trees and other ornamental plants used in sidewalks and gardenlike areas of sidewalks and other gardened areas of the downton Capital city of Madeira Island (Funchal), are infested by the Jacaranda or Lantana Bug, Orthezia insignis Browne. A ladybird, Hyperaspis pantherina Fürsch, was [...] imported from Kenya to control this pest. This ladybird is a specific predator of O. insignis and it has been used, successfully in biological control programs, in several countries of Africa, in Peru, Hawaii and in Santa Helena Island. In Madeira Island, H. pantherina is being reared in laboratory and released into infested jacarandas since July 2002, in a classical biological control way. The releasing of H. pantherina is described in detail as well as the adopted monitoring system to verify its acclimation.

  4. Defensive repertoire of Xenodon dorbignyi (Serpentes, Dipsadidae) / Repertório defensivo de Xenodon dorbignyi (Serpentes, Dipsadidae)

    Scientific Electronic Library Online (English)

    Alexandro Marques, Tozetti; Roberto Baptista de, Oliveira; Glaucia Maria Funk, Pontes.


    Full Text Available A capacidade de uma espécie em defender-se da ação de um predador esta diretamente relacionada à sua sobrevivência. Nesse sentido, os mecanismos de interação presa/predador são elementos importantes da história natural das espécies. Neste estudo foi avaliado o repertório defensivo da cobra-nariguda [...] (Xenodon dorbignyi), a partir da simulação de ataques predatórios na natureza. Foram observadas nove unidades comportamentais defensivas, sendo os movimentos erráticos, achatamento do corpo, triangulação da cabeça e display caudal os comportamentos mais freqüentemente exibidos. Não foram detectadas diferenças na estratégia defensiva entre os sexos ou entre indivíduos em diferentes estados reprodutivos. Os resultados sugerem que X. dorbignyi possui a capacidade de avaliar o nível de ameaça imposto pelo agressor, sendo o comportamento críptico, o achatamento do corpo e a fuga as estratégias defensivas primárias, com os demais displays representando respostas secundárias ao ataque predatório. Os resultados reforçam a hipótese de que X. dorbignyi represente simultaneamente um mímico de Micrurus e Bothrops. Abstract in english The ability of a species to defend itself against a predator is directly correlated with its survivorship. Thus, prey/predator interaction mechanisms are important elements of the natural history of species. In this study, we examined the defensive repertoire of the South-American hognose snake (Xen [...] odon dorbignyi) through simulations of predator attacks in the field. Nine defensive displays were observed. The most frequently observed displays were erratic movements, body flattening, head triangulation and tail display. No differences were detected in the defensive strategies shown by males and females, regardless of their reproductive state. Our findings suggest that X. dorbignyi has the ability to evaluate the level of threat imposed by the aggressor, with cryptic behavior, body flattening and locomotor escape as the primary defensive strategies, with other displays used as secondary responses to a predator attack. Our results support the hypothesis that X. dorbignyi is a mimic of both Micrurus and Bothrops.

  5. Feeding of Acestrorhynchus lacustris (Characidae: a post impoundment studies on Itaipu reservoir, upper Paraná River, PR

    Directory of Open Access Journals (Sweden)

    Norma Segatti Hahn


    Full Text Available With objective to know feeding spectrum of Acestrorhynchus lacustris (Reinhardt, 1874, a middle size predator in different places of influence area of Itaipu reservoir, stomach contents were analyzed. Samples were collected from March 1984 to February 1989 from Itaipu Reservoir and its adjacent areas. Its fed mainly on fishes, but it was an opportunistic (consumed 17 species of prey. Despite of the wide feeding spectrum, few preys were dominant in the diet, according to the different habitats sampled. As a result, it significant spatial differences in the diet was observed. Was observed through "Detrented Correspondence Analysis" (DCA these were divided into three groups in relation with diet: preys from upstream, with higher scores; preys from the reservoir, with intermediate scores; and preys from a tributary with smaller scores. This discrimination may be a function of prey availability in each habitat. The mean size of preys consumed increased with the size of the predator, as well as the variance, i. e. the largest fish also consumed small preys.Com o objetivo de conhecer o espectro alimentar de Acestrorhynchus lacustris (Reinhardt, 1874, um predador de médio porte, em diferentes locais da área de influência do reservatório de Itaipu, foram analisados conteúdos estomacais coletados no período de março/84 a fevereiro/89. Os dados evidenciaram tratar-se de uma espécie exclusivamente piscívora, porém oportunista, visto que consumiu 17 espécies de peixes-presa. Apesar do amplo espectro alimentar, poucas presas se destacaram nos distintos ambientes amostrados, resultando em diferenças significativas entre suas dietas. A análise de correspondência (DCA discriminou espacialmente três grupos; montante, com maiores escores; reservatório, com valores intermediários e tributário com menores valores, provavelmente em função dos tipos de presas disponíveis em cada ambiente. O tamanho das presas ingeridas aumenta com o crescimento do predador, porém os maiores exemplares não descartam peixes de pequeno porte de sua dieta.

  6. Influência de sistemas de produção sobre a ocorrência de inimigos naturais de afídeos em pomares de pessegueiros em Araucária-PR Influence of systems of production on the occurrence of natural enemies of aphids on orchards of peach trees in Araucaria-PR

    Directory of Open Access Journals (Sweden)

    Joselia Maria Schuber


    Full Text Available A pressão da sociedade tem forçado a adoção de sistemas de produção de frutas mais sustentáveis e de menor impacto ambiental. O objetivo deste trabalho foi verificar a influência dos sistemas de produção de Boas Práticas Agrícolas (BPA e Convencional (PC sobre a diversidade de inimigos naturais de afídeos presentes em seis pomares de pessegueiros no município de Araucária-PR, de julho de 2005 a setembro de 2006. O levantamento do número de inimigos naturais foi realizado por meio de cinco métodos de amostragens: visual em plantas de pessegueiros e em plantas invasoras; armadilhas Möericke; funil e adesivas. No sistema BPA, foram coletados mais espécimes de inimigos naturais (53%, em relação aos pomares PCs (46%, havendo a ocorrência, em ambos, de predadores das famílias Syrphidae, Coccinellidae e Chrysopidae e parasitóides da ordem Hymenoptera. Do total de inimigos naturais coletados, verificou-se a ocorrência de maior quantidade de predadores de afídeos.The pressure of the society has forced the adoption of more sustainable fruit production systems and with less environmental impact. The objective of this work was to verify the influence of production systems of Good Agricultural Practices (GAP and Conventional Production (CP, about the diversity of natural enemies of aphids present on six orchards of peach trees in the city of Araucaria, PR, from July 2005 to September 2006. The evaluation of the number of natural enemies of aphid's species was made by means of five sampling methods: visual in plants of peach trees; visual in invading plants; yellow water traps of Möericke type; funnel and adhesive traps. In the system GPA, more specimens of natural enemies had been collected (53% in relation to orchards CP (46%, having the occurrence, in both orchards, of predators of the Syrphidae, Coccinellidae and Chrysopidae family and parasitoids of Hymenoptera order. Concerning the total of collected natural enemies, it was verified the greatest occurrence of aphid predators.

  7. Uso tradicional de vertebrados silvestres en la Sierra Nanchititla, México. / Traditional use of wild vertebrates in Sierra Nanchititla, Mexico. / Uso tradicional de vertebrados silvestres na Serra de Nanchititla, México.

    Scientific Electronic Library Online (English)

    Octavio, Monroy-Vilchis; Leonardo, Cabrera; Pedro, Suárez; Martha Mariela, Zarco-González; Clarita, Rodríguez-Soto; Vicente, Urios.


    Full Text Available Os povoadores nativos de México têm se caracterizado por possuir conhecimento tradicional sobre as espécies de flora e fauna dos ambientes onde habitam, assim como por suas praticas de aproveitamento. Neste estudo se documentou o uso tradicional de vertebrados silvestres por parte dos habitantes das [...] treze comunidades de maior influência da Reserva Natural Serra Nanchititla (RNSN), se examinou sua disponibilidade como recurso nesta área protegida e se analisou a correlação entre ambas variáveis. Aplicaram-se técnicas quantitativas e qualitativas que mostram o grau de utilização do recurso considerando estimações populacionais das espécies na região e documentando o conhecimento de uso dos vertebrados por meio de entrevistas estruturadas. Avaliou-se a abundância relativa através da contagem de excrementos e câmaras armadilha do grupo com maior freqüência de uso (mamíferos) e se calcularam os índices de valor de uso por espécie e família de vertebrados. Todos os informantes (117), com exceção de um, aproveitam alguma das 33 espécies utilizadas na região. Os usos mais freqüentes consistem em cobrir suas necessidades alimentícias e curativas. O grupo mais utilizado é o de mamíferos, sendo o coelho (Sylvilagus floridanus) o mais utilizado. Os habitantes locais usam com maior freqüência as dez espécies com maior abundância na região. Os resultados aportam informação que contribuirá com as estratégias de conservação de recursos naturais na RNSN. Abstract in spanish Los pobladores nativos de México se han caracterizado por poseer conocimiento tradicional sobre las especies de flora y fauna de los ambientes donde habitan, así como por sus prácticas de aprovechamiento. En este estudio se documentó el uso tradicional de vertebrados silvestres por parte de los habi [...] tantes de las trece comunidades de mayor influencia de la Reserva Natural Sierra Nanchititla (RNSN), se examinó su disponibilidad como recurso en esta área protegida y se analizó la correlación entre ambas variables. Se aplicaron técnicas cuantitativas y cualitativas que muestran el grado de utilización del recurso considerando estimaciones poblacionales de las especies en la región y documentando el conocimiento de uso de los vertebrados por medio de entrevistas estructuradas. Se evaluó la abundancia relativa a través del conteo de excrementos y cámaras trampa del grupo con mayor frecuencia de uso (mamíferos) y se calcularon los índices de valor de uso por especie y familia de vertebrados. Todos los informantes (117) con excepción de uno aprovechan alguna de las 33 especies utilizadas en la región. Los usos mas frecuentes consisten en cubrir sus necesidades alimenticias y curativas. El grupo más utilizado es el de mamíferos, siendo el conejo (Sylvilagus floridanus) el más utilizado. Los habitantes locales usan con mayor frecuencia las diez especies con mayor abundancia en la región. Los resultados aportan información que contribuirá con las estrategias de conservación de recursos naturales en la RNSN. Abstract in english The native inhabitants of Mexico have been known to have a traditional knowledge about the flora and fauna species in their habitat, and about their utilization. In this study, the traditional use of wild vertebrates by the inhabitants of he 13 communities of largest influence in the Sierra Nanchiti [...] tla Natural Reserve (SNNR) was documented, their availability as a resource in the area was examined, and the correlation between the two variables analyzed. Quantitative and qualitative techniques were applied to show the degree of resource utilization, considering population estimates for the species in the region, and the usage knowledge of vertebrates was documented through structured interviews. The relative abundance of the group with the highest frequency of use (mammals) was evaluated by excreta counts and use of traps. Use value indexes were calculated for vertebrate species and family. All informers (117) but one did benefit from some of the 33 s

  8. Cacería de mamíferos medianos en cafetales del centro de Veracruz, México / Hunting of medium mammals in coffee plantations in central Veracruz, Mexico

    Scientific Electronic Library Online (English)

    Liliana, TLAPAYA; Sonia, GALLINA.


    Full Text Available El presente trabajo analiza la cacería de mamíferos medianos en cafetales del centro de Veracruz, México, enfocado en dos zonas: Huatusco y Teocelo-Coatepec, registrando datos por medio de entrevistas estructuradas aplicadas a cazadores activos en las zonas de estudio. Los cafetales son agroecosiste [...] mas que presentan un sistema de manejo bajo sombra de árboles, que permiten mantener una biodiversidad considerable de mamíferos medianos. La colecta de datos se realizó durante los meses de enero a mayo del 2006 en los cafetales muestreados como parte de un proyecto más amplio titulado BIOCAFE. Se aplicaron un total de 77 entrevistas estructuradas que nos permitieron conocer qué mamíferos son cazados, los métodos utilizados para cazarlos, el uso que les dan, además de inferir cuantos animales se extraen por año y que biomasa representa. Los resultados de las entrevistas muestran que de las 24 especies registradas de mamíferos medianos, son cinco especies las más cazadas en ambas zonas en proporciones significativas: armadillo (Dasypus novemcinctus), tlacuache (Didelphis virginiana), conejo (Sylvilagus floridanus), mapache (Procyon lotor) y zorra (Urocyon cinereoargenteus). De las 16 especies cazadas, el armadillo es la presa de mayor demanda y la más aprovechada en ambas zonas. La estimación de biomasa extraída al año fue de 194 kg/cazador para la zona de Teocelo-Coatepec y de 174 kg/cazador en la zona Huatusco. En cuanto a los métodos más comúnmente utilizados para cazar son; arma de fuego (53%), seguido del uso de perros (41%) y por último la arreada (33%). La presión de cacería fue mucho mayor en los cafetales de la zona de Teocelo-Coatepec por haber una mayor densidad poblacional humana. La cacería que se practica en ambas zonas es completamente ilegal, es por esto que es necesario realizar acciones para promover el manejo y la conservación de las especies, así como al desarrollo de la comunidad en el área de estudio. Abstract in english This study analyzes the hunting of medium mammals in coffee plantations in central Veracruz, México, focusing on two areas: Huatusco and Teocelo-Coatepec. The data were obtained through a guided interview, which was applied to active hunters in the study areas. The data collection was done during Ja [...] nuary to May 2006 as part of a larger project entitled BIOCAFE. We applied a total of 77 interviews that allowed us to know the mammals hunted, the methods used, how they used them, in addition to infer how many animals are extracted per year and the biomass that represented. The records showed that five species were mainly hunted in both areas: armadillo (Dasypus novemcinctus), opossum (Didelphis virginiana), rabbit (Sylvilagus floridanus), raccoon (Procyon lotor) and gray fox (Urocyon cinereoargenteus). Of the 16 hunted species, the armadillo is the most common prey and the most used in both areas. The estimated extracted biomass per year was 194kg/hunter in the zone of Teocelo-Coatepec and 174 kg/hunter in the Huatusco zone. The most common hunting methods are: by fire arm (53%), followed by the use of dogs (41%) and last, the beat (33%). The hunting pressure was greater in coffee plantations in the zone of Teocelo-Coatepec for having a higher human population density. Hunting practiced in both areas is completely illegal, hence is necessary to apply actions to promote the management and conservation of species, together with community development in the study area.

  9. DIAGNÓSTICO TAXONÓMICO DE LA FAMILIA TENUIPALPIDAE (ACARI: TETRANYCHOIDEA) EN EL VALLE DEL CAUCA (COLOMBIA) / Taxonomic diagnostic of the Tenuipalpidae family (Acari: Tetranychoidea) in the valle del Cauca (Colombia)

    Scientific Electronic Library Online (English)



    Full Text Available Varias especies de ácaros de la familia Tenuipalpidae, especialmente las del género Brevipalpus Donnadieu, son reconocidas como vectores de enfermedades virales en diferentes cultivos comerciales. La falta de estudios taxonómicos en esta familia de ácaros en Colombia y la posibilidad de introducir e [...] n forma accidental especies de estos ácaros planos, son una amenaza para la bioseguridad de la producción frutícola del país. El objetivo de este trabajo es contribuir a la identificación de las especies de Tenuipalpidae en la vegetación silvestre y cultivada en el departamento del Valle del Cauca y confirmar la identidad taxonómica de las especies de Brevipalpus en cítricos, guayaba, maracuyá, café y orquídeas. Las recolecciones de ejemplares se realizaron en épocas seca y lluviosa en varios municipios del departamento. El montaje de los ácaros se realizó en medio Hoyer. La especie predominante en todas las localidades y en los hospedantes recolectados fue Brevipalpus phoenicis Geijskes (1939). Por el contrario, B. obovatus Donnadieu se encontró en poblaciones muy bajas en limón Tahití y mandarina en algunas localidades de Palmira. Tenuipalpus anacardii De León se presentó en Anacardium excelsum (Bertero y Balb. ex Kunth) Skeels, en el municipio de Roldanillo y T. pacificus Baker se encontró en el corregimiento de Rozo, municipio de Palmira, sobre plantas importadas de un cultivo comercial de Dendrobium sp., mientras que Dolichotetranychus floridanus (Banks) solamente se encontró sobre Ananas comosus (L.) Merr., en muestras recolectadas en Cali. Abstract in english Several species of flat mites, family Tenuipalpidae, especially in the genus Brevipalpus Donnadieu, are recognized as vectors of viral diseases, which affect ornamentals and commercial crops. Both, the lack of taxonomical research related to this group in Colombia, and the high possibility of accide [...] ntally introducing members of this family into our country, are threads against biosecurity, mainly to the fruit tree production. The main goals of this project are to contribute towards flat mite species identification found in wild vegetation and crops in the Valle del Cauca and to confirm the taxonomic identity of Brevipalpus species found in citrus, guayaba, passion fruit, coffee, and orquids. Surveys were carried out during the dry and rainy (humid) seasons. Mites were mounted in Hoyer medium. Brevipalpus phoencis Geijskes (type) was the main species found over all the visited places and collected hosts. On the other hand, B. obovatus Donnadieu, was found in very low numbers on lemonTahiti and tangerine in some locations near the city of Palmira. Tenuipalpus anacardii De Leon was found on Anacardium excelsum, (Bertero y Balb. ex Kunth) Skeels, in the town of Roldanillo, and T. pacificus Baker was present in Rozo (Palmira´s Township) in imported plants of the commercial crop of Dendrobium sp. Dolichotetranychus floridanus (Banks) was only found among Ananas comosus (L.) Merr. near the city of Cali.


    Directory of Open Access Journals (Sweden)

    Liliana TLAPAYA


    Full Text Available El presente trabajo analiza la cacería de mamíferos medianos en cafetales del centro de Veracruz, México, enfocado en dos zonas: Huatusco y Teocelo-Coatepec, registrando datos por medio de entrevistas estructuradas aplicadas a cazadores activos en las zonas de estudio. Los cafetales son agroecosistemas que presentan un sistema de manejo bajo sombra de árboles, que permiten mantener una biodiversidad considerable de mamíferos medianos. La colecta de datos se realizó durante los meses de enero a mayo del 2006 en los cafetales muestreados como parte de un proyecto más amplio titulado BIOCAFE. Se aplicaron un total de 77 entrevistas estructuradas que nos permitieron conocer qué mamíferos son cazados, los métodos utilizados para cazarlos, el uso que les dan, además de inferir cuantos animales se extraen por año y que biomasa representa. Los resultados de las entrevistas muestran que de las 24 especies registradas de mamíferos medianos, son cinco especies las más cazadas en ambas zonas en proporciones significativas: armadillo (Dasypus novemcinctus, tlacuache (Didelphis virginiana, conejo (Sylvilagus floridanus, mapache (Procyon lotor y zorra (Urocyon cinereoargenteus. De las 16 especies cazadas, el armadillo es la presa de mayor demanda y la más aprovechada en ambas zonas. La estimación de biomasa extraída al año fue de 194 kg/cazador para la zona de Teocelo-Co atepec y de 174 kg/cazador en la zona Huatusco. En cuanto a los métodos más comúnmente utilizados para cazar son; arma de fuego (53%, seguido del uso de perros (41% y por último la arreada (33%. La presión de cacería fue mucho mayor en los cafetales de la zona de Teocelo-Coatepec por haber una mayor densidad poblacional humana. La cacería que se practica en ambas zonas es completamente ilegal, es por esto que es necesario realizar acciones para promover el manejo y la conservación de las especies, así como al desarrollo de la comunidad en el área de estudio.

  11. Serum antibodies to whole-cell and recombinant antigens of Borrelia burgdorferi in cottontail rabbits. (United States)

    Magnarelli, Louis A; Norris, Steven J; Fikrig, Erol


    Archived serum samples, from 95 eastern cottontail rabbits (Sylvilagus floridanus) captured in New York, New York, USA and Millbrook, New York, USA, during 1985-86, were analyzed in solid-phase enzyme-linked immunosorbent assays (ELISA) for total and class-specific immunoglobulin (Ig) M antibodies to whole-cell or recombinant antigens of Borrelia burgdorferi sensu stricto. Using a polyvalent conjugate, rabbit sera contained antibodies to whole-cell and recombinant antigens (protein [p]35, p37, or VlsE) during different seasons, but there was no reactivity to outer surface protein (Osp)A or OspB. Seventy-six of the 102 sera (75%) analyzed were reactive with one or more of the antigens; 61 of the positive samples (80%) reacted to whole-cell antigens, followed by results for the p35 (58%, 44/76), VlsE (43%, 33/76), and p37 (29%, 22/ 76) antigens. Fifty-eight sera (76%) contained antibodies to the VlsE or p35 antigens with or without reactivity to whole-cell antigens. High antibody titers (?1:2,560) recorded for 52 sera indicate robust antibody production. In analyses for IgM antibodies in an ELISA containing whole-cell antigens, there were 30 positive sera; titers ranged from 1:160 to 1:640. There was minimal cross-reactivity when rabbit antisera to Treponema pallidum or four serovars of Leptospira interrogans were screened against B. burgdorferi antigens. Based on more-specific results, VlsE and p35 antigens appear to be useful markers for detecting possible B. burgdorferi infections. PMID:22247369

  12. Oligocene Calcareous Nannofossils from IODP Site U1435: Implications for the Initial Opening of the South China Sea (United States)

    Kulhanek, D. K.; Su, X.; Liu, C.; Peleo-Alampay, A.


    International Ocean Discovery Program Expedition 349 cored Site U1435 on a structural high along the northern continent/ocean boundary in the East Subbasin of the South China Sea. At this site, thin Neogene and Quaternary sediment cover (~35 m thick) characterized by clays and manganese nodules is underlain by ~40 m of Oligocene deep marine nannofossil-rich clay and claystone. Calcareous nannofossils are abundant and moderately to well preserved throughout much of the Oligocene sequence, although their overall abundance decreases near the base of the unit. The diverse assemblage is characterized by abundant reticulofenestrids, common Cyclicargolithus floridanus, Cyclicargolithus abisectus, and Zygrhablithus bijugatus, with fewer numbers of species belonging to the genera Coccolithus, Discoaster, and Helicosphaera. The presence of well-preserved sphenoliths allows for good biostratigraphic control through the section, which we correlate to nannofossil Zones NP21 to NP25. The base of the sequence in Section 349-U1435A-9R-2 is dated to between 32.92 and 33.43 Ma based on the presence of Coccolithus formosus and absence of abundant Clausicoccus distichus. The Oligocene section at Site U1435 unconformably overlies a unit comprised dominantly of sandstone of unknown age due to a paucity of calcareous and siliceous planktonic marine microfossils. The presence of brackish water benthic foraminifers in some samples suggests a nearshore environment of deposition, substantially different from the deepwater (>2500 m) environment inferred for the Oligocene rocks based on the trace fossil assemblage. We infer that the abrupt transition from shallow to deepwater facies at this site represents the breakup unconformity for the initial opening of the South China Sea, indicating that seafloor spreading began at ~33 Ma.

  13. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India. (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind


    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as ?-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, ?-carotene ranged from 0.134 to 0.221 ?g/100 g, and lycopene from 0.055 to 0 .075 ?g/100 g. PMID:23510284

  14. Novel Hepatozoon in vertebrates from the southern United States. (United States)

    Allen, Kelly E; Yabsley, Michael J; Johnson, Eileen M; Reichard, Mason V; Panciera, Roger J; Ewing, Sidney A; Little, Susan E


    Novel Hepatozoon spp. sequences collected from previously unrecognized vertebrate hosts in North America were compared with documented Hepatozoon 18S rRNA sequences in an effort to examine phylogenetic relationships between the different Hepatozoon organisms found cycling in nature. An approximately 500-base pair fragment of 18S rDNA common to Hepatozoon spp. and some other apicomplexans was amplified and sequenced from the tissues or blood of 16 vertebrate host species from the southern United States, including 1 opossum (Didelphis virginiana), 2 bobcats (Lynx rufus), 1 domestic cat (Felis catus), 3 coyotes (Canis latrans), 1 gray fox (Urocyon cinereoargenteus), 4 raccoons (Procyon lotor), 1 pet boa constrictor (Boa constrictor imperator), 1 swamp rabbit (Sylvilagus aquaticus), 1 cottontail rabbit (Sylvilagus floridanus), 4 woodrats (Neotoma fuscipes and Neotoma micropus), 3 white-footed mice (Peromyscus leucopus), 8 cotton rats (Sigmodon hispidus), 1 cotton mouse (Peromyscus gossypinus), 1 eastern grey squirrel (Sciurus carolinensis), and 1 woodchuck (Marmota monax). Phylogenetic analyses and comparison with sequences in the existing database revealed distinct groups of Hepatozoon spp., with clusters formed by sequences obtained from scavengers and carnivores (opossum, raccoons, canids, and felids) and those obtained from rodents. Surprisingly, Hepatozoon spp. sequences from wild rabbits were most closely related to sequences obtained from carnivores (97.2% identical), and the sequence from the boa constrictor was most closely related to the rodent cluster (97.4% identical). These data are consistent with recent work identifying prey-predator transmission cycles in Hepatozoon spp. and suggest this pattern may be more common than previously recognized. PMID:21506825

  15. Genetic diversity of Kenyan native oyster mushroom (Pleurotus). (United States)

    Otieno, Ojwang D; Onyango, Calvin; Onguso, Justus Mungare; Matasyoh, Lexa G; Wanjala, Bramwel W; Wamalwa, Mark; Harvey, Jagger J W


    Members of the genus Pleurotus, also commonly known as oyster mushroom, are well known for their socioeconomic and biotechnological potentials. Despite being one of the most important edible fungi, the scarce information about the genetic diversity of the species in natural populations has limited their sustainable utilization. A total of 71 isolates of Pleurotus species were collected from three natural populations: 25 isolates were obtained from Kakamega forest, 34 isolates from Arabuko Sokoke forest and 12 isolates from Mount Kenya forest. Amplified fragment length polymorphism (AFLP) was applied to thirteen isolates of locally grown Pleurotus species obtained from laboratory samples using five primer pair combinations. AFLP markers and internal transcribed spacer (ITS) sequences of the ribosomal DNA were used to estimate the genetic diversity and evaluate phylogenetic relationships, respectively, among and within populations. The five primer pair combinations generated 293 polymorphic loci across the 84 isolates. The mean genetic diversity among the populations was 0.25 with the population from Arabuko Sokoke having higher (0.27) diversity estimates compared to Mount Kenya population (0.24). Diversity between the isolates from the natural population (0.25) and commercial cultivars (0.24) did not differ significantly. However, diversity was greater within (89%; P > 0.001) populations than among populations. Homology search analysis against the GenBank database using 16 rDNA ITS sequences randomly selected from the two clades of AFLP dendrogram revealed three mushroom species: P. djamor, P. floridanus and P. sapidus; the three mushrooms form part of the diversity of Pleurotus species in Kenya. The broad diversity within the Kenyan Pleurotus species suggests the possibility of obtaining native strains suitable for commercial cultivation. PMID:25344263

  16. The safety of ONRAB® in select non-target wildlife. (United States)

    Fry, Tricia L; Vandalen, Kaci K; Duncan, Colleen; Vercauteren, Kurt


    ONRAB(®) is a recombinant human adenovirus type 5 (HAd5) with the rabies glycoprotein gene incorporated into its genome. ONRAB(®) has been used in Canada as an oral rabies vaccine in target wildlife species such as: red fox (Vulpes vulpes), raccoon (Procyon lotor), and striped skunk (Mepthis mephitis). We evaluated the safety of ONRAB(®) in non-target wildlife species likely to contact the vaccine baits during oral rabies vaccine campaigns in the United States. We investigated the effects of oral inoculation of high titer ONRAB(®), approximately ten times the dose given to target species, in wood rats (Neotoma spp.), eastern cottontail rabbits (Sylvilagus floridanus), Virginia opossums (Didelphis virginiana), eastern wild turkeys (Meleagris gallopavo silvestri), and fox squirrels (Sciurus niger). We performed real-time polymerase chain reaction (PCR) on fecal swabs, oral swabs, and tissues, including lung, liver, kidney, small intestine, large intestine, and when appropriate nasal turbinates, to detect ONRAB(®) DNA from inoculated animals. By seven days post-inoculation, turkeys, opossums, and cottontails had all stopped shedding ONRAB(®) DNA. One wood rat and one fox squirrel still had detectable levels of ONRAB(®) DNA in fecal swabs 14 days post-inoculation. Real-time PCR analysis of the tissues revealed some ONRAB(®) DNA persisting in certain tissues; however, there were no significant gross or histologic lesions associated with ONRAB(®) in any of the species studied. Our results suggest that many non-target species are not likely to be impacted by the distribution of ONRAB(®) as part of oral rabies vaccination programs in the United States. PMID:23831321

  17. Phylogeographic Analyses of American Black Bears (Ursus americanus) Suggest Four Glacial Refugia and Complex Patterns of Postglacial Admixture. (United States)

    Puckett, Emily E; Etter, Paul D; Johnson, Eric A; Eggert, Lori S


    Studies of species with continental distributions continue to identify intraspecific lineages despite continuous habitat. Lineages may form due to isolation by distance, adaptation, divergence across barriers, or genetic drift following range expansion. We investigated lineage diversification and admixture within American black bears (Ursus americanus) across their range using 22 k single nucleotide polymorphisms and mitochondrial DNA sequences. We identified three subcontinental nuclear clusters which we further divided into nine geographic regions: Alaskan (Alaska-East), eastern (Central Interior Highlands, Great Lakes, Northeast, Southeast), and western (Alaska-West, West, Pacific Coast, Southwest). We estimated that the western cluster diverged 67 ka, before eastern and Alaskan divergence 31 ka; these divergence dates contrasted with those from the mitochondrial genome where clades A and B diverged 1.07 Ma, and clades A-east and A-west diverged 169 ka. We combined estimates of divergence timing with hindcast species distribution models to infer glacial refugia for the species in Beringia, Pacific Northwest, Southwest, and Southeast. Our results show a complex arrangement of admixture due to expansion out of multiple refugia. The delineation of the genomic population clusters was inconsistent with the ranges for 16 previously described subspecies. Ranges for U. a. pugnax and U. a. cinnamomum were concordant with admixed clusters, calling into question how to order taxa below the species level. Additionally, our finding that U. a. floridanus has not diverged from U. a. americanus also suggests that morphology and genetics should be reanalyzed to assess taxonomic designations relevant to the conservation management of the species. PMID:25989983

  18. Micropaleontological data (dinocysts, nannoplankton, spores and pollen) and biostratigraphy of the Alkun Formation, North Ossetia (United States)

    Filippova, N. Yu.; Beluzhenko, E. V.; Golovina, L. A.


    The initially obtained data characterize organic-walled phytoplankton (dinocysts), nannoplankton, spores, and pollen from the Upper Argun, Alkun, and Lower Assa deposits of the Fiagdon and Mairamadag sections situated on the southeast of North Ossetia (North Caucasus) in the Alkun Formation stratotype area. The lithology of the formation is described, and its position in the Oligocene-Miocene succession is considered. According to the analyzed data on organic-walled phytoplankton from the Fiagdon and Mairamadag sections, the transitional late Oligocene-early Miocene dinoflora from the top of the Argun Formation and the lower part of the Alkun Formation is in general of the Miocene aspect. Based on the dinocysts, deposits from the upper part of the Alkun Formation coupled with the Assa Formation are attributed to the lower Miocene. The entire interval of the studied deposits corresponds to the acme subzone Def of the Ebu Zone in the Mediterranean dinocyst zonation by D. Zevenboom, where it spans the top of the Chattian and lower part of the Aquitanian Stage. Nannoplankton assemblages from the Alkun deposits are tentatively correlated with the nannoplankton assemblage of Zone NN1 in the standard zonation by E. Martini. It is impossible to date precisely the Alkun Formation based on nannoplankton, as the respective deposits are lacking index species and characteristic taxa of the standard zonation. The dominance of the cosmopolitan species Cyclicargolithus floridanus is a peculiar feature of nannoplankton assemblages from the Alkun Formation. Palynological data are used to consider the dynamics of the evolution of the vegetation cover and climate. Four episodes of relative cooling are distinguished against a background of warm-temperate climatic conditions in general. The most significant episodes occurred in the mid-Alkun time and during the early phase of the Assa time.

  19. Evolution of viral sensing RIG-I-like receptor genes in Leporidae genera Oryctolagus, Sylvilagus, and Lepus. (United States)

    Lemos de Matos, Ana; McFadden, Grant; Esteves, Pedro J


    One of the most severe European rabbit (Oryctolagus cuniculus) pathogens is myxoma virus (MYXV), a rabbit-specific leporipoxvirus that causes the highly lethal disease myxomatosis. Other leporid genera, Sylvilagus and Lepus, encompass species with variable susceptibilities to MYXV, but these do not develop the lethal form of the disease. The protective role of the retinoic acid-inducible gene-I (RIG-I/DDX58) in sensing MYXV in nonpermissive human myeloid cells prompted the study of the RIG-I-like receptor (RLR) family evolution in the three leporid genera. This viral-sensor family also includes the melanoma differentiation-associated factor 5 (MDA5/IFIH1), and the laboratory of genetics and physiology 2 (LGP2/DHX58). Considering specifically the MYXV susceptible host (European rabbit) and one of the virus natural long-term hosts (Sylvilagus bachmani, brush rabbit), the amino acid differences of positively selected sites in RIG-I between the two species were located in the protein region responsible for viral RNA recognition and binding, the repressor domain. Such differences might play a determinant role in how MYXV is sensed. When looking for episodic selection on MDA5 and LGP2 of the eastern cottontail (Sylvilagus floridanus), we also uncovered evidence of selective pressures that might be exerted by a species-specific leporipoxvirus, the Shope fibroma virus. Finally, a putative alternative splicing case was identified in Oryctolagus and Lepus MDA5 isoforms, corresponding to the deletion of one specific exon. This study provided the first insights into the evolution of the leporid RLR gene family that helps illuminate the origins of the species-specific innate responses to pathogens and more specifically to MYXV. PMID:24220721

  20. Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato Critical analysis of the neural systems organizing innate fear responses

    Directory of Open Access Journals (Sweden)

    Newton Sabino Canteras


    Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While these shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing, it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

  1. Life history of Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) fed with castor bean (Ricinus communis L.) pollen in laboratory conditions / História de vida de Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae), alimentado com pólen de mamoneira (Ricinus communis L.) em condição de laboratório

    Scientific Electronic Library Online (English)

    PP, Marafeli; PR, Reis; EC. da, Silveira; GC, Souza-Pimentel; MA. de, Toledo.


    Full Text Available O ácaro predador, Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) é um dos principais inimigos naturais de ácaros tetraniquídeos em vários países, promovendo um eficiente controle em várias culturas alimentícias e ornamentais. O ataque de pragas como o ácaro-rajado, Tetranychus urtica [...] e Koch, 1836 (Acari: Tetranychidae), é um dos problemas enfrentados pelos produtores, principalmente em casa de vegetação, pela dificuldade de seu controle com o uso de agroquímicos devido ao rápido desenvolvimento de resistência o que dificulta seu controle. Foi objetivo deste trabalho estudar a história de vida do ácaro predador N. californicus como contribuição à sua criação massal em laboratório tendo como alimento pólen de mamoneira [Ricinus communis L. (Euphorbiaceae)] para posterior uso como inimigo natural de T. urticae em cultivo de roseiras (Rosa spp.) em casa de vegetação. Os estudos foram conduzidos em laboratório à temperatura de 25 ± 2°C, 70 ± 10% de UR e 14 horas de fotofase. Foram avaliados os aspectos biológicos e confeccionada a tabela de vida de fertilidade. Foi constatada uma longevidade de 32,9 dias para fêmeas adultas e 40,4 dias para machos. A estimativa da capacidade inata de crescimento da população (rm) foi 0,2 dias e a duração média de geração (T) foi 17,2 dias. A população dobrou a cada 4,1 dias. Os resultados obtidos foram semelhantes àqueles nos quais o predador N. californicus foi alimentado com T. urticae. Abstract in english The predatory mite, Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) is one of the principal natural enemies of tetranychid mites in several countries, promoting efficient control of those mites in several food and ornamental crops. Pest attacks such as that of the spider mite, Tetrany [...] chus urticae Koch, 1836 (Acari: Tetranychidae), is one of the problems faced by farmers, especially in the greenhouse, due to the difficulty of its control with the use of chemicals because of the development of fast resistance making it hard to control it. The objective of this work was to study the life history of the predatory mite N. californicus as a contribution to its mass laboratory rearing, having castor bean plant [Ricinus communis L. (Euphorbiaceae)] pollen as food, for its subsequent use as a natural enemy of T. urticae on a cultivation of greenhouse rosebushes. The studies were carried out in the laboratory, at 25 ± 2°C of temperature, 70 ± 10% RH and a 14 hour photophase. The biological aspects and the fertility life table were appraised. Longevity of 32.9 days was verified for adult females and 40.4 days for males. The intrinsic rate of increase (rm) was 0.2 and the mean generation time (T) was 17.2 days. The population doubled every 4.1 days. The results obtained were similar to those in which the predatory mite N. californicus fed on T. urticae.

  2. Differentiation between the traces of predation of muricids and naticids in Spanish Pliocene Chlamys

    Directory of Open Access Journals (Sweden)

    Reyment, R. A.


    Full Text Available The statistical analysis of holes drilled in species of the bivalve genus Chlamys from localities in the Lower Pliocene of Southern Spain throws light on aspects of muricid and naticid predation. Discriminant function analysis was found to be a useful means of identifying the nature of boreholes, with but slight errors of identification for known specimens. In particular, significant differences in relationships between predators and prey could be established. The question as to whether preferred locations of boreholes occur could be answered affirmatively for muricids. Also for muricids, the majority of the observed boreholes (74.1% are concentrated to the region fo the adductor muscle: such a relationship could not be definitely proven for naticids (36.9% within the adduetor muscle field. An association between the site of the prey and predator could only be demonstrated for naticids in connexion with prey of several species and genera. There is a strong association between the size of the prey and the site chosen for drilling for both groups of predators. There is indecisive evidence for a correlation between the location and size a drillhole for naticids, but probably not for muricids. The strategy of seleetion of a drilling site by muricids seems toâ?¢ be to weaken the function of the adductor muscle in the monomyarian Chlamys, hence facilitating access to the víscera. In general, multivariate analytical procedures, and especiaIly the method of canonical correlations, were found lo aid greatly the interpretation of the quantitative observations.El análisis estadístico de los orificios perforados en las especies del género Chlamys del Plioceno Inferior del Sur de España aclara algunos aspectos muy interesantes sobre la predacción de los murícidos y natícidos. El análisis de la función discriminante se ha determinado como un método muy útil para identificar la naturaleza de los orificios, son muy pocos los errores de identificación para los especímenes analizados. En concreto, se ha podido establecer diferencias significativas en las relaciones entre los predadores y las presas. Se ha podido responder afirmativamente a la cuestión de cómo eligen los sitios preferentes para la localización de las perforaciones en el caso de los murídicos. También, para los murícidos la mayoría de las perforaciones observadas (74,1% se ha concentrado en la región del músculo abductor; en cambio, para los natícidos no se ha observado este techo (sólo un 36,9%, de perforaciones en la región del músculo abductor. Para los natícidos se ha podido demostrar una asociación entre el lugar de la presa donde se producen las perforaciones y predador, únicamente cuando se toman en cuenta presas de muchas especies y géneros distintos. También existe una estrecha asociación entre el tamaño de la presa y el lugar donde perforan ambos grupos de predadores. No hay una evidencia decisiva que permita correlacionar la localización de las perforaciones para los natícidos, pero probablemente si la haya para los murícidos. La estrategia de selección del lugar de la perforación para los murícidos se ha determinado en función del músculo abductor en los monomiarios Chlamys para facilitar el acceso a las vísceras. En general, los métodos de análisis multivariado y en especial el método de correlaciones canónicas, se han encontrado como de gran ayuda en la interpretación de observaciones cuantitativas.

  3. Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say (Hemiptera, Anthocoridae e comportamento de oviposição em cultivares de crisântemo Effect of alternative prey on development and consumption of Orius insidiosus (Say (Hemiptera, Anthocoridae and oviposition behavior on chrysantemum cultivars

    Directory of Open Access Journals (Sweden)

    Maria da Conceição M. Soglia


    Full Text Available Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832 tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fotofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares, as quais estavam posicionadas sobre disco foliar (4 cm de cada cultivar ('White Reagan' e'Yellow Snowdon' em camada de ágar-água . Na avaliação da oviposição foram utilizados pecíolos de cada cultivar como substrato de oviposição e ovos de Anagasta kuehniella (Zeller, 1879 como alimento. O predador completou seu desenvolvimento alimentando-se somente de A. gossypii presente em ambas as cultivares. A duração da fase ninfal de O. insidiosus foi de 21,1 e 18,3 dias, em 'White Reagan' e 'Yellow Snowdon', respectivamente. O consumo de A. gossypii por fêmeas foi maior (PThis work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832 feeding on Aphis gossypii Glover, 1877 as weel as its oviposition behavior on two crysanthemum cut cultivars. The trials were conducted in climatic chamber at 25±1ºC, RH 70±10% and 12h photophase. Nymphs of the predator, less than 24h old, were kept individualy in petri dishes (5cm with 20 nymphs of A. gossypii (1st, 2nd and 3rt instars on leaf disc (4cm of each cultivar ("White Reagan" and "Yellow Snowdon" in a layer of agar-water (1%. Petiole of each crysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879. The predador complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on "White Reagan" and "Yellow Snowdon", respectively. The consumption of the females of O. insidiosus was higher (P<0.01 on A. gossypii in "White Reagan" (2.63 nymphs compared to the consumption in "Yellow Snowdon" (0.7 nymphs. Females of O. insidiosus oviposited in petiole of both cultivars with 22.5 and 23.3 eggs/female on "White Reagan" and "Yellow Snowdon", respectively. Release of O. insidiosus on chrysanthemum crops could be important to decrease the A. gossypii population, as the predator completes its development having this aphid as prey, and the chrysanthemum cultivars offer conditions to colonization and establishment of O. insidiosus.

  4. Biologia de Orius insidiosus (Say) (Hemiptera: Anthocoridae) Alimentado com Caliothrips phaseoli (Hood) (Thysanoptera: Thripidae) / Biology of Orius insidiosus (Say) (Hemiptera: Anthocoridae) Fed on Caliothrips phaseoli (Hood) (Thysanoptera: Thripidae)

    Scientific Electronic Library Online (English)



    Full Text Available A biologia do percevejo predador Orius insidiosus (Say), utilizando como alimento, adultos de Caliothrips phaseoli (Hood), foi estudada em câmara climática com temperatura de 25±1°C, 70±10 % de UR e 12h de fotofase. O período de desenvolvimento ninfal foi de 10,2 dias, não apresentando diferença sig [...] nificativa para machos e fêmeas. A duração do estágio ninfal foi 1,9, 1,7, 1,4, 1,8 e 3,1 dias para o 1º, 2º, 3º, 4º e 5º ínstares, respectivamente. A viabilidade ninfal foi de 69,0%, sendo que a maior mortalidade ocorreu no 2º ínstar (16,0%). O. insidiosus predou 73,7 tripes durante todo o estágio ninfal. O consumo de presas pelas ninfas de O. insidiosus aumentou com os sucessivos instares: 6,1, 9,0, 11,4, 16,7 e 29,3 tripes do 1º ao 5º ínstares, respectivamente. Não houve diferença no tempo de busca para os diferentes ínstares do predador, sendo que durou em média 52 min., a captura da presa foi dificultada pela intensa reação de defesa apresentada pela mesma, que consistiu na sua maioria, em saltos e pequenas corridas. As fêmeas ovipositaram 77,8 ovos com viabilidade de 71,6% e com um período embrionário de 5,3 dias. A longevidade das fêmeas (21 dias) foi significativamente maior que a dos machos (12,4 dias). O consumo das fêmeas foi de 159,1 tripes e o dos machos de 60,7 tripes. Não foi observada diferença no tempo de busca para os diferentes instares de O. insidiosus. Os resultados indicam que adultos de C. phaseoli são presas adequadas ao desenvolvimento e reprodução do predador O. insidiosus. Abstract in english The biology of Orius insidiosus (Say) fed on thrips Caliothrips phaseoli (Hood) was studied in a climatic chamber at 25±1°C, 70±10% RH and 12h photophase. Nymphal developmental time (10.2 days) was the same for males and females. The durations of the nymphal instars were 1.9, 1.7, 1.4, 1.8 and 3.1 d [...] ays for the 1st, 2nd, 3rd, 4th and 5th instars respectively. Nymphal survival was 69%, and the highest mortality occurred at the 2nd instar. O. insidiosus consumed 73.7 C. phaseoli throughout its nymphal stage. The amount of prey fed upon by O. insidiosus nymphs increased during the successive instars: 6.1, 9.0, 11.4, 16.7 and 29.3 thrips from the 1st to the 5th instar respectively. Females laid 77.8 eggs. Egg development in O. insidiosus took 5.3 days and only 71.6% of the eggs hatched. Female longevity was significantly higher (21 days) than that of males (12.4 days); consequently, females ate more thrips (159.1) than the males (60.7). The search time of O. insidiosus was the same for all instars. Thus, adults of C. phaseoli were proved suitable to the development and reproduction of the predator O. insidiosus.

  5. Variação espaço-temporal na distribuição e abundância de Moenkhausia sanctaefilomenae (Characiformes: Characidae em lagoas da planície de inundação do rio Cuiabá, Pantanal, Brasil=Spatial-temporal variation of the distribution and abundance of Moenkhausia sanctaefilomenae at lagoons of the Cuiaba river floodplain, Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Jerry Penha


    Full Text Available Identificar os fatores bióticos e abióticos que determinam a variação na distribuição e abundância das populações, tornou-se nos últimos anos um grande desafio para os ecologistas. Assim neste estudo foram avaliados o efeito das variáveis abióticas e a abundância de predadores sobre a abundância de Moenkhausia sanctaefilomenae, a variação no comprimento médio dos indivíduos entre lagoas e períodos e o efeito das variáveis abióticas e da abundância de predadores sobre a estrutura em comprimento. Foram amostradas 16 lagoas da planície de inundação do rio Cuiabá, no período de junho (vazante, setembro (seca e dezembro (enchente de 2005 e março (cheia de 2006. Para M. sanctaefilomenae, a distribuição é mais ampla e a abundância é maior no final da vazante, início da seca, reduzindo-se gradualmente ao longo dos períodos de seca, enchente e cheia. Adicionalmente, o período afeta a estrutura em tamanho das populações, que são espacialmente homogêneas. Indivíduos menores foram capturados no final do período de vazante e os maiores ao início da enchente. Durante o final da vazante/início da seca, a variação espacial na abundância da população foi relacionada positivamente com o pH, o oxigênio dissolvido e cobertura de macrófitas e área da lagoa, mas, não com a abundância local de predadores na zona litorânea das lagoas.Identifying the biotic and abiotic factors that determine the variation in the distribution and abundance of populations has become a great challenge for the field of ecology in recent years. Thus, in this study we evaluated the effect of abiotic variables and the abundance of predators on the abundance of Moenkhausia sanctaefilomenae, the variation in the average length of the individuals between lakes and periods, and the effect of the abiotic variables and abundance of predators on the structure in length of that species. Sixteen lakes of the Cuiabá river flood plain were sampled in June (drying period, September (dry period and December (flooding period 2005 and March (flood period 2006. For M. sanctaefilomenae, the distribution is ampler and the abundance is greater at the end of the drying period, beginning of dry season, reducing gradually over the periods of dry, drying and flood season. Additionally, the period affects the structure in size of the populations that are spatially homogeneous. Smaller individuals were captured at the end of the drying period and the larger individuals at the start of flooding. During the end of the drying period and in the beginning of the dry season, the spatial variation in the abundance of the population was positively related with pH, dissolved oxygen and macrophyte cover and area of the lake, but not with the local abundance of predators in the littoral zone of the lakes.

  6. Spatiotemporal variation patterns of plants and animals in San Carlos de Apoquindo, central Chile Patrones de variación espaciotemporal de plantas y animales en San Carlos de Apoquindo, Chile central

    Directory of Open Access Journals (Sweden)



    Full Text Available I summarize what is known about the mediterranean ecosystem represented in San Carlos de Apoquindo (33º 23' S, 70º 31' W, a rugged area of 835 ha located ca. 20 km east of downtown Santiago on the Andean foothills. This site attracted numerous researchers during 1976-1990 because of its proximity to Santiago and its relatively protected status. I review the literature, and provide unpublished information on this site. A total of 132 literature entries describe the ecology of San Carlos de Apoquindo, in about 30 topics. The shrub and herbaceous vegetation have been well studied, but little is known about the respective seed banks. Among animals, small mammals, rabbits, and avian and mammalian predators are the best investigated, whereas epigean arthropods, amphibians, lizards, snakes, passerine birds, and scavengers of all types are the least studied. Thematically, interactions from plant/climate, to plant/soil, to plant/herbivore, to herbivore/predator interactions, and to decomposition of animal carcasses, have been addressed. But gross inequalities exist on the thoroughness with which each topic has been researched. The best studied aspects deal with plant/herbivore and herbivore/predator interactions. Up to now, no description existed of soils and climate in the area, which I present in this paper. Taking advantage of the long-term aspect of the research at the site, I highlight temporal variation patterns. And because of the different landscape aspects present at the site, I also highlight data that depict such spatial variability. In general, San Carlos de Apoquindo has contributed greatly to the understanding of ecological processes in central Chile. I call for renewed efforts at studying this site's ecology from an ecosystem perspectiveResumo lo que se conoce acerca del ecosistema mediterráneo representado en San Carlos de Apoquindo (33º 23' S, 70º 31' O, un área con alto relieve y de 835 ha localizada ca. 20 km al Este del centro de Santiago en la precordillera andina. Este sitio atrajo a numerosos investigadores durante 1976-1990 debido a su proximidad a Santiago y a su condición de relativamente protegido. Reviso la literatura y proveo información no publicada sobre este sitio. Un total de 132 referencias bibliográficas describen la ecología de San Carlos de Apoquindo, en alrededor de 30 tópicos. La vegetación arbustiva y herbácea han sido bien estudiadas, pero poco se sabe acerca de sus respectivos bancos de semillas. Entre los animales, los micromamíferos, conejos, y predadores rapaces y carnívoros son los mejor investigados, en tanto que los artrópodos epígeos, anfibios, lagartijas, culebras, aves paserinas y los carroñeros de todo tipo son los menos estudiados. Temáticamente, se han analizado interacciones planta/clima, planta/suelo, planta/herbívoro y herbívoro/predador, así como la descomposición de cadáveres animales. Sin embargo, hay desbalances grandes en la profundidad con que se han tratado estos tópicos. Los aspectos mejor estudiados se refieren a interacciones planta/herbívoro y herbívoro/predador. Hasta ahora, no existía descripción detallada de suelos y clima en el área, que aquí presento. Aprovechando el aspecto de largo plazo de la investigación en el sitio, destaco los patrones de variación temporal. Y aprovechando la presencia de diferentes unidades de paisaje en el sitio, también destaco su variabilidad espacial. En general, San Carlos de Apoquindo ha contribuído grandemente al entendimiento de los procesos ecológicos en Chile central. Llamo a realizar esfuerzos renovados para estudiar la ecología de este sitio desde una perspectiva ecosistémica

  7. Fitoseídeos (Acari: Phytoseiidae associados a cafezais e fragmentos florestais vizinhos Phytoseiids (Acari: Phytoseiidae associated to coffee plantations and adjacent forest fragments

    Directory of Open Access Journals (Sweden)

    Ester Azevedo Silva


    Full Text Available Existem poucas informações sobre a fauna de ácaros predadores (Phytoseiidae em ambientes naturais brasileiros adjacentes a agroecossistemas cafeeiros (Coffea spp. ou sobre a influência que essa vegetação exerce como reservatório de ácaros predadores. Neste estudo, objetivou-se avaliar a diversidade destes organismos em cafeeiros e fragmentos florestais adjacentes. Coletaram-se amostras das espécies Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart. (Rutaceae, Metrodorea stipularis Mart. (Rutaceae e Allophylus semidentatus (Miq. Radlk. (Sapindaceae, em oito fragmentos florestais, de 5 a 51 ha, e cafezais adjacentes, nos meses de junho (final período chuvoso e outubro (final período seco nos anos 2004 e 2005, na região Sul do Estado de Minas Gerais. Ácaros foram extraídos das folhas, utilizando o método de lavagem e, em seguida, montados em lâminas de microscopia em meio de Hoyer, para identificação específica. No total foram identificados 2.348 fitoseídeos, sendo 2.090 nos fragmentos florestais e 258 espécimes nos cafezais adjacentes, pertencentes a 38 espécies. Servindo-se de análise faunística, a espécie Iphiseiodes zuluagai Denmark & Muma, 1972 apresentou os melhores índices no agroecossistema cafeeiro, sendo muito frequente e constante nas épocas estudadas. Nos fragmentos florestais Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 e Euseius alatus DeLeon, 1966 foram dominantes, muito abundantes, muito frequentes e constantes nas épocas estudadas. Podemos concluir que a vegetação nativa abriga ácaros predadores, inimigos naturais de ácaros-praga, que ocorrem na cultura cafeeira, possibilitando o desenvolvimento de programas de manejo ecológico com áreas de vegetação natural e agroecossistemas cafeeiros adjacentes.There is little information about the fauna of predatory mites (Phytoseiidae in Brazilian natural environments, adjacent to coffee agroecosystems (Coffea spp., or about the influence exerted by neighbor vegetation as a reservoir of predatory mites. The objective of this study was to evaluate the diversity of these organisms in coffee plantations and adjacent forest fragments. Samples of the species Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart., Metrodorea stipularis Mart. (Rutaceae and Allophylus semidentatus (Miq. Radlk. (Sapindaceae were collected in eight forest fragments, from 5 to 51ha, adjacent to coffee plantations, in June (end of the rainy season and October (end of the dry season in the years of 2004 and 2005, in the Southern region of State of Minas Gerais. Leaf mites were extracted using the wash method, mounted in microscopy slides with Hoyer's medium for identification. A total of 2.348 phytoseiids was collected, being 2.090 in the forest fragments and 258 in adjacent coffee plantations, belonging to 38 species. According to fauna analysis, Iphiseiodes zuluaguai Denmark & Muma, the year of 1972 presented the best indexes in the coffee agroecosystem, being very frequent and constant in those periods. In the forest fragments, Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 and Euseius alatus DeLeon, 1966 were dominant, very abundant, very frequent and constant in those periods. One may conclude that the native vegetation shelters predator mite, natural enemies of mite-pests that still occur in coffee culture, making possible ecological management program development involving areas of natural vegetation and adjacent coffee agroecosystems.

  8. Velocidade da água e a distribuição de larvas e pupas de Chirostilbia pertinax (Kollar (Diptera, Simuliidae e macroinvertebrados associados Water velocity and the distribution of larvae and pupae of Chirostilbia pertinax (Kollar (Diptera, Simuliidae and associated macroinvertebrates

    Directory of Open Access Journals (Sweden)

    José Eloy dos Santos Jr


    Full Text Available O presente trabalho objetivou investigar a relação entre a velocidade da água e a distribuição dos estágios imaturos de Chirostilbia pertinax (Kollar, 1832 e os macroinvertebrados bentônicos associados. As coletas foram realizadas em cinco pontos, no trecho superior do Rio dos Sinos, no Estado do Rio Grande do Sul. A fauna bentônica foi amostrada com substratos artificiais, que permaneceram instalados nos locais de maior corenteza d'água por períodos de 14 dias. Antes do recolhimento dos substratos foram realizadas medidas de velocidade d'água no local da sua instalação. Essas medidas foram agrupadas em três classes: baixa (0,20 a 0,63 m/s, média (0,64 a 1,07 m/s e alta (1,08 a 1,50 m/s para posterior relação com a distribuição da fauna coletada. Para avaliar a influência da velocidade de água sobre a distribuição dos macroinvertebrados e a abundância de C. pertinax foi realizada uma regressão múltipla. As coletas resultaram em 39.598 indivíduos, sendo 33.418 simulídeos e 6.180 macroinvertebrados associados. Entre os simulídeos 5.704 espécimes correspondem a larvas do último ínstar e pupas, dos quais 828 são de C. pertinax. Quanto à distribuição dessa espécie, 30,8% ocorreram na classe de baixa velocidade d'água, 24,9% na velocidade média e 44,3% na alta velocidade. Foi observado que a abundância de C. petinax aumenta à medida que os macroinvertebrados predadores diminuem e os organismos não predadores aumentam (GLM, R² = 0,207; F 2,50 = 6,536; P = 0,003. Esses resultados revelam que os imaturos de C. pertinax têm uma tendência em ocupar um microhábitat com menor ocorrência de predadores.The objective of the current study was to evaluate the distribution of the immature stages of Chirostilbia pertinax (Kollar, 1832 and associated bentic macroinvertebrates in relation to water velocity. This study was carried out on the upper course of Sinos river, in Rio Grande do Sul. Seasonal collections of larvae and pupae of black flies and associated benthic fauna were carried out at five places. In all sampling sites artificial substrates were installed, remaining submersed for 14 days in places of great water flow. Before removing the substrates the flow speeds on the collection sites were measured. To assess the distinct distribution patterns of the benthic fauna, the flow speed was divided in three classes: slow (0.20 - 0.63 m/s, medium (0.64 - 1.07 m/s and fast (1.08 - 1.50 m/s. A total of 39,598 specimens were collected, from which 33,418 were black flies and 6,180 associated macroinvertebrates. From the total black flies, 5,704 were in the last larval instar and pupae from which 828 were C. pertinax. In the distribution of this species 30.8% occurred in slow flow, 24.9% in medium flow and 44.3% in fast flow. The abundance of C. pertinax is inversely related to the predatory macroinvertebrates (GLM, R² = 0.207; F 2.50 = 6.536; P = 0.003. These results demonstrate that the immature stages of C. pertinax have a tendency to occupy microhabitats with less predator occurrence.

  9. Toxicidade de lufenurom para Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Toxicity of lufenuron to Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)



    Full Text Available Este trabalho investigou a suscetibilidade do percevejo predador Podisus nigrispinus (Dallas) ao lufenurom usando diferentes concentrações e métodos de exposição. Em laboratório, ninfas de 5º ínstar e adultos foram expostos a 0, 25, 50, 100, 150 e 200 mg i.a./l de lufenurom via tratamento tópico e i [...] ngestão de solução inseticida. Em casa telada, ninfas de 5º ínstar e adultos do predador foram confinados em plantas pulverizadas com as doses (10 e 50 g i.a./ha) recomendadas do lufenurom. A contaminação do predador por ingestão foi obtida fornecendo, durante cinco dias, uma lagarta do curuquerê-do-algodoeiro Alabama argillacea (Hübner) alimentada previamente com folhas pulverizadas. Ambas vias de contaminação, por ingestão e tópica, foram tóxicas para ninfas nas concentrações acima de 50 e 150 mg de i.a./l, respectivamente. Em geral, os adultos não foram suscetíveis ao lufenurom. Por outro lado, a viabilidade dos ovos foi reduzida a partir da concentração 100 mg i.a./l. Ninfas confinadas em plantas pulverizadas e alimentadas com lagartas tratadas não atingiram o estágio adulto, enquanto aquelas expostas apenas ao resíduo nas folhas não foram afetadas. Fêmeas expostas aos três dias de idade via contato residual e residual mais ingestão de lagartas tratadas (10 g i.a./ha) restauraram a viabilidade de ovos entre a 3ªe a 4ª semana da fase adulta, enquanto aquelas alimentando-se de lagartas tratadas (50 g i.a./ha) mantiveram a viabilidade dos ovos abaixo de 10% durante toda a vida. Estes resultados mostram a importância do uso da menor dose recomendada de lufenurom para a preservação de P. nigrispinus. Abstract in english This work investigated the susceptibility of the predatory stinkbug Podisus nigrispinus (Dallas) to lufenuron using different insecticide concentrations and exposure methods. In laboratory, 5th-instar nymphs and adults were exposed to 0, 25, 50, 100, 150 and 200 mg a.i./l of lufenuron by topical exp [...] osure and by ingestion exposure through treated drinking water. In open-sided greenhouse, 5th-instar nymphs and adults were caged on cotton plants treated with lufenuron at the lowest and the highest recommended doses (10 and 50 g a.i./ha). Ingestion exposure was set up by providing the predator during five days a cotton leafworm caterpillar Alabama argillacea (Hübner), previously fed on treated cotton leaves. Ingestion and topical exposure caused severe mortality to nymphs at concentration over 50 and 150 mg a.i./l, respectively. In general, adults of the predator were not susceptible to the lufenuron. On the other hand, egg viability was significantly reduced at concentrations over 100 mg a.i./l. Nymphs caged on treated plants and fed on treated caterpillars did not reach adult stage, while nymphs exposed to residual contact were not affected. Three-day old females exposed to residual contact and to residual contact ingestion of lufenuron through contaminated caterpillars (10 g a.i./ha) restored their egg viability between the 3rd- and 4th-week of adult lifetime, while, females fed with treated caterpillars (50 g a.i./ha) showed egg viability lower than 10% during lifetime. These results show the importance of using lufenuron at the lowest recommended dose, as a conservation strategy for P. nigrispinus.

  10. Fitoseídeos (Acari: Phytoseiidae) associados a cafezais e fragmentos florestais vizinhos / Phytoseiids (Acari: Phytoseiidae) associated to coffee plantations and adjacent forest fragments

    Scientific Electronic Library Online (English)

    Ester Azevedo, Silva; Paulo Rebelles, Reis; Maurício Sérgio, Zacarias; Patrícia Pádua, Marafeli.


    Full Text Available Existem poucas informações sobre a fauna de ácaros predadores (Phytoseiidae) em ambientes naturais brasileiros adjacentes a agroecossistemas cafeeiros (Coffea spp.) ou sobre a influência que essa vegetação exerce como reservatório de ácaros predadores. Neste estudo, objetivou-se avaliar a diversidad [...] e destes organismos em cafeeiros e fragmentos florestais adjacentes. Coletaram-se amostras das espécies Calyptranthes clusiifolia (Miq.) O. Berg (Myrtaceae), Esenbeckia febrifuga (A. St.-Hil.) A. Juss. ex Mart. (Rutaceae), Metrodorea stipularis Mart. (Rutaceae) e Allophylus semidentatus (Miq.) Radlk. (Sapindaceae), em oito fragmentos florestais, de 5 a 51 ha, e cafezais adjacentes, nos meses de junho (final período chuvoso) e outubro (final período seco) nos anos 2004 e 2005, na região Sul do Estado de Minas Gerais. Ácaros foram extraídos das folhas, utilizando o método de lavagem e, em seguida, montados em lâminas de microscopia em meio de Hoyer, para identificação específica. No total foram identificados 2.348 fitoseídeos, sendo 2.090 nos fragmentos florestais e 258 espécimes nos cafezais adjacentes, pertencentes a 38 espécies. Servindo-se de análise faunística, a espécie Iphiseiodes zuluagai Denmark & Muma, 1972 apresentou os melhores índices no agroecossistema cafeeiro, sendo muito frequente e constante nas épocas estudadas. Nos fragmentos florestais Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 e Euseius alatus DeLeon, 1966 foram dominantes, muito abundantes, muito frequentes e constantes nas épocas estudadas. Podemos concluir que a vegetação nativa abriga ácaros predadores, inimigos naturais de ácaros-praga, que ocorrem na cultura cafeeira, possibilitando o desenvolvimento de programas de manejo ecológico com áreas de vegetação natural e agroecossistemas cafeeiros adjacentes. Abstract in english There is little information about the fauna of predatory mites (Phytoseiidae) in Brazilian natural environments, adjacent to coffee agroecosystems (Coffea spp.), or about the influence exerted by neighbor vegetation as a reservoir of predatory mites. The objective of this study was to evaluate the d [...] iversity of these organisms in coffee plantations and adjacent forest fragments. Samples of the species Calyptranthes clusiifolia (Miq.) O. Berg (Myrtaceae), Esenbeckia febrifuga (A. St.-Hil.) A. Juss. ex Mart., Metrodorea stipularis Mart. (Rutaceae) and Allophylus semidentatus (Miq.) Radlk. (Sapindaceae) were collected in eight forest fragments, from 5 to 51ha, adjacent to coffee plantations, in June (end of the rainy season) and October (end of the dry season) in the years of 2004 and 2005, in the Southern region of State of Minas Gerais. Leaf mites were extracted using the wash method, mounted in microscopy slides with Hoyer's medium for identification. A total of 2.348 phytoseiids was collected, being 2.090 in the forest fragments and 258 in adjacent coffee plantations, belonging to 38 species. According to fauna analysis, Iphiseiodes zuluaguai Denmark & Muma, the year of 1972 presented the best indexes in the coffee agroecosystem, being very frequent and constant in those periods. In the forest fragments, Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 and Euseius alatus DeLeon, 1966 were dominant, very abundant, very frequent and constant in those periods. One may conclude that the native vegetation shelters predator mite, natural enemies of mite-pests that still occur in coffee culture, making possible ecological management program development involving areas of natural vegetation and adjacent coffee agroecosystems.

  11. Aspectos biológicos de Chrysoperla externa (Hagen, 1861(Neuroptera: Chrysopidae alimentada com Planococcus citri (Risso, 1813(Hemiptera: Pseudococcidae e Toxoptera citricida (Kirkaldy, 1907 (Hemiptera: Aphididae Bipogical aspects of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae fed with Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae and Toxoptera citricida (Kirkaldy, 1907 (Hemiptera: Aphididae (Hemiptera: Aphididae

    Directory of Open Access Journals (Sweden)

    Jean Patrick Bonani


    Full Text Available O ecossistema citrícola abriga muitas espécies de inimigos naturais, entre eles Chrysoperla externa (Hagen, 1861 que apresenta um grande potencial como agente de controle biológico de pragas. Neste trabalho, objetivou-se avapar o efeito das presas Planococcus citri (Risso, 1813 e Toxoptera citricida (Kirkaldy, 1907 sobre o desenvolvimento das fases de larva e pupa de C. externa. O ensaio foi conduzido em sala cpmatizada a uma temperatura de 25±1ºC, 70±10% UR e fotofase de 12 horas, sendo os tratamentos constituídos pelo fornecimento contínuo e alternado dessas duas presas em cada ínstar do predador, além de ovos de Anagasta kuehniella (Zeller, 1879, utilizados para fins de comparação. Foram avaliados o tempo de vida e a viabilidade das fases de larva, pupa e do período larva-adulto de C. externa. Constatou-se que T. citricida fornecido isoladamente ao longo do desenvolvimento larval ou em dois ínstares consecutivos do predador, não foi uma presa adequada, constatando-se 100% de mortalidade no período larva-adulto. Quando as larvas alimentaram-se de P. citri fornecida em dois ínstares do predador, a viabilidade no período larva-adulto foi semelhante à dieta constituída por apenas ovos de A. kuehniella, exceto quando se alimentaram de T. citricida no primeiro ínstar.The citrus-growing ecosystem houses a great deal of species of natural enemies, among them Chrysoperla externa (Hagen, 1861, which presents a great potential for use in the bipogical contrp of pests. The aim of this work was to evaluate the effects of the preys Planococcus citri (Risso, 1813 and Toxoptera citricida (Kirkaldy, 1907 on the development of larva and pupa of C. externa. The trial was carried out in an accpmatized room at 25±1ºC, 70±10% RH and 12-hour photophase, the treatments consisting of the continuous and alternate supply of those two preys in each instar of the predator, in apition to eggs of Anagasta kuehniella (Zeller, 1879 utilized for comparison purposes. Both the white mealybug and the aphids were given in sufficient amounts to the C. externa larvae to be able to feed ad libitum. The pfetime and the survival rate of the phases of larva, pupa and the larval-adult period of C. externa were evaluated. It was found that T. citricida given either singly along the larval development or in two consecutive instars of the predator was not an adequate prey, 100% of mortapty over the larval-adult period being found. When the larvae fed on P. citri, given in two instars of the predator, the survival rate in the larval-adult period was similar to the diet constituted of only A. kuehniella eggs, except when fed with T. citricida in the first instar.

  12. Aspectos biológicos da fase adulta de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae oriunda de larvas alimentadas com Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae Biological aspects of the adult stage of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae originating from the larvae fed Planococcus citri (Risso, 1813 (Hemiptera: Pseudococcidae

    Directory of Open Access Journals (Sweden)

    Gerane Celly Dias Bezerra


    Full Text Available Objetivou-se estudar alguns aspectos biológicos da fase adulta de Chrysoperla externa (Hagen quando as larvas desse predador foram alimentadas com ninfas e fêmeas adultas de Planococcus citri (Risso. O experimento foi conduzido em câmara climatizada regulada a 25 ± 1 ºC, 70 ± 10% de UR e fotofase de 12 horas. Os adultos de C. externa cujas larvas foram alimentadas com ninfas nos três ínstares e fêmeas adultas da cochonilha, foram separados por sexo e 25 casais foram individualizados em gaiolas determinando-se a razão sexual, período de pré-oviposição, capacidade de oviposição diária e total durante 40 dias consecutivos, longevidade, período embrionário e viabilidade de ovos. Constatou-se que as ninfas nos três ínstares e fêmeas adultas fornecidas como alimento, não afetaram a razão sexual, período de pré-oviposição, período embrionário e longevidade dos adultos de C. externa. A produção diária e total de ovos por C. externa foi afetada pelo tipo de alimento fornecido ao predador durante a fase de larva, observando-se uma maior produção quando os casais foram alimentados na fase de larva com fêmeas adultas da cochonilha. Analisando-se a produção de ovos, observou-se uma maior concentração de oviposição nos primeiros dez dias do período reprodutivo, decrescendo nas avaliações seguintes. Foram obtidas porcentagens maiores de ovos viáveis e menores de inviáveis e inférteis, porém, não diferiram em função do alimento fornecido ao predador na fase de larva.It was aimed to study some biological aspects in the adult stage of Chrysoperla externa (Hagen when the larvae of predator were fed both nymphs and adult females of Planococcus citri (Risso. The experiment was conducted in climate chamber at 25 ± 1°C, 70 ± 10% of RH and 12-h photophase. The adults of C. externa whose larvae were fed nymphs at the three instars and adult females of mealybug were separated by sex and 25 couples were individualized in cages of PVC determining sex ratio, pre-oviposition period, daily and total oviposition for 40 days on end, longevity, embryonic period and survival rate of eggs. It was found that the nymphs at the three instars and adult females given as food did not affect sex ratio, pre-oviposition period, embryonic period and longevity of adults of C. externa. The daily and total egg production by C. externa was affected by the sort of food given to the predator during the larval stage, observing a greater production when the couples were fed at the larval stage with adults females of mealybug. By assessing egg production, a higher concentration of oviposition on the first ten days of the reproductive period was found, decreasing in the next evaluations. The survival rates of eggs not differ in function of feed in the different stages of development of prey that was consumed by differents predator larvae stage.

  13. Aspectos biológicos de Chrysoperla externa (Hagen, 1861)(Neuroptera: Chrysopidae) alimentada com Planococcus citri (Risso, 1813)(Hemiptera: Pseudococcidae) e Toxoptera citricida (Kirkaldy, 1907) (Hemiptera: Aphididae) / Bipogical aspects of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) fed with Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) and Toxoptera citricida (Kirkaldy, 1907) (Hemiptera: Aphididae) (Hemiptera: Aphididae)

    Scientific Electronic Library Online (English)

    Jean Patrick, Bonani; Brígida, Souza; Lenira Viana Costa, Santa-Cecília; Lilian Roberta Batista, Correa.


    Full Text Available O ecossistema citrícola abriga muitas espécies de inimigos naturais, entre eles Chrysoperla externa (Hagen, 1861) que apresenta um grande potencial como agente de controle biológico de pragas. Neste trabalho, objetivou-se avapar o efeito das presas Planococcus citri (Risso, 1813) e Toxoptera citrici [...] da (Kirkaldy, 1907) sobre o desenvolvimento das fases de larva e pupa de C. externa. O ensaio foi conduzido em sala cpmatizada a uma temperatura de 25±1ºC, 70±10% UR e fotofase de 12 horas, sendo os tratamentos constituídos pelo fornecimento contínuo e alternado dessas duas presas em cada ínstar do predador, além de ovos de Anagasta kuehniella (Zeller, 1879), utilizados para fins de comparação. Foram avaliados o tempo de vida e a viabilidade das fases de larva, pupa e do período larva-adulto de C. externa. Constatou-se que T. citricida fornecido isoladamente ao longo do desenvolvimento larval ou em dois ínstares consecutivos do predador, não foi uma presa adequada, constatando-se 100% de mortalidade no período larva-adulto. Quando as larvas alimentaram-se de P. citri fornecida em dois ínstares do predador, a viabilidade no período larva-adulto foi semelhante à dieta constituída por apenas ovos de A. kuehniella, exceto quando se alimentaram de T. citricida no primeiro ínstar. Abstract in english The citrus-growing ecosystem houses a great deal of species of natural enemies, among them Chrysoperla externa (Hagen, 1861), which presents a great potential for use in the bipogical contrp of pests. The aim of this work was to evaluate the effects of the preys Planococcus citri (Risso, 1813) and T [...] oxoptera citricida (Kirkaldy, 1907) on the development of larva and pupa of C. externa. The trial was carried out in an accpmatized room at 25±1ºC, 70±10% RH and 12-hour photophase, the treatments consisting of the continuous and alternate supply of those two preys in each instar of the predator, in apition to eggs of Anagasta kuehniella (Zeller, 1879) utilized for comparison purposes. Both the white mealybug and the aphids were given in sufficient amounts to the C. externa larvae to be able to feed ad libitum. The pfetime and the survival rate of the phases of larva, pupa and the larval-adult period of C. externa were evaluated. It was found that T. citricida given either singly along the larval development or in two consecutive instars of the predator was not an adequate prey, 100% of mortapty over the larval-adult period being found. When the larvae fed on P. citri, given in two instars of the predator, the survival rate in the larval-adult period was similar to the diet constituted of only A. kuehniella eggs, except when fed with T. citricida in the first instar.

  14. Aspectos biológicos da fase adulta de Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) oriunda de larvas alimentadas com Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) / Biological aspects of the adult stage of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) originating from the larvae fed Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae)

    Scientific Electronic Library Online (English)

    Gerane Celly Dias, Bezerra; Lenira Viana Costa, Santa-Cecília; César Freire, Carvalho; Brígida, Souza.


    Full Text Available Objetivou-se estudar alguns aspectos biológicos da fase adulta de Chrysoperla externa (Hagen) quando as larvas desse predador foram alimentadas com ninfas e fêmeas adultas de Planococcus citri (Risso). O experimento foi conduzido em câmara climatizada regulada a 25 ± 1 ºC, 70 ± 10% de UR e fotofase [...] de 12 horas. Os adultos de C. externa cujas larvas foram alimentadas com ninfas nos três ínstares e fêmeas adultas da cochonilha, foram separados por sexo e 25 casais foram individualizados em gaiolas determinando-se a razão sexual, período de pré-oviposição, capacidade de oviposição diária e total durante 40 dias consecutivos, longevidade, período embrionário e viabilidade de ovos. Constatou-se que as ninfas nos três ínstares e fêmeas adultas fornecidas como alimento, não afetaram a razão sexual, período de pré-oviposição, período embrionário e longevidade dos adultos de C. externa. A produção diária e total de ovos por C. externa foi afetada pelo tipo de alimento fornecido ao predador durante a fase de larva, observando-se uma maior produção quando os casais foram alimentados na fase de larva com fêmeas adultas da cochonilha. Analisando-se a produção de ovos, observou-se uma maior concentração de oviposição nos primeiros dez dias do período reprodutivo, decrescendo nas avaliações seguintes. Foram obtidas porcentagens maiores de ovos viáveis e menores de inviáveis e inférteis, porém, não diferiram em função do alimento fornecido ao predador na fase de larva. Abstract in english It was aimed to study some biological aspects in the adult stage of Chrysoperla externa (Hagen) when the larvae of predator were fed both nymphs and adult females of Planococcus citri (Risso). The experiment was conducted in climate chamber at 25 ± 1°C, 70 ± 10% of RH and 12-h photophase. The adults [...] of C. externa whose larvae were fed nymphs at the three instars and adult females of mealybug were separated by sex and 25 couples were individualized in cages of PVC determining sex ratio, pre-oviposition period, daily and total oviposition for 40 days on end, longevity, embryonic period and survival rate of eggs. It was found that the nymphs at the three instars and adult females given as food did not affect sex ratio, pre-oviposition period, embryonic period and longevity of adults of C. externa. The daily and total egg production by C. externa was affected by the sort of food given to the predator during the larval stage, observing a greater production when the couples were fed at the larval stage with adults females of mealybug. By assessing egg production, a higher concentration of oviposition on the first ten days of the reproductive period was found, decreasing in the next evaluations. The survival rates of eggs not differ in function of feed in the different stages of development of prey that was consumed by differents predator larvae stage.

  15. Habitats and trophic relationships of Chironomidae insect larvae from the Sepotuba River basin, Pantanal of Mato Grosso, Brazil / Hábitats e relações tróficas de insetos Chironomidae da bacia do Rio Sepotuba, Pantanal de Mato Grosso, Brasil

    Scientific Electronic Library Online (English)

    CMM., Butakka; M., Grzybkowska; GD., Pinha; AM., Takeda.


    Full Text Available Hábitats bênticos estão ligados por processos físicos e são elementos essenciais na avaliação da dinâmica de distribuição de insetos dípteros Chironomidae e seu papel em ecossistemas aquáticos. Este trabalho apresenta os resultados dos padrões de distribuição de larvas de Chironomidae em 38 locais q [...] ue são abundantes na área de estudo, habitando o substrato do canal principal do rio, cachoeiras, córregos tributários, lagoas de planície de inundação, e reservatórios ao longo do Rio Sepotuba de sua desembocadura ao Rio Paraguai e na região de cabeceira. Um total de 1,247 larvas foi registrada. O táxons mais abundantes foram Polypedilum (Tripodura) sp. (25.2%), Cricotopus sp.3 (23.0%) e Tanytarsus sp. (15.0%). Fissimentum desiccatum foi encontrado somente no reservatório; Fissimentum sp.2 e Tanytarsus cf. T. obiriciae sp.2 nas lagoas de planície de inundação, e Goeldichironomus sp. no canal principal. A baixa diversidade dos locais S06 e S35 foi causada pela exclusiva presença da espécie Cricotopus sp.3, sozinha ou junta com um ou outro táxon (Tanytarsus sp., Djalmabatista sp.3). Coletores-filtradores representaram 16%, coletores-catadores 15%, predadores 11% e raspadores somente 1%. Os predadores dominaram no canal secundário (±88 ind/m2), correspondendo a 40% do total deste grupo. Cryptochironomus sp.2 (34%) e Ablasbemyia gr. annulata (26%) foram os mais abundantes entre os predadores. As diferenças ao longo do curso do rio foram decisivas para a formação de comunidades distintas e descontínuas e os limites tornam óbvios pertinentes às interrelações entre as populações na comunidade, como por exemplo, competição por alimento e hábitat. Abstract in english Benthic habitats are linked by physical processes and are essential elements in assessing of the distribution dynamics of Chironomidae dipteran insects and their role in aquatic ecosystems. This work presents results of distribution patterns of chironomids larvae in 38 sites that are abundant in the [...] study site, inhabiting the substrate of the main river channel, rapids, tributary brook, floodplain lakes and reservoir along the Sepotuba River from its mouth at the Paraguay River to the headwater region. A total of 1,247 larvae was registered. The most abundant taxa were Polypedilum (Tripodura) sp. (25.2%), Cricotopus sp.3 (23.0%) and Tanytarsus sp. (15.0%). Fissimentum desiccatum were found only in the reservoir; Fissimentum sp.2 and Tanytarsus cf. T. obiriciae sp.2 in floodplain lakes, and Goeldichironomus sp. in the main channel. The low diversity of the sites S06 and S35 is caused by the near-exclusive presence of the species Cricotopus sp.3, alone or together with one or another taxon (Tanytarsus sp., Djalmabatista sp.3). Collectors-filterers represent 16%, collectors-gatherers 15%, predators 11% and scrapers only 1%. The predators dominated in the secondary channel (±88 ind/m2), corresponding to 40% of the total of this group. Cryptochironomus sp.2 (34%) and Ablasbemyia gr. annulata (26%) were the most abundant among the predators. The differences along the river course are decisive for the formation of distinct or discontinuous communities and the limits become obvious though the interrelations between the populations in the community, as for instance, competition for food and habitats.

  16. Toxicidade de acaricidas a ovos e adultos de Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae) / Toxicity of acaricides to eggs and adults of Ceraeochrysa cubana (Hagen, 1861) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Geraldo Andrade, Carvalho; César Freire, Carvalho; Márcio do Nascimento, Ferreira.


    Full Text Available Objetivou-se, neste trabalho, avaliar o efeito de treze acaricidas sobre ovos e adultos de Ceraeochrysa cubana (Hagen, 1861). Os acaricidas foram pulverizados por meio de torre de Potter, nas concentrações recomendadas para o controle de ácaros na cultura dos citros. Os ensaios foram conduzidos sob [...] condições controladas de 25 ± 2º C, umidade relativa de 70 ± 10% e fotofase de 12 horas. Os acaricidas não foram tóxicos ao predador em sua fase de ovo. Em relação aos adultos, o carbosulfan e o triazophos foram altamente tóxicos (100% de mortalidade), enquanto que os piretróides bifenthrin e fenpropathrin causaram mortalidade aproximadamente de 60%. Os acaricidas dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin não provocaram mortalidade dos adultos de C. cubana. Flufenoxuron inibiu a capacidade de oviposição e provocou a inviabilização dos ovos. Baseando-se na escala da IOBC, os acaricidas carbosulfan, triazophos e flufenoxuron foram enquadrados na classe 4 = nocivos; bifenthrin e fenpropathrin na classe 2 = levemente nocivos, e dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin na classe 1 = inócuos a C. cubana. Os compostos enquadrados na classe 1 podem ser recomendados em programas de manejo integrado de pragas de citros objetivando a integração entre os métodos químico e biológico por meio dessa espécie de predador. Abstract in english The objective of this work was to evaluate the effects of thirteen acaricides on eggs and adults of the lacewing Ceraeochrysa cubana (Hagen, 1861). The acaricides were sprayed using a Potter's tower at the rate recommended for mite control in citrus orchard. The trials were performed in climatic cha [...] mber at 25 ± 2º C, 70 ± 10% RH and photophase of 12 hours. The egg stage showed high tolerance to the tested acaricides. Carbosulfan and triazophos caused 100% adult mortality, whereas bifenthrin and fenpropathrin caused around 60%. All other acaricides, dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin and fenibutatin oxide did not cause mortality of C. cubana adult. Flufenoxuron reduced adult egg laying and all eggs were nonviable. According to IOBC scale, the acaricides carbosulfan, triazophos and flufenoxuron were classified into class 4 = harmful; bifenthrin and fenpropathrin into class 2 = slightly toxic; and dicofol, clofentezine, abamectin, hexythiazox, cyhexatin, and fenbutatin oxide into class 1 = harmless to C. cubana. The compounds classified as first class may be recommended in programs of integrated pest management of citrus aiming at the integration between the biological and chemical control through this kind of predator.

  17. Toxicidade de acaricidas a ovos e adultos de Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae Toxicity of acaricides to eggs and adults of Ceraeochrysa cubana (Hagen, 1861 (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Geraldo Andrade Carvalho


    Full Text Available Objetivou-se, neste trabalho, avaliar o efeito de treze acaricidas sobre ovos e adultos de Ceraeochrysa cubana (Hagen, 1861. Os acaricidas foram pulverizados por meio de torre de Potter, nas concentrações recomendadas para o controle de ácaros na cultura dos citros. Os ensaios foram conduzidos sob condições controladas de 25 ± 2º C, umidade relativa de 70 ± 10% e fotofase de 12 horas. Os acaricidas não foram tóxicos ao predador em sua fase de ovo. Em relação aos adultos, o carbosulfan e o triazophos foram altamente tóxicos (100% de mortalidade, enquanto que os piretróides bifenthrin e fenpropathrin causaram mortalidade aproximadamente de 60%. Os acaricidas dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin não provocaram mortalidade dos adultos de C. cubana. Flufenoxuron inibiu a capacidade de oviposição e provocou a inviabilização dos ovos. Baseando-se na escala da IOBC, os acaricidas carbosulfan, triazophos e flufenoxuron foram enquadrados na classe 4 = nocivos; bifenthrin e fenpropathrin na classe 2 = levemente nocivos, e dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin e óxido de fenbutatin na classe 1 = inócuos a C. cubana. Os compostos enquadrados na classe 1 podem ser recomendados em programas de manejo integrado de pragas de citros objetivando a integração entre os métodos químico e biológico por meio dessa espécie de predador.The objective of this work was to evaluate the effects of thirteen acaricides on eggs and adults of the lacewing Ceraeochrysa cubana (Hagen, 1861. The acaricides were sprayed using a Potter's tower at the rate recommended for mite control in citrus orchard. The trials were performed in climatic chamber at 25 ± 2º C, 70 ± 10% RH and photophase of 12 hours. The egg stage showed high tolerance to the tested acaricides. Carbosulfan and triazophos caused 100% adult mortality, whereas bifenthrin and fenpropathrin caused around 60%. All other acaricides, dicofol, bromopropylate, tetradifon, clofentezine, abamectin, hexythiazox, cyhexatin and fenibutatin oxide did not cause mortality of C. cubana adult. Flufenoxuron reduced adult egg laying and all eggs were nonviable. According to IOBC scale, the acaricides carbosulfan, triazophos and flufenoxuron were classified into class 4 = harmful; bifenthrin and fenpropathrin into class 2 = slightly toxic; and dicofol, clofentezine, abamectin, hexythiazox, cyhexatin, and fenbutatin oxide into class 1 = harmless to C. cubana. The compounds classified as first class may be recommended in programs of integrated pest management of citrus aiming at the integration between the biological and chemical control through this kind of predator.

  18. Aspectos biológicos de Harmonia axyridis alimentada com duas espécies de presas e predação intraguilda com Eriopis connexa Biological aspects of Harmonia axyridis fed on two prey species and intraguild predation with Eriopis connexa

    Directory of Open Access Journals (Sweden)

    Natália Ribeiro Pereira dos Santos


    Full Text Available O objetivo deste trabalho foi determinar os aspectos biológicos de Harmonia axyridis, alimentada com duas espécies de presas, e a ocorrência de predação intraguilda com Eriopis connexa. Larvas de H. axyridis foram alimentadas diariamente com ovos de Anagasta kuehniella ou com o pulgão Schizaphis graminum. Adultos da joaninha foram separados em dez casais que receberam o mesmo tipo de alimento da fase larval. Na avaliação da predação, uma larva de quarto instar de cada espécie foi mantida na presença ou ausência de abrigo e de ovos de A. kuehniella. A fase larval de H. axyridis durou 10,2 e 8,9 dias, quando alimentada com A. kuehniella e S. graminum, respectivamente. A sobrevivência do predador, em fase imatura, variou de 70 a 100%. A joaninha apresentou período de oviposição de 47,3 e 51,7 dias, com 887,6 e 822,5 ovos, ao se alimentar de A. kuehniella e S. graminum, respectivamente. A longevidade das fêmeas foi de 74,1 e 76,2 dias e a dos machos de 67,3 e 70,3 dias, em A. kuehniella e S. graminum, respectivamente. H. axyridis atuou como predador intraguilda e foi a espécie dominante na competição com E. connexa.The objective of this work was to determine the biological aspects Harmonia axyridis, fed on two prey species, and the occurrence of intraguild predation with Eriopis connexa. Larvae of H. axyridis were fed daily with Anagasta kuehniella eggs or Schizaphis graminum aphid. Adults of H. axyridis were separated in ten couples which received the same food type of the larval stage. For the estimation of predation, a fourth instar larva of each species was maintained in the presence or absence of shelter and eggs of A. kuehniella. The larval stage lasted 10.2 days, when H. axyridis fed on A. kuehniella eggs, and 8.9 days when reared with S. graminum. The survival of predator during immature stages ranged from 70 to 100%. H. axyridis had an oviposition period of 47.3 and 51.7 days, laying a total of 887.6 and 822.5 eggs, when fed on A. kuehniella and S. graminum, respectively. Females had longevity of 74.1 and 76.2 days, and males of 67.3 and 70.3 days, fed on A. kuehniella and S. graminum, respectively. H. axyridis acted as an intraguild predator and was the dominant species in the competition with E. connexa.

  19. Morphology of female reproductive tract of the predator Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed on different diets

    Directory of Open Access Journals (Sweden)

    Walkymário de Paulo Lemos


    Full Text Available The morphology of the reproductive tract of Podisus nigrispinus (Dallas females fed with Alabama argillacea (Hübner larvae, artificial diet, Tenebrio molitor L. larvae or Musca domestica L. larvae were studied. The reproductive tract of females of this species presented yellow coloration and independent of the diet, each ovary had seven ovarioles joined through terminal filaments and forming a bunch shape structure. The histological data revealed that the ovary of P. nigrispinus was of meroistic telotrophic type, with each individual ovariole divided in a terminal filament, a tropharium (trophic chamber, a vitellarium, and a pedicel. The prey type affected the development and morphometry of these structures. Females of P. nigrispinus fed with 3rd or 5th instar larvae of cotton leafworm (A. argillacea presented developed ovaries with ovarioles showing a great number of oocytes in advanced stages of development. Females fed with artificial diet presented atrophic ovaries and ovarioles practically without oocytes. Females fed with T. molitor or M. domestica showed ovaries in intermediary stage of development. The central ovariole was longer in females fed with 5th instar larvae of cotton leafworm and shorter in those fed with artificial diet. Most developed oocytes were observed in ovaries of females fed with 5th or 3rd instar larvae of cotton leafworm, and the majority of atrophic oocytes were found in females fed with artificial diet.Este estudo apresenta a morfologia do sistema reprodutor feminino de Podisus nigrispinus (Dallas alimentado com larvas de Alabama argillacea (Hübner, Musca domestica L. e de Tenebrio molitor L. ou dieta artificial. As gônadas internas desse predador apresentaram coloração amarelada e, independente da dieta, cada ovário apresentou sete ovaríolos unidos pelos filamentos terminais em uma estrutura em forma de cacho. A análise histológica revelou que o ovário de P. nigrispinus é do tipo meroístico telotrófico com cada ovaríolo dividido morfologicamente em filamento terminal, trofário (câmara nutridora, vitelário e pedicelo. A dieta recebida por esse predador alterou o desenvolvimento e a morfometria de seus ovários. Fêmeas de P. nigrispinus alimentadas com larvas de terceiro ou quinto estádio de A. argillacea apresentaram ovários desenvolvidos com grande número de ovócitos em estágio avançado de desenvolvimento nos ovaríolos. Fêmeas com dieta artificial apresentaram ovários atrofiados e ovaríolos, praticamente, sem ovócitos em seu interior enquanto aquelas alimentadas com larvas de T. molitor ou M. domestica tiveram ovários em estágios intermediários de desenvolvimento. O comprimento do ovaríolo central foi maior em fêmeas alimentadas com larvas de quinto estádio de A. argillacea e menor naquelas com dieta artificial. Ovócitos em estágios mais avançados de desenvolvimento foram observados para fêmeas alimentadas com larvas de terceiro ou quinto estádios de A. argillacea, enquanto ovócitos atrofiados foram observados para aquelas com dieta artificial.

  20. Avaliação da predação de Podocnemis expansa e Podocnemis unifilis (Testudines, Podocnemididae) no rio Javaés, Tocantins / Evaluation of predation in Podocnemis expansa and Podocnemis unifilis (Testudines, Podocnemididae) in the Javaés River, Tocantins

    Scientific Electronic Library Online (English)

    Giovanni, Salera Junior; Adriana, Malvasio; Thiago Costa Gonçalves, Portelinha.


    Full Text Available Podocnemis expansa e P. unifilis são animais de vida longa, com uma demorada maturação sexual, o que influencia uma baixa taxa de substituição de indivíduos. Suas populações são caracterizadas por uma pequena mortalidade dos animais adultos, mas alta taxa de mortalidade de filhotes e embriões. Sendo [...] a predação natural de ninhos e filhotes um dos fatores mais importantes do baixo sucesso de eclosão dessas espécies. No rio Javaés, os ovos e recém-eclodidos podem ser predados por uma grande diversidade de animais: dentre as aves, urubus (Coragyps atratus e Cathartes aura), carcará (Polyborus plancus), jaburu (Jabiru mycteria); lagartos (Tupinambis teguixin) e mamíferos de pequeno porte, coati (Nasua nasua) e cachorro-do-mato (Cerdocyon thous). Do total anual de desovas de P. unifilis em média 65,98% são predadas, sendo 41,68% de forma total e 24,30% parcialmente. Enquanto que apenas 5,31% das ninhadas de P. expansa são sempre parcialmente predadas. Dentre os predadores aquáticos existem diversos peixes, principalmente piranhas (Serrasalmus nattereri) e jacarés (Melanosuchus niger e Caimam crocodilus). Os predadores das fêmeas de P. unifilis são: jacaré-açu (Melanosuchus niger), onça-pintada (Panthera onca) e onça-parda (Puma concolor). Enquanto que as fêmeas de P. expansa em postura, somente são predadas por P. onca. As fêmeas de P. unifilis em postura são predadas num total médio de 3,93% anualmente, enquanto que para P. expansa a média anual é 5,66% das fêmeas. Abstract in english Podocnemis expansa and P. unifilis long lived with late sexual maturation, which influences a low replacement rate of individuals. Their populations are characterized by low adults mortality, but high mortality of embryos and hatchlings. The natural nest predation is an important factor for hatchlin [...] g success. In Javaés River, the eggs and hatchlings can be predated by a large number of animals such as birds, vultures (Coragyps atratus and Cathartes aura), carcará (Polyborus plancus), jabiru (Jabiru mycteria); lizards (Tupinambis teguixin) and small mammals, coati (Nasua nasua) and crab-eating-fox (Cerdocyon thous). About 65,98% of nests of P. unifilis are predated (41,68% totally and 24,30% partially). Only 5,31% of P. expansa nests are partially predated. There are many aquatic predators, like carnivorous fish, mainly piranhas (Serrasalmus nattereri) and caimans (Melanosuchus niger e Caimam crocodilus). The predators of P. unifilis females are: black caiman (Melanosuchus niger), jaguar (Panthera onca) and puma (Puma concolor), and of P. expansa females is the P. onca. In average 3,93% of P. unifilis females are predated annually while that to P. expansa the average is 5,66%.

  1. The inverted trophic cascade in tropical plankton communities: impacts of exotic fish in the Middle Rio Doce lake district, Minas Gerais, Brazil / A cascata trófica invertida em comunidades planctônicas tropicais: impactos da introdução de peixes exóticos no distrito de lagos do médio rio Doce, MG

    Scientific Electronic Library Online (English)

    RM., Pinto-Coelho; JF., Bezerra-Neto; F., Miranda; TG., Mota; R., Resck; AM., Santos; PM., Maia-Barbosa; NAST., Mello; MM., Marques; MO., Campos; FAR., Barbosa.


    Full Text Available O presente estudo trata dos impactos ecológicos da introdução de duas espécies invasoras de peixes piscívoros em diversos lagos da região lacustre do médio rio Doce em Minas Gerais, Brasil. Demonstrou-se que estes efeitos não se restringiram às comunidade de peixes. A introdução dos predadores Pygoc [...] entrus nattereri (piranha-vermelha) e Cichla cf. ocelaris (tucunaré) não só causou uma forte redução no número de espécies de peixes nativos, como também mudanças nos níveis tróficos inferiores. Pouco depois das introduções, a maioria dos lagos começou a mostrar alterações na comunidade fitoplanctônica, tais como o aparecimento da dominância de Cyanophyceae. A comunidade zooplanctônica perdeu diversas espécies e, em alguns casos, houve o desaparecimento de todas as espécies de cladóceros limnéticos, como é o caso da lagoa Carioca. Por outro lado, predadores invertebrados, representados pelos dípteros da família Chaoboridae, floresceram nos lagos com maiores densidades de espécies exóticas de peixes, provavelmente como resultado da "liberação ecológica" causada pela redução da ictiofauna original. Além de uma tendência geral de perda de espécies em diferentes níveis tróficos, outras mudanças estão aparentemente associadas com a redução da qualidade de água. Dessa forma, esses ecossistemas estão necessitando urgentemente de novas abordagens nas estratégias de manejo e conservação. Abstract in english The present study deals with the ecological impacts of the introduction of two alien species of piscivorous fish in several lakes of the Middle Rio Doce lake district in Minas Gerais, Brazil. It was demonstrated that these effects were not restricted only to the fish community. The introduction of t [...] he predatory red piranha Pygocentrus nattereri and the tucunaré Cichla cf. ocellaris caused not only a sharp decrease in the number of native fish species, but also major shifts in other trophic levels. Just after the fish were introduced, most lakes began to show conspicuous changes in phytoplankton species composition, in which Cyanophyceae gradually came to dominate. The zooplankton community lost several species, and in some cases, such as Lake Carioca, all the cladoceran species disappeared. On the other hand, invertebrate predators, represented by the dipteran Chaoboridae, boomed in the lake, with higher densities of exotic species, probably as a result of the "ecological release" by reduction of the original fish fauna. There was a general trend of species loss in different trophic levels. All these changes are apparently associated with decreases in water quality. The present situation in these lakes demands new approaches to the management and conservation of these ecosystems.

  2. Compatibilidade reprodutiva de duas populações de Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Reproductive compatibility between two populations of Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)



    Full Text Available O presente trabalho consistiu na avaliação da compatibilidade reprodutiva entre duas populações de ácaros predadores preliminarmente identificadas como Iphiseiodes zuluagai Denmark & Muma, obtidas de uma plantação comercial de Citrus sinensis (L.) Osbeck. (Rutaceae) e de plantas de Syagrus romanzoff [...] iana (Cham.) Glassman (Arecaceae) encontradas em uma área de floresta. Os resultados deste estudo poderiam indicar a possibilidade de que estas últimas plantas pudessem servir de reservatório de I. zuluagai às primeiras. As colônias de I. zuluagai foram mantidas em laboratório através do método descrito por Reis et al. (1988), a 25±1ºC, 85±5% de U.R. e 12h de fotofase. A compatibilidade reprodutiva foi avaliada através de cruzamentos e retrocruzamentos entre ácaros de cada colônia e observações da fecundidade dos ácaros durante 10 dias. Cruzamentos heterogâmicos e retrocruzamentos produziram descendentes férteis em proporções comparáveis aos cruzamentos homogâmicos. Os resultados indicam que as populações testadas pertencem à mesma espécie, o que sugere um possível papel positivo de S. romanzoffiana como reservatório de I. zuluagai, a partir da qual o predador eventualmente poderia recolonizar áreas de plantas cultivadas. Abstract in english The present work consisted of an evaluation of the reproductive compatibility between two populations of a predatory mite preliminarily identified as Iphiseiodes zuluagai Denmark & Muma, obtained from a commercial plantation of Citrus sinensis (L.) Osbeck. (Rutaceae) and from Syagrus romanzoffiana ( [...] Cham.) Glassman (Arecaceae) found in a forest area. The results of this study could indicate the possibility that the latter system could serve as a reservoir of I. zuluagai to the former. The colonies of I. zuluagai were maintained in a laboratory using the method described by Reis et al. (1988), at 25±1ºC, 85±5% of R.H. and 12h light: 12h dark. The reproductive compatibility was evaluated through crosses and back-crosses between mites of each colony and observations on their fecundity during 10 days. The heterogamic crosses and the back-crosses resulted in fertile progeny in proportions comparable to homogamic crosses. These results indicate that both tested populations belong to the same species, which suggest a possible positive role of S. romanzoffiana as reservoir of I. zuluagai, from which the predator could eventually re-colonize patches of cultivated plants.

  3. Comparação econômica entre controle biológico e químico para o manejo de ácaro-vermelho em macieira / Economic comparison of biological and chemical control in the management of red spider mites in apple orchard

    Scientific Electronic Library Online (English)

    Lino Bittencourt, Monteiro; Alexander, Souza; Patrik Luiz, Pastori.


    Full Text Available O ácaro-vermelho da macieira, Panonychus ulmi (Acari: Tetranychidae), é uma importante praga na cultura da macieira em Fraiburgo - SC, e o controle biológico aplicado foi implantado em meados dos anos 90. O objetivo deste trabalho foi demonstrar os benefícios econômicos da utilização do controle bio [...] lógico no manejo do ácaro-vermelho. A avaliação foi realizada em dois pomares comerciais de macieiras. Em um deles, foi implantado o controle biológico aplicado de ácaros, baseado na liberação do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae), seleção de inseticidas e manejo de ervas invasoras, e o outro pomar seguiu o manejo convencional de artrópodes, baseado na aplicação de produtos químicos para o controle de insetos, ácaros fitófagos e ervas invasoras. A análise econômica mostrou que os custos com mão-de-obra e máquinas foram semelhantes em ambos os pomares, entretanto os custos com acaricidas foram significativamente inferiores no pomar onde o manejo foi o controle biológico, demonstrando que, apesar da necessidade de investimentos em instalações para a criação do ácaro predador e custos de manutenção das mesmas, a estratégia biológica foi economicamente viável. Abstract in english Red spider mite, Panonychus ulmi (Acari: Tetranychidae) is a significant pest in apple tree in Fraiburgo, Santa Catarina (SC) and applied biological control was implemented in the mid-nineties. The objective of this study was to demonstrate the economic benefits of biological control in the manageme [...] nt of red spider mite. The assessment was carried out in two commercial orchards, one of which was subjected to biological control of spider mite by releasing the predator Neoseiulus californicus, insecticide selection and weed management, and the other to conventional arthropod management, based on the application of chemicals to control insects, phytofagous mites and weed. Economic analysis showed that the costs for labor and machines were similar in both orchards; however acaricide costs were significantly lower in the orchard subjected to biological control, demonstrating that despite the need for investment in predator mite breeding apparatus and maintenance costs, the biological strategy was economically viable.

  4. Avaliação da predação de Podocnemis expansa e Podocnemis unifilis (Testudines, Podocnemididae no rio Javaés, Tocantins Evaluation of predation in Podocnemis expansa and Podocnemis unifilis (Testudines, Podocnemididae in the Javaés River, Tocantins

    Directory of Open Access Journals (Sweden)

    Giovanni Salera Junior


    Full Text Available Podocnemis expansa e P. unifilis são animais de vida longa, com uma demorada maturação sexual, o que influencia uma baixa taxa de substituição de indivíduos. Suas populações são caracterizadas por uma pequena mortalidade dos animais adultos, mas alta taxa de mortalidade de filhotes e embriões. Sendo a predação natural de ninhos e filhotes um dos fatores mais importantes do baixo sucesso de eclosão dessas espécies. No rio Javaés, os ovos e recém-eclodidos podem ser predados por uma grande diversidade de animais: dentre as aves, urubus (Coragyps atratus e Cathartes aura, carcará (Polyborus plancus, jaburu (Jabiru mycteria; lagartos (Tupinambis teguixin e mamíferos de pequeno porte, coati (Nasua nasua e cachorro-do-mato (Cerdocyon thous. Do total anual de desovas de P. unifilis em média 65,98% são predadas, sendo 41,68% de forma total e 24,30% parcialmente. Enquanto que apenas 5,31% das ninhadas de P. expansa são sempre parcialmente predadas. Dentre os predadores aquáticos existem diversos peixes, principalmente piranhas (Serrasalmus nattereri e jacarés (Melanosuchus niger e Caimam crocodilus. Os predadores das fêmeas de P. unifilis são: jacaré-açu (Melanosuchus niger, onça-pintada (Panthera onca e onça-parda (Puma concolor. Enquanto que as fêmeas de P. expansa em postura, somente são predadas por P. onca. As fêmeas de P. unifilis em postura são predadas num total médio de 3,93% anualmente, enquanto que para P. expansa a média anual é 5,66% das fêmeas.Podocnemis expansa and P. unifilis long lived with late sexual maturation, which influences a low replacement rate of individuals. Their populations are characterized by low adults mortality, but high mortality of embryos and hatchlings. The natural nest predation is an important factor for hatchling success. In Javaés River, the eggs and hatchlings can be predated by a large number of animals such as birds, vultures (Coragyps atratus and Cathartes aura, carcará (Polyborus plancus, jabiru (Jabiru mycteria; lizards (Tupinambis teguixin and small mammals, coati (Nasua nasua and crab-eating-fox (Cerdocyon thous. About 65,98% of nests of P. unifilis are predated (41,68% totally and 24,30% partially. Only 5,31% of P. expansa nests are partially predated. There are many aquatic predators, like carnivorous fish, mainly piranhas (Serrasalmus nattereri and caimans (Melanosuchus niger e Caimam crocodilus. The predators of P. unifilis females are: black caiman (Melanosuchus niger, jaguar (Panthera onca and puma (Puma concolor, and of P. expansa females is the P. onca. In average 3,93% of P. unifilis females are predated annually while that to P. expansa the average is 5,66%.

  5. Food extraction by the males of Podisus nigrispinus (Dallas (Hemiptera: Pentatomidae from cotton leafworm larvae

    Directory of Open Access Journals (Sweden)

    Alexandre Igor de Azevedo Pereira


    Full Text Available In this work, the effect of different densities (1, 3, 5, 7 and 9 of 3rd instar Alabama argillacea (Huebner larvae on food consumption by Podisus nigrispinus (Dallas males was evaluated. The densities established were converted to weight of prey offered: 13.4 mg (one larva, 33.3 mg (three larvae, 54.3 mg (five larvae, 81.8 mg (seven larvae, and 110.34 mg (nine larvae. The quantity of food consumed by P. nigrispinus increased with the prey density. The density of preys did not affect the time spent by the predator to ingest the food. The quantity of food extracted per minute was always higher in smaller densities and lower in higher densities. Males mean body weight did not differ statistically between the treatments tested, and weight gain was smaller in the first two densities tested. Relative consumption rates increased with the quantity of larvae offered. P. nigrispinus males might change its predatory behavior as a function of the quantity of prey available.O efeito de diferentes densidades (1, 3, 5, 7 e 9 de 3º lagartas do instar de Alabama argillacea (Huebner no consumo de alimento por machos de Podisus nigrispinus (Dallas foi avaliado em condições de laboratório. As densidades utilizadas foram convertidas a peso de presa oferecida: 13,40 mg (1 lagarta, 33.30 mg (3 lagartas, 54,30 mg (5 lagartas, 81,80 mg (7 lagartas e 110,34 mg (9 lagartas. A quantidade de alimento consumido pelo macho de P. nigrispinus aumentou com a densidade da presa. A densidade da presa não afetou o tempo gasto pelo predador para ingerir o alimento. A quantidade de alimento extraído por minuto pelo predador foi sempre maior nas mais baixas densidades e menores nas mais altas densidades. O peso corpóreo médio dos machos de P. nigrispinus não difereriu entre os tratamentos testados e o seu ganho de peso foi menor nas duas primeiras densidades testadas. As taxas de consumo relativo aumentaram com a quantidade de lagartas oferecidas. Os machos de P. nigrispinus podem mudar seu comportamento predatório em função da quantidade de presas disponíveis.

  6. Chemical defenses of the endemic Brazilian gorgonian Lophogorgia violacea Pallas (Octocorallia, Gorgonacea)

    Scientific Electronic Library Online (English)

    Rosângela de A., Epifanio; Lenize F., Maia; William, Fenical.


    Full Text Available O mecanismo de defesa contra predadores no octocoral brasileiro Lophogorgia violacea foi investigado através de ensaios de preferência alimentar em campo frente a predadores. Os ensaios de palatabilidade com o extrato bruto da gorgônia demonstraram que seus metabólitos secundários possuem atividade [...] deterrente significativa frente a peixes generalistas. O fracionamento do extrato bruto, guiado pelos ensaios em campo, revelou que uma mistura complexa de furanocembranolídeos é a responsável pela defesa química de L. violacea. O diterpeno lophotoxina (1) foi a principal substância isolada, seguida por outras duas similares, deoxilophotoxina (2) e 13-acetoxi-11beta,12beta-epoxipukalídeo (3), além de dois furanocembranolídeos inéditos na literatura, 7-acetoxi-8-hidroxilophotoxina (4) e 3-metoxi-8-hidroxilophotoxina (5). A lophotoxina (1), uma importante neurotoxina, originalmente isolada de L. rigida do Pacífico, demonstrou ser a mais potente dentre as substâncias fagoinibidoras presentes no extrato bruto. Por outro lado, os outros quatro furanocembranolídeos isolados também parecem contribuir, de maneira aditiva, para a atividade total observada. Estes resultados corroboram estudos prévios, confirmando que furanocembranolídeos são uma classe de substâncias de defesa frente ao consumo por peixes em ambientes tropicais e temperados. Abstract in english The chemical defenses of the Brazilian gorgonian octocoral Lophogorgia violacea Pallas have been investigated using feeding preference experiments performed in situ with an ecologically relevant, natural assemblage of predatory fishes. Feeding experiments incorporating the crude extract of the anima [...] l into palatable foods showed that the organic constituents of L. violacea provide a powerful chemical deterrence toward consumption by generalist fish carnivores. Bioassay-guided fractionation of the extract and evaluation of the fractions and purified compounds obtained in the same in situ assay revealed that a complex mixture of furanocembranolides was responsible for the overall feeding deterrence observed. The most potent feeding deterrent identified was lophotoxin (1), followed by two previously reported and structurally related compounds, deoxylophotoxin (2), and 13-acetoxy-11beta,12beta-epoxypukalide (3), as well as two new furanocembranolides: 7-acetoxy-8-hydroxylophotoxin (4) and 3-methoxy-8-hydroxylophotoxin (5). Lophotoxin (1), a neurotoxin originally isolated from the Pacific gorgonian L. rigida, was the most potent feeding deterrent among the furanocembranolides isolated. However, the four other related furanocembranolides (2-5) appear to contribute, in an additive manner, to the overall deterrent effects observed. These results add to earlier studies providing further evidence that compounds of this structural class provide effective chemical defenses against fish predators in both temperate and tropical environments.

  7. Ecological relations between mangrove leaf litter and the spatial distribution of the gastropod Melampus coffeus in a fringe mangrove forest / Relações ecológicas entre a serrapilheira de manguezal e a distribuição espacial do gastrópodo Melampus coffeus em uma borda de floresta de mangue

    Scientific Electronic Library Online (English)

    Diva S., Tavares; Rafaela C., Maia; Cristina, Rocha-Barreira; Helena, Matthews-Cascon.


    Full Text Available A serapilheira representa fonte de alimentos para diversos organismos que podem contribuir diretamente para a decomposição de matéria orgânica. A presença física desses detritos vegetais pode modificar áreas do ambiente e promover a formação de microhabitats, servindo de refúgio para diversos animai [...] s contra predadores e dessecação. O gastrópode Melampus coffeus (Linnaeus, 1758) (Ellobiidae) é comum em florestas de mangue na costa do Atlântico e se alimenta de folhas de mangue caídas. Nesse trabalho foi assumida a hipótese de que a distribuição espacial do Melampus coffeus é diretamente afetada pela deposição de serapilheira no manguezal. Objetivou-se avaliar a distribuição espacial desses gastrópodes em relação à serapilheira de mangue durante doze meses de coletas. A área de estudo foi estabelecida no médio estuário do rio Pacoti, Estado do Ceará, Brasil onde foram determinadas duas zonas de diferentes perfis topográficos. Amostras de Melampus coffeus e de serapilheira foram coletadas mensalmente. Os resultados indicaram que a presença de galhos na superfície do solo do manguezal favorece a ocupação do ambiente por indivíduos dessa espécie de molusco de menor tamanho, provavelmente porque indivíduos menores são mais suscetíveis ao ataque de predadores e à dessecação e a presença de galhos pode formar microhabitats mais seguros. Abstract in english Leaf litter represents a food source to many organisms that may directly contribute to organic matter decomposition. In addition, the physical presence of these vegetal detritus contributes for the modification of some environmental areas and produce microhabitats that may act as a refuge against pr [...] edators and desiccation for many animals. The pulmonate gastropod Melampus coffeus (Linnaeus, 1758) (Ellobiidae) is a very common specie in Atlantic Coast mangrove forests and feeds on fallen mangrove leaves. It was hypothesized that the spatial distribution of Melampus coffeus is directly affected by mangrove leaf litter biomass deposition. Thus, this research aimed at evaluating the spatial distribution of these gastropods in relation to the biomass of mangrove leaf litter through a twelve-month period. The study area was established in the middle estuary of Pacoti River, state of Ceará, Brazil where two adjacent zones with different topographic profiles were determined. Samples of Melampus coffeus and leaf litter were collected monthly, throughout a year, from the mangrove ground surface. The results indicated that the presence of twigs in mangrove litter favor the occupation by smaller individuals of M. coffeus, probably because smaller individuals are more susceptible to predator attacks and desiccation than larger ones, and twigs and branches may provide a safe microhabitat.


    Scientific Electronic Library Online (English)

    Gabriel Jaime, Colorado Zuluaga.


    Full Text Available O comportamento de agrupamiento é um fenómeno biológico global e ubicuo no reino animal que tem atraído considerável atenção em muitos contextos. Os dois factores principais que se crê favorecem a vida em grupo são a disponibilidade de alimento e a presença de predadores. Nesta revisão exploraram-se [...] as principais teorias publicadas na literatura que tratam de dar explicação ao comportamento de agrupamiento em animais. Esta revisão divide-se em duas secções. Inicialmente, descrevem-se as principais teorias bem como os potenciais mecanismos associados ao benefício de agrupar-se. Posteriormente, apresenta-se um caso especial num sistema social animal chamado bandadas mistas de espécies de aves, explorando a informação disponível em relação a causa-las potenciais que fazem que as aves se associem nesta particular agregação. Abstract in spanish El comportamiento de agrupamiento es un fenómeno biológico global y ubicuo en el reino animal que ha atraído considerable atención en muchos contextos. Los dos factores principales que se cree favorecen la vida en grupo son la disponibilidad de alimento y la presencia de predadores. En esta revisión [...] se exploraron las principales teorías publicadas en la literatura que tratan de dar explicación al comportamiento de agrupamiento en animales. Esta revisión se divide en dos secciones. Inicialmente, se describen las principales teorías así como los potenciales mecanismos asociados al beneficio de agruparse. Posteriormente, se presenta un caso especial en un sistema social animal llamado bandadas mixtas de especies de aves, explorando la información disponible en relación a las causas potenciales que hacen que las aves se asocien en esta particular agregación. Abstract in english Group living is a widespread, ubiquitous biological phenomenon in the animal kingdom that has attracted considerable attention in many different contexts. The availability of food and the presence of predators represent the two main factors believed to favor group life. In this review, major theorie [...] s supporting grouping behavior in animals are explored, providing an explanation of animal grouping. This review is divided in two sections. First, major theories as well as potential mechanisms behind the benefit of grouping are described. Later, a special case on the widespread animal social system of mixed-species avian flocks is presented, exploring the available information in relation to the potential causes that bring birds together into this particular social aggregation.

  9. Food partitioning between breeding White-tailed Kites (Elanus leucurus; Aves; Accipitridae) and Barn Owls (Tyto alba; Aves; Tytonidae) in southern Brazil / Partilha de alimento entre o gavião-peneira (Elanus leucurus; Aves; Accipitridae) e a coruja suindara (Tyto alba; Aves; Tytonidae) durante a reprodução no sul do Brasil

    Scientific Electronic Library Online (English)

    DR., Scheibler.


    Full Text Available Examinaram-se as dietas do gavião-peneira (Elanus leucurus; Aves; Accipitridae) e da coruja suindara (Tyto alba; Aves; Tytonidae) em atividade reprodutiva numa área agrícola no Sul do Brasil, analisando restos de presas regurgitadas. O objetivo foi avaliar como estes predadores que diferem marcadame [...] nte quanto aos seus períodos de atividade de caça (a coruja é noturna e o gavião diurno) partilham seu componente alimentar de pequenos mamíferos. Identificaram-se 2087 presas consumidas pela suindara e 1276 pelo gavião-peneira. Eles apresentaram uma alta sobreposição de seus nichos alimentares (índice de Pianka de 0,98). Com base no período diário de atividade de suas principais presas de pequenos mamíferos, uma sobreposição menor seria esperada. O roedor crepuscular/noturno Mus musculus foi a principal presa para a dieta da suindara (81%) e do gavião-peneira (63%). Este pequeno roedor exótico forneceu 63% da biomassa de pequenos mamíferos ingerida pela coruja e 44% pelo gavião. Espécies maiores de pequenos mamíferos nativos também foram importantes para a dieta do gavião-peneira, principalmente devido às suas contribuições de biomassa. Embora haja diferenças marcantes quanto aos seus períodos de atividade de caça, a suindara e o gavião-peneira são predadores muito semelhantes no Sul do Brasil, sobrepondo amplamente suas dietas. Abstract in english I examined the diet of breeding White-tailed Kites (Elanus leucurus; Aves; Accipitridae) and Barn Owls (Tyto alba; Aves; Tytonidae) in an agrarian area of southern Brazil by analyzing regurgitated prey remains. The objective was to evaluate how these raptors, which differ markedly in their hunting a [...] ctivity periods (owls are nocturnal and kites diurnal), share their mammalian food component. 2,087 prey consumed by Barn Owls and 1,276 by White-tailed Kites were identified. They presented a high overlap of food-niches (Pianka’s index was 0.98). Based on the daily activity period of their main small mammal prey, a lower overlap would be expected. The crepuscular/nocturnal Mus musculus was the main prey for the diet of breeding Barn Owls (81%) and White-tailed Kites (63%). This small exotic rodent provided 63% of the small mammal biomass ingested by owls and 44% by kites. Larger native small mammals were also considered important for the diet of kites, mainly because of their biomass contribution. Although these raptors differ markedly in their hunting activity periods, Barn Owls and White-tailed Kites are very similar predators in southern Brazil, overlapping their diets.

  10. Post-embryonic development of Ceraeochrysa cincta (Schneider, 1851 (Neuroptera: Chrysopidae fed with eggs of Diatraea saccharallis (Fabricius, 1794 (Lepidoptera: CrambidaeDesenvolvimento pós-embrionário de Ceraeochrysa cincta (Schneider, 1851 (Neuroptera: Chrysopidae alimentada com ovos de Diatraea saccharallis (Fabricius, 1794 (Lepidoptera: Crambidae

    Directory of Open Access Journals (Sweden)

    Luis Gustavo Amorim Pessoa


    Full Text Available The lacewings (Ceraeochrysa cincta are important predators found associated to many pests in several agroecosystems. Eggs of Sitotroga cerealella and Anagasta kuehniella are used traditionally for massal rearing of these predators. Other foods can be used in substitution to the traditional ones, but little is known about the biology of lacewings and other alternative foods. So, this work was carried out to evaluate the effect of different diets on the post-embryonic development of C. cincta in laboratory. After been individualized in glass tubes, each larva was fed with S. cereallella and Diatraea saccharallis. It was evaluated the larvae duration, weight and viability in each instar, the duration, weight and viability of the pupa and pre-pupa stages and the duration of the post-embryonic period. It was adopted a completely randomized design with ten replications per treatment, each consisting of five eggs or larvae of C. cincta. Larvae were weighed 48 hours after hatching and 48 hours after each molt, and pre-pupae and pupae, 48 hours after starting these stages. There was no effect of the kind of food provided on the parameters evaluated. Therefore, D. saccharallis eggs can be used to feed C. cincta.Os crisopídeos são importantes predadores encontrados associados a diversos artrópodes-praga em diversos agroecossistemas. Para a criação massal desses predadores são utilizados tradicionalmente ovos de Sitotroga cerealella e de Anagasta kuehniella. Outros alimentos podem ser utilizados em substituição aos tradicionais, mas pouco se conhece sobre a biologia de crisopídeos e outros alimentos alternativos. Assim, este trabalho objetivou verificar o efeito de diferentes dietas sobre o desenvolvimento pós-embrionário dessa espécie em laboratório. Após a individualização em tubos de vidro, cada larva foi alimentada com ovos de S. cerealella e Diatraea saccharallis. Avaliou-se a duração, o peso e a viabilidade das larvas em cada ínstar, a duração o peso e viabilidade das fases de pré-pupa e pupa e a duração do período pós-embrionário. Adotou-se o delineamento inteiramente casualizado, com dez repetições por tratamento, cada uma constituída por cinco ovos ou larvas de C. cincta. As larvas foram pesadas 48 horas após a eclosão e 48 horas após cada ecdise, e as pré-pupas e pupas, 48 horas após iniciarem esses estágios Não houve interferência do tipo de alimento fornecido sobre os parâmetros avaliados. Desta forma, ovos de D. saccharallis podem ser utilizados para alimentação de C. cincta.

  11. Biological aspects of the immature stages of Ceraeochrysa everes (Banks (Neuroptera: Chrysopidae Aspectos biológicos dos estágios imaturos de Ceraeochrysa everes (Banks (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Leonardo Rodrigues Barbosa


    Full Text Available A knowledge of the behavior and biological aspects of natural enemies is extremely important for the establishment of biological control programs. Biological aspects of the larvae, pre-pupae and pupae of the predator Ceraeochrysa everes (Banks were studied. Larvae of the adult F1 generation were reared in the laboratory (25 ± 2°C, 65 ± 10 % RH and 14h photophase on eggs of the Angoumois grain moth Sitotroga cerealella (Olivier. The duration and viability of the embryonic period, development of the immature stages and egg-adult period were evaluated. The mean embryonic period was 5.0 days, while the mean durations of the first, second and third instars were: 5.1 ± 0.03; 4.3 ± 0.05 and 4.5 ± 0.05 days, respectively, with viability exceeding 90%. Duration of the larval, pre-pupal and pupal stages averaged 13.9 ± 0.07; 5.7 ± 0.07 and 9.6 ± 0.12 days, respectively. Duration of the biological cycle was 34 ± 0.11 days on average. S. cerealella eggs were not suitable for rearing C. everes under laboratory conditions because they affected predator development.Para o estabelecimento de um programa de controle biológico, o conhecimento de alguns aspectos biológicos e de comportamento dos inimigos naturais é de extrema importância. Os aspectos biológicos do desenvolvimento larval e pupal do predador Ceraeochrysa everes (Banks foram estudados. Larvas oriundas de adultos da geração F1 foram mantidas em laboratório a 25 ± 21°C, 70 ± 10 % UR e fotofase 14 horas, sendo alimentadas com ovos de Sitotroga cerealella (Olivier. A duração e viabilidade do período embrionário, estágios imaturos de desenvolvimento e o período de ovo a adulto foram avaliados. O período embrionário foi em média de 5,0 dias, enquanto que as durações médias para o primeiro, segundo e terceiro instares foram de 5,1 ± 0,03; 4,3 ± 0,05 e 4,5 ± 0,05 dias, respectivamente, com viabilidade superior a 90 %. Os estágios larval, pré-pupal e pupal apresentaram duração média de 13,9 ± 0,07; 5,7 ± 0,07 e 9,6 ± 0,12 dias, respectivamente. A duração do ciclo biológico foi de 34 ± 0,11 dias em média. Ovos de S. cerelella não foram adequados para a manutenção de C. everes em laboratório, por interferir no desenvolvimento do predador.

  12. Comparação econômica entre controle biológico e químico para o manejo de ácaro-vermelho em macieira Economic comparison of biological and chemical control in the management of red spider mites in apple orchard

    Directory of Open Access Journals (Sweden)

    Lino Bittencourt Monteiro


    Full Text Available O ácaro-vermelho da macieira, Panonychus ulmi (Acari: Tetranychidae, é uma importante praga na cultura da macieira em Fraiburgo - SC, e o controle biológico aplicado foi implantado em meados dos anos 90. O objetivo deste trabalho foi demonstrar os benefícios econômicos da utilização do controle biológico no manejo do ácaro-vermelho. A avaliação foi realizada em dois pomares comerciais de macieiras. Em um deles, foi implantado o controle biológico aplicado de ácaros, baseado na liberação do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae, seleção de inseticidas e manejo de ervas invasoras, e o outro pomar seguiu o manejo convencional de artrópodes, baseado na aplicação de produtos químicos para o controle de insetos, ácaros fitófagos e ervas invasoras. A análise econômica mostrou que os custos com mão-de-obra e máquinas foram semelhantes em ambos os pomares, entretanto os custos com acaricidas foram significativamente inferiores no pomar onde o manejo foi o controle biológico, demonstrando que, apesar da necessidade de investimentos em instalações para a criação do ácaro predador e custos de manutenção das mesmas, a estratégia biológica foi economicamente viável.Red spider mite, Panonychus ulmi (Acari: Tetranychidae is a significant pest in apple tree in Fraiburgo, Santa Catarina (SC and applied biological control was implemented in the mid-nineties. The objective of this study was to demonstrate the economic benefits of biological control in the management of red spider mite. The assessment was carried out in two commercial orchards, one of which was subjected to biological control of spider mite by releasing the predator Neoseiulus californicus, insecticide selection and weed management, and the other to conventional arthropod management, based on the application of chemicals to control insects, phytofagous mites and weed. Economic analysis showed that the costs for labor and machines were similar in both orchards; however acaricide costs were significantly lower in the orchard subjected to biological control, demonstrating that despite the need for investment in predator mite breeding apparatus and maintenance costs, the biological strategy was economically viable.

  13. Ecological aspects of a Cosmopolites sordidus (Germar (Coleoptera: Curculionidae population in São Miguel do Iguaçu, PR./ Aspectos ecológicos da população de Cosmopolites sordidus, (Germar (Coleoptera: Curculionidae em São Miguel do Iguaçu, PR

    Directory of Open Access Journals (Sweden)

    Cristiane Rohde


    Full Text Available The population dynamics of Cosmopolites sordidus (Germar was studied in banana crops (cultivar Nanicão at São Miguel do Iguaçu, PR, using roof-tile-like baits, between June/2003 and May/2004. Adults infected by entomopathogenic fungi were recorded, and predators were also found on the baits. A comparative bioassay was carried out between the Beauveria bassiana isolate obtained from the experiment area and from other regions in Brazil against C. sordidus adults. The population peaks of C. sordidus adults occurred in June and July, a period with mild temperatures and low precipitation. The population of C. sordidus larvae, however, was concentrated in December. The insect predators found in the area were insects of the following orders: Coleoptera (Carabidae, Dermaptera (Forficulidae, Hemiptera (Reduviidae, Hymenoptera (Formicidae, and spiders of the families Ctenidae, Clubionidae, and Lycosidae, with a population peak two months after the pest population peak. A low number of C. sordidus adults infected by B. bassiana was found, with an annual mean of 0.44%. In the laboratory, the B. bassiana isolates were pathogenic to the insects.Estudou-se a dinâmica populacional de Cosmopolites sordidus (Germar em cultivo de banana(cultivar Nanicão, em São Miguel do Iguaçu, PR, através de iscas do tipo telha, entre junho/2003 a maio/2004. Atribuiu-se conceito ao estado de conservação da isca, visando observar sua durabilidade e atratividade. Registraram-se adultos infectados por fungos entomopatogênicos, sendo também encontrados predadores nas iscas. Realizou-se um bioensaio com isolados de Beauveria bassiana da área experimental e de Centros de Pesquisa do Brasil, para avaliar a patogenicidade em C. sordidus. Verificou-se que os picos populacionais de adultos de C. sordidus ocorreram em junho e julho, período de temperaturas amenas e baixas precipitações, enquanto que as larvas foram mais abundantes em dezembro. Os insetos predadores encontrados na área pertenciam às ordens: Coleoptera (Carabidae, Dermaptera (Forficulidae, Hemiptera (Reduviidae, Hymenoptera (Formicidae e aranhas das famílias Ctenidae, Clubionidae e Lycosidae, com pico populacional dois meses após o pico da população da praga. O número de adultos de C. sordidus infectados por B. bassiana foi baixo, com média anual de 0,44%. Em laboratório, os isolados de B. bassiana mostraram-se patogênicos aos insetos.

  14. Influência de fragmentos de cerrado na distribuição de ácaros em seringal / Influence of cerrado fragments in the distribution of mites in rubber tree crop

    Scientific Electronic Library Online (English)

    Peterson R., Demite; Reinaldo J.F., Feres.


    Full Text Available Este estudo teve como objetivo verificar se fragmentos de cerrado influenciam na composição da acarofauna de seringais. Foram estabelecidos cinco transectos, distantes 50 m entre si, em duas áreas de cultivo no sul do Mato Grosso, sendo o primeiro na borda com o limite das áreas nativas e o último a [...] 200 m no interior do seringal. Em cada transecto foram marcadas cinco plantas, sendo coletadas sete folhas de cada planta. Durante um ano foram realizadas 25 coletas quantitativas em dois cultivos de seringueiras. O menor número de fitófagos foi registrado no transecto próximo da vegetação nativa e o maior no mais distante. A maior diversidade também foi observada no transecto mais próximo da vegetação nativa. Dez espécies de ácaros predadores também foram registradas nas áreas nativas vizinhas. Os dados sugerem o deslocamento dos ácaros predadores das áreas naturais para o monocultivo. Essas áreas naturais podem fornecer alimento alternativo e hábitat para inimigos naturais de fitófagos no período de escassez de alimento no seringal. A presença de áreas nativas próximo a áreas de cultivo deve ser considerada na elaboração de programas de manejo ecológico de pragas. Abstract in english The aim of this study was to verify whether fragments of cerrado influence the composition of the mite fauna on rubber trees. Five transects distant 50 m, being the first in the edge near the native areas and the last 200 m inside the crop, were established in each rubber tree crop in southern State [...] of Mato Grosso. In each transect five plants were chosen, and seven leaves were collected from each plant. During one year, 25 quantitative samplings were conducted in two rubber tree crops. The lowest number of phytophagous mites occurred in the transect closer to the native vegetation, and the highest number, in the most distant from the native vegetation. The largest diversity was also observed in the transect closer to the neighboring vegetation. Ten species of predatory mites were also registered in neighboring native areas. These data suggest the movement of predatory mites from the native areas to the monoculture. These natural areas can possibly supply alternative food and habitat for natural enemies of phytophagous mites in the period of food scarceness in the rubber tree crop. The presence of native areas close to culture areas should be taken into account in the elaboration of programs of ecological management of pests.

  15. Predação e remoção de sementes de cinco espécies de palmeiras por Guerlinguetus ingrami (Thomas, 1901 em um fragmento urbano de Floresta Atlântica Montana Predation and removal of seeds from five species of palms by Guerlinguetus ingrami (Thomas, 1901 in an urban fragment of the Montane Atlantic Forest

    Directory of Open Access Journals (Sweden)

    Luci Ferreira Ribeiro


    Full Text Available Em um fragmento urbano de Floresta Ombrófila Densa Montana no Estado do Espírito Santo (Sudeste do Brasil, foram avaliados o padrão de frugivoria e as proporções de remoção, predação e armazenamento de frutos por Guerlinguetus ingrami, em relação a cinco espécies de palmeira (Syagrus pseudococos, S. ruschiana, Bactris setosa, Polyandrococos caudescens e Euterpe edulis. As espécies de Arecaceae enquadram-se na síndrome associada à dispersão por G. ingrami, na qual as espécies de plantas apresentam alta produção, grandes frutos com poucas sementes envolvidas por endocarpos resistentes e que não são usadas por outros predadores de sementes arborícolas. Os resultados apontaram que existem diferenças no padrão de frugivoria da espécie G. ingrami quando comparadas com as de espécies com a mesma síndrome; aquelas que possuem frutos maiores apresentaram maior taxa de remoção e de armazenamento de seus diásporos. E, devido à especificidade exibida por G. ingrami na atividade de dispersão de sementes, este roedor deverá atuar apenas em trocas compensatórias específicas em pequenos fragmentos defaunados. Portanto, a seletividade de G. ingrami poderia indicar que o seu papel como dispersor em pequenos fragmentos estaria restrito em função da maior probabilidade de mortalidade associada às plantas preferencialmente dispersas por essa espécie, e sua atuação como predador de sementes deve ser quantificada para que os seus efeitos, em pequenos fragmentos, sejam mais bem compreendidos.This study investigated the fruvigory pattern of Guerlinguetus ingrami, considering the removal, predation and caching of the fruits of palm species (Syagrus pseudococos, S. ruschiana, Bactris setosa, Polyandrococos caudescens and Euterpe edulis in an urban forest fragment of the montane Atlantic forest in the state of Espírito Santo, Southeastern Brazil. These palm species show characteristics theoretically expected to be seen in plants dispersed by squirrels (trees with a high productivity and whose fruits are large, with few seeds covered by rigid endocarps and that are not utilized by other arborean seed predators. Here we describe differences in the frugivory pattern exhibited by G. ingrami towards plants with the same dispersal syndrome. The diaspores of species with larger fruits were removed and cached by the squirrel at rates higher than the palms with small fruits. As a result of the high specificity showed by the squirrel's activities related to seed dispersal, this rodent should be important in compensatory shifts only in small, defaunated forest fragments. Therefore, the selectivity of G. ingrami could indicate that its role as a seed dispersor into small forest fragments would be restricted, due to the grater likelihood of mortality associated to the plants scattered by this species. The role of G. ingrami as a seed predator must be quantified for the effects of its behavioral activities in small fragments to be understood.

  16. Análisis Comparativo de los Patrones de Modificaciones Óseas de Dos Carnívoros Sudamericanos: El Gato Montés (Leopardus Geoffroyi) y el Zorro Pampeano (Lycalopex Gymnocercus). Aportes para la Identificación de la Acción de Pequeños Carnívoros en el Registro Arqueológico / Comparative Analysis of Bone Modification Patterns Produced by Two South American Carnivores: The Geoffroy's Cat (Leopardus Geoffroyi) and the Pampas Fox (Lycalopex Gymnocercus). Contributions to the Identification of the Action of Small Carnivores in the Archaeological Record

    Scientific Electronic Library Online (English)

    Daniel J, Rafuse; Mariela E, González; Cristian A, Kaufmann; María C, Álvarez; María A, Gutiérrez; Agustina, Massigoge.

    Full Text Available El objetivo de este trabajo es caracterizar y comparar los patrones de modificaciones óseas producidos por dos carnívoros autóctonos de Sudamérica, el zorro pampeano y el gato montés, sobre partes esqueletarias de pequeños vertebrados. Para esto se realizó una experiencia en un parque zoológico loca [...] l, ofreciendo 10 conejos en forma controlada, a cada uno de los predadores mencionados. En esta oportunidad se presentan los resultados de los restos no ingeridos, para los cuales se analizó la representación anatómica y los patrones de fractura. Los resultados indican que tanto el gato montés como el zorro pampeano generan una destrucción ósea significativa en los restos de conejo, lo cual impacta directamente en la representación de los individuos. Los elementos con mayor supervivencia fueron los huesos largos, la pelvis, el cráneo y la mandíbula. Por otra parte, la densidad ósea resultó ser uno de los factores que condicionó la destrucción diferencial de los elementos. Si bien nuestros resultados no permiten diferenciar las modificaciones generadas por estas dos especies de carnívoros, los patrones observados aportan nuevos datos que ayudan a distinguir estos conjuntos de aquellos originados por otros predadores como por ejemplo, aves rapaces diurnas y nocturnas. Abstract in english The objective of this paper is to characterize and compare the bone modification patterns on small vertebrate skeletal parts produced by two native South American carnivores, the Pampas fox and the Geoffroy's cat. To accomplish this, an experimental study was conducted at a local zoo, where each pre [...] dator was routinely offered 10 domestic rabbits. The results of the non-ingested remains are presented, including the anatomical representation and the fracture patterns. The results indicate that both the Geoffroy's cat and the Pampas fox generate significant bone destruction on rabbit remains, which impacts directly on the representation of individuals. Elements with greater survival rates include the long bones, innominate, cranium and mandible. In addition, bone density was found to be a factor which determines the differential destruction of elements. While our results cannot distinguish the patterns generated by these two species of carnivorous, observed modifications provide new data to help distinguish these assemblages from those caused by other predators such as diurnal and nocturnal birds.

  17. Experimental assessment of the effects of a Neotropical nocturnal piscivore on juvenile native and invasive fishes

    Directory of Open Access Journals (Sweden)

    Alejandra F. G. N. Santos


    Full Text Available We experimentally examined the predator-prey relationships between juvenile spotted sorubim Pseudoplastystoma corruscans and young-of-the-year invasive and native fish species of the Paraná River basin, Brazil. Three invasive (peacock bass Cichla piquiti, Nile tilapia Oreochromis niloticus, and channel catfish Ictalurus punctatus and two native (yellowtail tetra Astyanax altiparanae and streaked prochilod Prochilodus lineatus fish species were offered as prey to P. corruscans in 300 L aquaria with three habitat complexity treatments (0%, 50% and 100% structure-covered. Prey survival was variable through time and among species (C. piquiti A relação predador-presa entre juvenis de pintado Pseudoplatystoma corruscans (piscívoro nativo e jovens do ano de espécies nativas e invasoras de peixes da bacia do rio Paraná, Brasil, foi testada experimentalmente. Três espécies de peixe invasoras (o tucunaré Cichla piquiti, a tilápia do Nilo Oreochromis niloticus e o bagre do canal Ictalurus punctatus e duas nativas (o lambari do rabo amarelo Astyanax altiparanae e o curimbatá Prochilodus lineatus foram oferecidas como presa para P. corruscans em microcosmos, com três tratamentos de complexidade de habitat (0%, 50% e 100% de cobertura por estruturas submersas. A sobrevivência de presas variou ao longo do tempo e entre espécies (C. piquiti < O. niloticus < A. altiparanae < P. lineatus < I. punctatus, sendo governada, em grande parte, por diferenças espécies-específicas no comportamento das presas, mas também pelo tamanho e defesas morfológicas das mesmas. A complexidade de habitat não afetou diretamente a piscivoria de P. corruscans, mas, na presença do predador, algumas espécies-presa alteraram seu comportamento quanto ao uso de micro-habitat e grau de agregação entre os níveis de complexidade de habitat. Pseudoplatystoma corruscans predou preferencialmente sobre os indivíduos menores das espécies invasoras que apresentaram estruturas morfológicas defensivas pouco desenvolvidas e que não formavam cardume. Em geral, os resultados obtidos contrastam com os de um experimento análogo, no qual foi usado um piscívoro diurno, sugerindo que piscívoros noturnos predam preferencialmente sobre espécies de peixes diferentes (de hábitos mais diurnos e que são menos afetados pela complexidade estrutural de habitats. Os resultados obtidos sugerem que a recuperação de populações nativas de P. corruscans poderia contribuir para o controle de algumas espécies de peixes introduzidas no rio Paraná, especialmente C. piquiti e O. niloticus, dos quais se espera que o cuidado parental seja reduzido ou nulo à noite.

  18. Analysis of propagule pressure and genetic diversity in the invasibility of a freshwater apex predator: the peacock bass (genus Cichla)

    Scientific Electronic Library Online (English)

    Daniel C., Carvalho; Denise A. A., Oliveira; Iracilda, Sampaio; Luciano B., Beheregaray.


    Full Text Available Uma importante etapa na biologia da invasão é acessar variáveis biológicas que podem predizer o sucesso de invasão. O estudo da genética, evolução e interações entre invasores e espécies nativas no ambiente invadido pode prover uma oportunidade única para o estudo dos processos em genética de popul [...] ações e a capacidade de uma espécie ampliar seu habitat. Nesse trabalho, nos utilizamos dados de marcadores de DNA microssatélites para testar se a variação genética é relacionada a pressão de propágulo na invasão bem sucedida do predador de topo (o ciclídeo Amazônico Cichla) nos rios do Sudeste Brasileiro. Populações invasoras de Cichla vem impactando negativamente diversas comunidades de água doce no Sudeste brasileiro deste 1960. A redução da variação genética foi observada em todas populações invasoras, tanto para Cichla kelberi (CK) como Cichla piquiti (CP). Por exemplo, a heterozigose foi menor no ambiente invadido quando comparada com as populações nativas da bacia Amazônica (CP HE = 0.179/0.44; CK HE = 0.258/0.536 respectivamente). Assim, apesar do sucesso da invasão de Cichla no sudoeste do Brasil, baixa diversidade genética foi observada nas populações introduzidas. Nós sugerimos que uma combinação de fatores, como as estratégias reprodutivas de Cichla, o efeito de "armadilha evolutiva" e a hipótese de resistências biótica superam o efeito que a diversidade genética depauperada exerce, sendo aspectos-chave na invasão desse predador de topo de cadeia. Abstract in english An important step in invasive biology is to assess biological variables that could be used to predict invasion success. The study of genetics, evolution, and interactions of invasive and native species in invaded ranges provides a unique opportunity to study processes in population genetics and the [...] capability of a species' range expansion. Here, we used information from microsatellite DNA markers to test if genetic variation relates to propagule pressure in the successful invasion of an apex predator (the Amazonian cichlid Cichla) into Southeastern Brazilian River systems. Invasive populations of Cichla have negatively impacted many freshwater communities in Southeastern Brazil since the 1960s. Reduction of genetic variation was observed in all invasive populations for both Cichla kelberi (CK) and Cichla piquiti (CP). For instance, heterozygosity was lower in the invasive range when compared to native populations from the Amazon basin (CP HE = 0.179/0.44; CK HE = 0.258/0.536 respectively). Therefore, despite the successful invasion of Cichla in southeast Brazil, low genetic diversity was observed in the introduced populations. We suggest that a combination of factors, such as Cichla's reproductive and feeding strategies, the "evolutionary trap" effect and the biotic resistance hypothesis, overcome their depauperete genetic diversity, being key aspects in this apex predator invasion.

  19. Silicon influence on the tritrophic interaction: wheat plants, the greenbug Schizaphis graminum (Rondani) (Hemiptera: Aphididae), and its natural enemies, Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Aphidius colemani viereck (Hymenoptera: Aphidiidae) / Influência do silício na interação tritrófica: plantas de trigo, pulgão-verde Schizaphis graminum (Rondani) (Hemiptera: Aphididae) e seus inimigos naturais Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Aphidius colemani viereck (Hymenoptera: Aphidiidae)

    Scientific Electronic Library Online (English)

    Jair C., Moraes; Marcio M., Goussain; Marco A.B., Basagli; Geraldo A., Carvalho; Carvalho C., Ecole; Marcus V., Sampaio.


    Full Text Available Estudou-se a interação tritrófica: trigo, pulgão-verde Schizaphis graminum (Rondani) e seus inimigos naturais-chave Chrysoperla externa (Hagen) e Aphidius colemani Viereck, em plantas com ou sem adubação de silício. Os tratamentos consistiram em: 1) aplicação de silício via foliar; 2) aplicação de s [...] ilício no solo e 3) testemunha (sem aplicação). As avaliações consistiram: a) teste de preferência do pulgão com chance de escolha em laboratório e b) aspectos biológicos das fases imaturas do predador C. externa, alimentado com pulgões criados em plantas dos diferentes tratamentos. Para a realização dos bioensaios com A. colemani foram realizados dois tratamentos: 1) aplicação de silício no solo e 2) testemunha (sem aplicação). As características biológicas avaliadas foram: duração da fase imatura, longevidade, razão sexual, ciclo total e porcentagem de parasitismo. Verificou-se que a aplicação de silício aumentou o grau de resistência das plantas de trigo diminuindo a preferência do pulgão-verde em relação à testemunha. Esse resultado pode estar relacionado à barreira mecânica proporcionada pela deposição de sílica na parede celular, o que dificultaria a penetração do estilete no tecido da planta, como também ao aumento na síntese de compostos de defesa da planta. Entretanto, não foi observado nenhum efeito indireto da aplicação de silício nas características biológicas tanto do predador como do parasitóide. Abstract in english We studied the tritrophic interaction: wheat, greenbug Schizaphis graminum (Rondani) and its key natural enemies, Chrysoperla externa (Hagen) and Aphidius colemani Viereck, in plants with or without silicon fertilization. Treatments consisted of: 1) silicon application via the leaves; 2) silicon app [...] lication in the soil 3) control (no application). The evaluations consisted of: a) free-choice aphid preference test in the laboratory, from the 35th day after plant emergence, and b) biological aspects of the immature stages of predator C. externa, feeding on aphids reared on plants from the different treatments. Two treatments were tried in the bioassays involving A. colemani: 1) silicon application in the soil, and 2) control (no application). The biological traits evaluated were: duration of the immature stage, longevity, sex ratio, total developmental time, and percentage parasitism. Silicon application increased the degree of resistance in wheat plants, decreasing greenbug preference in relation to the control. This result could be related to the mechanical barrier provided by silica deposition in the cell wall, which would make it difficult for the stylet to penetrate the plant tissue, as well as an increase in the synthesis of plant defense compounds. However, no indirect effect of silicon application was observed on the biological traits of either the predator or the parasitoid.

  20. Biological aspects of the immature stages of Ceraeochrysa everes (Banks) (Neuroptera: Chrysopidae) / Aspectos biológicos dos estágios imaturos de Ceraeochrysa everes (Banks) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Leonardo Rodrigues, Barbosa; Sérgio de, Freitas; Alexander Machado, Auad.


    Full Text Available Para o estabelecimento de um programa de controle biológico, o conhecimento de alguns aspectos biológicos e de comportamento dos inimigos naturais é de extrema importância. Os aspectos biológicos do desenvolvimento larval e pupal do predador Ceraeochrysa everes (Banks) foram estudados. Larvas oriund [...] as de adultos da geração F1 foram mantidas em laboratório a 25 ± 21°C, 70 ± 10 % UR e fotofase 14 horas, sendo alimentadas com ovos de Sitotroga cerealella (Olivier). A duração e viabilidade do período embrionário, estágios imaturos de desenvolvimento e o período de ovo a adulto foram avaliados. O período embrionário foi em média de 5,0 dias, enquanto que as durações médias para o primeiro, segundo e terceiro instares foram de 5,1 ± 0,03; 4,3 ± 0,05 e 4,5 ± 0,05 dias, respectivamente, com viabilidade superior a 90 %. Os estágios larval, pré-pupal e pupal apresentaram duração média de 13,9 ± 0,07; 5,7 ± 0,07 e 9,6 ± 0,12 dias, respectivamente. A duração do ciclo biológico foi de 34 ± 0,11 dias em média. Ovos de S. cerelella não foram adequados para a manutenção de C. everes em laboratório, por interferir no desenvolvimento do predador. Abstract in english A knowledge of the behavior and biological aspects of natural enemies is extremely important for the establishment of biological control programs. Biological aspects of the larvae, pre-pupae and pupae of the predator Ceraeochrysa everes (Banks) were studied. Larvae of the adult F1 generation were re [...] ared in the laboratory (25 ± 2°C, 65 ± 10 % RH and 14h photophase) on eggs of the Angoumois grain moth Sitotroga cerealella (Olivier). The duration and viability of the embryonic period, development of the immature stages and egg-adult period were evaluated. The mean embryonic period was 5.0 days, while the mean durations of the first, second and third instars were: 5.1 ± 0.03; 4.3 ± 0.05 and 4.5 ± 0.05 days, respectively, with viability exceeding 90%. Duration of the larval, pre-pupal and pupal stages averaged 13.9 ± 0.07; 5.7 ± 0.07 and 9.6 ± 0.12 days, respectively. Duration of the biological cycle was 34 ± 0.11 days on average. S. cerealella eggs were not suitable for rearing C. everes under laboratory conditions because they affected predator development.

  1. Variación espacio-temporal de la actividad del camarón dulceacuícola Macrobrachium jelskii (Miers, 1877) (Crustacea, Decapoda, Caridea, Palaemonidae) / Spatial and temporal variation in the activity of freshwater prawn Macrobrachium jelskii (Miers, 1877) (Crustacea, Decapoda, Caridea, Palaemonidae)

    Scientific Electronic Library Online (English)

    Verónica, Williner; Pablo, Collins.


    Full Text Available Los ecosistemas manifiestan diferentes ciclos influenciados por factores endógenos y exógenos. Los organismos que los componen presentan, acordes a esos cambios, periodicidades en sus actividades. El objetivo del estudio fue determinar el ritmo nictemeral del camarón Macrobrachium jelskii en una lag [...] unas del Parque Nacional Río Pilcomayo, Argentina, y su variación en una transecta perpendicular a la costa. Las capturas fueron realizadas con trampas cada cuatro horas durante tres días consecutivos. En la noche se registró mayor actividad en las zonas vegetadas, caracterizadas por la presencia de ejemplares adultos, principalmente machos. La actividad trófica resultó elevada durante el día en áreas vegetadas, pudiendo ser atribuida a la disponibilidad de abundantes recursos alimenticios. En zonas de transición entre aguas abiertas y vegetadas, los valores mínimos se presentaron durante el día. Contrariamente, en aguas libres de vegetación la actividad trófica fue menor durante la noche, respondiendo al ciclo de la oferta trófica y a la actividad desarrollada por algunos predadores potenciales. La actividad diaria en esta población mostró cierta elasticidad o ajuste de acuerdo a las características del medio, observándose variaciones relacionadas con la edad, el sexo y con la presencia o ausencia de vegetación (y con ésta la oferta de recursos tróficos y de refugio contra los predadores potenciales). Abstract in english Exogenous and endogenous factors model different kind of cycles in ecosystems. Organisms reveal the influence of these components upon their activities. The aim of this study was to examine the circadian rhythm of shrimp Macrobrachium jelskii in a pond at Río Pilcomayo National Park and their possib [...] le variation along a transect perpendicular to the coast. Samples were taken with traps every four hours during three days. The highest activity was recorded in the macrophyte zone, mainly by adult males. Feeding process was high during the night in the vegetated area, due to resource abundance. The minimum activity level was recorded in the transition between open and vegetated waters during daylight hours. In open water, feeding activity was almost passive during nighttime, as a response to the trophic cycle and to predator activity. The studied population showed some degree of adjustment to environmental conditions, and showed variations related to sex, age, and presence or absence of vegetation (which provides resources and shelter).

  2. Levantamento da entomofauna associada a cultivares de batata em duas épocas de cultivo

    Directory of Open Access Journals (Sweden)



    Full Text Available Foi feito um levantamento da população de artrópodes num agroecossistema de batata, Solanum tuberosum L., em Santa Maria, RS, durante o ano agrícola 1989/90. O objetivo desta pesquisa foi comparar a entomofauna em diferentes cultivares de batata durante a época tradicional do seu crescimento e na safrinha. O experimento consistiu de nove cultivares durante a época tradicional, e de dez cultivares durante a safrinha. Amostras de insetos foram coletadas semanalmente com a rede de varredura (15 redadas por amostra. Os coleópteros foram predominantes durante a época tradicional do crescimento da cultura, e os dípteros, na safrinha. As espécies fitófagas mais freqüentes foram: Epitrix sp., na época tradicional, e Diabrotica speciosa (Germar, na safrinha, seguidas da Empoasca kraemeri Ross & Moore, em ambos os períodos de crescimento dessa cultura. Foi coletado um número maior de insetos no período tradicional de crescimento da cultura do que na safrinha. Os insetos mostraram preferência pela cultivar Bintje durante o período tradicional, e pela Pomina, na safrinha. A cultivar Sahael foi a menos procurada, nos dois períodos. As espécies de predadores Eriopis connexa (Germar e Geocoris sp. foram as mais numerosas no período tradicional de crescimento da cultura. Durante a safrinha, a Cycloneda sanguinea (L. predominou em todas as cultivares.

  3. Predation on Alouatta guariba clamitans Cabrera (Primates, Atelidae by Leopardus pardalis (Linnaeus (Carnivora, Felidae Predação em Alouatta guariba clamitans Cabrera (Primates, Atelidae por Leopardus pordalis (Linnaeus (Carnivora, Felidae

    Directory of Open Access Journals (Sweden)

    João M. D. Miranda


    Full Text Available There are a few studies about predation on primates. Howler monkeys, being relatively large animals, were believed to be preyed on successfully only by medium to large-sized carnivores and large birds of prey. Our study took place at Chácara Payquerê, which is situated in the municipality of Balsa Nova, State of Paraná, Southern Brazil. Fingers and nails from Alouatta guariba clamitans Cabrera, 1940 were founded in two faecal samples from Leopardus pardalis (Linnaeus, 1758. With our documentation large howler monkey remains in faeces, the possibility of ocelot being a potential predator of all Neotropical primates should be taken into consideration.São poucos os estudos sobre a predação de primatas. Sendo os bugios animais relativamente grandes, acredita-se que somente médios e grandes carnívoros e grandes rapineiros possam lograr sucesso em sua predação. O estudo foi realizado na Chácara Payquerê, situada no município de Balsa Nova, Estado do Paraná, sul do Brasil. Dedos e unhas de Alouatta guariba clamitans Cabrera, 1940 foram encontradas em duas amostras fecais de Leopardus pardalis (Linnaeus, 1758 que foram coletadas. Com este registro de grande primata em fezes, a possibilidade de a jaguatirica ser um potencial predador de todos os primatas neotropicais pode ser levada em consideração.

  4. Registro da ocorrência de Cybocephalus sp. (Coleoptera: Nitidulidae) predando espécies-praga de diaspididae (Hemiptera), no estado de Alagoas / Record of Cybocephalus sp. (Coleoptera: Nitidulidae) preying on pest species of diaspididae (Hemiptera), in the state of Alagoas, Brazil

    Scientific Electronic Library Online (English)



    Full Text Available Espécimes de Cybocephalus sp. foram coletados predando colônias de Aspidiotus destructor (Signoret), que infestavam coqueiros da variedade Anão, e colônias de Diaspis echinocacti (Bouché) em Opuntia ficus-indica Mill. e Nopalea cochenillifera (L.) Lyons (Cactaceae) (palmas-forrageiras); neste último [...] caso, o nitidulídeo estava presente juntamente com outro predador: Coccidophilus citricola (Brèthes) Coleoptera: Coccinellidae). Os ovos eram postos no interior das carapaças do diaspidídeo já predadas (um ovo por carapaça), sendo que foram encontrados todos os estágios de desenvolvimento. Não foi detectado dimorfismo sexual. A razão sexual natural foi de 0,52, o que representa uma proporção sexual de 1,1 fêmeas : 1 macho. Espécimes de Cybocephalus sp. também foram coletados predando coccídeos em Alamanda cathartica L. (Apocynaceae) e em Morus alba L. (Moraceae). Abstract in english Specimens of Cybocephalus sp. were collected preying on Aspidiotus destructor (Signoret) infesting coconut trees (Dwarf cultivar) and on Diaspis echinocacti (Bouché) present on Opuntia ficus-indica Mill. and Nopalea cochenillifera (L.) Lyons (Cactaceae). In the later case the nitidulid was associate [...] d with another predator: Coccidophilus citricola (Brèthes) (Coleoptera: Coccinellidae). The eggs were laid inside the scale of the diaspidid (one egg per scale); all life stages were detected. No sexual dimorphism was observed, and the natural sex ratio was 0.52 which represents a sexual proportion of 1.1 females : 1 male. Cybocephalus specimens were also collected preying on coccids on Alamanda cathartica L. (Apocynaceae) and on Morus alba L. (Moraceae).

  5. Colonização de macroinvertebrados bentônicos em detritos foliares em um riacho de primeira ordem na Floresta Atlântica do nordeste brasileiro

    Directory of Open Access Journals (Sweden)

    Iris Gabrielly Arruda dos Santos


    Full Text Available O objetivo do estudo foi avaliar a colonização de macroinvertebrados bentônicos em detritos foliares de Inga ingoides (Leguminosae em experimentos de campo em um riacho de primeira ordem da Mata Atlântica do Estado de Pernambuco no nordeste do Brasil. Um total de 270 bolsas de folhiço, distribuídas em três trechos do riacho com características similares em relação à morfologia e parâmetros físicos e químicos da água foram submersas, entre fevereiro a julho de 2013 e retiradas após 7, 30, 60, 90 e 120 dias. Dois tratamentos foram utilizados: colonização e exclusão da macrofauna. O percentual de biomassa remanescente final (%R foi maior para bolsas de colonização do que para as de exclusão, evidenciando a efetiva participação dos macroinvertebrados no processo de decomposição. Os fragmentadores apresentaram menor participação no processo de decomposição foliar de I. ingoides, sendo Tripletides (Trichoptera: Leptoceridae, Polypedillum e Stenochironomus (Diptera, Chironomidae os táxons predominantes na macrofauna. Filtrador foi o grupo trófico funcional predominante (45,6%, seguido por predador (31,2%, coletor (11,8%, raspador (6,7% e fragmentador (4,8%.

  6. A Deinosuchus riograndensis (Eusuchia: Alligatoroidea) from Coahuila, North Mexico / Un Deinosuchus riograndensis (Eusuchia: Alligatoroidea) de Coahuila, norte de México

    Scientific Electronic Library Online (English)

    Héctor E., Rivera-Sylva; Eberhard, Frey; José Rubén, Guzmán-Gutierrez; Francisco, Palomino-Sánchez; Wolfgang, Stinnesbeck.


    Full Text Available Restos diagnósticos de Deinosuchus han sido descubiertos por primera vez en la Formación Aguja (Cretácico Tardío, Campaniano tardío) cerca del poblado de La Salada (Noroeste de Coahuila, México), y se describen aquí por primera vez. El material abarca seis dientes y material postcranial como dos ost [...] eodermos y una vértebra cervical y una caudal referidas aquí a D. riograndensis. La asociación con una variedad de dinosaurios herbívoros y tortugas trionychidas sugiere una interacción predador-presa, la cual es confirmada por la presencia de una vértebra con la mordida de un Deinosuchus. A la fecha, los restos de Deinosuchus de La Salada representan la ocurrencia más sureña del género. Abstract in english Diagnostic remains of Deinosuchus have been discovered in the Aguja Formation (Late Cretaceous, late Campanian) near the town of La Salada (northwestern Coahuila, Mexico) and are described here for the first time. The material comprises six teeth and tooth fragments that were found associated with p [...] ostcranial material such as two osteoderms and a cervical and caudal vertebra and is referred here to D. riograndensis. The association with a variety of herbivorous dinosaurs and trionychid turtles suggest a predator-prey interaction, which is confirmed by the occurrence of a vertebra with a Deinosuchus bite mark. The Deinosuchus remains from La Salada represent the southernmost occurrence of the genus known to date.

  7. Food categories reconstruction and feeding consumption estimates for the Sciaenid Macrodon ancylodon (Bloch & Schneider, and the congeneric fishes Stellifer rastrifer (Jordan and Stellifer naso (Jordan (Pisces, Perciformes in the Caeté Estuary, Northern Coast of Brazil

    Directory of Open Access Journals (Sweden)

    Mauricio Camargo


    Full Text Available A quantitative method to estimate fish feeding consumption and energy intake from different food categories through the reconstruction of ingested preys based on hard not digestible body structures is presented. In order to establish the equations of the functional relationships between preys weight and body structures, stomachs of 1.086 specimens of Macrodon ancylodon (Bloch & Schneider, 1801, Stellifer rastrifer (Jordan, 1889, and Stellifer naso (Jordan, 1889 fish species were dissected. Consequently, preys reconstruction enabled a quantitative evaluation of food categories consumption. Results indicate a marked difference in diet composition and energy requirements according to fish species ontogenetic development.Um método quantitativo para se estimar o consumo alimentar e o aporte energético das diferentes categorias alimentares é apresentado através da reconstrução das presas ingeridas com base em estruturas corporais não digeríveis. Para tal, o presente estudo estabelece, através do exame dos conteúdos estomacais de 1.086 exemplares dissecados de Macrodon ancylodon (Bloch & Schneider, 1801, Stellifer rastrifer (Jordan, 1889 e Stellifer naso (Jordan, 1889, as equações das relações funcionais entre o peso das presas e estruturas corporais. Com as categorias reconstruídas foi possível quantificar o alimento ingerido pelos espécimes. Os resultados indicaram que existe uma marcada diferença, tanto na composição das categorias alimentares, bem como no aporte energético acompanhando o desenvolvimento ontogênico do predador.

  8. Populations analysis of the Brazilian Sharpnose Shark Rhizoprionodon lalandii (Chondrichthyes: Carcharhinidae on the São Paulo coast, Southern Brazil: inferences from mt DNA sequences

    Directory of Open Access Journals (Sweden)

    Fernando Fernandes Mendonça


    Full Text Available Sharks of the genus Rhizoprionodon can be considered some of the most important predators along the trophic coastal marine ecosystems and represent an important economic resource for the small-scale fisheries, especially on the Brazilian coastline. In order to analyze the population structure of the shark Rhizoprionodon lalandii of São Paulo, Southeastern coast of Brazil, levels of genetic diversity were identified by nucleotide sequence analyses of the mitochondrial DNA control region. The results obtained from this study present moderate values of haplotype diversity and low nucleotide diversity. Although the AMOVA tests (?ST = 0.08394, P Tubarões do gênero Rhizoprionodon são considerados predadores de grande importância ao longo da cadeia trófica nos ecossistemas costeiros e marinhos, também representando um importante recurso econômico para a pesca, especialmente no litoral brasileiro. A fim de analisar a estrutura populacional do tubarão Rhizoprionodon lalandii no litoral de São Paulo, sudeste do Brasil, foram identificados os níveis de diversidade genética a partir da análise de sequências nucleotídicas da região controladora do DNA mitocondrial. Os dados obtidos neste estudo apresentam valores moderados de diversidade haplotípica e baixos índices de diversidade nucleotídica. Embora os testes de AMOVA (?ST = 0,08394, P < 0,01 tenham revelado uma pequena diferença entre as amostras estudadas, evidências sobre a ocorrência de estruturação populacional não foram encontradas o que pode representar uma característica geral para tubarões vivendo em áreas costeiras.

  9. Populations analysis of the Brazilian Sharpnose Shark Rhizoprionodon lalandii (Chondrichthyes: Carcharhinidae) on the São Paulo coast, Southern Brazil: inferences from mt DNA sequences

    Scientific Electronic Library Online (English)

    Fernando Fernandes, Mendonça; Claudio, Oliveira; Otto Bismarck Fazzano, Gadig; Fausto, Foresti.


    Full Text Available Tubarões do gênero Rhizoprionodon são considerados predadores de grande importância ao longo da cadeia trófica nos ecossistemas costeiros e marinhos, também representando um importante recurso econômico para a pesca, especialmente no litoral brasileiro. A fim de analisar a estrutura populacional do [...] tubarão Rhizoprionodon lalandii no litoral de São Paulo, sudeste do Brasil, foram identificados os níveis de diversidade genética a partir da análise de sequências nucleotídicas da região controladora do DNA mitocondrial. Os dados obtidos neste estudo apresentam valores moderados de diversidade haplotípica e baixos índices de diversidade nucleotídica. Embora os testes de AMOVA (?ST = 0,08394, P Abstract in english Sharks of the genus Rhizoprionodon can be considered some of the most important predators along the trophic coastal marine ecosystems and represent an important economic resource for the small-scale fisheries, especially on the Brazilian coastline. In order to analyze the population structure of the [...] shark Rhizoprionodon lalandii of São Paulo, Southeastern coast of Brazil, levels of genetic diversity were identified by nucleotide sequence analyses of the mitochondrial DNA control region. The results obtained from this study present moderate values of haplotype diversity and low nucleotide diversity. Although the AMOVA tests (?ST = 0.08394, P

  10. Natural history of interaction between Meteorus sp. Haliday, 1835 (Hymenoptera: Braconidae) and its hyperparasitoid Toxeumella albipes Girault, 1913 (Hymenoptera: Pteromalidae) / História natural da interação entre Meteorus sp. Haliday, 1835 (Hymenoptera: Braconidae) e seu hiperparasitoide Toxeumella albipes Girault, 1913 (Hymenoptera: Pteromalidae)

    Scientific Electronic Library Online (English)

    JF, Sobczak; DP, Maia; JCMS, Moura; VA, Costa; J, Vasconcellos-Neto.


    Full Text Available Alguns parasitoides constroem um agregado de casulos que fica pendurado no corpo do hospedeiro até a emergência dos adultos, o que é uma vantagem contra o ataque de predadores que vasculham a vegetação em busca de presas. No entanto, tal comportamento não é eficiente contra o ataque de hiperparasito [...] ides. Este estudo registra a interação entre a lagarta Manduca sexta Linnaeus, 1763 (Lepidoptera, Sphingidae) parasitada por larvas de Meteorus sp. (Hymenoptera, Braconidae), e seu hiperparasitoide Toxeumella albipes (Hymenoptera, Pteromalidae). Esta é a primeira descrição do ataque e da oviposição de T. albipes. Abstract in english Some parasitoids build a cocoon mass that hangs in the host body until the adults emergence, which is an advantage against attack by predators who troll the vegetation in search of prey. However, such behaviour is not effective against the hyperparasitoid attacks. This study reports the interaction [...] between the caterpillar Manduca sexta Linnaeus, 1763 (Lepidoptera, Sphingidae) parasitised by Meteorus sp. (Hymenoptera, Braconidae) larvae and its hyperparasitoid Toxeumella albipes (Hymenoptera, Pteromalidae). This is the first description of the attack and oviposition of T. albipes.

  11. Controle ótimo em agroecossistemas usando SDRE

    Scientific Electronic Library Online (English)

    A., Molter; M., Rafikov.


    Full Text Available O propósito deste trabalho é encontrar estratégias ótimas de controle de pragas no sistema biológico que apresenta comportamento não-linear. O controle, baseado no modelo de Lotka - Volterra de duas presas e um predador, é aplicado em um agroecossistema de plantação de soja. O objetivo desta estraté [...] gia de controle é manter a população de pragas abaixo de nível de danos econômicos. Este problema do controle ótimo é resolvido através do método das Equações de Riccati Dependentes do Estado (SDRE). Simulações numéricas para as estratégias do controle de pragas propostas, baseadas no modelo de Lotka-Volterra, foram realizadas para mostrar eficácia deste método. Abstract in english The purpose of this work is to choose optimal control strategies of the biological system which exhibits the nonlinear behavior. The control, based on two preys - one predator Lotka-Volterra model, is applied in soybean crop agroecosystems. The goal of this pest control strategy is to maintain the p [...] est population density at level below the economic injury level. This optimal control problem is solved by State Dependent Riccati Equation (SDRE) method. Numerical simulations for proposed strategies of biological pest control based on the Lotka-Volterra model are provided to show the effectiveness of this method.

  12. Faunistic survey of sandstone caves from Altinópolis region, São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Douglas Zeppelini Filho


    Full Text Available The fauna of eight sandstone caves of the region of Altinópolis, (Serra Geral Arenitic Speleological province, São Paulo State, Southeastern Brazil was surveyed. Our results improve the previous faunistic knowledge of the region, recording 15 new occurrences for Brazilian caves and 26 for Brazilian sandstone caves. The fauna is characterized by a large number of detritivores/omnivores such as crickets and cockroaches, and several predators like spiders and heteropterans in bat guano.A fauna de oito cavernas areníticas da região de Altinópolis (província espeleológica arenítica da Serra Geral, Estado de São Paulo, Sudeste do Brasil foi amostrada. Nossos resultados aumentaram o conhecimento faunístico prévio da região, com o registro de 15 novas ocorrências para cavernas brasileiras e 26 para cavernas brasileiras em arenito. A fauna é caracterizada por um grande número de detritívoros/carnívoros tais como grilos e baratas, diversos predadores tais como aranhas e heterópteros no guano de morcego.

  13. Communal egg laying by Gonatodes humeralis (Sauria, Gekkonidae in Manaus primary and secondary forest areas Desovas comunais de Gonatodes humeralis (Sauria, Gekkonidae em áreas de floresta primária e secundária de Manaus

    Directory of Open Access Journals (Sweden)

    Welton Yudi ODA


    Full Text Available Communal nesting has been registered for a number of lizard species at different sites. Here it is described communal egg laying of Gonatodes humeralis at different sites near and in human buildings in the period between 1990 and 1998. All these communal nests have been found in the dry season, between April and July, suggesting that the nests of are more common in this season, when the activity of their predators is less intense and the reduction of humidity diminish the decomposition action of the fungi that may kill the eggs.Desovas comunais tem sido registradas para inúmeras espécies de lagartos em diferentes regiões. Neste estudo, estão descritas desovas comunais de Gonatodes humeralis em diferentes localidades próximas, no interior de construções humanas no período entre 1990 e 1998. Todas estas desovas comunais foram encontradas na estação seca, entre abril e julho, sugerindo que estas desovas são mais comuns neste período, quando a atividade dos predadores é menos intensa e a redução da umidade diminui a ação decompositora dos fungos que pode matar os ovos.

  14. Genética de comunidades

    Directory of Open Access Journals (Sweden)

    M. Verdú


    Full Text Available Los estudios sobre los procesos responsables del ensamblaje de las especies en comunidades ecológicas tradicionalmente han considerado a las especies como unidades de estudio. Sin embargo, dentro de las especies existe gran cantidad de variación genotípica y fenotípica que puede finalmente ser decisiva en el resultado de las interacciones con el resto de especies en la comunidad (competencia, mutualismo, etc. Recientemente se ha propuesto una nueva regla de ensamblaje de las comunidades que sugiere que la composición genética de una población afecta a la estructura y composición de la comunidad (es decir alfenotipo de la comunidad. Apoyando esta regla, varios estudios han demostrado que los cambios en la diversidad genética de poblaciones de plantas conllevan cambios predecibles en sus comunidades asociadas de herbívoros y predadores. Más allá de la visión poblacional, la nueva genética de comunidades pretende demostrar 1 que el genotipo particular de ciertos individuos es responsable del fenotipo de la comunidad, 2 que el fenotipo de la comunidad es heredable, y por lo tanto 3 que las comunidades evolucionan. Tras explicar estos tres conceptos, se discute el valor que esta aproximación puede tener desde el punto de vista de la biología de la conservación.

  15. Feeding strategy of the night shark (Carcharhinus signatus) and scalloped hammerhead shark (Sphyrna lewini) near seamounts off northeastern Brazil

    Scientific Electronic Library Online (English)

    Teodoro, Vaske Júnior; Carolus Maria, Vooren; Rosangela Paula, Lessa.


    Full Text Available Um total de 425 estômagos de tubarão-toninha (Carcharhinus signatus) e 98 estômagos de tubarão-martelo-entalhado (Sphyrna lewini), oriundos da pesca de espinhel e pesca com rede de emalhe nas adjacências dos bancos oceânicos do nordeste do Brasil, foi analisado entre 1992 e 1999. Ambas as espécies p [...] redam sobre peixes bento-pelágicos e recifais, cefalópodes migradores, e crustáceos de águas profundas, apresentando nichos alimentares similares (Índice de Schoener T=0.75). A alta riqueza de presas nas dietas deve ser um reflexo de que as teias alimentares para estas espécies são consideravelmente longas nessa região. Devido à concentração alimentar de ambos predadores nos bancos oceânicos, a pescaria intensa deve ser monitorada para evitar depleções locais. Abstract in english A total of 425 stomachs of night shark (Carcharhinus signatus), and 98 stomachs of scalloped hammerhead shark (Sphyrna lewini), from longline and surface gillneters near seamounts off northeastern Brazil, were analysed between 1992 and 1999. Both predators prey upon reef and benthopelagic fishes, mi [...] grant cephalopods and deep water crustaceans, showing similar feeding niches (Schoener Index T=0.75). The great prey richness of the diets may reflect the fact that the marine food web for these species is very extensive in this region. Due to the concentration for feeding of both predators in the seamounts, intense fisheries should be monitored to avoid localised depletions.

  16. Natural enemies of Bemisia tabaci (Gennadius) B biotype and Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae) in Brasília, Brazil / Inimigos naturais de Bemisia tabaci (Gennadius) biotipo B e Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae) em Brasília, DF

    Scientific Electronic Library Online (English)

    Maria R.V. de, Oliveira; Everton, Amancio; Raúl A., Laumann; Liziane de O., Gomes.


    Full Text Available Uma investigação foi conduzida em Brasília, DF, de janeiro de 1999 até mar