
Sample records for predadores agistemus floridanus

  1. Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) (Acari) em resposta a diferentes tipos de alimento / Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) (Acari) in response the different kinds of food

    Scientific Electronic Library Online (English)

    Noeli Juarez, Ferla; Gilberto José de, Moraes.


    Full Text Available [...] Abstract in english Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including dif [...] ferent species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae), Euseius concordis (Chant, 1959) and Neoseiulus anonymus (Chant & Baker, 1965), both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921), Polyphagotarsonemus latus (Banks, 1904), Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950), and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day). Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

  2. Oviposição dos ácaros predadores Agistemus floridanus Gonzalez, Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker (Acari em resposta a diferentes tipos de alimento Oviposition of the predators Agistemus floridanus Gonzalez, Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker (Acari in response the different kinds of food

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla


    Full Text Available Phytoseiidae and Sigmaeidae are the most common predatory mites on rubber tree leaves in the State of Mato Grosso, associated with phytophagous mites of the families Eriophyidae, Tenuipalpidae and Tetranychidae. The aim of this work was to compare the effect of different kinds of food, including different species of mites commonly found on the rubber tree in Mato Grosso, and one kind of pollen, on the oviposition of the predators Agistemus floridanus Gonzalez, 1965 (Stigmaeidae, Euseius concordis (Chant, 1959 and Neoseiulus anonymus (Chant & Baker, 1965, both Phytoseiidae. Those predators are common on rubber tree leaves in Mato Grosso. For the tests with A. floridanus, discs of 2 cm in diameter of rubber tree leaves were used as substrate. Food provided to the predators were the mites Calacarus heveae Feres, 1992, Oligonychus gossypii (Zacher, 1921, Polyphagotarsonemus latus (Banks, 1904, Tenuipalpus heveae Baker, 1945 and Tetranychus mexicanus (McGregor, 1950, and pollen of Typha angustifolia L. Agistemus floridanus accepted a larger variety of foodthan other predators. This was the only predator with high oviposition rate when fed C. heveae and T. heveae, the phytophagous mites considered most important on rubber trees. Euseius concordis and A. floridanus had nearly the same oviposition rates when fed pollen of T. angustifolia (ca. one egg per female per day. Neoseiulus anonymus had the highest oviposition rate than other predators when fed O. gossypii and T. mexicanus. Polyphagotarsonemus latus was the least suitable food for the predators studied.

  3. Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae) / Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae)

    Scientific Electronic Library Online (English)

    Noeli Juarez, Ferla; Gilberto José de, Moraes.


    Full Text Available [...] Abstract in english The rubber tree (Hevea brasiliensis Muell. Arg.) (Euphorbiaceae) is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae) on rubber trees, associated with the mite Tenuipalpu [...] s heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm) is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

  4. Biologia de Agistemus floridanus Gonzalez (Acari, Stigmaeidae Biology of Agistemus floridanus Gonzalez (Acari, Stigmaeidae

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla


    Full Text Available The rubber tree (Hevea brasiliensis Muell. Arg. (Euphorbiaceae is attacked by various species of phytophagous mites in Brazil. Studies conducted in the State of Mato Grosso showed the presence of Agistemus floridanus Gonzalez, 1965 (Stigmaeidae on rubber trees, associated with the mite Tenuipalpus heveae Baker, 1945. The aim of this work was to study the biology of that predator in the laboratory, when fed with T. heveae as prey. The study was started with 22 eggs, which resulted in 15 females reaching adult hood. To determine the effect of mating on oviposition, 30 females were used; half of those were maintained isolated and the remaining were maintained then with males during the whole adult stage. The stage of egg was the longest, with a duration of more than 4.0 days. The total duration of the immature phase was 10.2 days. Each female oviposited an average of 38.4 eggs, with a daily oviposition rate of 2.3 eggs per female. The duration of each adult phase, the daily oviposition rate and the longevity were different between the mated females and non-mated females. All eggs produced by non-mated originated males, characterizing, in this way, the development through arrhenothokous parthenogenesis. The results showed that A. floridanus has an innate increase capacity of 13.2 times in each generation, that the average duration of one generation is 19.2 days, that the intrinsic rate of increase (rm is about 0.16 female per female per day and that the number of females added daily to the population is 1.1.

  5. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) / Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira; Mário Eidi, Sato.


    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes) em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV). Apesar do grande volume de infor [...] mações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae), em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC), os produtos foram classificados como: classe 1 - inócuo (E99%), calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes) on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV). Despite the considerable amount of informatio [...] n on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) in laboratory conditions. Citrus leaf ("Pera" cultivar) arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC), the pesticides were classified as: class 1 - harmless (E99%), lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  6. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in citrus orchards on the predaceous mite Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae in laboratory conditions. Citrus leaf ("Pera" cultivar arenas with 25 adult females of A. brasiliensis were sprayed in a Potter tower. The mortality of mites was assessed 72 hours after treatment. The effect of pesticides on the reproduction of mite and egg viability was also evaluated. According to the proposal of the Working Group of "International Organization for Biological Control" (IOBC, the pesticides were classified as: class 1 - harmless (E99%, lime sulfur, cyhexatin, flufenoxuron, hexythiazox, fenbutatin oxide, propargite, pyridaben and spirodiclofen. Studies in the field conditions are still necessary for a better understanding of the effect of these chemicals on the predaceous mite.

  7. Biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) e sua potencialidade de predação sobre Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) / Biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae) and its predation potential on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae)

    Scientific Electronic Library Online (English)

    André L., Matioli; Carlos A.L. de, Oliveira.


    Full Text Available O presente trabalho objetivou estudar a biologia de Agistemus brasiliensis Matioli, Ueckermann & Oliveira nas temperaturas de 15; 20; 25; 30 e 35°C, alimentada com Brevipalpus phoenicis (Geijskes) e pólen de Thypha sp. em condições de laboratório. Tabelas de vida de fertilidade foram calculadas para [...] determinar os parâmetros biológicos. A temperatura ideal para o desenvolvimento de A. brasiliensis foi 29°C. Os valores de T (ciclo de vida - dias), R0 e r m, na temperatura de 30°C, foram de 13,95; 16,25 e 0,20, respectivamente. A potencialidade de predação de A. brasiliensis foi estudada para as densidades populacionais de 5; 10; 20; 40 e 60 adultos de B. phoenicis a 29°C, em arenas de 3 cm de diâmetro, sobre frutos de laranja-pêra. A densidade de 20 ácaros foi suficiente para que o predador consumisse seu número máximo de presas (7,6 ácaros por dia). Densidades acima de 40 ácaros da leprose proporcionaram 4,7 ovos por dia, em comparação aos 2,5 ovos por dia obtidos na densidade de 20 ácaros da leprose. Abstract in english The present work aimed to study the biology of Agistemus brasiliensis Matioli, Ueckermann & Oliveira at the following temperatures, namely 15, 20, 25, 30 and 35°C, fed with Brevipalpus phoenicis (Geijskes) and Typha pollen, in laboratory conditions. Life tables were calculated to evaluate the biolog [...] ical parameters. The optimal development of A. brasiliensis took place at 29°C. The values of T (time of generation - days), R0 and r m at 30°C were, 13.95, 16.25 and 0.20, respectively. The prey consumption of A. brasiliensis was studied at the densities of 5, 10, 20, 40 and 60 leprosis mite females per cage (3 cm in diameter) on citrus fruits at 29°C. The maximum prey, namely 7.6 B. phoenicis females per day, were consumed at a density of 20 leprosis mites. At densities of above 40 leprosis mites per cage, A. brasiliensis oviposits 4.7 eggs per day, in comparison to 2.5 eggs per day at 20 mites per cage.

  8. Associação e densidade populacional de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou na ausência de ácaros fitófagos / Association and populational density of mites predators in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without the presence of phytophagous mites

    Scientific Electronic Library Online (English)

    Alfredo de, Gouvea; Carla Felicita, Zanella; Sergio Miguel, Mazaro; Joel, Donazzolo; Luis Francisco Angeli, Alves.


    Full Text Available O objetivo deste trabalho foi avaliar a associação e a concentração de ácaros predadores em plantas de erva-mate Ilex paraguariensis St. Hil. (Aqüifoliaceae) na presença ou não de ácaros fitófagos. O trabalho foi realizado em plantação comercial em Dois Vizinhos, PR, de agosto de 2001 a julho de 200 [...] 2. Procederam-se coletas mensais de folhas de diferentes partes da planta. A contagem dos ácaros nas folhas foi realizada em laboratório com auxílio de microscópio estereoscópico. Foram constadas duas espécies de ácaros fitófagos, Dichopelmus notus Keifer e Oligonychus yothersi (McGregor), e três espécies de predadores, Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp., associadas às plantas de erva-mate. Foi observada associação de E. concordis e I. zuluagai a folhas com presença de D. notus e de Agistemus sp. a plantas com presença de D. notus e maior densidade populacional de E. concordis e de I. zuluagai em plantas com D. notus. Abstract in english This research was aimed at evaluating the association and concentration of predators mites in the mate-tea tree Ilex paraguariensis St. Hil. (Aqüifoliaceae) with or without phytophagous mites. This study was conduced at Dois Vizinhos, State of Paraná, from August 2001 to July 2002, in a mate-tea tre [...] e commercial plantation. Leaf samples from different parts of the plant were taken monthly, and the number of mites was counted in laboratory. Two species of phytophagous mites, Dichopelmus notus Keifer and Oligonychus yothersi (McGregor), and three species of predator mites Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. The association of E. concordis and I. zuluagai to the leaves with D. notus, the association of Agistemus sp. to the plants with D. notus and a higher population density of E. concordis and I. zuluagai in plant with D. notus were observed.

  9. Genetic similarity among Agistemus pallinii Matioli et al (Acari: Stigmaeidae) found in citrus orchards in Vicosa, Minas Gerais state, Brazil

    International Nuclear Information System (INIS)

    Stigmaeidae are very important predators of mite and insect pests on several crops in Brazil. It is considered the second most important family of predatory mites in citrus orchards in Brazil. However, their identification, especially that of the members of the genus Agistemus, is rather difficult based only on morphology. Hence, this study describes the use of random amplified polymorphic DNA (RAPD-PCR) markers to determine the genetic similarity of an Agistemus pallinii Matioli et al population found in 2004 in a citrus orchard in Vicosa, Minas Gerais State, Brazil, preying on Panonychus citri (McGregor). Amplifications were performed with 12 random primers (OPAA8, OPAA19, OPAB1, OPAB5, OPAB18, OPAC9, OPAC17, OPAC19, OPAD10, OPAE9, OPAE12 and OPAE17), which generated 119 bands, with 53.8% polymorphism. The coefficients of genetic similarity among the individuals ranged from 0.68 to 0.99, indicating a high genetic similarity among them. The 3D projection analysis clustered the majority of individuals confirming their high similarity. Though individuals of A. pallinii are minute (± 360 ?m long), the PCR-RAPD technique can still be used for their identification, complementing morphological analyses or for comparison of populations collected in different geographic regions. This is the fi rst molecular study carried out with stigmaeid mites. (author)

  10. Seletividade de oito inseticidas a predadores de lagartas em citros

    Directory of Open Access Journals (Sweden)

    Galvan Tederson Luiz


    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille, Protonectarina sylveirae (Saussure e Protopolybia exigua (Saussure (Hymenoptera: Vespidae em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom.

  11. Agistemus aimogastaensis sp. n. (Acari, Actinedida, Stigmaeidae), a recently discovered predator of eriophyid mites Aceria oleae and Oxycenus maxwelli, in olive orchards in Argentina


    Leiva, Sergio; Fernandez, Nestor; Theron, Pieter; Rollard, Christine


    A new species, Agistemus aimogastaensis, is described with the aid of optical and Scanning Electron Microscopy. This mite is an important predator of two eriophyid mites (Aceria oleae and Oxycenus maxwelli) in olive orchards (Olea europaea, variety Arauco) in La Rioja Province. The problems related to eriophyids in olive orchards in Argentina are highlighted and photos of the damage on leaves and fruit are included.

  12. Interspecific interactions involving Neoseiulus californicus (Acari: Phytoseiidae) and Agistemus brasiliensis (Acari: Stigmaeidae) as predators of Brevipalpus phoenicis (Acari: Tenuipalpidae). (United States)

    da Silva, Marcos Zatti; Sato, Mário Eidi; de Oliveira, Carlos Amadeu Leite; Nicastro, Roberto Lomba


    Brevipalpus phoenicis (Geijskes) is associated with the transmission of Citrus leprosis which is considered the main viral disease for the Brazilian citrus production. Mites of the families Stigmaeidae and Phytoseiidae coexist in various agricultural crops, often promoting the biological control of pest mites. The aim of this work was to study the interactions of Neoseiulus californicus (McGregor) (Phytoseiidae) and Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Stigmaeidae), in the presence or absence of B. phoenicis. Two experiments were carried out. In the first, a N. californicus female was placed in each leaf disc arena, with eggs of B. phoenicis and A. brasiliensis as food sources. In the second, an A. brasiliensis female was placed in each arena, with eggs of B. phoenicis and N. californicus as food sources. Adults of both predators were able to consume both types of eggs available as food sources, but they fed on considerably higher proportions of B. phoenicis than on eggs of the predator. Eggs of A. brasiliensis were not a suitable food source for N. californicus, which produced only 0.1 egg per female per day when only eggs of that species were present in the experimental unit. The results suggest that eggs of N. californicus were a suitable food source for A. brasiliensis, which oviposited 1.12 eggs per day, when only eggs of N. californicus were provided to the stigmaeid mite. The possible interactions among N. californicus, A. brasiliensis and B. phoenicis in citrus orchards are discussed. PMID:25524512

  13. Densità di Lepre (Lepus europaeus) e Silvilago (Sylvilagus floridanus) in ambienti planiziali


    Sandro Bertolino; Perrone, A.; Laura Gola


    Il silvilago (Sylvilagus floridanus) è un leporide d?origine nordamericana, introdotto in Italia a partire dal 1966 a scopo venatorio. Attualmente la specie è diffusa soprattutto in Piemonte e nella parte occidentale della Lombardia. Il silvilago potrebbe interferire con l?autoctona lepre comune (Lepus europaeus), anche se i dati al riguardo sono limitati. Nell?autunno-inverno 2002-2003 abbiamo condotto dei censimenti notturni con faro in alcune are...

  14. Predadores asociados a panonychus citri mcgregor (acari: tetranychidae en la costa central del Perú

    Directory of Open Access Journals (Sweden)

    Alberto Daniel Guanilo


    Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor, Typhlodromus (Anthoseius evectus (Schuster, Typhlodromus (Anthoseius transvaalensis (Nesbitt, Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A. evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados

  15. Discovery and validation of gene-linked diagnostic SNP markers for assessing hybridization between Largemouth bass (Micropterus salmoides) and Florida bass (M. floridanus). (United States)

    Li, Chao; Gowan, Spencer; Anil, Ammu; Beck, Benjamin H; Thongda, Wilawan; Kucuktas, Huseyin; Kaltenboeck, Ludmilla; Peatman, Eric


    Efforts to improve recreational fisheries have included widespread stocking of Micropterus floridanus outside its native range of peninsular Florida. Hybridization of Florida bass (M. floridanus) with largemouth bass (Micropterus salmoides) has now dramatically expanded beyond a naturally occurring intergrade zone in the southeast U.S. In recent years, there has been growing interest in protecting the genetic integrity of native basses and assessing the impact and nature of M. salmoides/M. floridanus introgression from the standpoint of hatchery and sport-fishery managers, fish biologists, ecologists and evolutionary biologists. Here, we conducted RNA-seq-based sequencing of the transcriptomes of M. salmoides, M. floridanus and their F1 hybrid and identified a set of 3674 SNP markers with fixed-allelic differences from 2112 unique genes. We then developed a subset of 25 of these markers into a single diagnostic multiplex assay and validated its capacity for assessing integrity and hybridization in hatchery and wild populations of largemouth and Florida bass. The availability of this resource, high-quality transcriptomes and a large set of gene-linked SNPs, should greatly facilitate functional and population genomics studies in these key species and allow the identification of traits and processes under selection during introgressive hybridization. PMID:25047482

  16. Evaluation of the eastern cottontail Sylvilagus floridanus as an amplifying vertebrate host for Cache Valley virus (Bunyaviridae) in Indiana. (United States)

    Blackmore, Carina G M; Grimstad, Paul R


    To evaluate the importance of eastern cottontails (Sylvilagus floridanus) as amplifying hosts for Cache Valley virus (CVV), we tested hunter-provided blood samples from northern Indiana for specific neutralizing (N) antibodies against this mosquito-borne bunya-virus. Samples were collected during the winter of 1994-95. Two seronegative eastern cottontails, captured in July 1995, were also infected with CVV by subcutaneous inoculation, and two others were infected by allowing CVV-infected mosquitoes to feed on them. The results indicate that eastern cottontails probably are not important amplifying hosts for CVV. The prevalence of N antibodies against CVV was low (6.0%, n=82) among the hunter-killed animals. Low viremia (CVV. PMID:18263839

  17. Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

    DEFF Research Database (Denmark)

    Bonasio, Roberto; Li, Qiye


    Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferases and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator.

  18. Caracterización del comportamiento y las señales vibratorias en Euthyrhynchus floridanus (Hemiptera: Pentatomidae) durante el cortejo y la cópula / Characterization of the behavioral and vibrational signals in Euthyrhynchus floridanus (Hemiptera: Pentatomidae) during courtship and copulation

    Scientific Electronic Library Online (English)

    R. Daniel, Briceño.


    Full Text Available Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) es una especie neotropical perteneciente a la familia Pentatomidae con más de 4 000 especies descritas, y se distribuye desde la Florida hasta Brasil. Este estudio describe el comportamiento sexual y reporta por primera vez la producción [...] de vibraciones de sustrato por machos y hembras durante el comportamiento precopulatorio y la cópula. Se grabó tanto el comportamiento de cortejo y de cópula como las diversas señales producidas utilizando un cartucho fonográfico, conectado a una cámara de video. Posteriormente se reprodujo las vibraciones de las hembras en ausencia de estas y se registró las respuestas de los machos. Se distinguieron al menos tres vibraciones de sustrato distintas para los machos y una para las hembras, y se caracterizaron por ser señales de baja frecuencia que van desde los 127 hasta 180Hz. Las sonidos de los machos en E. floridianus fueron significativamente diferentes en la frecuencia, duración y número de pulsos tanto en el cortejo como en la cópula para los sonidos de ronroneo y tamborileo. La producción de sonidos en esta especie se asoció principalmente con comportamientos estimulatorios- mecánicos durante el cortejo y copula. Patrones de comportamiento y su relación con las vibraciones del sustrato sugiere que estas señales pueden ser importantes para los machos en el contexto de la localización de su compañera y la selección sexual. Abstract in english Euthyrhynchus floridanus (Linnaeus) (Hemiptera: Pentatomidae) is a neotropical species belonging to the family Pentatomidae with over 4 000 species described, and is distributed from Florida to Brazil. This study describes the sexual behavior and reported for the first time the production of substra [...] te vibrations by males and females during copulatory behavior and mating. Courtship and copulatory behavior, as well as the diverse signals, were recorded with a phonographic cartridge connected to a video camera. Female vibrations were reproduced in the absence of females and the responses by males were recorded. At least three types of substrate vibrations were distinguished in males and one in females, and these signals were characterized by their low frequency, varying from 127 to 180Hz. The sounds of E. floridianus males were significantly different in frequency, duration and number of pulses, both in courtship and in copulation, for the purring and drumming sounds. The production of sounds in this species is associated principally with mechanical, stimulatory behavior during courtship and copulation. Patterns of behavior and their relation to substrate vibrations suggest that these signals are important for the males in the context of mate location and sexual selection.

  19. Biologia Do Àcaro Predador Amblyseius Herbicolus Alimentado por Pólen e Pela Presa Tetranychus Urticae

    Directory of Open Access Journals (Sweden)

    Hamilton Oliveira


    (Acari: Tetranychidae. Por ser T. urticae a principal praga da cultura do morangueiro, existe uma busca constante de novas espécies com potencial de agente de controle biológico contra esse fitófago. Desse modo, o objetivo desse trabalho foi avaliar a biologia do ácaro predador A. herbicolus quando alimentado por dietas compostas por pólen de mamona, por T. urticae e pela associação de pólen de mamona e T. urticae. Essas dietas constituíram os tratamentos do experimento que foi conduzido sob condições controladas (T = 25±2ºC, UR = 65±10% e Fotoperíodo de 13h sobre arenas confeccionadas com folhas de morangueiro (Ø = 2.5 cm. Os resultados demonstram que a fase juvenil do ácaro predador A. herbicolus se completa apenas quando o mesmo foi alimentado por pólen e por pólen e T. urticae. A maior longevidade do predador foi observada quando o mesmo foi alimentado pela dieta composta apenas por pólen, porém maior taxa de oviposição foi observada quando A. herbicolus foi alimentado pela associação das dietas de pólen e T. urticae. Os dados obtidos demonstram que o ácaro predador A. herbicolus atinge a fase adulta somente quando alimentado por dietas contendo pólen. Porém, na fase adulta, A. herbicolus necessita se alimentar de dietas à base de T. urticae para obter maior energia e assim, conseqüentemente apresentar maior potencial reprodutivo.

  20. Effects of hatchery rearing on Florida largemouth bass Micropterus floridanus resource allocation and performance under semi-natural conditions. (United States)

    Garlock, T M; Monk, C T; Lorenzen, K; Matthews, M D; St Mary, C M


    This study examined the growth, activity, metabolism and post-release survival of three groups of Florida largemouth bass Micropterus floridanus: wild-caught fish, hatchery fish reared according to standard practice (hatchery standard) and hatchery fish reared under reduced and unpredictable food provisioning (hatchery manipulated). Hatchery-standard fish differed from wild-caught fish in all measured variables, including survival in semi-natural ponds. Hatchery-standard and hatchery-manipulated fish showed higher activity levels, faster growth and lower standard metabolic rates than wild-caught fish in the hatchery. Fish reared under the manipulated feeding regime showed increased metabolic rates and increased post-release growth, similar to wild-caught fish. Their activity levels and post-release survival, however, remained similar to those of hatchery-standard fish. Activity was negatively correlated with post-release survival and failure of the feed manipulation to reduce activity may have contributed to its failure to improve post-release survival. Activity and post-release survival may be influenced by characteristics of the rearing environment other than the feeding regime, such as stock density or water flow rates. PMID:25257181

  1. Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids


    Marcos Rafael Gusmão; Marcelo Picanço; Germano L.D. Leite; Marcelo F. Moura


    Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomenda...

  2. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae)


    Silveira Luís Cláudio Paterno; Bueno Vanda Helena Paes; Pierre Leonardo Santa Rosa; Mendes Simome Martins


    O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), ...

  3. Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação


    Campos Artur Kanadani; Mota Marcelo de Andrade; Araújo Jackson Victor; Cecon Paulo Roberto


    Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos...

  4. Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa

    Directory of Open Access Journals (Sweden)



    Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA, em Lavras, MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel f. maculata, Acyrthosiphon pisum (Harris, A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC.


    Directory of Open Access Journals (Sweden)



    Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies

  6. Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação

    Directory of Open Access Journals (Sweden)

    Campos Artur Kanadani


    Full Text Available Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol, na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum. A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p<0,05, quando comparado ao apresentado pelos fungos congelados com DMSO 10 % ou água. A produção de esporos foi maior (p< 0,05 no fungo M. appendiculatum preservado a 4masculineC em geladeira.

  7. Local feeding specialization of the red fox (Vulpes vulpes in response to eastern cottontail (Sylvilagus floridanus introduction (NW Italy

    Directory of Open Access Journals (Sweden)

    Alessandro Balestrieri


    Full Text Available Abstract To appreciate the influence of the introduction of the Eastern cottontail (Sylvilagus floridanus on the food habits of the red fox (Vulpes vulpes, between June 1998 and February 2000 fox diet was investigated by means of scat analysis (N=115 in a 250 ha wide Natural Reserve of NW Italy, and compared with data collected in the same area prior to cottontail colonization (1988-1989. Comparison included also the diet of badgers (Meles meles, considered as potential competitors for food resources. Alien lagomorphs (mean percent volume, Vm% = 68% represented by far the most exploited resource, only three other food items reaching values of mean percent volume barely higher than 5%. Cottontails frequency of occurrence did not vary according either to season or to their reproductive cycle (II-IX vs. X-I, whilst diet niche breadth varied inversely proportional to the use of this key-resource. Overall fox trophic niche breadth varied from 0.64 in 1988-89 to 0.31 in 1998-00 (B, Levin’s index. These findings led us to consider the feeding habits of the fox in the study area as a result of local specialization of a typical generalist carnivore, according to the predictions of optimal foraging theory. No variation occurred in the badger niche breadth since cottontail introduction, whilst niche overlap between foxes and badgers decreased from 0.59 to 0.13 (O, Pianka’s index, possibly reducing competition for food in summer. Riassunto Specializzazione alimentare a livello locale della Volpe Vulpes vulpes in risposta all’introduzione del Silvilago Sylvilagus floridanus (Italia nord occidentale. Per valutare gli effetti dell’introduzione del Silvilago (Sylvilagus floridanus sul comportamento alimentare della volpe (Vulpes vulpes, nel periodo giugno 1998-febbraio 2000, la dieta del carnivoro è stata definita tramite l’analisi di 115 feci raccolte nella Riserva Naturale “Garzaia di Valenza” (Provincia di Alessandria, Italia nord occidentale di circa 250 ha. I risultati ottenuti sono stati confrontati con quelli conseguiti nella medesima area prima dell’introduzione del Silvilago, oltre che con quelli disponibili sulla dieta del Tasso (Meles meles, che può essere ritenuto un potenziale competitore per le risorse alimentari. I lagomorfi sono risultati la categoria alimentare maggiormente consumata (volume medio percentuale, Vm% = 68%, mentre solo tre altre categorie hanno raggiunto valori di Vm di poco superiori al 5%. Non sono emerse variazioni stagionali o relative al periodo riproduttivo (febbraio-settembre vs. ottobre-gennaio del Silvilago, anche se l’ampiezza di nicchia complessiva è risultata inversamente proporzionale al consumo di lagomorfi. L’ampiezza di nicchia della Volpe è scesa da 0,64 nel 1988-89 a 0,31 nel 1998-00. Nel complesso, la dieta della Volpe nell’area di studio può essere considerata l’espressione di una specializzazione a livello locale, così come previsto dalla teoria del foraggiamento ottimale. Non è emersa alcuna variazione per l’ampiezza di nicchia del Tasso, mentre il grado di sovrapposizione (indice di Pianka tra il mustelide e la Volpe è nettamente diminuito (da 0,59 a 0,13. In questi termini la specializzazione della Volpe potrebbe rendere minima la competizione alimentare con il Tasso, in particolar modo in estate, quando la siccità limita la disponibilità di lombrichi.

  8. Seletividade de oito inseticidas a predadores de lagartas em citros / Selectivity of eight insecticides to predators of citrus caterpillars

    Scientific Electronic Library Online (English)

    Tederson Luiz, Galvan; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; André Luiz Barreto, Crespo.


    Full Text Available O objetivo deste trabalho foi avaliar a seletividade dos inseticidas abamectina, acefato, carbaril, deltametrina, fenitrotiom, fenpropatrina, paratiom metílico e triclorfom aos predadores Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) e Protopolybia exigua (Saussure) (Hymen [...] optera: Vespidae) em concentrações que corresponderam a 50% e 100% da dose recomendada para o controle de lagartas em citros. Os inseticidas estudados não foram seletivos em favor do predador P. sylveirae. Fenitrotiom, fenpropatrina, paratiom metílico e triclorfom não foram seletivos em favor dos predadores B. lecheguana e P. exigua. Abamectina, acefato e carbaril foram medianamente seletivos em favor de P. exigua, o mesmo foi verificado com abamectina e carbaril em favor de B. lecheguana. Acefato foi seletivo em favor de B. lecheguana e deltametrina em favor de P. exigua. As altas mortalidades causadas por deltametrina a P. sylveirae, triclorfom a B. lecheguana e acefato a P. exigua decresceram quando aplicados em subdose. B. lecheguana foi o predador mais tolerante à dose de acefato, seguido por P. exigua e P. sylveirae. O predador P. exigua foi mais tolerante à dose de deltametrina que B. lecheguana e P. sylveirae. As três espécies de predadores foram altamente suscetíveis às doses e subdoses de fenitrotiom, fenpropatrina e paratiom metílico, e à dose de triclorfom. Abstract in english The selectivity of abamectin, acephate, carbaryl, deltamethrin, fenitrothion, fenpropathrin, methyl parathion and trichlorfon to the predators Brachygastra lecheguana (Latreille), Protonectarina sylveirae (Saussure) and Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) was evaluated using insec [...] ticide concentrations corresponding to 50% and 100% of the current recommended rate for citrus caterpillars. The insecticides studied were not selective in favor of the predator P. sylveirae. Fenitrothion, fenpropathrin, methyl parathion and trichlorfon were not selective in favor of the predator B. lecheguana and P. exigua. Abamectin, acephate and carbaryl showed median selectivity in favor of P. exigua, and the same was observed with abamectin and carbaryl in favor of B. lecheguana. Acephate was selective in favor of B. lecheguana and deltamethrin in favor of P. exigua. The high mortalities caused by deltamethrin in P. sylveirae, trichlorfon in B. lecheguana and acephate in P. exigua decreased when the lower concentration was used. B. lecheguana was the most tolerant predator to the higher acephate concentration, followed by P. exigua and P. sylveirae. P. exigua was more tolerant to the higher deltamethrin concentration than B. lecheguana and P. sylveirae. The three predator species were highly susceptible to both concentrations of fenitrothion, fenpropathrin and methyl parathion, and the higher concentration of trichlorfon.

  9. Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores

    Directory of Open Access Journals (Sweden)

    Gonçalves Paulo Antonio de Souza


    Full Text Available Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tratamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench; cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.; cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília; cebola + milho (Zea mays L.; cebola + rúcula (Eruca sativa L. + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento.

  10. Seletividade de inseticidas a predadores de pulgões / Selectivity of insecticides to predators of aphids

    Scientific Electronic Library Online (English)

    Marcos Rafael, Gusmão; Marcelo, Picanço; Germano L.D., Leite; Marcelo F., Moura.


    Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L.) e Eriopis connexa (Germ.)(Coleoptera: Coccinellidae). Folhas de tomatei [...] ro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer) e Macrosiphum euphorbiae (Thomas) em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente). Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente). Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade) e permetrina (61 e 100% de mortalidade, respectivamente). A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente) do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente) para o controle de pulgões no tomateiro. Abstract in english The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L.) and Eriopis connexa (Germ.) (Coleoptera: Coccinellidae) was studied. Tomato leaves were submerged in [...] insecticide solution at recommended rate for controlling Myzus persicae (Sulzer) and Macrosiphum euphorbiae (Thomas) in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively). Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively). Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively) and permethrin (61 and 100% mortality respectively) than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively) than when they were applied at their full dose (100 and 66.5% mortality, respectively).

  11. Seletividade de inseticidas a predadores de pulgões Selectivity of insecticides to predators of aphids

    Directory of Open Access Journals (Sweden)

    Marcos Rafael Gusmão


    Full Text Available Estudou-se a seletividade dos inseticidas cipermetrina, diclorvós, diazinon, etion, fenitrotion, malation, metamidofós, paration metílico, permetrina, pirimicarbe e vamidation para adultos dos predadores Cycloneda sanguinea (L. e Eriopis connexa (Germ.(Coleoptera: Coccinellidae. Folhas de tomateiro foram imersas em caldas inseticidas nas doses utilizadas para o controle dos pulgões Myzus persicae (Sulzer e Macrosiphum euphorbiae (Thomas em tomateiro e também na metade das doses recomendadas. Os fatores em estudo foram os inseticidas, as doses, as espécies de predadores e o sexo para C. sanguinea. Vamidation e o pirimicarbe foram os inseticidas mais seletivos a C. sanguinea seguidos do etion e diclorvós (3,2; 6,7; 49,7 e 52,5% de mortalidade, respectivamente. Para E. connexa o pirimicarbe foi o mais seletivo seguido pelo etion e cipermetrina (1,96; 71,28 e 81,92% de mortalidade, respectivamente. Os machos de C. sanguinea foram mais tolerantes que as fêmeas ao etion (33 e 66,5% de mortalidade e permetrina (61 e 100% de mortalidade, respectivamente. A toxicidade da permetrina a E. connexa e do etion às fêmeas de C. sanguinea foi menor quando estes inseticidas foram aplicados em subdose (74,4 e 25% de mortalidade, respectivamente do que quando estes foram aplicados na dose recomendada (100 e 66,5% de mortalidade, respectivamente para o controle de pulgões no tomateiro.The selectivity of cypermethrin, dichlorvos, diazinon, ethion, fenitrothion, matathion, methamidophos, methyl parathion, permethrin, pirimicarb, and vamidathion to adults of Cycloneda sanguinea (L. and Eriopis connexa (Germ. (Coleoptera: Coccinellidae was studied. Tomato leaves were submerged in insecticide solution at recommended rate for controlling Myzus persicae (Sulzer and Macrosiphum euphorbiae (Thomas in tomatoes. The effect of insecticides, doses, predator species, and sex of C. Sanguinea in insecticide selectivity was evaluated. Pirimicarb and vamidathion were the most selective insecticides for C. sanguinea followed by ethion and dichlorvos (3.2, 6.7, 49.7, and 52.5% mortality, respectively. Pirimicarb was the most selective insecticide for E. connexa, followed by ethion and cypermethrin (2, 71.3, and 81.9% mortality, respectively. Males of C. sanguinea were more tolerant to ethion (33 and 66.5% mortality, respectively and permethrin (61 and 100% mortality respectively than females. Permethrin toxicity to E. connexa and ethion toxicity to C. sanguinea females were lower when those insecticides were applied at half dose (74.4 and 25% mortality, respectively than when they were applied at their full dose (100 and 66.5% mortality, respectively.

  12. Interactions mediated by predators in arthropod food webs / Interações mediadas por predadores em teias alimentares de artrópodes

    Scientific Electronic Library Online (English)

    Madelaine, Venzon; Angelo, Pallini; Arne, Janssen.


    Full Text Available Estudos sobre interações entre plantas, herbívoros e inimigos naturais são importantes para o entendimento da dinâmica populacional das espécies em teias alimentares, bem como para o sucesso do controle de pragas por inimigos naturais. Os programas de controle biológico fundamentam-se na ocorrência [...] de sucessões tróficas, onde a adição de um inimigo natural causa o decréscimo na densidade da presa/hospedeiro e o aumento da biomassa da planta. Entretanto, quando mais de uma espécie de inimigo natural é usada para controlar várias pragas no mesmo sistema, teias alimentares artificiais são criadas e as interações tritróficas simples transformam-se em outras mais complicadas. A ocorrência de interações complexas e de onivoria nestas teias alimentares pode modificar a direção e a intensidade dos efeitos diretos dos inimigos naturais sobre as pragas. Neste artigo, são apresentados e discutidos os resultados experimentais sobre interações mediadas por predadores em uma teia alimentar artificial. Esta teia é formada em plantas de pepino em casa de vegetação onde o controle biológico é aplicado. A teia constitui-se de duas pragas, o ácaro rajado Tetranychus urticae Koch e o tripes Frankliniella occidentalis (Pergande). Para o controle dos ácaros rajados são liberados os ácaros predadores Phytoseiulus persimilis Athias-Henriot e Neoseiulus californicus (McGregor). O controle dos tripes é feito através de liberações do percevejo generalista Orius laevigatus (Fieber) e do ácaro predador especialista Neoseiulus cucumeris (Oudemans). Resultados de estudos comportamentais mostraram que algumas destas espécies são atraídas para o mesma planta e não evitam plantas ocupados por outras espécies. Quando estas espécies são encontradas na mesma planta, interações complexas ocorrem: (a) predação intraguilda de O. laevigatus sobre P. persimilis, (b) uso da teia produzida pelo ácaro rajado pelas larvas de tripes como refúgio contra seus predadores. As conseqüências destas interações na dinâmica populacional dos predadores e das pragas e no sucesso do controle biológico são discutidos. Abstract in english Studies on interactions among plants, herbivores and natural enemies are important for understanding population dynamics of species in food webs, but they are also important for the practice of pest control with natural enemies. Biological control programs heavily rely on the occurrence of trophic c [...] ascades, where the addition of one natural enemy causes a decrease of pest densities and an increase of plant biomass. However, when more that one natural enemy is used to control various pests in the same system, artificial food webs are created and simple tritrophic interactions change to more complicated ones. The occurrence of complex interactions and omnivory in these food webs may modify the sign and the strength of direct effects of natural enemies on pests. In this paper, we show and discuss the experimental results on interactions mediated by predators in an artificial food web that occurs on cucumber plants in greenhouses where biological control is applied. The two pests in this food web are the two-spotted spider mite Tetranychus urticae Koch, and the western flower thrips Frankliniella occidentalis (Pergande). The predatory mites Phytoseiulus persimilis Athias-Henriot and Neoseiulus californicus (McGregor) are used to control spider mites, and the generalist predatory bug Orius laevigatus (Fieber) and a specialist predatory mite Neoseiulus cucumeris (Oudemans) are predators of thrips. Results from behavioural studies showed that some of these species are attracted to the same patch and do not avoid each other's presence. We show some complex interactions arising from the meeting of these species: (a) the intraguild predation by O. laevigatus on P. persimilis, (b) the use of spider-mite web as a refuge by thrips larvae against their predators. The consequences of such interactions for population dynamics of predators and prey and their implication

  13. Ácaros predadores associados ao ácaro-da-erinose da lichia Predator mites associated with the litchi erinose mite

    Directory of Open Access Journals (Sweden)

    Pedro Renan Ferreira Picoli


    Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%, seguida por Phytoseius intermedius (31,2%, Euseius concordis (14,1%, Amblyseius herbicolus (8,8% e Iphiseiodes zuluagai (3,3%. O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação.The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal variety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%, followed by Phytoseius intermedius (31.2%, Euseius concordis (14.1%, Amblyseius herbicolus (8.8% and Iphiseiodes zuluagai (3.3%. Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

  14. Ácaros predadores associados ao ácaro-da-erinose da lichia / Predator mites associated with the litchi erinose mite

    Scientific Electronic Library Online (English)

    Pedro Renan Ferreira, Picoli; Marineide Rosa, Vieira; Eloisa Aparecida da, Silva; Max Sander de Oliveira da, Mota.


    Full Text Available O objetivo deste trabalho foi identificar ácaros predadores em plantas de lichia e correlacionar o desenvolvimento populacional dessas espécies com o do ácaro-da-erinose da lichia, Aceria litchii. A pesquisa foi desenvolvida no Município de Casa Branca, SP, com árvores adultas, de 12 anos de idade, [...] da variedade Bengal. Mensalmente, de agosto de 2008 a setembro de 2009, foram coletadas folhas para avaliação dos níveis populacionais de A. litchii e de ácaros predadores. Foram registrados 6.557 indivíduos da família Phytoseiidae. A espécie mais abundante foi Amblyseius compositus (42,6%), seguida por Phytoseius intermedius (31,2%), Euseius concordis (14,1%), Amblyseius herbicolus (8,8%) e Iphiseiodes zuluagai (3,3%). O desenvolvimento populacional de A. compositus, E. concordis e I. zuluagai correlacionou-se positivamente com o de Aceria litchii, o que indica relação de predação. Abstract in english The objective of this work was to identify predator mites present in lychee plants and to correlate these species population development with the one of the litchi erineum mite, Aceria litchii. The research was carried out in the county of Casa Branca, SP, Brazil, with mature trees of the Bengal var [...] iety, with 12 years old. From August 2008 to September 2009, leaves were collected monthly for the evaluation of A. litchii and predatory mites population levels. Registers were made for 6,557 mites of the Phytoseiidae family. The most abundant species was Amblyseius compositus (42.6%), followed by Phytoseius intermedius (31.2%), Euseius concordis (14.1%), Amblyseius herbicolus (8.8%) and Iphiseiodes zuluagai (3.3%). Population development of A. compositus, E. concordis and I. zuluagai was positively correlated with the one of Aceria litchii, indicating a predation relationship.

  15. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)


    Luís Cláudio Paterno Silveira; Vanda Helena Paes Bueno; Leonardo Santa Rosa Pierre; Simome Martins Mendes


    O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R...

  16. Predadores asociados a panonychus citri mcgregor (acari: Tetranychidae) en la costa central del Perú / Predators associated to panonychus citri Mcgregor (acari: Tetranychidae) in the central coast of Peru

    Scientific Electronic Library Online (English)

    Alberto Daniel, Guanilo; Norberta, Martínez.


    Full Text Available Fueron identificadas 15 especies de predadores asociados a Panonychus citri en la costa central del Perú. Estos fueron: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias- Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthosei [...] us) transvaalensis (Nesbitt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. y Armascirus sp. Los insectos predadores fueron Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider y Aeolothrips sp. Las especies predadoras asociadas más frecuentes fueron A. chungas, T. (A.) evectus y N. californicus. Asimismo, Stethorus tridens y Stethorus histrio fueron abundantes en zonas donde no se encontraron los ácaros predadores antes mencionados. Abstract in english In the central coast of Peru, fifteen predators associated to Panonychus citri were identified: Amblyseius chungas Denmark & Muma, Phytoseiulus persimilis Athias-Henriot, Neoseiulus californicus (McGregor), Typhlodromus (Anthoseius) evectus (Schuster), Typhlodromus (Anthoseius) transvaalensis (Nesbi [...] tt), Typhlodromina subtropica Muma & Denmark, Mexecheles sp., Cheletogenes sp. and Armascirus sp. Stethorus tridens Gordon, Stethorus histrio Chazeau, Oligota sp., Chrysoperla externa Hagen, Ceraeochrysa cincta Schneider and Aeolothrips sp. were the acarophagous insects found. Most abundant species were: A. chungas, T.(A.) evectus and N. californicus. Furthermore, both Stethorus tridens and Stethorus histrio were frequent in fields where predator mites were absent.

  17. Efeito de inseticidas em insetos predadores em culturas de algodão / Effect of insecticides on predator insects associated with cotton

    Scientific Electronic Library Online (English)



    Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L.), instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.); F [...] ipronil 800 WDG (64, 80 e 100 g/ha de i.a.); Endosulfan 350 CE (700 g/ha de i.a.); e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.). Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare) no campo, e a Cycloneda sanguinea (L.), em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb.), e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs) no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório. Abstract in english To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L.) crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.); Fipronil 800 WDG (64, [...] 80 and 100 g/ha of a.i.); Endosulfan 350 EC (700 g/ha of a.i.); and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare) under field condition and to Cycloneda sanguinea (L.) under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb.), and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L.) and Doru lineare (Eschs) under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.

  18. Efeito de inseticidas em insetos predadores em culturas de algodão Effect of insecticides on predator insects associated with cotton

    Directory of Open Access Journals (Sweden)



    Full Text Available Com o objetivo de verificar o efeito de inseticidas em insetos predadores em cultura de algodão (Gossypium hirsutum L., instalaram-se, em 1993-1994, dois experimentos, um no campo, e outro, em laboratório. No experimento realizado no campo, os tratamentos foram: Fipronil 200 SC (75 g/ha de i.a.; Fipronil 800 WDG (64, 80 e 100 g/ha de i.a.; Endosulfan 350 CE (700 g/ha de i.a.; e testemunha. Em laboratório, além das formulações à base de Fipronil foi utilizado o Paration metílico 600 CE (480 g/ha de i.a.. Fipronil foi seletivo para os artrópodes predadores (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea e Doru lineare no campo, e a Cycloneda sanguinea (L., em laboratório, e pode ser recomendado em programas de manejo integrado de pragas na cultura do algodoeiro para o controle de Alabama argillacea (Rueb., e Anthonomus grandis Boh. Endosulfan foi seletivo em relação a Scymnus sp., Geocoris ventralis Thomazini e Doru lineare (Eschs no campo, com uma redução dos insetos inferior a 30%, e o Paration metílico não foi seletivo para C. sanguinea em laboratório.To assess the selectivity of insecticides to predator insects in cotton (Gossypium hirsutum L. crops two, trials, 1993-1994, under field and laboratory conditions were conducted. Under field conditions, the following treatments were compared: Fipronil 200 CS (75 g/ha of a.i.; Fipronil 800 WDG (64, 80 and 100 g/ha of a.i.; Endosulfan 350 EC (700 g/ha of a.i.; and control. Under laboratory conditions, in addition to Friponil, Methyl parathion 600 EC 480 g/ha of a.i. was also tested. Fipronil was selective to predators (Scymnus sp., Geocoris ventralis, Cycloneda sanguinea and Doru lineare under field condition and to Cycloneda sanguinea (L. under laboratory conditions. This product can be used in integrated pest management programs in cotton crops to control Alabama argillacea (Rueb., and Anthonomus grandis Boh. Endosulfan was selective to Scymnus sp., Geocoris ventralis Thomazini, Cycloneda sanguinea (L. and Doru lineare (Eschs under field conditions, with a 30% reduction of insects, while Methyl parathion was not selective to C. sanguinea in laboratory.


    Directory of Open Access Journals (Sweden)

    Julio Cezar Silveira Nunes


    Full Text Available

    The selectivity of insecticides for the complex of predators of the pests of cotton plant was evaluated in field experiment, in Goiânia- Goiás (Brazil, during the crop 1998/99. The experimental design was the randomized blocks with seven treatments and four repetitions (check, clorfluazuron, Bacillus thuringiensis, alanycarb, endosulfan and acephate in two amounts. The samplings were accomplished in beforeapplication, two days, seven and fourteen days after the treatment. For the obtained results (Henderson & Tilton, the products, in the decreasing order of selectivity, were: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    KEY-WORDS: Insecta; insecticides; cotton plant; predators.

    A seletividade de inseticidas para o complexo das pragas do algodoeiro foi avaliada em experimento de campo, em Goiânia (GO, durante a safra 1998/99. O delineamento experimental foi em blocos ao acaso com sete tratamentos testemunha, clorfluazuron, B. thuringiensis, alanycarb, endosulfan e acephate em duas dosagens, em quatro repetições. As amostragens foram realizadas em pré-aplicação; aos dois, sete e quatorze dias após as pulverizações. Pelos resultados obtidos (fórmula de Herderson & Tilton, os produtos, na ordem decrescente de seletividade, foram: alanycarb, clorfluazuron, B. thuringiensis, endosulfan e acephate.

    PALAVRAS-CHAVE: Insecta; inseticidas; algodão; predadores.

  20. Diversidade de predadores em coentro, endro e funcho sob manejo orgânico / Diversity of predators in coriander, dill and fennel under organic management

    Scientific Electronic Library Online (English)

    A.L.S., Resende; M.M. de, Haro; V.F. da, Silva; B., Souza; L.C.P., Silveira.


    Full Text Available Espécies vegetais da família Apiaceae podem proporcionar recursos vitais para insetos predadores de pragas agrícolas, promovendo sua eficiência como agentes de controle biológico devido à oferta de recursos como sítios de refúgio, proteção e alimentação. Assim, o objetivo deste trabalho foi avaliar [...] a atração de insetos predadores pelas apiáceas coentro (Coriandrum sativum L.), endro (Anethum graveolens L.) e funcho (Foeniculum vulgare Mill.). O experimento foi conduzido no campus da Universidade Federal de Lavras (UFLA), Lavras, MG, em blocos completos ao acaso, com três tratamentos e quatro repetições. Coletas semanais foram realizadas por meio de batida das plantas em bandejas, sendo os predadores aspirados e acondicionados em frascos com álcool 70%. Determinaram-se a curva do coletor, a riqueza de espécies, o índice de diversidade de Shannon-Wienner e o índice de similaridade (análise de Cluster). O funcho apresentou maior índice de Shannon-Wienner (H' = 1,104) e riqueza, enquanto o coentro mostrou maior abundância, sobretudo para a espécie Orius insidiosus (Hemiptera: Anthocoridae), um importante predador de tripes em hortaliças. Outras espécies predadoras de pragas de hortaliças foram encontradas, de maneira geral, em todas as apiáceas, destacando-se os adultos e larvas de coccinelídeos, importantes predadores de pulgões. A análise de Cluster indicou maior similaridade entre funcho e endro (55,03%). O período de floração promoveu considerável aumento na abundância de predadores, sobretudo no coentro. Abstract in english Species of plants of the Apiaceae family can provide vital resources for predators of agricultural pests, boosting their efficiency as biological control agents, because they allow their maintenance in the environment by offering features such as sites of refuge, protection and food. The present stu [...] dy was aimed to evaluate the attraction of predator insects by 3 Apiaceae species, namely coriander (Coriandrum sativum L.), dill (Anethum graveolens L.) and fennel (Foeniculum vulgare Mill.). The bioassay was conducted on the campus of UFLA (MG) in a randomized block design with 3 treatments and 4 replications. Weekly collections were carried out by beating the plants on white plastic trays, aspirating the predators and packing them into bottles with 70% alcohol. Determinations were made of the collector curve, the species richness, the Shannon-Wienner diversity index and the index of similarity (cluster analysis). The fennel had a higher richness and Shannon-Wienner index (H' = 1.104), while the coriander was more abundant, especially for the species Orius insidiosus (Hemiptera: Anthocoridae), a major predator of thrips in vegetables. Other predatory species of vegetable pests were found, generally, on all Apiaceae, especially adults and larvae of coccinellids, which are important predators of aphids. Cluster analysis indicated a greater similarity between fennel and dill (55.03%), and a lower value for the other pairs. The flowering period increased the abundance of predators, especially the coriander.

  1. Domácias do cafeeiro beneficiam o ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)? / Do coffee domatia benefit the predatory mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)?

    Scientific Electronic Library Online (English)

    Cláudia H.C., Matos; Angelo, Pallini; Fredson F., Chaves; Carla, Galbiati.


    Full Text Available Os cafeeiros apresentam domácias em suas folhas que abrigam ácaros, inclusive ácaros predadores que podem também fazer uso dessas estruturas. Neste estudo foi avaliado o efeito das domácias sobre o predador Iphiseiodes zuluagai Denmark & Muma, através da manipulação dessas estruturas em folhas de Co [...] ffea arabica L. var. Catuaí. Os testes foram realizados em arenas constituídas por folhas de cafeeiro com a face abaxial voltada para cima. Foi avaliada a sobrevivência de I. zuluagai em folhas com domácias fechadas (T1); domácias abertas contendo alimento (T2) e domácias abertas vazias (T3). Foram feitas observações a cada 24h, contabilizando-se o número de adultos vivos, local de oviposição e quantidade de ovos de I. zuluagai / tratamento. Foram observadas diferenças significativas entre os tratamentos. Nas folhas com domácias abertas (T2 e T3) foram encontrados ácaros vivos até o final do experimento, não ocorrendo o mesmo nas folhas com domácias fechadas (T1). No que se refere à oviposição de I. zuluagai, nos tratamentos em que as domácias se encontravam abertas (T2 e T3), o ácaro ovipositou preferencialmente dentro destas estruturas, enquanto nas folhas com domácias fechadas a oviposição foi feita preponderantemente à margem das folhas em contato com o algodão úmido. Os resultados indicam a importância das domácias como fonte de sobrevivência para os ácaros predadores nas plantas, sugerindo uma interação mutualística planta-predador. No café, o mutualismo planta-predador intermediado por domácias poderia ser explorado em estratégias de controle biológico natural, ao se selecionarem espécies de cafeeiro com domácias que favoreçam a presença dos ácaros predadores nas mesmas, protegendo-as contra o ataque de ácaros herbívoros nocivos. Abstract in english Coffee plants have domatia on their leaves harboring mites, and the predatory mites can also use such structures. Here we evaluated the effect of the domatia on the predatory mite Iphiseiodes zuluagai Denmark & Muma, manipulating these structures on the leaves of Coffea arabica L. var. Catuaí. The t [...] ests were done using arenas made of coffee leaves placed up side down inside petri dishes. The survivorship of I. zuluagai was evaluated when released on leaves with closed domatia (T1); leaves with open domatia plus prey (T2) and leaves with open domatia without prey (T3). The experiment was checked every 24h, measuring the number of alive adults, oviposition site and the number of I. zuluagai eggs/treatment. Significant difference was found between treatments. Mites were alive until the end of the experiments on leaves with open domatia (T2 and T3), which did not happen on leaves with closed domatia (T1). The predators oviposited preferentially inside the domatia on treatments with open domatia, and on the edge of the leaves, next to the moist cotton bordering the leaves, on the treatment with closed domatia. The results indicate the role of domatia on the survivorship of the predators on the coffee plants, suggesting a possible mutualist interactions plant-predator. On coffee crops, a mutualistic plant-predator interaction mediated by domatia could be used in practices of natural biological control, selecting coffee plants with domatia to harbor predatory mites and thereby protecting plants against harmful herbivore mites.

  2. Toxoplasmosis Silvestre: relación presa-predador y papel funcional de pequeños felinos silvestres neotropicales en la transmisión -resumen-

    Directory of Open Access Journals (Sweden)

    William A Cañón-Franco


    Full Text Available Pequeños felinos neotropicales se ubican en el tope de la cadena alimenticia y‚ aunque críticamente amenazados‚ ocho especies de felinos son relativamente abundantes en el continente americano‚ sin embargo‚ pocos estudios biológicos sobre la circulación de agentes infecciosos han sido realizados. Para determinar el papel epidemiológico que cumplen las poblaciones de felinos silvestres en la transmisión de la Toxoplasmosis en la región sur de Brasil (estado de Rio Grande do Sul‚ fue determinada la frecuencia molecular de Toxoplasma gondii. La amplificación del marcador ITS1 fue posible en 31 de los 90 felinos analizados (34‚4%‚ de las especies Puma yagouaroundi (9/22‚ Leopardus geoffroyi (6/22‚ Leopardus tigrinus (8/28‚ Leopardus wiedii (6/10‚ Leopardus pardalis (1/1 y Leopardus colocolo (1/7. Dos nuevos genotipos de T. gondii fueron caracterizados por PCR-RFLP (Lw#31Tn - Py#21Sm y el genotipo Py#56Br previamente descrito en gatos domésticos‚ perros y chigüiros del Brasil. Adicionalmente‚ fue parcialmente caracterizado el genotipo I (Py#36Sm‚ evidenciando la circulación ambiental y su posible relación en la presentación de toxoplasmosis ocular en humanos. Los resultados demuestran que pequeños felinos silvestres tienen un papel importante en la transmisión de la toxoplasmosis en la interfase animales domésticos-silvestres‚ por lo que no se descarta la posible hibridación con genotipos urbanos. La carnivoría y las relaciones presa-predador son fundamentales en la transmisión horizontal de Toxoplasma. Aunque existan variaciones biogeográficas y estacionales en la dieta de los felinos silvestres‚ aproximadamente 40% a 80%‚ corresponde a pequeños mamíferos no voladores (marsupiales y roedores. El estudio de la dinámica de transmisión en diferentes niveles tróficos es de gran interés para la comprensión ecológica del ciclo silvestre de este parásito. Esta propuesta se fundamenta en evaluar el impacto de variables biológicas de las especies predadas (edad‚ sexo‚ peso y dieta y de variables ecológicas (uso vertical y horizontal del espacio‚ densidad de la especie‚ tiempo de vida y distribución en el bioma en la toxoplasmosis silvestre en tres diferentes biomas del estado de Mato Grosso (Brasil. Actualmente‚ están siendo analizados tejidos de roedores (géneros Necromys‚ Oecomys‚ Oligoryzomys‚ Oryzomys‚ Oxymycterus‚ Proechimys‚ Calomys‚ Cavia‚ Holochilus‚ Necromys‚ Oecomys‚ marsupiales (géneros Philander‚ Didelphis‚ Marmosa‚ Marmosops‚ Metachirus‚ Micoureus‚ Monodidelphis y de otros mamíferos silvestres de la región (Familia Felidae‚ Canidae‚ Myrmecophagidae‚ Cebidae‚ Dasypodidae‚ Mustelidae. Los resultados parciales de la investigación demuestran la circulación de Toxoplasma entre carnívoros (Cerdocyon thous y primates (Sapajus sp‚ con resultados negativos para las demás especies en estudio‚ indicando que otros niveles biológicos participan en la transmisión.

  3. Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines, and ground cover plants. (United States)

    Childers, Carl C; Ueckermann, Eduard A


    Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the families Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) in central and south central Florida. Inner and outer canopy leaves, fruit, twigs, and trunk scrapings were sampled monthly between August 1994 and January 1996. Open flowers were sampled in March from five of the sites. Two species of eupalopsellid mites (Exothorhis caudata Summers and Saniosulus harteni (van-Dis and Ueckermann)) were identified from 252 specimens collected within citrus tree canopies within the seven citrus orchards of which 249 were E. caudata. Only two E. caudata were collected from ground cover plants within five of the seven orchards. Eight species of Stigmaeidae were identified from 5,637 specimens: Agistemus floridanus Gonzalez, A. terminalis Gonzalez, Eustigmaeus arcuata (Chandhri), E. sp. near arcuata, E. segnis (Koch), Mediostigmaeus citri (Rakha and McCoy), Stigmaeus seminudus Wood, and Zetzellia languida Gonzalez were collected from within citrus tree canopies from seven orchard sites. Agistemus floridanus was the only species in either family that was abundant with 5,483 collected from within citrus tree canopies compared with only 39 from vine or ground cover plants. A total of 431 samples from one or more of 82 vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards and one or more eupalopsellids or stigmaeids were collected from 19 of these plants. Richardia brasiliensis (Meg.) Gomez had nine A. floridanus from 5 of 25 samples collected from this plant. Solanum sp. had five A. floridanus from three samples taken. Both eupalopsellid and stigmaeid species numbers represented orchards were on full herbicide programs and ground cover plants were absent. Agistemus floridanus was more abundant in the citrus orchards with on-going or recent herbicide programs compared with orchards having well-developed ground cover plants. Agistemus floridanus was most abundant on inner leaves between January and April and again during September through November. Additional collection records of E. caudata, S. harteni, A. terminalis, M. citri, Z. languida, and Zetzellia sp. near silvicola within Florida citrus orchards between 1989 and 2004 are included. Four species of Eupalopsellidae and ten species of Stigmaeidae occur within Florida citrus orchards. PMID:24771254

  4. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis

    Directory of Open Access Journals (Sweden)

    Bruce Veronez


    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyroximate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%; and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

  5. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis / Toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis

    Scientific Electronic Library Online (English)

    Bruce, Veronez; Mário Eidi, Sato; Roberto Lomba, Nicastro.


    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpi [...] roximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%); e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis. Abstract in english The objective of this work was to evaluate the toxicity of synthetic and natural compounds on Tetranychus urticae and the predator Phytoseiulus macropilis. Mortality and growth rates of T. urticae and its predator were evaluated after applications of: abamectin, clofentezine, fenpropathrin, fenpyrox [...] imate, propargite, sulfur and spiromesifen, at their recommended concentrations; neem oils (Natuneem and Sempre Verde Killer Neem at 1%); and aqueous extracts at 10% of Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis, and Eucalyptus saligna. The acute toxicity and the influence of the compounds on the instantaneous growth rate of the mites were carried out in laboratory. Extracts of A. cepa, A. angustifolia, neem oil?based products, spiromesifen, propargite, fenpyroximate, abamectin and fenpropathrin caused mortality higher than 83% on T. urticae. Extract of A. angustifolia, Natuneem and clofentezine did not cause significant mortality rates on P. macropilis. Agave angustifolia and Natuneem did not affect significantly the growth rate of this predator. Propargite, fenpyroximate, abamectin, fenpropathrin, spiromesifen and extract of L. nobilis severely affected P. macropilis population.

  6. First record of native predators on the invasive species Thaumastocoris peregrinus (Hemiptera:Thaumastocoridae) in Eucalyptus in Argentina / Primer registro de predadores nativos de la especie invasora Thaumastocoris peregrinus (Hemiptera: Thaumastocoridae) en Eucalyptus en la Argentina

    Scientific Electronic Library Online (English)

    Marina V., Santadino; María B., Riquelme Virgala; Carlos E., Coviella.


    Full Text Available Se han observado, repetidamente, a dos predadores nativos consumiendo a Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae), chinche del eucaliptus. Para identificar a estos predadores y corroborar si estas especies pueden utilizar a T. peregrinus como alimento aceptable, se [...] obtuvieron muestras de huevos de ambas especies de predadores del arboretum de la Universidad Nacional de Luján. Las ninfas fueron criadas por separado en condiciones de laboratorio y alimentadas ad libitum con ninfas y adultos de T. peregrinus. Se registró el número de presas consumidas diariamente y el tiempo de desarrollo. Las especies de predadores fueron identificadas como Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) y Podisus australis Berg (Hemiptera: Pentatomidae). Este trabajo presenta el primer registro de predadores nativos utilizando a esta especie invasora como fuente de alimento sobre Eucalyptus camaldulensis en la provincia de Buenos Aires, Argentina. Abstract in english Two native predators have been repeatedly observed consuming the bronze bug, Thaumastocoris peregrinus Carpintero & Dellapé (Hemiptera: Thaumastocoridae). To identify these predators and to corroborate whether these species can use T. peregrinus as a suitable food item, egg samples of both predator [...] species were collected from the arboretum at the Universidad Nacional de Luján. Nymphs were reared individually under laboratory conditions and fed ad libitum with nymphs and adults of T. peregrinus. The number of prey consumed daily and the development time were recorded. The predator species were identified as Atrachelus cinereus Fabricius (Hemiptera: Reduviidae) and Podisus australis Berg (Hemiptera: Pentatomidae). This research presents the first report of native predators using this invasive species as a food resource in Eucalyptus camaldulensis forest in Buenos Aires province, Argentina.

  7. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor / Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    Scientific Electronic Library Online (English)

    Harley Nonato de, Oliveira; Dirceu, Pratissoli; Eder Pin, Pedruzzi; Marcelo Curitiba, Espindula.


    Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae) têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae). No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae), [...] uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural. Abstract in english Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae) have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae), in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae), one of the m [...] ost damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

  8. Desenvolvimento do predador Podisus nigrispinus alimentado com Spodoptera frugiperda e Tenebrio molitor Development of the predator Podisus nigrispinus fed on Spodoptera frugiperda and Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Harley Nonato de Oliveira


    Full Text Available Ninfas de Podisus nigrispinus (Heteroptera: Pentatomidae têm sido criadas em laboratório com larvas de Tenebrio molitor L. (Coleoptera: Tenebrionidae. No entanto, não existem relatos sobre a predação, no campo ou em laboratório, de P. nigrispinus em Spodoptera frugiperda (Lepidoptera: Noctuidae, uma das principais pragas de inúmeras culturas no Brasil. Este trabalho teve o objetivo de avaliar o desenvolvimento ninfal e características reprodutivas do percevejo predador P. nigrispinus em lagartas de S. frugiperda e em larvas de T. molitor, em laboratório. A presa S. frugiperda proporcionou ao predador menor longevidade, maior produção e viabilidade de ovos do que as larvas de T. molitor. Esses resultados demonstram que a lagarta S. frugiperda melhora as características reprodutivas de P. nigrispinus, de forma que a sua utilização como presa alternativa pode servir para incrementar a produção massal desse inimigo natural.Nymphys of Podisus nigrispinus (Heteroptera: Pentatomidae have been reared on Tenebrio molitor L. (Coleoptera: Tenebrionidae, in laboratory conditions. However, there are no reports on P. nigrispinus predation, in field or laboratory, on Spodoptera frugiperda (Lepidoptera: Noctuidae, one of the most damaging pests in crops in Brazil. This research had the objective to evaluate nymphal development and reproductive characteristics of the predator P. nigrispinus when reared on caterpillars of S. frugiperda and on larvae of T. molitor, in laboratory conditions. S. frugiperda provided a smaller longevity, higher egg production and viability to predator than T. molitor. The nutricional quality of this caterpillar improves the reproductive characteristics of the predator, so that its utilization as factitious host can increase mass production of this natural enemy.

  9. Coenosia attenuata (Dptera: Muscidae), um predador em estudo para utilização em culturas protegidas / Coenosia attenuata (Dptera: Muscidae), a predator being studied for use in greenhouses greenhouses

    Scientific Electronic Library Online (English)

    Joana, Martins; Cíntia, Domingos; Raquel, Nunes; André, Garcia; Cristina, Ramos; Célia, Mateus; Elisabete, Figueiredo.


    Full Text Available Coenosia attenuata Stein, ou “mosca tigre”, predador polífago de importantes pragas agrícolas, enquanto larva e adulto, foi detectado em Portugal, pela primeira vez, em 2002, no Oeste. Para optimização da sua criação em massa, alteraram-se metodologias descritas na bibliografia. Ocorreu maior número [...] de emergências em substratos com maior número de larvas de esciarídeos e em substrato de terra misturado com fibra de coco. Estudou-se, em laboratório, o seu comportamento e capacidade de predação sobre várias espécies, incluindo parasitóides e predadores importantes em culturas protegidas, tendo predado todas as espécies testadas: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta e algumas espécies de Psycodidae. Observaram-se indícios de preferência alimentar das fêmeas de mosca tigre por moscas brancas e larvas mineiras, em relação a diglifos, e diferenças no comportamento de predação sobre moscas brancas em presença de larvas mineiras ou drosófilas. Abstract in english Coenosia attenuata Stein, or “tiger-fly”, a polyphagous predator of important agricultural pests, as larva and adult, was detected for the first time, in Portugal, in 2002, in the “Oeste” region. For mass rearing optimization, the methodologies described in literature were changed. A higher number o [...] f emergences occurred on substrates with higher number of sciarids larvae and on the substrate with soil mixed with coconut fiber. The predation capacity and behaviour of C. attenuata was studied in laboratory in relation to several species, including parasitoids and predators with an important role in protected crops. All species tested were predated: Diglyphus isaea, Trialeurodes vaporariorum, Liriomyza huidobrensis, Drosophila melanogaster, Eretmocerus mundus, Nesidiocoris tenuis, Orius laevigatus, Dacnusa sibirica, Pseudococcus viburni, Tuta absoluta and some Psycodidae species. There was evidence of female preference for whiteflies and leafminers in relation to Diglyphus isaea, as well as predation behaviour differences over whiteflies when leafminers or drosophilids were present.

  10. Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis

    Directory of Open Access Journals (Sweden)

    André Luiz Barreto Crespo


    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart (Lepidoptera: Pieridae e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90, calcularam-se os índices de seletividade diferencial (ISD90, de toxicidade relativa, e de tolerância relativa (ITRe90. O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75 e P. sylveirae (ISD90 = 2,95 e 3,59 em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70 em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64. B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05, e mais tolerante ao carbaril (ITRe90 = 0,14. Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04. As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis.This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart (Lepidoptera: Pieridae and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure (Hymenoptera: Vespidae. Based on concentration-response curves and lethal concentrations for 90% of the population (LC90, the differential selectivity index (DSI90, relative toxicity index and relative tolerance index (ReTI90 were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75 and P. sylveirae (DSI90 = 2.95 and 3.59 against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70 against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64. B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05, but the opposite was observed to carbaryl (ReTI90 = 0.14. These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04. Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

  11. Seletividade fisiológica de inseticidas a Vespidae predadores de Ascia monuste orseis / Insecticide physiological selectivity to Vespidae predators of Ascia monuste orseis

    Scientific Electronic Library Online (English)

    André Luiz Barreto, Crespo; Marcelo Coutinho, Picanço; Leandro, Bacci; Eliseu José Guedes, Pereira; Alfredo Henrique Rocha, Gonring.


    Full Text Available Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em relação a Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) e a seus predadores Brachygastra lecheguana Latreille e Protonectarina sylveirae (Saussure) (Hymenopter [...] a: Vespidae). Por meio de curvas de concentração-mortalidade e das concentrações letais para 90% da população (CL90), calcularam-se os índices de seletividade diferencial (ISD90), de toxicidade relativa, e de tolerância relativa (ITRe90). O paratiom metílico e triclorfom apresentaram seletividade em favor de B. lecheguana (ISD90 = 2,83 e 1,75) e P. sylveirae (ISD90 = 2,95 e 3,59) em relação a A. monuste orseis. Deltametrina e permetrina apresentaram seletividade em favor de P. sylveirae (ISD90 = 1,98 e 2,70) em relação a A. monuste orseis, mas não apresentaram seletividade em favor de B. lecheguana (ISD90 = 0,21 e 0,64). B. lecheguana foi menos tolerante a deltametrina, permetrina e triclorfom do que P. sylveirae (ITRe90 = 9,36, 4,23 e 2,05), e mais tolerante ao carbaril (ITRe90 = 0,14). Os predadores apresentaram tolerância semelhante ao paratiom metílico (ITRe90 = 1,04). As curvas de concentração-mortalidade do carbaril, permetrina e triclorfom em ambos os predadores, de deltametrina em B. lecheguana, e de paratiom metílico em P. sylveirae, apresentaram maiores inclinações do que as curvas em A. monuste orseis. Abstract in english This work aimed to study the selectivity of the insecticides carbaryl, deltamethrin, methyl parathion, permethrin and trichlorfon in relation to Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) and to their predators Brachygastra lecheguana Latreille and Protonectarina sylveirae (Saussure) (Hym [...] enoptera: Vespidae). Based on concentration-response curves and lethal concentrations for 90% of the population (LC90), the differential selectivity index (DSI90), relative toxicity index and relative tolerance index (ReTI90) were calculated. Methyl parathion and trichlorfon were selective to B. lecheguana (DSI90 = 2.83 and 1.75) and P. sylveirae (DSI90 = 2.95 and 3.59) against A. monuste orseis. Deltamethrin and permethrin were selective to P. sylveirae (DSI90 = 1.98 and 2.70) against A. monuste orseis, but weren't selective to B. lecheguana (DSI90 = 0.21 and 0.64). B. lecheguana was less tolerant to deltamethrin, permethrin and trichlorfon than P. sylveirae (ReTI90 = 9.36, 4.23 and 2.05), but the opposite was observed to carbaryl (ReTI90 = 0.14). These two predators showed similar tolerance to methyl parathion (ReTI90 = 1.04). Concentration-response curves of carbaryl, permethrin and trichlorfon to both predators, deltamethrin to B. lecheguana, and methyl parathion to P. sylveirae, showed greater slopes than these curves to A. monuste orseis.

  12. Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae) / Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Evaldo Martins, Pires; Rosenilson, Pinto; Mabio Chrisley, Lacerda; José Cola, Zanuncio; Maria do Carmo Queiroz, Fialho.


    Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi e [...] studar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae) alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae) em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21%) e a de atividade de postura, à 0 h (50,56% dos ovos depositados), enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%), seguido das 00 h (29,65%), 18 h (22,36%) e 6 h (16,60%). Abstract in english Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductiv [...] e behavior and predation rate of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21%) and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited) while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58%) followed by those at 12:00 AM (29.65%) 06:00 PM (22.36%) and 06:00 AM (16.60%).

  13. Potencial reprodutivo horário do predador de lagartas desfolhadoras do eucalipto: Podisus nigrispinus (Heteroptera: Pentatomidae Hourly reproductive potential of the predator of Lepidoptera eucalypt desfoliators: Podisus nigrispinus (Heteroptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    Evaldo Martins Pires


    Full Text Available Insetos da subordem Heteroptera apresentam ampla diversidade faunística, incluindo predadores de pragas agrícolas e florestais. Espécies do gênero Podisus destacam-se entre os percevejos predadores no controle biológico de lagartas desfolhadoras de eucalipto, soja, algodão e tomate. O objetivo foi estudar o comportamento reprodutivo e a atividade de predação de Podisus nigrispinus (Heteroptera: Pentatomidae alimentado com pupas de Tenebrio molitor L. (Coleoptera: Tenebrionidae em laboratório. Casais desse predador foram acondicionados em potes plásticos de 500 mL com pupas de T. molitor e água em tubos tipo anestésico odontológico, inseridos na tampa desses potes. Foram observados: a postura o acasalamento e a alimentação de machos e fêmeas de P. nigrispinus às 0 h, 6 h, 12 h e 18 h. O porcentual de fêmeas de P. nigrispinus predando foi de 26,26; 24,39; 15,91; e 34,21% e o de machos, de 7,41; 6,20; 4,88; e 5,77%, às 0 h, 6 h, 12 h e 18 h, respectivamente. O maior número de fêmeas ovipositando foi observado às 00 h. A maior porcentagem de fêmeas predando foi às 18 h (32,21% e a de atividade de postura, à 0 h (50,56% dos ovos depositados, enquanto foram registrados apenas 1,66% dos ovos às 12 h. O número de acasalamentos de P. nigrispinus foi maior às 12 h (34,58%, seguido das 00 h (29,65%, 18 h (22,36% e 6 h (16,60%.Insects of the sub-order Heteroptera present a wide diversity including predators of agricultural and forest pests. Species of the genus Podisus are important agents of biological control of defoliating caterpillars of eucalyptus, soybem, cotton and tomato. The objective was to study the reproductive behavior and predation rate of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae in the laboratory. Pairs of this predator were placed in 500 ml plastic pots with T. molitor pupae and water in tubes of anesthetic odontologic type inserted in the lid. The egg masses were removed and matting and feeding of males and females P. nigrispinus were observed at 12:00 AM, 06:00 AM, 12:00 PM and 06:00 PM. The percentages of females of P. nigrispinus predating were 26.26, 24.39, 15.91 and 34.21%, and males 7.41, 6.20, 4.88 e 5.77% at 12:00 AM, 6:00AM, 12:00 PM and 06:00 PM, respectively. The largest number of females of this predator laying eggs was observed at 12:00 AM. The largest percentage of females predating was observed at 6:00 PM (32.21% and the maximum number of eggs masses laid at 12:00 AM (50.56% of the eggs deposited while only 1.66% of them were registered at 12:00 AM. The number of mating of P. nigrispinus was higher at 12:00 PM (34.58% followed by those at 12:00 AM (29.65% 06:00 PM (22.36% and 06:00 AM (16.60%.

  14. Insetos predadores em copas de Citrus deliciosa (Rutaceae sob manejo orgânico no sul do Brasil Predatory insects in canopies of Citrus deliciosa (Rutaceae under organic management in southern Brazil

    Directory of Open Access Journals (Sweden)

    Rosana M. de Morais

    Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae (16,87% e Coccidophilus sp. (Coleoptera, Coccinellidae (11,85%. A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações.The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species from ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae (16.87% and Coccidophilus sp. (Coleoptera, Coccinellidae (11.85%. The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

  15. Insetos predadores em copas de Citrus deliciosa (Rutaceae) sob manejo orgânico no sul do Brasil / Predatory insects in canopies of Citrus deliciosa (Rutaceae) under organic management in southern Brazil

    Scientific Electronic Library Online (English)

    Rosana M. de, Morais; Aline, Barcellos; Luiza R., Redaelli.


    Full Text Available A fauna de insetos predadores em copas de Citrus deliciosa Tenore var. Montenegrina, em Montenegro, Rio Grande do Sul, Brasil, foi avaliada quanto à sua composição, abundância e diversidade, entre março de 2004 e março de 2005. Foram coletados, no total, 658 insetos predadores, representados por 51 [...] espécies de dez famílias e cinco ordens, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera e Hemiptera. As espécies mais abundantes foram Camponotus sp. 1 (Hymenoptera, Formicidae) (16,87%) e Coccidophilus sp. (Coleoptera, Coccinellidae) (11,85%). A maior abundância, riqueza e eqüitabilidade de insetos predadores foi registrada na primavera, embora não tenha sido constatada diferença significativa entre as estações. Abstract in english The composition, abundance and diversity of predatory insects occurring on canopies of Citrus sinensis Tenore var. Montenegrina, in Montenegro, State of Rio Grande do Sul, Brazil, were studied from March 2004 to March 2005. A total of 658 predaceous insects were collected, representing 51 species fr [...] om ten families and five orders, Coleoptera, Hymenoptera, Neuroptera, Thysanoptera and Hemiptera. The most abundant species were Camponotus sp. 1 (Hymenoptera, Formicidae) (16.87%) and Coccidophilus sp. (Coleoptera, Coccinellidae) (11.85%). The highest abundance, richness and evenness of predatory insects were recorded in spring, although no significant difference among seasons has been found.

  16. Percevejos predadores (Orius spp.) (Hemiptera: Anthocoridade) e tripes (Thysanoptera): interação no mesmo habitat? / Species of Orius (Hemiptera, Anthocoridae) and thrips (Thysanoptera): interaction in the same habitat?

    Scientific Electronic Library Online (English)

    Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Júlio Neil Cassa, Louzada; Lívia Mendes, Carvalho.


    Full Text Available O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das r [...] egiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R), calculado com dados de presença/ausência das espécies (Orius e tripes) no mesmo "habitat". Orius insidiosus (Say) foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin) e negativamente associado a Frankliniella schultzei (Trybom) e Caliothrips phaseoli (Hood). Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter) esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton). Abstract in english The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrip [...] s species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R) (presence/absence of the species in the same habitat). Orius insidiosus (Say) was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin), and negatively associated with Frankliniella schultzei (Trybom) and Caliothrips phaseoli (Hood). Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter) was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton).

  17. Percevejos predadores (Orius spp. (Hemiptera: Anthocoridade e tripes (Thysanoptera: interação no mesmo habitat? Species of Orius (Hemiptera, Anthocoridae and thrips (Thysanoptera: interaction in the same habitat?

    Directory of Open Access Journals (Sweden)

    Luís Cláudio Paterno Silveira


    Full Text Available O gênero Orius Wolff é composto por espécies de percevejos predadores, principalmente de tripes, encontradas em muitos ecossistemas naturais e manejados. Entretanto, as interações que podem ocorrer entre esses predadores e suas presas no mesmo "habitat" não são bem conhecidas entre as espécies das regiões tropicais. Este estudo teve como objetivo registrar a interação de espécies de Orius e de tripes coletadas na mesma planta, ou seja, presentes no mesmo "habitat". As coletas foram feitas em várias plantas cultivadas, no campo e em casas de vegetação e em plantas invasoras. A forma e o grau de associação entre as espécies foram determinados, utilizando-se o coeficiente de Spearman (R, calculado com dados de presença/ausência das espécies (Orius e tripes no mesmo "habitat". Orius insidiosus (Say foi encontrado associado positivamente aos tripes Frankliniella sp., Neohydatothrips sp. e Haplothrips gowdeyi (Franklin e negativamente associado a Frankliniella schultzei (Trybom e Caliothrips phaseoli (Hood. Orius thyestes Herring e Orius sp1 ocorreram simultaneamente em 10 espécies de tripes sem, contudo, apresentar associação significativa, enquanto Orius perpunctatus (Reuter esteve associado positivamente às espécies Frankliniella sp. e Neohydatothrips sp. e, negativamente, a Frankliniella gemina (Moulton.The genus Orius Wolff comprise species that are mostly thrip predators , in natural and managed ecosystems. Interactions between Orius species and its preys in the same habitat in tropical areas are not well known. The objective of this research was to record the interactions between Orius and thrips species present in the same habitat. Sampling on crops and weeds were conducted in the field and greenhouse conditions. The association level between Orius and thrips species was evaluated by Spearman coefficient (R (presence/absence of the species in the same habitat. Orius insidiosus (Say was found positively associated with Frankliniella sp., Neohydatothrips sp. and Haplothrips gowdeyi (Franklin, and negatively associated with Frankliniella schultzei (Trybom and Caliothrips phaseoli (Hood. Orius thyestes Herring and Orius sp1 coexist with 10 thrips species, but no significant association was found between those predators and thrips species. Orius perpunctatus (Reuter was found positively associated with Frankliniella sp. and Neohydatothrips sp., and negatively associated with Frankliniella gemina (Moulton.

  18. Diversidade de pulgões e de seus parasitóides e predadores na cultura da alfafa / Diversity of aphids and their parasitoids and predators in alfalfa crop

    Scientific Electronic Library Online (English)



    Full Text Available O objetivo deste trabalho foi verificar a diversidade de pulgões, seus predadores e parasitóides, e a influência de fatores climáticos nas suas populações. Foram realizadas coletas semanais no período de abril/1995 a março/1996, no campo de alfafa da Universidade Federal de Lavras (UFLA), em Lavras, [...] MG. As espécies de pulgões coletadas foram Therioaphis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji e Aphis craccivora Kock, presentes na cultura durante todo o período de estudo, com picos populacionais em novembro/1995, julho/1995, dezembro/1995 e abril/1996, respectivamente. Foram amostrados insetos predadores das famílias Coccinellidae, Syrphidae, Anthocoridae, Geocoridae e Chrysopidae, tendo as duas últimas ocorrência esporádica. Espécies da família Coccinellidae ocorreram durante todo o período amostral, apresentando o pico populacional no final de dezembro/1995, com precipitação de 20 mm e temperatura de 22,6ºC. A família Syrphidae alcançou maiores números em abril, à precipitação de 53 mm e temperatura de 21ºC. A família Anthocoridae não se manteve por todo o período amostral, porém um pico populacional ocorreu no final de dezembro nas mesmas condições que aquele apresentado pela família Coccinellidae. Os parasitóides da família Aphididae alcançaram pico em junho/1995, à temperatura de 16ºC. Abstract in english This work was carried out with the objective of showing the diversity of aphids and their predators and parasitoids, as well as the influence of the climatic factors on these insects in alfalfa crop. The survey was done weekly from April/95 to March/96. Four species of the aphids were found: Therioa [...] phis trifolii (Monel) f. maculata, Acyrthosiphon pisum (Harris), A. kondoi Shinji and Aphis craccivora Kock, which were present in the crop during all the survey period, with the population peaks in November/95, July/95, December and April/96, respectively. Predator insects belong to families: Coccinellidae, Syrphidae, Anthocoridae, Geocoridae and Chrysopidae were found. Species of Coccinellidae occurred during all the survey period, with the population peak in the end of December with 20 mm of rainfall and 22.6ºC. The Syrphidae species reaching higher numbers in April/95, with 53 mm of rainfall and 21ºC. Orius sp. was the only specie of Anthocoridae, with a peak in the end of December/95, under the same conditions as to Coccinellidae. Two species of the parasitoids were found: Aphidius colemani Viereck and A. ervi Haliday with the populacional peak in June/95 at 16ºC.

  19. Diversidade e abundância de artrópodes predadores associados a diferentes cultivares de algodoeiro / Diversity and abundance of predaceous arthropods associated with different cotton cultivars

    Scientific Electronic Library Online (English)

    Lílian Lúcia, Costa; Ivan Carlos Fernandes, Martins; Antonio Carlos, Busoli; Francisco Jorge, Cividanes.


    Full Text Available Com o objetivo de estudar a abundância e a diversidade de artrópodes predadores associados à cultura do algodoeiro e analisar a influência de fatores meteorológicos, interações entre inimigos naturais e a dinâmica populacional de coccinelídeos associados à sua principal presa, o pulgão Aphis gossypi [...] i, um experimento foi realizado na região de Ipameri (GO), no Campus da Universidade Estadual de Goiás. O delineamento experimental utilizado foi o de blocos ao acaso, com cinco tratamentos, constituídos pelas cultivares DeltaOPAL, FMX 966, FMX 993, FMX 910 e NuOPAL, em quatro repetições. Dentre os artrópodes observados na cultura do algodoeiro, os coccinelídeos e as aranhas foram os mais abundantes, nas cultivares avaliadas. As aranhas ocorreram em todo o ciclo do algodoeiro. Já os coccinelídeos aumentaram sua população, gradativamente, até 55 DAE, apresentando pico populacional aos 34 DAE, coincidindo com o pico populacional dos pulgões A. gossypii. Dentre os coccinelídeos observados nas cultivares em estudo, verificou-se que Scymnus spp. foi o gênero mais abundante no algodoeiro. Os pentatomídeos e forficulídeos predominaram dos 99 aos 128 dias após a emergência do algodão, período que corresponde à maior densidade de pragas-alvo destes insetos. Verificou-se que não houve influência dos fatores meteorológicos e nem interação negativa entre os artrópodes predadores. Abstract in english With the objective of studying the abundance and diversity of predaceous arthropods associated with cotton crop, and analyze the influence of meteorological factors, interactions between natural enemies and population dynamics of coccinellids associated with their principal prey, the aphid Aphis gos [...] sypii, an experiment was carried out in the region of Ipameri, Goiás State, Brazil, at the Universidade Estadual de Goiás campus. The experimental design was randomized blocks, with five treatments, consisting of the DeltaOPAL, FMX 966, FMX 993, FMX 910, and NuOPAL cultivars, in four replications. Among the arthropods sampled in the cotton crop, the coccinellids and spiders were the most abundant ones in the cultivars evaluated. Spiders occurred throughout the cotton cycle, while the coccinellids population increased gradually until 55 DAE, showing a population peak at 34 DAE, coinciding with the population peak of aphids (Aphis gossypii). Among the coccinellids observed in the cultivars under study, Scymnus spp. was the most abundant in cotton. The pentatomid and forficulid occurred from 99 to 128 days after the emergence of cotton, which corresponds to the highest density of target pest insects. It was not found influence of meteorological factors or negative interactions among predaceous arthropods.

  20. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff) (Heteroptera: anthocoridae) / Crops and weeds as host plants Orius species (Heteroptera: anthocoridae)

    Scientific Electronic Library Online (English)

    Luís Cláudio Paterno, Silveira; Vanda Helena Paes, Bueno; Leonardo Santa Rosa, Pierre; Simome Martins, Mendes.

    Full Text Available O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar [...] os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say) foi coletado nas culturas de milho (Zea mays L.), milheto (Pennisetum glaucum (L.) R.Br.), sorgo (Sorghum spp.), feijão (Phaseolus vulgaris L.), girassol (Helianthus annuus L.), alfafa (Medicago sativa L.), soja [Glycine max (L.) Merr.], crisântemo (Chrysanthemum spp.), tango (Solidago canadensis L.) e cartamus (Carthamus tinctorius L.) e nas plantas invasoras picão-preto (Bidens pilosa L.), caruru (Amaranthus sp.), losna-branca (Parthenium hysterophorus L.) e apaga-fogo (Alternanthera ficoidea L.). Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter) e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen. Abstract in english The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identification [...] s of the specimens was done in the laboratory. Orius insidiosus (Say) was collected on the following crops: corn (Zea mays L.), pearl millet (Pennisetum glaucum (L.) R.Br.), sorghum (Sorghum spp.), bean (Phaseolus vulgaris L.), sunflower (Helianthus annuus L.), alfalfa (Medicago sativa L.), soybean (Glycine max (L.) Merr.), chrysanthemum (Chrysanthemum spp.), tango (Solidago canadensis L.) and carthamus (Carthamus tinctorius L.). On weeds, O. insidiosus was found on farmer's friend (Bidens pilosa L.), amaranth (Amaranthus sp.), parthenium weed (Parthenium hysterophorus L.) and Joseph's coat (Alternanthera ficoidea L.). Orius thyestes Herring was found on weed plants farmer's friend, amaranth and Joseph's coat. Orius perpunctatus (Reuter) and Orius sp. were collected mainly on weed plants (farmer's friend, amaranth and Joseph's coat) and corn. Many of these plants are natural hosts for these predators, providing refuge, prey and pollen.

  1. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff (Heteroptera: anthocoridae Crops and weeds as host plants Orius species (Heteroptera: anthocoridae

    Directory of Open Access Journals (Sweden)

    Luís Cláudio Paterno Silveira


    Full Text Available O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say foi coletado nas culturas de milho (Zea mays L., milheto (Pennisetum glaucum (L. R.Br., sorgo (Sorghum spp., feijão (Phaseolus vulgaris L., girassol (Helianthus annuus L., alfafa (Medicago sativa L., soja [Glycine max (L. Merr.], crisântemo (Chrysanthemum spp., tango (Solidago canadensis L. e cartamus (Carthamus tinctorius L. e nas plantas invasoras picão-preto (Bidens pilosa L., caruru (Amaranthus sp., losna-branca (Parthenium hysterophorus L. e apaga-fogo (Alternanthera ficoidea L.. Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen.The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identifications of the specimens was done in the laboratory. Orius insidiosus (Say was collected on the following crops: corn (Zea mays L., pearl millet (Pennisetum glaucum (L. R.Br., sorghum (Sorghum spp., bean (Phaseolus vulgaris L., sunflower (Helianthus annuus L., alfalfa (Medicago sativa L., soybean (Glycine max (L. Merr., chrysanthemum (Chrysanthemum spp., tango (Solidago canadensis L. and carthamus (Carthamus tinctorius L.. On weeds, O. insidiosus was found on farmer's friend (Bidens pilosa L., amaranth (Amaranthus sp., parthenium weed (Parthenium hysterophorus L. and Joseph's coat (Alternanthera ficoidea L.. Orius thyestes Herring was found on weed plants farmer's friend, amaranth and Joseph's coat. Orius perpunctatus (Reuter and Orius sp. were collected mainly on weed plants (farmer's friend, amaranth and Joseph's coat and corn. Many of these plants are natural hosts for these predators, providing refuge, prey and pollen.

  2. Relação predador: presa de Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) para o controle do pulgão-verde em genótipos de sorgo / Predator: prey ratios of Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) for the control of greenbug in sorghum genotypes

    Scientific Electronic Library Online (English)

    Liliane K., Figueira; Fernando M., Lara.


    Full Text Available O uso da resistência de plantas associado a agentes de controle biológico pode ser uma alternativa viável no controle de Schizaphis graminum (Rondani) em sorgo. Objetivou-se estudar diferentes relações predador:presa em genótipos de sorgo resistente (TX 430 x GR 111), moderadamente resistente (GB 3B [...] ) e suscetível (BR 007B) para o controle do pulgão-verde por Chrysoperla externa (Hagen). Para isso foram realizadas, em condições de casa-de-vegetação, liberações do crisopídeo nas relações predador:presa de 1:5; 1:10; 1:25 e 1:50. O genótipo TX 430 x GR 111 foi o mais eficiente no controle do pulgão-verde, S. graminum, assim como as relações predador:presa de 1:5 e de 1:10 nos três genótipos. A interação resistência de plantas e controle biológico foi positiva e permitiu controle acima de 80% nas relações predador:presa de 1:5 e 1:10 no material resistente TX 430 x GR 111; no genótipo GB 3B o melhor controle foi obtido com 1 predador: 5 presas. Abstract in english The use of host plant resistance associated with biocontrol agents may be a viable alternative to Schizaphis graminum (Rondani) control in sorghum. This work aimed to study different predator:prey ratios on genotype resistant (TX 430 x GR 111), moderately resistant (GB 3B) and susceptible (BR 007B) [...] for the aphid control by the predator Chrysoperla externa (Hagen). Thus, the lacewings were released at the predator:prey ratios of 1:5; 1:10; 1:25 and 1:50 under greenhouse conditions. The genotype TX x GR 111 was the most efficient to control S. graminum, as well the 1:5 and 1:10 predator: prey ratios on the three genotypes. The interaction between plant resistance and biological control with C. externa was positive and permitted a control over 80% at the predator:prey ratios of 1:5 and 1:10; on the GB 3B genotype the best control was at the 1:5 predator:prey ratio.

  3. Seletividade de Inseticidas a Brevicoryne brassicae (L.) (Hemiptera: Aphididae) e ao Predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) / Insecticide Selectivity to Brevicoryne brassicae (L.) (Hemiptera: Aphididae) and the Predator Doru luteipes (Scudder) (Dermaptera: Forficulidae)

    Scientific Electronic Library Online (English)



    Full Text Available Este trabalho teve por objetivo estudar a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Brevicoryne brassicae (L.) (Hemiptera: Aphididae), em relação a adultos e ninfas de primeiro, segundo e terceiro estádio [...] s do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarbe e deltametrina foram altamente seletivos em favor de todos os estádios de desenvolvimento de D. luteipes, sendo que o mesmo ocorreu para o acefato, com exceção de ninfas de primeiro estádio do predador às quais ele é medianamente seletivo. Dimetoato foi, em geral, medianamente seletivo enquanto metamidofós e paratiom metílico foram pouco seletivos em favor do predador. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade do dimetoato (para adultos, ninfas de primeiro e segundo estádios do predador) e metamidofós (para ninfas de terceiro estádio) apresentaram as maiores inclinações, indicando que os estádios estudados apresentam resposta homogênea a esses inseticidas. Abstract in english The objective of this work was to study the selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb to first, second, and third instar nymphs and adults of the predator Doru luteipes (Scudder) (Dermaptera: Forficulidae) in comparison with l [...] ast instar nymphs of the prey Brevicoryne brassicae (L.) (Hemiptera: Aphididae). Pirimicarb and deltamethrin were highly selective to all developmental stages of D. luteipes; the same was observed with acephate except for first instar nymphs to whom it showed median selectivity. Dimethoate showed median selectivity, but methamidophos and methyl parathion were low selective to the predator. Second and third instar nymphs and adults of D. luteipes were more tolerant to acephate, methyl parathion and pirimicarb than first instar nymphs. First and second instar nymphs showed similar tolerance to deltamethrin, dimethoate and methamidophos. Concentration-response curves for dimethoate (to adults and first and second instar nymphs) and methamidophos (to third instar nymphs) showed steeper slopes indicating an homogeneous response of these developmental stages to these insecticides.

  4. Efeito de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) alimentado com Schizaphis graminum (Rondani) (Hemiptera: Aphididae) / Effect of sorghum genotypes on the predator Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) fed on Schizaphis graminum (Rondani) (Hemiptera: Aphididae)

    Scientific Electronic Library Online (English)



    Full Text Available O trabalho objetivou avaliar o efeito indireto da resistência de genótipos de sorgo sobre o predador Chrysoperla externa (Hagen) usando o pulgão Schizaphis graminum (Rondani) como presa. Os genótipos usados no estudo foram: GR 11111 e TX 430 x GR 111 (resistentes), GB 3B (moderadamente resistente) e [...] BR 007B (suscetível). Larvas recém-eclodidas foram confinadas individualmente em recipientes de vidro e alimentadas com S. graminum, criados separadamente em cada um dos quatro genótipos. Após a emergência, os adultos obtidos de cada tratamento foram sexados e agrupados aos casais, colocados em gaiolas contendo dieta à base de levedo de cerveja e mel. Os insetos foram observados diariamente da fase jovem até o período de 60 dias após a emergência do adulto. Genótipos com maior grau de resistência proporcionaram maior consumo de pulgões pelo predador, porém menor peso a este. Quando os pulgões foram criados no genótipo resistente GR 11111, o peso das larvas, sobrevivência da pré-pupa e longevidade da fêmea do predador foram inferiores. As associações positivas observadas entre o predador, C. externa, e o genótipo resistente, TX 430 x GR 111, e entre o predador e o genótipo moderadamente resistente GB 3B, evidenciaram a possibilidade de integração entre os dois métodos de controle: resistência de plantas e controle biológico. Abstract in english The work aimed to evaluate the indirect effect of sorghum genotypes resistance on biological aspects of the predator Chrysoperla externa (Hagen) using the aphid Schizaphis graminum (Rondani) as prey. The genotypes used in the study were: GR 11111 and TX 430 x GR 111 (resistant), GB 3B (moderately re [...] sistant) and BR 007B (susceptible). Newrly hatched larvae were confined individually in glass vials and fed on S. graminum reared separately in each one of the four genotypes. After emergence, adults from each treatment were paired in cages and provided with yeast and honey. The insects were observed daily from immature phase until 60 days after adult emergence. Increases on genotype resistance rate promoted higher consumption of aphids by the predator and lesser weight. Lower larval weight, pre-pupal survival and adult longevity of the predator were verified when the aphids were reared on the genotype GR 11111. Beneficial association was observed among the predator C. externa and the resistant genotype TX 430 x GR 111 and among the predator and the moderately resistant GB 3B, thus indicating the possibility of integration between the two methods of control: host plant resistance and biological control.

  5. Predatory mites associated with Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on native solanaceous plants of coastal Pernambuco State, Brazil / Ácaros predadores associados a Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) em solanáceas nativas do litoral de Pernambuco

    Scientific Electronic Library Online (English)

    Alexsandra A., Rosa; Manoel G.C., Gondim Jr.; Komi K.M., Fiaboe; Gilberto J. de, Moraes; Markus, Knapp.


    Full Text Available Avaliou-se a ocorrência do ácaro vermelho do tomateiro (Tetranychus evansi Baker & Pritchard) e de ácaros predadores em quatro das espécies mais abundantes de solanáceas nativas do litoral de Pernambuco. Foram feitas coletas mensais de amostras de plantas de meados de setembro de 2002 a fins de maio [...] de 2003, nos municípios de Aliança, Carpina, Camaragibe, Goiana, Igarassu e Recife. Foram encontrados 5.485 ácaros pertencentes a mais de 27 espécies, das quais as mais numerosas foram as espécies fitófagas T. evansi e Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), e as espécies predadoras Asca sp. (Ascidae), Phytoseius guianensis De Leon e Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (ambos Phytoseiidae). Índices de associação negativos foram determinados entre T. evansi e quatro espécies de fitoseídeos predadores [as três mais numerosas encontradas neste estudo assim como Phytoseiulus macropilis (Banks)]. Foram também realizados testes em laboratório para se avaliar a aceitação de Tetranychus urticae Koch e T. evansi como presas àqueles predadores. Apenas P. macropilis sobreviveu e ovipositou adequadamente quando alimentado com T. urticae. Embora conseguissem se manter vivos por alguns dias quando alimentados com T. evansi, os níveis de reprodução dos quatro predadores foram muito baixos. Esses resultados indicam que embora encontrados comumente sobre solanáceas no campo, aqueles predadores alimentam-se muito pouco ou não se alimentam de T. evansi na natureza. Abstract in english The occurrence of the tomato red spider mite (Tetranychus evansi Baker & Pritchard) and predatory mites on four of the most abundant native solanaceous plants in coastal Pernambuco, Brazil, was evaluated. Monthly samples were collected from mid September 2002 to late May 2003 in Aliança, Carpina, Ca [...] maragibe, Goiana, Igarassu and Recife. A total of 5,485 mites of more than 27 species were found, of which the most common were the phytophagous species T. evansi and Brevipalpus phoenicis (Geijskes) (Tenuipalpidae), and the predaceous species Asca sp. (Ascidae), Phytoseius guianensis De Leon and Paraphytoseius orientalis (Narayanan, Kaur & Ghai) (both Phytoseiidae). Negative indexes of association were determined between T. evansi and each of four species of predaceous phytoseiids [i.e., the three most numerous species found in this study as well as Phytoseiulus macropilis (Banks)]. Laboratory tests were also conducted to evaluate the acceptability of Tetranychus urticae Koch and T. evansi as prey by the four predatory species. Only P. macropilis survived and oviposited well when fed T. urticae. Although they were able to remain alive for some days when fed T. evansi, the reproduction levels of the four predator species were very low. These results suggest that despite being commonly found on solanaceous plants in the field, these predators feed very little or do not feed at all on T. evansi in nature.

  6. Harmonia axyridis em árvores frutíferas e impacto sobre outros coccinelídeos predadores / Harmonia axyridis in fruit trees and impact on other predator coccinellids

    Scientific Electronic Library Online (English)

    Julianne, Milléo; Jana Magaly Tesserolli de, Souza; Ivana de Freitas, Barbola; Patrícia Elizabeth, Husch.


    Full Text Available O objetivo deste trabalho foi avaliar a flutuação populacional de Harmonia axyridis em árvores frutíferas, durante dois anos (2004-2006), relacioná-la a variáveis abióticas e avaliar sua influência sobre outros coccinelídeos predadores, em Ponta Grossa, PR. H. axyridis representou 38% dos Coccinelli [...] dae. Houve diferença significativa na freqüência relativa da espécie entre os anos de coleta, que passou de 0,20 para 0,67 de um ano ao outro. Houve correlação positiva significativa entre abundância de H. axyridis e temperatura média, nas plantas cítricas, e correlação negativa significativa entre abundância de H. axyridis e umidade relativa do ar, nas plantas não cítricas. H. axyridis exerce impacto negativo sobre as joaninhas locais. Abstract in english The objective of this work was to evaluate the population fluctuation of Harmonia axyridis in fruit trees, during two years (2004-2006), to relate it with abiotic variables and to assess its influence on the other predator coccinellids, in Ponta Grossa, PR, Brazil. H. axyridis represented 38% in Coc [...] cinellidae. There was significant difference in the relative frequency of the species between the sampling years, which changed from 0.20 to 0.67, from one year to the other. There was positive significative correlation between H. axyridis abundance and mean temperature, in citric plants, and negative significative correlation between H. axyridis abundance and air relative humidity, in noncitric plants. H. axyridis causes negative impact on local ladybugs.

  7. Seletividade de inseticidas a Podisus rostralis (Stal (Heteroptera: Pentatomidae predador de lagartas desfolhadoras de eucalipto Selectivity of insecticides to Podisus rostralis (Stal (Heteroptera: Pentatomidae predator of eucalyptus-defoliating caterpillars

    Directory of Open Access Journals (Sweden)

    Alfredo Henrique Rocha Gonring


    Full Text Available O objetivo deste trabalho foi estudar a seletividade fisiológica dos inseticidas deltametrina, fenitrotiom, malatiom e permetrina em favor de ninfas (3º e 5º instares e adultos (fêmeas e machos do predador Podisus rostralis, empregando-se 50 (subconcentração e 100% da concentração usada no controle de lagartas desfolhadoras de eucalipto. Deltametrina foi seletivo em favor de ninfas de 3º e 5º instares e adultos (1,94, 0,00 e 7,87% de mortalidade, respectivamente do predador. Permetrina foi seletivo em favor de ninfas de 5º instar (3,55% de mortalidade e medianamente seletivo em favor de ninfas de 3º instar e adultos (28,22 e 32,08% de mortalidade, respectivamente do predador. Malatiom foi medianamente seletivo em favor de ninfas de 5º instar (49,38% de mortalidade e não-seletivo em favor de ninfas 3º instar e adultos (95,34 e 88,99% de mortalidade, respectivamente do predador. Fenitrotiom não foi seletivo em favor de nenhum dos instares do predador (100% de mortalidade. A alta toxicidade do fenitrotiom a P. rostralis não foi reduzida quando o predador foi exposto a 50% da concentração recomendada deste inseticida. O impacto do malatiom (a ninfas de 3º instar e adultos e permetrina (a fêmeas sobre P. rostralis diminuiu quando estas fases do predador foram expostas à metade das concentrações desses inseticidas. O impacto do deltametrina não foi afetado por sua concentração. Ninfas de 3º instar e adultos foram menos tolerantes do que ninfas de 5º instar ao malatiom e permetrina. As fêmeas de P. rostralis foram mais tolerantes que os machos à concentração do malatiom e à subconcentração de permetrina.The objective of this work was to study the physiological selectivity of deltamethrin, fenitrothion, malathion, and permethrin to nymphs (third and fifth instars and adults (females and males of the predator Podisus rostralis. The insecticides were used in concentrations corresponding to 50 and 100% of the concentration used for control of eucalyptus-defoliating caterpillars. Deltamethrin was selective to third and fifth instar nymphs and adults of the predator (1.94, 0.00 and 7.87% of mortality, respectively. Permethrin was selective in favor of fifth instar nymphs (3.55% of mortality, and showed median selectivity in favor of third instar nymphs and adults of the predator (28.22 and 32.08% of mortality. Malathion was medially selective to fifth instar nymphs (49.38% of mortality, but was not selective to fifth instar nymphs and adults of the predator (95.34 and 88.99% of mortality. Fenitrothion was not selective to any instar of P. rostralis (100% of mortality. The high toxicity of fenitrothion to this predator did not decrease when the lowest concentration was used, but the impact of malathion (to third instar nymphs and adults and permethrin (to females of P. rostralis was reduced when these instars were exposed to half of the concentrations of these insecticides. The impact of deltamethrin was not affected by the concentration. Finally, third instar nymphs and adults were less tolerant to malathion and permethrin than fifth instar nymphs of the predator; females of P. rostralis were more tolerant than males to the recommended concentration of malathion and to half permethrin.

  8. Reproductive characteristics of the predator Podisus nigrispinus fed with an insect resistant soybean variety Características reprodutivas do predador Podisus nigrispinus alimentado com variedade de soja resistente a insetos

    Directory of Open Access Journals (Sweden)

    Fausto da Costa Matos Neto


    Full Text Available The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1 females of P. nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae caterpillars reared on leaves of this variety; T2 females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.O objetivo desta pesquisa foi avaliar o efeito do genótipo IAC 17, resistente a insetos, nas características reprodutivas de fêmeas de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae, utilizando o genótipo susceptível UFV 16 como controle. Os tratamentos foram: T1 fêmeas de P. nigrispinus alimentadas com plantas de UFV 16 e lagartas de Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae, criadas em folhas desta cultivar; T2 fêmeas de P. nigrispinus alimentadas com plantas de IAC 17, e lagartas de A. gemmatalis, criadas em folhas desta cultivar. Avaliou-se a longevidade das fêmeas, períodos de pré-oviposição, oviposição e pós-oviposição, número de ovos e de posturas/fêmea, peso dos ovos, intervalo entre posturas, número de ovos/postura, porcentagem de ovos eclodidos, número de ninfas/fêmea e número total de presas mortas/fêmea de P. nigrispinus. A maioria das características avaliadas mostrou resultados semelhantes entre tratamentos, exceto o período de oviposição, que foi mais longo para fêmeas criadas no genótipo resistente que no susceptível, e a porcentagem de fêmeas que ovipositaram antes de morrer, que foi menor na IAC 17. Além disso, o genótipo IAC 17 causou maior mortalidade de fêmeas de P. nigrispinus no início de sua fase adulta e distribuição mais uniforme da produção de ovos ao longo do período adulto desse predador. Por outro lado, os resultados não sugerem efeito desse genótipo na prole do predador.

  9. Reproductive characteristics of the predator Podisus nigrispinus fed with an insect resistant soybean variety / Características reprodutivas do predador Podisus nigrispinus alimentado com variedade de soja resistente a insetos

    Scientific Electronic Library Online (English)

    Fausto da Costa, Matos Neto; José Cola, Zanuncio; Marcelo Coutinho, Picanço; Ivan, Cruz.


    Full Text Available O objetivo desta pesquisa foi avaliar o efeito do genótipo IAC 17, resistente a insetos, nas características reprodutivas de fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), utilizando o genótipo susceptível UFV 16 como controle. Os tratamentos foram: T1) fêmeas de P. nigrispinus [...] alimentadas com plantas de UFV 16 e lagartas de Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae), criadas em folhas desta cultivar; T2) fêmeas de P. nigrispinus alimentadas com plantas de IAC 17, e lagartas de A. gemmatalis, criadas em folhas desta cultivar. Avaliou-se a longevidade das fêmeas, períodos de pré-oviposição, oviposição e pós-oviposição, número de ovos e de posturas/fêmea, peso dos ovos, intervalo entre posturas, número de ovos/postura, porcentagem de ovos eclodidos, número de ninfas/fêmea e número total de presas mortas/fêmea de P. nigrispinus. A maioria das características avaliadas mostrou resultados semelhantes entre tratamentos, exceto o período de oviposição, que foi mais longo para fêmeas criadas no genótipo resistente que no susceptível, e a porcentagem de fêmeas que ovipositaram antes de morrer, que foi menor na IAC 17. Além disso, o genótipo IAC 17 causou maior mortalidade de fêmeas de P. nigrispinus no início de sua fase adulta e distribuição mais uniforme da produção de ovos ao longo do período adulto desse predador. Por outro lado, os resultados não sugerem efeito desse genótipo na prole do predador. Abstract in english The objective of this research was to evaluate the effect of the insect resistant soybean genotype IAC 17 on reproductive characteristics of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females compared to the soybean insect susceptible genotype UFV 16. Treatments were: T1) females of P. [...] nigrispinus fed on plants of the UFV 16 and Anticarsia gemmatalis Hübner (Lepidoptera: Noctuidae) caterpillars reared on leaves of this variety; T2) females of P. nigrispinus fed on plants of the IAC 17 and A. gemmatalis caterpillars reared on leaves of this variety. Longevity of females, pre-oviposition, oviposition and pos-oviposition periods, number of eggs and egg masses/female, egg weight, interval between egg mass laying, number of eggs/egg mass, percentage of nymphs, number of nymphs/female and total number of prey killed/female of P. nigrispinus were evaluated. Most of the characteristics evaluated showed similar results between treatments, but the oviposition period was longer for females reared on the resistant genotype than on the susceptible one and the percentage of total females that laid eggs was lower on the IAC 17. Also, the resistant genotype caused higher mortality of P. nigrispinus females at the beginning of its adult stage and egg production by females of this predator was better spread along its adult stage with this resistant genotype. On the other hand, results suggest no effect of the resistant genotype on the offspring of this predator.

  10. Artrópodes fitófagos e predadores associados em 20 acessos Luffa sp. em sistema orgânico / Phytophagous and predators arthropods associated in 20 accesses of Luffa sp in organic system

    Scientific Electronic Library Online (English)

    Germano Leão Demolin, Leite; Elwira Daphinn Silva, Moreira; Verônica Alves, Mota; Izabel Cristina Pereira Vaz, Ferreira; Cândido Alves da, Costa.


    Full Text Available Os objetivos desta pesquisa foram verificar os artrópodes fitófagos e seus predadores em 20 acessos de bucha vegetal Luffa sp. (Cucurbitaceae), a distribuição destes no dossel das plantas em cultivo orgânico e a produção de frutos dos acessos. O experimento foi em blocos casualizados com 20 tratamen [...] tos e quatro repetições. Os tratamentos foram os acessos P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 e P32, provenientes da Embrapa (CENARGEN, DF), e P01, P02, P04, P05, P06 e P07, obtidos em Porteirinha-MG. As parcelas foram compostas por quatro plantas de Luffa sp. A maior abundância de Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) foi observada nas folhas do acesso P467 em referência aos demais acessos de Luffa sp. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) foi mais observada nas flores dos acessos P01, P03, P30, P32, P263 e P569 e menos abundantes nos acessos P05, P125, P159, P304, P446 e P570. Os acessos de Luffa sp. com maior número de frutos/planta foram P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 e P570. Os predadores aranhas e Coccinellidae (Coleoptera) bem como o fitófago Cicadellidae (Hemiptera) preferiram atacar a face adaxial, sendo que não se detectou diferença estatística entre as faces para os demais artrópodes. T. spinipes esteve mais presente na parte apical do dossel das plantas. Com esses resultados, o acesso P06 é o mais indicado para o cultivo, pois foi um dos que apresentou maiores produtividades e menores taxas de ataque de insetos. Abstract in english The objectives of this research were to verify the phytophagous arthropods and their predators in 20 accesses of vegetable loofah Luffa sp. (Cucurbitaceae), the distribution of the canopy of the plants in organic system and the production of fruits of the accesses. The experiment was in randomized b [...] locks designed with 20 treatments and four replicates. The treatments were the accesses P159, P304, P466, P03, P570, P569, P467, P30, P446, P495, P125, P263, P644 and P32, from Embrapa (CENARGEN, DF, Brazil) and P01, P02, P04, P05, P06 and P07, obtained in Porteirinha, MG, Brazil. Each plot consisted of four plants Luffa sp. The greatest abundance of Diabrotica speciosa (Germar) (Coleoptera: Chrysomelidae) was observed in leaves of the access P467 in reference to the others accessions of Luffa sp.. Trigona spinipes (Fabricius) (Hymenoptera: Apidae) was observed in most flowers of accesses P01, P03, P30, P32, P263 and P569 and less abundant in accesses P05, P125, P159, P304, P446 and P570. The accesses of Luffa sp. highest number of fruits per plant were P01, P03, P05, P06, P07, P30, P32, P125, P263, P446 and P570. The spiders and predatory Coccinellidae (Coleoptera) and the phytophagous Cicadellidae (Hemiptera) preferred to attack the adaxial side, but no statistical difference was detected between the faces to the other arthropods. T. spinipes was present in the apical part of the plant canopy. With these results, access P06 is the most suitable for cultivation, because it was one of those with higher yields and lower rates of insect attack.

  11. Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae) em diferentes temperaturas / Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae) under different temperatures

    Scientific Electronic Library Online (English)

    José Wagner da Silva, Melo; Cleiton Araújo, Domingos; Andreia Serra, Galvão; Manoel Guedes Corrêa, Gondim Junior; Gilberto José de, Moraes.


    Full Text Available Euseius alatus DeLeon (Acari: Phytoseiidae) é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avalia [...] r o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e 33ºC, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30ºC mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatus em laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro. Abstract in english Euseius alatus DeLeon (Acari: Phytoseiidae) is one of the most common predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effe [...] ct of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33ºC; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility life table, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

  12. Biologia do ácaro predador Euseius alatus DeLeon (Acari: Phytoseiidae em diferentes temperaturas = Biology of predator mite Euseius alatus DeLeon (Acari: Phytoseiidae under different temperatures

    Directory of Open Access Journals (Sweden)

    José Wagner da Silva Melo


    Full Text Available Euseius alatus DeLeon (Acari: Phytoseiidae é um dos predadores mais comuns em fruteiras no Brasil, alimentando-se de pólen, ácaros e outros pequenos artrópodes. Este predador apresenta ampla distribuição, ocorrendo desde o Rio Grande do Sul até o Ceará. O presente trabalho teve como objetivo avaliar o efeito da temperatura no desenvolvimento e na reprodução de E. alatus e determinar suas exigências térmicas. O estudo foi conduzido a 18, 21, 24, 27, 30 e33°C, umidade relativa de 70 ± 5% e fotofase de 12h. Nessas temperaturas, o período de ovoadulto durou 14,0; 8,1; 5,5; 4,9; 3,8 e 3,1 dias, respectivamente. Os estágios de ovo, larva, protoninfa, deutoninfa e período de ovo-adulto apresentaram limiares térmicos de 12,52; 13,85; 14,86; 14,86 e 13,31ºC e constantes térmicas de 22,32; 14,23; 16,23; 17,3 e 70,16 graus dias. Os valores para os parâmetros da tabela de vida de fertilidade, analisados em conjunto com os valores das diferentes variáveis de desenvolvimento em diferentes temperaturas, permitiram concluir que a temperatura de 30°C mostrou-se mais adequada ao desenvolvimento e reprodução de E. alatusem laboratório. Logo, tudo indica que E. alatus encontra melhores condições de temperatura para se desenvolver em regiões mais quentes do Brasil, como as preponderantes no Nordeste brasileiro.Euseius alatus DeLeon (Acari: Phytoseiidae is one of the mostcommon predators of tropical fruit trees in Brazil, feeding of pollen, mites and other small arthropods. This predator presents wide distribution, occurring from Rio Grande do Sul to Ceará. This work had as objective to evaluate the effect of temperature on the development and reproduction of E. alatus, in addition to determining their thermal requirements. The study was accomplished at temperatures of 18, 21, 24, 27, 30 and 33°C; relative humidity of 70 ± 5%; and 12-h photophase. At these temperatures, the egg-adult period lasted 14.0; 8.1; 5.5; 4.9; 3.8 and 3.1 days, respectively. The egg, larva, protonymph and deutonymph stages and the egg-adult period presented thermal thresholds of 12.52; 13.85; 14.86; 14.86 and 13.31ºC, and thermal constants of 22.32; 14.23; 16.23; 17.3 and 70.16 degrees days. The values for the parameters of the fertility lifetable, analyzed in conjunction with the values of the different variables of development at different temperatures, showed that the temperature of 30ºC is the most suitable for development and reproduction of E. alatus in the laboratory. Therefore, is it apparent that the best temperature conditions for the development of E. alatus are found in the warmer regions of Brazil, such as those observed in northeastern Brazil.

  13. Dark clouds and their silver linings: exotic generalist predators in augmentative biological control / Das nuvens escuras um raio de luz: controle biológico por aumento da população de predadores generalistas exóticos

    Scientific Electronic Library Online (English)



    Full Text Available Vários artrópodos predadores polífagos estão disponíveis para uso em controle biológico pelo aumento da população, com o objetivo de controlar ácaros e insetos-praga em ampla variedade de culturas. Muitos desses predadores não são nativos da área onde serão introduzidos. Neste artigo discutem-se os [...] beneficios e os riscos do uso de predadores generalistas exóticos como agentes de biocontrole. O fato de os predadores polífagos serem criados facilmente em alimento não-natural e poderem ser usados contra diferentes espécies de pragas, faz com que eles se tornem atrativos para comercialização. Predadores polífagos ou fitófagos facultativos apresentam menor dificuldade em se manterem na presença de baixas populações das presas e podem ser introduzidos nas culturas antes que a praga-alvo esteja presente, evitando o crescimento de populações de pragas que possam causar danos econômicos. Por outro lado, espécies generalistas podem interferir com outras espécies benéficas na cultura e espécies facultativas podem, excepcionalmente, causar danos às culturas. O uso de inimigos naturais não-nativos pode envolver riscos ambientais. Procedimentos para a avaliação de riscos, enfocando principalmente a amplitude de hospedeiros, têm sido implementados em um número crescente de países. A avaliação da especificidade hospedeira, entretanto, deve ser conduzida em condições reais. Em adição, a adequabilidade do clima, a habilidade de dispersão de um predador importado e a presença de seus inimigos naturais na área de introdução são fatores importantes quando se avaliam os riscos ambientais. As normas reguladoras são essenciais mas não devem dificultar a implementação do controle biológico como alternativa ao controle químico de pragas. Abstract in english Several polyphagous arthropod predators are commercially available for augmentative biological control targeting mite and insect pests in a variety of cropping systems. A number of these predators are not native to the area of release. The current paper discusses benefits and risks of using exotic g [...] eneralist predators as biocontrol agents. The fact that polyphagous predators are easily reared on unnatural foods and can be used against different pest species makes them attractive for commercialization. Polyphagous or facultatively phytophagous predators have less difficulty in maintaining their populations at low prey densities and can sometimes be introduced in the crop before the target pest is present, thus preventing the buildup of pest populations before economic damage is done. On the other hand, generalists may interfere with the action of other beneficials in the crop, and facultative plant feeding by predatory arthropods exceptionally causes crop damage. The use of non-native natural enemies may entail environmental risks. In a growing number of countries, risk assessment procedures are being implemented that are largely focused on host range testing. It is emphasized, however, that the experimental evaluation of host specificity should be done under realistic conditions. Furthermore, climatic matching and dispersal ability of an imported predator and the presence of its natural enemies in the area of introduction are important factors to be considered when assessing environmental risks. Regulation is essential but should not hamper the implementation of biological control as an alternative to chemical pest control.

  14. Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl (Heteroptera:Pentatomidae Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl (Heteroptera:Pentatomidae

    Directory of Open Access Journals (Sweden)

    Francisco Roberto de Azevedo


    Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl. Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molitor com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps.The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl. The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius cincticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

  15. Efeitos da temperatura e da defesa da presa no consumo pelo predador Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae) / Effects of temperature and of the prey defense on the consumption by the predator Supputius cincticeps (Stäl) (Heteroptera:Pentatomidae)

    Scientific Electronic Library Online (English)

    Francisco Roberto de, Azevedo; Francisco de Sousa, Ramalho.


    Full Text Available A pesquisa objetivou determinar se a temperatura e a defesa da presa afetam o consumo e a utilização de larvas de Tenebrio molitor L. por ninfas de Supputius cincticeps (Stäl). Quantificaram-se em cada um dos ínstares do predador Supputius cincticeps os consumos bruto e diário das larvas de T. molit [...] or com e sem defesa, ganho de peso total e ganho de peso diário pelo predador. Foram determinados os efeitos da defesa da presa e da temperatura ambiente no consumo de alimento pelas ninfas de 2º, 3º, 4º e 5º ínstares de S. cincticeps. A pesquisa foi conduzida na Unidade de Controle Biológico da Embrapa-Centro Nacional de Pesquisa de Algodão, em Campina Grande, PB, a 20, 25, e 30ºC, 60±10% UR e fotofase de 14 horas. Os resultados mostraram que o consumo bruto de larvas de T. molitor pelo S. cincticeps depende do ínstar do predador e da temperatura, do ínstar do predador e da defesa da presa, e da temperatura e defesa da presa; o consumo diário de S. cincticeps depende do ínstar do predador e da temperatura, e do ínstar do predador e da defesa da presa, e o ganho de peso de S. cincticeps depende do seu ínstar, da temperatura e da defesa apresentada pelas larvas de T. molitor. O tamanho das larvas de T. molitor funciona como defesa ao ataque de S. cincticeps. Abstract in english The objective of the research was to determine if the temperature and pray defense affect the consumption and utilization of Tenebrio molitor L. larvae by nymphs of Supputius cincticeps (Stäl). The gross and daily consumptions of T. molitor larvae with and without defense by the predator Supputius c [...] incticeps, and the gross and daily weight gains of the predator were quantified. Effects of the prey defense and temperature on the food consumption by the 2nd, 3rd, 4th and 5th instar nimphs of S. cincticeps were determined. The research was carried out in the Biological Control Unit of the Embrapa-Centro Nacional de Pesquisa de Algodão, at Campina Grande, PB, Brazil, at 20, 25, and 30°C, 60±10% RH and 14L:10D photoperiod. The results showed that the gross consumption of T. molitor larvae by S. cincticeps depends on the predator instar and on temperature, on the predator instar and on the prey defense, and on temperature and on the prey defense; the daily consumption of S. cincticeps depends on its instar and on temperature, and on its instar and on the prey defense; and S. cincticeps weight gain depends on its instar, on temperature and on the prey defense. The size of T. molitor larvae works as a defense to attack of S. cincticeps.

  16. Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae) / Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Anderson Mathias, Holtz; Gustavo Dias de, Almeida; Marcos Antonio Matiello, Fadini; José Cola, Zanuncio; José Salazar, Zanuncio-Júnior; Gilberto Santos, Andrade.


    Full Text Available O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae) foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae) em plantas de Eucalyptus urophylla no campo ou, apenas, em lab [...] oratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e a fertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas). A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto. Abstract in english The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae) pupae on Eucalyptus urophylla plants in the field or only with pupae of this p [...] rey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions) only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.

  17. Phytophagy on eucalyptus plants increases the development and reproduction of the predator Podisus nigrispinus (Hemiptera: Pentatomidae = Fitofagia em plantas de eucaliptos aumenta o desenvolvimento e a reprodução do predador Podisus nigrispinus (Hemiptera: Pentatomidae.

    Directory of Open Access Journals (Sweden)

    Anderson Mathias Holtz


    Full Text Available The effect of plant feeding on biological aspects of Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae was evaluated. Nymphs and adults of this predator were fed with Tenebrio molitor L. (Coleoptera: Tenebrionidae pupae on Eucalyptus urophylla plants inthe field or only with pupae of this prey in the laboratory. The development and nymphal survival, as well as the pre-oviposition period, number of egg masses, number, fertility and viability of eggs and the longevity of females of this predator were evaluated. The eucalyptus plants improved the development of P. nigrispinus. This demonstrates that this predator can present higher population growth with eucalyptus plants and T. molitor pupae than in the laboratory (controlled conditions only with this prey. These plants can supply nutrients that can the population growth and efficiency of P. nigrispinus for biological control in eucalyptus plantations.O efeito da alimentação em plantas sobre os aspectos biológicos de Podisus nigrispinus (Hemiptera: Pentatomidae foi avaliado. Ninfas e adultos desse predador foram alimentados com pupas de Tenebrio molitor L. (Coleotpera: Tenebrionidae em plantas de Eucalyptus urophylla no campo ou, apenas, em laboratório. O desenvolvimento e a sobrevivência ninfal desse predador, além do período de pré-oviposição, número de posturas, viabilidade dos ovos e afertilidade e longevidade de fêmeas foram avaliados. A planta de eucalipto proporcionou um incremento no desenvolvimento de P. nigrispinus. Isto demonstra que esse predador pode apresentar maior crescimento populacional com plantas de eucalipto e pupas de T. molitor alimentado com apenas a presa (condições controladas. A planta pode fornecer nutrientes que aumentam o crescimento populacional e a eficiência de P. nigrispinus para o controle biológico em plantios de eucalipto.


    Scientific Electronic Library Online (English)



    Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-d [...] os-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies Abstract in english Through the bioassays, it was verified the residual contact, ovicidal and persistence effects of the products chlorfenapyr and fenbutatin-oxide on two species of predaceous mites, Iphiseiodes zuluagai Denmark & Muma and Euseius alatus DeLeon (Acari: Phytoseiidae), associated to the citrus leprosis m [...] ite Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). The adult total effect was studied through the residual spray contact method in glass surface, according to IOBC methodology. Ovicidal effect was evaluated through direct spray on the predators mite eggs, also in glass surface. Persistence of the products was evaluated, in laboratory conditions, in arenas made with sprayed orange leaves in the field at 0, 5, 15 and 30 days after the application. Results showed that chlorfenapyr was noxious to I. zuluagai and E. alatus, and fenbutatin-oxide was slightly harmful to E. alatus and innocuous to I. zuluagai. None of the products presented ovicidal effect. Fenbutatin-oxide presented low persistence to both predators mite species, and chlorfenapyr in the smallest rate (31.3 ml) was of low persistence and in the great one (62.5 ml) moderately persistent. Fenbutatin-oxide was innocuous and slightly harmful to the predaceous mites I. zuluagai and E. alatus, respectively, and of low persistence for both species

  19. Efeitos de Metarhizium anisopliae (Metsch.) Sorok. e Beauveria bassiana (Bals.) Vuill. sobre o percevejo predador Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) / Effects of Metarhizium anisopliae (Metsch.) Sorok. and Beauveria bassiana (Bals.) Vuill. on the predatory stinkbug Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Ítalo W.B., França; Edmilson J., Marques; Jorge B., Torres; José V., Oliveira.


    Full Text Available Fungos entomopatogênicos e o percevejo predador Podisus nigrispinus (Dallas) podem ocorrer simultaneamente nos agroecossistemas infectando o mesmo inseto alvo ou alvos diferentes. O contato durante a disseminação do fungo ou pulverização, caminhamento em superfícies vegetais tratadas e predação de i [...] ndivíduos contaminados estão entre as possíveis vias de interação entre fungos entomopatogênicos e percevejos predadores. Este trabalho avaliou o impacto de três isolados de cada um dos fungos Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 e 1189) e Beauveria bassiana (Bals.) Vuill. (604, 634 e 561) sobre ninfas e adultos de P. nigrispinus pelas vias de contato, residual seco e ingestão de presas contaminadas, em laboratório. M. anisopliae ocasionou maior mortalidade do predador que B. bassiana, tanto por contato como por resíduo seco do fungo. Entre as vias de infecção dos fungos o contato causou maior mortalidade do predador. Não houve confirmação de mortalidade de adultos em nenhuma das vias de infecção pelos isolados testados. A predação de larvas de Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminadas com os fungos afetou a produção de ovos das fêmeas adultas, porém o mesmo não foi constatado quando adultos alimentaram-se de presas contaminadas. Os resultados sugerem que isolados de M. anisopliae podem causar mortalidade de ninfas de P. nigrispinus por contato, enquanto os isolados de B. bassiana foram de menor impacto em todas as vias de infecção estudadas, comparados aos isolados de M. anisopliae. Abstract in english Entomopathogenic fungi and the predatory stinkbug Podisus nigrispinus (Dallas) can target simultaneously the same or different pests in agroecosystems. Topical contact during fungal dispersion or spraying, walking on plant surfaces and ingestion of contaminated prey are some of possible ways of inte [...] ractions between fungi and the predatory stinkbug. The impact of three isolates of Metarhizium anisopliae (Metsch.) Sorok. (866, 1022 and 1189) and Beauveria bassiana (Bals.) Vuill. (604, 634 and 561) against nymphs and adults of P. nigrispinus was investigated under laboratory conditions. M. anisopliae caused higher mortality compared to B. bassiana either by topical application or by dry residue on cotton leaves. Topic contact with both fungi caused higher mortality to the predator. No mortality confirmation was reported for the adults. Nymphs fed with cotton leafworm larvae Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) contaminated by the fungi had their reproduction affected, but this was not observed when adult predators fed on contaminated larvae. These findings suggest that isolates of M. anisopliae can cause mortality of P. nigrispinus nymphs by topical contact, while isolates of B. bassiana were less harmful by all ways of infection as compared to M. anisopliae.

  20. Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae e ácaros predadores da família Phytoseiidae Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae and mites predators from the family Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Hilda Maria Brito


    Full Text Available A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks, foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L. DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores.The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L. DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

  1. Toxicidade de natuneem sobre Tetranychus urticae Koch (Acari: Tetranychidae) e ácaros predadores da família Phytoseiidae / Toxicity of the natuneem over the Tetranychus urticae Koch (Acari: Tetranychidae) and mites predators from the family Phytoseiidae

    Scientific Electronic Library Online (English)

    Hilda Maria, Brito; Manoel Guedes Corrêa, Gondim Junior; José Vargas de, Oliveira; Cláudio Augusto Gomes da, Câmara.


    Full Text Available A toxicidade de diferentes concentrações de Natuneem a Tetranychus urticae Koch e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks), foi estudada. Foi avaliada a toxicidade sobre ovos, e o efeito residual e repelente, sobre adultos. O tratamento dos ovos consistiu na [...] imersão em diluições de Natuneem por cinco segundos, e o efeito residual e repelente sobre adultos consistiu na imersão de discos de folhas de Canavalia ensiformes (L.) DC. também em diluições por cinco segundos. Natuneem foi repelente para T. urticae e E. alatus, quando testado nas concentrações de 0,25; 0,50 e 1,00%, e exibiu efeito neutro para P. macropilis. A toxicidade de Natuneem a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. A fecundidade de T. urticae foi reduzida significativamente por Natuneem em todas as concentrações, enquanto para os ácaros predadores a redução foi significante apenas nas maiores concentrações. Natuneem, nas concentrações testadas, apresentou melhor ação sobre o ácaro-rajado e menor impacto para os ácaros predadores. Abstract in english The toxicity of the Natuneem at different concentrations for both Tetranychus urticae Koch and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) were studied. The toxicity on eggs, and the residual and repellent effects on adults was evaluated. Egg treatment consisted on [...] dipping eggs into Natuneem dilutions for five seconds; and residual and repellent effects for adults consisted on dipping leaf discs of Canavalia ensiformes (L.) DC. into the dilutions for five seconds. Natuneem was repellent for T. urticae and E. alatus at the concentrations 0.25, 0.50 and 1.0%, and exhibited neutral effect on P. macropilis. The toxicity of Natuneem on eggs and adults was greater for T. urticae compared to the toxicity on predatory mites. The fecundity of T. urticae was reduced significantly by Natuneem in all concentration. On predatory mites significant reduction on its fecundity was found at the highest concentrations evaluated. Natuneem was performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites under the conditions studied.

  2. Seletividade de inseticidas a Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predador de Ascia monuste orseis (Godart) (Lepidoptera: Pieridae) / Selectivity of insecticides to Polybia ignobilis (Haliday) (Hymenoptera: Vespidae) predator of Ascia monuste orseis (Godart) (Lepidoptera: Pieridae)

    Scientific Electronic Library Online (English)

    Marcelo, Picanço; Luciano J., Ribeiro; Germano L.D., Leite; Marcos R., Gusmão.


    Full Text Available Avaliou-se a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom ao predador Polybia ignobilis (Haliday) em dosagens que causaram 90% de mortalidade em lagartas de 4º e 5º ínstares de Ascia monuste orseis (Godart). Os inseticidas paratiom metílico (cerca d [...] e 86% mortalidade) e carbaril (cerca de 62% de mortalidade) não foram seletivos a P. ignobilis. Os inseticidas mais seletivos foram triclorfom e permetrina (4% de mortalidade do predador). Deltametrina apresentou grau de seletividade intermediária (26% de mortalidade). Adultos de P. ignobilis com listras amareladas (38% de mortalidade) foram mais tolerantes a carbaril que adultos que não apresentavam tal característica (86%). Abstract in english The selectivity of carbaryl, deltamethrin, methyl parathion, permethrin and thrichlorfon to the predator Polybia ignobilis (Haliday) was evaluated in dosages which killed 90% of 4th and 5th instars of Ascia monuste orseis (Godart). Methyl parathion (86% average mortality) and carbaryl (62%) were not [...] selective to P. ignobilis; thrichlorfon and permethrin (4%) were more selective while deltamethrin showed intermediate selectivity (26% average mortality). Adults of P. ignobilis with yellow strips (38%) were more tolerant to carbaryl than those without this characteristic (86% average mortality).


    Directory of Open Access Journals (Sweden)

    Érico Amaral


    Full Text Available

    Esta nota prévia apresenta alguns dados bionômicos do predador de abelhas Apiomerus nigrilobus Stal, 1872 obtidos sob condições de laboratório. O estudo foi realizado no Departamento de Entomologia da Escola Superior de Agricultura “Luiz de Queiroz” da Universidade do Estado de São Paulo, no período de março de 1972 a dezembro de 1973. O ciclo biológico médico constatado para este predador foi de 246 dias. Os autores apresentam três quadros que resumem os dados obtidos.

    This preliminary note presents some bionomics data of the honeybee predator Apiomerus nigrilobus Stal, 1872 obtained in laboratory. The study was conducted at the Agricultural College ";Luiz de Queiroz” U.S.P. — São Pau1o, Brazil, from March 1972 to December 1973. The evolutionary cycle of this predator, on an average, is 246 days. A table is presented showing the results.

  4. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa

    Directory of Open Access Journals (Sweden)

    M. Florencia Grandi


    Full Text Available Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American sea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predatorio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica.

  5. Ácaros predadores e o fungo Neozygites floridana associados a tetraniquídeos em soja no Rio Grande do Sul / Predatory mites and the fungus Neozygites floridana associated with spider mites on soybean, in Rio Grande do Sul, Brazil

    Scientific Electronic Library Online (English)

    Samuel, Roggia; Jerson Vanderei Carús, Guedes; Rejane Cristina Roppa, Kuss Roggia; Geraldo José Nascimento de, Vasconcelos; Denise, Navia; Italo, Delalibera Junior.


    Full Text Available O objetivo deste trabalho foi verificar a ocorrência de ácaros predadores e do fungo Neozygites floridana, associados a ácaros tetraniquídeos, em soja (Glycine max L.), no Estado do Rio Grande do Sul. Entre 2003 e 2005, foram avaliadas amostras de folhas de soja das principais regiões produtoras do [...] Estado. Essas amostras foram coletadas de diferentes posições da planta e aleatoriamente na lavoura. As espécies de ácaros predadores encontradas foram: Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis e Galendromus annectens. O fungo N. floridana apresentou ampla distribuição e ocorreu em todas as espécies de tetraniquídeos encontradas: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni e T. urticae. Abstract in english The objective of this work was to verify the occurrence of predatory mites and the fungus Neozygites floridana, associated with spider mites in soybean (Glycine max L.), in Rio Grande do Sul, Brazil. From 2003 to 2005, samples of soybean leaves from the most important soybean producing regions of th [...] e state were evaluated. These samples were collected from different positions of the plant and randomly in the field. The predatory mite species found were Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis, and Galendromus annectens. The fungus N. floridana was widely distributed and occurred in all the spider mite species found: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni and T. urticae.

  6. Ácaros predadores e o fungo Neozygites floridana associados a tetraniquídeos em soja no Rio Grande do Sul Predatory mites and the fungus Neozygites floridana associated with spider mites on soybean, in Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Samuel Roggia


    Full Text Available O objetivo deste trabalho foi verificar a ocorrência de ácaros predadores e do fungo Neozygites floridana, associados a ácaros tetraniquídeos, em soja (Glycine max L., no Estado do Rio Grande do Sul. Entre 2003 e 2005, foram avaliadas amostras de folhas de soja das principais regiões produtoras do Estado. Essas amostras foram coletadas de diferentes posições da planta e aleatoriamente na lavoura. As espécies de ácaros predadores encontradas foram: Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis e Galendromus annectens. O fungo N. floridana apresentou ampla distribuição e ocorreu em todas as espécies de tetraniquídeos encontradas: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni e T. urticae.The objective of this work was to verify the occurrence of predatory mites and the fungus Neozygites floridana, associated with spider mites in soybean (Glycine max L., in Rio Grande do Sul, Brazil. From 2003 to 2005, samples of soybean leaves from the most important soybean producing regions of the state were evaluated. These samples were collected from different positions of the plant and randomly in the field. The predatory mite species found were Neoseiulus anonymus, N. californicus, Phytoseiulus fragariae, P. macropilis, Proprioseiopsis cannaensis, and Galendromus annectens. The fungus N. floridana was widely distributed and occurred in all the spider mite species found: Mononychellus planki, Tetranychus desertorum, T. gigas, T. ludeni and T. urticae.

  7. A search for predators and food selectivity of two native species of Hydra (Cnidaria: Hydrozoa) from Brazil / Potenciais predadores e seletividade alimentar de duas especies de Hydra (Cnidaria: Hydrozoa) nativas no Brasil.

    Scientific Electronic Library Online (English)

    Fernanda Cristina, Massaro; Natalia Felix, Negreiros; Odete, Rocha.


    Full Text Available As hidras são os representantes mais comuns dos cnidários de água doce. Em geral, estes organismos são encontrados em todos os continentes, exceto na Antártica. O presente estudo teve como objetivo obter informações mais aprofundadas sobre aspectos biológicos e ecológicos de duas espécies de Hydra n [...] ativas no Brasil, Hydra viridissima e Hydra salmacidis. Foram realizados experimentos de predação e seletividade alimentar para se determinar, respectivamente, os potenciais predadores e as presas preferenciais destas duas espécies. Os resultados indicaram que as duas espécies de Hydra não foram consumidas por nenhum dos predadores testados, os quais são usuais predadores de invertebrados em águas doces: ninfas de Odonata e larvas de Chaoborus sp. (Insecta), adultos de Copepoda Cyclopoida (Crustacea) e peixes da espécie Poecilia reticulata. Observou-se que H. viridissima ao se alimentar selecionou positivamente as fases jovens de copépodos calanóides e os pequenos cladóceros, e selecionou negativamente as presas grandes, como os adultos de copépodos calanóides e os ostrácodos. Já a espécie H. salmacidis, a qual apresenta um tamanho maior, além de ter preferência pelos náuplios e copepoditos de copépodos calanóides e pequenos cladóceros, também selecionou positivamente os indivíduos adultos dos copépodos calanóides. Os resultados obtidos evidenciaram que as espécies H. viridissima e H. salmacidis provavelmente são pouco ou não são predadas em muitos ambientes naturais, sendo elas próprias os predadores de topo da cadeia alimentar nestes ambientes. Por outro lado, estes organismos são predadores eficientes e observou-se uma relação positiva entre o tamanho da espécie de Hydra e o tamanho da presa. A seletividade alimentar destas espécies esteve relacionada com o tamanho das presas, assim como com outras características, tais como a espessura da carapaça e a eficiência de natação. Abstract in english The Hydra is the most common representative of freshwater cnidarians. In general, it is found in freshwaters on every continent, with the exception of Antarctica. The aim of the present study is to gather biological and ecological data on aspects of two species of Hydra native to Brazil: Hydra virid [...] issima and Hydra salmacidis. Predation and food selectivity experiments were performed to assess the possible predators and the prey preferences, respectively, of the two species. The results indicate that the two species of Hydra were not consumed by any of the predators that were tested, which are typical predators of invertebrates in freshwater: nymphs of Odonata Anisoptera and the phantom midge larvae of Chaoborus sp. (Insecta), adults of Copepoda Cyclopoida (Crustacea) and the small fish Poecilia reticulata. It was observed that the smaller Hydra, H. viridissima, positively selected the nauplii and copepodites of calanoid copepods and small cladocerans and rejected large prey, such as the adults of calanoid copepods and ostracods. The larger H. salmacidis, besides the nauplii and copepodites of the calanoid copepods and small cladocerans, also positively selected the large adults of the calanoid copepods. It can be concluded that both H. viridissima and H. salmacidis are most likely preyed on little or not preyed on at all in many freshwater bodies, as they are top predators in the food chain. At the same time, they are efficient predators, and a positive relationship was observed between the prey size and the Hydra species size. Food selectivity was related to prey size as well as other prey characteristics, such as carapace thickness and swimming efficiency.

  8. A dieta alimentar da presa Tenebrio molitor (Coleoptera: Tenebrionidae) pode afetar o desenvolvimento do predador Podisus nigrispinus (Heteroptera: Pentatomidae)? / Can the diet of the prey Tenebrio molitor (Coleoptera: Tenebrionidae) affect the development of the predator Podisus nigrispinus (Heteroptera: Pentatomidae)?

    Scientific Electronic Library Online (English)

    Claubert Wagner Guimarães de, Menezes; Silma da Silva, Camilo; Arley José, Fonseca; Sebastião Lourenço de, Assis Júnior; Diego Faustolo, Bispo; Marcus Alvarenga, Soares.


    Full Text Available Inimigos naturais são importantes para o controle de pragas em culturas agrícolas e florestais. A criação de insetos predadores em biofábricas deve ser de baixo custo para serem utilizados em programas de Manejo Integrado de Pragas (MIP). O objetivo deste trabalho foi avaliar o desenvolvimento de Po [...] disus nigrispinus Dallas, 1851 (Heteroptera: Pentatomidae), alimentado com larvas de Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae), criadas com as seguintes dietas: farelo de trigo, ração triturada ou peletizada para aves poedeiras e fubá de milho. Foram obtidos os parâmetros de desenvolvimento e reprodução necessários para calcular a tabela de vida do predador. Os parâmetros da tabela de vida revelaram crescimento populacional em todos os tratamentos. No entanto, a taxa líquida de reprodução (Ro) de P. nigrispinus foi menor quando alimentados com larvas de T. molitor criadas com fubá de milho, mostrando ser a alimentação menos adequada para esse predador. Por proporcionar maior número total de ovos, o farelo de trigo constituiu a melhor dieta para P. nigrispinus. Estudos sobre dietas de presas alternativas são importantes, pois podem favorecer a nutrição de inimigos naturais e, consequentemente, melhorar o desempenho das criações massais em laboratório. Abstract in english Natural enemies are important for controlling pests in agricultural and forestry culture. The reproductions of predatory insects in biofactories should have low cost to be used in Integrated Pest Management Program (IPM). The objective of this study was to evaluate the development of Podisus nigrisp [...] inus Dallas, 1851 (Heteroptera: Pentatomidae) fed with Tenebrio molitor Linnaeus, 1758 (Coleoptera: Tenebrionidae). The larvae of T. molitor were created with the following diets: wheat bran, shredded or pelleted poultry feed layers and corn meal. Parameters for the development and reproduction of the P. nigrispinus were obtained. Parameters of the life table show population growth in all treatments. However, the net rate of reproduction (Ro) of P. nigrispinus was lower when they were fed with larvae of T. molitor created with corn meal, which proved to be the least adequate food for this predator. By providing a larger total number of eggs, wheat bran was the best diet for P. nigrispinus. Studies on alternative prey diets are important as they may favor the nutrition of natural enemies and, consequently, improve the performance in laboratory rearing.

  9. Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae em culturas de pepino e morango Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae in cucumber and strawberry crops

    Directory of Open Access Journals (Sweden)

    M.A. Watanabe


    Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fitoseídeos Amblyseius idaeus (Denmark & Muma e Phytoseudus macropilis (Banks, comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4 para o pepino e 5 tratamentos para o morangueiro (T1-T5: T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae.The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytoseiids Amblyseius idaeus (Denmark & Muma and Phytoseudus macropilis (Banks, commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4 and 5 treatments for strawberry crops (T1-T5: T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

  10. Controle biológico do ácaro rajado com ácaros predadores fitoseídeos (Acari: Tetranychidae, Phytoseiidae) em culturas de pepino e morango / Biological control of the two-spotted spider mite (Acari: Tetranychidae, Phytoseiidae) in cucumber and strawberry crops

    Scientific Electronic Library Online (English)

    M.A., Watanabe; G.J. de, Moraes; I., Gastaldo Jr.; G., Nicolella.


    Full Text Available O ácaro rajado, Tetranychus urticae Koch, é considerado uma das principais pragas de hortaliças e várias outras culturas no Brasil, em áreas onde um considerável volume de acaricidas é anualmente empregado no seu controle. O objetivo deste trabalho foi testar a viabilidade técnica do emprego dos fit [...] oseídeos Amblyseius idaeus (Denmark & Muma) e Phytoseudus macropilis (Banks), comum ente encontrados no Brasil, no controle de T. urticae em pepino e morangueiro em Jaguaríúna,SP. Utilizou-se o delineamento experimental em blocos casualizados, com 4 repetições e 4 tratamentos (T1-T4) para o pepino e 5 tratamentos para o morangueiro (T1-T5): T1, testemunha; T2, pulverizações semanais de Malation para a exclusão de predadores nativos; T3, liberações periódicas de A.idaeus; T4, liberações periódicas de P.macropilis; T5, pulverizações semanais de avermectina para a exclusão de ácaros fitófagos e predadores nativos. Apenas A.idaeus se estabeleceu na cultura de pepino, reduzindo significativamente a população de T. urticae. Ambas espécies de predadores se estabeleceram na cultura do morango e reduziram significativamente a população de T.urticae. Abstract in english The two-spotted spider mite, Tetranychus urticae Koch, is considered one of the main pests of horticultural and other crops in Brazil, in areas where a considerable volume of acaricides is annually used for its control. The objective of this work was to test the technical viability of using phytosei [...] ids Amblyseius idaeus (Denmark & Muma) and Phytoseudus macropilis (Banks), commonly found in Brazil, to control T .urticae in cucumber and strawberry crops in Jaguaríúna,SP. A randomized complete block design was used, with 4 replicates and 4 treatments for cucumber (T1-T4) and 5 treatments for strawberry crops (T1-T5): T1, control; T2, weekly sprays of malathion for exclusion of native predators; T3, periodical releases of A.idaeus; T4, periodical releases of P. macropilis; T5, weekly sprays of avermectin for exclusion of native phytophagous and predatory mites. Only A. idaeus was successfully established on cucumber, significantly reducing T. urticae population. Both released phytoseiid species were established on strawberry and reduced significantly the population of T. urticae.

  11. Biologia de Amblyseius largoensis (Muma) (Acari: Phytoseiidae), um potencial predador de Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro / Biology of Amblyseius largoensis (Muma) (Acari: Phytoseiidae), a potential predator of Aceria guerreronis Keifer (Acari: Eriophyidae) on coconut trees

    Scientific Electronic Library Online (English)

    Andréia S., Galvão; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; José V. de, Oliveira.


    Full Text Available Aceria guerreronis Keifer é considerada uma das principais pragas do coqueiro no mundo. Dentre os Phytoseiidae relatados nessa cultura, Amblyseius largoensis (Muma) tem sido encontrado associado a A. guerreronis. Com o intuito de verificar se A. largoensis se alimenta de A. guerreronis, foi estudada [...] a biologia desse predador com diferentes fontes de alimento, incluindo A. guerreronis. Foram avaliadas três dietas [Tetranychus urticae Koch + pólen de mamona (Ricinus communis L.) + mel a 10%, A. guerreronis + pólen + mel e A. guerreronis isoladamente], avaliando-se o desenvolvimento, sobrevivência, oviposição, razão sexual e longevidade de A. largoensis a 27ºC, 60 ± 5% de umidade relativa e fotofase de 12h. Tabelas de vida de fertilidade foram construídas. A duração da fase imatura foi menor na dieta constituída apenas por A. guerreronis, enquanto que a fecundidade foi maior nas dietas à base de presa + pólen + mel. Não houve diferença entre os valores de sobrevivência das formas imaturas submetidas a diferentes dietas alimentares. Os parâmetros da tabela de vida de fertilidade foram superiores quando a alimentação foi constituída por A. guerreronis ou T. urticae + pólen + mel, embora o predador tenha sido capaz de completar seu ciclo biológico e se reproduzir quando alimentado exclusivamente com A. guerreronis. Os resultados sugerem que A. largoensis seja um predador de A. guerreronis em condições naturais e que possa estar desempenhando algum papel no controle dessa praga. Abstract in english Aceria guerreronis Keifer is considered one of the main pests of coconuts around the world. Amongst the Phytoseiidae recorded on this crop, Amblyseius largoensis (Muma) has been reported in association with A. guerreronis. In order to verify whether A. largoensis feeds on A. guerreronis, the biology [...] of this predator was evaluated on different food sources, including A. guerreronis. Three types of diet were tested [Tetranychus urticae Koch + castor bean (Ricinus communis L.) pollen + honey at 10%, A. guerreronis + pollen + honey, and only A. guerreronis], determining its development, survivorship, oviposition, sex ratio and longevity at 27ºC, 60 ± 5% RH 12 h photophase. Fertility life tables were constructed. The duration of the immature phase was lower when feeding only on A. guerreronis, while fecundity was higher when feeding on a prey + pollen + honey. There was no difference in relation to survivorship of the immature stages between the three diets. Parameters of fertility life tables were higher when the diet included A. guerreronis or T. urticae + pollen + honey, although the predator was able to complete its life cycle and reproduce when feeding exclusively on A. guerreronis. The results suggest that A. largoensis preys upon A. guerreronis under natural condition and that it might play some role in the control of the latter.

  12. Impacto da temperatura e da defesa da presa na utilização de Tenebrio molitor L. por ninfas do predador Supputius cincticeps (Heteroptera:Pentatomidae) / Impact of the temperature and of the prey defense on the utilization of Tenebrio molitor L. by nymphs of the predator Supputius cincticeps (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Francisco R. de, Azevedo; Francisco S., Ramalho.


    Full Text Available Estudaram-se os efeitos da temperatura e da defesa da presa na utilização de larvas de Tenebrio molitor L. pelas ninfas do predador Supputius cincticeps (Stäl). Constatou-se que o crescimento de S. cincticeps ocorreu em função da defesa da presa e/ou da temperatura. A taxa de consumo relativo de lar [...] vas de T. molitor pelo S. cincticeps dependeu do ínstar do predador e da temperatura ambiente e também do comportamento de defesa da presa. A eficiência de conversão das larvas de T. molitor ingeridas por ninfas de S. cincticeps dependeu do ínstar do predador, da temperatura e da defesa apresentada pela presa. A taxa de crescimento relativo de S. cincticeps dependeu do ínstar do predador e da temperatura do ambiente, e do ínstar do predador e da defesa da presa. Abstract in english The effects of the temperature and of the prey defense on the utilization of Tenebrio molitor L. larvae by the nymphs of the predator Supputius cincticeps (Stäl) were studied. Growth of S. cincticeps was function of the prey defense and/or temperature. The relative consumption rate of T. molitor lar [...] vae by S. cincticeps depended on the instar of the predator and on the temperature, and also on the defense behavior of the prey. The efficiency of conversion of T. molitor larvae ingested by nymphs of S. cincticeps depended upon the predator instar, temperature and defense of the prey. The relative growth rate of S. cincticeps was related to predator instar and temperature, and predator instar and defense of the prey.

  13. Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Luciano Pamplona de Góes Cavalcanti


    Full Text Available OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larvas em cada caixa, e a cada semana acrescentavam-se 100 larvas por caixa/dia, até se obter um máximo de 500 larvas/dia. Comprimento e peso dos peixes foram medidos semanalmente. RESULTADOS: Foram utilizadas 369.000 larvas no total. O Trichogaster trichopteros foi a única espécie em que ambos os sexos predaram 100% das larvas oferecidas. O Betta splendens deixou de predar apenas 15 larvas. Machos do Poecilia reticulata apresentaram baixa capacidade larvófaga quando comparados às fêmeas da mesma espécie. Em relação ao peso e tamanho o Betta splendens mostrou-se capaz de predar 523 larvas/grama/dia. CONCLUSÕES: Fêmeas e machos de Trichogaster trichopteros e de Astyanax fasciatus, e fêmeas de Betta splendens e de Poecillia sphenops foram os peixes que apresentaram maior competência para predar as larvas. Embora com competência menor, machos de Poecillia sphenops e fêmeas de Poecilia reticulata foram capazes de eliminar o número de larvas de Aedes aegypti que possam emergir durante 24 horas num criadouro, em condições naturais. Machos de Poecilia reticulata não foram predadores eficazes.OBJECTIVE: To evaluate the efficacy of fish as predators of the Aedes aegypti larvae in laboratory conditions. METHODS: The male and female of five different fish were included in the experiment. The tests to measure their consumption ability lasted five weeks for each species. Each trial involved four test tanks and four control tanks. Two control tanks contained just one fish, and the other two just larvae. Each of the test tanks contained one fish and the larvae. During the first week, 100 larvae were placed in the tank, with an additional 100 added every week, up to a maximum daily amount of 500 larvae. The length and weight of the fish were measured at the beginning and end of every week. RESULTS: A total of 369,000 larvae were used. The Trichogaster trichopteros was the only species in which both sexes ate 100% of the available larvae. The Betta splendens failed to eat only 15 larvae. The male Poecilia reticulate showed a strong capacity for larvae eating, compared with the female of the same species. In terms of weight and size, the Betta splendens proved capable of eating 523 larvae per gram of weight per day. CONCLUSIONS: The female and male Trichogaster trichopteros and Astyanax fasciatus, and the female Betta splendens and Poecilia sphenops proved to be the most effective predators of the Aedes aegypti larvae. And although the male Poecilia sphenops and female Poecilia reticulata were less effective, they were also capable of eradicating the total number of Aedes aegypti larvae that could appear over 24 hours in a breeding site under natural conditions. The male Poecilia reticulata, however, proved incapable of doing so.

  14. Adequabilidade de diferentes substratos à oviposição do predador Orius insidiosus (Say) (Hemiptera: Anthocoridae) / Suitability of different substrates for oviposition of the predator Orius insidiosus (Say) (Hemiptera: Anthocoridae)

    Scientific Electronic Library Online (English)

    Simone M., Mendes; Vanda H.P., Bueno; Lívia M., Carvalho.


    Full Text Available Fêmeas de Orius insidiosus (Say) colocam seus ovos endofíticamente, em diversas plantas, e um obstáculo para a criação massal desse predador é a seleção de um substrato de oviposição que seja de fácil obtenção e aceito pelo inseto. O objetivo deste estudo foi avaliar a preferência e a adeqüabilidade [...] de diferentes substratos de oviposição para O. insidiosus. Os testes foram conduzidos em câmaras climatizadas reguladas a 25 ± 1°C, UR de 70 ±10% e fotofase de 12h. Os substratos avaliados quanto à preferência e adequabilidade foram caule de caruru (Amaranthus viridis L.), caule e vagem de feijão (Phaseolus vulgaris L.), vagem de feijão-de-vagem (Phaseolus vulgaris L.) e inflorescências de picão-preto (Bidens pilosa L.). Na adequabilidade também foi avaliado o caule de poaia-do-campo (Spermacoce latifola Aubl.). Fêmeas submetidas aos testes com e sem chance de escolha preferiram ovipositar em inflorescências de picão-preto. O período de pré-oviposição foi influenciado pelo tipo de substrato, sendo menor na presença da inflorescência de picão-preto (3,0 dias) e no feijão, tanto no caule (3,1dias) como na vagem (3,7 dias) comparado aos demais substratos. O período de oviposição, bem como a longevidade foram cerca de três a quatro vezes menores na presença do caule de poaia-do-campo (8,9 dias). O número total de ovos/fêmea de O. insidiosus foi maior em inflorescências de picão-preto (163,3 ovos). Os resultados indicam a adeqüabilidade das inflorescências de picão-preto como substrato de oviposição para O. insidiosus, sendo o preferido nos testes, com e sem chance de escolha, e onde as fêmeas apresentaram melhor performance reprodutiva. Abstract in english Orius insidiosus (Say) females lay eggs inside plant tissue. An obstacle for its mass rearing is the selection of a plant that is suitable and well-accept by the female for oviposition. The objectives of this work were to evaluate the preference and the suitability of different plant structures as o [...] vipositional substrates for O. insidiosus. The trials were conducted in climatic chamber at 25 ± 1°C, RH 70 ± 10% and photophase 12h. The plant sites as amaranth stem (Amaranthus virides L.), common bean's stem and pod (Phaseolus vulgaris L.), green bean's pod (Phaseolus vulgaris L.) and farmer's friend inflorescence (Bidens pilosa L.) were evaluated in no-choice and choice tests. The broadleaf button weed stem (Spermacoce latifola Aubl.) was also used to evaluate the suitability on the reproductive parameters. The females of O. insidiosus preferred to oviposit in farmer's friend inflorescence in no-choice and choice tests. The pre-oviposition period was affected by the plant site used as an ovipositional substrate, being shorter in farmer's friend inflorescence (3.0 days) and in common bean (both on stem (3.1 days) and pod (3.7 days) compared to all substrates evaluated. The oviposition period and the longevity were about three or four times shorter on broadleaf button weed stem (8.9 days). The total number of eggs/ female was higher in farmer's friend inflorescence (163.3 eggs). The results indicated the preference and suitability of farmer's friend inflorescence as an ovipositional substrate for O. insidiosus, in which the females showed better reproductive performance.

  15. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae?

    Directory of Open Access Journals (Sweden)

    Rafael Braga da Silva


    Full Text Available Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål (Hemiptera, Pentatomidae? The stink bug Supputius cincticeps (Stål (Hemiptera, Pentatomidae is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae, and Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål (Hemiptera, Pentatomidae? O percevejo Supputius cincticeps (Stål (Hemiptera, Pentatomidae é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de controle natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L. (Coleoptera, Tenebrionidae, Spodoptera frugiperda (J. E. Smith (Lepidoptera, Noctuidae e Thyrinteina arnobia (Stoll (Lepidoptera, Geometridae foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior, apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores

  16. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? / A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?

    Scientific Electronic Library Online (English)

    Rafael Braga da, Silva; Alberto Soares, Corrêa; Terezinha Maria Castro, Della Lucia; Alexandre Igor Azevedo, Pereira; Ivan, Cruz; José Cola, Zanuncio.


    Full Text Available A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? O percevejo Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) é um predador encontrado em várias regiões brasileiras, que possui atributos desejáveis como agente de contro [...] le natural ou em programas de controle biológico. O objetivo deste trabalho foi testar se diferentes espécies de presa podem afetar o comportamento de ataque e o sucesso de predação de S. cincticeps. Larvas de Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) e Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) foram oferecidas a S. cincticeps, em bioensaios de laboratório, onde o comportamento de ataque do predador e o comportamento de defesa das presas foram observados por período de duas horas. O comportamento de ataque de S. cincticeps às presas apresentou variações nas frequências dos atos predatórios. O sucesso da inserção dos estiletes na presa depende da parte do corpo que é atacada (anterior, mediana ou posterior), apresentando maior sucesso quando o ataque ocorre na região anterior. As larvas de T. arnobia e S. frugiperda apresentaram maior frequência de movimentos bruscos quando atacadas por S. cincticeps, enquanto as de T. molitor não exibiram tais reações. Consequentemente, o sucesso da predação de S. cincticeps foi maior sobre T. molitor e S. frugiperda e consideravelmente menor em T. arnobia. Essas informações sobre as diferenças no comportamento de ataque de S. cincticeps a diferentes presas são úteis para os programas de controle biológico envolvendo hemípteros predadores Abstract in english Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natura [...] l control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio molitor (L.) (Coleoptera, Tenebrionidae), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae), and Thyrinteina arnobia (Stoll) (Lepidoptera, Geometridae) were offered to S. cincticeps in laboratory bioassays where predatory attack and prey defensive behaviors were observed for 2-hour periods. The attack behavior of S. cincticeps changed with the prey species offered. More than 25% of T. molitor and S. frugiperda larvae were immediately attacked, but T. arnobia was not immediately attacked by S. cincticeps. Successful attack (i.e., successful insertion of the predator stylets into the prey) depends on the region of the body attacked, with a greater proportion of successful attacks in the anterior than in the median or posterior regions. Larvae of T. arnobia and S. frugiperda displayed a sequence of abrupt head and body movements in response to S. cincticeps attack. Attempts of predation were more successful on T. molitor and S. frugiperda than on T. arnobia. Information about the differential attack behavior of S. cincticeps on different prey species is important for designing successful biological control programs using this hemipteran predator.

  17. Alcaeorrhynchus grandis (Dallas): an eventual predator of Chlosyne lacinia saundersii Doubleday & Hewitson on sunflower in Northern Paraná State / Alcaeorrhynchus grandis (Dallas): predador eventual de Chlosyne lacinia saundersii Doubleday & Hewitson em girassol no Norte do Estado do Paraná

    Scientific Electronic Library Online (English)

    Andréa B., Malaguido; Antônio R., Panizzi.


    Full Text Available Observou-se a ocorrência de Alcaeorrhynchus grandis (Dallas) (Hemiptera: Pentatomidae: Asopinae) predando larvas da lagarta do girassol Chlosyne lacinia saundersii Doubleday & Hewitson em girassol (Helianthus annuus L.) na Fazenda Experimental da Embrapa Soja, no norte do Paraná, durante janeiro-fev [...] ereiro de 1998. De ovos coletados em campo, ninfas do percevejo foram criadas em laboratório alimentadas com larvas de C. l. saundersii obtidas no campo. As ninfas também foram criadas com larvas da lagarta da soja Anticarsia gemmatalis Hübner obtidas em laboratório, para comparação. Nenhuma ninfa de A. grandis sobreviveu até a idade adulta, atingindo 100% de mortalidade já no 3º instar, quando alimentadas com larvas de C. l. saundersii. Quando alimentadas com larvas de A. gemmatalis, 32,5% das ninfas atingiram a idade adulta. Trata-se do primeiro registro deste predador associado a lagarta do girassol no Norte do Estado do Paraná. Abstract in english [...

  18. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo

    Directory of Open Access Journals (Sweden)

    Maria A Medeiros


    Full Text Available Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr. was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults. The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do tomate sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr. foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos. Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional.

  19. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems / Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo

    Scientific Electronic Library Online (English)

    Maria A, Medeiros; Edison R, Sujii; Helena C, Morais.


    Full Text Available Vários estudos têm demonstrado que a diversificação do agroecossistema pode reduzir a infestação por insetos-praga pelo uso da estratégia do estabelecimento de plantas companheiras. Neste trabalho estudou-se o efeito da presença do coentro e botão-de-ouro como plantas companheiras na cultura do toma [...] te sob manejo orgânico e convencional, na abundância das pragas do tomate e de predadores. O experimento foi conduzido em condições de campo, no Distrito Federal, de julho a outubro de 2004. O desenho experimental foi em blocos ao acaso, com três repetições e no arranjo fatorial 3 x 2 [três níveis de diversificação cultural: tomate em monocultivo, tomate consorciado com coentro, e consórcio tomate com coentro e botão-de-ouro e dois sistemas de cultivo: orgânico e convencional]. Cada parcela experimental tinha 80 plantas de tomateiro, sendo os insetos-praga e artrópodes predadores semanalmente coletados em cinco plantas/parcela. Tuta absoluta (Meyr.) foi a espécie-praga mais comum em ambos os sistemas de cultivo. O tomate consorciado como coentro e botão-de-ouro, no sistema de cultivo orgânico, apresentou menor abundância e maior diversidade de pragas, e maior abundância e diversidade de artrópodes predadores, principalmente aos 80 dias após o transplantio do tomate, coincidindo com o pico populacional da T. absoluta (ovos e adultos). Os predadores mais abundantes foram aranhas, joaninhas e formigas. As aranhas foram abundantes e uniformemente distribuídas em ambos os sistemas. As joaninhas apareceram tardiamente no sistema orgânico, no período de florescimento do coentro. As formigas foram mais abundantes no sistema convencional. Abstract in english Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional ma [...] nagement on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was of randomized blocks with three replicates in a 3 x 2 factorial arrangement [Three crop diversification levels: tomato in monoculture, tomato intercropped with coriander, and tomato intercropped with coriander and Gallant soldier; and two cropping systems: organic and conventional]. Each plot had 80 plants of the tomato and the pest-insects and predaceous arthropods were collected every week in five tomato plants/plot. Tuta absoluta (Meyr.) was the commonest pest species in both cropping systems. The tomato intercropped with coriander and Gallant soldier in organic cropping system had lower abundance and higher diversity of pests, and higher abundance and diversity of predaceous arthropods, mainly at 80 days after the tomato transplanting, coinciding with the population peak of T. absoluta (eggs and adults). The more abundant predators were spiders, lady beetles and ants. The spiders were abundant and uniformly distributed in both systems. The lady beetles appeared lately in the organic system, at the flowering season of the coriander. The ants were more abundant in the conventional systems.

  20. Efeito de espécies vegetais em bordadura em cebola sobre a densidade populacional de tripes e sirfídeos predadores / Effect of different species of border plants on the population density of thrips and syrphids predators in onion crop

    Scientific Electronic Library Online (English)

    Paulo Antonio de Souza, Gonçalves; Carlos Roberto, Sousa e Silva.


    Full Text Available Analisou-se a relação entre o efeito do plantio de diferentes espécies vegetais, em bordadura, na cultura da cebola, Allium cepa L, na incidência de Thrips tabaci Lind. e sirfídeos predadores, Toxomerus spp. O experimento foi conduzido na Epagri, EE de Ituporanga, de agosto a dezembro de 1998. Os tr [...] atamentos foram cebola em monocultivo; cebola + trigo mourisco (Fagopyrum esculentum Moench); cebola + nabo forrageiro (Raphanus sativus L. var. oleiferus Metzg.); cebola + cenoura (Daucus carota L., cv. Nantes e cv. Brasília); cebola + milho (Zea mays L.); cebola + rúcula (Eruca sativa L.) + vegetação espontânea. O plantio de diferentes espécies vegetais em bordadura não provocou diferenças significativas na incidência de tripes e sirfídeos predadores. A produtividade comercial de bulbos de cebola foi similar em sistema de monocultivo e diversificado, sugerindo ser possível adotar tais sistemas sem perdas em rendimento. Abstract in english The effect of planting different species of border plants on the population density of thrips (Thrips tabaci Lind), and syrphid predators (Toxomerus spp.), population density were evaluated at EPAGRI, Santa Catarina State, Brazil. The research was carried out from August to December 1998. The treatm [...] ents were onion monoculture; onion intercropped with buck wheat (Fagopyrum esculentum Moench) (Poligonaceae); onion intercropped with fodder radish (Raphanus sativus L. var. oleiferus Metzg.); onion intercropped with carrots (Daucus carota L.) Nantes and Brasília cultivars; onion intercropped with maize (Zea mays L.); onion intercropped with Eruca sativa and weed. The onion thrips and syrphid predators population density were similar in onion monoculture and policulture. The yields were similar in onion monoculture and policulture, suggesting the possibility to intercrop onion without losses.

  1. Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra Hirundinacea (Emberizidae:Thraupinae) / Predadores aéreos e bandos mistos de aves, em campo-cerrado, liderados por Cypsnagra hirundinacea (Emberizidae: Thraupinae)

    Scientific Electronic Library Online (English)



    Full Text Available Bandos mistos de aves incluindo Cypsnagra hirundinacea e Neothraupis fasciata como espécies que vigiam por sentinelas foram estudados em campo-cerrado de março a setembro de 1996. O propósito desse estudo foi verificar a possível relação entre o grau de alerta de uma espécie e a liderança dos bandos [...] . Durante as observações (em média de 2h30) foi quantificado o tempo vigiado por sentinelas de ambas as espécies. Os sentinelas de Cypsnagra hirundinacea realizaram a quase totalidade da vigilância (tempo com sentinela foi em média de 42 ± 17% do tempo, sendo 41 ± 17% vigiado por C. hirundinacea e 1,2% por N. fasciata), além de emitirem todos os chamados de alarme registrados (54% dos encontros com predadores aéreos estimularam chamados de alarme). O tempo vigiado por sentinelas nos bandos apresentou relação significativa com a taxa de encontro entre os predadores aéreos e os bandos (ANOVA, F = 3,0; p Abstract in english Bird mixed flocks including Cypsnagra hirundinacea and Neothraupis fasciata as species with sentinels were studied in "campo-cerrado" in order to investigate the possible relationship between alertness and the mixed flock leadership. This study was conducted from March to September 1996 and mixed fl [...] ocks were observed on average for 2:30h. The time with sentinels were recorded for C. hirundinacea and N. fasciata. The sentinels of Cypsnagra hirundinacea performed most of the vigilance (time with sentinel was on average 42 ± 17%, 41 ± 17% of which by C. hirundinacea, whereas only 1.2 % by N. fasciata) and gave all the alarm calls recorded (54% of the encounters with raptors stimulated alarm calls). A relationship was verified between time with sentinel and the rate of encounters with raptor (ANOVA, F = 3.0, P

  2. Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja / Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests

    Scientific Electronic Library Online (English)

    Ivan Carlos, Corso; Décio Luiz, Gazzoni; Manoel Eugenio, Nery.


    Full Text Available Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquis [...] a de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93) e percevejos (4/3/93). A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também não foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias. Abstract in english A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja [...] , located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993) or the stink bug complex (3/4/1993). Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

  3. Efeito de doses e de refúgio sobre a seletividade de inseticidas a predadores e parasitóides de pragas de soja Effect of doses and of refuge on the insecticide selectivity to predators and parasitoids of soybean insect pests

    Directory of Open Access Journals (Sweden)

    Ivan Carlos Corso


    Full Text Available Com o objetivo de avaliar o impacto sazonal de alguns inseticidas sobre predadores e parasitóides de pragas da cultura da soja, instalou-se um experimento com delineamento de blocos ao acaso, constando de oito tratamentos e três repetições, no campo experimental da Embrapa-Centro Nacional de Pesquisa de Soja, em Londrina, PR. Os tratamentos consistiram de aplicações de inseticidas para o controle da lagarta-da-soja (pulverizados em 21/1/93 e percevejos (4/3/93. A técnica empregada para levantamento da população de insetos foi a do método do choque, que consiste na aplicação de um inseticida de alto impacto sobre a comunidade de insetos presente nas plantas, sua coleta sobre panos estendidos no solo, e sua posterior identificação e contagem em laboratório. A análise da variância revelou não haver diferenças significativas entre as populações de predadores, himenópteros e dípteros encontrados, nos diferentes tratamentos estudados. Também n??o foram verificados os fenômenos de ressurgência de pragas ou o aparecimento de elevadas populações de pragas secundárias.A field experiment was conducted to evaluate seasonal effect of insecticides on predators and parasitoids of soybean insect pests. A randomized block design was used, with three replications, and the experiment was set up in the experimental station of the Embrapa-Centro Nacional de Pesquisa de Soja, located at Londrina, PR, Brazil. Treatments consisted of insecticide application to control the velvetbean caterpillar (1/21/1993 or the stink bug complex (3/4/1993. Insect population was sampled through the shock technique, consisting of an application of a broad spectrum insecticide over the plants to be sampled, being the insects collected on cloths placed on the ground, and transferred to the laboratory to be identified and counted. Statistical analysis revealed no differences on the populations of species of predators, diptera or himenoptera as a group. No effects of pest resurgence or secondary pest outbreaks were also observed.

  4. Killer whales attack on South American sea lion associated with a fishing vessel: predator and prey tactics / Ataque de orcas a un lobo marino sudamericano asociado a un barco pesquero: tácticas del predador y la presa

    Scientific Electronic Library Online (English)

    M. Florencia, Grandi; Rocío, Loizaga de Castro; Enrique A, Crespo.


    Full Text Available Las interacciones entre orcas y lobos marinos son ampliamente conocidas. Este trabajo describe el comportamiento predador-presa entre orcas y un lobo marino sudamericano asociados a un barco pesquero de arrastre. Particularmente en Argentina el comportamiento predatorio de las orcas y el anti-predat [...] orio de los lobos marinos comunes fueron descriptos mediante observaciones costeras, pero se sabe poco sobre el comportamiento de estas especies en aguas abiertas. En este trabajo, a partir de un video grabado desde un barco de pesca arrastrero, junto con la entrevista del capitán del barco, se describe cómo un grupo de orcas ataca a un lobo marino Sudamericano. Este comportamiento predador-presa representa un ejemplo sobre la complejidad de las interacciones entre mamíferos marinos y las pesquerías a lo largo de la costa patagónica. Abstract in english Interactions between killer whales and sea lions are widely known. This work describes the predator-prey behaviour of killer whales and South American sea lion associated with a trawling fishery. In Argentina the predatory behaviours of killer whales and anti-predatory behaviours of South American s [...] ea lions have been described from costal based observations, but predator-prey behaviour of these species is poorly known at open waters. Here we describe a killer whale group attack on an individual sea lion, using a video recorded from a trawling vessel and an interview of the ship captain. This predator-prey behaviour represents an example of the complexity of interactions between marine mammals and fisheries along the Patagonian coast.

  5. Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil / Dinâmica populacional de Aceria guerreronis Keifer (Acari: Eriophyidae) e predadores associados em frutos de coqueiro no Nordeste do Brasil

    Scientific Electronic Library Online (English)

    Aleuny C., Reis; Manoel G.C., Gondim Jr.; Gilberto J. de, Moraes; Rachid, Hanna; Peter, Schausberger; Late E., Lawson-Balagbo; Reginaldo, Barros.


    Full Text Available Aceria guerreronis Keifer pode causar danos severos em coqueiro em vários países ao redor do mundo. Raros estudos têm sido conduzidos para determinar os ácaros predadores associados com A. guerreronis no Brasil. O objetivo deste estudo foi avaliar a prevalência de A. guerreronis e dos predadores ass [...] ociados nas brácteas e na superfície dos frutos abaixo delas, durante 12 meses, em frutos de coqueiro adulto ao longo da costa de Alagoas, Paraíba e Pernambuco, no Nordeste do Brasil. Ácaros de 10 famílias foram encontrados, contudo a espécie mais abundante foi A. guerreronis, correspondendo a 99,5% dos ácaros coletados. Dentre as espécies predadoras prevaleceram os ácaros Phytoseiidae Neoseiulus baraki (Athias-Henriot) e Neoseiulus paspalivorus (De Leon). Estes são achatados e possuem pernas curtas, características que lhes permitem invadir o habitat ocupado por A. guerreronis. Outros predadores foram encontrados, mas em número bem menor, provavelmente pela dificuldade que têm em penetrar nas áreas comumente habitadas por A. guerreronis. Contudo, essas espécies têm potencial de predação sobre o ácaro quando este sai de seu habitat preferido para se dispersar. Não se observaram correlações significativas entre os níveis de fatores abióticos e os níveis populacionais de A. guerreronis ou dos fitoseídeos associados a essa espécie. Isso provavelmente se deu devido aos efeitos simultâneo e conflitante daqueles fatores sobre os ácaros no campo, ou a diferenças significativas entre os fatores climáticos medidos no ambiente e aqueles prevalentes no habitat ocupado por A. guerreronis. Abstract in english Aceria guerreronis Keifer can cause severe damage to coconuts in several countries around the world. Rare studies have been conducted to determine the predatory mites associated with A. guerreronis in Brazil. The study evaluated the prevalence of A. guerreronis and associated predators on the bracts [...] and on the surface of the fruits underneath the bracts, for 12 months, on coconut palms grown along the coast of the States of Alagoas, Paraíba and Pernambuco, Northeastern Brazil. Mites of 10 families were found, but by far the most abundant species was A. guerreronis, corresponding to 99.5% of the mites collected. The prevailing species amongst the predators were the Phytoseiidae mites Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon). These are flat mites that have short limbs, characteristics that allow them to invade the main habitat occupied by A. guerreronis. Other predators were found, but in low numbers, due mainly to their difficulty in reaching the fruit areas most inhabited by A. guerreronis. However, these mites could prey on that pest when it leaves its preferred habitat to disperse. No significant correlations were observed between the levels of abiotic factors and the population levels of A. guerreronis or of the phytoseiids associated with it. This probably occurred due to the simultaneous and conflicting effects of those factors on the mites in the field, or to significant differences between the climatic factors measured in the environment and those prevailing in the habitat occupied by A. guerreronis.

  6. Trophic niche comparison between two predators in northern Rio de Janeiro State, Brazil: a stable isotopes approach / Comparacao do nicho trofico entre dois predadores no norte do estado do Rio de Janeiro, Brasil: uma abordagem de isotopos estaveis

    Scientific Electronic Library Online (English)

    Ana Paula Madeira Di, Beneditto; Carlos Eduardo, Rezende; Plinio Barbosa, Camargo; Helena Amaral, Kehrig.

    Full Text Available O nicho trófico dos predadores simpátricos Pontoporia blainvillei (golfinho franciscana) e Trichiurus lepturus (peixe-espada) foi comparado através de razões de isótopos estáveis (?15N and ?13C) nos tecidos hepático e muscular para compreender como eles coexistem no norte do Estado do Rio de Janeiro [...] (21°30?S-22°15?S), sudeste do Brasil. Os espécimes do golfinho foram capturados acidentalmente em pescarias comerciais com rede de espera, enquanto os espécimes do peixe foram alvo dessas pescarias. Os predadores apresentaram valores similares de ?15N no fígado (P. blainvillei: 14.6 ± 1.0; T. lepturus: 14.4 ± 0.6), o que indica posição trófica semelhante quanto à ingestão alimentar recente. No entanto, P. blainvillei apresentou valores mais leves de ?15N no músculo (13.8 ± 1.0) em relação a T. lepturus (15.0 ± 0.4), revelando diferenças na dieta de longo prazo que podem estar relacionadas ao tamanho das presas ingeridas. As assinaturas de ?13C indicaram uma cadeia alimentar preferencialmente costeira e bentônica para P. blainvillei (fígado: ?15.2 ± 0.6; músculo: ?16.0 ± 0.5) e uma cadeia alimentar mais oceânica e pelágica para T. lepturus (fígado: ?17.2 ± 0.6; músculo: ?16.8 ± 0.3). As variâncias isotópicas do fígado e do músculo revelaram uma maior amplitude de nicho para P. blainvillei em relação a T. lepturus, com maior aproveitamento dos recursos alimentares disponíveis em águas costeiras. Na área de estudo, as diferenças no uso do habitat e na exploração de recursos alimentares estão favorecendo a coexistência dos predadores. Abstract in english The trophic niche of the sympatric predators Pontoporia blainvillei (franciscana dolphin) and Trichiurus lepturus (ribbonfish) was compared by stable isotope (?15N and ?13C) ratios in hepatic and muscular tissues to understand how they co-exist in the northern Rio de Janeiro State (21°30?S-22°15?S), [...] south-eastern Brazil. Dolphin specimens were incidentally captured through commercial gillnet fisheries, while fish specimens were the target of these fisheries. The predators had similar ?15N values in the liver (P. blainvillei: 14.6 ± 1.0‰; T. lepturus: 14.4 ± 0.6‰), which indicates similar trophic position in the recent food intake. However, P. blainvillei showed lighter ?15N values in muscle (13.8 ± 1.0‰) than T. lepturus (15.0 ± 0.4‰), revealing differences in the long term diet that could be related with the prey size ingested. The ?13C signatures showed a preferential inshore and benthic food chain for P. blainvillei (liver: ?15.2 ± 0.6‰; muscle: ?16.0 ± 0.5‰) and a more offshore and pelagic food chain for T. lepturus (liver: ?17.2 ± 0.6‰; muscle: ?16.8 ± 0.3‰). The isotopic variances of liver and muscle revealed a broader niche width to P. blainvillei in relation to T. lepturus, with a greater use of available food resources in coastal waters. In the area of study, the differences in habitat use and exploitation of food resources are favoring the predators' coexistence.

  7. Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa

    Directory of Open Access Journals (Sweden)

    Madelaine Venzon


    Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer, e seu predador Eriopis connexa (Germar. Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azadiractina a 0,5%, 1%, em acefato (0,75 g L-1 e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1 e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa.The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer and on its predator Eriopis connexa (Germar. Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin at concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1 and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1 and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

  8. Toxicidade letal e subletal do nim sobre o pulgão-verde e seu predador Eriopis connexa / Lethal and sublethal toxicity of neem on green peach aphid and on its predator Eriopis connexa

    Scientific Electronic Library Online (English)

    Madelaine, Venzon; Maria da Consolação, Rosado; Angelo, Pallini; Amanda, Fialho; Célia de Jesus, Pereira.


    Full Text Available O objetivo deste trabalho foi avaliar, em laboratório, os efeitos do extrato de semente de nim sobre uma praga da pimenteira, o pulgão-verde Myzus persicae (Sulzer), e seu predador Eriopis connexa (Germar). Folhas de pimenteira foram imersas em solução aquosa de extrato de semente de nim (1% de azad [...] iractina) a 0,5%, 1%, em acefato (0,75 g L-1) e em água. Fêmeas do pulgão foram transferidas para essas folhas e, após seis dias, avaliou-se a população final. Larvas de quarto ínstar do predador foram colocadas em plantas de pimenteira infestadas com pulgões e pulverizadas com solução aquosa de nim a 0,25 e, 0,5%, em acefato (0,75 g L-1) e em água. Após 48 horas, as larvas foram transferidas para tubos de plástico e alimentadas com pulgões. A mortalidade larval, a viabilidade pupal e a emergência de adultos foram avaliadas. A população de pulgões foi significativamente menor em folhas tratadas com nim e com acefato do que nas tratadas com água. A mortalidade de larvas do predador foi maior em plantas tratadas com acefato do que com nim. No entanto, somente 9,1 e 10% das larvas em plantas tratadas com nim a 0,25% e a 0,5%, respectivamente, formaram pupas e não houve emergência de adultos. Apesar do potencial do nim em reduzir a população de M. persicae, o produto apresenta efeitos nocivos a E. connexa. Abstract in english The aim of this work was to assess, in laboratory, the effects of neem seed extract on chilli pepper pest, the green peach aphid Myzus persicae (Sulzer) and on its predator Eriopis connexa (Germar). Chilli pepper leaves were treated with an aqueous solution of neem seed extract (1% of azadiractin) a [...] t concentrations of 0.5 and 1.0%, using acephate (0.75 g L-1) and water. Aphid females were transferred to treated leaves and after six days the aphid population was checked. Fourth-instar larvae of E. connexa were placed on pepper seedlings infested with aphids and sprayed with an aqueous solution of neem at 0.25 and 0.5%, using acephate (0.75 g L-1) and water. After 48 hours, larvae were transferred to plastic tubes and fed aphids. Larval mortality, pupal viability and adult emergence were evaluated. Aphid population was significantly lower on leaves treated with neem and acephate than on water treated plants. Mortality of E. connexa larvae was higher on plants treated with acephate than on neem treated plants. However, only 9.1 and 10% of larvae on plants treated with neem at 0.25 and 0.5%, respectively, reached the pupal phase and there was no adult emergence. In spite of the potential of neem to reduce M. persicae population, the product shows deleterious effects on E. connexa.

  9. Artrópodes-praga e predadores (Arthropoda) associados à cultura da mangueira no Vale do São Francisco, nordeste do Brasil / Arthropods-pest and predators associated with mango trees at the Vale do São Francisco, Northestern Brazil

    Scientific Electronic Library Online (English)

    Flávia R., Barbosa; Manoel E. de C., Gonçalves; Wellington A., Moreira; José A. de, Alencar; Eduardo A. de, Souza; Cherre S.B. da, Silva; Adriano de M., Souza; Ismênia da G., Miranda.


    Full Text Available Com o objetivo de identificar e estudar a ocorrência das pragas da mangueira e de predadores no Vale do São Francisco, realizaram-se prospecções em oito plantios comerciais, da cultivar Tommy Atkins, de fevereiro de 2000 a janeiro de 2002. Em cada plantio, foram feitas coletas de moscas-das-frutas u [...] tilizando-se armadilhas McPhail e Jackson; a ocorrência de outras pragas e predadores foi estimada em amostras de ramos, folhas, inflorescências e frutos. Os artrópodes-praga, em ordem decrescente de ocorrência, foram: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87,0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66,1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64,6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42,9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39,3%; Anastrepha spp. (Diptera: Tephritidae) - 33,0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26,4%; Oligonychus sp. (Acari: Tetranychidae) - 16, 6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13,1%; mirídeo não identificado - 9,1% e pulgões [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover) (Hemiptera: Aphididae)] - 7,2%. Os predadores foram: Euseius concordis (Chant) e E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32,7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32,3%; Rubroscirus sp. (Acari: Cunaxidae) - 17,7%; aranhas não identificadas - 16,6% e (Chrysoperla externa (Hagen) e Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3,7%. Abstract in english In order to identify and evaluate the occurrence of arthropods-pest and predators on mangoes at "Vale do São Francisco", northestern Brazil, studies were carried out in eight commercial plantations of the cv. Tommy Atkins, from February 2000 to January 2002. In each area, fruit flies were collected [...] using McPhail and Jackson traps; other pests and predators were evaluated on samples of branches, panicles and fruits. The arthropods-pest occurrence in decreasing order were: Aceria mangiferae (Sayed) (Acari: Eriophyidae) - 87.0%; Pseudaonidia tribitiformis (Green) (Hemiptera: Diaspididae) - 70.1%; Ceratitis capitata Wied. (Diptera: Tephritidae) - 66.1%; Erosomyia mangiferae Felt (Diptera: Cecidomyiidae) - 64.6%; Pleuroprucha asthenaria Walker (Lepidoptera: Geometridae) - 42.9%; Polyphagotarsonemus latus (Banks) (Acari: Tarsonemidae) - 39.3%; Anastrepha spp. (Diptera: Tephritidae) - 33.0%; Selenothrips rubrocinctus (Giard) (Thysanoptera: Thripidae) - 26.4%; Oligonychus sp. (Acari: Tetranychidae) - 16.6%; Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae) - 13.1%; unidentified mirid - 9.1%, and aphids [Aphis craccivora Koch; Toxoptera aurantii (Boyer de Fonscolombe), A. gossypii Glover (Hemiptera: Aphididae)] - 7.2%. The predators were: Euseius concordis (Chant) and E. citrifolius (Denmark & Muma) (Acari: Phytoseiidae) - 32.7%; Cheletogenes ornatus (Canestrini & Fanzago) (Acari: Cheyletidae) - 32.3%; Rubroscirus sp. (Acari: Cunaxidae) - 17.7%; unidentified arachnids - 16.6%, and Chrysoperla externa (Hagen) and Ceraeochrysa cubana (Hagen) (Neuroptera: Chrysopidae) - 3.7%.

  10. Effect of prey density on the functional and numerical responses of two species of predaceous mites (Acari: Phytoseiidae) / Efeito da densidade de presa nas respostas funcional e numérica de duas espécies de ácaros predadores (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Paulo R., Reis; Elber O., Sousa; Adenir V., Teodoro; Marçal, Pedro Neto.


    Full Text Available Ácaros da família Phytoseiidae são os inimigos naturais de ácaros-praga mais importantes e estudados. Uma questão freqüentemente levantada é se os fitoseídeos podem reduzir altas densidades de ácaros fitófagos a baixos níveis. Os estudos da resposta funcional e numérica podem contribuir para respond [...] er essa pergunta. O objetivo deste trabalho foi avaliar o potencial de predação de Iphiseiodes zuluagai Denmark e Muma e Euseius alatus DeLeon (Acari: Phytoseiidae) como agentes de controle biológico do ácaro fitófago Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vetor do vírus da leprose-dos-citros e da mancha-anular do cafeeiro. Bioensaios foram realizados em laboratório. Fêmeas adultas de cada predador foram individualizadas em arenas de folha de citros com 3 cm de diâmetro. Fases imaturas de B. phoenicis foram oferecidas, como presas, nas seguintes quantidades/arena: 1, 2, 5, 10, 20, 30 e 35 (com sete repetições), 45 (quatro repetições), 55 (três repetições) e 70, 100, 125, 200 e 300 (duas repetições). O número de presas mortas e de ovos colocados pelo predador foram avaliados a cada 24h, durante oito dias. As presas mortas foram diariamente substituídas por novas presas. Para ambos os ácaros predadores foi constatada uma correlação positiva e altamente significativa entre o número de presas oferecidas e mortas. A oviposição média diária também aumentou em função do número de presas mortas. Nas densidades mais baixas, E. alatus matou mais B. phoenicis do que I. zuluagai, e o contrário foi observado nas densidades mais altas. É possível que E. alatus possa reduzir a população de B. phoenicis mesmo em baixas densidades do ácaro fitófago, e que I. zuluagai possa fazer o mesmo nas mais altas. O fato de E. alatus necessitar de menos presas que I. zuluagai sugere que sua sobrevivência possa ser maior do que a de I. zuluagai sob baixa densidade de presa. Abstract in english Phytoseiidae mites are the most important and studied natural enemies of pest mites. A question frequently raised is whether phytoseiid may reduce high densities of phytophagous mites. Studies of functional and numerical responses may help to answer this question. The aim of this work was to evaluat [...] e the potential predation success of Iphiseiodes zuluagai Denmark and Muma and Euseius alatus DeLeon (Acari: Phytoseiidae) on Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae), vector of the citrus leprosis and the coffee ringspot viruses. Bioassays were performed in the laboratory. Adult females of each predator were isolated in arenas made with citrus leaves (3-cm diameter). Immature stages of B. phoenicis were offered as prey, at the following numbers/arena: 1, 2, 5, 10, 20, 30 and 35 (seven replicates), 45 (four replicates), 55 (three replicates) and 70, 100, 125, 200 and 300 (two replicates). The number of killed prey and of eggs laid by the predators was evaluated every 24h, during eight days. Killed prey was replaced daily by new prey. For both predatory mites, a positive and highly significant correlation was found between the numbers of prey offered and killed. The average daily oviposition rate also increased with the number of killed prey. At the lower densities, E. alatus killed and ate more B. phoenicis than I. zuluagai. The opposite was observed at the highest densities. It is possible that E. alatus can reduce B. phoenicis population even at low prey densities, and I. zuluagai can do the same also at high densities. The fact that E. alatus requires less prey than I. zuluagai suggests that its survivorship may be higher than that of I. zuluagai at low prey densities.

  11. Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical

    Directory of Open Access Journals (Sweden)

    MS. Arcifa


    Full Text Available The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocerans and copepods were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi avaliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso.

  12. Survey of cyclopids (Crustacea, Copepoda in Brazil and preliminary screening of their potential as dengue vector predators Levantamento de ciclopídeos (Crustacea, Copepoda no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue

    Directory of Open Access Journals (Sweden)

    Luciana Urbano dos Santos


    Full Text Available INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01 of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01 criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido.

  13. Survey of cyclopids (Crustacea, Copepoda) in Brazil and preliminary screening of their potential as dengue vector predators / Levantamento de ciclopídeos (Crustacea, Copepoda) no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue

    Scientific Electronic Library Online (English)

    Luciana Urbano dos, Santos; Carlos Fernando S. de, Andrade.


    Full Text Available INTRODUÇÃO: Copépodos ciclopídeos são conhecidos como bons controladores de mosquitos, especialmente quando considerado as larvas dos vetores da dengue Aedes aegypti e Ae. albopictus. MATERIAL E MÉTODO: Onze corpos d'água em Campinas, SP, Brasil, foram avaliados para copépodos coletando-se 1,5 l de [...] água de cada um deles. O potencial predador dos copépodos adultos foi avaliado por 24 h, em laboratório, em grupos de 5 indivíduos predadando sobre 30 larvas de 1° estádio de Ae. albopictus. RESULTADOS E CONCLUSÕES: No presente levantamento as seguintes espécies de ciclopídeos foram encontradas: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. O potencial predador desses copépodos variou de zero a 97,3%. A amostra coletada no campo contendo apenas com M. longisetus var. longisetus mostrou a melhor eficiência de controle, sem diferença significativa de uma cultura de laboratório (ML-01) criada por 3 anos, desta mesma espécie, que foi avaliada para comparação. A amostra com poucos M. albidus var. albidus foi cotada em segundo melhor lugar, apresentando em média 25,9% de eficiência. O uso de copépodos em pneus armadilha como controladores dos vetores da dengue é discutido. Abstract in english INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. lo [...] ngisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01) of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.

  14. Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake / Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical

    Scientific Electronic Library Online (English)

    MS., Arcifa; TC., Bunioto; A., Perticarrari; WJ., Minto.


    Full Text Available O foco deste estudo é verificar se microcrustáceos apresentam migração horizontal diária (MHD) em um lago raso tropical, durante um ano, e o valor adaptativo com relação à predação. A abundância de predadores invertebrados, larvas de caoborídeos e ácaros aquáticos, e de cladóceros e copépodos foi av [...] aliada mensalmente em três estações de coleta localizadas em um transecto, de dia e à noite. Ambos os predadores invertebrados foram predominantemente pelágicos. Os cladóceros não realizaram MHD, distribuindo-se indistintamente nas zonas litorânea e pelágica, ou foram mais abundantes na zona limnética. Os náuplios e copepoditos de duas espécies de copépodos e os adultos de Tropocyclops prasinus meridionalis Kiefer ocuparam principalmente a zona limnética, não migrando horizontalmente. As características limnológicas (temperatura, oxigênio dissolvido, pH e condutividade) foram adequadas nas duas zonas do lago. A concentração de alga foi um pouco menor no litoral do que na zona limnética durante o dia e parece ser adequada para os organismos; contudo, como a qualidade das algas não foi avaliada, não é possível ser conclusivo sobre sua influência. Os resultados indicaram que os microcrustáceos não realizaram MHD, a qual não constitui, portanto, uma estratégia para diminuir a predação dos dois invertebrados, Chaoborus brasiliensis Theobald e Krendowskia sp., em uma base anual, neste lago raso. Abstract in english The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocer [...] ans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not undergo significant DHM, distributing indistinctly onshore and offshore or being mostly pelagic. Nauplii, copepodites of two copepod species and adults of Tropocyclops prasinus meridionalis Kiefer were mostly distributed offshore, and did not perform DHM. The limnological features (temperature, dissolved oxygen, pH, and conductivity) were suitable for the organisms in both zones of the lake. Algal food concentration was a little lower in the littoral than in the limnetic zone during the day, but it seems to be suitable for the organisms. However, as the algae quality was not evaluated, it is not possible to be conclusive concerning its influence. The results indicated that DHM was not performed by the microcrustaceans and is not, therefore, a strategy for decreasing predation by both invertebrates, Chaoborus brasiliensis Theobald and Krendowskia sp., on a yearly basis in this shallow lake.

  15. Efeito da alimentação de Schizaphis graminum com genótipos de sorgo no desenvolvimento do predador Cycloneda sanguinea / Effect of Schizaphis graminum feeding on sorghum genotypes on the development of its predator Cycloneda sanguinea

    Scientific Electronic Library Online (English)

    Terezinha Monteiro dos, Santos; Liliane Karla, Figueira; Arlindo Leal, Boiça Júnior; Fernando Mesquita, Lara; Ivan, Cruz.


    Full Text Available O pulgão Schizaphis graminum (Rondani) (Hemiptera: Aphididae) é uma das principais pragas do sorgo. O objetivo deste trabalho foi determinar o efeito da alimentação deste inseto com genótipos de sorgo resistentes e suscetíveis no desenvolvimento do predador Cycloneda sanguinea (Linnaeus) (Coleoptera [...] : Coccinellidae). O pulgão foi criado em folhas dos genótipos de sorgo GR 11111 e TX 430 x GR 111, resistentes, GB 3B, de resistência moderada e BR 007B, suscetível ao hemíptero. As larvas de C. sanguinea foram alimentadas diariamente, ad libitum, com ninfas e adultos de S. graminum. A duração das fases de desenvolvimento e a sobrevivência de C. sanguinea não foram influenciadas pelo genótipo. Apenas a duração do quarto ínstar, da fase larval e do período de larva a adulto foram afetadas. O peso de larvas de segundo ínstar de C. sanguinea não foi afetado pelo genótipo. Nos demais ínstares e fase adulta, esse parâmetro foi diferenciado conforme o genótipo de sorgo utilizado como hospedeiro ao pulgão. Os genótipos resistentes GR 11111 e TX 430 x GR 111 não afetam adversamente o desenvolvimento e a fecundidade de C. sanguinea, durante uma geração. Estes genótipos demonstram compatibilidade com o predador e viabilizam o manejo de S. graminum na cultura do sorgo. Abstract in english The aphid Schizaphis graminum (Rondani) (Hemiptera: Aphididae) is one of the main pests of sorghum crop. The objective of this work was to evaluate the effect of this aphid feeding on resistant and susceptible sorghum genotypes on the development of its predator Cycloneda sanguinea (Linnaeus) (Coleo [...] ptera: Coccinellidae). The aphid was reared on leaves of sorghum genotypes GR 11111 and TX 430 x GR 111, resistant, GB 3B, moderately resistant, and BR 007B, susceptible to the hemipterous. Larvae of C. sanguinea were fed ad libitum on S. graminum nymphs and adults, daily. The duration and survival of developmental phases of C. sanguinea were not significantly influenced by genotype. Only the fourth instar, the larval phase and the larvaeadult period duration were affected. The weight of C. sanguinea larvae of second instar was not affected by sorghum genotype. For both instars and adult phase, this parameter was differentiate due to each genotype used as host to the aphid. The resistant genotypes GR 11111 and TX 430 x GR 111 do not affect adversely C. sanguinea development and fecundity, during one generation. These genotypes show compatibility with the predator, allowing the S. graminum management on sorghum crop.

  16. Inseticidas botânicos aplicados sobre Aphis gossypii e seu predador Cycloneda sanguinea em algodão-colorido / Botanical insecticides applied on Aphis gossypii and its predator Cycloneda sanguinea on naturally colored cotton

    Scientific Electronic Library Online (English)

    Mariana Oliveira, Breda; José Vargas de, Oliveira; Edmilson Jacinto, Marques; Rachel Gonçalves, Ferreira; Mauricéa Fidelis, Santana.


    Full Text Available O objetivo deste trabalho foi avaliar os efeitos de inseticidas botânicos sobre Aphis gossypii e seu predador Cycloneda sanguinea, em algodão-colorido. Foram avaliados inseticidas botânicos à base de azadiractina, extrato aquoso de sementes de nim e óleo de mamona, nas concentrações de 0 a 2%, de 0 [...] a 2,5% e de 0 a 3%, respectivamente. Os bioensaios, em delineamento inteiramente casualizado, foram realizados em laboratório. A mortalidade do pulgão variou de 64 a 100% para azadiractina; 12 a 92% para extrato aquoso de nim; e 8 a 68% para óleo de mamona. A taxa instantânea de crescimento mostrou-se negativa a partir da concentração 1,25% para azadiractina, 2,25% para extrato aquoso de nim, e 3,0% para óleo de mamona. Todos os inseticidas apresentaram toxicidade para larvas de 1º instar do predador, com mortalidade de 96,7 a 100% para azadiractina e extrato aquoso de nim, e de 50 a 100% para óleo de mamona. Para o 4º instar, a mortalidade variou de 87,5 a 100% para azadiractina, 73,3 a 100% para o extrato de nim, e 43,3 a 100% para o óleo de mamona. Os inseticidas testados são promissores para o manejo de A. gossypii, porém mostraram-se pouco seletivos a C. sanguinea. Abstract in english The objective of this work was to evaluate the effects of botanical insecticides on Aphis gossypii and its predator Cycloneda sanguinea, in naturally colored cotton. The botanical insecticides based on azadirachtin, aqueous extract of nim seeds, and castor oil were tested at the concentrations from [...] 0 to 2%, 0 to 2.5%, and 0 to 3%, respectively. The bioassays were performed in laboratory conditions, in a completely randomized design. Aphid mortality ranged from: 64 to 100% for azadirachtin; 12 to 92% for nim aqueous extract; and 8 to 68% for castor oil. The instantaneous rate of increase reached negative values starting from concentrations of: 1.25%, for azadirachtin; 2.25%, for nim aqueous extract; and 3.0%, for castor oil emulsion. All insecticides were toxic to the first instar larvae of the predator, with mortality values from 96.7 to 100%, for azadirachtin and nim aqueous extract, and from 50 to 100% for castor oil emulsion. For the 4th instar larvae, mortalities ranged from 87.5 to 100% for azadirachtin; from 73.3 to 100% for nim aqueous extract; and from 43.3 to 100% for castor oil emulsion. The tested insecticides are promising for A. gossypii management, although they are not selective toward C. sanguinea.

  17. Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae and Corydalus Latreille (Megaloptera, Corydalidae in Southeastern Brazil O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae e Corydalus Latreille (Megaloptera, Corydalidae no Sudeste do Brasil

    Directory of Open Access Journals (Sweden)

    Marcos Callisto


    Full Text Available Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW and in the headwaters of São Francisco river, at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W, in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm were sampled: 61 in the Indaiá stream and 17 in other two streams. Twelve Corydalus larvae (22-79 mm in the Indaiá stream and three out of 15 larvae in the headwaters of São Francisco river (38-50 mm had Corynoneura, larvae and pupae on their gills (3rd to 6th and a few larvae attached to the abdominal segments of larger Corydalus larvae (> 25 mm. Sixty-nine larvae of Corynoneura were found in the regurgitated material from Corydalus. It is remarkable that by attaching to larger body size predators, prey could become free from predator bouts and could also be transported by them.Comensalismo entre Corydalus Latreille, 1802 (Insecta, Megaloptera, Corydalidae e Corynoneura Winnertz, 1846 (Insecta, Diptera, Chironomidae, Orthocladiinae foi registrado no córrego Indaiá situado a 1.380 m de altitude no Parque Nacional da Serra do Cipó (19-20ºS, 43-44ºW e nas nascentes do rio São Francisco a 1.300-1.700 m de altitude no Parque Nacional da Serra da Canastra (20º00'-20º30'S, 46º15'-47º00'W, Minas Gerais, Brasil. Setenta e oito larvas de Corydalus (tamanhos: 22-88 mm foram coletadas: 61 no córrego Indaiá e 17 em outros córregos. Doze larvas de Corydalus (tamanhos: 22-79 mm no córrego Indaiá e três encontradas nas nascentes do rio São Francisco (tamanhos: 38-50 mm apresentaram larvas e pupas de Corynoneura em suas brânquias (3ª a 6ª e algumas larvas fixadas nos segmentos abdominais de grandes Corydalus (> 25 mm. Sessenta e nove larvas de Corynoneura foram retiradas do material regurgitado por Corydalus. É importante observar que fixados aos predadores de grande tamanho corporal as presas se tornam livres de outros predadores além de serem transportados por eles.

  18. Does predator benefits prey? Commensalism between Corynoneura Winnertz (Diptera, Chironomidae) and Corydalus Latreille (Megaloptera, Corydalidae) in Southeastern Brazil / O predador beneficia sua presa? Comensalismo entre Corynoneura Winnertz (Diptera, Chironomidae) e Corydalus Latreille (Megaloptera, Corydalidae) no Sudeste do Brasil

    Scientific Electronic Library Online (English)

    Marcos, Callisto; Michael D.C., Goulart; Pablo, Moreno; Rogério P., Martins.


    Full Text Available Comensalismo entre Corydalus Latreille, 1802 (Insecta, Megaloptera, Corydalidae) e Corynoneura Winnertz, 1846 (Insecta, Diptera, Chironomidae, Orthocladiinae) foi registrado no córrego Indaiá situado a 1.380 m de altitude no Parque Nacional da Serra do Cipó (19-20ºS, 43-44ºW) e nas nascentes do rio [...] São Francisco a 1.300-1.700 m de altitude no Parque Nacional da Serra da Canastra (20º00'-20º30'S, 46º15'-47º00'W), Minas Gerais, Brasil. Setenta e oito larvas de Corydalus (tamanhos: 22-88 mm) foram coletadas: 61 no córrego Indaiá e 17 em outros córregos. Doze larvas de Corydalus (tamanhos: 22-79 mm) no córrego Indaiá e três encontradas nas nascentes do rio São Francisco (tamanhos: 38-50 mm) apresentaram larvas e pupas de Corynoneura em suas brânquias (3ª a 6ª) e algumas larvas fixadas nos segmentos abdominais de grandes Corydalus (> 25 mm). Sessenta e nove larvas de Corynoneura foram retiradas do material regurgitado por Corydalus. É importante observar que fixados aos predadores de grande tamanho corporal as presas se tornam livres de outros predadores além de serem transportados por eles. Abstract in english Commensalism between Corydalus Latreille, 1802 (Megaloptera, Corydalidae) and Corynoneura Winnertz, 1846 (Diptera, Chironomidae, Orthocladiinae) larvae was recorded in Indaiá stream, at 1,380 m a.s.l. (Parque Nacional da Serra do Cipó, 19º-20ºS, 43º-44ºW) and in the headwaters of São Francisco river [...] , at 1,300-1,700 m a.s.l. (Parque Nacional da Serra da Canastra, 20º00'-20º30'S, 46º15'-47º00'W), in Minas Gerais state, Brazil. Seventy eight Corydalus larvae (range 22-88 mm) were sampled: 61 in the Indaiá stream and 17 in other two streams. Twelve Corydalus larvae (22-79 mm) in the Indaiá stream and three out of 15 larvae in the headwaters of São Francisco river (38-50 mm) had Corynoneura, larvae and pupae on their gills (3rd to 6th) and a few larvae attached to the abdominal segments of larger Corydalus larvae (> 25 mm). Sixty-nine larvae of Corynoneura were found in the regurgitated material from Corydalus. It is remarkable that by attaching to larger body size predators, prey could become free from predator bouts and could also be transported by them.

  19. Predacious mites in papaya (Carica papaya L.) orchards: in search of a biological control agent of phytophagous mite pests / Ácaros predadores em pomares de mamoeiro (Carica papaya L.): em busca de um agente de controle biológico de ácaros fitófagos

    Scientific Electronic Library Online (English)

    Karin F.S., Collier; Jose O.G. de, Lima; Gilberto S., Albuquerque.


    Full Text Available Com o objetivo de selecionar ácaros predadores com potencial de controle de ácaros fitófagos do mamão, foram realizadas, de janeiro de 1999 a fevereiro de 2000, amostragens bimensais de ácaros em dois pomares, um orgânico (Silva Jardim, RJ) e outro com controle químico de pragas, doenças e invasoras [...] (Linhares, ES). Todas as espécies presentes nas brotações laterais, folhas novas, folhas velhas e botões florais dos mamoeiros e nas folhas das plantas invasoras foram quantificadas e identificadas ao menos até família. Apesar da relativamente diversa fauna de ácaros, somente representantes de uma família de predadores, Phytoseiidae, foram encontrados. Dentre estes, Neoseiulus idaeus Denmark & Muma destacou-se por sua abundância e freqüência nas diferentes épocas do ano no pomar de Linhares, coincidindo principalmente com as flutuações na abundância dos tetraniquídeos. Tal ocorrência em um sistema de produção com grande emprego de acaricidas, aliada às características biológicas favoráveis dessa espécie, recomendam-na como candidata a agente de controle biológico de ácaros pragas do mamão, em especial Tetranychus urticae Koch. Abstract in english This study was conducted to search for potential mite predators to control phytophagous mites in papaya orchards. Bimonthly surveys, from January 1999 to February 2000, were carried out in two orchards, one in Silva Jardim (RJ), where pests are naturally controlled, and one at Linhares (ES), where p [...] ests are chemically controlled. All mite species collected from buds, new leaves, old leaves, and floral buttons of papaya trees and from weed leaves were quantified and identified to at least family level. Despite the relatively diverse mite fauna, we found representatives of only one family of predacious mites, i.e. Phytoseiidae. Among these, Neoseiulus idaeus Denmark & Muma was the most abundant and frequent during all seasons in the Linhares orchard, coinciding mainly with the fluctuations in abundance of tetranychid mites. Such occurrence in a production system with large use of acaricides, together with its favorable biological traits reported in the literature, lead us to recommend this species as a good candidate for biological control of papaya mite pests, especially Tetranychus urticae Koch.

  20. Atividade predatória, crescimento radial e esporulação de fungos predadores de nematóides Monacrosporium spp, submetidos à criopreservação / Predatory activity, radial growth and esporulation of nematode-trapping fungus Monacrosporium spp, submitted to cryopreservation

    Scientific Electronic Library Online (English)

    Artur Kanadani, Campos; Marcelo de Andrade, Mota; Jackson Victor de, Araújo; Paulo Roberto, Cecon.


    Full Text Available Testes in vitro foram realizados para avaliar o efeito da criopreservação em nitrogênio líquido com e sem adição de crioprotetores (DMSO ou glicerol), na atividade predatória sobre larvas infectantes de Cooperia sp e Haemonchus sp, crescimento radial e produção de conídios de dois isolados de fungos [...] predadores de nematóides (Monacrosporium sinense e Monacrosporium appendiculatum). A capacidade predatória dos fungos sobre larvas infectantes de Cooperia sp e Haemonchus sp dos fungos previamente submetidos aos diferentes métodos de preservação não foi afetada. O crescimento radial dos fungos criopreservados com glicerol 10% foi mais expressivo(p Abstract in english In vitro tests were performed to evaluate the effect of cryopreservation with or without addition of cryoprotectants (DMSO or glycerol) in the predatory activity on Cooperia sp and Haemonchus sp infective larvae, radial growth and conidial production of two isolates of nematode-trapping fungus (Mona [...] crosporium sinense and M. appendiculatum). The predatory activity on Cooperia and Haemonchus sp infective larvae of the fungus submitted to the different preservations methods did not affected. The radial growth of the fungus cryopreserved with glycerol was higher (p

  1. A regional analysis of weather mediated competition between a parasitoid and a coccinellid predator of oleander scale / Análise regional da competição mediada por fatores climáticos entre um parasitóide e um coccinelídeo predador da cochonilha-da-espirradeira na Califórnia

    Scientific Electronic Library Online (English)

    Andrew P., Gutierrez; Marina A., Pizzamiglio.


    Full Text Available O controle natural de uma população assexuada de cochonilha-da-espirradeira (Aspidiotus nerii Bouchè (Hemiptera: Diaspididae) em plantas do louro da California [Umbellularia californica (Hopk. & Arn.) Nut.] por dois de seus inimigos naturais [Aphytis chilensis Howard (Hymenoptera: Aphelinidae) e Rhy [...] sobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae)] foi examinado em meio-ambiente com mudanças climáticas usando um modelo geral tritrófico, com base em estrutura populacional de idade e massa e acionado por condições climáticas. O modelo é de complexidade intermediária e os parâmetros foram obtidos através de extensas observações de laboratório e campo em Albany, Califórnia. Índices fisiológicos dependentes de temperatura foram desenvolvidos a partir de dados de laboratório e usados para modificar o crescimento per capita, fecundidade e taxas de sobrevivência dos valores máximos. O modelo tritrófico foi integrado em GIS (sistema geográfico de informação ) e a dinâmica das espécies foi examinada através dos anos e das zonas ecológicas da Califórnia. Dados de campo e resultados de modelagem sugerem que o coccinelídeo predador é o agente mais importante no controle da cochonilha-da-espirradeira no clima ameno de Albany. Entretanto, a análise de regressão linear multivariada de dados de simulações regionais, demonstra que, sob altas temperaturas, A. chilensis é o fator mais importante suprimindo as densidades da cochonilha, enquanto o predador R. lophanthae é mais eficiente em regiões mais frias. A presença de R. lophanthae aumenta a densidade da cochonilha 9,7% em média através das zonas ecológicas da Califórnia. Abstract in english The regulation of an asexual population of the oleander scale [Aspidiotus nerii Bouchè (Hemiptera: Diaspididae)] on California bay tree [Umbellularia californica (Hopk. & Arn.) Nut.] by two natural enemies; an idiobiont, ectoparasitoid Aphytis chilensis Howard (Hymenoptera: Aphelinidae) and a coccin [...] ellid predator (Rhysobius lophanthae (Blaisd.) (Coleoptera: Coccinellidae), was examined using a general weather-driven, tri-trophic, physiologically based age-mass structured demographic model. The model is of intermediate complexity and was parameterized using extensive laboratory data and field observations from Albany, CA. Temperature-dependent physiological indices were estimated from the laboratory data and used to scale per capita growth, fecundity and survivorship rates from maximal values in a time varying environment. The tri-trophic model was integrated in a GIS (geographic information system) and the species dynamics examined across years and across the ecological zones of California. Field data and simulation results suggested the coccinellid predator was the most important regulating agent of oleander scale in the mild climate of Albany. However, multiple linear regression analysis of simulation data across all ecological zones of California shows that the parasitoid A. chilensis is the most important agent in suppressing oleander scale densities in warmer climates, while the predator R. lophanthae increases scale density an average of 9.7% across all regions.

  2. Ovary development, egg production and oviposition for mated and virgin females of the predator Podisus nigrispinus (Heteroptera: Pentatomidae) / Desenvolvimento ovariano, produção de ovos e oviposição de fêmeas virgens ou acasaladas do predador Podisus nigrispinus (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Marcus Alvarenga, Soares; Joana Darc, Batista; José Cola, Zanuncio; José, Lino-Neto; José Eduardo, Serrão.


    Full Text Available Insetos Asopinae são predadores generalistas e Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) é a espécie mais estudada desse grupo no Brasil. O objetivo foi avaliar o desenvolvimento ovariano, a produção de ovos e a oviposição de fêmeas de P. nigrispinus virgens ou acasaladas. Cinco fêmea [...] s com 24 horas de idade foram dissecadas e os ovários foram analisados. Quinze fêmeas desse predador foram acasaladas (T1) e outras 15 foram individualizadas sem acasalamento (T2). Os ovários de cinco fêmeas por tratamento foram dissecados e os ovos maduros e em formação foram contados. Cinco fêmeas virgens de P. nigrispinus com 20 dias de idade foram também analisadas. Fêmeas de P. nigrispinus com 24 horas de idade apresentaram baixo desenvolvimento ovariano, sem evidencia de produção de ovócitos. As fêmeas do tratamento T1 apresentaram ovários completamente desenvolvidos, com 22,67 ± 7,26 ovos maduros e 31,33 ± 1,33 ovos em processo de maturação. Ovários de fêmeas do tratamento T2 apresentaram uma quantidade baixa de ovos nos primeiros estágios de maturação (15 ± 1,73). Fêmeas do tratamento T2, dissecadas aos 20 dias, apresentaram 28,33 ± 2,31 e 15 ± 1,96 ovos maduros e imaturos, respectivamente. Fêmeas de P. nigrispinus iniciam a ovogênese e a maturação dos ovos logo após a emergência, porém o acasalamento é importante para manter a produção dos ovos e a oviposição. Abstract in english The Asopinae insects are generalist predators, and Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is the most studied species of this group in Brazil. The objective was to study ovarian development, egg production and oviposition of mated and virgin P. nigrispinus females. Five 24-hours-ol [...] d females were dissected and the ovaries were analyzed. Fifteen females of this predator were mated (T1), and another fifteen were individualized without mating (T2). The ovaries of five females per treatment were dissected and mature and immature eggs were counted. Five virgin females of P. nigrispinus at twenty days old were also analyzed. Twenty-four-hours-old P. nigrispinus females had low ovary development without the evidence of oocyte production. The females of the T1 had completely developed ovaries, with 22.67 ± 7.26 mature eggs and 31.33 ± 1.33 oocytes in the maturation process. Ovaries of females of T2 had a lower quantity of eggs in the early maturation stage (15 ± 1.73). Females of T2 that were dissected at day 20 had 28.33 ± 2.31 and 15 ± 1.96 mature and immature eggs, respectively. Podisus nigrispinus females begin oogenesis and egg maturation soon after their emergence but mating is important to maintain egg production and oviposition.

  3. Effect of sub-lethal concentrations of permethrin on ovary activation in the predator Supputius cincticeps (Heteroptera: Pentatomidae Efeito de concentrações subletais de permetrina na ativação ovariana do predador Supputius cincticeps (Heteroptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    W. P. Lemos


    Full Text Available Insecticides may cause mortality and deleterious effects on predatory stinkbugs. For this reason, the effect of five concentrations of permethrin applied on third instar nymphs of Supputius cincticeps (Stål (Heteroptera: Pentatomidae was investigated on ovary activation in this predator. The nymphs received topical application of permethrin in the following concentrations (mg a.i./ml: 10-7, 10-6, 10-5, 10-4, and 10-3. Ovary lengths and oocyte numbers were quantified following first egg mass. Ovary length of S. cincticeps varied from 5.7 mm with 10-4 mg a.i./ml, to 6.4 mm with 10-7 mg a.i./ml, with similar values for the other permethrin concentrations and for the control. The number of oocytes per female varied from 13.5 with 10-3 mg a.i./ml, to 29.2 for the control, with significant differences.The number of oocytes per female of nymphs exposed to a permethrin concentration of 10-5 mg a.i./ml was similar to that of the control.However, the lower number of oocytes per female from nymphs exposed to other concentrations of permethrin suggests that this insecticide may affect the reproductive capacity of this predator. The results obtained are discussed in relation to tolerance of Heteroptera predators to insecticides and possible hormesis occurrence.Inseticidas podem causar mortalidade e efeitos deletérios em percevejos predadores. Por isso investigou-se o efeito de cinco concentrações de permetrina aplicadas em ninfas de terceiro estádio de Supputius cincticeps (Stål (Heteroptera: Pentatomidae em sua ativação ovariana. Essas ninfas receberam aplicação tópica de permetrina nas seguintes concentrações (mg i.a./ml: 10-7, 10-6, 10-5, 10-4, 10-3. O comprimento dos ovários e o número de ovócitos foram quantificados após a primeira postura. O comprimento do ovário variou de 5,7 mm na concentração de 10-4 mg i.a./ml a 6,4 mm na concentração de 10-7 mg i.a./ml, com valores semelhantes para as outras concentrações de permetrina e controle. O número de ovócitos por fêmea variou de 13,5 (10-3 mg i.a./ml a 29,2 no controle, com diferenças significativas entre concentrações. O número de ovócitos por fêmea, proveniente de ninfas expostas a concentração de 10-5 mg i.a./ml, foi semelhante àquele do controle. No entanto, o menor número de ovócitos por fêmea, provenientes de ninfas expostas a outras concentrações de permetrina, sugere que esse inseticida pode afetar a capacidade reprodutiva. Esses resultados são discutidos em relação à tolerância de Heteroptera predador aos inseticidas e a possível ocorrência de hormese.

  4. Field tests of predaceous pentatomid pheromones and semiochemistry of Podisus and Supputius species (Heteroptera: Pentatomidae: Asopinae) / Testes de campo com feromônios de pentatomídeos predadores e análise semioquímica de espécies dos gêneros Podisus e Supputius (Heteroptera: Pentatomidae: Asopinae)

    Scientific Electronic Library Online (English)

    Jeffrey R., Aldrich; José C., Zanuncio; Evaldo F., Vilela; Jorge B., Torres; Ronald D., Cave.


    Full Text Available Armadilhas contendo feromônios sintéticos de Podisus nigrispinus (Dallas) e Supputius cincticeps (Stäl) foram testadas no campo, na Universidade Federal de Viçosa, Minas Gerais, Brasil, a partir de 7 de setembro de 1995. Durante a coleta (setembro-outubro/95), não se observou a presença de P. nigris [...] pinus nas armadilhas em teste. No entanto, diversos adultos (machos e fêmeas) de Podisus distinctus (Stäl) foram coletados durante o mesmo período, bem como, alguns adultos de S. cincticeps e dois parasitóides fêmeas de Cylindromyia atra Roeder (Diptera: Tachinidae). Análises químicas do extrato glandular de machos de P. distinctus indicaram que os principais compostos feromonais desta espécie, também são produzidos por P. nigrispinus e S. cincticeps. Devido a este fato, em 6 de novembro, foram colocadas no campo uma série de armadilhas contendo iscas feromonais tanto de P nigrispinus, como de S. cincticeps. As armadilhas foram monitoradas até 6 de fevereiro de 1996. Durante esta segunda etapa do estudo, observou-se que a combinação das duas iscas feromonais aumentou em seis vezes a coleta de adultos de P. distinctus, em comparação com aquelas onde havia somente a isca para P. nigrispinus. Embora a fenologia para estes asopines neotropicais seja semelhante à do predador norte-americano de clima temperado Podisus maculiventris (Say), menos predadores e parasitóides hospedeiros foram coletados. Possíveis feromônios foram identificados para Podisus rostralis (Stäl), em Goiás, Brasil, e Podisus sagitta (Fabricius), de Honduras. Compostos químicos de outras secreções exócrinas destas espécies neotropicais também foram estudados. Abstract in english Traps baited with synthetic pheromones for either Podisus nigrispinus (Dallas) or Supputius cincticeps (Stäl) were field tested at the Universidade Federal de Viçosa, Minas Gerais, Brazil, beginning September 7, 1995. No P. nigrispinus were caught but, in September and October, several adult males a [...] nd females of P. distinctus (Stäl) were caught along with a few adults of S. cincticeps and two females of a tachinid fly parasitoid, Cylindromyia atra Roeder. Chemical analysis of the pheromone gland extract of P. distinctus males indicated that this species produces a pheromone containing the major compounds of P. nigrispinus and S. cincticeps. Therefore, on November 6 a set of traps was baited with the pheromones of both P. nigrispinus and S. cincticeps, and monitored in the field until February 6, 1996. During this second phase of the study, six times more P. distinctus were caught in the combined pheromone treatment than in traps baited only with the P. nigrispinus pheromone. The phenology of these neotropical asopines is like that for P. maculiventris (Say) in temperate North América, although fewer predators and host-seeking parasitoids were caught. Suspected pheromones were also identified for P. rostralis (Stäl) from Goiás, Brazil, and P. sagitta (Fabricius) from Honduras. In addition, the chemistry of other exocrine secretions from these neotropical species was investigated.

  5. Efeito de acaricidas sobre Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) e ácaros predadores em citros no Estado de Roraima, Brasil / Effect of acaricides on Schizotetranychus hindustanicus (Hirst) (Acari: Tetranychidae) and predaceous mites on citrus in the State of Roraima, Brazil

    Scientific Electronic Library Online (English)

    A.L., Marsaro Júnior; M.E., Sato; R.M. de, Aguiar; G.B., Vieira; R.J. da, Silva Júnior; J.L. de C., Mineiro.


    Full Text Available O ácaro-hindustânico-dos-citros, Schizotetranychus hindustanicus (Hirst), é uma praga de importância quarentenária, recentemente introduzida no Brasil. Até a condução do presente estudo, não havia informações na literatura sobre a eficiência de acaricidas no controle de S. hindustanicus, em condiçõe [...] s de campo. O estudo teve por objetivo avaliar o efeito de alguns acaricidas, utilizados em pomares de citros no país, sobre o ácaro-praga e ácaros predadores (Phytoseiidae) presentes na cultura. O experimento foi conduzido em um pomar de citros (limão-tahiti), em Boa Vista, RR. Os acaricidas testados e respectivas concentrações (g i.a./100 L de água) foram: mancozebe (200), abamectina (0,36), espirodiclofeno (6), enxofre (400) e dimetoato (80). A aplicação foi realizada com equipamento acoplado a um trator, provido de pistolas, aplicando-se 10 litros de calda por planta. O delineamento estatístico foi inteiramente casualizado com seis tratamentos e cinco repetições. As avaliações foram realizadas aos 1, 4, 7, 14, 28, 42 e 56 dias após a aplicação (DAA). Em cada avaliação, foram coletados 20 folhas e 10 frutos por parcela, contando-se o número de ácaros S. hindustanicus e fitoseídeos. Todos os produtos reduziram significativamente a população do ácaro-hindustânico nas folhas até 28 DAA. Os acaricidas dimetoato e espirodiclofeno foram altamente eficientes no controle de S. hindustanicus, sendo que o espirodiclofeno apresentou um período de controle mais longo que dimetoato. Com relação aos ácaros predadores, dimetoato, enxofre e abamectina causaram mortalidades significativas (72 a 100%) aos fitoseídeos, até 4 DAA. A espécie predominante de fitoseídeo foi Euseius concordis (Chant), correspondendo a 71% dos ácaros observados. Abstract in english Schizotetranychus hindustanicus (Hirst) is a pest of quarantine importance, recently introduced in Brazil. There was no information in the literature, on the efficacy of acaricides for the control of S. hindustanicus (Hirst) under field conditions, up to the conduction of this research. The objectiv [...] e of this study was to evaluate some acaricides currently used in citrus orchards, determining their effect on pest mites and predaceous mites (Phytoseiidae) living among the crop. The experiment was carried out in a citrus orchard (Tahitian lime), in the Boa Vista municipality, in the state of Roraima, Brazil. The acaricides studied and their respective concentrations (g a.i./100 l of water) were: mancozeb (200), abamectin (0.36), spirodiclofen (6), sulphur (400) and dimethoate (80). The application was made using tractor-mounted hydraulic handgun sprayers, using a volume of 10 L of acaricide suspension per plant. The statistical design was a completely randomized design with six treatments and five replicates. The evaluations of the effect of chemicals on the populations of S. hindustanicus and predaceous mites (Phytoseiidae) were carried out at 1, 4, 7, 14, 28, 42 and 56 days after treatment (DAT). During each evaluation, 20 leaves and 10 fruits were collected per plot, counting the number of S. hindustanicus and phytoseiid mites. All the chemicals reduced significantly the population of hindustan citrus mite on the leaves until 28 DAT. The acaricides dimethoate and spirodiclofen were highly effective against S. hindustanicus, and spirodiclofen presented a longer effective period than dimethoate. Regarding the predaceous mites, dimethoate, sulfur and abamectin caused significant mortality (72 to 100%) to the predators up to 4 DAT. The predominant species of Phytoseiid mite was Euseius concordis (Chant), corresponding to 71% of mites of this family.

  6. Alternative plants hosts of legume aphids and predators in the province of León, Spain / Plantas hospedadoras alternativas de áfidos de leguminosas y sus predadores, en la provincia de León (España)

    Scientific Electronic Library Online (English)

    Isabel, Bertolaccini; Etelvina, Núñez-Pérez; Emilio Jorge, Tizado.


    Full Text Available Durante los meses de primavera, verano y otoño de 1998 y 1999 se observaron al azar cultivos de leguminosas, y las plantas espontáneas marginales e intercalares, en la provincia de León (España). Los cultivos muestreados fueron: Medicago sativa, Phaseolus vulgaris,Pisum sativum, Cicer arietinum, Tri [...] folium repens, Vicia fava, Trifoliumpratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolio y Lens esculenta. Se observaron 23 familias de plantas espontáneas, en ellas y en los cultivos se identificaron los áfidos, su densidad poblacional y de los predadores de las familias Coccinellidae, Syrphidae Chrysopidae. Las familias con mayores registros de los enemigos naturales de los pulgones fueron: Apiaceae, Asteraceae y Chenopodiaceae para Syrphidae y Coccinellidae. Se concluye que el manejo de los agrosistemas, mediante la manipulación de las plantas espontáneas, constituiría un recurso a tener en cuenta para incrementar el potencial de los enemigos naturales de los áfidos plaga de los cultivos de leguminosas. Abstract in english The study was done during the spring, summer and fall of 1998 and 1999. Samples were taken at random from legume crops and spontaneous plants adjacent to them in the province of León (Spain). Observations were made on the following crops: Medicago sativa, Phaseolus vulgaris, Pisum sativum, Cicer ari [...] etinum, Trifolium repens, Vicia fava, Trifolium pratense, Vicia ervilia, Lathyrus cicera, Lathyrus sativus, Trigonella foenum-graecum, Lupinus albus, Lupinus angustifolius and Lens esculenta. Twenty three families of spontaneous plants were observed. The aphid species and their population densities on the spontaneous plants and crop plants were recorded, as was the presence of members of the families Coccinellidae, Syrphidae and Chrysopidae. The plant families Brassicaceae, Asteraceae and Chenopodiaceae had the greatest numbers of these natural enemies of aphids the manipulation of spontaneous plants in agrosystems is a potential means of increasing populations of natural enemies of aphid pests in legume crops.

  7. Acão de Inseticidas Organofosforados Utilizados no Controle de Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) Sobre o Ácaro Predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Action of Organophosphate Insecticides Used to Control Leucoptera coffeella (Guérin-Mèneville) (Lepidotera: Lyonetiidae) on the Predator Mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)



    Full Text Available O controle químico apresenta vantagens como economicidade e rapidez de ação, e tem sido preferencialmente usado no controle de pragas pelos agricultores. Em contrapartida, entre as desvantagens destaca-se o largo espectro de ação dos compostos, que atingem espécies não-alvos, como inimigos naturais, [...] além de contaminarem o meio ambiente. O presente trabalho avaliou a ação dos inseticidas clorpirifós, dissulfotom, etiom e paratiom-metílico, normalmente usados para controlar o bicho-mineiro-do-cafeeiro Leucoptera coffeella (Guérin-Mèneville), sobre o ácaro predador Iphiseiodes zuluagai Denmark & Muma, agente de controle dos ácaros fitófagos Oligonychus ilicis (McGregor) e Brevipalpus phoenicis (Geijskes) em agroecossistema cafeeiro. Para verificar o efeito seletivo dos compostos sobre o ácaro predador, concentrações discriminatórias (CLs99) dos quatros inseticidas foram determinadas para o 3º instar larval de L. coffeella, através do método de bioensaios de concentração-mortalidade em papel-filtro, impregnado com resíduo seco de inseticidas. O clorpirifós causou 100% de mortalidade dos ácaros testados; o etiom e o paratiom-metílico causaram 34% e 19% de mortalidade, respectivamente. Dissulfotom foi o mais seletivo em favor do predador, não mostrando ação letal. O efeito diferenciado dos inseticidas foi desta forma verificado, e tal informação possibilita a utilização dos inseticidas seletivos no agroecossistema cafeeiro, preservando populações de I. zuluagai e favorecendo o controle biológico exercido pelo ácaro predador. Abstract in english Chemical control has been preferentially used to suppress pests by farmers mainly due to low price of the products and immediate action on target organisms. However, wide action range of the compounds, undesirable effects on non target organisms and the contamination of the environment are among the [...] disadvantages of this method of control. This study evaluated the action of the insecticides chlorpyrifos, disulfoton, ethion and methyl-parathion, normally used to control the coffee leaf-miner, Leucoptera coffeella (Guérin-Mèneville), on the predaceous mite Iphiseiodes zuluagai Denmark & Muma, a control agent of the phytophagous mites Oligonychus ilicis (McGregor) and Brevipalpus phoenicis (Geijskes) in coffee plantation. Discriminatory concentrations (LC99), established on the 3rd instar of L. coffeella, by means of the method of dry insecticide residues impregnated in filter paper, were used to verify the selectivity of the insecticides on the predaceous mite. The insecticide chlorpyrifos caused 100% of mortality in I. zuluagai. Ethion and methyl-parathion showed mortality of 34% and 19%, respectively. Disulfoton presented the highest selectivity for the mite, with no lethal action on the predator. The different effects found on the insecticides' action show that it is possible to use the selective insecticides in coffee plantation to preserve populations of I. zuluagai, thus favouring the biological control on phytophagous mite.

  8. Seletividade de extratos de nim (Azadirachta indica A. Juss.) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) / Selectivity of neem extracts (Azadirachta indica A. Juss.) to the predatory Mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Sheila A., Mourão; Júlio C.T., Silva; Raul N.C., Guedes; Madelaine, Venzon; Gulab N., Jham; Claudinei L., Oliveira; José C., Zanuncio.


    Full Text Available A toxicidade relativa dos extratos de folha, semente e óleo de torta de Azadirachta indica A. Juss (nim) ao ácaro predador Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) foi estudada em laboratório. Foram determinadas concentrações discriminatórias (CLs99) dos extratos de folha, semente [...] e óleo de torta de nim para fêmeas adultas de Oligonychus ilicis (McGregor) (Acari: Tetranychidae), através de bioensaios de concentração-mortalidade. Arenas com 3,5 cm de diâmetro, confeccionadas com folhas de cafeeiro flutuando em água, foram impregnadas com resíduo seco dos extratos e usadas para se estimar a seletividade ao ácaro I. zuluagai. As concentrações dos extratos de nim que mataram 99% de O. ilicis, após 72h de exposição foram: 277,4; 520,9 e 10,9 mg/ml, para folha, semente e óleo de torta, respectivamente. A concentração discriminatória do extrato de óleo de torta de nim para fêmeas adultas de O. ilicis foi altamente tóxica ao ácaro I. zuluagai, as dos extratos de folha e de semente foram seletivos. Abstract in english The relative toxicity of the leaf, seed and oil neem cake extracts of Azadirachta indica A. Juss (neem) to the predatory mite Iphiseiodes zuluagai (Denmark & Muma) (Acari: Phytoseiidae) was evaluated. To verify the relative toxicity of these extracts on the predatory mite, discriminating concentrati [...] ons of the extracts were determined for adult females of the Oligonychus ilicis (McGregor) (Acari: Tetranychidae), through the method of concentration-mortality. Coffee leaf disks with 3.5 cm of the diameter were put floating on water and impregnated with dry residue of the extracts. Concentrations of neem extracts which caused mortality (99%) of O. ilicis, after 72h of exposition, were 277.4; 520.9 e 10.9 mg/ml for leaf, seed and oil neem cake, respectively. The discriminating concentration of extract of oil neem cake for O. ilicis females was highly toxic to I. zuluagai; while extract of leaf and seed were selective to the predatory mite.

  9. Seletividade de inseticidas, utilizados no controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) em pêssego, a Vespidae predadores / Seletivity of insecticides used for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach, to predatory Vespidae

    Scientific Electronic Library Online (English)

    Alfredo H.R., Gonring; Marcelo, Picanço; Marcelo F. de, Moura; Leandro, Bacci; Cláudio H., Bruckner.


    Full Text Available Estudo-se em laboratório a seletividade dos inseticidas carbaril, deltametrina, fenitrotiom, fentiom, malatiom, nalede, paratiom metílico e triclorfom aos predadores Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) e Protopolybia exigua (Saussure) (Hymenoptera: Vespidae) [...] em concentrações que correspondem a 50% (subdose) e 100% (dose) da recomendação para o controle de Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) na cultura do pêssego. Nas doses recomendadas, para controle de G. molesta, os inseticidas fenitrotiom, fentiom, paratiom metílico, nalede e triclorfom não apresentaram seletividade às três espécies de Vespidae, causando 100% de mortalidade a estas, com exceção do triclorfom que matou 96,9% de P. sylveirae. Carbaril e malatiom foram seletivos em favor de P. versicolor versicolor (18,6 e 6,7% de mortalidade, respectivamente), e deltametrina em favor de P. versicolor versicolor (3,7% de mortalidade) e P. exigua (11,9% de mortalidade). P. sylveirae foi mais suscetível a deltametrina que P. exigua e P. versicolor versicolor. Já P. versicolor versicolor foi mais tolerante a malatiom e carbaril que P. sylveirae e P. exigua. Deltametrina, malatiom e nalede causaram menor mortalidade em P. sylveirae quando aplicados em subdose, sendo que o mesmo ocorreu com carbaril e malatiom para P. exigua. Abstract in english The selectivity of the insecticides carbaryl, deltamethrin, fenitrothion, fenthion, malathion, naled, methyl parathion and trichlorfon to the predators Protonectarina sylveirae (Saussure), Polistes versicolor versicolor (Olivier) and Protopolybia exigua (Saussure) was studied in laboratory using 50 [...] and 100% of the recommended dose for the control of Grapholita molesta (Busch) (Lepidoptera: Olethreutidae) in peach orchards. The insecticides fenitrothion, fenthion, methyl parathion, naled, and trichlorfon showed no selectivity in favour of the wasps at the full recommended dose, all of them causing 100% mortality among the predators except for trichlorfon which caused 96.9% mortality to P. sylveirae. Carbaryl and malathion were selective in favour of P. versicolor versicolor (18.6 and 6.7% mortality, respectively), and deltamethrin was selective in favour of P. versicolor versicolor (3.6% mortality) and P. exigua (11.8% mortality). P. sylveirae was more susceptible to deltamethrin than P. exigua and P. versicolor versicolor. P. versicolor versicolor was more tolerant to malathion and carbaryl than P. sylveirae and P. exigua. Deltamethrin, malathion and naled were less lethal to P. sylveirae when applied at the lower dose; while the same happened to carbaryl and malathion for P. exigua.

  10. Seletividade de agrotóxicos utilizados em pessegueiro sobre ovos e pupas do predador Chrysoperla externa / Selectivity of pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa

    Scientific Electronic Library Online (English)

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Paulo Ricardo Baier, Siqueira; Ítalo Lucas de, Moraes; Cleiton Jair, Gauer.


    Full Text Available Objetivou-se com este trabalho avaliar a seletividade de dezenove agrotóxicos utilizados na cultura do pessegueiro sobre ovos e pupas do predador Chrysoperla externa em condições laboratoriais (temperatura 25±1ºC, umidade relativa 70±10% e fotofase 14 horas). Os agrotóxicos foram pulverizados direta [...] mente sobre ovos e pupas por meio de uma torre de Potter, utilizando a máxima dosagem recomendada para a cultura do pessegueiro. Foi avaliada a viabilidade de ovos e pupas, além da fecundidade e fertilidade de adultos emergidos de pupas tratadas. Os agrotóxicos foram classificados para ovos em função da redução na eclosão e, para pupas, em função do efeito total, conforme a escala de toxicidade proposta pela IOBC. A maioria dos agrotóxicos avaliados (8 inseticidas, 8 fungicidas e 2 herbicidas) se mostrou inócua (classe 1) a ovos e pupas, com redução na eclosão de larvas e efeito total em pupas inferiores a 30%. A exceção se deu para o inseticida óleo mineral, que reduziu a eclosão de larvas em 69,55% quando pulverizado em ovos e proporcionou efeito total em pupas de 36,22%, sendo classificado como levemente nocivo (classe 2) a ovos e pupas de C. externa Abstract in english This research aimed to evaluate the effect of nineteen pesticides used in peach orchards on eggs and pupae of the predator Chrysoperla externa in bioassays carried under laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase). The pesticides were directly spra [...] yed on eggs and pupae trough a Potter tower using the maximum recommended dosage for peach orchards. It was evaluated eggs and pupae viability, in addition to fecundity and fertility of adults emerged from treated pupae. The pesticides were classified to eggs according to reduction in eggs hatch, and to pupae according to the total effect into IOBC toxicity categories. Most of pesticides evaluated (8 insecticides, 8 fungicides and 2 herbicides) were harmless (category 1) to eggs and pupae, with a reduction in eggs hatch and total effect to pupae lower than 30%, except for the insecticide mineral oil, which reduced eggs hatch in 69.55% and caused a total effect of 36.22% in pupae, being therefore classified as slightly harmful (category 2) to eggs and pupae of C. externa

  11. Ácaros predadores (Acari) associados à cultura do morango (Fragaria sp., Rosaceae) e plantas próximas no Estado do Rio Grande do Sul / Predatory mites (Acari) associated with strawberry and neighboring plants in the State of Rio Grande do Sul

    Scientific Electronic Library Online (English)

    Noeli Juarez, Ferla; Marla Maria, Marchetti; Dinarte, Gonçalves.

    Full Text Available O objetivo deste estudo foi determinar as espécies de ácaros predadores associados à cultura do morango e em plantas associadas, no estado do Rio Grande do Sul. Este estudo foi conduzido nos municípios de Bom Princípio, Capitão e Lajeado em plantações de morango da variedade Oso Grande em túnel baix [...] o. As avaliações foram feitas mensalmente entre agosto de 2002 e março de 2004. Nas plantas de morango, as amostras foram constituídas de três folhas coletadas em cada uma das 15 plantas escolhidas ao acaso, totalizando 45 folhas/campo. Nas plantas associadas, o esforço de amostragem foi de uma hora para cada planta avaliada. Ácaros das famílias Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae e Tydeidae foram observados associados com o ácaro rajado, Tetranychus urticae Koch, 1836, praga importante na região onde este estudo foi conduzido. Vinte espécies foram identificadas, 14 das quais pertencem à família Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) e Neoseiulus californicus (McGregor, 1954) foram as espécies mais comuns. Nas plantas asssociadas, a maior diversidade foi observada em Richardia sp. (seis espécies), Agerantum conyzoides L.(quatro espécies) e Sonchus oleraceus L., Bidens pilosa L.e Rumex sp. (três espécies). Uma chave docotômica é apresentada para a identificação das espécies. Abstract in english The aim of this study was to determine the species predatory mites on strawberry crop and associated plants in the State of Rio Grande do Sul. It was conducted in Bom Princípio, Capitão and Lajeado counties, in crops of strawberry Oso Grande variety in low tunnels. The evaluations were done monthly [...] between August 2002 and March 2004. In the plants of strawberry, the samples were constituted of three leaves collected in each of 15 plants taken randomly, totaling 45 leaves/field. In the associated plants, the sampling effort was of one hour for each plant evaluated. Mites of the families Ascidae, Parasitidae, Phytoseiidae, Cunaxidae, Erythraeidae, Stigmaeidae and Tydeidae were observed associated with the two-spotted spider mite, Tetranychus urticae Koch, 1836, important pest of this crop in the region where the study was conducted. Twenty species were identified, 14 of which belong to the family Phytoseiidae. Phytoseiulus macropilis (Banks, 1905) and Neoseiulus californicus (McGregor, 1954) were the most common species. On associated plants, the highest diversity of predatory mites was found on Richardia sp. (six mite species), Agerantum conyzoides L. (four mite species) and Sonchus oleraceus L., Bidens pilosa L. and Rumex sp. (three mite species). A dichotomous key is presented for the separation of the species collected.

  12. Estímulos Olfativos Envolvidos na Localização de Presas pelo Ácaro Predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) em Macieiras e Plantas Hospedeiras Alternativas / Olfactory Stimuli Involved in Prey Location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) on Apple and Alternate Host Plants

    Scientific Electronic Library Online (English)



    Full Text Available Os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Tetranychidae) causam sérios prejuízos à cultura da maçã no Sul do Brasil. Uma alternativa de manejo dessas espécies, atualmente em uso em pomares de macieira de Fraiburgo, SC, é o controle biológico com o ácaro predador Neoseiul [...] us californicus (McGregor). Visando compreender como as interações do predador com ambas as presas em suas plantas hospedeiras são intermediadas ao nível olfativo, estudaram-se as respostas do predador tanto em macieira, Malus domestica (Borkham), como em algumas plantas invasoras de pomares: Sida rhombifolia L., Plantago tomentosa Lamarck e Taraxacum officinale Weber, hospedeiras alternativas de T. urticae no inverno. As respostas foram investigadas em olfatômetro em tubo na forma de Y. Em macieira, para ambas as presas, N. californicus respondeu significativamente aos aleloquímicos emanados de folhas atacadas isoladamente ou em conjunto com a presa e/ou seus subprodutos (fezes, ovos, teias e exúvias), assim como àqueles emanados de folhas sadias com a presa e seus subprodutos. N. californicus também foi atraído por folhas sadias de macieira contendo os subprodutos de T. urticae. Em relação à localização de T. urticae nas plantas hospedeiras alternativas, verificou-se que, em S. rhombifolia e P. tomentosa, os voláteis dos subprodutos do ácaro aparentemente exercem papel atrativo preponderante, enquanto não houve resposta a nenhum dos estímulos olfativos relacionados a T. officinale. Assim, no processo de localização de P. ulmi e T. urticae por N. californicus, tanto os estímulos olfativos da presa e de seus subprodutos como aqueles emitidos pela planta atacada por estes podem funcionar como sinalizadores para o predador localizar as colônias de ácaros fitófagos. Além disto, voláteis das flores das três plantas invasoras exerceram forte atratividade ao predador, o que sugere que este estímulo está envolvido na localização de pólen, outra de suas fontes de alimento. Abstract in english The phytophagous mites Panonychus ulmi (Koch) and Tetranychus urticae Koch (Tetranychidae) cause severe losses in apples in southern Brazil. An alternate means of managing both species, currently under way in orchards in Fraiburgo, SC, is the use of the predatory mite Neoseiulus californicus (McGreg [...] or). To understand how this predator interacts at the olfactive level with both prey on their host plants, we studied the responses of N. californicus on apple, Malus domestica (Borkham), as well as on three of the predator's alternate winter hosts (Sida rhombifolia L., Plantago tomentosa Lamarck and Taraxacum officinale Weber), in a Y-tube olfactometer. On apple, the tests demonstrated that N. californicus responded significantly to allelochemicals associated with previously-infested leaves with or without P. ulmi or T. urticae or their associated byproducts (feces, eggs, exuviae, and webs), as well as to those associated with previously-uninfested leaves + prey and its byproducts. The predator also responded to a mixture of volatile odors from previously-uninfested apple leaves with T. urticae byproducts. In relation to the location of T. urticae by N. californicus on its alternate winter host plants, we observed that the prey byproducts are more attractive to the predator on S. rhombifolia and P. tomentosa, whereas infested leaves of T. officinale with or without prey and its byproducts did not elicit any response. These results indicate that the volatiles from the host plant, as well as those from the prey and its byproducts, serve as cues in the prey location by N. californicus. Additionally, volatiles from the flowers of the three alternate host plants were highly attractive to the predator, which suggests that this stimuli could be involved in locating pollen, another of its food sources.

  13. Compatibilidade de inseticidas e acaricidas com o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) em algodoeiro / Compatibility of insecticides and acaricides to the predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) on cotton

    Scientific Electronic Library Online (English)



    Full Text Available Os objetivos deste trabalho foram estudar a ação dos inseticidas espinosade, lambdacialotrina e monocrotofós no controle do curuquerê-do-algodoeiro Alabama argillacea (Hübner), sua compatibilidade com o percevejo predador Podisus nigrispinus (Dallas), e os efeitos dos inseticidas e acaricidas metioc [...] arbe, pimetrozine, tiametoxam, abamectim, diafentiurom, dicofol e propargite na predação de A. argillacea por P. nigrispinus no campo. Inseticidas e concentrações utilizadas proporcionaram controle de A. argillacea acima de 90% no dia da aplicação. O controle de A. argillacea por lambdacialotrina (20 g i.a./ha) e monocrotofós (240 e 320 g i.a./ha) foi observado até três dias após aplicação, enquanto espinosade (30 e 60 g i.a./ha) prolongou o controle acima de 90% até cinco dias. Monocrotofós e lambdacialotrina foram significativamente mais tóxicos para P. nigrispinus comparado a espinosade. O efeito residual de monocrotofós e lambdacialotrina para P. nigrispinus foi evidente até três dias após a aplicação. A sobrevivência de P. nigrispinus foi afetada por metiocarbe, tiametoxam, diafentiurom, abamectim e enxofre após um dia, e apenas por tiametoxam após três dias da aplicação. Pimetrozine, dicofol e propargite não afetaram a sobrevivência de P. nigrispinus. A predação de lagartas de A. argillacea por P. nigrispinus não foi observada no dia da aplicação em plantas tratadas com metiocarbe e afetada por tiametoxam, abamectim, diafentiurom e enxofre, mesmo três dias após a aplicação. Os inseticidas pimetrozine e espinosade, bem como os acaricidas dicofol e propargite mostraram-se compatíveis com P. nigrispinus, e devem ser priorizados em programas de manejo integrado de pragas do algodoeiro. Abstract in english The objectives of this work were to study the insecticides espinosad, lambdacyhalothrin and monocrotophos on the control of Alabama argillacea (Hübner), the compatibility of these insecticides with the predatory stinkbug Podisus nigrispinus (Dallas), and the effects of the insecticides and acaricide [...] s methiocarb, pymetrozine, thiamethoxam, abamectin, diafenthiuron, dicofol and propargite on the predatory stinkbug behavior preying upon A. argillacea under field conditions. More than 90% of cotton leafworm control was obtained at the day 0 of application with all insecticides. Control of A. argillacea by lambdacyhalothrin (20 g a.i./ha) and monocrotophos (240 and 320 g a.i./ha) was observed up to day 3 after application; while spinosad (30 and 60 g a.i./ha) prolonged control up to day 5. Monocrotophos and lambdacyhalothrin were significantly more toxic to P. nigrispinus compared to spinosad. Toxicity of monocrotophos and lambdacyhalothrin to P. nigrispinus was evident up to day 3 after application. Survival of P. nigrispinus was affected by methiocarb, thiamethoxam, diafenthiuron, abamectin and sulfur one day after application and only under thiamethoxam treatment after three days. Pymetrozine, dicofol and propargite did not affect P. nigrispinus survival compared to untreated plants. Podisus nigrispinus at the day of application did not prey on A. argillacea under methiocarb treatment, and the predation rate was affected under thiamethoxam, abamectin, diafenthiuron and sulfur treatments at the day of application and after three days. The insecticides pymetrozine and spinosad, and the acaricides dicofol and propargite were compatible to P. nigrispinus and should be considered within a cotton pest management program.

  14. Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae in residual toxicity persistence tests

    Directory of Open Access Journals (Sweden)

    Marcelo Gustavo Ruiz


    Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor, são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando exposto a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA, folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus.Phytoseiid mites, mainly Neoseiulus californicus (McGregor, are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the insecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA, leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p < 0.05. Progression of pesticide's effect decline was submitted to regression analysis. On 1 and 3 DAA mean mortality in all of the treatments was significantly different from that of the water-treated control. On the sixth DAA, propargite, cyhexatin and cyfluthrin treatments caused about 30% mortality, while mortality levels in treatments with azimphos-methyl and carbaryl were statistically similar to that of control treatment. On the tenth DAA, mortality in none of the pesticide treatments differed from that of control. All of the pesticide treatments presented progressive decline throughout the experimental period, being significant (p < 0.01 the negative linear regression obtained. Tested acaricides produced the greatest negative

  15. Mortalidade do ácaro predador Neoseiulus californicus (Acari: Phytoseiidae) em testes de toxicidade residual de inseticidas e acaricidas usuais em pomáceas / Mortality of predatory mite Neoseiulus californicus (Acari: Phytoseiidae) in residual toxicity persistence tests

    Scientific Electronic Library Online (English)

    Marcelo Gustavo, Ruiz; Gilberto José de, Moraes.


    Full Text Available Os ácaros fitoseídeos, especialmente Neoseiulus californicus (McGregor), são importantes agentes de controle biológico de ácaros tetraniquídeos-praga nas culturas de pomáceas no "Alto Valle del Río Negro y Neuquén", Argentina. Neste trabalho, avaliou-se a mortalidade de N. californicus quando expost [...] o a resíduos dos inseticidas azimphos-methyl, carbaryl e cyfluthrin, e dos acaricidas cyhexatin e propargite. Os produtos foram aplicados às concentrações recomendadas em plantas de pereira. Um, três, seis e dez dias após a aplicação (DAA), folhas tratadas foram retiradas das plantas para a preparação de unidades experimentais. Cinco adultos de N. californicus, provenientes de criação-estoque, foram transferidos para cada unidade, onde pólen de taboa foi fornecido como alimento. As unidades foram mantidas a 25 ± 2 ºC, 60 ± 10% de umidade relativa e fotoperíodo de 14 h. A mortalidade do ácaro foi avaliada 24 h após o confinamento. As médias de mortalidade foram comparadas pelo teste de Dunnett, a 5% de probabilidade. A progressão do declínio do efeito dos produtos testados foi submetida à análise de regressão. Nas duas primeiras datas de avaliação, todos os produtos apresentaram valores de mortalidade significativamente diferentes da testemunha tratada com água. Seis dias após a aplicação, propargite, cyhexatin e cyfluthrin apresentaram mortalidade de aproximadamente 30%, enquanto a mortalidade nos tratamentos azimphos-methyl e carbaryl apresentou níveis estatisticamente similares aos da testemunha. Dez dias após a aplicação, a mortalidade em todos os tratamentos não diferiu significativamente da testemunha. O efeito de todos os produtos apresentou declínio progressivo ao longo do período de observação, sendo significativa a 1% de probabilidade a regressão linear negativa para os valores obtidos. Os maiores efeitos negativos sobre a sobrevivência de N. californicus corresponderam aos acaricidas testados. Azimphos-methyl foi o produto que menos afetou a sobrevivência do ácaro predador. Os inseticidas testados, usados na região do "Alto Valle del Río Negro y Neuquén" para o controle de Cydia pomonella, praga-chave das culturas de pomáceas, apresentaram baixa toxicidade sobre N. californicus. Abstract in english Phytoseiid mites, mainly Neoseiulus californicus (McGregor), are important biological control agents of Tetranychidae pest mites in pip fruit crops in the region known as "Alto Valle del Río Negro y Neuquén", Argentina. We assessed the mortality of N. californicus when exposed to residues of the ins [...] ecticides azimphos-methyl, carbaryl and cyfluthrin, as well as the acaricides cyhexatin and propargite. Pear plants were sprayed up to dip-point with pesticides in their recommended label concentrations. One, 3, 6 and 10 days after application (DAA), leaves were collected from treated plants and used to establish experimental arenas. Five adult laboratory-reared N. californicus specimens were transferred into each arena which contained Southern cattail pollen as food source. Experimental arenas were kept at 25 ± 2 ºC, 60 ± 10% RH and a photoperiod of 14 hours. Mite mortality was assessed 24 hours after the confinement. The completely randomized design was adopted for data statistical analysis, mortality means were compared by Dunnett's test (p

  16. Localização e aceitação de dieta artificial contendo feromônio sexual pelo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Location and acceptance of artificial diet with sexual pheromone by the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Miryan D.A., Coracini; Evaldo F., Vilela; Paulo de, Marco Júnior; José C., Zanuncio; Mirian F., Furtado.


    Full Text Available Estudou-se o efeito da adição do feromônio sexual sintético de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) na localização e aceitação da dieta artificial utilizada para criação do inseto em laboratório. Avaliou-se o efeito do feromônio sexual completo, dos três componentes que ocorrem e [...] m maior proporção no feromônio [a-terpineol, fenilmetanol e (E)-2-hexenal] e de um dos componentes que ocorrem em menor proporção no feromônio (trans-piperitol) sobre a dieta, comparados à dieta pura e a larvas de Musca domestica L. (Diptera: Muscidae). A atração de ninfas de segundo ínstar de P. nigrispinus à dieta artificial foi facilitada pela presença do feromônio sexual adicionado à mesma, sendo que a dieta com feromônio completo mostrou maior atratividade que a dieta pura após cinco ou 120 min do oferecimento da dieta. Porém, larvas de M. domestica foram, na maioria das vezes, mais atrativas que os demais tratamentos. O ganho de peso foi significativamente maior para ninfas alimentadas com dieta com os três componentes majoritários, dieta com trans-piperitol e larvas de M. domestica, apresentando peso médio de 1,4 mg, 1,35 mg e 1,3 mg, respectivamente. P. nigrispinus apresentou menor ganho de peso com dieta pura e dieta com feromônio completo, com ninfas pesando 0,37 mg e 0,6 mg, respectivamente. Os resultados demonstraram que os componentes do feromônio utilizados causaram efeito fagoestimulante sobre o predador P. nigrispinus, e que podem atuar auxiliando estes insetos no processo de localização do alimento. Abstract in english A mass rearing program of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) is under development at the Federal University of Viçosa, MG, Brazil, aiming to release this predaceous insect for the control of caterpillars in Eucalyptus reforestation areas. As the location and acceptance of the a [...] rtificial diet by P. nigrispinus needs to be improved, we tested the effect of the addition of its synthetic sex pheromone to the diet. We impregnated diets, inside and/or outside, with the complete pheromone blend, with the three main components (a-terpineol, benzyl alcohol, and (E)-2-hexenal), as well as with trans-piperitol, and compared the development of insects fed on artificial and natural (Musca domestica L. alive larvae) diets. Attraction of second instar nymphs of P. nigrispinus to artificial diets was enhanced by the addition of the sex pheromone blend compared with the plain diet, both after five and 120 min on the diet. However, none of the pheromone added diets were as attractive to P. nigrispinus as the housefly larvae diet. Increase in weight was greater for nymphs fed on diet with the three major components of the pheromone, as well as with trans-piperitol or housefly larvae diet, and they averaged 1.40, 1.35 and 1.30 mg, respectively. On the other hand, plain diet and diet with the addition of the whole pheromone blend showed the smallest increase in nymph weight (0.37 and 0.6 mg, respectively). The results also demonstrated that sex pheromone of P. nigrispinus can improve feeding stimulation on nymphs, proven to be of some value in the location process of artificial food by the species.

  17. Dinâmica populacional de ácaros (Acari) em erva-mate (Ilex paraguariensis St. Hil.: Aquifoliaceae) / Populational dynamics of mites (Acari) in the mate-tea tree (Ilex paraguariensis St. Hil.: Aquifoliaceae)

    Scientific Electronic Library Online (English)

    Alfredo de, Gouvea; Luiz C., Boaretto; Carla F., Zanella; Luis F.A., Alves.


    Full Text Available Este trabalho foi realizado em Dois Vizinhos, PR, com o objetivo de estudar a dinâmica populacional de ácaros fitófagos e seus predadores em plantas de erva-mate (Ilex paraguariensis St. Hil. Aquifoliaceae). Folhas de diferentes partes da planta foram coletadas de agosto de 2001 a julho de 2002, e o [...] s ácaros presentes foram contados sob microscópio estereoscópico. Foram encontradas associadas às plantas de erva-mate duas espécies de ácaros fitófagos Dichopelmus notus Keifer, e Oligonychus yothersi (McGregor), e três espécies de predadores identificados como sendo Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma e Agistemus sp. O ácaro D. notus ocorreu em maior número na face inferior de folhas, em folhas maduras e em folhas dos estratos inferior e médio. O. yothersi predominou em folhas maduras. A concentração de E. concordis e I. zuluagai sempre foi maior na face inferior de folhas, em folhas maduras, em folhas dos estratos inferior e médio e na região interna da copa. Os ácaros D. notus, O. yothersi, E. concordis e I. zuluagai tiveram picos populacionais em período de temperatura amena e baixa precipitação pluviométrica. A maior densidade populacional de Agistemus sp. ocorreu na face inferior das folhas e seu pico populacional ocorreu em período de alta temperatura e precipitação pluviométrica elevada. Abstract in english The objective of this research was to analyze the populational dynamic of the phytophagous mites, as well as that of their natural predators in the plants Ilex paraguariensis St. Hil. (Aquifoliaceae). This study was conduced in Dois Vizinhos, State of Paraná, from August 2001 to July 2002. Leaf samp [...] les from different parts of the plant were taken and the number of mites was registered. During this period, two species of phytophagous mites, Dichopelmus notus Keifer, and Oligonychus yothersi (McGregor), and three species of predator mites identified as Euseius concordis (Chant), Iphiseiodes zuluagai Denmark & Muma, and Agistemus sp. were related to the mate-tea plant. Large numbers of D. notus appeared on mature leaves and on the inferior face of leaves. The mite was more frequent in the inferior and medium strata. O. yothersi occurred mainly on mature leaves. The concentration of E. concordis e I. zuluagai was higher on the inferior face of the leaves, and on the leaves of inferior and medium strata, as well as in the internal canopy region, and on mature leaves. The highest numbers of D. notus, O. yothersi, E. concordis and I. zuluagai occurred in periods with mild temperatures and little rain precipitation. The largest population density of Agistemus sp. occurred on the inferior face of the leaves, more often in periods of high temperature and heavy rain.

  18. Toxicidade de agroquímicos ao ácaro-da-leprose dos citros Brevipalpus phoenicis (Geijskes) e ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae) / Toxicity of agrochemicals to the citrus leprosis mite Brevipalpus phoenicis (Geijskes) and predator mite Neoseiulus Californicus (McGregor) (Acari: Tenuipalpidae, Phytoseiidae)

    Scientific Electronic Library Online (English)

    M.Z. da, Silva; M.E, Sato; C.A.L. de, Oliveira; B, Veronez.


    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade dos principais agroquímicos utilizados em citros em Brevipalpus phoenicis e Neoseiulus californicus, potencial predador de ácaros fitófagos na cultura. Os bioensaios foram realizados utilizando discos de folhas de laranjeira para N. californicus e f [...] rutos para B. phoenicis. Foram utilizadas 35 fêmeas adultas do ácaro predador e 50 fêmeas adultas do ácaro fitófago. Utilizaram-se 13 agroquímicos nas concentrações recomendadas para o controle do ácaro da leprose. As aplicações foram feitas por meio de torre de Potter, sendo realizadas quatro repetições para cada tratamento. As avaliações do número de ácaros vivos e mortos foram observadas 72 horas após a aplicação. Os bioensaios com espirodiclofeno e etoxazol foram realizados em ovos dos acarinos. Clorfenapir, e piridabem mostraram-se nocivos a N. californicus, causando mortalidades de 88,6 e 99%, respectivamente. Abamectina causou mortalidade de 62,1%, considerada elevada ao se comparar ao dinocape (2%), propargito (4,2%), enxofre (5%), fempropatrina (12,4%) e acrinatrina (22%). Cyflumetofen, óxido de fembutatina e deltametrina foram inócuos ao N. californicus. Espirodiclofeno não provocou inviabilidade de ovos e mortalidade nas larvas de N. californicus, contudo, etoxazole provocou 100% de mortalidade nas larvas do predador ao entrarem em contato como o resíduo do produto. Para B. phoenicis, abamectina, clorfenapir, dinocape, cyflumetofen, óxido de fembutatina, piridabem e propargito provocaram 100% de mortalidade. Fempropatrina (95%), acrinatrina (87%) e enxofre (76%) mostraram-se menos efetivos. O deltametrina não foi eficiente no controle do ácaro da leprose. Etoxazol e espirodiclofeno causaram inviabilidade em 100% dos ovos de B. phoenicis. Abstract in english The objective of this study was to evaluate various pesticides used in citrus crops in regard to their toxicity to Brevipalpus phoenicis and Neoseiulus californicus, a potential predator of phytophagous mites in the crop. Bioassays were conducted using orange-tree leaf discs for N. californicus and [...] fruits for B. phoenicis. A total of 35 adult females of the predator mite were used, along with 50 adult females of the phytophagous mites. Tests were carried out with 13 chemicals at concentrations recommended for the control of leprosis mites. The applications were made using a Potter tower, with 4 replications for each treatment. Assessments of the number of live and dead mites were observed 72 hours after application. Bioassays with spirodiclofen and etoxazole were performed on eggs of mites. Chlorfenapyr and pyridaben proved harmful to N. californicus, causing mortalities of 88 and 99% respectively. Abamectin caused mortality of 62%, considered high when compared to dinocap (2%), propargite (4.2%), sulfur (5%), fenpropathrin (12.4%) and acrinathrin (22%). Cyflumetofen oxide, fenbutatin and deltamethrin were harmless to N. californicus. Spirodiclofen did not cause egg mortality or larvae mortality in N. californicus, however etoxazole caused 100% mortality in larvae of the predator on contact with the residue of the product. For B. phoenicis, abamectin, chlorfenapyr, dinocap, cyflumetofen, fenbutatin oxide, pyridaben and propargite caused 100% mortality. Fenpropathrin (95%), acrinathrin (87%) and sulfur (76%) were less effective. Deltamethrin was not effective in controlling leprosis mites. Etoxazole and spirodiclofen caused 100% egg mortality for B. phoenicis.

  19. Primeiro registro de Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) e sua associação com insetos predadores, parasitóides e formigas em couve (Cruciferae) no Brasil / First record of Lipaphis pseudobrassicae Davis (Hemiptera: Aphididae) and its association with predator insects, parasitoids and ants in kale (Cruciferae) in Brazil

    Scientific Electronic Library Online (English)

    André L.S., Resende; Edmilson E., Silva; Venicio B., Silva; Raul L.D., Ribeiro; José G.M., Guerra; Elen L., Aguiar-Menezes.


    Full Text Available Este estudo descreve a fauna de insetos predadores, parasitóides e formigas associada a pulgões em couve (Brassica oleracea L. var. acephala D.C.), cultivada em sistema orgânico. O pulgão foi identificado como Lipaphis pseudobrassicae Davis, sendo este o primeiro registro da espécie atacando couve n [...] o Brasil. Parasitismo primário por Diaeretiella sp. e Aphidius sp. e hiperparasitismo por Aphydencyrtus sp., Alloxysta sp., Pachyneuron sp. e Syrphophagus sp. foram observados. Vinte espécies de Coccinellidae foram coletadas, sendo que oito delas foram observadas, tanto na fase adulta como larval, atacando o pulgão: Hyperaspis (Hyperaspis) festiva Mulsant, que foi a mais abundante (72,5% do total de insetos predadores obtidos), Cycloneda sanguinea (L.), Eriopis connexa Germar, Coleomegilla maculata DeGeer, Hippodamia convergens Guérin, Heterodiomus sp., Scymnus (Pullus) sp.1 e Scymnus (Pullus) sp.2. Larvas de Syrphidae afidófagas coletadas nas folhas de couve infestadas por L. pseudobrassicae pertencem às espécies Allograpta exotica (Wiedemann) e Ocyptamus gastrostactus (Wiedemann). Larvas e pupas de Syrphidae foram parasitadas por Pachyneuron sp., Syrphophagus sp. e Diplazon laetatorius Fabricius. Larvas de Chrysopodes sp. foram observadas alimentando-se de L. pseudobrassicae. Espécies de formigas associadas às colônias desse pulgão foram Ectatomma quadridens Fabricius e Pheidole sp. Abstract in english This study describes the fauna of predator insects, parasitoids and ants associated with aphids on kale (Brassica oleracea L. var. acephala D.C.) in organic system. The aphid was identified as Lipaphis pseudobrassicae Davis, and this is the first record of the species attacking kale in Brazil. Prima [...] ry parasitism by Diaeretiella sp. and Aphidius sp. and hyperparasitism by Aphydencyrtus sp., Alloxysta sp., Pachyneuron sp. and Syrphophagus sp. were observed. Twenty species of Coccinellidae were collected, and eight of them were observed in adult and larval stages attacking the aphid: Hyperaspis (Hyperaspis) festiva Mulsant, which was the most abundant (72.5% of all predator insects obtained), Cycloneda sanguinea (L.), Eriopis connexa Germar, Coleomegilla maculata DeGeer, Hippodamia convergens Guérin, Heterodiomus sp., Scymnus (Pullus) sp.1 and Scymnus (Pullus) sp.2. Aphidophagous Syrphidae larvae collected on leaves of kale infested by L. pseudobrassicae belong to the species Allograpta exotica (Wiedemann) and Ocyptamus gastrostactus (Wiedemann). Larvae and pupae of Syrphidae were parasitized by Pachyneuron sp., Syrphophagus sp. and Diplazon laetatorius Fabricius. Larvae of Chrysopodes sp. were observed feeding on L. pseudobrassicae. Species of ants associated with the colony of this aphid were Ectatomma quadridens Fabricius and Pheidole sp.

  20. Effect of neem seed oil aqueous solutions on survival and development of the predator Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) / Efeito de soluções aquosas de óleo de sementes de nim, Azadirachta indica, na sobrevivência e desenvolvimento do predador Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae)

    Scientific Electronic Library Online (English)

    Flávia A.C. da, Silva; Sueli S., Martinez.


    Full Text Available Os efeitos de soluções aquosas do óleo de sementes de nim sobre o predador Cycloneda sanguinea (L.), nos estágios de ovo, larva e adulto, foram avaliados em laboratório. Em um primeiro experimento, ovos e larvas de 2º ínstar foram pulverizados com as soluções de nim nas concentrações de 0; 0, 5 e 2, [...] 25 ml/l de água apresentaram mortalidade significativa (P Abstract in english The effects of the neem seed oil aqueous solutions on survival and performance of egg, larva and adult stage of the Coccinelid predator Cycloneda sanguinea (L.) were evaluated under laboratory conditions. In a first trial, eggs and 2nd-instar larvae were sprayed with the neem solutions at 0; 0.5 and [...] 2.25 ml/l and kept at 25 ± 1ºC, 70% RH and 14h photoperiod. Egg viability and duration and larvae and pupae survival were evaluated as well as the predatory capacity of the larvae, adult longevity and reproduction. Egg spraying did not affect egg hatch or larvae survival and development. When the larvae were sprayed, significant mortality was observed only at the higher concentration (P

  1. Diversidade e flutuação populacional de ácaros (Acari) em amora-preta (Rubus fruticosus, Rosaceae) no estado do Rio Grande do Sul, Brasil / Diversity and population fluctuation of mites (Acari) in blackberry (Rubus fruticosus, Rosaceae) in the state of Rio Grande do Sul, Brazil

    Scientific Electronic Library Online (English)

    Márla Maria, Marchetti; Noeli Juarez, Ferla.


    Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae), framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy [...] no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9%) e Tetranychidae (13,9%), compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae), foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2,1%) e Phytoseiidae (0,4%) foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae), as espécies de predadores mais abundantes. Abstract in english Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae), raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in [...] Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9%) and Tetranychidae (13.9%), composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae) was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae). Stigmaeidae (2.1%) and Phytoseiidae (0.4%) were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae) and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae) the most common predaceous species.

  2. Diversidade e flutuação populacional de ácaros (Acari em amora-preta (Rubus fruticosus, Rosaceae no estado do Rio Grande do Sul, Brasil Diversity and population fluctuation of mites (Acari in blackberry (Rubus fruticosus, Rosaceae in the state of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Márla Maria Marchetti


    Full Text Available Ácaros das famílias Eriophyidae, Tarsonemidae e Tetranychidae são citados como de importância econômica na cultura de amora-preta (Rubus fruticosus, Rosaceae, framboesa e outras frutas pequenas. Este estudo foi conduzido de novembro de 2001 a outubro de 2003 nas cultivares Brazos, Caigangue e Tupy no município de Ilópolis, Rio Grande do Sul, com o objetivo de conhecer a acarofauna e sua dinâmica populacional em amora-preta. Foram coletados 36.094 ácaros pertencentes a 11 famílias. A maioria dos ácaros coletados pertence às famílias Diptilomiopidae (80,9% e Tetranychidae (13,9%, compostas por espécies fitófagas. Chakrabartiella sp. (Diptilomiopidae, foi a espécie mais abundante, seguida por Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2,1% e Phytoseiidae (0,4% foram os ácaros predadores mais comuns, sendo Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae e Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae, as espécies de predadores mais abundantes.Mites of the families Eriophyidae, Tarsonemidae and Tetranychidae are considered of economic importance in the blackberry (Rubus fruticosus, Rosaceae, raspberry and other small fruit crops. This study was conducted from November of 2001 to October of 2003 on Brazos, Caigangue and Tupy cultivars in Ilópolis municipality, state of Rio Grande do Sul, to describe the mitefauna and its population fluctuation in blackberry crops. A total of 36,094 mites belonging to 12 families was collected. Most of the mites belong to Diptilomiopidae (80.9% and Tetranychidae (13.9%, composed predominantly of phytophagous species. Chakrabartiella sp. (Diptilomiopidae was the most abundant species, followed by Neotetranychus asper Feres & Flechtmann, 2000 (Tetranychidae. Stigmaeidae (2.1% and Phytoseiidae (0.4% were the most common families of predaceous mites, and Agistemus brasiliensis Matioli, Ueckermann & Oliveira, 2002 (Stigmaeidae and Typhlodromalus aripo DeLeon, 1967 (Phytoseiidae the most common predaceous species.

  3. Efeito das plantas do algodoeiro e do tomateiro, como complemento alimentar, no desenvolvimento e na reprodução do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of cotton and tomato plants as complementary food on development and reproduction of the predator Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)



    Full Text Available A alimentação em plantas pelo percevejo predador Podisus nigrispinus (Dallas) tem produzido efeitos na sua biologia que variam com a espécie de planta utilizada. Este estudo foi conduzido com o objetivo de avaliar o desenvolvimento e a reprodução de P. nigrispinus confinado sobre as folhas de algodo [...] eiro Gossypium hirsutum cv. Precoce CNPA1 e tomateiro industrial Lycopersicum esculentum cv. IPA5, e alimentados com pupas de Tenebrio molitor (L.). Ninfas e adultos de P. nigrispinus foram confinados com presa sobre algodoeiro, presa sobre tomateiro, com presa e água, e somente presa. O acesso às plantas foi obtido confinando os predadores nas folhas das plantas cultivadas em vasos. Ninfas confinadas em algodoeiro e tomateiro mais presa apresentaram menor duração no segundo e quinto ínstares. No entanto, o menor período ninfal foi observado para ninfas confinadas em algodoeiro mais presa. A sobrevivência de ninfas em cada ínstar e em todo o estágio ninfal foi menor para ninfas mantidas somente com presa comparado com aquelas com presa mais água e com presa sobre a planta. A disponibilidade do algodoeiro juntamente com a presa produziu ninfas de quinto ínstar mais pesadas, quando comparado com o tomateiro mais presa, água mais presa, e somente presa. O peso de adultos na emergência foi menor apenas quando os insetos tiveram acesso somente à presa. No entanto, fêmeas de P. nigrispinus confinadas sobre folhas de algodoeiro com presa ou mantidas com presa e água apresentaram significativo aumento de peso ao iniciar a reprodução, enquanto fêmeas confinadas sobre folhas de tomateiro ou somente com presa não variaram seu peso. A disponibilidade do algodoeiro e do tomateiro proporcionou aumento na produção de ovos e longevidade de P. nigrispinus. Além disso, as fêmeas mantidas com presa sobre as folhas de algodoeiro apresentaram maior taxa de oviposição. Baseado nos parâmetros populacionais taxa reprodutiva, taxa intrínseca de crescimento populacional e tempo médio de geração, conclui-se que o crescimento populacional de P. nigrispinus pode ser melhorado de acordo com o tipo de planta disponível, apresentando melhores resultados quando os insetos foram confinados sobre folhas de algodoeiro, seguido pelo confinamento dos adultos sobre o tomateiro. Além disso, a disponibilidade de água juntamente com a presa também propiciou melhor desenvolvimento da espécie. Abstract in english The occasional feeding on plants by Podisus nigrispinus (Dallas) has produced different responses on its biology according to the plant species available. This study was undertaken to determine the development and reproduction of P. nigrispinus when confined on Gossypium hirsutum cv. Precocious CNPA [...] 1 and processing tomato Lycopersicum esculentum cv. IPA5 plants, using Tenebrio molitor (L.) pupa as prey. Nymphs and adults of P. nigrispinus were provided with prey and plants of cotton, prey and plant of tomato, prey and water, and only the prey. The predator could access the plants by caging nymphs and prey on plant leaves cultivated in pots. Nymphs caged on cotton or tomato plants with prey showed shorter duration of second and fifth ínstars. However, the shortest development period was observed for nymphs caged on cotton plants with prey. Nymphs fed on prey alone had lower survival within each ínstar and for the whole stage when compared to nymphs accessing plant, prey and water. The availability of cotton plants to nymphs produced heavier individuals compared to tomato plants, prey and water, and only prey. The adult weight at emergence was similar between plants and prey plus water, and superior to the treatment with prey alone. However, females of P. nigrispinus with access to the prey and cotton plant and prey and water showed significant body weight increase at the beginning of the reproductive activity, while females confined on tomato plants and only on prey did not range their weight during their lives. The availability of cotton and tomato plants to P. nigrispinus increased th

  4. Efeito da suplementação de folhas de Eucalyptus urophylla no desenvolvimento e reprodução do predador Supputius cincticeps (Stal) (Heteroptera: Pentatomidae) / Effect of supplementary feeding on Eucalyptus urophylla leaves in the development and reproduction of the predatory bug Supputius cincticeps (Stal) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Sebastião L., Assis Jr.; Teresinha V., Zanuncio; Germi P., Santos; José C., Zanuncio.


    Full Text Available Avaliou-se o efeito da alimentação suplementar de folhas de Eucalyptus urophylla, no desenvolvimento e reprodução de Supputius cincticeps (Stal) em laboratório. S. cincticeps foi alimentado com Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) ou T. molitor mais mudas de E. urophylla. A inclusão da [...] planta na alimentação de S. cincticeps, aumentou sua taxa líquida de reprodução Ro (de 7,15 para 24,05), a razão infinitesimal rm (de 0,034 para 0,052), e a razão finita de aumento populacional 1 (de 1,035 para 1,053), em relação ao uso isolado da presa. Conseguiu-se, ainda, aumentar os índices de sobrevivência, a longevidade e a expectativa de vida média para metade da população (ex50), sendo 50,8 e 64,9 dias para os percevejos alimentados com presa e com presa e planta, respectivamente. O predador S. cincticeps apresentou hábitos alimentares que incluem fitofagia e a inclusão da planta na sua dieta, foi vantajosa para a sua criação massal. Abstract in english The effect of supplementary feeding of Supputius cincticeps (Stal) on Eucalyptus urophylla leaves was evaluated in the laboratory. S. cincticeps was fed with Tenebrio molitor (L.) (Coleoptera: Tenebrionidae) larvae or T. molitor larvae plus E. urophylla. The inclusion of this plant for S. cincticeps [...] feeding increased its net reproductive rate (Ro) from 7.15 to 24.05, its infinitesimal ratio (rm) from 0.034 to 0.052, and the finite population increase (1) from 1.035 to 1.053, compared to feeding only with the prey. S. cincticeps fed both plant and prey showed higher survival rate, longevity, and life span for half of the population (ex50), which was 50.8 and 64.9 for bugs fed the prey, and prey and plant, respectively. The inclusion of the plant also increased the reproduction rate of S. cincticeps, thus being recommended for mass rearing of this predator.

  5. Ocorrência de Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae e do predador Pentilia egena (Mulsant (Coleoptera, Coccinelidae em Myrtus communis L. (Myrtaceae, em Pinheiral, RJ Occurrence of Selenaspidus articulatus (Morgan (Hemiptera, Diaspididae and of the predator Pentilia egena (Mulsant (Coleoptera, Coccinelidae on Myrtus communis L. (Myrtaceae, in Pinheiral County, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Edson Henrique de Azeredo


    Full Text Available As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1 M. communis pode ser indicada como planta isca; (2 esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3 a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4 a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação, com diferenças significativas em PThe evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 965 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1 M. communis may be indicated as plant bait; (2 this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3 the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4 the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases and 1.03.76 and 1.0-3.98 (in blooming/fructification, with significant differences at P< 0.01.

  6. Ocorrência de Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) e do predador Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) em Myrtus communis L. (Myrtaceae), em Pinheiral, RJ / Occurrence of Selenaspidus articulatus (Morgan) (Hemiptera, Diaspididae) and of the predator Pentilia egena (Mulsant) (Coleoptera, Coccinelidae) on Myrtus communis L. (Myrtaceae), in Pinheiral County, Rio de Janeiro, Brazil

    Scientific Electronic Library Online (English)

    Edson Henrique de, Azeredo; William Costa, Rodrigues; Paulo Cesar Rodrigues, Cassino.


    Full Text Available As avaliações foram realizadas, semanalmente, durante os estádios vegetativo e de floração/frutificação em quatro quadrantes (N, S, L, O) da planta. Foram coletadas 2.230 espécimes de S. articulatus, sendo 1.224 no estágio vegetativo e 1.006 no florescimento/frutificação, sendo 59,8% adultos. De um [...] total de 965 P. egena, 416 foram imaturos e 549 adultos. As principais conclusões deste trabalho são: (1) M. communis pode ser indicada como planta isca; (2) esta planta pode ser cultivada ou não próxima às culturas de importância econômica, pois funciona como um repositório da praga ou de seu inimigo natural; (3) a relação predador/presa/quadrante da planta/estágio fenológico foi, respectivamente, 1,14:1,0 e 1,0:1,08 nos quadrantes norte e leste; enquanto, à sul e oeste da planta M. communis foi de 1,0:2,26 e 1,0:2,80; (4) a predação de S. articulatus por P. egena ocorreu, em média, de 1,0 a 2,8 ninfas e 1,66 a 4,44 adultos (no estágio vegetativo) e de 1,0-3,76 a 1,0-3,98 (no estágio de florescimento/frutificação), com diferenças significativas em P Abstract in english The evaluations were conducted weekly in the vegetative and blooming/fructification phases in four quadrants (N, S, E, W) of the plant. It was collected 2,230 specimens of S. articulatus, 1,224 in the vegetative phase and 1,006 in the blooming/fructification, being 59,8% adults. From the total of 96 [...] 5 of P. egena, 416 were immatures and 549 adults. The main conclusions are: (1) M. communis may be indicated as plant bait; (2) this plant, may be cultivated or not around the crops of economic importance, because it may function as a reservoir of the pest or of its natural enemies; (3) the relation predator/prey/plant quadrant/phenology phases was, respectivelly, 1.14:1.0 and 1.0:1,08 in north and east quadrant; while in south and west quadrant was 1.0:2.26 and 1.0:2.80; and, (4) the predaction of S. articulatus by P. egena was, in average, 1.02.8 nymphs and 1.664.44 adults (in vegetative phases) and 1.03.76 and 1.0-3.98 (in blooming/fructification), with significant differences at P

  7. Dieta artificial para criação de Doru luteipes (Scudder) (Dermaptera: Forficulidae), predador da lagarta-do-cartucho do milho, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) / Artificial diet for rearing Doru luteipes (Scudder) (Dermaptera: Forficulidae), a predator of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)

    Scientific Electronic Library Online (English)

    Amarildo, Pasini; José R.P., Parra; Janaína M., Lopes.


    Full Text Available Uma nova técnica de criação para o predador Doru luteipes (Scudder), envolvendo dietas artificiais e substrato artificial de oviposição é sugerida. Tanto adultos, quanto ninfas foram mantidos em placas contendo um canudinho transparente de refrigerante com algodão umedecido e o respectivo alimento. [...] Foram testados os seguintes tratamentos: ovos de Spodoptera frugiperda (J.E. Smith); ovos de Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae); ovos de Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); farinha de pupa de insetos (FPI); pólen comercial de abelhas Apis mellifera L. (Hymenoptera: Apidae) (PC); FPI + PC, FPI + pólen de taboa [Typha angustifolia L. (Thyphaceae)]. Para as dietas artificiais, observou-se que os tratamentos com farinha de pupas de insetos (FPI), FPI + pólen comercial (PC) e FPI + pólen de taboa resultaram em 32; 29 e 29 dias de período ninfal, com 83; 90 e 100% de sobrevivência, respectivamente, sendo superiores ao tratamento com PC , com 37 dias e 67% de sobrevivência. Os tratamentos com farinha de pupas de insetos, isolada ou em mistura com pólens, foram semelhantes ao padrão com ovos de S. frugiperda. Conclui-se que a criação de D. luteipes com as dietas artificiais testadas, bem como o método de criação, são adequados para sua produção em laboratório. Abstract in english A new technique involving an artificial diet and an artificial substrate for oviposition for the rearing of the predator Doru luteipes (Scudder) is suggested. Both adults and nymphs were maintained in petri dishes containing a transparent piece of soda straw filled with moistened cotton and the corr [...] esponding food for the biossays. The following treatments were tested: eggs of Spodoptera frugiperda (J.E. Smith), Diatraea saccharalis Fabricius (Lepidoptera: Pyralidae) and Anagasta kuehniella Zeller (Lepidoptera: Pyralidae); insect pupae meal (FPI); Apis mellifera L. (Hymenoptera: Apidae) commercial pollen (PC); FPI + PC, and FPI + cattail pollen [Typha angustifolia L. (Thyphaceae)]. Each treatment had 50 replicates, and food was offered in excess. Treatments consisting of insect pupae meal (FPI), FPI + commercial pollen (PC), and FPI + cattail pollen resulted in nymphal development of 32, 29, and 29 days, with 83, 90 and 100% survival, respectively, and were superior to the PC treatment, with values of 37 days and 67% survival observed for insects reared on commercial pollen. Treatments that included insect pupae flour, either alone or mixed with pollens, were similar to control (S. frugiperda eggs). We conclude that the artificial diets tested and rearing technique are suitable for the artificial rearing of D. luteipes in laboratory conditions.

  8. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae) e os predadores Phytoseiulus macropilis (Banks) e Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae) / Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae) and the predators Phytoseiulus macropilis (Banks) and Neoseiulus Californicus (Mcgregor) (Acari: phytoseiidae)

    Scientific Electronic Library Online (English)

    Daniele Cristine Hoffmann, Schlesener; Adriane Fonseca, Duarte; Milton Fernando Cabezas, Guerrero; Uemerson Silva da, Cunha; Dori Edson, Nava.


    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L) e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L) sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiu [...] lus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.). A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos. Abstract in english The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L) and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L) over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus m [...] acropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.). The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

  9. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae

    Directory of Open Access Journals (Sweden)

    Daniele Cristine Hoffmann Schlesener


    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

  10. Exigências térmicas e potencial de desenvolvimento dos parasitóides Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) em ovos do percevejo predador Podisus nigrispinus (Dallas) / Thermal requirements and development of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) on the predator stinkbug Podisus nigrispinus (Dallas)

    Scientific Electronic Library Online (English)

    Jorge B., Torres; Dirceu, Pratissoli; José C., Zanuncio.


    Full Text Available O desenvolvimento e a viabilidade dos parasitóides de ovos Telenomus podisi Ashmead e Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) foram estudados em cinco temperaturas constantes de 17 a 32°C, em seu hospedeiro, o percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatom [...] idae). A duração do período ovo-adulto das fêmeas foi de 10,8 dias (32°C) a 48,6 dias (17°C) para T. podisi e de 10,2 dias (32°C) a 35,4 dias (17°C) para T. brochymenae. A viabilidade, em todas as temperaturas, manteve-se entre 89,0 e 92,7% para T. brochymenae, com redução significativa da viabilidade de T. podisi nas temperaturas extremas de 17 e 32°C. A temperatura base e a constante térmica, para o desenvolvimento das fêmeas foram de 11,1°C e 9,5°C e de 205,3 e 214,7 graus dias, para T. podisi e T. brochymenae, respectivamente. O número de gerações por ano, para os parasitóides e o hospedeiro, estimado com base nas temperaturas de áreas de cultivo de eucalipto, foram de 22,6; 23,9 e 10,2, para T. podisi, T. brochymenae e P. nigrispinus, respectivamente. Essas observações indicam que T. brochymenae é melhor adaptado a variações de temperaturas que T. podisi, no entanto, as duas espécies parasitam com sucesso P. nigrispinus. Abstract in english Development and viability of the egg parasitoids Telenomus podisi Ashmead and Trissolcus brochymenae (Ashmead) (Hymenoptera: Scelionidae) were studied at five constant temperatures ranging from 17°C to 32°C on its host, the predatory bug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae). Fema [...] le development from egg to adult ranged from 10.8 days (32°C) to 48.6 days (17°C) for T. podisi, and from 10.2 days (32°C) to 35.4 days (17°C) for T. brochymenae. Parasitism viability ranged from 89.0 to 92.7% for T. brochymenae. However, T. podisi viability decreased in lower and higher temperatures. Lower threshold temperatures for egg to adult female development was estimated at 11.1°C for T. podisi and 9.5°C for T. brochymenae. Thermal requirements for this period was 205.3 and 214.7 degree-days for T. podisi and T. brochymenae, respectively. Number of generations per year of these parasitoids and its host, considering the temperature conditions of eucalyptus areas, were estimated to be 22.6, 23.9 and 10.2 for T. podisi, T. brochymenae and P. nigrispinus, respectively. These results indicate that T. brochymenae is better adapted to temperature variations than T. podisi, however, both species can successfully parasitize P. nigrispinus.

  11. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae encontrados em seringueira no centro-oeste do Brasil Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae found in rubber-trees in mid-west Brazil

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla


    Full Text Available Euseius concordis (Chant e Neoseiulus anonymus (Chant & Baker são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg. em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inseticidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies.Euseius concordis (Chant and Neoseiulus anonymus (Chant & Baker are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg. in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecticides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS. Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

  12. Seletividade de acaricidas e inseticidas a ácaros predadores (Acari: Phytoseiidae) encontrados em seringueira no centro-oeste do Brasil / Side-effect of acaricides and insecticides to predatory mites (Acari: Phytoseiidae) found in rubber-trees in mid-west Brazil

    Scientific Electronic Library Online (English)

    Noeli Juarez, Ferla; Gilberto José de, Moraes.


    Full Text Available Euseius concordis (Chant) e Neoseiulus anonymus (Chant & Baker) são ácaros predadores da família Phytoseiidae comumente encontrados em seringueira (Hevea brasiliensis Muell. Arg.) em Mato Grosso, região centro-oeste do Brasil. Este trabalho foi realizado para verificar o efeito de acaricidas e inset [...] icidas-acaricidas empregados em plantações de seringueira, e outros que teriam potencial para serem empregados contra insetos e ácaros considerados pragas dessa cultura, sobre E. concordis e N. anonymus. Utilizou-se o método residual de pulverização em superfície, recomendado como padrão pelo Grupo de Trabalho "Pesticidas e Artrópodes Benéficos", da Organização Internacional de Controle Biológico e Integrado de Plantas e Animais Nocivos/Seção Regional do Paleártico Oeste. Duas concentrações de cada um dos seguintes ingredientes ativos foram utilizadas: acefato, dicofol, endosulfan, formetanate, metomil, monocrotofós, óxido de fenbutatin e propargite. Uma das concentrações utilizadas foi uma média daquelas sugeridas pelos fabricantes para o controle de ácaros e insetos fitófagos presentes em outras culturas, uma vez que nenhum dos produtos testados tem registro para o uso em seringueira e a outra correspondeu à cerca de um terço da primeira. Endosulfan a 320ppm, dicofol a 100ppm e óxido de fenbutatin a 100 e 320ppm foram inócuos a E. concordis, enquanto que endosulfan a 320ppm e dicofol a 100ppm foram inócuos a N. anonymus. Acefato, formetanate e monocrotofós, nas concentrações testadas, foram nocivos às duas espécies. Abstract in english Euseius concordis (Chant) and Neoseiulus anonymus (Chant & Baker) are predatory mites of the family Phytoseiidae commonly found on rubber trees (Hevea brasiliensis Muell. Arg.) in the State of Mato Grosso, in the mid-west Brazil. This work was conducted to verify the effect of acaricides and insecti [...] cides-acaricides occasionally used in rubber tree plantations, and other products that could be used against different pests (insects and mites) in this crop, on E. concordis and N. anonymus. The residual contact spray method in glass surface was used, which is recommended by the Working Group on "Pesticides and Benefic Arthropods" of the International Organization of Biologic and Integrated Control of Noxious Plants and Animals/Regional Section of the West Paleartic (IOBC/WPRS). Two concentrations of the following active ingredients were used: acephato, dicofofol, endosulfan, formetanate, metomil, monocrotophos, oxid of fenbutanin and propargit. For each product, one of the concentrations used was an average of the concentrations recommended by the manufacturers for the control of mites and phytophagous insects in other crops, since none of the tested products are registered for use on rubber tree. The other concentration corresponded to ca. a third of the former concentration. Endosulfan at 320ppm, dicofol at 100ppm and fenbutanin oxid at 100 and 320ppm were harmless to E. concordis, while endosulfan at 320ppm and dicofol at 100ppm were harmless to N. anonymus. Acephate, formetanate and monocrotofós, in concentrations, were harmful to both species.

  13. Composição faunística de insetos predadores em fragmento florestal e em área de hortaliças na região de Jaboticabal, Estado de São Paulo - DOI: 10.4025/actascibiolsci.v25i2.2015 Faunal composition of predator insects in forest fragment and area of vegetables in Jaboticabal region, state of São Paulo, Brazil - DOI: 10.4025/actascibiolsci.v25i2.2015

    Directory of Open Access Journals (Sweden)

    Luciano Kenji Sakemi


    Full Text Available Efetuou-se um levantamento populacional em área de fragmento florestal e em área de hortaliças, entre novembro de 1996 a fevereiro/1998, visando determinar as espécies de insetos predadores e a influência de fatores abióticos. A amostragem foi efetuada semanalmente por meio de armadilha luminosa, aplicando-se aos resultados análise faunística e correlação simples com temperatura, umidade relativa e precipitação. No fragmento florestal foi observado maior semelhança na abundância de espécies do que na área de hortaliças, mas neste hábitat capturou-se maior número de indivíduos (95%. As espécies Metius sp., Polpochila impressifrons (Dej., Eulissus sp. e Doru sp. foram predominantes nas duas áreas, evidenciando a importância dessas espécies como predadoras de pragas de hortaliças. Arthrostictus speciosus (Dej. e Leptotrachelus sp. predominaram no fragmento florestal, o mesmo ocorrendo com Paederus sp. na área de hortaliças. Esta espécie deve preferir locais abertos e quentes, enquanto A. speciosus e Leptotrachelus sp. podem estar melhor adaptadas para locais escuros e úmidos de florestasA population survey was carried out in a forest fragment and in an area of vegetables, from November/1996 to February/1998, aiming to determine the predator insect species and the influence of abiotic factors. The samples were taken weekly by light traps. The results were evaluated using faunistic analysis and simple correlation with temperature, relative humidity and rainfall. In the forest fragment higher similarity in the abundance of species was observed comparing to the area of vegetables, but the largest number of captured individuals (95% occurred in this last habitat. Metius sp., Polpochila impressifrons (Dej., Eulissus sp. and Doru sp. were predominant species in both areas, evidencing they may play an important role as pest predators in areas of vegetables. Arthrostictus speciosus (Dej. and Leptotrachelus sp. predominated in the forest fragment, and the same was observed with Paederus sp. in the vegetable area. This species is probably adapted for open and hot places, while A. speciosus and Leptotrachelus sp. can be adapted for dark and humid places of forests

  14. Observações sobre a ocorrência de Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae na costa do Rio de Janeiro, Brasil Remarks about the Pilumnus floridanus Stimpson (Decapoda, Brachyura, Pilumnidae occurrence in Rio de Janeiro coast, Brazil

    Directory of Open Access Journals (Sweden)

    Lydia M. S. Oliveira


    Full Text Available Os espécimes foram coletados na Baía de Sepetiba, Rio de Janeiro no inverno. Sua distribuição era conhecida para Off Cape Lookout, Carolina do Norte até a Flórida, Golfo do México, Canal de Yucatan, Honduras, Antilhas, Venezuela e Brasil (Alagoas, Sergipe e Bahia.The specimens were collected in Sepetiba Bay during the winter. Their distribution was formerly known from Off Cape Lookout, North Carolina until Florida, Gulf of Mexico, Yucatan Channel, Honduras, Antilles, Venezuela and Brazil (Alagoas, Sergipe and Bahia.

  15. Richness, origin and structure of an Eimeria community in a population of Eastern cottontail (Sylvilagus floridanus) introduced into Italy.

    Czech Academy of Sciences Publication Activity Database

    Bertolino, S.; Hofmannová, L.; Girardello, M.; Modrý, David


    Ro?. 137, ?. 8 (2010), s. 1179-1186. ISSN 0031- 1820 Institutional research plan: CEZ:AV0Z60220518 Keywords : coccidia * community ecology * co-occurrence * host-parasite relationships * introduced parasites * introduced host Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.522, year: 2010

  16. Modernidade seletiva e estado predador: primeira aproximação às revoltas populares em maputo de 2008 e 2010

    Scientific Electronic Library Online (English)

    Héctor Guerra, Hernández.


    Full Text Available Nos dias 5 de fevereiro de 2008 e 1 e 2 de setembro de 2010 Maputo foi o cenário de duas revoltas populares de grandes proporções, cada uma delas motivadas pelo descontentamento generalizado da população frente a reajustes econômicos, impostos pelo governo, que aumentariam significativamente o custo [...] da vida dos maputenses. Essa situação mobilizou tanto a elite política como intelectual a desenvolver apressadamente algumas hipóteses que pudessem explicar esses eventos. Neste texto pretende-se contrastar essas hipóteses para, em seguida, propor uma análise que possibilite um entendimento mais abrangente a respeito das causas que teriam levado à população a sair às ruas. Parte-se da constatação que o estado seria o produto histórico de violentos conflitos, cujas sequelas podem ser percebidas no receio e desconfiança que a população teria desenvolvido, e a partir da qual o estado seria percebido menos como um facilitador e mais como um concorrente invasivo e predatório. Abstract in english In 2008, at February 5th and in 2010, at September 1st and 2nd, Maputo was the scenery of two popular uprisings of major proportions, each one was motivated by general discontent against the economic readjustments, the government tax, that would increase significantly the living costs of maputenses. [...] This situation mobilized the elite, both political and intellectual, to hurriedly develop some hypotheses that could explain these events. The intention of this paper is to contrast these hypotheses, thereafter, to propose an analysis that will enable a more omnibus understanding about the causes that would had led the people to the streets. Therefore, the departure point is the assertion that the State would be the historical product of violent conflicts, whose consequences could be perceived on the fear and distrust that the people developed, and from which the State would be less like a facilitator than a competitor invasive and predatory.

  17. Seletividade fisiológica de inseticidas a vespidae predadores do bicho-mineiro-do-cafeeiro

    Directory of Open Access Journals (Sweden)



    Full Text Available Estudou-se, em laboratório, a seletividade dos inseticidas clorpirifós, deltametrina, dimetoato, ethion, monocrotofós e permetrina às vespas predadoras Apoica pallens Fab., Brachygastra lecheguana Latreille e Polistes versicolor versicolor Olivier (Hymenoptera: Vespidae em concentrações que correspondem a 50% e 100% da dosagem recomendada para o controle do bicho-mineiro-do-cafeeiro, Perileucoptera coffeella Guérin-Meneville (Lepidoptera: Lyonetiidae. Deltametrina foi seletivo em favor de P. versicolor versicolor e A. pallens. O ethion foi medianamente seletivo a A. pallens e P. versicolor versicolor, e seletivo em favor de B. lecheguana. Os demais inseticidas não foram seletivos às vespas predadoras. A ordem crescente de tolerância das vespas a deltametrina foi: P. versicolor versicolor > A. pallens > B. lecheguana. Para o ethion esta ordem foi: B. lecheguana > P. versicolor versicolor > A. pallens. O clorpirifós, deltametrina, dimetoato, monocrotofós e permetrina apresentaram semelhante toxicidade às vespas nas duas dosagens utilizadas. O ethion, por sua vez, reduziu seu impacto sobre A. pallens e P. versicolor versicolor quando aplicado em subdosagem.

  18. Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937 no controle de nematóides de bovinos

    Directory of Open Access Journals (Sweden)

    Alves P.H.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937 foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de Cynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001. No grupo B (controle, as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P<0,05 do que as do grupo A e a diferença entre o OPG dos animais dos grupos A e B, no final do experimento, foi de 88,8%. O gênero Cooperia foi o mais prevalente em ambas as pastagens. Conclui-se que a aplicação de pellets de M. thaumasium na dosagem e periodicidade de aplicação usadas foi eficiente no controle de nematóides parasitos gastrintestinais de bovinos.

  19. Gluttonous predators: how to estimate prey size when there are too many prey Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande

    Directory of Open Access Journals (Sweden)

    MS. Araújo


    Full Text Available Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites. This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.O tamanho das presas é uma importante dimensão do nicho trófico. Em estudos de ecologia alimentar, os itens alimentares são geralmente medidos individualmente com o uso de paquímetro ou ocular micrométrica. Entre os anfíbios e répteis, há espécies que consomem grande número de itens alimentares pequenos (e.g. formigas, cupins. Esse grande número, por sua vez, torna a estimativa do tamanho das presas consumidas uma tarefa difícil. Desenvolvemos um método para colher subamostras dos conteúdos estomacais desses animais com o objetivo de obter estimativas de tamanho das presas. Especificamente, desenvolvemos um protocolo baseado em uma rotina de bootstrap que permite a obtenção de subamostras com erro de precisão de no máximo 5% e confiança de 95%. Esse método deve diminuir o esforço amostral e facilitar estudos futuros sobre os hábitos alimentares de anfíbios e répteis, além de fornecer um meio de obter estimativas precisas de tamanho de presas.

  20. Seletividade de agroquímicos ao ácaro predador Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) / Agrochemical selectivity to predaceous mite Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Paulo R., Reis; Luiz G., Chiavegato; Gilberto J., Moraes; Everaldo B., Alves; Elber O., Sousa.


    Full Text Available Testes de efeito adverso de agroquímicos sobre Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) foram conduzidos em laboratório, utilizando o método residual de contato com pulverização em superfície de vidro. Foram testados 42 produtos químicos, a maioria utilizada na citricultura brasilei [...] ra. A mortalidade e o efeito dos produtos na reprodução do ácaro foram avaliados diariamente durante oito dias. Os produtos foram classificados quanto ao efeito total causado ao ácaro (combinação da mortalidade e efeito na reprodução) em quatro classes de toxicidade propostas pela IOBC/WPRS. Os resultados mostraram que cerca de 26% dos produtos testados foram inócuos (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, hidróxido de cobre, naled, oxicloreto de cobre, óxido cuproso e tetradifon), 14% levemente nocivos (abamectin, chlorothalonil, sulfato de cobre, thiophanate-methyl (PM) e ziram), 7% moderadamente nocivos (enxofre, parathion-methyl e thiophanate-methyl (SC)) e 52% nocivos ao ácaro (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, óleo mineral e vegetal, phosmet, propargite, quinomethionate, triazophos, e vamidothion). Abstract in english The side-effects of agrochemical to Iphiseiodes zuluagai Denmark & Muma (Acari: Phytoseiidae) were studied in laboratory using the residual contact spray method in glass surface. Forty-two plant protection products, used in Brazilian citrus orchards, were tested. Mite mortality and fecundity were ev [...] aluated for eight days. Tested products were ranked in toxicity classes, according to IOBC/WPRS system, by the total effect (combination of mortality and reproduction effect). The results showed that ca. 26% of the tested products were harmless (captan, clofentezine, fenbutatin oxide, fosetyl, hexythiazox, copper hydroxide, naled, copper oxychloride, cuprous oxide and tetradifon), 14% slightly harmful (abamectin, chlorothalonil, copper sulphate, thiophanate-methyl (PM) and ziram), 7% moderately harmful (sulfur, parathion-methyl and thiophanate-methyl (SC)) and 52% harmful to the mite (acrinathrin, amitraz, azinphos-ethyl, azocyclotin, benomyl, bifenthrin, bromopropylate, carbaryl, carbosulfan, chlorfenapyr, cyhexatin, dicofol, fenpropathrin, fenpyroximate, mancozeb, mineral and vegetable oils, phosmet, propargite, quinomethionate, triazophos and vamidothion).

  1. Competência de peixes como predadores de larvas de Aedes aegypti, em condições de laboratório Efficacy of fish as predators of Aedes aegypti larvae, under laboratory conditions


    Luciano Pamplona de Góes Cavalcanti; Ricardo José Soares Pontes; Ana Cláudia Ferreira Regazzi; Francisco José de Paula Júnior; Rodrigo Lins Frutuoso; Emanuel Primos Sousa; Fábio Fernandes Dantas Filho; José Wellington Oliveira Lima


    OBJETIVO: Avaliar a competência de peixes na predação de larvas de Aedes aegypti, em condições de laboratório. MÉTODOS: Foram testados machos e fêmeas de cinco espécies de peixe. Os testes de predação duravam cinco semanas para cada espécie. Cada ensaio compreendia quatro caixas testes e quatro caixas controles. Das caixas controle, duas tinham somente um peixe e as outras duas, apenas larvas. Cada caixa teste continha um peixe e larvas. Na primeira semana foram expostas 100 larva...

  2. Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae

    Directory of Open Access Journals (Sweden)



    Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e Protonectarina sylveirae (Hymenoptera: Vespidae. Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90 calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris.Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveirae (Hymenoptera: Vespidae was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90 of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

  3. Gluttonous predators: how to estimate prey size when there are too many prey / Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande

    Scientific Electronic Library Online (English)

    MS., Araújo; A., Pinheiro; SF., Reis.


    Full Text Available O tamanho das presas é uma importante dimensão do nicho trófico. Em estudos de ecologia alimentar, os itens alimentares são geralmente medidos individualmente com o uso de paquímetro ou ocular micrométrica. Entre os anfíbios e répteis, há espécies que consomem grande número de itens alimentares pequ [...] enos (e.g. formigas, cupins). Esse grande número, por sua vez, torna a estimativa do tamanho das presas consumidas uma tarefa difícil. Desenvolvemos um método para colher subamostras dos conteúdos estomacais desses animais com o objetivo de obter estimativas de tamanho das presas. Especificamente, desenvolvemos um protocolo baseado em uma rotina de bootstrap que permite a obtenção de subamostras com erro de precisão de no máximo 5% e confiança de 95%. Esse método deve diminuir o esforço amostral e facilitar estudos futuros sobre os hábitos alimentares de anfíbios e répteis, além de fornecer um meio de obter estimativas precisas de tamanho de presas. Abstract in english Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high int [...] ake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

  4. Inducers of resistance in potato and its effects on defoliators and predatory insects / Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores

    Scientific Electronic Library Online (English)



    Full Text Available Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se [...] llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM), y 4 - 1,15% tierra de diatomeas (DE). Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo. Abstract in english The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised compl [...] ete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM); and 4 - 1.15% diatomaceous earth (DE). Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.

  5. Inducers of resistance in potato and its effects on defoliators and predatory insects Los inductores de resistencia en la papa y sus efectos sobre insectos predadores y defoliadores

    Directory of Open Access Journals (Sweden)



    Full Text Available The effects of chemical inducers of plant resistance on folivorous beetles and predatory insects in Solarium tuberosum L. were evaluated. The effects of these chemical inducers on crop development and yield were also determined. The experiment was conducted with cv. Emeraude using a randomised complete-block design with four treatments and six replications: 1 - control; 2 - 1% silicic acid; 3 - 0.02% acibenzolar-S-methyl (ASM; and 4 - 1.15% diatomaceous earth (DE. Treatments 2, 3 and 4 were applied by spraying plant foliage every 10 days, total of five applications. The injuries and damages caused by beetles were evaluated. There were no significant differences in the presence of folivorous and predatory beetles in the aerial plant mass and the surrounding soil. However, the plants treated with silica or DE were less preferred by defoliators. Spraying with silicic acid, ASM and DE produced significant increases in plant diameter and height without affecting productivity. The application of silicic acid, ASM or DE increased protection against herbivorous insects and decreased tuber damage.Se evaluaron los efectos de los inductores químicos de resistencia de plantas a insectos en los escarabajos hebívoros y otros insectos depredadores en Solanum tuberosum. Los efectos de estos inductores químicos también se evaluaron en el desarrollo y en el rendimientos del cultivo. El experimento se llevó a cabo con el cv. Emeraude, utilizando un diseño de bloques al azar con cuatro tratamientos y seis repeticiones: 1 - Control, 2 - 1% de ácido silícico, 3 -0,02% acibenzolar-s-metil (ASM, y 4 - 1,15% tierra de diatomeas (DE. Los tratamientos 2, 3 y 4 se aplicaron por aspersión en el follaje de las plantas cada 10 días, un total de cinco aplicaciones. Se evaluaron las lesiones y los daños causados por Diabrotica speciosa. No hubo diferencias significativas en la presencia de D. speciosa y depredadores en la parte aérea de la planta y en el suelo circundante. Sin embargo, las plantas tratadas con ácido silícico o DE fueron menos preferidas por D. speciosa y el efecto asociado con ácido silícico, ASM y DE produjo un aumento significativo en el diámetro y la altura de la planta sin afectar la productividad. La aplicación de ácido silícico, ASM o DE aumentó la protección contra insectos y disminuyó los daños al tubérculo.

  6. Seletividade de inseticidas a três Vespidae predadores de Dione juno juno (Lepidoptera: Heliconidae) / Selectivity of insecticides to three Vespidae predators of Dione juno juno (Lepidoptera: Heliconidae)

    Scientific Electronic Library Online (English)



    Full Text Available Dentre os insetos que atacam o maracujazeiro, Dione juno juno (Lepidoptera: Heliconidae) é considerada a praga-chave. Estudou-se a seletividade dos inseticidas fentiom, cartape, malatiom e deltametrina a Dione juno juno, em relação às vespas predadoras Polybia fastidiosuscula, Polybia scutellaris e [...] Protonectarina sylveirae (Hymenoptera: Vespidae). Estimaram-se as curvas concentração-mortalidade e mediante o uso da concentração letal do inseticida em 90% dos indivíduos (CL90) calcularam-se os índices de seletividade diferencial e índices de tolerância. A deltametrina foi seletiva à P. scutellaris e P. fastidiosuscula e medianamente seletiva à P. sylveirae e o cartape foi medianamente seletivo às três espécies de vespas predadoras. O malatiom foi seletivo a P. sylveirae e medianamente seletivo a P. fastidiosuscula. As vespas predadoras P. fastidiosuscula eP. scutellaris foram mais tolerantes a deltametrina e ao fentiom do que P. sylveirae, enquanto o P. fastidiosuscula e P. sylveirae toleraram mais o cartape do que P. scutellaris. O malatiom foi mais tolerado pela espécie P. sylveirae do que por P. fastidiosuscula e P. scutellaris. Abstract in english Among insects that attack passion fruit, Dione juno juno (Lepidoptera: Heliconidae) is considered the most dangerous plague. The selectivity of the insecticides fenthion, cartap, malathion and deltamethrin to the predatory wasps Polybia fastidiosuscula, Polybia scutellaris and Protonectarina sylveir [...] ae (Hymenoptera: Vespidae) was studied based on these insecticide toxicities to their prey Dione juno juno. Concentration-mortality regression lines were obtained and the estimated lethal concentration of insecticide to 90% (LC90) of the individuals were used for the calculation of the differential selectivity index and tolerance index. Deltamethrin was selective in favor of P. scutellaris and P. fastidiosuscula and showed intermediate selectivity to P. sylveirae, while cartap showed intermediate selectivity to all three species of predatory wasps. Malathion was selectivite to P. sylveirae and showed intermediate selectivity to P. fastidiosuscula. The predatory wasps P. sylveirae and P. fastidiosuscula were more tolerant to cartap than P. scutellaris and P. sylveirae was more tolerant to malathion than P. fastidiosuscula and P. scutellaris.

  7. Gluttonous predators: how to estimate prey size when there are too many prey Predadores glutões: como estimar o tamanho das presas quando o número delas é muito grande


    Ms, Arau?jo; Pinheiro, A.; Sf, Reis


    Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in ...

  8. Contribuição para o conhecimento da Mimosicerya hempeli (Cockerell, 1899) (Homoptera. Margarodidae) e de seu predador Exoplectra erythrogasfer Mulsant, 1851 (Coleoptera, Coccinellidae)

    Scientific Electronic Library Online (English)

    Francisco A. M., Mariconi; Adiei P. L., Zamith.

    Full Text Available [...] Abstract in english This paper deals with Mimosicerya hempeli (Cock., 1899) (Homoptera, Margarodidae) and its predator, the ladybeetle Exo-plectra erythrogaster Muls., 1851 (Coleoptews, Coccinellidae), which were found to occur at Piracicaba, State of São Paulo, Brasil. The first is a pest of "cássia imperial" (Cassia [...] fistula L.), and several other trees. As those insects are little known, a few bionomical notes and descriptions of some of their stages are presented. The adult scales proved to be very resistant to an application of mineral oil plus malathion. Methyl Demeton applied with irrigation water showed no control. The same insecticide injected into the trunk gave very poor results.

  9. Aegla platensis Schmitt, 1942 (Decapoda: Anomura) um predador de imaturos de Simuliidae (Diptera: Culicomorpha) Aegla platensis Schmitt, 1942 (Decapoda: Anomura) a predator of Simuliidae imature stages (Diptera: Culicomorpha)


    Sandra Tonetti Magni; Victor Py-Daniel


    Observações de campo e de laboratório evidenciaram, pela primeira vez, a predação preferencial, de larvas e pupas de simulídeos pelo crustáceo. Aegla platensis Schmitt, 1942. Foram feitas observações de campo e coletas no arroio Carpintaria, Município de Dois Irmãos, Rio Grande do Sul, Brasil. É ressaltada a possibilidade de ser usado esse caranguejo em manejo integrado no controle de simulídeos.For the first time, preferential predation of larvae and pupae of Simuliidae by the crustacean, Ae...

  10. Hypoxic environments as refuge against predatory fish in the Amazonian floodplains / Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas

    Scientific Electronic Library Online (English)

    MB., Anjos; RR., De Oliveira; J., Zuanon.


    Full Text Available Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação [...] , devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1), mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p Abstract in english Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pr [...] essure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1) but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p

  11. Hypoxic environments as refuge against predatory fish in the Amazonian floodplains Ambientes hipóxicos como refúgios contra peixes predadores nas várzeas amazônicas

    Directory of Open Access Journals (Sweden)

    MB. Anjos


    Full Text Available Several groups of Amazonian fishes exhibit behavioral, morphological and physiological characteristics that allow occupying hypoxic environments, despite the energetic costs of living in such harsh conditions. One of the supposed advantages of occupying hypoxic habitats would be a lower predation pressure resulting from a lower number of piscivorous fishes in those environments. We tested this hypothesis in an area of the Amazon River floodplain through gill net fishing in normoxic and hypoxic habitats. From the 103 species caught, 38 were classified as piscivores. We found no difference in the number of piscivorous species captured in hypoxic and normoxic habitats (chi2 = 0.23; p = 0.63; df = 1 but piscivorous individuals were more numerous in normoxic than in hypoxic sampling stations (chi2 = 104.4; p Diversos grupos de peixes amazônicos apresentam mecanismos para suportar condições de hipóxia, incluindo especializações comportamentais, morfológicas e fisiológicas, apesar do custo energético envolvido. Uma das supostas vantagens em ocupar ambientes hipóxicos seria a redução da pressão de predação, devido à presença de um menor número de peixes piscívoros. Testamos esta hipótese em um ambiente de várzea do rio Amazonas, por meio de coleta de peixes com malhadeiras em ambientes hipóxicos e normóxicos. Das 103 espécies capturadas, 38 foram classificadas como piscívoras. Não houve diferença no número de espécies piscívoras e não piscívoras nos dois tipos de ambientes amostrados (chi2 = 0,23; p = 0,63; gl = 1, mas a proporção de peixes piscívoros foi maior sob condições de normóxia (chi2 = 104,40; p < 0,001; gl = 1. Isto indica que ambientes com baixa concentração de oxigênio dissolvido podem de fato funcionar como locais de refúgio contra peixes piscívoros nas várzeas amazônicas.

  12. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  13. ClEST cluster :Cl_singleton1654 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1654 zinc ... transporter zip11-like Cimex lectularius nuclear gene 411 TTAAATGTCAACAGCG ... GGCCATATGCATTCATTCCAGCCTGTGTTGGGTTTCTACT fw20018 1 Zinc ... transporter ZIP11 [Camponotus floridanus] EFN60394 ...

  14. ClEST cluster :Cl_singleton2242 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2242 ubiquitin carboxyl-terminal ... hydrolase 7 Cimex lectularius nuclear gene 439 ATGA ... CTCTATCCTAATAAAGGTGCA mb20048 1 Ubiquitin carboxyl-terminal ... hydrolase 7 [Camponotus floridanus] EFN60413 1.462 ...

  15. ClEST cluster :Cl_singleton0912 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0912 homeodomain-interacting protein kinase ... 2 Cimex lectularius nuclear gene 357 CCG ... AATCGTCA fs15061 1 Homeodomain-interacting protein kinase ... 2 [Camponotus floridanus] EFN73498 4.27897E-25 GO: ...

  16. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia


    Mueller Martin J; Stoll Sascha; Berthold Kristina; Krischke Markus; Straka Josef; Feldhaar Heike; Gross Roy


    Abstract Background Carpenter ants (genus Camponotus) are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine) of the amino acids essent...

  17. Stomach content analysis of potential predators of Simuliidae (Diptera: Nematocera) in two lowland forest streams, Central Amazonia, Brazil / Análise do conteúdo estomacal de possíveis predadores de Simuliidae (Diptera: Nematocera), em dois igarapés de terra firme na Amazônia Central, Brasil

    Scientific Electronic Library Online (English)

    Yamile B., Alencar; Neusa, Hamada; Sandra, Magni-Darwich.


    Full Text Available O conteúdo estomacal de insetos (Plecoptera e Odonata), crustáceos e peixes foi analisado por meio de dissecção para se verificar a predação sobre imaturos de simulídeos e identificação dos outros itens alimentares. O trabalho foi realizado em dois igarapés da Reserva Florestal Adolpho Ducke (Sabiá- [...] I), Manaus - AM, pertencente ao Instituto Nacional de Pesquisas da Amazônia (INPA), com espécimes coletados mensalmente no período de abril de 1992 a maio de 1993 e nos meses de novembro de 1993 e junho de 1994. As coletas foram realizadas por meio de cestas-armadilhas (contendo folhas de jambeiro, Eugenia malaccensis L., Myrtaceae) e rapiché. Constatou-se a predação de imaturos de Simuliidae por um exemplar de peixe (Microcharacidium gnomus, Characidae), Plecoptera (Perlidae) e Odonata (Gomphidae, Agrionidae, Libellulidae, Dicteriadidae e Coenagrionidae). Outros itens alimentares observados nos organismos analisados foram Diptera (Chironomidae), Trichoptera (Hydropsychidae, Hydroptilidae), Coleoptera (Elmidae), Hymenoptera (Formicidae), Ephemeroptera (Baetidae, Leptophlebidae), outros insetos, ovos de insetos, Hydracarina, Crustacea, Nematoda, detritos e restos vegetais. Abstract in english [...

  18. Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae, em três presas alternativas Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae, in three alternative preys

    Directory of Open Access Journals (Sweden)

    José Cola Zanuncio


    Full Text Available Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae catterpilars; T2 - Musca domestica (Diptera, Muscidae larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae larva. Longevity and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

  19. Survey of cyclopids (Crustacea, Copepoda) in Brazil and preliminary screening of their potential as dengue vector predators Levantamento de ciclopídeos (Crustacea, Copepoda) no Brasil e avaliação preliminar de seu potencial como predadores dos vetores da dengue


    Luciana Urbano dos Santos; Andrade, Carlos Fernando S.


    INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were...

  20. Diel horizontal distribution of microcrustaceans and predators throughout a year in a shallow neotropical lake Distribuição horizontal de microcrustáceos e predadores ao longo do ano em um lago neotropical


    Ms, Arcifa; Tc, Bunioto; Perticarrari, A.; Wj, Minto


    The focus of this study is to investigate if microcrustaceans undergo diel horizontal migration (DHM) in a tropical shallow lake on a yearly basis and analyse the adaptive value regarding predation. Abundance of invertebrate predators, chaoborid larvae and water mites, and microcrustaceans (cladocerans and copepods) were evaluated on a monthly basis in three stations located on a transect during the day and at night. Both invertebrate predators were predominantly pelagic. Cladocerans did not ...

  1. Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae) / Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae)

    Scientific Electronic Library Online (English)

    Lívia Mendes, Carvalho; Vanda Helena Paes, Bueno; Simone Martins, Mendes.


    Full Text Available O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperatura [...] s, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879). O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70±10% e fotofase de 12horas. Efeito deletério da temperatura em O. thyestes foi obtido a 16ºC, na qual apenas 40% das ninfas atingiram a fase adulta, e destes apenas 19% não apresentaram deformações morfológicas. O maior período de pré-oviposição foi observado a 19ºC (17,8 dias). Os maiores valores para a fecundidade média total foram registrados a 25 e 28ºC, com 109,2 e 128,2 ovos/fêmea, respectivamente, e o menor a 19ºC, com 22,8 ovos/fêmea. A 22 e 31ºC as fêmeas viveram mais que os machos, sendo que a 19ºC a longevidade foi maior, independente do sexo. As baixas temperaturas influenciaram a reprodução e longevidade de O. thyestes sugerindo que esta espécie poderá ter melhor performance reprodutiva em temperaturas mais elevadas, como aquelas de regiões tropicais e ou subtropicais. Abstract in english The development time and the fecundity of Orius species are strongly influenced by a wide range of factors, like environmental conditions and in particular temperature. This work aimed to evaluate the reproduction and adult longevity of Orius thyestes Herring, 1966 in different temperatures. Eggs of [...] Anagasta kuehniella (Zeller, 1879) was provide as food supply. The experiment was carried out in climatic chambers at temperatures 16, 19, 22, 25, 28 and 31 ± 1°C, RH 70 ±10% and photophase 12h. A deleterious effect of the temperature on O. thyestes was found at 16°C, in which only 40% of the nymphs reached adulthood, of which only 19% presented normal morphological characteristics, without any alterations. The longest pre-oviposition period was found at 19°C (17.8 days). The highest fecundities were found at 25 and 28°C (109.2 and 128.2 eggs/female, respectively) and the lowest at 19 °C (22.8 eggs/female). At 22 and 31°C, females lived longer than the males. The low temperatures affected the reproduction and longevity of O. thyestes, suggesting that this species would have better reproductive performance under high temperatures, as it occur in tropical and or subtropical regions.

  2. Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae) Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae)


    Lívia Mendes Carvalho; Vanda Helena Paes Bueno; Simone Martins Mendes


    O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperaturas, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879). O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70&pl...

  3. Influência da temperatura na reprodução e longevidade do predador Orius thyestes Herring (Hemiptera, Anthocoridae Influence of the temperature on reproduction and longevity of the predator Orius thyestes Herring (Hemiptera, Anthocoridae

    Directory of Open Access Journals (Sweden)

    Lívia Mendes Carvalho


    Full Text Available O desenvolvimento e a fecundidade das espécies de Orius são bastante influenciados por uma série de fatores, como as condições ambientais, e em particular, pela temperatura. Esse trabalho teve como objetivo avaliar a reprodução e a longevidade de Orius thyestes Herring 1966 em diferentes temperaturas, tendo como alimento, ovos de Anagasta kuehniella (Zeller, 1879. O experimento foi conduzido em câmaras climatizadas com temperaturas de 16, 19, 22, 25, 28, 31 ± 1ºC, UR de 70±10% e fotofase de 12horas. Efeito deletério da temperatura em O. thyestes foi obtido a 16ºC, na qual apenas 40% das ninfas atingiram a fase adulta, e destes apenas 19% não apresentaram deformações morfológicas. O maior período de pré-oviposição foi observado a 19ºC (17,8 dias. Os maiores valores para a fecundidade média total foram registrados a 25 e 28ºC, com 109,2 e 128,2 ovos/fêmea, respectivamente, e o menor a 19ºC, com 22,8 ovos/fêmea. A 22 e 31ºC as fêmeas viveram mais que os machos, sendo que a 19ºC a longevidade foi maior, independente do sexo. As baixas temperaturas influenciaram a reprodução e longevidade de O. thyestes sugerindo que esta espécie poderá ter melhor performance reprodutiva em temperaturas mais elevadas, como aquelas de regiões tropicais e ou subtropicais.The development time and the fecundity of Orius species are strongly influenced by a wide range of factors, like environmental conditions and in particular temperature. This work aimed to evaluate the reproduction and adult longevity of Orius thyestes Herring, 1966 in different temperatures. Eggs of Anagasta kuehniella (Zeller, 1879 was provide as food supply. The experiment was carried out in climatic chambers at temperatures 16, 19, 22, 25, 28 and 31 ± 1°C, RH 70 ±10% and photophase 12h. A deleterious effect of the temperature on O. thyestes was found at 16°C, in which only 40% of the nymphs reached adulthood, of which only 19% presented normal morphological characteristics, without any alterations. The longest pre-oviposition period was found at 19°C (17.8 days. The highest fecundities were found at 25 and 28°C (109.2 and 128.2 eggs/female, respectively and the lowest at 19 °C (22.8 eggs/female. At 22 and 31°C, females lived longer than the males. The low temperatures affected the reproduction and longevity of O. thyestes, suggesting that this species would have better reproductive performance under high temperatures, as it occur in tropical and or subtropical regions.

  4. Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil

    Directory of Open Access Journals (Sweden)

    JMF. Penha


    Full Text Available Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and seventh largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima, respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável.

  5. Sustainable harvest of two large predatory catfish in the Cuiabá river basin, northern Pantanal, Brazil / Pesca sustentável de dois grandes bagres predadores na bacia do Rio Cuiabá, Pantanal norte, Brasil

    Scientific Electronic Library Online (English)

    JMF., Penha; LAF., Mateus.


    Full Text Available A pesca é uma importante atividade econômica no Pantanal. Entre as espécies que ocorrem na região, os bagres Pimelodídeos se destacam como uma importante parte da captura anual. Este estudo avalia a estrutura, estado de explotação e o manejo do estoque do Hemisorubim platyrhynchos e Sorubim cf. lima [...] , respectivamente o sexto e o sétimo maiores Pimelodídeos do Pantanal. As análises se baseiam nos peixes capturados no Rio Cuiabá pela pesca e desembarcados no Mercado Municipal "Antônio Moysés Nadaf", na cidade de Cuiabá, Estado do Mato Grosso. Os resultados indicam que a pesca comercial incide sobre várias coortes do estoque e que usualmente somente são capturados indivíduos acima do comprimento médio na primeira maturação. Estimativas do coeficiente instantâneo de mortalidade mostram que a mortalidade por pesca atual é baixa. Simulações do modelo de rendimento relativo por recruta indicam que o rendimento atual das duas espécies poderia aumentar com um aumento no esforço de pesca, indicando que o estoque está subexplotado. Contudo, um aumento no esforço de pesca corrente deve ser visto com cautela, uma vez que a relação entre o estoque e o recrutamento para as espécies é desconhecido. Em síntese, os resultados indicam que o nível atual de captura das duas espécies no Rio Cuiabá é sustentável. Abstract in english Fishery is an important economic activity in the Pantanal. Among the region’s species, the Pimelodidae catfish stands out as an important part of the annual catch. This study assesses the structure, exploitation and stock management of Hemisorubim platyrhynchos and Sorubim cf. lima, the sixth and se [...] venth largest Pimelodidae of the Pantanal. The analysis is based on fish caught by commercial fishing in the Cuiabá river and landed at the "Antônio Moysés Nadaf" Market in the Cuiabá city, Mato Grosso state, Brazil. The findings indicate that commercial fishing activities target several fish cohorts and that usually only individuals above mean length at first maturation are caught. Estimates of the instantaneous mortality coefficient show that the current fishing mortality is low. Simulations of relative yield-per-recruit model demonstrate that the current yield of two species could be greater if the fishery effort were increased, indicating that the stocks are underexploited. However, an increase in current fishery efforts should be viewed with caution, since the stock-recruitment relationship for the species is unknown. The results indicate that the current harvest of two species in the Cuiabá River Basin is sustainable.

  6. Duração do período ninfal e sobrevivência do predador Podisus connexivus Bergroth (Hemiptera, Pentatomidae), em três presas alternativas / Ninfal period duration and survival of the predator Podisus connexivus Bergroth (Hemiptera, Pentatomidae), in three alternative preys

    Scientific Electronic Library Online (English)

    José Cola, Zanuncio; Joaquim Efigênio M, Leite; João Batista, Alves; Germi Porto, Santos.

    Full Text Available [...] Abstract in english Longevity and survival of the predator Podisus connexivus (Hemiptera: Pentatomidae) were studied in three alternative preys: T1 - Bombyx mori (Lepidoptera, Bombycidae) catterpilars; T2 - Musca domestica (Diptera, Muscidae) larva and T3 - Tenebrio molitor (Coleoptera, Tenebrionidae) larva. Longevity [...] and survival were: 22,1±0,6 days and 54,3±5,3%; 25,2±1,3 days and 56,0±4,9% and 22,0±0,8 days and 34,6±8,6%, for treatments T1, T2 and T3, respectively. Comparing to other researches, a lower survival was found. This is probably because a F2 generation from field material, was used. Since the insect was not well adapted to the laboratory conditions this could have led to lower survival.

  7. Efeito da escassez de presa na sobrevivência e reprodução do predador Supputius cincticeps (Stål) (Heteroptera: Pentatomidae) / Effect of prey shortage on the reproduction and longevity of Supputius cincticeps (Stål) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Sheila A., Mourão; José C., Zanuncio; Adrián J., Molina-Rugama; Evaldo F., Vilela; Mábio C., Lacerda.


    Full Text Available O efeito da escassez de presas no desempenho de fêmeas de Supputius cincticeps (Stål) foi estudado a 24,6 ± 0,7ºC, umidade relativa de 80 ± 4% e fotoperíodo de 12h. Larvas de Tenebrio molitor L. foram fornecidas às fêmeas durante 24h, a cada um, dois, quatro, seis ou oito dias; pedaços de vagem de f [...] eijão (Phaseolus vulgaris L.) foram fornecidos em todos os tratamentos de forma contínua. A porcentagem de fêmeas com posturas, o período de oviposição e o número de posturas, de ovos e de ninfas diminuíram com o aumento do intervalo sem presa. Entretanto, os períodos de pré-oviposição e de pós-oviposição aumentaram à medida que o alimento tornou-se menos freqüente, enquanto a longevidade e o número de ovos por postura não foram afetados pelo regime de presas. Os resultados sugerem uma compensação entre a longevidade e a fecundidade (redução da segunda para manter a primeira), o que pode contribuir para o estabelecimento e a sobrevivência de S. cincticeps em condições de escassez de presa. Abstract in english The effect of prey shortage on the performance of Supputius cincticeps (Stål) females was evaluated at 24.6 ± 0.7ºC, 80 ± 4% RH and 12h photophase. Larvae of Tenebrio molitor L. were offered to the females during 24h every one, two, four, six or eight days; pieces of green bean (Phaseolus vulgaris L [...] .) were offered continuously. The percentage of females with egg masses, oviposition period, and the number of egg masses, eggs and nymphs decreased with the increase in the interval without prey, whereas the periods of pre- and pos-oviposition increased. On the other hand, longevity and number of eggs per egg mass were not affected by the prey regimen. The results suggest a trade-off between longevity and fecundity (reduction of fecundity to maintain longevity), which could contribute to the establishment and survival of S. cincticeps during periods of prey scarcity.

  8. Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? A agressividade da presa altera o comportamento de ataque do predador Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)?


    Rafael Braga da Silva; Alberto Soares Corrêa; Terezinha Maria Castro Della Lucia; Alexandre Igor de Azevedo Pereira; Ivan Cruz; José Cola Zanuncio


    Does the aggressiveness of the prey modify the attack behavior of the predator Supputius cincticeps (Stål) (Hemiptera, Pentatomidae)? The stink bug Supputius cincticeps (Stål) (Hemiptera, Pentatomidae) is a predator found in several Brazilian regions, which possesses desirable attributes as a natural control agent and in biological control programs. The aim of this study was to test if the attack behavior and predation success of S. cincticeps were affected by prey species. Larvae of Tenebrio...

  9. Influence of the webbing produced by Oligonychus ilicis (McGregor) (Acari: Tetranychidae) on associated predatory phytoseiids; Influencia da teia de Oligonychus ilicis (McGregor) (Acari: Tetranychidae) sobre os fitoseideos predadores associados

    Energy Technology Data Exchange (ETDEWEB)

    Franco, Renato A. [Bioagri Laboratorios Ltda., Piracicaba, SP (Brazil)], e-mail:; Reis, Paulo R. [Empresa de Pesquisa Agropecuaria de Minas Gerais (EPAMIG), Belo Horizonte, MG (Brazil). Ecocentro], e-mail:; Zacarias, Mauricio S. [EMBRAPA Cafe, Lavras, MG (Brazil)], e-mail:; Oliveira, Daniel C. [Universidade Federal de Lavras (UFLA), MG (Brazil)


    Oligonychus ilicis (McGregor) is among those mite species that can cause damage to coffee plants (Coffea spp.). Species of Phytoseiidae acari are considered the most important and studied predatory mites. The objective of this study was to evaluate the effects of the webbing produced by O. ilicis on its predation by females of the phytoseiids Iphiseiodes zuluagai Denmark and Muma, Euseius citrifolius Denmark and Muma and Amblyseius herbicolus (Chant). Four bioassays were conducted, with three treatments and ten replicates. Each replicate consisted of 25 O. ilicis per experimental unit (a leaf disc of Coffea arabica) according to the tested developmental stage, in independent experiments. To spin the web, 15 adult females were put on each experimental unit for 24h; females were then removed, leaving only the web, and predators and prey to be tested were introduced. Predation was assessed after 24h. In the presence of webbing, the consumption of eggs, larvae and nymphs by I. zuluagai and eggs and larvae by E. citrifolius was lower. For A. herbicolus, egg predation was lower, but larval predation did not vary significantly and predation of nymphs and adults was higher in the presence of webbing. Predators as a whole were more efficient consuming larvae regardless of the presence of webbing. Considering the stages of O. ilicis altogether, webbing reduced the predation potential of I. zuluagai and E. citrifolius, but not of A. herbicolus. (author)

  10. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium / Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium

    Scientific Electronic Library Online (English)

    Jackson Victor de, Araújo; Marcos Pezzi, Guimarães; Artur Kanadani, Campos; Nilo Chaves de, Sá; Priscilla, Sarti; Rafaela Carolina Lopes, Assis.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 [...] (controle), os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000). No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg) em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P Abstract in english The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (co [...] ntrol), the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000). In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg) on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (P

  11. Aplicação de formulação do fungo predador de nematóides Monacrosporium thaumasium (Drechsler, 1937) no controle de nematóides de bovinos / Control of bovine gastrointestinal nematodes using formulation of the nematode-trapping fungus Monacrosporium thaumasium (Drechsler, 1937)

    Scientific Electronic Library Online (English)

    P.H., Alves; J.V., Araújo; M.P., Guimarães; R.C. L., Assis; P., Sarti; A.K., Campos.


    Full Text Available A viabilidade de uma formulação do fungo Monacrosporium thaumasium (Drechsler, 1937) foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Dois grupos de sete bezerras cada, mestiças Holandês ´ Zebu, de quatro a seis meses de idade, foram colocados em pastagens de C [...] ynodon dactilon. No grupo A, cada animal recebeu 20g de pellets (formulação granulada) de M. thaumasium via oral, duas vezes por semana, durante quatro meses, com início na estação chuvosa (outubro, 2001). No grupo B (controle), as bezerras não receberam nenhum tratamento. As contagens de ovos por grama de fezes (OPG) e das larvas infectantes encontradas na pastagem do grupo B foram significativamente maiores (P Abstract in english The viability of a formulation of the fungus Monacrosporium thaumasium (Drechsler, 1937) was evaluated for the biological control of bovine gastrointestinal nematode parasites. Two groups of seven female calves each, Holstein ´ Zebu crossbred, four to six months of age, were placed in Cynodon dactil [...] on pastures. In group A, each animal received via oral 20g of pellets of M. thaumasium twice a week during a four-month period that began with the onset of the rainy season (October, 2001). In group B (control), the calves did not receive any treatment. The counts of eggs per gram of faeces (EPG) for animals of the group B were significantly greater (P

  12. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) / Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Rodolfo Vargas, Castilhos; Anderson Dionei, Grützmacher; Dori Edson, Nava; Moisés João, Zotti; Paulo Ricardo Baier, Siqueira.


    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas), utili [...] zando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC). Os agrotóxicos (% de ingrediente ativo na calda) azoxystrobina (0,016), captana (0,192), dodina (0,126), folpete (0,200), mancozebe (0,256), mancozebe + oxicloreto de cobre (0,140 + 0,096), tebuconazole (0,320), abamectina (0,002), óleo mineral 1 (2,420), óleo mineral 2 (1,920), dicloreto de paraquate (0,300) e glifosato (1,440) foram inócuos; deltametrina (0,002) foi levemente nocivo e dimetoato (0,160), fosmete (0,160) e malationa (0,240) foram nocivos a adultos de C. externa. Abstract in english The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861) (Neuroptera: Chrysopidae) under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase), using t [...] he "International Organization for Biological Control" (IOBC) methodology. The pesticides (% active ingredient) azoxystrobin (0.016), captan (0.192), dodine (0.126), pholpet (0.200), mancozeb (0.256), mancozeb + cooper oxichloride (0.140 + 0.096), tebuconazole (0.320), abamectin (0.002), mineral oil 1 (2.420), mineral oil 2 (1.920), paraquat dichloride (0.300) and gliphosate (1.440) were harmless; deltametrin (0.002) was slightly harmful and dimetoate (0.160), phosmet (0.160) and malathion (0.240), were harmful to C. externa adults.

  13. Seletividade de agrotóxicos utilizados em pomares de pêssego a adultos do predador Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae Selectivity of pesticides used in peach orchard on adults of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae

    Directory of Open Access Journals (Sweden)

    Rodolfo Vargas Castilhos


    Full Text Available A seletividade de dezesseis agrotóxicos utilizados na produção integrada e convencional de pêssego foi avaliada sobre a fase adulta de Chrysoperla externa através de bioensaios de exposição residual conduzidos em laboratório (temperatura de 25±1ºC, umidade relativa 70±10% e fotofase 14 horas, utilizando-se de metodologia prescrita pela "International Organization for Biological Control" (IOBC. Os agrotóxicos (% de ingrediente ativo na calda azoxystrobina (0,016, captana (0,192, dodina (0,126, folpete (0,200, mancozebe (0,256, mancozebe + oxicloreto de cobre (0,140 + 0,096, tebuconazole (0,320, abamectina (0,002, óleo mineral 1 (2,420, óleo mineral 2 (1,920, dicloreto de paraquate (0,300 e glifosato (1,440 foram inócuos; deltametrina (0,002 foi levemente nocivo e dimetoato (0,160, fosmete (0,160 e malationa (0,240 foram nocivos a adultos de C. externa.The selectivity of sixteen pesticides used in integrated and conventional peach production was evaluated on adults of Chrysoperla externa (Hagen,1861 (Neuroptera: Chrysopidae under bioassays in laboratory conditions (temperature of 25±1ºC, relative humidity 70±10% and 14 hours photophase, using the "International Organization for Biological Control" (IOBC methodology. The pesticides (% active ingredient azoxystrobin (0.016, captan (0.192, dodine (0.126, pholpet (0.200, mancozeb (0.256, mancozeb + cooper oxichloride (0.140 + 0.096, tebuconazole (0.320, abamectin (0.002, mineral oil 1 (2.420, mineral oil 2 (1.920, paraquat dichloride (0.300 and gliphosate (1.440 were harmless; deltametrin (0.002 was slightly harmful and dimetoate (0.160, phosmet (0.160 and malathion (0.240, were harmful to C. externa adults.

  14. Control of bovine gastrointestinal nematode parasites using pellets of the nematode-trapping fungus Monacrosporium thaumasium Controle de nematóides parasitos gastrintestinais de bovinos com pellets do fungo predador de nematóides Monacrosporium thaumasium

    Directory of Open Access Journals (Sweden)

    Jackson Victor de Araújo


    Full Text Available The viability of a formulation of the fungus Monacrosporium thaumasium associated with ivermectin was evaluated for the biological control of bovine gastrointestinal nematode parasites. Four groups of five calves each were placed in pastures with a stocking rate of 1.6 animal/hectare. In group 1 (control, the calves did not receive any treatment. In group 2, each animal received 20g of pellets of M. thaumasium orally twice a week during a six-month period that began with the onset of the rainy season (October 23, 2000. In group 3, each animal received 20g of pellets of M. thaumasium orally twice a week during the same period as 2, as well as two strategic treatments with ivermectin (200 mcg/kg on May 10, 2001 and July 5, 2001. In group 4, the animals were treated with ivermectin alone as described for group 3. EPG counts for group 1 were significantly greater (PA viabilidade de uma formulação do fungo Monacrosporium thaumasium associada com ivermectina foi avaliada no controle biológico de nematóides parasitos gastrintestinais de bovinos. Quatro grupos de cinco bezerros foram colocados em pastagens com uma taxa de lotação de 1,6 animal/hectare. No grupo 1 (controle, os bezerros não receberam nenhum tratamento. No grupo 2, cada animal recebeu 20 g de pellets de M. thaumasium, via oral, duas vezes por semana e durante um período de seis meses que começou na estação chuvosa (23 de outubro, 2000. No grupo 3, cada animal recebeu 20g de pellets de M. thaumasium, via oral, duas vezes por semana e durante o mesmo período do grupo 2, assim como dois tratamentos estratégicos com ivermectina (200 mcg/kg em 10 de maio de 2001 e em 5 de julho de 2001. No grupo 4, os animais foram tratados somente com ivermectina como descrito no grupo 3. As contagens de OPG dos animais do grupo 1 foram significativamente maiores (P< 0,01 do que os animais dos grupos 2 e 3 e a diferença no final do experimento foi próxima de 100%. Os OPGs dos animais do grupo 4 permaneceram altos até o primeiro tratamento estratégico com ivermectina. Os resultados do grupo 1 e 4 diferiram significativamente (P< 0,05 daqueles dos grupos 2 e 3 a partir de dezembro de 2000. Concluiu-se que a aplicação de pellets de M. thaumasium nesta dosagem e periodicidade de aplicação tornaram os tratamentos anti-helmínticos desnecessários.

  15. Efeito do intervalo de alimentação na reprodução e na longevidade do predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) / Effect of feeding intervals on reproduction and longevity of Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae)

    Scientific Electronic Library Online (English)

    Adrián J., Molina-Rugama; José C., Zanuncio; Dirceu, Pratissoli; Ivan, Cruz.


    Full Text Available O efeito do intervalo de alimentação em fêmeas de Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae), foi estudado a 24 ± 3ºC, UR de 70 ± 10 % e fotofase de 12 horas. Os tratamentos consistiram no fornecimento de larvas de Musca domestica L. (Diptera: Muscidae), durante 24 horas a cada um, doi [...] s, quatro, oito ou 16 dias. Fêmeas de P. nigrispinus, alimentadas a cada um, dois e quatro dias, produziram maior número de ovos (225,4; 184,6 e 135,3 ovos, respectivamente), que aquelas alimentadas à cada oito ou 16 dias (8,3 e 0,0 ovos, respectivamente). A longevidade das fêmeas que receberam presa a cada quatro dias (43,0 dias), foi maior do que aquelas alimentadas a cada oito ou 16 dias (27,3 e 10,6 dias). Abstract in english The effect of feeding intervals on Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) females was studied. Females were fed during 24 hours after either one, two, four, eight or 16 days with Musca domestica L. (Diptera: Muscidae) larvae at 24 ± 3º C, 70 ± 10% RH and photophase of 12 hours. Fem [...] ales of P. nigrispinus fed every one, two and four days produced higher number of eggs (225.4, 184.6 and 135.3 eggs, respectively) than those fed every eight or 16 days (8.3 and 0.0 eggs, respectively). Females fed every four days lived longer (43.0 days) than those fed every eight or 16 days (27.3 and 10.6 days).

  16. Evaluación del interés de productores ganaderos en el control selectivo y eficiente de predadores en la Patagonia Austral / Evaluation of the interest of southern Patagonian ranchers toward selective and efficient predator control methods

    Scientific Electronic Library Online (English)

    Arantxa, GARCÍA BREA; Sonia Cristina, ZAPATA; Diego Esteban, PROCOPIO; Rolando, MARTÍNEZ PECK; Alejandro, TRAVAINI.


    Full Text Available Elaboramos una encuesta con el fin de evaluar el interés de los productores ganaderos por incorporar prácticas selectivas de control basándonos en la caracterización del sistema de producción ganadera de Santa Cruz y su relación con la predación por el zorro colorado (Lycalopex culpaeus). Para los e [...] ncuestados (n = 90) la carga ovina actual está por debajo de la óptima, lo que es consistente con el hecho de que para la mayoría (73%) la ganadería sólo representa una parte de sus ingresos. El nivel de pérdida de corderos por predación de zorros colorados varía entre el 5% y el 50% de la producción anual y esta tasa se ha mantenido en los últimos años, a pesar de que el 56% de los encuestados percibe un aumento en la abundancia de zorros en sus campos en los últimos 10 años. Las actitudes negativas de los productores hacia el zorro colorado se reflejaron en el hecho de que su control continúa siendo una práctica habitual para el 73% de los encuestados incluso en establecimientos sin producción. El uso de veneno es o ha sido utilizado por la mayoría de los productores (74%) a pesar de su prohibición. Sin embargo, el 91% de los encuestados estaría dispuesto a reemplazar sus prácticas por métodos de control selectivos y eficientes. Este es un punto importante para incentivar el uso de métodos alternativos de control, como cebos tóxicos administrados selectivamente, lo que permitiría el abandono de las prácticas tradicionales tan nocivas para la conservación de la biodiversidad. Abstract in english Sheep ranchers (n = 90) were surveyed to evaluate their interest in the incorporation of predator selective control methods. We based our survey on the characterization of the sheep ranching system of Santa Cruz province and its relationship with culpeo fox (Lycalopex culpaeus) predation. For a larg [...] e percentage of producers (73%), the carrying capacity at present is under the optimal, which is consistent with the fact that sheep ranching represents only a part of their income. Lamb losses due to culpeo foxes predation vary between 5% and 50% of the annual lamb production, and these percentages did not vary during the last years in spite of the perceiving, by 53% of ranchers, of an increment in foxes abundance. Ranchers tend to exaggerate real losses of their lambs due to predation, although they recognize that there are other causes that could facilitate it. Nevertheless, fox control, including poisoning as a method, is still a current practice even in those ranches without sheep. The 90% of the sheep ranchers showed a good willingness to replace their current practices by selective and efficient control methods. This is an important point to encourage the use of selective control methods, like toxic baits delivered in a selective way, which would allow the abandonment of the traditional practices so dangerous to biodiversity conservation.

  17. Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor, em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC, os produtos foram classificados como: classe 1 inócuo (E99%, clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros.This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days, dicofol and pyridaben (14 days and chlorfenapyr (21 days, without risk of significant adult mortality rates due to the application of pesticides.

  18. Seletividade de alguns agrotóxicos em uso na citricultura ao ácaro predador Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of the main pesticides recommended in citrus orchards on predaceous mite Neoseiulus californicus (Mcgregor) (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Carlos Amadeu Leite de, Oliveira.


    Full Text Available Objetivou-se avaliar o efeito dos principais agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor), em condições de laboratório, por tratar-se de um fitoseídeo com grande potencialidade para ser utilizado no controle dos ácaros fitófagos na cultura. O método de bioensaio adotado [...] foi o de contato direto e residual. Folhas de citros da variedade Pêra, contendo 25 fêmeas adultas de N. californicus procedentes de uma criação-estoque, foram pulverizadas em torre de Potter. Avaliaram-se a mortalidade do ácaro 72 horas após a aplicação e o efeito dos produtos na viabilidade dos ovos. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico e Integrado de Plantas e Animais Nocivos" (IOBC), os produtos foram classificados como: classe 1 inócuo (E99%), clorfenapyr, dicofol e pyridaben. N. californicus mostrou-se tolerante a diversos agrotóxicos, o que viabiliza sua utilização, juntamente com produtos químicos pertencentes a grupamentos distintos e de diferentes mecanismos de ação, o que atende a um manejo adequado de controle dos principais ácaros fitófagos da cultura dos citros. Abstract in english This work was carried out to determine the residual toxicity of the main pesticides used in citrus, on Neoseiulus californicus (McGregor) under laboratory conditions. For this, it was used the residual contact bioassay. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The residual [...] action was evaluated at 2 hours and 1; 3; 5; 7; 10; 14 e 21 days after treatment. Ten adult females of N. californicus were transferred to each ring, together with an enough amount of Tetranychus urticae nymphs and adults to feed the predator. Mortality evaluations were performed at 72 hours after treatment. Bioassays indicate that the pesticides: acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite were innocuous to N. californicus. On the other hand, abamectin, azocyclotin e cyhexatin caused mortalities of 29.8; 32.0 e 34.1%, respectively, two hours after transference. Dicofol, pyridaben and chlorfenapyr were extremely toxic to the predator mite, causing 100% of mortality two hours after the application. This way, to this population of N. californicus, the releases can be performed safely 3 days after the application, except for cyhexatin (5 days), dicofol and pyridaben (14 days) and chlorfenapyr (21 days), without risk of significant adult mortality rates due to the application of pesticides.

  19. Effect of plant diversification on abundance of South American tomato pinworm and predators in two cropping systems Efeito da diversificação de plantas na abundância da traça-do-tomateiro e predadores em dois sistemas de cultivo


    Maria A de Medeiros; Sujii, Edison R.; Helena C Morais


    Several studies have demonstrated that the diversification of the agroecosystem may reduce insect pest infestation using the strategy of companion planting. We studied the effect of the presence of coriander and Gallant soldier as companion plants in the tomato crop under organic and conventional management on abundance of the tomato pests and predators. The experiment was carried out under field conditions, at Distrito Federal, Brazil, from July to October, 2004. The experimental design was ...

  20. ClEST cluster :Cl_contig0419 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...

  1. NUEVOS REGISTROS DE CANGREJOS DEL GÉNERO PALICUS (PHILIPPI, 1838)(CRUSTACEA: DECAPODA: BRACHYURA: PALICIDAE) PARA EL MAR CARIBE COLOMBIANO / New records of the crabs of the genus Palicus (Philippi, 1838) (Crustacea: Decapoda: Brachyura: Palicidae) from the Caribbean coast of Colombia

    Scientific Electronic Library Online (English)

    Adriana, Bermúdez; Norella, Cruz; Gabriel R, Navas S; Hernando, Campos.


    Full Text Available Se amplía el ámbito geográfico para Palicus floridanus y se registran por primera vez cinco especies de la familia Palicidae colectadas en el mar Caribe colombiano durante el crucero INVEMAR-Macrofauna I, entre 1998 y 1999, a lo largo de la franja superior del talud continental (300 y 500 m de profu [...] ndidad). Con las de este trabajo, en el área se han reportado seis especies: P. alternatus Rathbun, 1897; P. cursor A. Milne-Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, y P. sicus A. Milne-Edwards, 1880. En la costa caribe colombiana el único registro previo para la familia era P. alternatus. Abstract in english A new range extension of Palicus floridanus and five new records of Palicidae are presented, the samples are collected from the Colombian Caribbean coast during the cruise of INVEMAR-Macrofauna I between 1998 and 1999, along the upper continental Slope (300 and 500 m deep). Six species have now been [...] recorded from the area: P. alternatus Rathbun, 1897; P. cursor A. Milne- Edwards, 1880; P. floridanus Rathbun, 1918; P. gracilipes A. Milne-Edwards, 1880; P. gracilis Smith, 1883, and P. sicus A. Milne-Edwards, 1880. Previously, P. alternatus was the only member of the family reported for this area before this study.

  2. O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)


    Rodrigo Damasco Daud; Reinaldo José Fazzio Feres


    No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para comparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém colet...

  3. Identification of plant families associated with the predators Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) and Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) using pollen grain as a natural marker Identificação de famílias de plantas associadas aos predadores Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) e Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) usando o pólen como marcador natural


    MA. Medeiros; PA Ribeiro; HC. Morais; Castelo Branco, M.; ER Sujii; ML. Salgado-Laboriau


    The predators Hippodamia convergens Guérin-Menéville (Coleoptera: Coccinelidae) and Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae), are frequently observed on vegetable crops, especially on tomato plants, as well as on flowers of several plants around crop fields. It is well known that when predators feed on pollen and nectar they can increase their longevity and reproductive capacity. The objective of this work was to identify plants that could be a pollen source for H. convergens a...

  4. Morfologia dos imaturos e do adulto de Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae, predador de cochonilhas-de-carapaça (Hemiptera, Diaspididae de citros Morphology of immatures and adult of Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae, predator of citrus armored scales (Hemiptera, Diaspididae

    Directory of Open Access Journals (Sweden)

    Ricardo Adaime da Silva


    Full Text Available Imaturos e adultos de Coccidophilus citricola Brèthes, 1905 são descritos e ilustrados com auxílio de microscopia eletrônica de varredura. A larva é comparada com as de Microweisea Cockerel e outras espécies de Coccinellidae, e o adulto com duas espécies norte-americanas de Coccidophilus Brèthes.Immatures and adults of Coccidophilus citricola Brèthes, 1905 are described and illustrated, using scanning electron microscopy. The larva is compared to those of Microweisea Cockerel and other species of Coccinellidae, and the adults with two North American species of the Genus Coccidophilus Brèthes.

  5. Ocorrência de moscas brancas (Hemiptera: Aleyrodidae) e do predador Delphastus pusillus (LeConte) (Coleoptera: Coccinellidae) em mamoeiro (Carica papaya L.) sob cultivo em ambiente protegido / Whiteflies (Hemiptera: Aleyrodidae) and the predator Delphastus pusillus (Le Conte) (Coleoptera: Coccinellidae) on papaya tree (Carica papaya L.) grown under screened conditions

    Scientific Electronic Library Online (English)

    Marineide R., Vieira; Luiz S., Correa.


    Full Text Available Em fevereiro e outubro de 1998, na área experimental da Fazenda de Ensino e Pesquisa da UNESP no município de Selvíria-MS (latitude 20° 22' S, longitude 51° 22' W, altitude 335 m), foi constatada a presença de mosca branca em mamoeiro cultivar Baixinho de Santa Amália, plantado no interior de um tel [...] ado com malha de 2 x 2 mm. Essa área fazia parte de um experimento visando determinar o efeito do cultivo em ambiente protegido sobre o desenvolvimento das plantas, a produção de frutos e a ocorrência do mosaico do mamoeiro. Nas duas ocasiões os insetos foram enviados ao Centro de Recursos Genéticos e Biotecnologia (CENARGEN) da EMBRAPA para identificação. Na primeira infestação o material foi identificado como Trialeurodes sp. e na infestação de outubro como Bemisia tabaci biótipo B . Nos dois casos havia grande quantidade de ninfas nas folhas maduras e de adultos nas folhas novas. Para Trialeurodes sp. foi realizada uma contagem de ninfas em dezoito folhas, em cinco áreas de 1 cm² por folha, distribuídas ao acaso, encontrando-se a média de 7,6 ninfas por cm². Como conseqüência da presença das duas espécies, o único dano observado foi um intenso desenvolvimento de fumagina recobrindo completamente a superfície das folhas, que acabaram por secar e cair. A infestação de B. tabaci biótipo B foi controlada pela presença de larvas e adultos do coccinelídeo Delphastus pusillus (LeConte) que alimentavam-se vorazmente das ninfas presentes. Abstract in english We report the presence of whitefly species at the Experimental Farm of UNESP, located in Selvíria, state of Mato Grosso do Sul, Brazil ( 20°22' latitude S, 51°22' longitude W, altitude 335 m), in February and October 1998. These insects were found on papaya trees cultivar Baixinho de Santa Amália, g [...] rown under screened conditions (2 mm x 2 mm mash). The goal of the original experiment was to determine the effect of growing the cultivar under a protected environment on the development of the trees, fruit production and incidence of the "papaya ringspot virus". Whitefly specimens were sent to the Center of Genetic Resources and Biotechnology (CENARGEN) of EMBRAPA, for identification. The specimens collected in February were identified as Trialeurodes sp. and those collected in October were recognized as Bemisia tabaci biotype B. In both ocasions there were great numbers of nymphs on mature leaves and of adults on young leaves. We counted the number of Trialeurodes nymphs in eighteen leaves, in five areas of 1 cm² per leaf, distributed at random, where we found an average of 7.6 nymphs/cm². The only damage associated with the presence of whitefly of both species was the intense development of `sooty molds', covering completely the leaves, which wilted and fell. The infestation of B. tabaci biotype B was controlled by larvae and adults of the coccinellid Delphastus pusillus (LeConte), which fed avidly on the whitefly nymphs.

  6. Morfologia dos imaturos e do adulto de Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predador de cochonilhas-de-carapaça (Hemiptera, Diaspididae) de citros / Morphology of immatures and adult of Coccidophilus citricola Brèthes (Coleoptera, Coccinellidae, Sticholotidinae), predator of citrus armored scales (Hemiptera, Diaspididae)

    Scientific Electronic Library Online (English)

    Ricardo Adaime da, Silva; Lúcia Massutti de, Almeida; Antonio Carlos, Busoli.


    Full Text Available Imaturos e adultos de Coccidophilus citricola Brèthes, 1905 são descritos e ilustrados com auxílio de microscopia eletrônica de varredura. A larva é comparada com as de Microweisea Cockerel e outras espécies de Coccinellidae, e o adulto com duas espécies norte-americanas de Coccidophilus Brèthes. [...] Abstract in english Immatures and adults of Coccidophilus citricola Brèthes, 1905 are described and illustrated, using scanning electron microscopy. The larva is compared to those of Microweisea Cockerel and other species of Coccinellidae, and the adults with two North American species of the Genus Coccidophilus Brèthe [...] s.

  7. El uso de otolitos y huesos de la cabeza para la identificación de dos especies del género Merluccius, en estudios de predador-presa / The use of otoliths and bones of the head for the identification of two species of the genus Merluccius, in studies of prey-predator

    Scientific Electronic Library Online (English)

    Sergio Matías, Delpiani; Mariano, González-Castro; Juan Martín, Díaz de Astarloa.


    Full Text Available [...] Abstract in english A comparative osteological analysis of 6 bones and the sagitta otolith in Merluccius hubbsi and M. australis, two species that live in Southwest Atlantic, has been carried out. The objective was to contribute to identifying these two species as prey in the diet studies, and further description of th [...] ese bony elements for a better taxonomic identification. Fresh bones disarticulation techniques were used. Potentially diagnostic features were observed for discrimination of species in the following elements: urohyal, maxilla, premaxilla, dentary, quadrate, hyomandibular, and the sagitta otolith.

  8. O valor de Mabea fistulifera Mart. (Euphorbiaceae), planta nativa do Brasil, como reservatório para o predador Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae) / The value of Mabea fistulifera Mart. (Euphorbiaceae), indigenous plant from Brazil, as reservoir for the predator Euseius citrifolius Denmark & Muma (Acari, Phytoseiidae)

    Scientific Electronic Library Online (English)

    Rodrigo Damasco, Daud; Reinaldo José Fazzio, Feres.


    Full Text Available No presente trabalho foi estudada a utilização do pólen de Mabea fistulifera Mart. como alimento para Euseius citrifolius Denmark & Muma, 1970. O experimento foi conduzido em BOD a 25 ± 1°C, 60 ± 10% UR e 12 h de fotofase. Pólen de Typha angustifolia L. e Ricinus communis L. foram utilizados para co [...] mparação, por serem considerados alimentos favoráveis para manutenção dessa espécie. Cada alimento foi avaliado em três períodos de estocagem a 10ºC: recém coletados a 11 dias (Pólen I); de 15 a 26 dias (Pólen II) e de 30 a 41 dias (Pólen III). A eficiência de cada alimento foi baseada na taxa média de oviposição de 11 dias consecutivos. Para cada tratamento foram utilizadas cinco fêmeas sobre uma arena feita com folha de limoeiro, sendo replicado 10 vezes. As taxas média de oviposição de cada tratamento foram comparadas através da ANOVA, complementada com o teste de Bonferroni. O índice de correlação de Pearson foi utilizado para relacionar a taxa de oviposição com o período de estocagem. Houve diferenças significativas entre alguns tratamentos (F = 4,78, df = 89, p Abstract in english In this paper, pollen of Mabea fistulifera Mart. was evaluated as food for Euseius citrifolius Denmark & Muma, 1970. The mites were kept in a rearing chamber at 25 ± 1°C, 60 ± 10% UR e 12 h of photophase. Pollen of Typha angustifolia L. and Ricinus communis L. were used for comparison, because of th [...] eir known suitability to this predator. The suitability of those three types of pollen was evaluated when they were stored for different periods at 10ºC: newly collected to 11 days old (Pollen I); from 15 to 26 days old (Pollen II) and from 30 to 41 days old (Pollen III). The suitability of each kind of food was determined based on the oviposition rate at 11 consecutive days. Each experimental plot consisted of five females in an arena made of lemon leaf; treatments were replicated 10 times. Oviposition rate for treatments were compared using ANOVA, and Bonferroni's test. Pearson's correlation index was used to compare oviposition rates at different periods of store of pollen. There were significant differences (F = 4.78; df = 89, p

  9. Avaliação de substratos de oviposição para Orius insidiosus (Say) (Hemiptera, Anthocoridae) Evaluation of oviposition substrates for Orius insidiosus (Say) (Hemiptera, Anthocoridae)


    Lívia M. Carvalho; Vanda H.P. Bueno; Cristina Castañé


    Avaliação de substratos de oviposição para Orius insidiosus (Say) (Hemiptera, Anthocoridae). Fêmeas do predador O. insidiosus usam tecidos de plantas para colocação de seus ovos, o que caracteriza a oviposição endofítica. Este trabalho teve por objetivo avaliar diferentes substratos de oviposição para este predador. O estudo foi conduzido em sala climatizada a 25 ± 2ºC, UR de 70 ± 10% e fotofase de 12 horas. Os substratos de oviposição utilizados foram brotos de feijão (Phaselus...


    Directory of Open Access Journals (Sweden)



    Full Text Available En el presente artículo de investigación se demuestra que los modelos degenerados del tipo dos predadores compitiendo por una presa que se regenera los cuales son modelados por un sistema tridimensional no lineal de ecuaciones diferenciales y que satisfacen las condiciones planteadas por Butter-Farkas: los puntos de bifurcación que definen la existencia de la bifurcación Zip coinciden aún en el caso en que la respuesta funcional de los predadores son diferentes.

  11. Density and habitat requirements of sympatric hares and cottontails in northern Italy


    Anna Vidus Rosin; Alessandro Montagna; Alberto Meriggi; Sara Serrano Perez


    Abstract From 2005 to 2009, densities and habitat selection by the European hare (Lepus europaeus) and Eastern cottontail (Sylvilagus floridanus) were assessed during feeding activity in an intensively cultivated area in northern Italy. Hare average density (74 ind./km2) was comparable to the highest values reported for European farming areas. Preand post-breeding density fluctuated widely across the...

  12. Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

    Directory of Open Access Journals (Sweden)

    Wernegreen Jennifer J


    Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

  13. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A.


    Hamer Sarah A; Hickling Graham J; Keith Rich; Sidge Jennifer L; Walker Edward D; Tsao Jean I


    Abstract Background Wild birds contribute to maintenance and dissemination of vectors and microbes, including those that impact human, domestic animal, and wildlife health. Here we elucidate roles of wild passerine birds, eastern cottontail rabbits (Sylvilagus floridanus), and Ixodes dentatus ticks in enzootic cycles of two spirochetes, Borrelia miyamotoi and B. andersonii in a region of Michigan where the zoonotic pathogen B. burgdorferi co-circulates. Methods Over a four-year period, wild b...

  14. Structural Changes of Oil Palm Empty Fruit Bunch (OPEFB) after Fungal and Phosphoric Acid Pretreatment


    Taherzadeh, Mohammad J; Muhammad N. Cahyanto; Claes Niklasson,; Ria Millati; Siti Syamsiah; Mofoluwake M. Ishola; Isroi


    Oil palm empty fruit bunch (OPEFB) was pretreated using white-rot fungus Pleurotus floridanus, phosphoric acid or their combination, and the results were evaluated based on the biomass components, and its structural and morphological changes. The carbohydrate losses after fungal, phosphoric acid, and fungal followed by phosphoric acid pretreatments were 7.89%, 35.65%, and 33.77%, respectively. The pretreatments changed the hydrogen bonds of cellulose and linkages between lignin and carbohydra...

  15. Anisaldehyde production and aryl-alcohol oxidase and dehydrogenase activities in ligninolytic fungi of the genus Pleurotus.


    Gutie?rrez, A.; Caramelo, L.; Prieto, A.; Marti?nez, M. J.; Marti?nez, A. T.


    A variety of simple aromatic compounds were identified in liquid cultures of the basidiomycetes Pleurotus cornucopiae, P. eryngii, P. floridanus, P. pulmonarius, P. ostreatus, and P. sajor-caju by using gas chromatography-mass spectrometry. Such compounds were detected in fungal cultures on lignin- and straw-containing media, but it was found that they were also produced in the absence of aromatic precursors. Anisylic and hydroxybenzylic compounds (such as alcohols, aldehydes, and acids) were...



    Magnarelli, Louis A.; Norris, Steven J.; Fikrig, Erol


    Archived serum samples, from 95 eastern cottontail rabbits (Sylvilagus floridanus) captured in New York, New York, USA and Millbrook, New York, USA, during 1985–86, were analyzed in solid-phase enzyme-linked immunosorbent assays (ELISA) for total and class-specific immunoglobulin (Ig) M antibodies to whole-cell or recombinant antigens of Borrelia burgdorferi sensu stricto. Using a polyvalent conjugate, rabbit sera contained antibodies to whole-cell and recombinant antigens (protein [p]35, p...

  17. Circumvention of prey defense by a predator: ant lion vs. ant.


    T. Eisner; Baldwin, I.T.; Conner, J.


    The pit-dwelling ant lion Myrmeleon carolinus, although topically sensitive to formic acid, is able to prey on formic acid-spraying ants (Camponotus floridanus). It kills the ants without inducing them to spray, and it sucks out the ant's body contents without puncturing the acid sac. Ordinarily, when Camponotus is attacked it retaliates by simultaneously biting and spraying, but it usually refrains from spraying until it has secured a grip with the mandibles. When Myrmeleon pulls Camponotus ...

  18. Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae

    Directory of Open Access Journals (Sweden)

    Walkymário Paulo Lemos


    Full Text Available Attack behavior of the predator Podisus rostralis (Stäl (Heteroptera: Pentatomidae adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack behavior: (1 Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2 Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl (Heteroptera: Pentatomidae tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae. Dez adultos do predador, com 24 horas de idade, foram observados durante duas horas acompanhando-se os seguintes comportamentos de ataque: (1 Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2 Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas.

  19. Attack behavior of Podisus rostralis (Heteroptera: Pentatomidade) adults on caterpillars of Bombyx mori (Lepidoptera: Bombycidae)

    Scientific Electronic Library Online (English)

    Walkymário Paulo, Lemos; José Cola, Zanuncio; José Eduardo, Serrão.


    Full Text Available Estudou-se, em laboratório, o comportamento de ataque de adultos do predador Podisus rostralis (Stäl) (Heteroptera: Pentatomidae) tendo como presa lagartas de quarto estádio de Bombyx mori L. (Lepidoptera: Bombycidae). Dez adultos do predador, com 24 horas de idade, foram observados durante duas hor [...] as acompanhando-se os seguintes comportamentos de ataque: (1) Predador: localização da presa; observação da presa; toque das presas com as antenas; comportamento de ataque; paralisação da presa; fuga do predador após ataque; finalização do ataque; ataques sucessivos; e (2) Presa: defesa. O predador P. rostralis localizou sua presa antes do ataque, aproximando-se dela através de lentos movimentos circulares. O ataque é, usualmente, realizado na parte posterior da presa para reduzir reação de defesa. O maior tamanho da presa em relação ao predador pode dificultar a paralisação, porém o predador consegue paralisá-la em menos de duas horas. Abstract in english Attack behavior of the predator Podisus rostralis (Stäl) (Heteroptera: Pentatomidae) adults on fourth instar Bombyx mori L. (Lepidoptera: Bombycidae) caterpillars was studied in laboratory conditions. Ten 24 hours old adults of this predator were observed during two hours with the following attack b [...] ehavior: (1) Predator: prey finding; prey observation; touching prey with antenna; attack behavior; prey paralysis; predator retreat after attack; attack cessation; successive attacks; and (2) Prey: defense. The predator P. rostralis found its prey before attacking and it approached it with slow circular movements. The attack was usually made in the posterior part of the prey to reduce defense reaction. Larger size of prey in relation to the predator resulted difficult prey paralysis but it occurred in less than two hours.


    Directory of Open Access Journals (Sweden)

    José H. Pedrosa-Macedo


    Full Text Available Com o objetivo de verificar a distribuição, independente do efeito de cada componente, contou-se posturas, larvas sadias, predadas ou parasitadas de Oncideres impluviata em galhos de bracatinga (Mimosa scabrella Benth.. O levantamento foi realizado no período de 1984/85, em Almirante Tamandaré, Paraná. Para o estudo da distribuição das larvas e de imimigos naturais foi medida a distância da base do galho até o ponto onde se encontrava cada larva sadia ou parasitada, galeria vazia ou predador. Os resultados demostraram que as larvas se concentram a partir dos 10,0 cm do ponto base do galho, estendendo-se até 40,0 cm, com uma concentração máxima entre 10,0 e 20,0 cm. Os predadores e parasitas apresentam uma concentração não coincidente, sendo que os parasitas concentram-se entre 20, e 30,0 cm e os predadores entre 10,0 e 20,0 cm a partir da base. Pelos resultados obtidos conclui-se que as larvas se estabelecem numa posição onde encontram as melhores condições de sobrevivência, ao passo que os parasitas e predadores estão na depend~encia das condições intrinsecas de cada espécie em função das condições ideais da fase de desenvolvimento dos hospedeiros ou presas.

  1. Distribuição das posturas, de larvas e de inimigos naturais de Oncideres impluviata (Germar, 1824 (Col.: Cerambycidae.

    Directory of Open Access Journals (Sweden)

    Ervandil Corrêa Costa


    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 Com o objetivo de verificar a distribuição, independente do efeito de cada componente, contou-se posturas, larvas sadias, predadas ou parasitadas de Oncideres impluviata em galhos de bracatinga (Mimosa scabrella Benth.. O levantamento foi realizado no período de 1984/85, em Almirante Tamandaré – Paraná. Para o estudo da distribuição das larvas e de inimigos naturais foi medida a distância da base do galho até o ponto onde se encontrava cada larva sadia ou parasitada, galeria vazia ou predador. Os resultados demonstraram que as larvas se concentram a partir dos 10,0 cm do ponto base do galho, estendendo-se até 40,0 cm, com uma concentração máxima entre 10,0 e 20,0 cm. Os predadores e parasitas apresentam uma concentração não coincidente, sendo que os parasitas concentram-se entre 20,0 e 30,0 cm e os predadores entre 10,0 e 20,0 cm a partir da base. Pelos resultados obtidos conclui-se que as larvas se estabelecem numa posição onde encontram as melhores condições de sobrevivência, ao passo que os parasitas e predadores estão na dependência das condições intrínsecas de cada espécie em função das condições ideais da fase de desenvolvimento dos hospedeiros ou presa.

  2. Nestmate recognition in ants is possible without tactile interaction (United States)

    Brandstaetter, Andreas Simon; Endler, Annett; Kleineidam, Christoph Johannes


    Ants of the genus Camponotus are able to discriminate recognition cues of colony members (nestmates) from recognition cues of workers of a different colony (non-nestmates) from a distance of 1 cm. Free moving, individual Camponotus floridanus workers encountered differently treated dummies on a T-bar and their behavior was recorded. Aggressive behavior was scored as mandibular threat towards dummies. Dummies were treated with hexane extracts of postpharyngeal glands (PPGs) from nestmates or non-nestmates which contain long-chain hydrocarbons in ratios comparable to what is found on the cuticle. The cuticular hydrocarbon profile bears cues which are essential for nestmate recognition. Although workers were prevented from antennating the dummies, they showed significantly less aggressive behavior towards dummies treated with nestmate PPG extracts than towards dummies treated with non-nestmate PPG extracts. In an additional experiment, we show that cis-9-tricosene, an alkene naturally not found in C. floridanus’ cuticular profile, is behaviorally active and can interfere with nestmate recognition when presented together with a nestmate PPG extract. Our study demonstrates for the first time that the complex multi-component recognition cues can be perceived and discriminated by ants at close range. We conclude that contact chemosensilla are not crucial for nestmate recognition since tactile interaction is not necessary.

  3. Influence of customized cooking methods on the phenolic contents and antioxidant activities of selected species of oyster mushrooms (Pleurotus spp.). (United States)

    Tan, Yee-Shin; Baskaran, Asweni; Nallathamby, Neeranjini; Chua, Kek-Heng; Kuppusamy, Umah Rani; Sabaratnam, Vikineswary


    Nutritional value of cooked food has been considered to be lower compared to the fresh produce. However, many reports showed that processed fruits and vegetables including mushrooms may retain antioxidant activity. Pleurotus spp. as one of the edible mushroom are in great demand globally and become one of the most popular mushrooms grown worldwide with 25-fold increase in production from 1960-2009. The effects of three different cooking methods (boiling, microwave and pressure cooking) on the antioxidant activities of six different types of oyster mushrooms (Pleurotus eryngii, P citrinopileatus, P. cystidiosus P. flabellatus, P. floridanus and P. pulmonarius) were assessed. Free radical scavenging (DPPH) and reducing power (TEAC) were used to evaluate the antioxidant activities and the total phenolic contents were determined by Folin-Ciocalteu reagent. Pressure cooking improved the scavenging abilities of P. floridanus (>200 %), P. flabellatus (117.6 %), and P. pulmonarius (49.1 %) compared to the uncooked samples. On the other hand, the microwaved Pleurotus eryngii showed 17 % higher in the TEAC value when compared to the uncooked sample. There was, however, no correlation between total phenolic content and antioxidant activities. There could be presence of other bioactive components in the processed mushrooms that may have contributed to the antioxidant activity. These results suggested that customized cooking method can be used to enhance the nutritional value of mushrooms and promote good health. PMID:25892809

  4. On the relation amongst limnological factors and fish abundance in reservoirs at semiarid region / Relação entre características limnológicas e abundância de peixes em reservatórios da região semiárida

    Scientific Electronic Library Online (English)

    Ronaldo César, Gurgel-Lourenço; Carlos Alberto de Sousa, Rodrigues-Filho; Ronaldo, Angelini; Danielle Sequeira, Garcez; Jorge Iván, Sánchez-Botero.


    Full Text Available Objetivo: Avaliar os possíveis padrões temporais nictemerais e sazonais na assembleia íctica em relação a aspectos limnológicos e fatores bióticos em dois reservatórios no semiárido Nordeste do Brasil. Métodos Peixes foram amostrados com redes de espera em ciclos nictemerais nos períodos seco e chu [...] voso em dois reservatórios (Paulo Sarasate /PS e Edson Queiroz /EQ). O conteúdo estomacal das espécies predadoras foi avaliado. As variáveis limnológicas foram submetidas a uma PCA, enquanto suas relações com a abundância de peixes foi determinada por uma CCA. Padrões temporais relativos à abundância de espécies de peixes foram detectados com nMDS. Resultados Temperatura e oxigênio dissolvido segregaram fisico-quimicamente os reservatórios. Níveis de turbidez e clorofila-a diferiram entre os períodos do ano, e a abundância relativa das espécies diferiram entre os reservatórios. Predadores foram mais abundantes no PS, enquanto detritívoros foram mais abundantes no EQ. Triportheus signatus e Plagioscion squamosissimus foram as espécies mais abundantes em ambos os reservatórios. No geral, a abundância de predadores foi positivamente relacionada com altas temperaturas e oxigênio dissolvido (PS>EQ) e negativamente associada com turbidez. Os padrões de atividades de P. squamosissimus não podem ser explicados por flutuações nas variáveis ambientais. Espécies não predadoras tenderam a se agruparem aos vetores clorofila-a, pH e turbidez. Predadores apresentaram dieta mais diversificada no PS de acordo com a disponibilidade de alimento, enquanto predadores no EQ consumiram somente peixe e camarão. Padrões nictemerais variaram para algumas espécies dependendo do reservatório. Em geral, no PS predadores foram mais ativos durante as horas iluminadas do dia, enquanto não predadores foram mais ativos após o escurecer. Entretanto, no EQ predadores e não predadores mostraram padrões nictemerais de atividades similares. Independentemente do reservatório, predadores foram mais abundantes no período chuvoso. Nenhuma tendência sazonal foi observada para espécies não predadoras. Conclusões Diferenças limnológicas entre PS e EQ influenciaram padrões temporais na abundância das espécies. Abstract in english Aim: To evaluate possible nycthemeral and seasonal temporal patterns in fish assemblage associated with limnological aspects and biotic factors in two reservoirs in semarid Northeastern Brazil. Methods Fish were sampled with gillnets in nycthemeral cycles throughout the dry and rainy season in two [...] reservoirs (Paulo Sarasate/PS and Edson Queiroz/EQ). The stomach contents of the predator species were surveyed. The limnological variables were submitted to principal components analysis, while their relation to fish abundance was determined by canonical correspondence analysis. Temporal patterns in relative fish species abundance were detected with nMDS. Results Temperature and dissolved oxygen levels segregated the reservoirs physico-chemically. Turbidity and chlorophyll-a levels differed between seasons, and the relative abundance of species differed between the reservoirs. Predators were more abundant in PS, while detritivores were more abundant in EQ. Triportheus signatus and Plagioscion squamosissimus were the most abundant species in both reservoirs. In general, predator abundance was positively associated with high temperature and dissolved oxygen (PS>EQ) and negatively associated with turbidity. The activity patterns of P. squamosissimus could not be explained by fluctuations in environmental variables. Non-predators tended to cluster around the vectors chlorophyll-a, pH and turbidity. Predators had a more diversified diet in PS in accordance with food availability, while predators in EQ ate only fish and shrimp. Nycthemeral patterns varied for the same species depending on the reservoir. Generally, in PS predators were more active during daylight hours while non-predators were more active after dark. However, in EQ predators and non-predators displayed

  5. Zoophytophagy in predatory Hemiptera

    Directory of Open Access Journals (Sweden)

    Jorge Braz Torres


    Full Text Available Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variability in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase and herbivores taking prey (peptidase.Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sobre enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase e percevejos fitófagos alimentarem de presas (peptidase.

  6. Avaliação de risco e plasticidade comportamental limitada em girinos de Rhinella ornata (Anura, Bufonidae) / Assessment risk and limited behavioral plasticity in tadpoles of Rhinella ornata (Anura, Bufonidae)

    Scientific Electronic Library Online (English)

    Renan N., Costa; Fausto, Nomura.


    Full Text Available Os girinos de anuros são elementos importantes das redes tróficas de ambientes aquáticos, sendo recurso alimentar de diversos tipos de predadores. Desta maneira, os girinos apresentam uma grande variedade de mecanismos de defesa que podem ser morfológicos, comportamentais e/ou fisiológicos. A impala [...] tabilidade, produzida pelo acúmulo de substâncias tóxicas na pele, é um mecanismo comum em muitas linhagens de anfíbios. No entanto, alguns predadores não são afetados por estas substâncias tóxicas, o que pode favorecer o desenvolvimento de mecanismos alternativos de defesa contra predação. Neste contexto, nosso objetivo foi avaliar se girinos impalatáveis de Rhinella ornata (Spix, 1824), podem apresentar mecanismos comportamentais de defesa contra predação na presença de predadores que não são afetados pelas substâncias tóxicas em sua pele. Para testar nossa hipótese, utilizamos dois tipos de predadores aquáticos: um heteróptero aquático do gênero Belostoma e uma larva de libélula do gênero Aeshna. Os girinos foram colocados em aquários com pistas visuais e químicas dos predadores (experimento de risco direto), somente pistas químicas (experimento de risco indireto) e ausência completa de sinais de predadores (controle). Em ambos os casos, o comportamento de natação foi observado durante 5 minutos. Durante os experimentos não houve alteração no comportamento de natação dos girinos. Abstract in english Anuran tadpoles are important elements of trophic networks in aquatic environments, being food resource for many types of predators. Thus, the tadpoles exhibit a great variety of defense mechanisms that may be morphological, behavioral and/or physiological. The unpalatability, produced by the accumu [...] lation of toxic substances in the skin, is a common mechanism in many frog lineages. However, some predators are not affected by these toxic substances, which may favor the development of alternative mechanisms of defense against predation. In this context, our objective was evaluate if the unpalatable tadpoles of Rhinella ornata (Spix, 1824) may present behavioral mechanisms of defense against predation in the presence of predators that are not affected by toxic substances on its skin. To test our hypothesis, we used two kinds of predators: an aquatic Heteroptera of the genus Belostoma and a dragonfly larva of the genus Aeshna. The tadpoles were located in aquariums with visual and chemical clues of predators (direct risk experiment), only chemical clues (indirect risk experiment) and by the complete absence of predator signals (control). In both cases, the swimming behavior was observed for 5 minutes. During the experiments there was no alteration in swimming behavior of tadpoles.

  7. Zoophytophagy in predatory Hemiptera

    Scientific Electronic Library Online (English)

    Jorge Braz, Torres; David W., Boyd.


    Full Text Available Percevejos predadores alimentando em diferentes níveis tróficos tem despertado o interesse para o entendimento da ecologia e papéis exercido no controle biológico por esses predadores. Os parâmetros que governam o comportamento alimentar onívoro desses predadores tem sido auxiliado pelos estudos sob [...] re enzimas de glândula salivares. A variabilidade de enzimas em percevejos predadores tem sido sugerido como adaptação básica para a convergência ou divergência para a onivoria. Assim, enzimas salivares de percevejos predadores tem fornecido entendimento, ao menos parcial, da alternância de alimentação entre plantas e animais. Neste estudo, foi utilizado a presença de enzimas como variáveis canônicas para atribuir a cada espécie estudada predominância do comportamento alimentar baseado na combinação das enzimas salivares secretadas. A enzima pectinase tem sido específica para espécies fitófagas, portanto, sendo considerada variável de separação e, fosfolipase e tripisina como indicadoras de adaptações para predação, enquanto amilase e peptidase como indicativo para onivoria pois são encontradas tanto em espécies fitófagas e predadoras. Assim, sendo essas usadas como explicação para adaptação em percevejos predadores alimentarem de plantas (amilase) e percevejos fitófagos alimentarem de presas (peptidase). Abstract in english Predaceous hemipteran feeding on different trophic levels have raised questions about their ecology and role in biological control. Therefore, specific adaptations allowing them to simultaneously use plants and animals as sources for their nutritional requirements are important. Enzymatic variabilit [...] y in predatory hemipterans has been suggested as the basic adaptation for convergent or divergent to omnivory. Thus, the salivary enzymatic complexes of predatory hemipterans have been furnished a partial understanding of the mechanisms permitting switching between plant and animal food sources. In this study, a discriminatory analysis was performed to attribute trophic habits to each insect investigated based on the presence and absence of salivary enzyme combinations. Although peptidase is found in all tested predatory hemipterans' salivary glands, it is not a distinguishing enzyme because it has been found in phytophagous species as well. However, the presence of peptidase and amylase activity in hemipteran salivary glands is considered to be an explanation for these insects' ability to switch their diet, predators feeding on plants (amylase) and herbivores taking prey (peptidase).

  8. Nutritional upgrading for omnivorous carpenter ants by the endosymbiont Blochmannia

    Directory of Open Access Journals (Sweden)

    Mueller Martin J


    Full Text Available Abstract Background Carpenter ants (genus Camponotus are considered to be omnivores. Nonetheless, the genome sequence of Blochmannia floridanus, the obligate intracellular endosymbiont of Camponotus floridanus, suggests a function in nutritional upgrading of host resources by the bacterium. Thus, the strongly reduced genome of the endosymbiont retains genes for all subunits of a functional urease, as well as those for biosynthetic pathways for all but one (arginine of the amino acids essential to the host. Results Nutritional upgrading by Blochmannia was tested in 90-day feeding experiments with brood-raising in worker-groups on chemically defined diets with and without essential amino acids and treated or not with antibiotics. Control groups were fed with cockroaches, honey water and Bhatkar agar. Worker-groups were provided with brood collected from the queenright mother-colonies (45 eggs and 45 first instar larvae each. Brood production did not differ significantly between groups of symbiotic workers on diets with and without essential amino acids. However, aposymbiotic worker groups raised significantly less brood on a diet lacking essential amino acids. Reduced brood production by aposymbiotic workers was compensated when those groups were provided with essential amino acids in their diet. Decrease of endosymbionts due to treatment with antibiotic was monitored by qRT-PCR and FISH after the 90-day experimental period. Urease function was confirmed by feeding experiments using 15N-labelled urea. GC-MS analysis of 15N-enrichment of free amino acids in workers revealed significant labelling of the non-essential amino acids alanine, glycine, aspartic acid, and glutamic acid, as well as of the essential amino acids methionine and phenylalanine. Conclusion Our results show that endosymbiotic Blochmannia nutritionally upgrade the diet of C. floridanus hosts to provide essential amino acids, and that it may also play a role in nitrogen recycling via its functional urease. Blochmannia may confer a significant fitness advantage via nutritional upgrading by enhancing competitive ability of Camponotus with other ant species lacking such an endosymbiont. Domestication of the endosymbiont may have facilitated the evolutionary success of the genus Camponotus.


    Directory of Open Access Journals (Sweden)



    Full Text Available Besouros predadores da família Histeridae foram coletados através do uso de armadilhas "pitfall" iscadas com massa fecal fresca de bovinos instaladas em área de pastagem em Piracicaba, SP. Coletaram-se durante o período de 15 de abril de 1995 a 17 de fevereiro de 1996, quatro espécies identificadas como Hister punctifer, Phelister panamensis, P. haemorrhous e P. rufinotus. A espécie P. panamensis é um importante predador de ovos e larvas de Haematobia irritans e representou 72,93% do total de insetos coletados.Histeridae beetles were collected using pitfall traps baited with cattle manure, placed in a pasture area in Piracicaba, SP, Brazil. The following species were collected from April 15th 1995 to February 17th 1996.: Hister punctifer, Phelister panamensis, P. haemorrhous and P. rufinotus. The species P. panamensis, an important predator of the horn fly, Haematobia irritans, represented 72,93% of all insects collected.

  10. Interações predatórias entre Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) e Loxosceles intermedia Mello-Leitão (Araneae, Sicariidae) Predatory interactions between Pholcus phalangioides (Fuesslin) (Araneae, Pholcidae) and Loxosceles intermedia Mello-Leitão (Araneae, Sicariidae)


    Marta L. Fischer; Flávia S. Krechemer


    A co-ocorrência de Pholcus phalangioides (Fuesslin, 1775) e de Loxosceles intermedia Mello-Leitão, 1934 no intra e no peridomicílio somada à natureza araneofágica e invasora de teias de P.phalangioides sugere que ambas as espécies tenham desenvolvido algum padrão de interação interespecífica. Assim, objetivou-se caracterizar essa interação e avaliar a eficiência de P.phalangioides como predador de L.intermedia. Foram realizados cinco experimentos laboratoriais visando quantificar...

  11. Aspectos biológicos de Chrysoperla raimundoi Freitas & Penny (Neuroptera, Chrysopidae) Biological aspects of Chrysoperla raimundoi Freitas & Penny (Neuroptera, Chrysopidae)


    Taís Carmona Lavagnini; Sérgio de Freitas; Antônio Lourenço Bezerra


    Os crisopídeos são importantes predadores e são encontrados em diversos agroecossistemas. A temperatura é um dos fatores determinantes para o desenvolvimento dos insetos, sendo que existe um gradiente de variação aceitável para cada espécie. Portanto, objetivou-se com este estudo verificar a influência de diferentes temperaturas sobre o desenvolvimento embrionário e pós-embrionário de C. raimundoi assim como verificar as conseqüências nas diferentes gerações. As fases jovens f...

  12. Cost and benefits of the morphological defences in larvae of Scymnus nubilus Mulsant (Coleoptera: Coccinellidae)


    Pacheco, Paulo Alexandre Botelho


    Diferentes mecanismos de defesa contra a predação e parasitismo evoluíram entre os insectos. Estes podem ser químicos, comportamentais ou estruturais. As larvas do pequeno coccinelídeo Scymnus nubilus estão cobertas por uma camada de ceras que podem actuar como um mecanismo defensivo contra formigas e outros predadores. No entanto, o grau de protecção conferido pelas ceras às larvas de Scymnus não é bem conhecido. O objectivo deste estudo foi avaliar alguns dos custos e benefícios da produção...

  13. Seletividade de inseticidas a Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) e Cotesia sp. (Hymenoptera: Braconidae) inimigos naturais de Ascia monuste orseis (Godart, 1818) (Lepdoptera: Pieridae) Selectivity of insecticides to Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) and Cotesia sp. (Hymenoptera: Braconidae) natural enemies of Ascia monuste orseis (Godart, 1818) (Lepdoptera: Pieridae)


    Marcelo Coutitnho Picanço; Marcelo Fialho de Moura; Moacyr Mascarenhas Motta Miranda; Lessando Moreira Gontijo; Flávio Lemes Fernandes


    Este trabalho objetivou estudar a seletividade dos inseticidas carbaril, deltametrina, paratiom metílico, permetrina e triclorfom em favor do predador Doru luteipes (Scudder) (Dermaptera: Forficulidae) e do parasitóide Cotesia sp. (Hymenoptera: Braconidae), em relação ao controle do curuquerê Ascia monuste orseis (Godart) (Lepidoptera: Pieridae). Foram determinadas as CL90 para A. monuste orseis e estas foram utilizadas como doses discriminatórias para se avaliar o grau de seletividade ...

  14. Influência de tricomas glandulares de Solanum berthaultii na predação de Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) em Myzus persicae (Sulzer) (Homoptera: Aphididae) / Influence of glandular trichomes of Solanum berthaultii on the predation of Scymnus (Pullus) argentinicus (Weise) (Coleoptera: Coccinellidae) on Myzus persicae (Sulzer) (Homoptera: Aphididae)

    Scientific Electronic Library Online (English)

    Daniel C., Gamarra; Vanda H. P., Bueno; Jair C., Moraes; Alexander M., Auad.


    Full Text Available Avaliou-se a influência dos tricomas glandulares da batata Solanum berthaultii no desenvolvimento larval, mortalidade e capacidade de predação de Scymnus (Pullus) argentinicus (Weise) sobre o pulgão Myzus persicae (Sulzer). Verificou-se que o desenvolvimento larval do predador foi interrompido pela [...] alta mortalidade (89%) no 1° ínstar, provavelmente pela ação dos tricomas glandulares de S. berthaultii. Quando o predador foi liberado nos diferentes ínstares e adultos, observou-se mortalidade larval no 1°, 2° e 3° ínstares em S. berthaultii pela ação dos tricomas glandulares, sendo que o 4° ínstar e adulto não foram afetados. Em S. tuberosum não foi observada mortalidade do predador. A capacidade de predação de S. (Pullus) argentinicus foi significativamente superior na batata S. tuberosum em relação a S. berthaultii em todos os ínstares e adultos. A mortalidade de M. persicae foi superior em S. tuberosum (por predação) em relação aos valores observados em S. berthaultii (pela ação combinada do predador e tricomas glandulares). Abstract in english The effect of glandular trichomes of wild potato plant Solanum berthaultii, on larval development, survival and prey capacity of Scymnus (Pullus) argentinicus (Weise) on the aphid Myzus persicae (Sulzer) was studied. The larval development of the predator was interrupted due the high mortality (89%) [...] on the 1st instar, probably due to the action of glandular trichomes of S. berthaultii. It was observed also mortality of 1st, 2nd and 3rd instars when S. argentinicus was liberated on S. berthaultii. The 4th instar and the adult stage of the predator were not affected by the glandular trichomes. It was not observed mortality of S. argentinicus on S. tuberosum and the prey capacity of S. (Pullus) argentinicus was significantly higher on S. tuberosum when compared to S. berthaultii, in all instars and adult. The mortality of M. persicae was higher in S. tuberosum (by predation) when compared to S. berthaultii (by the combined action of predator and glandular trichomes).

  15. Distribuição do metal mercúrio em atum (Thunnus albacares) e pescada bicuda (Cynoscion microlepidotus) capturados no litoral do Rio de Janeiro, Brasil Distribution of metal mercury in tuna (Thunnus albacares) and weaker fish (Cynoscion microlepidotus) captured in Rio de Janeiro coast, Brazil


    Medeiros, R. J.; Ma?rsico, E. T.; Sa?o Clemente, S. C.; Ferreira, M. S.


    O presente estudo verificou a cinética mercurial em órgãos, tecido muscular e conteúdo estomacal de duas espécies de peixes marinhos predadores, identificando os locais de maior acumulação desse metal. Para o processo analítico, foi utilizada a técnica de espectrofotometria de absorção atômica por arraste de vapor a frio. A distribuição de Hg nas porções analisadas apresenta ampla dispersão. Para o atum, a variação foi de 0,004 µg.g-1 no fígado, nas brânquias e baço, e ...

  16. Predação de ninhos de Trachemys dorbigni (Duméril & Bibron) (Testudines, Emydidae) no extremo sul do Brasil Nest predation of Trachemys dorbigni (Duméril & Bibron) (Testudines, Emydidae) in Southern Brazil


    Gonc?alves, Fernanda A.; Cechin, Sonia Z.; Alex Bager


    Ninhos da tartaruga tigre-d'água, Trachemys dorbigni, foram monitorados durante a estação reprodutiva de 2005/2006 para avaliar as taxas de predação e a variação temporal destas; identificar as espécies predadoras, sua importância na destruição dos ninhos e determinar a influência da dispersão dos ninhos sobre a predação, no extremo sul do Brasil. Dos 58 ninhos monitorados, 98% (n = 57) foram destruídos por predadores. Eventos de predação ocorreram predominantemente nas prim...

  17. Plantas de ocorrência espontânea como substratos alternativos para fitoseídeos (Acari, Phytoseiidae) em cultivos de seringueira Hevea brasiliensis Muell. Arg. (Euphorbiaceae) Weeds as alternative substrates to phytoseiids (Acari, Phytoseiidae) in rubber tree Hevea brasilienis, Muell. Arg. (Euphorbiaceae) cultivation


    Marcos Roberto Bellini; Gilberto José de Moraes; Reinaldo José Fazzio Feres


    O objetivo deste estudo foi determinar as espécies de plantas espontâneas em áreas de cultivo de seringueira que poderiam servir com reservatório de ácaros predadores. O trabalho foi conduzido em Olímpia, Estado de São Paulo, Brasil, em dois cultivos de seringueira. A cada três meses, cerca de 1.000 cm³ de folhas de cada uma das cinco espécies de plantas espontâneas dominantes em cada cultivo foi tomada para determinar os fitoseídeos. Como as plantas espontâneas dominantes variar...

  18. Toxicidade diferencial de agrotóxicos utilizados em citros para Neoseiulus californicus, Euseius concordis e Brevipalpus phoenicis Differential toxicity of pesticides used on citrus to Neoseiulus californicus, Euseius concordis and Brevipalpus phoenicis


    Marcos Zatti da Silva; Mário Eidi Sato; Carlos Amadeu Leite de Oliveira; Débora Soller Rais


    Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) é considerada uma das principais pragas em citros no Brasil, devido à transmissão do vírus da leprose dos citros e à necessidade de frequentes aplicações de acaricidas para seu controle. Assim, objetivou-se comparar a toxicidade dos principais agrotóxicos utilizados em citros no Brasil, sobre populações de B. phoenicis e de ácaros predadores das espécies Neoseiuluscalifornicus (McGregor) e Euseius concordis (Chant) (Acari: Phytoseiidae)....

  19. Effect of temperature and prey in the biology of Scymnus subvillosus (Goeze) (Coleoptera: Coccinellidae)


    Sebastia?o, Dalila Carla Barbosa


    Scymnus subvillosus (Goeze) é um predador afidífago presente no Arquipélago dos Açores (Portugal), que ocorre em baixas densidades., recentemente, foi observado a explorar Melanaphis donacis (Passerini) em Arundo donax L. O Scymnus spp., embora menos estudadas, têm sido nos últimos anos, alvo de investigação na perspectiva da sua utilização como agentes de controlo biológico. Este estudo teve como objetivo determinar os efeitos concomitantes de quatro temperaturas constantes (15° ...

  20. A low-cost GPS-GPRS telemetry system for otters: field tests and preliminary data on wild otters


    Martins, Bruno Herlander Mira


    Os rios europeus, particularmente os do sul da Europa representam um dos habitats com maior riqueza de espécies que, contudo, continuam a sofrer um acentuado declínio, quase sempre devido a actividades humanas. No que diz respeito às populações de lontraeuropeia (Lutra lutra, Linnaeus 1758), sendo um predador de topo destes ecossistemas e com grandes requisitos ecológicos, o impacto sentido nas suas populações, essencialmente pela destruição do seu habitat e consequente diminuição...

  1. Predação de sementes de leguminosas por bruquídeos (Insecta: Coleoptera na Serra dos Carajás, Pará, Brasil Legume seed damage by bruchids (Insecta: Coleoptera in Serra dos Carajás, Pará state, Brazil

    Directory of Open Access Journals (Sweden)

    Cecília Lomônaco


    Full Text Available Estudou-se a predação de sementes em Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth. var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae e Phaseolus linearis H.B.K. (Fabaceae para investigar a taxa de predação e a existência de defesas contra a ação de predadores. Foi constatada a preferência por sementes de maior tamanho pelo bruquídeo de Bauhinia pulchella, o que pode significar uma adaptação das plantas em ter sementes pequenas que escapem da predação. Em Mimosa somnians, a imprevisibilidade do número de sementes viáveis produzidas poderia consistir num mecanismo de defesa, por impedir a otimização da quantidade de ovos deixados pelo predador em cada fruto. O formato extremamente achatado das sementes de Mimosa acutistipula parece limitar a ação de predadores. A alta resistência da casca dos frutos de Phaseolus linearis e o aspecto compacto e duro de suas sementes podem ser considerados defesas mecânicas. Existe relação entre o tamanho de sementes e o tamanho de predadores para as espécies estudadas.Seed damage in Bauhinia pulchella Benth. (Caesalpiniaceae, Mimosa acutistipula Benth var. nigra Hub., Mimosa somnians H.B. ex Willd. (Mimosaceae and Phaseolus linearis H.B.K. (Fabaceae, was studied to investigate defense against predators. The preference for larger seeds of Bauhinia pulchella by bruchids is a selection pressure for the plant to product smaller seeds, as a survival mechanism to scape predation. The impredictability of the number of viable seeds per pod in Mimosa somnians could represent a defense mechanism because it does not permit the optimization of the number of eggs laid in each fruit. The flattened seeds of Mimosa acutistipula limit the attack sucess of predator beetles. The high resistance of the pod skin and the hard compact seeds in Phaseolus linearis may be considered mechanical defenses. There is a con-elation between seed size and predator size in the species studied.

  2. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system


    Maria Alice Medeiros; Edison Ryoiti Sujii; Helena Castanheira de Morais


    A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado ...

  3. Controle biológico de Culicidae (Díptera por Copelatus SP. N. (Coleóptera Dytiscidae na floresta amazônica

    Directory of Open Access Journals (Sweden)

    José Lopes


    Full Text Available Many literature citations state that Coleóptera of the family Dytiscidae are predators of larvae of Culicidae. In an area of primative forest, small receptacles of water were introduced in order to study ecology of Dytiscidae. A new species of the genus Copelatus was discovered and found to be a predator of mosquito larvae. Field observations of behavior colonization of receptacles and aspects of the controle of mosquito population were made. In the laboratory were studied resistance to dessication, dispersion, aquatic respiration, relationship with other predators and its influence upon development of Culicidae larvae. Copelatus appears to be an efficient agent of biological control of larva of Culicidae in small reservatories of water. Existem na literatura inúmeras citações, referentes a Coleópteras da família Dytiscidae, incriminando-os como predador de larvas de Culicidae. Foi introduzido em uma área de mata primaria recipiente contendo água, com o objetivo de identificar um predador para as larvas de mosquito. Coletou-se um Dytiscidae, espécie nova do gênero Copelatus que exerce ação predatória sobre as larvas de mosquito. Estudou-se seu comportamento em campo observando-se a colonização dos recipientes e sua atuação positiva no controle de Culicidae. Em laboratório foi estudado Fatores de Resistência a dessecação, dispersão, respiração aquática, comportamento frente a outro predador e influência sobre o desenvolvimento das larvas de Culicidae. Copelatus mostrou-se eficiente agente de controle biológico das larvas de Culicidae em pequenos reservatórios de água.

  4. Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi

    Directory of Open Access Journals (Sweden)



    Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores Agropastoril (Agriflor, em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução.

  5. Pragas e inimigos naturais na soja e no milho cultivados em sistemas diversificados

    Directory of Open Access Journals (Sweden)

    Cividanes Francisco Jorge


    Full Text Available A consorciação de culturas e o plantio direto podem influenciar a dinâmica populacional de insetos, aumentando ou diminuindo a densidade populacional de pragas e de inimigos naturais. Deste modo, avaliaram-se os efeitos de sistemas de plantio direto e da consorciação soja [Glycine max (L. Merrill] e milho (Zea mays L. sobre as populações de insetos-pragas e inimigos naturais. Os tratamentos constituíram um fatorial 3x2 (monocultura de soja, monocultura de milho, consorciação soja-milho em plantio direto e plantio convencional. Os insetos foram amostrados pelo método do pano, rede entomológica e procura visual. No milho, a ocorrência de insetos-pragas da parte aérea e insetos predadores não foi influenciada pelo manejo do solo. Lagartas de Helicoverpa zea ocorreram em maior número (5,1 no milho em consorciação. Na soja, adultos de Anticarsia gemmatalis e do predador Cycloneda sanguinea foram mais abundantes em plantio direto, respectivamente, 0,4 e 2,4 insetos. Observou-se maior número do sirfídeo Toxomerus sp. em plantio convencional (1,3. Nas condições de consorciação, verificou-se baixo número de Diabrotica gracilenta (11,5 na soja, enquanto que Maecolaspis sp. (5,0 e Megascelis sp. (17,0 e os predadores C. sanguinea (2,3, Doru sp. (0,8, Geocoris sp. (1,5 e Toxomerus sp. (1,4 ocorreram em alta densidade.

  6. Diversidad y microestructura de quitones (Mollusca: Polyplacophora) del Caribe de Costa Rica

    Scientific Electronic Library Online (English)

    Cedar I, García-Ríos; Migdalia, Álvarez-Ruiz.


    Full Text Available Los poliplacóforos asociados a los arrecifes de coral en la costa caribeña de Costa Rica han sido poco estudiados. El examen del cascajo de coral acumulado en el sublitoral somero, en cuatro estaciones de colección, localizadas en la Provincia de Limón reveló una diversidad de quitones mayor a la do [...] cumentada. Anteriormente se habían registrado ocho especies para el Caribe costaricense: Ischnochiton erythronotus (C.B. Adams, 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon, 1886); S. purpurascens (C.B. Adams, 1845); Acanthopleura granulata (Gmelin, 1791); Chiton marmoratus Gmelin, 1791; C. tuberculatus Linnaeus, 1758; Acanthochitona rhodea (Pilsbry, 1893). Otras cinco se registran aquí por primera vez: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954; Cryptoconchus floridanus (Dall 1889). Abstract in english Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four coll [...] ection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulate (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889). Rev. Biol. Trop. 59 (1): 129-136. Epub 2011 March 01.

  7. The chemistry of antipredator defense by secondary compounds in neotropical lepidoptera: facts, perspectives and caveats

    Scientific Electronic Library Online (English)

    José R., Trigo.


    Full Text Available Defesas químicas em lepidópteros contra predadores têm sido observadas desde o século XIX. O caso clássico de proteção química contra predadores é o da borboleta monarca, Danaus plexippus, cuja larva seqüestra cardenolidas de sua planta hospedeira Asclepias curassavica e transfere-as para os adultos [...] tornando-os impalatáveis para pássaros. Entretanto diversas outras substâncias podem estar envolvidas na proteção química de lepidópteros neotropicais (glicosídeos iridóides, glicosídeos cianogênicos, glicosinolatos, alcalóides pirrolizidínicos e tropânicos, ácidos aristolóquicos, inibidores de glicosidase, pirazinas). Esses compostos podem ser seqüestrados da planta hospedeira larval, obtidos de fontes vegetais visitadas por adultos ou biossintetizados de novo. Os lepidópteros conhecidos como impalatáveis para predadores vertebrados e/ou invertebrados são as borboletas Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae e Acraeinae (Nymphalidae) e mariposas Arctiidae. Entretanto informações sobre as substâncias que são responsáveis pela impalatabilidade e como elas são adquiridas nem sempre são obtidas. Esse artigo de revisão aborda principalmente observações de campo e laboratório sobre a rejeição de borboletas e mariposas neotropicais por predadores, correlações entre impalatabilidade e substâncias químicas encontradas nos insetos e bioensaios que demonstrem a atividade dessas substâncias contra predadores. Perspectivas são sugeridas para esses tópicos. Abstract in english Chemical defense against predation in butterflies and moths has been studied since nineteenth century. A classical example is that of the larvae of the monarch butterfly Danaus plexippus, which feed on leaves of Asclepias curassavica (Asclepiadaceae), sequestering cardenolides. The adults are protec [...] ted against predation by birds. Several other substances may be involved in chemical defense, such as iridoid glycosides, cyanogenic glycosides, glucosinolates, pyrrolizidine and tropane alkaloids, aristolochic acids, glycosidase inhibitors and pyrazines. The acquisition of these substances by lepidopterans can be due to sequestration from larval or adult host plants or de novo biosynthesis. Many Lepidoptera are known to be unpalatable, including the butterflies Troidini (Papilionidae), Pierinae (Pieridae), Eurytelinae, Melitaeinae, Danainae, Ithomiinae, Heliconiinae and Acraeinae (Nymphalidae), and Arctiidae moths, but knowledge of the chemical substances responsible for property is often scarce. This review discusses mainly three topics: field and laboratory observations on rejection of butterflies and moths by predators, correlation between unpalatability and chemicals found in these insects, and bioassays that test the activity of these chemicals against predators. Perspectives and future directions are suggested for this subject.

  8. Antipredator and alarm reaction responses of silver catfish (Rhamdia quelen) juveniles exposed to waterborne ammonia

    Scientific Electronic Library Online (English)

    Paula, Weber; Carina, Vogel; Carla, Lang; Bernardo, Baldisserotto.

    Full Text Available Amônia possui efeito relativamente tóxico em peixes e outros organismos aquáticos. Este estudo examinou se juvenis de jundiás modificam seu comportamento em resposta a percepção do risco de predação quando expostos a substâncias de alarme liberadas por conspecíficos e predadores em água com diferent [...] es concentrações de amônia. Foram utilizados juvenis de jundiá nunca expostos a predadores. Os peixes foram criados em laboratório desde a fase larval e mantidos em aquários de 40-L contendo diferentes concentrações de NH3: 0; 0,05; 0,1 e 0,2 mg L-1 por 10 dias. As substâncias de alarme utilizadas foram odor de predador e extrato de pele de conspecíficos. Os juvenis foram transferidos para aquários de 2-L para realização dos testes para comportamento antipredador e resposta à substância de alarme, os quais foram realizados nos dias 1, 5 e 10 a partir do início da exposição à amônia. O aquário teste continha um esconderijo em uma de suas extremidades. Foram feitas observações comportamentais 10-min pré-estímulo e 10-min pós-estímulo. Os resultados do estudo sugerem que juvenis de jundiá nunca expostos a predadores são capazes de identificar predadores e extrato de pele de conspecíficos pelo odor. Além disso, os níveis de NH3 na água alteram a resposta anti-predatória desta espécie. Abstract in english Ammonia has relatively toxic effects on fish and other aquatic organisms. This study examined whether juvenile silver catfish exposed to alarm substances released by conspecifics and predators in water with different ammonia levels modify their behaviour in response to the perceived risk of predatio [...] n. We used juvenile catfish that were naive to predators. The fish were raised from the larval stage in the laboratory and kept in 40-L aquaria at waterborne NH3 concentrations of 0, 0.05, 0.1, or 0.2 mg L-1 for 10 days. The alarm substances used were predator odour and skin extract from conspecifics. The juveniles were transferred to 2-L aquaria for the antipredator and alarm reaction behavioural tests, which were performed on days 1, 5 and 10 after initial exposure to ammonia. The test aquaria contained a shelter at one end of the tank. The trials consisted of a 10-min prestimulus and a 10-min poststimulus observation period. The results of the study suggest that naive juvenile catfish are able to identify predators and skin extract from conspecifics by odour. In addition, waterborne NH3 levels modify the antipredator response of this species.

  9. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) submitted to antipredator training / Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae) submetidas a treinamentoanti-predação

    Scientific Electronic Library Online (English)

    Cristiano S. de, Azevedo; Robert J., Young.


    Full Text Available As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758) por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativei [...] ro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada) ou um predador real (cachorro doméstico) com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada) às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras. Abstract in english Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758) populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born anim [...] als that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog) with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar) to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.

  10. Fish ladders: safe fish passage or hotspot for predation?

    Scientific Electronic Library Online (English)

    Angelo Antonio, Agostinho; Carlos Sergio, Agostinho; Fernando Mayer, Pelicice; Elineide Eugênio, Marques.


    Full Text Available Passagens para peixes têm sido consideradas como estratégias para conservação da biodiversidade, visando além de assegurar os deslocamentos entre habitats fragmentados, atenuar a mortalidade por predação dos estratos populacionais que se concentram nos trechos imediatamente abaixo de barragens. Embo [...] ra a mortalidade por predação no trecho a jusante de reservatórios tenha sido bem investigada, especialmente sobre os juvenis de salmonídeos em movimentos descendentes, nada se sabe acerca da predação de peixes neotropicais em áreas de atração e confinamento de peixes, eventos comuns a essas facilidades de transposição. Nesse estudo são analisados aspectos da predação em um sistema de transposição de peixes (barragem de Lajeado, rio Tocantins, Brasil), buscando avaliar a abundância, a distribuição e o tempo de permanência de grandes peixes predadores na escada, as injúrias impostas por piranhas durante a passagem e a ocorrência de outros vertebrados predadores. Para isso foram realizadas amostragens a jusante, ao longo da escada, no trecho imediatamente acima da barragem e a montante do reservatório, utilizando redes de espera, tarrafas e contagens ou registros visuais durante o período de um ano (Novembro de 2002 a Outubro de 2003). Marcações com linha e missanga e registro de mutilações foram também realizados em concomitância. Peixes, aves, quelônios e cetáceos foram os principais grupos de predadores observados, com predomínio dos dois primeiros. A área nas imediações da entrada da escada, a jusante, foi a região com maior número de grandes predadores, sendo a única de relevância para vertebrados não peixes. Indivíduos marcados permaneceram na escada exercendo a piscivoria por até 90 dias. Rhaphiodon vulpinus, Hydrolycus armatus e Serrasalmus rhombeus foram os principais peixes predadores. Mutilações por ataques de Serrasalmus atingiram 36% das espécies e alcançaram 4% dos indivíduos no topo da escada. Os resultados sugerem que a alta densidade de peixes no ambiente restrito da escada, associada às injúrias sofridas no percurso e a presença de múltiplos predadores dotados de estratégias de predação variadas, transforme o corredor para passagem de peixes em um "hotspot" de predação Abstract in english Fish ladders are a strategy for conserving biodiversity, as they can provide connectivity between fragmented habitats and reduce predation on shoals that accumulate immediately below dams. Although the impact of predation downstream of reservoirs has been investigated, especially in juvenile salmoni [...] ds during their downstream movements, nothing is known about predation on Neotropical fish in the attraction and containment areas commonly found in translocation facilities. This study analysed predation in a fish passage system at the Lajeado Dam on the Tocantins River in Brazil. The abundance, distribution, and the permanence (time spent) of large predatory fish along the ladder, the injuries imposed by piranhas during passage and the presence of other vertebrate predators were investigated. From December 2002 to October 2003, sampling was conducted in four regions (downstream, along the ladder, in the forebay, and upstream of the reservoir) using gillnets, cast nets and counts or visual observations. The captured fish were tagged with thread and beads, and any mutilations were registered. Fish, birds and dolphins were the main predator groups observed, with a predominance of the first two groups. The entrance to the ladder, in the downstream region, was the area with the highest number of large predators and was the only region with relevant non-fish vertebrates. The main predatory fish species were Rhaphiodon vulpinus, Hydrolycus armatus, and Serrasalmus rhombeus. Tagged individuals were detected predating along the ladder for up to 90 days. Mutilations caused by Serrasalmus attacks were noted in 36% of species and 4% of individuals at the top of the ladder. Our results suggested that the high density of fish in the restricted ladd

  11. Behavioural responses of captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae submitted to antipredator training Respostas comportamentais de emas cativas Rhea americana Linnaeus (Rheiformes, Rheidae submetidas a treinamentoanti-predação

    Directory of Open Access Journals (Sweden)

    Cristiano S. de Azevedo


    Full Text Available Human activities have been diminishing greater rhea Rhea americana (Linnaeus, 1758 populations throughout their natural distribution. The reintroductions of captive-born greater rheas have been tried but without success; since the individuals reintroduced were killed by predators. Captive-born animals that have been isolated from predators for many generations can lose their predator recognition abilities. To enhance the survival rates of the reintroduced animals, researchers are now using antipredator training techniques. We studied the response of 15 zoo-borne greater rheas to antipredator training. The animals were divided into three groups: two test groups and one control group. We ran 15 antipredator tests and four control testes with each group. Antipredator tests consisted of pairing a taxidermized predator model or a real predator (domestic dog with a simulation of a capture procedure. Control tests consisted of presenting the predator model (jaguar to the birds, after training but not associating it with an aversive event and recording behavioural responses. All tests were video-recorded and analysed a posteriori. Results showed that the trained rheas responded appropriately to the predators, becoming more vigilant and that there was considerable individual differences in response to antipredator training. The results demonstrated that antipredator training is effective and therefore an invaluable tool for reintroduction projects involving greater rheas. Furthermore, the methods employed in this research project should be applicable to other species of flightless birds.As atividades humanas têm diminuído as populações de emas Rhea americana (Linnaeus, 1758 por toda sua área de distribuição. Reintroduções de emas nascidas em cativeiro têm sido tentadas, mas sem sucesso, uma vez que os indivíduos reintroduzidos são mortos por predadores. Animais nascidos em cativeiro que foram isolados de seus predadores por várias gerações podem se tornar incapacitados do seu reconhecimento. Para aumentar as taxas de sobrevivência dos animais reintroduzidos, pesquisadores têm utilizado técnicas de treinamento anti-predação. O objetivo deste trabalho foi a aplicação de treinamento anti-predação em emas nascidas em cativeiro e avaliação de suas respostas comportamentais. Foram treinadas 15 emas adultas. Os animais foram divididos em três grupos: dois grupos-teste e um grupo controle. Foram realizados 15 testes anti-predação e quatro testes-controle com cada grupo. O teste anti-predação consistia em parear um modelo taxidermizado de predador (onça-pintada ou um predador real (cachorro doméstico com uma simulação de captura. Os testes-controle consistiram na apresentação do modelo do predador (onça empalhada às aves, depois do treinamento, mas sem a associação com o estímulo aversivo. As respostas comportamentais foram filmadas e os comportamentos anotados posteriormente. Os resultados mostraram que as emas responderam apropriadamente aos predadores, se tornando mais vigilantes, e que existem diferenças individuais evidentes em resposta ao treinamento anti-predação. Os resultados demonstraram que o treinamento anti-predação pode ser uma ferramenta valiosa para futuros projetos de reintrodução envolvendo emas. Além disso, os métodos empregados nesta pesquisa podem ser aplicados a outras espécies de aves não-voadoras.

  12. Head triangulation as anti-predatory mechanism in snakes / Triangulação da cabeça como mecanismo anti-predação em serpentes

    Scientific Electronic Library Online (English)

    Denise Dalbosco, Dell' Aglio; Tiago Shizen Pacheco, Toma; Adriane Esquivel, Muelbert; Anne Gomes, Sacco; Alexandro Marques, Tozetti.


    Full Text Available Mecanismos anti-predação em serpentes são diversos e complexos, incluindo comportamentos miméticos. Algumas serpentes triangulam a cabeça, possivelmente mimetizando outras serpentes mais perigosas. No entanto, são escassos os estudos demonstrando a eficiência deste comportamento frente a predadores [...] naturais. O objetivo deste estudo foi verificar, utilizando serpentes artificiais, se os indivíduos com cabeça triangular são menos suscetíveis ao ataque de predadores e, se o ataque predatório é direcionado à cabeça das serpentes. Serpentes artificiais foram dispostas sistematicamente na margem de uma estrada. A taxa de modelos atacados foi 48,71%. O número de ataques em modelos de cabeça arredondada foi significativamente maior do que nos modelos com cabeça triangular. Houve diferença significativa entre as partes atacadas nas serpentes quando comparados aos diferentes formatos de cabeça. Portanto, as serpentes que possuem triangulação da cabeça podem ser um alvo menos frequente de ataques por predadores do que as que não possuem esse tipo de comportamento. Abstract in english Anti-predator mechanisms in snakes are diverse and complex, including mimetic behavior. Some snakes triangulate their head, probably mimicking other more dangerous snakes. However, there is a lack of studies that demonstrate the effectiveness of this behavior with natural predators. The aim of this [...] study was to verify, using artificial snakes, if snakes with triangular heads are less susceptible to attack by predators, and if predatory attack is targeted to the head of serpents. Artificial snakes were systematically arranged on a road border. The rate of attacked models was 48.71%. Number of attacks on models with rounded head was significantly higher than in models with triangular head. There was a significant difference between the places of attack on the snakes in relation to different head shapes. Therefore, snakes that have head triangulation may be a less frequent target of attacks by predators than those without such behavior.

  13. Predation Tactics of Trumpetfish in Midwater

    Directory of Open Access Journals (Sweden)

    Peter J. Auster


    Full Text Available Predators are known to modify hunting tactics in response to local conditions to exploit prey of different species, densities or position within habitat patches. I describe three unusual prey hunting tactics used by trumpetfish (Aulostomus maculatus distributed in midwater above reefs off Bonaire, Netherlands Antilles, in the southern Caribbean Sea. Hunting behaviors were focused on dense feeding aggregations of brown chromis (Chromis multilineata and were categorized as: (1 slow horizontal following, (2 vertical hovering or drift, and (3 diagonal cross encounters where trumpetfish descended diagonally through the water while adjusting trajectory to encounter target prey. Understanding variation in predator behavior and ambit, in this case vertical ambit, adds to our knowledge of how predators adapt to unique local opportunities to exploit prey.Predadores são conhecidos por modificar táticas de caça em resposta às condições locais para explorar presas de diferentes espécies, densidades ou posição dentro dos habitats. Descrevo três táticas de predação não usuais utilizadas pelo peixe-trombeta (Aulostomus maculatus à meia água sobre os recifes de Bonaire, Antilhas Holandesas, na porção sul do mar do Caribe. Comportamentos de caça foram direcionados para densas agregações de forrageamento de mulatas (Chromis multilineata e foram categorizados como: (1 perseguição horizontal lenta, (2 pairando verticalmente ou à deriva, e (3 encontros cruzados diagonais, onde o peixe-trombeta desce diagonalmente através da água enquanto ajusta a sua trajetória para interceptar a presa almejada. A compreensão do comportamento do predador e seus domínios, neste caso a dimensão vertical, contribui para o conhecimento de como predadores se adaptam a condições locais particulares de exploração de presas.

  14. Mites and leaf domatia: no evidence of mutualism in Coffea arabica plants / Ácaros e domácias foliares: sem evidências de mutualismo em plantas de Coffea arabica

    Scientific Electronic Library Online (English)

    Gustavo Quevedo, Romero; Rodrigo Damasco, Daud; Adriana Trevizoli, Salomão; Luiz Fernando, Martins; Reinaldo José Fazzio, Feres; Woodruff Whitman, Benson.


    Full Text Available Domácias são pequenas estruturas presentes na junção entre as nervuras principal e secundárias das folhas de muitas espécies de plantas, que podem mediar interações mutualísticas entre ácaros e plantas. Em experimento, nós bloqueamos as domácias em formato de covas de folhas novas e velhas de Coffea [...] arabica L. com gotas de resina, a fim de investigar o seu papel i) na abundância de ácaros na comunidade e ii) nos danos foliares. Mais de 77% dos ácaros coletados são predadores, enquanto 19 e 3,3% são onívoros e fitófagos, respectivamente. Não houve influência do bloqueio das domácias tanto na abundância quanto nos danos foliares. Entretanto, os ácaros predadores e micófagos foram mais abundantes nas folhas novas do que nas velhas; os ácaros fitófagos ocorreram em pequena densidade e ocuparam somente as plantas com domácias abertas. A ausência de mutualismo entre os ácaros e plantas de C. arabica pode ter ocorrido porque as entradas das domácias analisadas eram muito pequenas, não permitindo a entrada dos predadores fitoseídeos nessas estruturas. Abstract in english We conducted experiments by blocking off pit-like domatia from old and new leaves of Coffea arabica L., using tiny resin drops, to investigate the role of domatia on i) mite abundance at the community level and on ii) leaf damages. More than 77% of the mites collected were predators, whereas 19 and [...] 3.3% were omnivores and phytophages, respectively. Domatia blockage treatment had no influence either on mite abundances or leaf damages. However, predatory and omnivorous mites were more abundant on new than on the old leaves; phytophagous mites occurred at very low density and occupied only plants having open domatia. The absence of mutualism between mites and C. arabica probably occurred because the entrances of domatia were too small and did not enable the entry of fitoseid predators in these structures.

  15. Predation Tactics of Trumpetfish in Midwater

    Scientific Electronic Library Online (English)

    Peter J., Auster.

    Full Text Available Predadores são conhecidos por modificar táticas de caça em resposta às condições locais para explorar presas de diferentes espécies, densidades ou posição dentro dos habitats. Descrevo três táticas de predação não usuais utilizadas pelo peixe-trombeta (Aulostomus maculatus) à meia água sobre os reci [...] fes de Bonaire, Antilhas Holandesas, na porção sul do mar do Caribe. Comportamentos de caça foram direcionados para densas agregações de forrageamento de mulatas (Chromis multilineata) e foram categorizados como: (1) perseguição horizontal lenta, (2) pairando verticalmente ou à deriva, e (3) encontros cruzados diagonais, onde o peixe-trombeta desce diagonalmente através da água enquanto ajusta a sua trajetória para interceptar a presa almejada. A compreensão do comportamento do predador e seus domínios, neste caso a dimensão vertical, contribui para o conhecimento de como predadores se adaptam a condições locais particulares de exploração de presas. Abstract in english Predators are known to modify hunting tactics in response to local conditions to exploit prey of different species, densities or position within habitat patches. I describe three unusual prey hunting tactics used by trumpetfish (Aulostomus maculatus) distributed in midwater above reefs off Bonaire, [...] Netherlands Antilles, in the southern Caribbean Sea. Hunting behaviors were focused on dense feeding aggregations of brown chromis (Chromis multilineata) and were categorized as: (1) slow horizontal following, (2) vertical hovering or drift, and (3) diagonal cross encounters where trumpetfish descended diagonally through the water while adjusting trajectory to encounter target prey. Understanding variation in predator behavior and ambit, in this case vertical ambit, adds to our knowledge of how predators adapt to unique local opportunities to exploit prey.

  16. Genetically modified corn on fall armyworm and earwig populations under field conditions / Milho geneticamente modificado e sua ação sobre a lagarta-do-cartucho e tesourinha em condições de campo

    Scientific Electronic Library Online (English)

    Marina Regina, Frizzas; Sinval, Silveira Neto; Charles Martins de, Oliveira; Celso, Omoto.


    Full Text Available Avaliou-se o efeito do milho geneticamente modificado MON810 sobre o inseto praga Spodoptera frugiperda (J.E. Smith) e o seu predador Doru luteipes (Scudder) em condições de campo no Brasil. As avaliações foram conduzidas em campos de milho MON810, comparadas com milho convencional com e sem aplicaç [...] ão de inseticidas, em quatro safras na região de Barretos, SP. Foram avaliados os danos de S. frugiperda em plantas e a contagem do número de lagartas de S. frugiperda e de adultos e ninfas do predador D. luteipes em plantas de milho. Verificou-se uma menor porcentagem de danos de S. frugiperda e os menores números médios de lagartas (pequenas e grandes) no milho MON810. Não foram observadas diferenças (P>0,05) entre os tratamentos na abundância do predador D. luteipes em plantas de milho. A segunda época de plantio apresentou as maiores porcentagens de danos de S. frugiperda e as menores médias do número de tesourinhas coletadas. O milho MON810 foi efetivo no controle de S. frugiperda e a abundância do predador D. luteipes foi similar nos três tratamentos, em condições de campo. Abstract in english The effects of corn MON810 on the Spodoptera frugiperda (J.E. Smith) and the earwig Doru luteipes (Scudder) were tested under field conditions in Brazil. Results from MON810 corn fields were compared with those fields of conventional corn with and without the application of insecticides in four harv [...] ests in the region of Barretos, SP. It was assessed the damage to S. frugiperda via direct counts of the number of fall armyworms and adults and nymphs of the predator D. luteipes on corn plants. The rate of S. frugiperda damage and the average numbers of larvae (large and small) were lower in the MON810 corn field relative to the control plot. There were no differences (P>0.05) between treatments regarding the predator abundance in corn plants. The second crop season ("safrinha") showed the greatest extent of S. frugiperda damage and the lowest average abundance of earwigs. MON810 was effective in controlling S. frugiperda and abundance of predator D. luteipes was similar in the three treatments under field conditions.

  17. Ecological Roles of Coleoptera Associated with Carcasses in Caatinga

    Directory of Open Access Journals (Sweden)

    Wellington Santos


    Resumo. O papel ecológico da coleopterofauna associada a carcaças de porcos em uma área de Caatinga foi examinado. Para captura desses insetos foram utilizadas armadilhas do tipo bandeja, pitfall e Shannon modificada, durante duas estações (seca e chuvosa. 4.851 coleópteros foram coletados, pertencentes a 19 famílias e 88 espécies. A categoria ecológica mais abundante foi predador/parasita (72,7%, seguida por onívoro (15,1%, necrófago (10,9% e incidental (1,3%. Futuros estudos sobre biologia das espécies predadoras/parasitas são necessários para se determinar sua possível utilidade forense na estimativa do intervalo pós-morte.

  18. Food webs of Mediterranean coastal wetlands


    Compte Ciurana, Jordi


    En aquesta tesi doctoral s'han estudiat els efectes directes i indirectes de dos tipus d'espècies claus de la comunitat aquàtica dels aiguamolls de l'Empordà (aiguamolls costaners mediterranis amb una xarxa tròfica senzilla). S'han realitzat experiments al camp utilitzant microcosmos i mesocosmos i els resultats han estat analitzats mitjançant tres aproximacions: la taxonòmica, la funcional i la de mides. S'ha comprovat que en situacions amb absència de predadors i dominància d'una única espè...

  19. Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae) em plantas hospedeiras / Feeding preference and performance of Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) among host plants

    Scientific Electronic Library Online (English)

    Roberta R., Coelho; Antônio F. S. L., Veiga; Jorge B., Torres.

    Full Text Available O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret) (Hemiptera, Pentatomidae) e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae), caruru, Amaranthus lividus L. (Amaranthaceae) e [...] feijão, Phaseolus vulgaris L. (Fabaceae). Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos) e ganho de peso (28 a 30% do peso vivo) foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas. Abstract in english The choice between cotton, Gossypium hirsutum L. (Malvaceae), green bean, Phaseolus vulgaris L. (Fabaceae) and pigweed, Amaranthus lividus L. (Amaranthaceae) and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret) (Hemiptera, Penta [...] tomidae) adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes) and weight gain (28 to 30% of body weight) were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

  20. Efeitos da aplicação de agrotóxicos utilizados na produção integrada de maçã sobre pupas de Chrysoperla externa Effects of pesticides application used in integrated apple production on Chrysoperla externa pupae


    Alexandre Pinho Moura; Geraldo Andrade Carvalho; Olinto Lasmar; Valéria Fonseca Moscardini; Denise Tourino Rezende


    Devido à grande importância de Chrysoperla externa (Neuroptera: Chrysopidae) como agente de controle biológico de artrópodes-praga na cultura da macieira no Brasil, avaliaram-se os efeitos dos agrotóxicos (g i.a. L-1) abamectina (0,02), carbaril (1,73), enxofre (4,80), fenitrotiona (0,75), metidationa (0,40) e triclorfom (1,50) em pupas desse predador, oriundas de Bento Gonçalves e Vacaria, Rio Grande do Sul, bem como sobre o desenvolvimento dos adultos obtidos e sua reprodução. A apl...

  1. Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars


    Maria da Conceição M. Soglia; Vanda Helena Paes Bueno; Lívia Mendes Carvalho


    Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fotofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as...

  2. Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas)

    Scientific Electronic Library Online (English)

    Walter S., Evangelista Junior; Roberta L., Santos; Jorge B., Torres; José C., Zanuncio.


    Full Text Available Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas). O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus ( [...] Dallas) (Hemiptera, Pentatomidae), é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae) e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume) durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%). Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão. Abstract in english Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas). Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the inter [...] action of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas) (Hemiptera, Pentatomidae) has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v) during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20%) ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.

  3. Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas

    Directory of Open Access Journals (Sweden)

    Walter S. Evangelista Junior


    Full Text Available Effect of gossypol on survival and reproduction of the zoophytophagous stinkbug Podisus nigrispinus (Dallas. Gossypol is a sesquiterpene aldehyde found in cotton plants conferring resistance against herbivory. Although the effect of this sesquiterpenoid on insect pests of cotton is known, the interaction of this compound with zoophytophagous predators such as Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae has not been studied so far. Thus, the objective of this study was to evaluate the effect of the purified gossypol on nymphs and adults of P. nigrispinus. Nymphs and adults of this predator were fed on Tenebrio molitor pupae and supplemented with solutions of gossypol at concentrations of 0.00, 0.05, 0.10, and 0.20% (w/v during the nymphal and adult stages or, only during the adult stage of P. nigrispinus. The nymphal stage of the predator was, on average, two days longer when suplemmented with gossypol. Emerged adults had lower fecundity and egg hatching, especially at the highest gossypol concentration (0.20% ingested during the nymphal and adult stages. However, this predator was not affected when it ingested the compound only during the adult stage. P. nigrispinus can have delayed nymphal development and lower reproductive performance when ingesting the gossypol during the nymphal and adult stages, but only at higher concentrations of gossypol than that produced by cotton plants.Efeito do gossipol na sobrevivência e reprodução do percevejo zoofitófago Podisus nigrispinus (Dallas. O gossipol é um aldeído sesquiterpeno produzido pelo algodoeiro que confere resistência contra a herbivoria. A interação deste sesquiterpeno com predadores zoofitófagos, como Podisus nigrispinus (Dallas (Hemiptera, Pentatomidae, é inexistente apesar do reconhecido efeito do gossipol sobre insetos pragas do algodoeiro. Assim, este estudo avaliou o efeito do extrato de gossipol sobre ninfas e adultos de P. nigrispinus. O predador foi alimentado com pupas de Tenebrio molitor L. (Coleoptera, Tenebrionidae e suplementado com soluções do gossipol nas concentrações 0, 0,05, 0,10 e 0,20% (peso/volume durante os estágios ninfal e adulto e somente durante o estágio adulto. A duração do estágio ninfal do predador foi em média dois dias mais longo quando suplementado com gossipol. Adultos oriundos de ninfas suplementadas com gossipol apresentaram menor fecundidade e viabilidade dos ovos, em especial na maior concentração (0,20%. Contudo, adultos não foram afetados quando suplementados com gossipol somente durante este estágio. Os resultados demonstram que a ingestão prolongada do gossipol ocasiona efeito no desenvolvimento e reprodução do predador P. nigrispinus, porém somente em concentração superior àquela produzida naturalmente pela planta de algodão.

  4. New record of predatory ladybird beetle (Coleoptera, Coccinellidae feeding on extrafloral nectaries

    Directory of Open Access Journals (Sweden)

    Lúcia M. Almeida


    Full Text Available New record of predatory ladybird beetle (Coleoptera, Coccinellidae feeding on extrafloral nectaries. Feeding by Exoplectra miniata (Germar on extrafloral nectaries of Inga edulis Mart. was observed in Nova Friburgo, Rio de Janeiro, Brazil. This is the first record of this behavior for Exoplectrini.Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae alimentando-se de nectário extrafloral. A alimentação de Exoplectra miniata (Germar em nectários extraflorais de Inga edulis Mart. foi observada em Nova Friburgo, Rio de Janeiro, Brasil. Este é o primeiro registro deste comportamento para Exoplectrini.

  5. New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries

    Scientific Electronic Library Online (English)

    Lúcia M., Almeida; Geovan H., Corrêa; José A., Giorgi; Paschoal C., Grossi.


    Full Text Available Novo registro de um coccinelídeo predador (Coleoptera, Coccinellidae) alimentando-se de nectário extrafloral. A alimentação de Exoplectra miniata (Germar) em nectários extraflorais de Inga edulis Mart. foi observada em Nova Friburgo, Rio de Janeiro, Brasil. Este é o primeiro registro deste comportam [...] ento para Exoplectrini. Abstract in english New record of predatory ladybird beetle (Coleoptera, Coccinellidae) feeding on extrafloral nectaries. Feeding by Exoplectra miniata (Germar) on extrafloral nectaries of Inga edulis Mart. was observed in Nova Friburgo, Rio de Janeiro, Brazil. This is the first record of this behavior for Exoplectrini [...] .

  6. Mercúrio total em cação comercializado em São Paulo - SP, Brasil


    Morales-aizpuru?a, Isabel C.; Tenuta-filho, Alfredo; Sakuma, Alice M.; Zenebon, Odair


    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislaç?...

  7. Mercúrio total em cação comercializado em São Paulo - SP, Brasil Total mercury contents in shark species commercialized in São Paulo-SP, Brazil


    Morales-aizpuru?a, Isabel C.; Tenuta-filho, Alfredo; Sakuma, Alice M.; Zenebon, Odair


    Foram determinados os teores de mercúrio total em espécies de cação - anjo, cação-azul, cambeva, caçoa, machote e anequim - comercializadas em São Paulo - SP, Brasil. Os níveis encontrados variaram de 0,04 a 4,71mg Hg/kg, sendo que 54% estavam acima de 1mg Hg/kg, que é o limite aceito pela legislação brasileira especificamente para peixes predadores, para o propósito de consumo. Os resultados mostram que espécies de cação têm sido comercializadas em desacordo com a legislaç?...

  8. Preferência alimentar e desempenho de Brontocoris tabidus Signoret (Hemiptera, Pentatomidae em plantas hospedeiras Feeding preference and performance of Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae among host plants

    Directory of Open Access Journals (Sweden)

    Roberta R. Coelho


    Full Text Available O comportamento de escolha entre plantas pelo percevejo predador Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae e a relação com o ganho de peso e seu desempenho foram investigados com plantas de algodoeiro, Gossypium hirsutum L. (Malvaceae, caruru, Amaranthus lividus L. (Amaranthaceae e feijão, Phaseolus vulgaris L. (Fabaceae. Adultos do predador foram permitidos livre escolha entre plantas e, posteriormente, mantidos sobre as mesmas plantas escolhidas inicialmente para a alimentação. Também, o desenvolvimento e a reprodução foram obtidos confinando os predadores com e sem presa mais plantas. Os resultados mostraram que B. tabidus não demonstrou preferência para alimentação entre as plantas estudadas. O tempo de alimentação (106 a 115 minutos e ganho de peso (28 a 30% do peso vivo foram similares em relação à alimentação em plantas. Entretanto, a longevidade das fêmeas foi menor quando mantidas em feijão, comparadas com algodoeiro e caruru. A duração da fase ninfal do predador variou entre as plantas, bem como a produção de descendentes demonstrando menor desempenho sobre plantas de feijão. As ninfas alimentadas, apenas, de plantas não atingiram a fase adulta e viveram até 6,5 dias, sendo maior a sobrevivência em algodoeiro e caruru. Os resultados mostram que apesar de B. tabidus não apresentar seleção da planta hospedeira para alimentação, estas podem contribuir diferentemente na sua história de vida com destaque para o algodão e o caruru entre as plantas estudadas.The choice between cotton, Gossypium hirsutum L. (Malvaceae, green bean, Phaseolus vulgaris L. (Fabaceae and pigweed, Amaranthus lividus L. (Amaranthaceae and its relationship as first feeding, weight gain and biological performance of the predator Brontocoris tabidus (Signoret (Hemiptera, Pentatomidae adults were studied. Adults of the predator were allowed to choose between plants and, immediately paired and reared on the same selected plants plus prey. Furthermore, nymphal development and adult stage were obtained on the same plants plus prey. The results show that B. tabidus do not exhibit host plant preference among tested plants. Likewise, feeding period (106 to 115 minutes and weight gain (28 to 30% of body weight were statistically equal among plants. However, predators at adult stage only or nymphal and adult stages maintained on young green bean plants plus prey exhibited lower performance compared to the other plants. Nymphs feeding exclusively on plants lived, on average, up to 6.5 days but did not reach adult stage and lived longer on cotton plants and pig weed. The results indicated that adults of the predator B. tabidus do not exhibit selection on host plant to feed although different results in its life history was attained among the studied plants with better results for cotton and pigweed.

  9. Metazoan parasites of the channel catfish (Ictalurus punctatus) from three dams in Nuevo Leon, Mexico / Metazoarios parásitos del bagre de canal (Ictalurus punctatus) de tres presas en Nuevo León, México

    Scientific Electronic Library Online (English)

    Lucio, Galaviz-Silva; Zinnia Judith, Molina-Garza; Baldemar, Escobar-González; Francisco Javier, Iruegas-Buentello.


    Full Text Available El bagre de canal (Ictalurus punctatus) es una de las especies que destacan a nivel mundial en la acuacultura. Aunque la presencia de esta especie es cada vez mayor en la industria pesquera, su fauna parasitaria en México ha recibido escasa atención. Esta investigación tiene como objetivos obtener i [...] nformación sobre la prevalencia y abundancia de la fauna parasitaria de I. punctatus y contribuir al inventario nacional de los parásitos de este hospedero. El estudio se realizó en tres presas del estado de Nuevo León: Cerro Prieto, Rodrigo Gómez y El Cuchillo-Solidaridad. Fueron registradas siete especies de helmintos y una especie de copépodo de 24 I. punctactus. Los resultados obtenidos consisten en un total de 4,687 parásitos, de los cuales 108 fueron endoparásitos y 4,579 ectoparásitos. Los resultados demuestran una gran diversidad de helmintos parásitos, incluyendo a Ligictaluridus floridanus, Corallobothrium fimbriatum y un nuevo registro de localidad para Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp. y el copepodo Ergasilus cerastes, así como un nuevo registro de hospedero y localidad para Spinitectus tabascoensis, originalmente descrito en Ictalurus furcatus en Tabasco al sur de México. Abstract in english The freshwater channel catfish (Ictalurus punctatus, Rafinesque, 1818) is one of the world-wide highlight species in aquaculture. Despite the growing presence of this fish in the farming industry, its parasitic fauna is rarely studied in Mexico. This survey was designed to provide insight into the o [...] ccurrence and abundance of parasitic fauna of I. punctatus and to contribute to the national inventory of parasites of this fish. This study was performed at the following three dams in the state of Nuevo Leon, Mexico: Cerro Prieto, Rodrigo Gomez, and El Cuchillo-Solidaridad. Seven helminths and 1 copepod species were recorded from the 24 I. punctatus collected. This record consists of a total of 4,687 parasites, of which 108 were endoparasites and 4,579 ectoparasites. Our findings demonstrate a great diversity of helminth parasites, including Ligictaluridus floridanus, and Corallobothrium fimbriatum, and new locality records for Megalogonia ictaluri, Centrocestus formosanus, Diplostomum (Austrodiplostomum) compactum, Spiroxys sp., the copepod Ergasilus cerastes, and a new host and distribution record was reported for Spinitectus tabascoensis, originally described from I. furcatus from Tabasco, southern Mexico.

  10. Distribution of warm water alpheoid shrimp (Crustacea, Caridea) on the continental shelf of eastern South America between 23 and 35º Lat. S

    Scientific Electronic Library Online (English)

    Martin L, Christoffersen.

    Full Text Available The southern boundaries of Tozeuma serratum A. Milne Edwards, Salmoneus ortmanni (Rankin) and Processa profunda Manning & Chace, previously known only from the northwestern Atlantic, have been extended to São Paulo, Paraná and Uruguay, respectively. Latreutes parvulus (Stimpson), previously not know [...] n beyond São Paulo has been found to as far south as the Province of Buenos Aires. A systematic account of these four species is furnished, based mainly on material collected by the R/V "Prof. W. Besnard". The 16 species of Alpheoidea whose southern boundaries occur in warm-temperate shelf waters of eastern South America belong to two distinct faunal assemblages: (1) Tropical species - Alpheus floridanus Kingsley, A. intrinsecus Bate, A. normanni Kingsley, Salmoneus ortmanni (Rankin) Synalpheus longicarpus (Herrick), Ogyrides alphaerostris (Kingsley) (= O. occidentalis(Ortmann)), Exhippolysmata oplophoroides (Holthuis), Latreutes parvalus (Stimpson), Processa bermudensis (Rankin) and P. hemphilli Manning & Chace - which are largely restricted to coastal and inshore shelf waters less than 50 m deep; and (2) Subtropical species - Alpheus pouang Chris toffersen, A. puapeba Christoffersen, Merhippolyte americana Holthuis, Tozeuma serratum A. Milne Edwards, Processa guyanae. Holthuis and P. profunda Manning & Chace - which are largely restricted to the outer portion of the continental shelf within the studied area. Considering the temperature and distributional data available for each species, it is suggested that the poleward boundaries of O. alphaerostris are set by maximum summer temperatures of about 20ºC required for the reproduction of the species, while the poleward boundaries of most of the tropical and subtropical species are set by minimum winter temperatures critical for their survival: about 15ºC for A. floridanus, about 11ºC for E. oplophoroides, about 9ºC for A. pouang, L. parvulus, P. guyanae., P. guyanae and P. hemphilli, and P. profunda and about 8ºC for A. puapeba and M. americana. It is further suggested that the shoreward boundaries of some of the subtropical species are set by maximum summer temperatures critical for their survival: about 20-22ºC for A. puapzba and about 17-18ºC for A. pouang and M. americana.

  11. Roadkills of vertebrates in Venezuela / Vertebrados mortos em estradas na Venezuela

    Scientific Electronic Library Online (English)

    Jan, Pinowski.


    Full Text Available Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-o [...] utubro). Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae), durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 raposas Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766) (Myrmecophagidae), 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae). Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae). Abstract in english This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October). During five passages on [...] this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae) during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae), 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776) (Canidae), 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758) (Myrmecophagidae), 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766) (Hydrochaeridae) and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae). Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae).

  12. Roadkills of vertebrates in Venezuela Vertebrados mortos em estradas na Venezuela

    Directory of Open Access Journals (Sweden)

    Jan Pinowski


    Full Text Available This paper presents an analysis of vertebrate roadkills in five different habitats of tropical South America. Observations of vertebrate roadkills were conducted in 1978, on a 572 km road between Caracas and Mantecal/Apure in Venezuela, during the rainy season (June-October. During five passages on this route, which includes five distinct habitats, 79 vertebrate carcasses - mammals and reptiles - were found. If we assume that the carcasses remain for two days on the road, vehicles can be expected to strike 350 spectacled caimans Caiman crocodilus Linnaeus, 1758 (Alligatoridae during the rainy season alone. Similar calculations for other species yield 313 snakes and lizards, 294 opossums Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 crab-eating foxes Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduas Tamandua tetradactyla (Linnaeus, 1758 (Myrmecophagidae, 55 capybaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae and 37 eastern cottontails Sylvilagus floridanus Allen, 1890 (Leporidae. Numerous papers have been published on vertebrates killed by vehicles on roads in Europe, North America, and Australia, and several papers are available regarding vertebrate roadkills in Africa and Asia. From South America there are several papers on vertebrates, birds, and mammals, whereas from Venezuela only one and it deals with iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.Este trabalho apresenta uma análise de vertebrados mortos em estrada em cinco habitats tropicais diferentes na América do Sul. As observações dos vertebrados mortos em estrada foram feitas em 1978, a 572 km da rodovia entre Caracas e Mantecal/Apure na Venezuela, durante a estação das chuvas (junho-outubro. Durante cinco passagens nesta rota, a qual inclui cinco habitats diferentes, foram encontradas 79 carcaças de vertebrados - répteis e mamíferos. Assumindo que as carcaças permaneçam por dois dias na estrada, é esperado que veículos matem 350 crocodilos Caiman crocodilus Linnaeus, 1758 (Alligatoridae, durante a estação das chuvas. Cálculos similares foram feitos para outras 313 espécies de cobras e lagartos, 294 gambás Didelphis marsupialis Linnaeus, 1758 (Didelphidae, 220 raposas Cerdocyon thous (Linnaeus, 1776 (Canidae, 129 tamanduás Tamanduá tetradactyla (Linnaeus, 1766 (Myrmecophagidae, 55 capivaras Hydrochaerus hydrochaeris (Linnaeus, 1766 (Hydrochaeridae e 37 lebres Sylvilagus floridanus Allen, 1890 (Leporidae. Numerosos trabalhos têm sido publicados sobre vertebrados mortos por veículos em estradas da Europa, América do Norte e Austrália e vários trabalhos têm sido referências úteis sobre vertebrados mortos em estradas na África e Ásia. Da América do Sul existem vários trabalhos com vertebrados, pássaros e mamíferos, sendo que da Venezuela existe apenas um que tenha tratado de iguanas (Iguana iguana Linnaeus, 1758, Iguanidae.

  13. Fototrampeo de mamíferos en la Sierra Nanchititla, México: abundancia relativa y patrón de actividad

    Scientific Electronic Library Online (English)

    Octavio, Monroy-Vilchis; Martha M, Zarco-González; Clarita, Rodríguez-Soto; Leroy, Soria-Díaz; Vicente, Urios.


    Full Text Available La conservación de las especies y su manejo adecuado dependen de la disponibilidad de información sobre sus poblaciones, por ello es importante estudiar aspectos como la abundancia y el patrón de actividad. En esta investigación se utilizaron trampas-cámara para obtener índices de abundancia relativ [...] a y establecer el patrón de actividad de los mamíferos medianos y grandes de la Sierra Nanchititla, México. El trabajo se llevó a cabo durante el periodo de diciembre de 2003 a mayo de 2006, con un esfuerzo total de 4 305 días-trampa. Se obtuvieron 897 fotografías de 19 especies, las más abundantes fueron: Nasua narica, Sylvilagus floridanus y Urocyon cinereoargenteus, de acuerdo con el índice de abundancia relativa (IAR, número de registros independientes/100 días trampa), coincidiendo con estudios basados en métodos indirectos. El patrón de actividad de las especies registradas mostraron que el 67% son de hábitos nocturnos. Algunas especies mostraron diferencias con los patrones mencionados por otros autores, las cuales se relacionan principalmente con la estacionalidad, la disponibilidad de recursos y el sexo de los individuos Abstract in english Mammals’ camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns. Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity [...] pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days), and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. Rev. Biol. Trop. 59 (1): 373-383. Epub 2011 March 01.

  14. Fototrampeo de mamíferos en la Sierra Nanchititla, México: abundancia relativa y patrón de actividad

    Directory of Open Access Journals (Sweden)

    Octavio Monroy-Vilchis


    Full Text Available La conservación de las especies y su manejo adecuado dependen de la disponibilidad de información sobre sus poblaciones, por ello es importante estudiar aspectos como la abundancia y el patrón de actividad. En esta investigación se utilizaron trampas-cámara para obtener índices de abundancia relativa y establecer el patrón de actividad de los mamíferos medianos y grandes de la Sierra Nanchititla, México. El trabajo se llevó a cabo durante el periodo de diciembre de 2003 a mayo de 2006, con un esfuerzo total de 4 305 días-trampa. Se obtuvieron 897 fotografías de 19 especies, las más abundantes fueron: Nasua narica, Sylvilagus floridanus y Urocyon cinereoargenteus, de acuerdo con el índice de abundancia relativa (IAR, número de registros independientes/100 días trampa, coincidiendo con estudios basados en métodos indirectos. El patrón de actividad de las especies registradas mostraron que el 67% son de hábitos nocturnos. Algunas especies mostraron diferencias con los patrones mencionados por otros autores, las cuales se relacionan principalmente con la estacionalidad, la disponibilidad de recursos y el sexo de los individuosMammals’ camera-trapping in Sierra Nanchititla, Mexico: relative abundance and activity patterns. Species conservation and their management depend on the availability of their population behavior and changes in time. This way, population studies include aspects such as species abundance and activity pattern, among others, with the advantage that nowadays new technologies can be applied, in addition to common methods. In this study, we used camera-traps to obtain the index of relative abundance and to establish activity pattern of medium and large mammals in Sierra Nanchititla, Mexico. The study was conducted from December 2003 to May 2006, with a total sampling effort of 4 305 trap-days. We obtained 897 photographs of 19 different species. Nasua narica, Sylvilagus floridanus and Urocyon cinereoargenteus were the most abundant, in agreement with the relative abundance index (RAI, number of independent records/100 trap-days, and according to previous studies with indirect methods in the area. The activity patterns of the species showed that 67% of them are nocturnal, except Odocoileus virginianus, Nasua narica and others. Some species showed differences with previously reported patterns, which are related with seasonality, resources availability, organism sex, principally. The applied method contributed with reliable data about relative abundance and activity patterns. Rev. Biol. Trop. 59 (1: 373-383. Epub 2011 March 01.

  15. Density and habitat requirements of sympatric hares and cottontails in northern Italy

    Directory of Open Access Journals (Sweden)

    Anna Vidus Rosin


    Full Text Available Abstract From 2005 to 2009, densities and habitat selection by the European hare (Lepus europaeus and Eastern cottontail (Sylvilagus floridanus were assessed during feeding activity in an intensively cultivated area in northern Italy. Hare average density (74 ind./km2 was comparable to the highest values reported for European farming areas. Preand post-breeding density fluctuated widely across the study years, probably as a consequence of changes in the carrying capacity of the study area. Cottontail population size progressively increased, as expected for a recently introduced species supported by high reproductive performances. Hares used both crops and spontaneous vegetation during their feeding activity. Conversely, cottontails avoided winter cereals and preferred to feed on alfalfa. Our results suggest that simplified agro-ecosystems cannot maintain high density hare populations even at a short time scale. Landscape heterogeneity could enhance the chances of coexistence between the two lagomorphs.
    Riassunto Densità ed esigenze ecologiche della lepre e del silvilago in condizioni di simpatria in Italia settentrionale Tra il 2005 e il 2009, la densità e l’uso del habitat durante l’attività di alimentazione da parte della Lepre europea (Lepus europaeus e del Silvilago (Sylvilagus floridanus sono stati indagati in un’area intensamente coltivata nell’Italia settentrionale. La densità media della lepre nell’area di studio (74 ind./km2 corrisponde ai valori maggiori riportati per le aree agricole europee. Le densità pre- e post riproduttive della lepre hanno mostrato sensibili fluttuazioni durante il periodo di studio, probabilmente dovute ai cambiamenti stagionali della capacità portante dell’area di studio. L’abbondanza del silvilago è aumentata durante gli ultimi tre anni di studio, come prevedibile per una specie, a bassa densità, ben adattata agli ambienti agricoli e supportata da una elevata performance riproduttiva. Durante l’attività di alimentazione, le lepri hanno utilizzato sia le coltivazioni sia la vegetazione spontanea. Invece, il silvilago ha evitato i cereali autunnali e selezionato l’erba medica. I risultati suggeriscono che ambienti agricoli semplificati non sono in grado di mantenere popolazioni di lepre ad alte densità nemmeno per brevi periodi di tempo. Ambienti eterogenei potrebbero favorire la coesistenza tra le due specie di lagomorfi.


  16. Ocorrência e recrutamento larval de Teredinidae (Mollusca, Bivalvia) na região do Sistema Costeiro Cananéia-Iguape, São Paulo, Brasil / The occurrence and larval recruitment of Teredinidae (Mollusca, Bivalvia) in Cananeia-Iguape Coastal System, São Paulo, Brazil

    Scientific Electronic Library Online (English)

    Daniela T. de, Moraes; Clemente, Coelho Jr.; Rafael C. G. da, Cruz; Sônia G. B. C., Lopes.


    Full Text Available A ocorrência e o recrutamento larval de Teredinidae na região do Sistema Costeiro Cananéia-Iguape foram acompanhados por doze meses utilizando-se coletores laminados de pinho, instalados em três estações dentro do bosque de mangue (mediolitoral) e em uma estação, localizada no infralitoral. No mangu [...] ezal, a colonização por larvas de teredinídeos ocorreu após quatro meses de permanência dos coletores na estação mais frequentemente inundada pela maré e somente após oito meses nas duas estações com menor frequência de inundação. No infralitoral, após quatro meses, os coletores já estavam consideravelmente danificados. Ao longo do experimento, houve um decréscimo no número de teredinídeos, especialmente no infralitoral, ocasionado possivelmente pela competição por alimento e espaço entre teredinídeos e foladídeos. Foram encontrados 2.658 indivíduos, sendo 704 de Teredinidae e 1.954 de Pholadidae. Entre os teredinídeos, Bankia fimbriatula foi a espécie mais abundante tanto no infralitoral quanto no manguezal, seguida de Bankia gouldi e Lyrodus floridanus que ocorreram somente no infralitoral, e Nausitora fusticula encontrada somente no manguezal. Martesia striata, único foladídeo, ocorreu somente no infralitoral. Abstract in english The occurrence and larval settlement of Teredinidae in Cananéia-Iguape Coastal System were observed for one year, by using laminated pinewood panels installed in three stations inside the mangrove forest (intertidal zone) and in one station, in the infralittoral. In the mangrove forest, the larval c [...] olonization occurred after four months in the most frequently flooded station and after eight months in the two less frequent flooded stations. In the infralittoral, the panels were highly infested after four months. Along the experiment, the number of individuals decreased, especially in the infralittoral, possibly due to competition between teredinids and pholadids for wood. Bankia fimbriatula was the most abundant teredinid, occurring in the infralittoral and in the mangrove area, followed by Bankia gouldi and Lyrodus floridanus, which occurred only in the infralittoral and Nausitora fusticula which was found only in the mangrove forest. In total, 704 individuals of Teredinidae were collected. Martesia striata, the single pholadid, was found in the infralittoral, and totaled 2,658 individuals.

  17. A new species of Symbra (Hymenoptera, Eurytomidae, Heimbrinae from dry forest in Brazil and new occurrence records for other Heimbrinae Uma nova espécie de Symbra (Hymenoptera, Eurytomidae, Heimbrinae de uma área de Caatinga e novos registros de ocorrência de outros Heimbrinae

    Directory of Open Access Journals (Sweden)

    Daniell Rodrigo Rodrigues Fernandes


    Full Text Available The geographic ranges of Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 and H. parallela Stage & Snelling, 1986 are extended based on study of material deposited in the entomological collections of the Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brazil of the Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brazil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae is described, illustrated and compared with S. cordobensis Stage & Snelling, 1986, the single species previously known for this genus. A key to the genera of Heimbrinae and to the species of Symbra is provided.Os limites geográficos de Heimbra opaca (Ashmead, 1894, H. bicolor Subba Rao, 1978 e H. parallela Stage & Snelling, 1986 são estendidos com base no material examinado das coleções entomológicas do Laboratório de Sistemática e Bioecologia de Parasitoides e Predadores da APTA (Ribeirão Preto, SP, Brasil e do Instituto Brasileiro de Geografia e Estatística (Brasília, DF, Brasil. Symbra potiguara Perioto & Fernandes sp. nov. (Hymenoptera, Eurytomidae é descrita, ilustrada e comparada com a única espécie conhecida desse gênero, S. cordobensis Stage & Snelling, 1986. Uma chave para os gêneros de Heimbrinae e para as espécies de Symbra é fornecida.

  18. Períodos de ausência de presas e estabilidade do controle biológico do ácaro-rajado / Periods of prey absence and stability of the spider mite biological control

    Scientific Electronic Library Online (English)

    Hamilton, Oliveira; Vanessa, Duarte; Daniela, Rezende; Marcos Antônio Matiello, Fadini; Angelo, Pallini.


    Full Text Available O objetivo deste trabalho foi avaliar os parâmetros biológicos do ácaro predador Phytoseiulus macropilis na ausência de alimento por períodos de um a seis dias. Foram avaliados: o número de ovos por fêmea ao dia; o número total de ovos; a longevidade de fêmeas; e a razão sexual dos descendentes. Fêm [...] eas que ficaram por mais de três dias sem alimento apresentaram queda em todas variáveis biológicas avaliadas. O predador P. macropilis somente se estabelecerá em campo se as manchas ocupadas pelo ácaro-rajado não estiverem muito distantes umas das outras. Abstract in english The objective of this work was to access the biological parameters of the predator mite Phytoseiulus macropilis in the food absence for periods of one or more days. Data evaluated were: egg number per female per day; total number of eggs; longevity of females; and the offspring sex rate. Female in s [...] tarvation for three or more days showed decrease in all biological variables. P. macropilis only will settle in the field if patch populations occupied by spider mite are not very distant from each other.

  19. Períodos de ausência de presas e estabilidade do controle biológico do ácaro-rajado Periods of prey absence and stability of the spider mite biological control

    Directory of Open Access Journals (Sweden)

    Hamilton Oliveira


    Full Text Available O objetivo deste trabalho foi avaliar os parâmetros biológicos do ácaro predador Phytoseiulus macropilis na ausência de alimento por períodos de um a seis dias. Foram avaliados: o número de ovos por fêmea ao dia; o número total de ovos; a longevidade de fêmeas; e a razão sexual dos descendentes. Fêmeas que ficaram por mais de três dias sem alimento apresentaram queda em todas variáveis biológicas avaliadas. O predador P. macropilis somente se estabelecerá em campo se as manchas ocupadas pelo ácaro-rajado não estiverem muito distantes umas das outras.The objective of this work was to access the biological parameters of the predator mite Phytoseiulus macropilis in the food absence for periods of one or more days. Data evaluated were: egg number per female per day; total number of eggs; longevity of females; and the offspring sex rate. Female in starvation for three or more days showed decrease in all biological variables. P. macropilis only will settle in the field if patch populations occupied by spider mite are not very distant from each other.

  20. Development, survival and reproduction of Podisus nigrispinus (Dallas, 1851 (Heteroptera: Pentatomidae with salt and amino acids solutions supplementary diet

    Directory of Open Access Journals (Sweden)

    Simone Patrícia Carneiro Freitas


    Full Text Available This study presents the effect of a supplementary diet with amino acids and sodium chloride solutions in addition to prey on the development, survival and reproduction of the predator Podisus nigrispinus (Heteroptera, Pentatomidae. Both solutions showed deleterious effects on nymph survival, adult weight, female longevity, number of egg masses, eggs per female, eggs per egg mass and nymphs per female besides egg viability of P. nigrispinus when compared with diet with water and prey. When compared with plant supplements in the diet the use of amino acids and salt solutions for mass rearing of P. nigrispinus was inferior.O presente estudo mostra o efeito da suplementação alimentar com soluções de aminoácidos e salina (NaCl no desenvolvimento, sobrevivência e reprodução de Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae. Ambas soluções causaram efeito deletério na sobrevivência ninfal, peso dos adultos, longevidade das fêmeas e nos números de posturas, de ovos/fêmea, de ovos/postura e de ninfas, bem como na viabilidade dos ovos de P. nigrispinus quando comparado com estes insetos que além de presa receberam água. Estes resultados são discutidos em comparação com o efeito positivo que a suplementação alimentar com plantas tem sido relatada para esses predadores e sugerem que o uso de plantas é melhor que a substituição por solução de aminoácidos em sistemas de criação em laboratório desses predadores.

  1. Caracterização da microfauna em estação de tratamento de esgotos do tipo lodos ativados: um instrumento de avaliação e controle do processo / Microfauna characterization in activated sludge wastewater treatment plant: an instrument of assessment and control of process

    Scientific Electronic Library Online (English)

    Alessandra Pellizzaro, Bento; Pablo Heleno, Sezerino; Luiz Sergio, Philippi; Valeria, Reginatto; Flavio Rubens, Lapolli.


    Full Text Available A microfauna presente em uma ETE por lodos ativados foi caracterizada, correlacionada com parâmetros físico-químicos e utilizada em modelos existentes de avaliação de sistemas. Durante 351 dias o lodo ativado manteve-se estável com flocos compactos, pequenos e com poucos filamentos. Os protozoários [...] predominantes no lodo foram as tecamebas e os ciliados predadores de flocos, indicando estabilidade do sistema. Os métodos propostos em literatura, baseados no IBL, na densidade total da microfauna e na relação entre ciliados predadores de flocos e ciliados fixos, mostraram-se eficientes para o diagnóstico das condições depurativas do sistema. A análise qualitativa do lodo, englobando o tamanho, quantidade de filamentos, compactação e a identificação das espécies dominantes, foi suficiente para uma caracterização imediata das condições depurativas do sistema de tratamento. Abstract in english Microfauna found in an activated sludge WTP was characterized, correlated to the physical-chemical parameters and used in existing assessment models. During 351 days, the activated sludge remained stable with compacted and small poorly filamentous flocs. It was composed mainly by testate amoebas and [...] crawling ciliates that indicated the stability of the system. The application of the existent system evaluation models to microfauna (SBI, crawling ciliate/attached ciliate relation and total density) was found to be efficient for the assessment of the system depurative conditions. The sludge qualitative analysis, which included the flocs size, amount of filaments, compacting and the identification of the dominant microfauna species, was enough to an immediate diagnosis of the treatment system depurative conditions.

  2. Consumo alimentar de Chrysoperla externa sobre as diferentes fases de desenvolvimento de Dysmicoccus brevipes, em laboratório Food consumption of Chrysoperla externa in different developmental phases of Dysmicoccus brevipes, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    Rita de Cássia Rodrigues Gonçalves-Gervásio


    Full Text Available Estudou-se o consumo e preferência alimentar de larvas de Chrysoperla externa Hagen, 1861 (Neuroptera: Chrysopidae em laboratório à temperatura de 25±2°C, 70±10% UR e 12 horas de fotofase, utilizando como presa a cochonilha-do-abacaxi (Dysmicoccus brevipes Cockerell, 1893, Hemiptera: Pseudococcidae. Durante a fase larval do predador foram consumidas, em média, 70, 50 e 15,8 cochonilhas do primeiro, segundo e terceiro ínstar, respectivamente, e 10 fêmeas adultas, num total de 145,8 indivíduos. Do número total de cochonilhas, 51% foram consumidos durante o terceiro ínstar do predador. O alto número de cochonilhas consumido demonstra que a C. externa apresenta potencial para ser utilizada no controle biológico da cochonilha D. brevipes.The food consumption and preference of larvae of Chrysoperla externa Hagen, 1861 (Neuroptera: Chrysopidae larval were studied in laboratory under 25±2°C, 70±10% RH and 12 hours photophase, utilizing the pineapple mealybug (Dysmicoccus brevipes Cockerell, 1893, Hemiptera: Pseudococcidae as a prey. The results showed that the predator's larval phases consumed on average of 70, 50 and 15,8 mealybugs of the first, second and third instar, respectively, and 10 adult females amounting to 145,8 individuals. It was noticed that 51% of the total number of mealybugs were consumed during the predator third instar. The high number of mealybugs consumed shows that C. externa presents a potential to be utilized in biological control of the mealybug D. brevipes.

  3. A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates

    Directory of Open Access Journals (Sweden)

    Cristina Sazima


    Full Text Available Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos peixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores.

  4. A non-digging zoobenthivorous fish attracts two opportunistic predatory fish associates

    Scientific Electronic Library Online (English)

    Cristina, Sazima; Alice, Grossman.


    Full Text Available Entre os peixes recifais, uma espécie fossadora nuclear em atividade de forrageamento pode atrair seguidores oportunistas que se alimentam de organismos expostos pela atividade do nuclear. O coió-voador Dactylopterus volitans alimenta-se de animais bentônicos, principalmente crustáceos e pequenos pe [...] ixes, explorando o substrato com os primeiros raios externos de suas nadadeiras peitorais. Registramos o coió sendo seguido por dois predadores oportunistas, a guarajuba Caranx bartholomaei e a piraúna Cephalopholis fulva, em Fernando de Noronha, ao largo da costa Nordeste do Brasil. Apesar de não agir como uma espécie fossadora do substrato, o coió atua como uma espécie nuclear por explorar os tufos de algas e também pela sua passagem próxima às rochas e lajes, espantando e desentocando animais escondidos que, assim, tornam-se vulneráveis aos predadores. Abstract in english Following behaviour among reef fishes involves mostly a digging nuclear species while foraging, which attracts opportunistic followers preying on the exposed organisms. The flying gurnard Dactylopterus volitans preys on benthic animals, mostly crustaceans and small fishes, scratching and probing the [...] bottom with the inner rays of its pectoral fins. We recorded the flying gurnard being followed by two opportunistic predators, the yellow jack Caranx bartholomaei and the coney Cephalopholis fulva at Fernando de Noronha, off northeast Brazil. Albeit not actually digging the substrate, the flying gurnard acts as a nuclear species by exploring algae tufts and by its wandering near the boulders and ledges, disturbing and flushing out hidden animals which thus become available to predation.

  5. Predation on Tropidurus hispidus (Squamata: Tropiduridae) by Lasiodora klugi (Aranea: Theraphosidae) in the semiarid caatinga region of northeastern Brazil / Predação sobre Tropidurus hispidus (Squamata: Tropiduridae) por Lasiodora klugi (Aranea: Theraphosidae) na região de caatinga semiárida do nordeste do Brasil

    Scientific Electronic Library Online (English)

    Washington Luiz Silva, Vieira; Maria Betânia Ribeiro, Gonçalves; Rômulo Pantoja, Nóbrega.


    Full Text Available Um evento de predação sobre Tropidurus hispidus (Tropiduridae) pela aranha caranguejeira Lasiodora klugi (Theraphosidae) foi observado em área de caatinga arbórea no nordeste do Brasil. Artrópodes são potenciais predadores de pequenos vertebrados e pesquisadores têm relatado eventos de predação envo [...] lvendo aranhas e herpetofauna em regiões neotropicais. Portanto, a presente comunicação breve é o segundo caso de predação de aranha sobre lagartos do gênero Tropidurus no Brasil e o primeiro para as caatingas semiáridas, reforçando a argumentação de que grandes aranhas possuem um papel relevante como predadores desses animais. Abstract in english A predation event on Tropidurus hispidus (Tropiduridae) by the crab spider Lasiodora klugi (Theraphosidae) was observed in an arboreal caatinga area in northeastern Brazil. Arthropods are potential predators of small vertebrates and researchers have reported predation events involving spiders and he [...] rpetofauna in Neotropical regions. As such, the present short communication is the second case of predation of spiders on Tropidurus lizards in Brazil, and the first for the semiarid caatinga, reinforcing the argument that large spiders have relevant roles as predators of these animals.

  6. Dieta de Leopardus colocolo (Carnivora: Felidae en la Reserva Nacional de Junín, Junín, Perú

    Directory of Open Access Journals (Sweden)

    Ursula Fajardo


    Full Text Available Este estudio caracteriza la dieta de Leopardus colocolo en los alrededores del lago Junín, en el centro del Perú, a partir de los restos de las presas presentes en 43 heces. El origen de las heces del predador se determinó a partir del ADN mitocondrial de las células epiteliales intestinales adheridas a la superficie de las heces, utilizando como marcador la región de control. Los restos de las presas fueron identificados utilizando literatura especializada y la comparación con especímenes de colección, identificando un total of 14 ítems alimenticios pertenecientes a mamíferos de las familias Cricetidae (6, Chinchillidae (1 y Caviidae (1 y aves de las familias Anatidae (3 y Rallidae (2, y un grupo de aves no identificadas (1. Los roedores fueron el principal componente de la dieta de L. colocolo, en frecuencia y biomasa, seguido por las aves. Entre los ítems alimenticios consumidos, el roedor cricétido pequeño Calomys sp. fue el más frecuente; sin embargo, el mayor aporte de biomasa relativa fue proporcionado por el roedor mediano Cavia tschudii. La amplitud de nicho obtenida fue baja (Bsta= 0.17, indicando una dieta especializada. Nuestros resultados confirman que, como ocurre con la mayoría de felinos pequeños neotropicales, L. colocolo es un predador especializado en la captura de vertebrados, principalmente mamíferos pequeños. No se registró variación estacional en la dieta y el análisis de las clases de edad de los roedores cricétidos mostró que los adultos fueron los más consumidos. Se infiere que L. colocolo tiene un patrón de actividad diurno y nocturno.

  7. Controller design techniques for the Lotka-Volterra nonlinear system

    Directory of Open Access Journals (Sweden)

    Magno Enrique Mendoza Meza


    Full Text Available A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species. In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, that the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies. Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional. Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico.

  8. Estudio del comportamiento de una jauría de perros ferales presente en el humedal de La Conejera (Compartir-Suba, Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Zerda Ordóñez Enrique


    Full Text Available Los perros ferales son un problema en la actualidad para las instituciones encargadas en el cuidado de los diferentes humedales presentes en la ciudad de Bogotá, debido a la constante amenaza que estos animales representan para la fauna residente en estos espacios en recuperación. Se utilizaron técnicas de observación directa y registro indirecto para obtener una descripción morfológica de cada uno de los animales y realizar un catálogo comportamental de los perros tanto a nivel individual como social. Los muestreos se realizaron entre agosto y septiembre de 2005 en el humedal de La Conejera (Compartir-Suba, Bogotá, Colombia. Se registraron diez individuos pertenecientes a un mismo grupo social, conformado por siete machos y tres hembras. La organización social de los perros mostró semejanzas con la de sus antecesores los lobos, presentando básicamente dos líneas jerárquicas siendo una para los machos y una para las  hembras, cada una con un macho y hembra alpha respectivamente. Los perros encuentran al interior del humedal los recursos necesarios como es abrigo,agua y alimento suficiente para su supervivencia y la de sus crías, debido a la ausencia de otros predadores que luchan por los mismos recursos, teniendo mejor acceso y menor competencia. Se realizan observaciones y recomendaciones para implementar en contra de la supervivencia y permanencia de estos animales en lugares donde se tenga fauna silvestre amenazada por este tipo de predadores.

  9. Efeitos do plantio direto e da consorciação soja-milho sobre inimigos naturais e pragas

    Directory of Open Access Journals (Sweden)

    Cividanes Francisco Jorge


    Full Text Available Procurou-se avaliar os efeitos do plantio direto e da consorciação soja (Glycine max (L. Merrill e milho (Zea mays L. sobre pragas e inimigos naturais. Os tratamentos constituíram um fatorial 3 x 2 (monocultura de soja, monocultura de milho, consorciação soja-milho x plantio direto, plantio convencional, em blocos casualizados. Os insetos foram amostrados pelo método do pano, rede entomológica, procura visual e armadilha de sucção. Entre os insetos-pragas do milho, Maecolaspis assimilis ocorreu em maior número no sistema de plantio convencional; o mesmo ocorreu com os predadores Cycloneda sanguinea e Doru sp. Por outro lado, M. assimilis e o predador Toxomerus sp. foram mais numerosos na monocultura de milho em relação à cultura do milho consorciado com soja. Dos insetos-pragas da soja, destacaram-se pelo maior número Anticarsia gemmatalis e Diabrotica gracilenta, no sistema de plantio convencional, e o mesmo aconteceu com a espécie da família Trichogrammatidae, enquanto as espécies da família Eulophidae foram mais numerosas na soja sob sistema de plantio direto. Na soja consorciada com milho foi maior o número de insetos-pragas Megalotomus sp. e Maecolaspis sp. e dos inimigos naturais Geocoris sp., Lebia concina, Orius sp., Braconidae e Scelionidae.

  10. Energy density of freshwater Patagonian organisms / Densidad energética de los organismos Patagónicos de agua dulce

    Scientific Electronic Library Online (English)

    Javier, Ciancio; Miguel, Pascual.


    Full Text Available La densidad energética de los organismos puede ser utilizada con distintos fines como evaluar la calidad de la dieta, comparar la importancia de distintas presas para un predador, corregir las tasas de evacuación gástrica de modelos, explicar el comportamiento de forrajeo de ciertos predadores o det [...] erminar su estado fisiológico. Consiste en un parámetro fundamental para el modelado bioenergético de ecosistemas. En este trabajo estimamos la densidad energética de los principales grupos de los ecosistemas de agua dulce de la Patagonia, incluyendo peces, crustáceos, gasterópodos, oligoquetos e insectos. Encontramos que los peces (5048-5789 Cal/g) es el grupo energéticamente más denso seguido de los insectos (5062-5232), crustáceos (3364-3994), oligoquetos (3471) y finalmente los gasterópodos (1143). Abstract in english We assessed by using a bomb calorimeter the energy density of the main species of Patagonian freshwater ecosystems, including fish, crustaceans, gastropods, oligochaetes, and insects. Fish (5048-5789 Cal/g) were the most energy density group, followed by insects (5062- 5232), crustaceans (3364-3994) [...] , oligochaetes (3471) and gastropods (1143). These data consist on the first direct energy density estimations of freshwater species and are intended as a baseline information for modelling the energy fluxes in Patagonian freshwater ecosystems.

  11. The glassy sweepers' way: seeking a versatile wrasse to be cleaned

    Scientific Electronic Library Online (English)

    Cristina, Sazima; João Paulo, Krajewski; Roberta Martini, Bonaldo; Ivan, Sazima.


    Full Text Available Peixes recifais diurnos compõem a maioria dos clientes nas estações de peixes limpadores. Entretanto, algumas espécies com hábitos noturnos também procuram os peixes limpadores, ficando expostas a potenciais predadores diurnos quando precisam deixar seus abrigos. Registramos aqui as interações de li [...] mpeza entre um labrídeo diurno (Thalassoma noronhanum) e um cliente com hábitos noturnos (Pempheris schomburgki), que permanece abrigado durante o dia. Esta espécie de cliente deixa seu abrigo durante o dia e nada em direção a T. noronhanum quando este limpador desloca-se próximo aos esconderijos. Uma vez que T. noronhanum é capaz de manter estações de limpeza temporárias, próximas aos abrigos dos clientes, P. schomburgki diminui uma possível exposição aos predadores quando procura esta espécie versátil de limpador. Abstract in english Diurnal reef fishes compose the bulk of clients that seek cleaner fishes' services, but some nocturnal species that shelter at daytime also seek the cleaners. While doing so the nocturnal clients must leave their hiding places and thus they get exposed to potential diurnal predators. We report here [...] on the cleaning interactions between a daytime cleaner wrasse (Thalassoma noronhanum) and a night time active client (Pempheris schomburgki) that usually remains sheltered at daytime. We recorded P. schomburgki leaving their shelter at daytime and heading towards T. noronhanum, whenever the cleaner swam by the shelter. Since T. noronhanum is able to tend temporary cleaning station near the safety of the shelters of its clients, P. schomburgki lessens a possible risk of predation by seeking this versatile cleaner.

  12. The glassy sweepers' way: seeking a versatile wrasse to be cleaned

    Directory of Open Access Journals (Sweden)

    Cristina Sazima


    Full Text Available Diurnal reef fishes compose the bulk of clients that seek cleaner fishes' services, but some nocturnal species that shelter at daytime also seek the cleaners. While doing so the nocturnal clients must leave their hiding places and thus they get exposed to potential diurnal predators. We report here on the cleaning interactions between a daytime cleaner wrasse (Thalassoma noronhanum and a night time active client (Pempheris schomburgki that usually remains sheltered at daytime. We recorded P. schomburgki leaving their shelter at daytime and heading towards T. noronhanum, whenever the cleaner swam by the shelter. Since T. noronhanum is able to tend temporary cleaning station near the safety of the shelters of its clients, P. schomburgki lessens a possible risk of predation by seeking this versatile cleaner.Peixes recifais diurnos compõem a maioria dos clientes nas estações de peixes limpadores. Entretanto, algumas espécies com hábitos noturnos também procuram os peixes limpadores, ficando expostas a potenciais predadores diurnos quando precisam deixar seus abrigos. Registramos aqui as interações de limpeza entre um labrídeo diurno (Thalassoma noronhanum e um cliente com hábitos noturnos (Pempheris schomburgki, que permanece abrigado durante o dia. Esta espécie de cliente deixa seu abrigo durante o dia e nada em direção a T. noronhanum quando este limpador desloca-se próximo aos esconderijos. Uma vez que T. noronhanum é capaz de manter estações de limpeza temporárias, próximas aos abrigos dos clientes, P. schomburgki diminui uma possível exposição aos predadores quando procura esta espécie versátil de limpador.

  13. Controller design techniques for the Lotka-Volterra nonlinear system

    Scientific Electronic Library Online (English)

    Magno Enrique Mendoza, Meza; Amit, Bhaya; Eugenius, Kaszkurewicz.


    Full Text Available Uma ampla classe de modelos do tipo predador-presa pode ser escrita como um sistema dinâmico não linear em uma ou duas variáveis (espécies). Em diversos contextos é necessário introduzir um controle nessas dinâmicas. Este artigo foca-se em modelos de duas variáveis. Assume-se, de acordo com a praxe [...] em ecologia matemática, que o controle corresponde à remoção de uma proporção da população dos predadores (controle proporcional). Seis técnicas de projeto de controladores são aplicados ao modelo Lotka-Volterra, o qual é utilizado como um padrão ou "benchmark'' para avaliar e comparar estas técnicas em um contexto ecológico. Abstract in english A large class of predator-prey models can be written as a nonlinear dynamical system in one or two variables (species). In many contexts, it is necessary to introduce a control into these dynamics. In this paper we focus on models of two species, and assume, as is common in mathematical ecology, tha [...] t the control corresponds to a proportional removal of the predator population. Six controller design techniques are applied to the Lotka-Volterra model, which is thus used as a benchmark to evaluate and compare these techniques in an ecological context.

  14. Domácias e seu papel na defesa das plantas Domatia mediating plant defense

    Directory of Open Access Journals (Sweden)

    Cláudia Helena Cysneiros Matos


    Full Text Available Domácias são pequenas estruturas presentes na face inferior das folhas de diversas plantas de importância agrícola e têm sido descritas por serem tipicamente habitadas por ácaros (predadores e fungívoros que provêm benefícios às plantas. São estruturas extremamente complexas e não apresentam qualquer função fisiológica conhecida. Tem sido postulado que os ácaros se beneficiam das domácias pela obtenção de um local seguro para reprodução e proteção contra predadores e que as plantas também se beneficiam pela redução do ataque de herbívoros ou patógenos. Assim, ecologistas têm hipotetizado que as domácias mediam uma associação mutualística entre as plantas e os ácaros que protegem as folhas. Nesta revisão, é discutido o papel das domácias na defesa das plantas contra pequenos artrópodes.Leaf domatia are small structures found on the underside of the leaves of many plants of agricultural importance. Domatia have been described to be typically inhabited by mites (predators and fungivorous that provide benefits to the plant. The structures can be extremely complex and seem to have an unknown physiological function. It has been postulated that mites may get some benefit from leaf domatia by securing a safe place for reproduction and refuge from predators. Additionally, plants get benefits via reduced herbivory or pathogen attack. Hence, ecologists have hypothesized that domatia mediate a mutualistic association between plants and their bodyguard mites. In this review we discussed the pivotal role of the domatia in plant defenses against small arthropods.

  15. Biology of Brontocoris tabidus (Heteroptera: Pentatomidae) fed with Musca domestica (Diptera: Muscidae) larvae / Biologia de Brontocoris tabidus (Heteroptera: Pentatomidae) alimentado com larvas de Musca domestica (Diptera: Muscidae)

    Scientific Electronic Library Online (English)

    P., Jusselino-Filho; J. C., Zanuncio; D. B., Fragoso; J. E, Serrão; M. C., Lacerda.


    Full Text Available A performance reprodutiva e o desenvolvimento de Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) alimentado com larvas de Musca domestica L. (Diptera: Muscidae) foram investigados. A duração da fase ninfal desse predador foi de 31,2 dias, com sobrevivência de 44,1%. Os períodos de pré-ovi [...] posição e de incubação e o número de ovos por postura foram de 8,14 dias, 5,6 dias e 45,4 dias, respectivamente. B. tabidus apresentou viabilidade de ovos de 44,7%. A longevidade das fêmeas desse predador foi de 18,4 dias. Esses resultados são discutidos com ênfase ao uso de M. domestica em criação massal e manutenção de colônias de B. tabidus em condições de laboratório. Abstract in english Development and reproductive performance of Brontocoris tabidus (Signoret) (Heteroptera: Pentatomidae) fed with Musca domestica L. (Diptera: Muscidae) larvae was evaluated. Duration of the nymphal phase of this predator was 31.2 days, with a 44.1% survival rate. Preoviposition and egg incubation per [...] iods and number of eggs/egg mass were 8.14 days, 5.6 days, and 45.4, respectively. B. tabidus presented 44.7% egg viability. Female longevity of this predator was 18.4 days. Results are discussed based on this prey use in mass rearing and maintenance of colonies of B. tabidus under laboratory conditions.

  16. Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae remember antipredator training? Emas Rhea americana Linnaeus (Rheiformes, Rheidae se lembram do treinamento anti-predação?

    Directory of Open Access Journals (Sweden)

    Cristiano S. de Azevedo


    Full Text Available The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 captive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável.

  17. Do captive-born greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae) remember antipredator training? / Emas Rhea americana Linnaeus (Rheiformes, Rheidae) se lembram do treinamento anti-predação?

    Scientific Electronic Library Online (English)

    Cristiano S. de, Azevedo; Robert J., Young.


    Full Text Available O treinamento anti-predação é uma ferramenta poderosa usada atualmente para ajudar os animais reintroduzidos a reconhecer e escapar de seus predadores. Testar a capacidade de memória dos animais após o treinamento é importante para se avaliar a validade de sua aplicação. Um grupo de 15 emas nascidas [...] em cativeiro foi estudado no zoológico de Belo Horizonte. Oito aves foram treinadas contra predadores e sete não. Após o término dos treinamentos, foram realizados quatro testes de memória após 40, 55, 70 e 88 dias. Os testes de memória consistiam em apresentar um modelo de predador para as emas e anotar as respostas comportamentais exibidas. Foram medidas a capacidade de memória das aves, a influência do tamanho do grupo no comportamento das aves e a influência do treinamento anti-predação na estimulação de respostas comportamentais adequadas. Os resultados mostraram que as emas retiveram a capacidade de reconhecimento do predador por quase três meses após o término dos treinamentos, que o tamanho do grupo afeta as respostas das aves (mais comportamentos de defesa quando sozinhas) e que o treinamento anti-predação é essencial para estimular uma resposta comportamental adequada, uma vez que o grupo não treinado se comportou tranqüilamente perante o predador. Conclui-se que o treinamento anti-predação é válido para futuros programas de reintrodução de emas, uma vez que a capacidade de memória dessas aves é considerável. Abstract in english The antipredator training is a powerful tool now being used to help the reintroduced animals to recognise and escape from their predators. Testing the memory capacity of the animals after antipredator training is important to evaluate if the application of the training is worthwhile. A group of 15 c [...] aptive-born greater rheas was studied at Belo Horizonte Zoo. Eight birds were antipredator trained and seven birds were not. After the end of the antipredator training sessions, we run four memory tests at 40, 55, 70 and 88 days after training was completed. The memory tests consisted of showing a predator model to the rheas and recording their behavioural responses. It was measured the capacity of antipredator information storage, the influence of the group size on the behaviour of the birds and the influence of the antipredator training on the elicitation of the correct behavioural responses of the birds when confronted by a predator. The results showed that the rheas retained predator recognition for almost three months, that the group size affected the responses of the birds (more defence behaviours expressed when tested alone) and that the antipredator training is essential to elicit the adequate antipredatory responses, since untrained birds behaved in a tranquil manner when confronted by a predator model. We concluded that antipredator training is worthwhile for future reintroduction programs for greater rheas, since their memory capacity is considerable.

  18. Biological aspects and predatory capacity of Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) fed on Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) reared on cotton genotypes / Aspectos biológicos e capacidade predatória de Podisus nigrispinus (Dallas) (Hemiptera: Pentatomidae) alimentado com Alabama argillacea (Hübner) (Lepidoptera: Noctuidae) criada em genótipos de algodoeiro

    Scientific Electronic Library Online (English)

    Terezinha Monteiro dos, Santos; Arlindo Leal, Boiça Jr..


    Full Text Available Plantas hospedeiras podem influenciar indiretamente as características biológicas do predador, de maneira positiva ou negativa, ressaltando assim a importância de estudos relacionando o efeito de cultivares sobre o terceiro nível trófico. Este trabalho avalia os aspectos biológicos e a capacidade pr [...] edatória de adultos de Podisus nigrispinus alimentados com lagartas de Alabama argillacea criadas em genótipos de algodoeiro. Diariamente o predador foi alimentado com lagartas de quarto ínstar criadas com folhas de algodoeiro CNPA Precoce 1 (média pilosidade), CNPA 9211-31 (alto teor de gossipol), CNPA 9211-41 (teor médio de gossipol) e GL2 GL3 (sem gossipol). Essas plantas oferecidas como alimento às lagartas não influenciaram os períodos de pré-oviposição, oviposição e pós-oviposição e a capacidade de oviposição do predador. O peso médio das fêmeas foi maior (126,2 mg) quando elas foram alimentadas com lagartas de A. argillacea criadas em folhas do genótipo GL2 GL3, em comparação com aquele (96,2 mg) de fêmeas que se alimentaram de lagartas criadas em folhas do genótipo CNPA 9211-41. A longevidade de fêmeas do predador variou de 30,7 a 31,5 dias, enquanto que a dos machos apresentou intervalo de variação de 38,0 a 66,3 dias. Fêmeas de P. nigrispinus predaram, em média, de 125,2 a 184,0 lagartas, durante a fase adulta, enquanto os machos predaram no mínimo 135,7 e no máximo 205,0 lagartas. Para o controle de A. argillacea, a utilização de plantas resistentes em associação com P. nigrispinus é viável, pois genótipos resistentes não influenciam negativamente as características biológicas do predador. Abstract in english Host plants may influence indirectly biological characteristics of predators, on a positive or negative way, poiting out the importance of studies evaluating the effect of cultivars on the third trophic level. This study evaluates the biological aspects and predatory capacity of Podisus nigrispinus [...] adults fed Alabama argillacea larvae reared on cotton genotypes. The predator was fed daily with fourth instar larvae reared on leaves of the following genotypes CNPA Precoce 1 (hirsute), CNPA 9211-31 (high gossypol level), CNPA 9211-41 (medium gossypol level) and GL2 GL3 (gossypol glandless). The pre-oviposition, oviposition and post-oviposition periods and the oviposition capacity of P. nigripinus were not affected when preyed on cotton leafworms reared on the listed cotton genotypes. Mean weight of predator females was higher (126.2 mg) when they fed on A. argillacea reared on GL2 GL3 cotton leaves, in comparison to the observed weight (96.2mg) of P. nigripinus females fed on larvae reared on CNPA 9211-41. Longevity of P. nigrispinus ranged 30.7 to 31.5 days for females and 38.0 to 66.3 days for males. P. nigrispinus females preyed 125.2 to 184.0 A. argillacea larvae during its adult stage, while adult males preyed 135.7 to 205.0 leafworms. Using plant resistance in association with P. nigrispinus is viable to control A. argillacea, because resistant genotypes do not influence negatively the biological characteristics of the predator.

  19. Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil

    Directory of Open Access Journals (Sweden)

    WJ. Minto


    Full Text Available The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical contact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A predator and kairomones present and B predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A predator and kairomones absent and B the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity and food (algae did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do contato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A predador e "kairomones" presentes e B predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A predador e "kairomones" ausentes e B igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica e alimento (algas não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones".

  20. Experiments on the influence of Chaoborus brasiliensis Theobald, 1901 (Diptera: Chaoboridae) on the diel vertical migration of microcrustaceans from Lake Monte Alegre, Brazil / Experimentos sobre a influência de Chaoborus brasiliensis (Diptera: Chaoboridae) sobre a migração vertical de microcrustáceos do Lago Monte Alegre, Brasil

    Scientific Electronic Library Online (English)

    WJ., Minto; MS., Arcifa; A., Perticarrari.


    Full Text Available O objetivo deste trabalho foi avaliar se a migração vertical dos microcrustáceos do Lago Monte Alegre é relacionada aos predadores invertebrados, nomeadamente larvas de Chaoborus brasiliensis. A hipótese testada no experimento foi a de que o comportamento migratório da presa seria dependente do cont [...] ato físico com as larvas de Chaoborus ou dos "kairomones" liberados por elas. Dois experimentos foram realizados no laboratório, com dois tratamentos e três réplicas cada. Os experimentos foram feitos dentro de cilindros de acrílico de 1,5 m de altura e 0,20 m de diâmetro. Os tratamentos do Experimento I foram: A) predador e "kairomones" presentes e B) predador e "kairomones" presentes, mas o predador isolado em tubos de rede dentro do cilindro, não tendo contato físico com a presa. Os tratamentos do Experimento II foram: A) predador e "kairomones" ausentes e B) igual ao Experimento I. Fatores físicos e químicos (temperatura, oxigênio dissolvido, pH, condutividade elétrica) e alimento (algas) não influenciaram a distribuição vertical das presas, pois eles estavam quase homogeneamente distribuídos na coluna d'água em ambos os experimentos; as concentrações de alimento não foram limitantes. Copépodos adultos (Tropocyclops prasinus meridionalis e Thermocyclops decipiens) realizaram migração reversa no tratamento B dos dois experimentos; o cladócero Daphnia gessneri migrou de modo noturno no tratamento A do Experimento I; migração vertical não foi detectada para copepoditos, bem como para larvas de Chaoborus. Os experimentos indicaram que Daphnia respondeu ao contato físico com as larvas de Chaoborus e não aos "kairomones". Copépodos adultos foram aparentemente mais sensíveis aos "kairomones". Abstract in english The aim of this work was to evaluate whether diel vertical migration of microcrustaceans from Lake Monte Alegre is related to invertebrate predators, namely larvae of Chaoborus brasiliensis. The hypothesis tested in the experiments was that the migratory behaviour of prey would depend on physical co [...] ntact with Chaoborus brasiliensis larvae or with kairomones released by them. Two experiments were undertaken in the laboratory, with two treatments and three replicates each. Experiments were carried out in acrylic cylinders 1.5 m high and 0.20 m in diameter. Treatments in Experiment I were: A) predator and kairomones present and B) predator and kairomones present, but predator isolated in net tube inside the cylinder, having no physical contact with prey. Treatments in Experiment II were: A) predator and kairomones absent and B) the same as in experiment I. Physical and chemical factors (temperature, dissolved oxygen, pH, electrical conductivity) and food (algae) did not influence vertical distribution of prey, as they were almost homogeneously distributed in the water column in both experiments; food concentrations were not limiting. Adult copepods (Tropocyclops prasinus meridionalis and Thermocyclops decipiens) showed reverse migration in the treatment B of both experiments; the cladoceran Daphnia gessneri migrated nocturnally in the treatment A of the Experiment I; vertical migration was undetectable for copepodites, as well as for Chaoborus larvae. The experiments indicated that Daphnia responded to physical contact with Chaoborus larvae but not to kairomones alone. Adult copepods seemed to be more sensitive to kairomones.

  1. Estado actual y conservación de aves pelágicas que utilizan la plataforma continental argentina como área de alimentación / Status and conservation of pelagic birds using the Argentinean continental shelf as a foraging area

    Scientific Electronic Library Online (English)

    Marco, Favero; María Patricia, Silva Rodríguez.


    Full Text Available La importancia de la plataforma continental argentina no está solamente vinculada con su extensión sino también con su elevada productividad, lo que hace que sea utilizada como área de alimentación por un importante número y biomasa de predadores tope marinos que se reproducen en la costa y en secto [...] res insulares alejados del continente. Entre estos predadores tope, las aves pelágicas se destacan por sus extraordinarias habilidades de vuelo y sus extensos viajes de alimentación o migratorios de varios miles de kilómetros. La distribución de estas aves (y otros predadores tope marinos) a lo largo de la plataforma no es uniforme, presentando mayores concentraciones en áreas donde las características oceanográficas promueven elevadas abundancias de presas. Generalmente se observa un mayor número de individuos agregados cerca de frentes con gradientes de temperatura horizontales que sobre áreas térmicamente más homogéneas. Si bien algunas poblaciones de aves pelágicas sufren actualmente problemas relacionados con la contaminación, el disturbio humano y la degradación ambiental, los problemas de conservación más importantes parecen provenir de impactos sufridos en áreas reproductivas por la presencia de predadores introducidos y en el mar por los efectos negativos de la interacción con las pesquerías. La plataforma continental argentina tiene importancia global y juega un papel clave en el mantenimiento de aves y mamíferos marinos provenientes de regiones adyacentes y remotas. Existe una urgente necesidad de renovar la información disponible sobre la distribución de predadores tope en la plataforma para definir las áreas más importantes. El análisis combinado de esos datos con la distribución del esfuerzo pesquero y la explotación de recursos no renovables será crucial para desarrollar e implementar programas adecuados de conservación y manejo. Abstract in english The importance of the Argentinean continental shelf is not only linked with its extension but also to its high productivity. That's why this area is extensively used as foraging area by a large number and biomass of top predators both breeding in the continental shores and in islands away from the c [...] ontinent. Among these top predators, seabirds have remarkable flying abilities and perform extensive foraging and migratory trips, in the order of thousands of kilometers. The distribution of these birds (and other marine top predators) along the continental shelf is not uniform, with higher densities in those areas where the oceanographic characteristics promote prey concentration; more predators are usually aggregated close to frontal systems characterized by horizontal thermal gradients. In spite of some seabird populations currently suffering conservation problems allied with pollution, human disturbance and habitat degradation, the most important issues seem to be related to the introduction of predators in breeding areas, and to the negative effects of the interaction with fisheries. The Argentinean continental shelf has global importance and plays a key role in the maintenance of seabird and marine mammal populations, both local and those coming from adjacent and remote areas. There is an urgent need of gathering and analyzing new information on the distribution of top predators along the continental shelf in order to define important areas. The combined analysis of these data with the distribution of fishing effort and the exploitation of non renewable resources will be crucial to the adequate development and implementation of conservation and management programs.

  2. Suitability of leguminous cover crop pollens as food source for the green lacewing Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae) / Adequação do pólen de leguminosas utilizadas em adubação verde como fonte de alimento para Chrysoperla externa (Hagen) (Neuroptera: Chrysopidae)

    Scientific Electronic Library Online (English)

    Madelaine, Venzon; Maria C., Rosado; Denise E., Euzébio; Brígida, Souza; José H., Schoereder.


    Full Text Available A diversificação das culturas com plantas que forneçam pólen nutricionalmente adequado para predadores pode reduzir a população de pragas pelo aumento da efetividade dos predadores. Neste trabalho, avaliou-se a viabilidade nutricional de polens de leguminosas utilizadas como adubação verde, para o c [...] risopídeo Chrysoperla externa (Hagen), comumente encontrado em agroecossistemas cafeeiros. Os adubos verdes testados foram guandu e crotalária, leguminosas utilizadas em sistemas orgânicos de café. Adultos de C. externa recém-emergidos foram criados em dietas contendo pólen de guandu, de crotalária e de mamona (controle). O sucesso reprodutivo de C. externa foi avaliado nas dietas de pólen e quando mel foi adicionado ao pólen, para se verificar a necessidade do predador por fonte extra de carboidratos. A taxa de crescimento populacional do predador foi semelhante nas dietas de pólen de guandu e de crotalária. No entanto, a taxa aumentou significativamente quando mel foi adicionado às dietas. Fêmeas alimentadas com pólen de guandu e mel e com pólen de crotalária e mel tiveram crescimento superior ao das alimentadas com pólen de mamona e mel. Fêmeas alimentadas somente com pólen de mamona ou somente com mel não ovipositaram. Os polens de guandu e de crotalária foram igualmente adequados para C. externa, especialmente quando foram complementados com mel. Os resultados sugerem que para aumentar a efetividade dos predadores, os sistemas orgânicos de café deveriam ser diversificados com plantas que forneçam pólen em combinação com plantas que forneçam néctar. Abstract in english Diversification of crops with species that provide suitable pollen for predators may reduce pest population on crops by enhancing predator effectiveness. In this paper we evaluated the suitability of leguminous cover crop pollens to the predatory green lacewing Chrysoperla externa (Hagen). The preda [...] tor is commonly found in coffee agroecosystems and the plant species tested were pigeon pea and sunn hemp, which are used in organic coffee systems. Newly emerged females and males of C. externa were reared on diets containing pollen of pigeon pea, sunn hemp, or castor bean, used as a control. The reproductive success of C. externa was evaluated when females fed the pollen species and when honey was added to the diets, to verify the predator need for an extra carbohydrate source. Similar intrinsic growth rates were found for females fed on pigeon pea pollen and on sunn hemp pollen but these rates increased significantly when honey was added to the diets. Females fed with pigeon pea pollen plus honey and with sunn hemp pollen plus honey had higher intrinsic growth rates than those fed with castor bean pollen plus honey. Females fed on castor bean pollen only or on honey only, did not oviposit. Leguminous pollen species were equally suitable for C. externa especially when they were complemented with honey. The results suggest that to successfully enhance predator effectiveness, organic coffee plantation should be diversified with plant providing pollen in combination with plant providing nectar.

  3. Distributed representation of social odors indicates parallel processing in the antennal lobe of ants. (United States)

    Brandstaetter, Andreas Simon; Kleineidam, Christoph Johannes


    In colonies of eusocial Hymenoptera cooperation is organized through social odors, and particularly ants rely on a sophisticated odor communication system. Neuronal information about odors is represented in spatial activity patterns in the primary olfactory neuropile of the insect brain, the antennal lobe (AL), which is analog to the vertebrate olfactory bulb. The olfactory system is characterized by neuroanatomical compartmentalization, yet the functional significance of this organization is unclear. Using two-photon calcium imaging, we investigated the neuronal representation of multicomponent colony odors, which the ants assess to discriminate friends (nestmates) from foes (nonnestmates). In the carpenter ant Camponotus floridanus, colony odors elicited spatial activity patterns distributed across different AL compartments. Activity patterns in response to nestmate and nonnestmate colony odors were overlapping. This was expected since both consist of the same components at differing ratios. Colony odors change over time and the nervous system has to constantly adjust for this (template reformation). Measured activity patterns were variable, and variability was higher in response to repeated nestmate than to repeated nonnestmate colony odor stimulation. Variable activity patterns may indicate neuronal plasticity within the olfactory system, which is necessary for template reformation. Our results indicate that information about colony odors is processed in parallel in different neuroanatomical compartments, using the computational power of the whole AL network. Parallel processing might be advantageous, allowing reliable discrimination of highly complex social odors. PMID:21849606

  4. Composition of cottontail rabbit milk from stomachs of young and directly from gland. (United States)

    Anderson, R R; Sadler, K C; Knauer, M W; Wippler, J P; Marshall, R T


    Milk samples were from stomachs of 27 nursing cottontail rabbits (Sylvilagus floridanus) within 5 min after cessation of nursing. Four milk samples were directly from mammary glands by hand milking aided by tranquilizer and oxytocin. Means and standard errors for 27 stomach samples for total solids, fat, protein, lactose, and ash were 33.6 +/- .8%, 13.9 +/- 1.7%, 14.6 +/- .5%, 2.22 +/- .05%, and 2.06 +/- .07%. Those values of 4 samples directly from the gland were 35.2 +/- .4%, 14.4 +/- .4%, 15.8 +/- .6%, 2.67 +/- .26%, and 2.07 +/- .06%. Fatty acid compositions were similar for the groups, except linoleic acid was 30.0% of fatty acids from stomach milk and 24.7% in milk obtained directly. Differences between sampling methods in palmitoleate, stearate, and oleate may have been from differences in season of sampling. Minerals were more concentrated in milk obtained directly, except potassium. Differences between milks of domesticated and cottontail rabbits are discussed. PMID:1184805


    Directory of Open Access Journals (Sweden)

    Mesa Nora Cristina


    Full Text Available Varias especies de ácaros de la familia Tenuipalpidae, especialmente las del géneroBrevipalpus Donnadieu, son reconocidas como vectores de enfermedades viralesen diferentes cultivos comerciales. La falta de estudios taxonómicos en esta familiade ácaros en Colombia y la posibilidad de introducir en forma accidental especiesde estos ácaros planos, son una amenaza para la bioseguridad de la producciónfrutícola del país. El objetivo de este trabajo es contribuir a la identificación de lasespecies de Tenuipalpidae en la vegetación silvestre y cultivada en el departamentodel Valle del Cauca y confirmar la identidad taxonómica de las especies deBrevipalpus en cítricos, guayaba, maracuyá, café y orquídeas. Las recoleccionesde ejemplares se realizaron en épocas seca y lluviosa en varios municipios deldepartamento. El montaje de los ácaros se realizó en medio Hoyer. La especiepredominante en todas las localidades y en los hospedantes recolectados fueBrevipalpus phoenicis Geijskes (1939. Por el contrario, B. obovatus Donnadieuse encontró en poblaciones muy bajas en limón Tahití y mandarina en algunaslocalidades de Palmira. Tenuipalpus anacardii De León se presentó en Anacardiumexcelsum (Bertero y Balb. ex Kunth Skeels, en el municipio de Roldanillo y T.pacificus Baker se encontró en el corregimiento de Rozo, municipio de Palmira,sobre plantas importadas de un cultivo comercial de Dendrobium sp., mientrasque Dolichotetranychus floridanus (Banks solamente se encontró sobre Ananascomosus (L. Merr., en muestras recolectadas en Cali

  6. Análisis comparativo de la alimentación del gato montés (Lynx Rufus en dos diferentes ambientes de México

    Directory of Open Access Journals (Sweden)

    Marcelo Aranda


    Full Text Available En el presente trabajo se analiza, en forma comparativa, la alimentación del gato montés en dos localidades con ambientes diferentes: la primera es el predio ?El Plomito?, Sonora, con vegetación de matorrales áridos, y la segunda es la Sierra del Ajusco, en el sur de la Cuenca de México, donde predominan los bosques de coníferas. Mediante el análisis de 197 y 922 excretas, se identificaron 18 y 28 presas diferentes, respectivamente. En ambas localidades, los grupos de especies presa que aportaron mayor biomasa a la alimentación del gato montés fueron los lagomorfos, con 74.2% en El Plomito y 70.0% en El Ajusco, y los roedores con 18.9 y 18.7%, en el mismo orden. En El Plomito la presa más importante fue Sylvilagus audubonii (35.5%, seguida por Lepus sp. (31.5%, Neotoma albigula (14.0%, Odocoileussp. (2.9% y Spermophilus variegatus (1.7%. En El Ajusco la presa más importante fue Sylvilagus floridanus(41.6%, seguida por Sylvilagus cunicularius (15.4%, Romerolagus diazi (12.3%, Cratogeomys merriami (5.1% y Sciurus aureogaster (4.9%. Los resultados obtenidos apoyan la teoría de que el gato montés, al igual que las otras especies de linces, es un depredador especialista en la caza de lagomorfos.

  7. Great horned owl (Bubo virginianus) dietary exposure to PCDD/DF in the Tittabawassee River floodplain in Midland, Michigan, USA. (United States)

    Coefield, Sarah J; Zwiernik, Matthew J; Fredricks, Timothy B; Seston, Rita M; Nadeau, Michael W; Tazelaar, Dustin L; Moore, Jeremy N; Kay, Denise P; Roark, Shaun A; Giesy, John P


    Soils and sediments in the floodplain of the Tittabawassee River downstream of Midland, Michigan, USA contain elevated concentrations of polychlorinated dibenzofurans (PCDF) and polychlorinated dibenzo-p-dioxins (PCDD). As a long-lived, resident top predator, the great horned owl (Bubo virginianus; GHO) has the potential to be exposed to bioaccumulative compounds such as PCDD/DF. Site-specific components of the GHO diet were collected along 115 km of the Tittabawassee, Pine, Chippewa, and Saginaw Rivers during 2005 and 2006. The site-specific GHO biomass-based diet was dominated by cottontail rabbits (Sylvilagus floridanus) and muskrats (Ondatra zibethicus). Incidental soil ingestion and cottontail rabbits were the primary contributors of PCDD/DF to the GHO diet. The great horned owl daily dietary exposure estimates were greater in the study area (SA) (3.3 to 5.0 ng 2,3,7,8-TCDD equivalents (TEQ(WHO-avian))/kg body wt/d) than the reference area (RA) (0.07 ng TEQ(WHO-Avian)/kg body wt/d). Hazard quotients (HQs) based on central tendency estimates of the average daily dose and no-observable-adverse effect level (NOAEL) for the screech owl and uncertainty factors were <1.0 for both the RA and the SA. Hazard quotients based on upper end estimates of the average daily dose and NOAEL were <1.0 in the RA and up to 3.4 in the SA. PMID:20872700

  8. Effects of enhanced UV-B radiation on plant chemistry: nutritional consequences for a specialist and generalist lagomorph. (United States)

    Thines, Nicole J; Shipley, Lisa A; Bassman, John H; Fellman, John K; Mattison, D Scott; Slusser, James R; Gao, Wei


    Ultraviolet-B (UV-B) radiation has been increasing in temperate latitudes in recent decades and is expected to continue rising for some time. Enhanced UV-B radiation can change plant chemistry, yet the effects of these changes on mammalian herbivores are unknown. To examine the influence of enhanced UV-B radiation on nutrition of a specialist and generalist hindgut fermenter, we measured nutritional and chemical constituents of three common North American range plants, big sagebrush (Artemisia tridentata), yarrow (Achillea millefolium), and bluebunch wheatgrass (Pseudoregneria spicata), and how these changes influenced in vitro dry matter digestibility and in vivo digestibility by pygmy rabbits (Brachylagus idahoensis) and eastern cottontails (Sylvilagus floridanus). Forages were irradiated for 3 mo with ambient (1x) or supplemental (1.6x) UV-B radiation representing a 15% ozone depletion for Pullman, WA, USA. Enhanced UV-B radiation had minimal effects on the nutritional content and the tannin-binding capacity of forages. Similarly, the terpene concentration in sagebrush and yarrow was not affected by higher UV-B irradiances. Flavonoid compounds increased in sagebrush but decreased in yarrow. Rabbit preference and intake was not affected by treatment levels for any forage species and no differences were found between treatments for dry matter, fiber, protein digestibility, and apparent digestible energy. PMID:17406969

  9. Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas / Phytophagy by Podisus nigrispinus on cotton plants and weeds

    Scientific Electronic Library Online (English)

    Walter Santos, Evangelista Júnior; Manoel Guedes Correa, Gondim Junior; Jorge Braz, Torres; Edmilson Jacinto, Marques.


    Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência tot [...] al de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas. Abstract in english This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas) (Heteroptera: Pentatomidae) development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods unde [...] r partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

  10. Acarofauna associada a frutos de coqueiro (Cocos nucifera L.) de algumas localidades das Américas / Acarofauna associated with coconut fruits (Cocos nucifera L.) from some localities in America

    Scientific Electronic Library Online (English)

    Denise, Návia; Gilberto J. de, Moraes; Antonio C., Lofego; Carlos H.W., Flechtmann.


    Full Text Available Neste trabalho foram identificados ácaros fitófagos e predadores associados a frutos de coqueiro de localidades do Brasil, Colômbia, Cuba, EUA, México e Venezuela. Foram encontradas três espécies de ácaros fitófagos (duas Eriophyidae, uma Tarsonemidae), quatro espécies de ácaros predadores (duas Asc [...] idae, duas Phytoseiidae), e duas espécies de hábito alimentar pouco conhecido (uma Eupodidae, uma Tydeidae). Aceria guerreronis Keifer (Eriophyidae) foi encontrada nas amostras de Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe e São Paulo, Brasil; e também de Cuba, EUA, México e Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) foi encontrada em amostras do Rio de Janeiro, São Paulo e Sergipe, Brasil; da Colômbia e do México. O tarsonemídeo Steneotarsonemus furcatus De Leon foi coletado em frutos provenientes de Alagoas, Minas Gerais, Rio de Janeiro e Sergipe. Os sintomas observados em frutos infestados por esses ácaros fitófagos foram descritos. As espécies de Ascidae encontradas foram Proctolaelaps longipilis Chant e Proctolaelaps sp.; e as de Phytoseiidae foram Typhlodromus (Anthoseius) ornatus (Denmark & Muma) e Typhlodromalus manihoti (Moraes). Provavelmente essas espécies de ácaros predadores foram registradas, pela primeira vez, em frutos de coqueiro, no mundo. Abstract in english Phytophagous and predatory mites associated with fruits of coconut from Brazil, Colombia, Mexico, USA and Venezuela were identified in this study. Three species of phytophagous mites (two Eriophyidae, one Tarsonemidae), four species of predatory mites (two Ascidae, two Phytoseiidae), and two species [...] with unknown feeding habit (one Eupodidae, one Tydeidae) were found. Aceria guerreronis Keifer (Eriophyidae) were found in samples from Alagoas, Bahia, Minas Gerais, Pernambuco, Rio de Janeiro, Rio Grande do Norte, Sergipe and São Paulo, Brazil; and also from Cuba, Mexico, USA and Venezuela. Amrineus cocofolius Flechtmann (Eriophyidae) was found in samples from Rio de Janeiro, São Paulo and Sergipe, Brazil, from Colombia and from Mexico. The tarsonemid Steneotarsonemus furcatus De Leon was found on fruits from Alagoas, Minas Gerais, Rio de Janeiro, Sergipe, Brazil. Symptoms observed on fruits infested by these phytophagous mites were described. The Ascidae species found were Proctolaelaps longipilis Chant and Proctolaelaps sp.; and the Phytoseiidae species were Typhlodromus (Anthoseius) ornatus (Denmark & Muma) and Typhlodromalus manihoti (Moraes). For our knowledge, these predator species were registered for the first time from coconut fruits around the world.

  11. Diet of four annual killifishes: an intra and interspecific comparison

    Directory of Open Access Journals (Sweden)

    Gabriel Laufer


    Full Text Available We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lagoon basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae, Ephemeroptera (especially Betidae, and coleopteran larvae (especially Dytiscidae. Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae, Ephemeroptera (especialmente Betidae, e larvas de Coleoptera (especialmente Dytiscidae. Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação.

  12. Diet of four annual killifishes: an intra and interspecific comparison

    Scientific Electronic Library Online (English)

    Gabriel, Laufer; Matías, Arim; Marcelo, Loureiro; Juan Manuel, Piñeiro-Guerra; Sabrina, Clavijo-Baquet; César, Fagúndez.


    Full Text Available Nós examinamos a dieta de 4 peixes anuais, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus e Cynopoecilus melanotaenia, que habitam poças temporárias do sudeste do Uruguai, através da análise de conteúdo estomacal. Os peixes foram capturados em cinco poças temporárias [...] da bacia da lagoa Castillos, na região de Humedales del Este. Nós identificamos 13099 itens de presas estraídos de 669 estômagos das quatro espécies. No sistema estudado, peixes anuais representam os predadores de topo mais abundantes e conspícuos. Os rivulídeos são predadores generalistas nas poças temporaries estudadas, consumindo principalmente itens aquáticos. Zooplâncton representou o item principal da dieta para as quatro espécies, seguido de ovos, algas e diatomáceas. Insetos compoem o próximo grupo em número de presas, como segue: larvas de Diptera (especialmente Chironomidae e Cullicidae), Ephemeroptera (especialmente Betidae), e larvas de Coleoptera (especialmente Dytiscidae). Ácaros foram também presas importantes em número. As quatro espécies de peixes diferem na composição e riqueza das dietas. O padrão geral de diferenciação da dieta entre espécies e grupos demográficos de rivulídeos pode ser relacionado à variação do tamanho corporal. Como predadores de topo, os rivulídeos anuais são um componente importante dos ecossistemas de poças temporárias. A compreensão da história natural destas espécies e de suas comunidades é necessária a sua conservação. Abstract in english We examined the diet of 4 annual fishes, Austrolebias viarius, Austrolebias cheradophilus, Austrolebias luteoflammulatus and Cynopoecilus melanotaenia inhabiting temporal ponds of southeastern Uruguay, by analysis of stomach contents. Fishes were captured from fifty ephemeral ponds of Castillos Lago [...] on basin, in the region of the Humedales del Este. We identified 13099 individual prey items extracted from 669 stomachs of the four captured species. In the studied system, annual killifishes represents the most abundant and conspicuous top predators. Killifishes are generalist key predators at the ephemeral ponds of the studied system, consuming mostly aquatic items. Zooplancton represented the bulk of the diet in the four analyzed species, followed by eggs, algae and diatoms. Insects are the next group in prey number, as follows: Diptera larvae (especially Chironomidae and Cullicidae), Ephemeroptera (especially Betidae), and coleopteran larvae (especially Dytiscidae). Acari are also important prey in number. The four fish species differ in diet composition and in diet richness. A general pattern of differences in diet richness among killifish species and demographic groups could be related to variations in body sizes. As top predators annual killifishes are an important component of the temporal pond ecosystems. Understanding the natural history of this species and their communities is necessary in order to conserve them.

  13. Efeito da presa alternativa no desenvolvimento e consumo de Orius insidiosus (Say) (Hemiptera, Anthocoridae) e comportamento de oviposição em cultivares de crisântemo / Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars

    Scientific Electronic Library Online (English)

    Maria da Conceição M., Soglia; Vanda Helena Paes, Bueno; Lívia Mendes, Carvalho.


    Full Text Available Este trabalho teve como objetivo avaliar o desenvolvimento e o consumo de Orius insidiosus (Say, 1832) tendo Aphis gossypii Glover, 1877 como presa, bem como seu comportamento de oviposição em duas cultivares de crisântemo. O experimento foi conduzido em câmara climática a 25 ± 1ºC, UR 70 ± 10% e fo [...] tofase de 12 horas. Ninfas do predador com até 24 horas de idade foram colocadas individualmente em placas de petri (5 cm) contendo 20 ninfas de A. gossypii (1º, 2º e 3º ínstares), as quais estavam posicionadas sobre disco foliar (4 cm) de cada cultivar ('White Reagan' e'Yellow Snowdon') em camada de ágar-água . Na avaliação da oviposição foram utilizados pecíolos de cada cultivar como substrato de oviposição e ovos de Anagasta kuehniella (Zeller, 1879) como alimento. O predador completou seu desenvolvimento alimentando-se somente de A. gossypii presente em ambas as cultivares. A duração da fase ninfal de O. insidiosus foi de 21,1 e 18,3 dias, em 'White Reagan' e 'Yellow Snowdon', respectivamente. O consumo de A. gossypii por fêmeas foi maior (P Abstract in english This work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832) feeding on Aphis gossypii Glover, 1877 as weel as its oviposition behavior on two crysanthemum cut cultivars. The trials were conducted in climatic chamber at 25±1ºC, RH 70±10% and 12h photophase. Ny [...] mphs of the predator, less than 24h old, were kept individualy in petri dishes (5cm) with 20 nymphs of A. gossypii (1st, 2nd and 3rt instars) on leaf disc (4cm) of each cultivar ("White Reagan" and "Yellow Snowdon") in a layer of agar-water (1%). Petiole of each crysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879). The predador complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on "White Reagan" and "Yellow Snowdon", respectively. The consumption of the females of O. insidiosus was higher (P

  14. Influência do fotoperíodo na reprodução e longevidade de Orius insidiosus (Say) (Heteroptera: Anthocoridae) / Effect of photoperiod on reproduction and longevity of Orius insidiosus (Say) (Heteroptera: Anthocoridae)

    Scientific Electronic Library Online (English)



    Full Text Available Orius insidiosus (Say) é um importante predador de tripes, e sua reprodução pode ser afetada pelo fotoperíodo. O objetivo deste trabalho foi verificar a ocorrência de diapausa reprodutiva em O. insidiosus submetido a diferentes fotoperíodos em laboratório. O experimento foi conduzido em câmaras clim [...] áticas, nos fotoperíodos 9L:15E, 10L:14E, 11L:13E, 12L:12E, 13L:11E e 14L:10E, temperatura de 25±1ºC e UR de 70±10%. A fecundidade e a razão sexual do predador não foram afetadas pelos diferentes fotoperíodos; o número médio de ovos/fêmea foi de 162,0, 189,8, 175,8, 195,2, 132,2 e 125,1 nos fotoperíodos 9L:15E, 10L:14E, 11L:13E, 12L:12E, 13L:11E e 14L:10E respectivamente. O fotoperíodo, no entanto, afetou a longevidade de O. insidiosus independentemente do sexo, sendo que a maior longevidade (77,1 dias) ocorreu no fotoperíodo 14L:10E e a menor (40,1 dias) no fotoperíodo 9L:15E. O. insidiosus não apresentou predisposição a entrar em diapausa reprodutiva nos fotoperíodos analisados, nas condições deste experimento. Essa informação é importante para a compreensão dos fenômenos que regem o desempenho e a utilização dessa espécie de predador para o controle biológico de tripes em sistemas de cultivos protegidos. Abstract in english Orius insidiosus (Say) is an important predator of thrips and photoperiod can affect the reproduction of this insect. The objective of this work was to verify the occurrence of reproductive diapause in O. insidiosus in laboratory conditions. The experiments were carried out in environmental chambers [...] , at photoperiods of 9L:15D, 10L:14D, 11L:13D, 12L:12D, 13L:11D and 14L:10D, temperature of 25±1ºC and RH of 70±10%. Fecundity and sex ratio were not affected by the different photoperiods; an average number of 162.0, 189.8, 175.8, 195.2, 132.2 and 125.1 eggs/female, respectively, were found on these photoperiods. However, the photoperiods affected longevity of the predator. Longevity varied from 77.1 days, at photoperiod 10L:14D, to 40.1 days at photoperiod 9L:15D. O. insidiosus did not enter reproductive diapause in the conditions carried out in this experiment. This information is important to understand the factors that are involved on performance and use of O. insidiosus on biological control of thrips on protected cultivation.

  15. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Directory of Open Access Journals (Sweden)

    Geuza Cantanhêde


    Full Text Available The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro following changes in abundance of a forage fish (Moenkhausia dichroura during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (State of Mato Grosso, Brazil from March 2000 to February 2001 (period I and from March 2003 to February 2004 (period II. The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.O objetivo deste estudo foi investigar alterações na dieta de um peixe piscívoro (Acestrorhynchus pantaneiro após mudanças na abundância de um peixe forrageiro (Moenkhausia dichroura durante a colonização de um reservatório. Os peixes foram amostrados mensalmente entre março/2000 e fevereiro/2001 (período I e março/2003 e fevereiro/2004 (período II, no reservatório de Manso (Mato Grosso, Brasil. A abundância de M. dichroura foi significativamente diferente entre os períodos, representando 9,6% dos indivíduos no período I e 66,4% no período II. No período I A. pantaneiro consumiu 41 presas, enquanto que no período II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no período I representava apenas 15%. A relação entre o tamanho do predador e da presa foi positiva em ambos os períodos, porém significativamente diferente. No período II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura. Os resultados mostraram que A. pantaneiro consumiu, no período II, a presa mais abundante e disponível, alterando a composição de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alterações provavelmente causaram um decréscimo nos custos energéticos associados à procura da presa, maximizando o ganho de energia do predador.

  16. Alterations on piscivorous diet following change in abundance of prey after impoundment in a Neotropical river

    Scientific Electronic Library Online (English)

    Geuza, Cantanhêde; Norma Segatti, Hahn; Rosemara, Fugi; Éder André, Gubiani.


    Full Text Available O objetivo deste estudo foi investigar alterações na dieta de um peixe piscívoro (Acestrorhynchus pantaneiro) após mudanças na abundância de um peixe forrageiro (Moenkhausia dichroura) durante a colonização de um reservatório. Os peixes foram amostrados mensalmente entre março/2000 e fevereiro/2001 [...] (período I) e março/2003 e fevereiro/2004 (período II), no reservatório de Manso (Mato Grosso, Brasil). A abundância de M. dichroura foi significativamente diferente entre os períodos, representando 9,6% dos indivíduos no período I e 66,4% no período II. No período I A. pantaneiro consumiu 41 presas, enquanto que no período II foram registradas 14 presas, sendo que M. dichroura foi a presa mais consumida, passando a representar 95% da dieta, enquanto no período I representava apenas 15%. A relação entre o tamanho do predador e da presa foi positiva em ambos os períodos, porém significativamente diferente. No período II pequenos e grandes predadores consumiram principalmente pequenas presas (M. dichroura). Os resultados mostraram que A. pantaneiro consumiu, no período II, a presa mais abundante e disponível, alterando a composição de sua dieta, amplitude do nicho alimentar e tamanho da presa. Estas alterações provavelmente causaram um decréscimo nos custos energéticos associados à procura da presa, maximizando o ganho de energia do predador. Abstract in english The goal of this study was to investigate the alterations of diet of a piscivorous fish (Acestrorhynchus pantaneiro) following changes in abundance of a forage fish (Moenkhausia dichroura) during the trophic upsurge stage in a reservoir. Fish samplings were taken monthly in the Manso Reservoir (Stat [...] e of Mato Grosso, Brazil) from March 2000 to February 2001 (period I) and from March 2003 to February 2004 (period II). The abundance of Moenkhausia dichroura in the reservoir was significantly different in both periods, representing 9.6% of the individuals in period I and 66.4% in period II. Stomach contents analyses showed that the number of prey species consumed by A. pantaneiro decreased from 41 prey in period I to 14 in period II. In the last period M. dichroura was the most important prey, comprising 95% of the diet, in contrast with the period I when this species represented only 15% of the diet. The predator and prey size relationship was positive in both periods, however was significantly different, because small and large predators consumed mainly small prey (M. dichroura) in period II. Thus, the results showed that A. pantaneiro altered its diet composition, trophic niche breadth and prey sizes to feed on more abundant and accessible prey. These alterations probably caused a decrease in energy costs related to prey searching, maximizing the energy gain of the predator.

  17. Manejo integrado de pragas em macieira no Rio Grande do Sul II: uso de Neoseiulus californicus para o controle de Panonychus ulmi / Apple integrated pest management in Rio Grande do Sul: II. the use of The Neoseiulus californicus for control of the Panonychus ulmi

    Scientific Electronic Library Online (English)



    Full Text Available Com o objetivo de implementar o controle biológico de ácaro-vermelho Panonychus ulmi em macieira foi proposta uma estratégia de controle baseada na criação de Neoseiulus californicus em estufa, em liberações inundativas e no uso de acaricidas, em um pomar comercial de macieira da Rincão das Flores A [...] gropastoril (Agriflor), em Vacaria, Rio Grande do Sul, entre 1992 e 1996. A amostragem do ácaro-vermelho orientou as liberações e as transferências de ácaros predadores, das estufas de criação e dos ramos provenientes da poda verde, para parcelas de alta incidência de ácaro-vermelho. A eficiência da estratégia de controle do ácaro-vermelho foi avaliada com o levantamento de ovos de inverno. No primeiro ano, a associação de acaricidas com ácaros predadores permitiu um reduzido número de ovos de inverno do ácaro-vermelho, em torno de 1,3 ovo por unidade de amostragem contra 59,8 ovos na testemunha. No segundo ano, 58% das macieiras não foram pulverizadas com acaricidas. Nos dois anos subseqüentes, o controle do ácaro-vermelho foi realizado exclusivamente com ácaros predadores. N. californicus passou o inverno nas ervas daninhas do pomar e migrou espontaneamente para a copa das macieiras nos anos subseqüentes a sua introdução. Abstract in english Having the purpose to increment the biological control of European red mites Panonychus ulmi in apple tree, a control strategy was proposed based on phytoseids Neoseiulus californicus in a greenhouse, on successive inoculative releases and use of acaricides, in a commercial apple orchard of Rincão d [...] as Flores Agropastoril (Agriflor), in Vacaria, Rio Grande do Sul, Brazil, among 1992-1996. The red mite samples guided both phytoseid releasing and transfering from the greenhouse and unwanted branches pruned, to apples trees with high population rates of European red mites. The inseticide effects on phytoseids were used to choose the pesticides for pest control. During the first winter season, the association between acaricides and phytoseids was able to reduce overwinter eggs, about 1,3 eggs/bud unit, while in the control area had 59,8 eggs. In the second year, the reduction of European red mite populations was significant. After the following two years, the control of European red mites was done only using the phytoseids. In the years that followed its introduction, N. californicus resurged on the apple trees.

  18. Fitofagia de Podisus nigrispinus em algodoeiro e plantas daninhas Phytophagy by Podisus nigrispinus on cotton plants and weeds

    Directory of Open Access Journals (Sweden)

    Walter Santos Evangelista Júnior


    Full Text Available O objetivo deste trabalho foi avaliar o efeito de seis plantas daninhas e do algodoeiro no desenvolvimento, reprodução e sobrevivência do percevejo predador Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae sob escassez parcial de presas, alimentação em intervalos de três dias, e ausência total de presas. Com escassez parcial de presas, o desenvolvimento ninfal foi maior em Ricinus communis e menor em Bidens pilosa. Viabilidade dos ínstares, peso de fêmeas, período de pré-oviposição e fecundidade foram similares entre as plantas, porém o peso de machos e longevidade de fêmeas foram reduzidos em Desmodium tortuosum e R. communis, respectivamente. Com base nos parâmetros de tabela de vida foi estimada melhor performance do predador em Amaranthus hybridus, D. tortuosum e R. communis. Ninfas submetidas à escassez total de presas viveram mais em Ageratum conyzoides, B. pilosa, D. tortuosum e Euphorbia heterophylla; porém não viveram além do terceiro ínstar. A longevidade de fêmeas do predador foi favorecida pela presença de A. conyzoides em relação a Gossypium hirsutum, vivendo em média 15,7 e 29,8 dias, respectivamente. No entanto, a disponibilidade de plantas não foi suficiente para as fêmeas atingirem maturação sexual e produção de ovos, quando submetidas à escassez total de presas.This work evaluated the effect of six weeds and cotton plants on predatory stinkbug Podisus nigrispinus (Dallas (Heteroptera: Pentatomidae development, reproduction and survival under partial prey scarcity, three days feeding intervals, and total absence of prey. Nymphal developmental periods under partial prey scarceness with three days of feeding intervals were higher on Ricinus communis and lower on Bidens pilosa. Partial prey scarcity did not affect nymphal viability, adult female weight and reproductive characteristics, but male weight and female longevity were reduced in Desmodium tortuosum and R. communis, respectively. Podisus nigrispinus showed better performance on Amaranthus hybridus, D. tortuosum and R. communis based on the life table parameters. Nymphs reared under total absence of prey lived longer on Ageratum conyzoides, B. pilosa, D. tortuosum and Euphorbia heterophylla; however, they did not live beyond the third ínstar. Longevity of P. nigrispinus females was improved depending on the plant available ranging from 15.7 days on Gossypium hirsutum to 29.8 days on A. conyzoides. The plant availability under total absence of prey, however, was not sufficient to endure female sexual maturation and egg production.

  19. Análise crítica dos sistemas neurais envolvidos nas respostas de medo inato Critical analysis of the neural systems organizing innate fear responses

    Directory of Open Access Journals (Sweden)

    Newton Sabino Canteras


    Full Text Available O nosso entendimento das bases neurofisiológicas da reação emocional do medo baseia-se em grande parte nos estudos que envolvem respostas condicionadas a estímulos fisicamente aversivos, como, por exemplo, o choque elétrico nas patas. Enquanto este paradigma parece ser útil para avaliarmos os sistemas neurais envolvidos na resposta do, assim chamado, medo condicionado (que tipicamente tem se limitado à observação da resposta de congelamento, este paradigma parece ter sérias limitações para investigarmos as bases neurais das respostas de medo em circunstancias naturais. Trabalhos recentes utilizando técnicas de lesões neurais bem como de mapeamento funcional em animais expostos a predadores naturais, ou somente ao odor destes predadores, revelam uma série de estruturas neurais como responsáveis pelas respostas de medo inato, bastante distintas daquelas previamente implicadas nas respostas de condicionamento aversivo. Como revisto no presente trabalho, entre estas estruturas temos distritos diferenciados da zona medial do hipotálamo; setores específicos da amídala e do sistema septo-hipocampal, envolvidos, respectivamente no processamento de pistas relacionadas à presença do predador e na análise contextual do ambiente; e setores da matéria cinzenta periaquedutal, já classicamente envolvidos na expressão de respostas de defesa. Estas informações podem ser potencialmente importantes para a análise e terapêutica de psicopatologias relacionadas aos distúrbios da reação emocional de medo.Unconditioned emotional responses elicited by exposure to a predator have served as the prototypical exemplar for analyses of the behavioral biology of fear-related emotionality. However, the primary research model for the study of fear has involved shock-based cue and context conditioning. While these shock-based models have provided a good understanding of neural systems regulating specific conditioned fear-related behaviors (typically freezing, it is not known if the neural systems underlying an array of defensive responses to innate, unconditioned, painless threat stimuli, and conditioning to these stimuli, are the same as those involved in foot shock and its conditioning sequellae. Recent work involving lesions and c-Fos activation in conjunction with predator or predator odor exposure suggest specific neural systems for response to these, potentially different from the systems outlined in Pavlovian fear conditioning studies. As outlined in the present review, these systems include the medial hypothalamic defensive circuit; specific amygdalar and septo-hippocampal territories, involved in processing, respectively, cues related to the predator presence and environmental contextual analysis; and the periaqueductal gray, known to be critically involved in the expression of predator-induced responses. This information may be potentially important in analysis of defense-related psychopathologies and in the design of therapeutic interventions for them.

  20. Impact of integrated pest management on the population of leafminers, fruit borers, and natural enemies in tomato / Impacto do manejo integrado de pragas sobre populações de minadores de folhas, broqueadores de frutos e inimigos naturais na cultura do tomateiro

    Scientific Electronic Library Online (English)

    Moacyr Mascarenhas Motta, Miranda; Marcelo Coutinho, Picanço; José Cola, Zanuncio; Leandro, Bacci; Ézio Marques da, Silva.


    Full Text Available O objetivo deste trabalho foi avaliar o impacto do manejo integrado de pragas (MIP) na produtividade e populações de minadores de folhas, broqueadores de frutos, predadores e parasitóides na cultura de tomate. Os tratamentos foram calendário (pulverizações de inseticidas e fungicidas duas vezes/sema [...] na), MIP (pulverizações de inseticidas somente quando os níveis de controle foram atingidos) e testemunha (sem aplicação de inseticidas e fungicidas). O tomateiro no MIP apresentou produtividade semelhante à do calendário com redução de 65,6% das pulverizações de inseticidas. O ataque de Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) e Liriomyza spp. (Diptera: Agromyzidae) às folhas só atingiu o nível de controle na fase final do cultivo. O principal broqueador de frutos foi Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), seguido de T. absoluta e Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). As populações de inimigos naturais foram grandemente reduzidas pelas aplicações excessivas de inseticidas. Os predadores foram mais abundantes que os parasitóides. Os predadores mais abundantes foram: Araneidae, Anthicus sp. (Coleoptera: Anthicidae), larvas de Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae), adultos de Staphylinidae (Coleoptera), Orius sp. e Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera) e Phlaeothripidae (Thysanoptera). Os parasitóides mais abundantes foram Hymenoptera das famílias Eulophidae, Braconidae (Bracon sp. e Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] e Bethylidae (Goniozus nigrifemur Ashmead), além de Diptera: Tachinidae. Abstract in english The objective of this work was to evaluate the impact of integrated pest management (IPM) in the productivity of the tomato and in the populations of leafminers, fruit borers, and natural enemies in tomato crops. The treatments were calendar (spraying twice weekly with insecticides and fungicides), [...] IPM (spraying when action thresholds were achieved), and control (no pesticide was applied). IPM was the most efficient system of pest control due to presenting similar productivity and 65.6% less pesticide applications than in the calendar. The attack of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) and Liriomyza spp. (Diptera: Agromyzidae) to the leaves only achieved the action threshold in the final phase of the cultivation. The main fruit borer was Neoleucinoides elegantalis (Guen.) (Lepidoptera: Crambidae), followed by T. absoluta and Spodoptera eridania (Cr.) (Lepidoptera: Noctuidae). The natural enemy populations were severely reduced by excessive pesticide applications. Predators were more abundant than parasitoids. The most abundant predators were Araneidae, Anthicus sp. (Coleoptera: Anthicidae), Cycloneda sanguinea larva (L.) (Coleoptera: Coccinellidae), Staphylinidae adults (Coleoptera), Orius sp. and Xylocoris sp. (Hemiptera: Anthocoridae), Formicidae (Hymenoptera), and Phlaeothripidae (Thysanoptera). The most abundant parasitoids were Hymenoptera of the families Eulophidae, Braconidae (Bracon sp. and Chelonus sp.), Trichogrammatidae [Trichogramma pretiosum (Riley)] and Bethylidae (Goniozus nigrifemur Ashmead), besides Tachinidae (Diptera).

  1. Biological control of phytophagous arthropods in the physic nut tree Jatropha curcas L. in Brazil / Controle biológico de artrópodes fitófagos em Pinhão Manso Jatropha curcas L. no Brasil

    Scientific Electronic Library Online (English)

    Flávio Lemes, Fernandes; Maria Elisa de Sena, Fernandes; Elisângela Novais, Lopes; Madelaine, Venzon; Juno Ferreira da Silva, Diniz; Luís Antônio dos Santos, Dias.


    Full Text Available Jatropha curcas possui alto teor de óleo biocombustível que poderia substituir os combustíveis poluentes, possuindo grande potencial para o cultivo em larga escala de monocultivos no sistema convencional. Nós exploramos a ocorrência, a distribuição espacial e a resposta funcional das principais esp [...] écies fitófagas e seus inimigos naturais com potencial para controle biológico conservativo. Começamos a amostragem de fitófagos e predadores quando o J. curcas atingiu seis meses de idade. As espécies fitófagas mais frequentes foram ninfas e adultos Empoasca kraemeri, seguido por Frankliniella schultzei e Myzus persicae. Dentre os predadores, Ricoseius loxochelis, Iphiseioides zuluagai, Araneidae, Psyllobora vigintimaculata (larv), Psyllobora vigintimaculata (adulto) e Anthicus sp. foram as mais frequentes. Os parasitoides mais comuns foram das famílias Encyrtidae e Braconidae. As maiores densidades de E. kraemeri fitófagos e F. schultzei nas bordas da cultura de J. curcas seguem padrões espaciais semelhantes aos de inimigos naturais de I. zuluagai e A. sp. Esses artrópodes podem ser considerados eficientes predadores de estágios imaturos de E. kraemeri e F. schultzei em J. curcas. Abstract in english Jatropha curcas has a high biofuel oil content, which could replace polluting fuels, and has great potential for large scale monoculture cultivation in the conventional system. We explored the occurrence, spatial distribution and the functional response of the main phytophagous species of this plan [...] t and their natural enemies to explore the potential for conservative biological control. We began sampling phytophagous species and predators when J. curcas plants were six months old. The most common species of phytophagous insects were nymphs and adults of Empoasca kraemeri, followed by Frankliniella schultzei and Myzus persicae. Among the predators, Ricoseius loxocheles, Iphiseioides zuluagai, Araneidae, larvae and adults of Psyllobora vigintimaculata and Anthicus sp. were the most frequently encountered. The most common parasitoids were the families Encyrtidae and Braconidae. The highest densities of E. kraemeri and F. schultzei on the edges of the J. curcas crop follow spatial patterns similar to those of their natural enemies I. zuluagai and Anthicus sp. These arthropods can be considered efficient predators of immature stages of E. kraemeri and F. schultzei on J. curcas.


    Directory of Open Access Journals (Sweden)



    Full Text Available The present work describes biological aspects of species caught with pelagic longline off Rio Grande do Sul State, Brazil, between 30ºS to 35ºS. Results point this area as a possible feeding ground of pelagic predators like sharks, swordfish and tunas. Data revealed this area as a parturition location for females blue sharks Prionace glauca. O presente trabalho descreve aspectos da biologia das espécies capturadas com espinhel pelágico na região oceânica frente ao Estado do Rio Grande do Sul, Brasil, cobrindo a área entre 30ºS e 35ºS. Os resultados indicam o uso da área como possível sítio de alimentação para grandes predadores pelágicos como tubarões, espadartes e atuns. Os dados indicam ainda a área como um local utilizado por fêmeas de tubarão-azul Prionace glauca para o parto.

  3. TANINOS CONDENSADOS DE Ephedra breana phil. -EphedraceaE-

    Directory of Open Access Journals (Sweden)

    Rafael A. Ricco


    Full Text Available Este trabajo aborda el estudio de los taninos condensados (proantocianidinas de Ephedra breana Phil. Se estudiaron comparativamente los extractos metanólicos de los tallos aéreos herbáceos y lignificados. En los tallos herbáceos se determinó la presencia de prodelfinidina, que se encuentra principalmente bajo la forma de compuestos de alto peso molecular (polímeros, mientras que en los tallos lignificados se detectó proapigeninidina (una 3-desoxi-proantocianidina bajo la forma de monómero y oligómeros. Se determinaron diferencias cuali-cuantitativas cuando se compararon los tallos herbáceos y lignificados. Se considera que la elevada concentración de taninos en los tallos herbáceos constituye un posible mecanismo de defensa contra los predadores. Por otro lado, debido a su estructura química, los taninos condensados presentes en los tallos aéreos herbáceos podrían actuar, además, como agentes antioxidantes.

  4. Physiological selectivity of insecticides to adult of Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae) / Seletividade fisiológica de inseticidas para adultos de Doru luteipes (Scudder, 1876) (Dermaptera: Forficulidae)

    Scientific Electronic Library Online (English)

    Ana Carolina Maciel, Redoan; Geraldo Andrade, Carvalho; Ivan, Cruz; Maria de Lourdes Corrêa, Figueiredo; Rafael Braga da, Silva.


    Full Text Available Doru luteipes (SCUDDER, 1876) é um dos principais inimigos naturais da Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), alimentando-se de seus ovos e lagartas pequenas. Para sua conservação é necessária a utilização de inseticidas seletivos a S. frugiperda e inócuos ao predador. A [...] ssim, o objetivo deste trabalho foi avaliar a toxicidade de inseticidas registrados para o controle de S. frugiperda. Foram conduzidos bioensaios com adultos de D. luteipes tratados diretamente com os inseticidas, exposição aos resíduos dos compostos aplicados em placas de vidro e consumo de ovos de S. frugiperda contaminados e ofertados uma, 24 e 48 horas após o tratamento. Os inseticidas foram classificados segundo índices propostos pela IOBC/WPRS. Para os adultos de D. luteipes tratados diretamente com os inseticidas, triflumurom foi inócuo (classe 1); clorfenapir e etofemproxi levemente nocivos (classe 2); teflubenzurom/?-cipermetrina e espinosade moderadamente nocivos (classe 3) e tiametoxam/?-cialotrina nocivo (classe 4). No bioensaio de exposição de D. luteipes aos resíduos dos inseticidas aplicados em placas de vidro, todos os produtos foram nocivos ao predador, exceto triflumurom que foi levemente nocivo. A sobrevivência de adultos após o consumo de ovos contaminados com tiametoxam/?-cialotrina foi de 46,7% (levemente nocivo ao predador); os demais inseticidas foram inócuos. Devido à baixa toxicidade do triflumurom a adultos do predador, este composto pode ser recomendado em programas de manejo integrado de pragas visando a preservação dessa espécie de inimigo natural. Os demais produtos devem ser avaliados em casa de vegetação e campo para comprovação de sua toxicidade. Abstract in english Doru luteipes (SCUDDER, 1876) is considered one of the best natural enemies of the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae), feeding on their eggs and small caterpillars. For its conservation it is necessary to use selective insecticides to S. frugiperda and h [...] armless to the predator. Therefore, objective of the present work was to evaluate the toxicity of insecticides registered to control of S. frugiperda. It was conducted bioassays with D. luteipes adults treated with insecticides directly by exposure to residues of compounds applied on glass plates and the consumption of eggs of S. frugiperda contaminated and offered each one, 24 and 48 hours after treatment. The insecticides were classified according to indices proposed by IOBC/WPRS. For adults D. luteipes treated directly with insecticides, triflumuron was harmless (class 1); chlorfenapyr and etofenprox as slightly harmful (class 2) teflubenzuron/?-cypermethrin and spinosad moderately harmful (class 3) and thiamethoxan/?-cyhalothrin harmful (class 4). In bioassay exposure of D. luteipes residues of insecticides applied to glass plates, all products were harmful to the predator, except triflumuron which was considered slightly harmful. The survival of adults after consumption of contaminated eggs was 46.7% for the insecticide tiametoxam/?-cialotrina considered slightly harmful to the predator. The other insecticides were innocuous. Due to the low toxicity presented by the triflumuron to the D. luteipes adults, this compound can be recommended in programs aimed at integrated pest management the preservation of this natural enemy. All other products must be evaluated in greenhouse and field to prove its toxicity.

  5. Eficiência de Chrysoperla externa (Hagen, 1861(Neuroptera: Chrysopidae no controle de Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae em pimentão (Capsicum annum L. Efficiency of Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae in the Myzus persicae (Sulzer, 1776 (Hemiptera: Aphididae population reduction in sweet pepper (Capsicum annum L.

    Directory of Open Access Journals (Sweden)

    Leonardo Rodrigues Barbosa


    Full Text Available Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, contendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente.The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs containing 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

  6. Inseticidas seletivos à tesourinha Doru luteipes (Scudder utilizados no controle do pulgão verde em brássicas Selective insecticides to the earwing Doru luteipes (Scudder used for controlling the green peach aphid in Brassicae

    Directory of Open Access Journals (Sweden)

    Leandro Bacci


    Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer (Homoptera: Aphididae, em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes, dimetoato (para adultos e ninfas de primeiro e segundo estádios, paratiom metílico (para ninfas de primeiro e terceiro estádio e acefato (para adultos, apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae.The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer (Homoptera: Aphididae and on first, second, and third instar nymphs and adults of the Doru luteipes (Scudder (Dermaptera: Forficulidae. Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes, for dimethoate (to adults and first and second instar nymphs of the predator, for methyl parathion (to first and third instar nymphs of the predator, and for acephate (to adults of the predator showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.

  7. Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse

    Directory of Open Access Journals (Sweden)

    Lívia Mendes Carvalho


    Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan' em casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method" e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande, e o restante incluíram F. gemina (Bagnall, Frankliniella sp., Caliothrips phaseoli (Hood e Haplothrips gowdeyi (Franklin. Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%, sendo também coletados Myzus persicae (Sulzer e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.. Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas.Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan' in commercial greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande (>90%, F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood and Haplothrips gowdeyi (Franklin were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover (>80%, Myzus persicae (Sulzer and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson, and the predators Chrysoperla sp., Cycloneda sanguinea (L. and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

  8. Ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em crisântemo de corte em casa de vegetação / Occurrence and population fluctuation of thrips, aphids and natural enemies in cut chrysanthemum in greenhouse

    Scientific Electronic Library Online (English)

    Lívia Mendes, Carvalho; Vanda Helena Paes, Bueno; Simone Martins, Mendes.

    Full Text Available Os pulgões e os tripes são importantes pragas em cultivo de crisântemo em casas de vegetação. O objetivo deste trabalho foi avaliar a ocorrência e flutuação populacional de tripes, pulgões e inimigos naturais em cultivares de crisântemo de corte ('White Reagan', 'Yellow Snowdon' e 'Sunny Reagan') em [...] casa de vegetação comercial. A amostragem de tripes foi realizada através de batidas nas plantas ("tapping method") e a de pulgões a partir de coletas diretas nas plantas. Das espécies de tripes amostradas, mais de 90% foram identificadas como Frankliniella occidentalis (Pergande), e o restante incluíram F. gemina (Bagnall), Frankliniella sp., Caliothrips phaseoli (Hood) e Haplothrips gowdeyi (Franklin). Foi observado maior número de tripes/planta no cultivar White Reagan se comparado com 'Yellow Snowdon'. Aphis gossypii Glover foi a espécie de pulgão mais comum (> 80%), sendo também coletados Myzus persicae (Sulzer) e Dysaphis sp. Maior número de pulgões foi verificado na cultivar White Reagan, quando comparada com 'Sunny Reagan'. Orius insidiosus (Say) foi o único predador encontrado associado aos tripes, sendo verificada uma correlação positiva significativa entre a população de tripes e a desse predador. Dentre os inimigos naturais relacionados aos pulgões, foram observados parasitóides (Aphidius colemani Viereck e Lysiphlebus testaceipes Cresson) e predadores (Chrysoperla sp., Cycloneda sanguinea Linnaeus e Scymnus sp.). Houve uma correlação positiva significativa entre o crescimento populacional de pulgões e desses predadores e parasitóides nas cultivares White Reagan e Sunny Reagan. Inimigos naturais podem ocorrer naturalmente em casas de vegetação e influenciar as populações de pragas. Abstract in english Aphids and thrips play an important role on chrysanthemum crops in greenhouses. The objective of this work was to evaluate the occurrence and population densities of thrips, aphids and natural enemies in cut chrysanthemum cultivars ('White Reagan', 'Yellow Snowdon' and 'Sunny Reagan') in commercial [...] greenhouse. Thrips sampling was made by the tapping method, while aphids were sampled by direct counting on the plants. Frankliniella occidentalis (Pergande) (>90%), F. gemina, Frankliniella sp., Caliothrips phaseoli (Hood) and Haplothrips gowdeyi (Franklin) were the thrips species found. A higher number of thrips/plant was found in 'White Reagan' compared with 'Yellow Snowdon' cultivar. The aphid species Aphis gossypii (Glover) (>80%), Myzus persicae (Sulzer) and Dysaphis sp. were found. A higher number of aphids were found in 'White Reagan' than in 'Sunny Reagan' cultivar. The predatory bug Orius insidiosus (Say) was the only species found associated with thrips in all chrysanthemum cultivars. A positive correlation between thrips and O. insidiosus populations was found. Among the natural enemies associated with aphids the parasitoids Aphidius colemani Viereck and Lysiphlebus testaceipes (Cresson), and the predators Chrysoperla sp., Cycloneda sanguinea (L.) and Scymnus sp were collected. A positive correlation between aphids and their natural enemies' populations in 'White Reagan' and 'Sunny Reagan' cultivars was found. Natural enemies can naturally occur on chrysanthemum in greenhouse and they can affect the pest population.

  9. Eficiência de Chrysoperla externa (Hagen, 1861)(Neuroptera: Chrysopidae) no controle de Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) em pimentão (Capsicum annum L.) / Efficiency of Chrysoperla externa (Hagen, 1861) (Neuroptera: Chrysopidae) in the Myzus persicae (Sulzer, 1776) (Hemiptera: Aphididae) population reduction in sweet pepper (Capsicum annum L.)

    Scientific Electronic Library Online (English)

    Leonardo Rodrigues, Barbosa; César Freire de, Carvalho; Brígida, Souza; Alexander Machado, Auad.


    Full Text Available Avaliou-se a eficiência de larvas de primeiro ínstar de Chrysoperla externa no controle Myzus persicae em pimentão, em experimentos realizados em câmara e sala climatizadas a 25 ± 1ºC, UR de 70 ± 10% e fotofase de 12 horas. Larvas de C. externa recém-eclodidas foram liberadas em discos foliares, con [...] tendo 5; 10 ou 20 ninfas do afídeo, acondicionados em placas de Petri. Em um segundo experimento, larvas do predador foram liberadas nas proporções 1:5, 1:10 e 1:20, em plantas inoculadas com 60; 100 e 140 ninfas do pulgão. O potencial predatório de C. externa nos discos foliares foi influenciado pela densidade inicial do pulgão. A eficiência do predador nas densidades de 5; 10 e 20 pulgões foi de 100%; 96,7% e 79,3%, respectivamente. A eficiência das larvas em eliminar as populações do pulgão nas plantas de pimentão variou em função do tempo. Na proporção 1:5, a eliminação das ninfas ocorreu entre um e dois dias após a liberação do predador, enquanto nas proporções 1:10 e 1:20 o período de quatro dias não foi suficiente para que os pulgões fossem eliminados. As larvas de C. externa quando liberadas nas três proporções promoveram reduções na população de M. persicae, se comparada à testemunha. No entanto, nas proporções 1:5 e 1:10 o predador se mostrou mais eficiente. Abstract in english The efficiency of Chrysoperla externa first instar larvae in the control of Myzus persicae in sweet pepper was evaluated in experiments conducted in climatic chamber and room at 25 ± 1ºC, 70 ± 10% RH and 12h photophase. C. externa newly emerged larvae were released in sweet pepper foliar discs conta [...] ining 5; 10 or 20 aphid nymphs, putted in Petri dishes. In a second experiment, predator larvae were released in 1:5, 1:10 and 1:20 proportions in sweet pepper plants inoculated with 60; 100 and 140 aphids nymphs. The C. externa predatory potential in the foliar discs was affected by aphid initial density. The predator efficiency in 5; 10 and 20 aphid densities was 100%; 96,7% and 79,3%, respectively. The larvae efficiency in eliminating aphids populations in sweet pepper plants range as a result of the time. In 1:5 proportion the nymphs elimination occurred between one and two days after the predator release, while in 1:10 and 1:20 proportions four days were not sufficient to the aphids elimination. C. externa larvae released in the three proportions promoted reductions in M. persicae population when compared to the control. The proportions 1:5 and 1:10 the predator was more efficient.

  10. Inseticidas seletivos à tesourinha Doru luteipes (Scudder) utilizados no controle do pulgão verde em brássicas / Selective insecticides to the earwing Doru luteipes (Scudder) used for controlling the green peach aphid in Brassicae

    Scientific Electronic Library Online (English)

    Leandro, Bacci; Marcelo C., Picanço; Marcos Rafael, Gusmão; Robert W., Barreto; Tederson Luiz, Galvan.


    Full Text Available Estudou-se a seletividade dos inseticidas acefato, deltametrina, dimetoato, metamidofós, paratiom metílico e pirimicarbe a ninfas de último estádio de Myzus persicae (Sulzer) (Homoptera: Aphididae), em relação a adultos, ninfas de primeiro, segundo e terceiro estádios de Doru luteipes (Scudder) (Der [...] maptera: Forficulidae). Pirimicarbe foi altamente seletivo em favor de todos os estádios do predador, sendo que os demais inseticidas foram medianamente seletivos em favor de adultos do predador. Deltametrina, paratiom metílico e dimetoato foram medianamente seletivos em favor de ninfas de terceiro estádio de D. luteipes, sendo que o mesmo ocorreu com os dois primeiros destes em relação a ninfas de primeiro e segundo estádios, respectivamente. Acefato foi pouco seletivo em favor de ninfas de segundo e terceiro estádios, sendo que o mesmo ocorreu com paratiom metílico, deltametrina e metamidofós em relação a ninfas de primeiro, segundo e terceiro estádios, respectivamente. Dimetoato e metamidofós foram mais tóxicos a ninfas de primeiro e segundo estádios do predador do que ao pulgão, sendo que o mesmo ocorreu com o acefato para ninfas de primeiro estádio. Adultos e ninfas de segundo e terceiro estádios de D. luteipes foram mais tolerantes ao acefato, paratiom metílico e pirimicarbe do que ninfas de primeiro estádio do predador. Ninfas de primeiro e segundo estádios apresentaram tolerância semelhante a deltametrina, dimetoato e metamidofós. As curvas de concentração-mortalidade de deltametrina, metamidofós e pirimicarbe (para todos os estádios de desenvolvimento de D. luteipes), dimetoato (para adultos e ninfas de primeiro e segundo estádios), paratiom metílico (para ninfas de primeiro e terceiro estádio) e acefato (para adultos), apresentaram maiores inclinações do que as curvas destes inseticidas para M. persicae. Abstract in english The selectivity of the insecticides acephate, deltamethrin, dimethoate, methamidophos, methyl parathion, and pirimicarb were studied on the last nymphal phase of the green peach aphid Myzus persicae (Sulzer) (Homoptera: Aphididae) and on first, second, and third instar nymphs and adults of the Doru [...] luteipes (Scudder) (Dermaptera: Forficulidae). Pirimicarb was highly selective in favor of all developmental stages of D. luteipes. Deltamethrin, methyl parathion and dimethoate were of median selectivity in favor of third instar nymphs of D. luteipes, as was also observed for the first two of these insecticides regarding to nymphs of first and second instars, respectively. Acephate was little selective in favor of second and third instars nymphs, and the same was observed for methyl parathion, deltamethrin and methamidophos to first, second and third instar nymphs, respectively. Dimethoate and methamidophos were more toxic to nymphs of first and second instars of the predator than to the last instar nymphs of the green peach aphid. D. luteipes adults and second and third instar nymphs were more tolerant to acephate, methyl parathion, and pirimicarb than first instar nymphs. D. luteipes first and second instar nymphs showed similar tolerance to deltamethrin, dimethoate, and methamidophos. Concentration-response curves for deltamethrin, methamidophos, and pirimicarb (to all development stages of D. luteipes), for dimethoate (to adults and first and second instar nymphs of the predator), for methyl parathion (to first and third instar nymphs of the predator), and for acephate (to adults of the predator) showed steeper slopes than the concentration-response curves of these insecticides established to M. persicae.


    Scientific Electronic Library Online (English)

    Dionísio, Link; Ervandil Corrêa, Costa.

    Full Text Available RESUMO Aspectos da biologia e frequência de infestação de Diploschema rotundicolle (Serville, 1834) foram estudados em cinamomo e plantas cítricas, em Santa Maria - RS, durante os anos de 1989 e 1990. Há preferência para oviposição em citros. O ciclo evolutivo é maior em citros que em cinamomo. Emer [...] gem menos adultos em citros que em cinamomo. Há maior incidência de predadores nas galerias larvais, nas plantas cítricas. Abstract in english SUMMARY Biological aspects and infestation frequency of Diploschema rotundicolle were observed at Santa Maria - RS, during 1989 and 1990 seasons in chinaberry, Metia azedarach (Meliaceae) and citrus spp. (Rutaceae). There was a preference for laying eggs on citrus plants. The life cycle is longer in [...] citrus than in chinaberry and fewer adults emerged in citrus than in chinaberry. There was a greater number of predators inside galleryes in citrus plants.

  12. Uso de recursos alimentares por peixes imaturos e adultos de espécies piscívoras em uma planície de inundação neotropical / Use of food resources by juveniles and adults of piscivorous fish species in a neotropical floodplain

    Scientific Electronic Library Online (English)

    André Nogueira, Bozza; Norma Segatti, Hahn.


    Full Text Available Este estudo teve como objetivo avaliar o uso dos recursos alimentares por indivíduos imaturos e adultos de Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis, da planície de inundação do alto [...] Rio Paraná, coletados trimestralmente entre março de 2007 e dezembro de 2008. Foi avaliada a composição quantitativa da dieta através da obtenção do volume das presas (% volume) e amplitude de nicho trófico de cada uma das espécies, bem como as inter-relações tróficas entre elas, através da similaridade entre as dietas e tamanho das presas. A dieta das seis espécies foi composta por peixes-presa (42 espécies), crustáceos e insetos, sendo que todas elas, com exceção de P. corruscans, mostraram alterações ontogenéticas. A amplitude de nicho foi maior para H. aff. malabaricus adultos e menor para P. corruscans adultos e P. squamosissimus imaturos. A similaridade na dieta foi maior para aquelas espécies que consumiram Characidae e menor para P. squamosissimus imaturos, os quais consumiram preferencialmente crustáceos. Houve correlação positiva entre o tamanho da presa e do predador, porém cada espécie consumiu presas de tamanhos diferentes, mostrando que elas não são correlacionadas. Os resultados demonstraram que as seis espécies consumiram peixes desde as fases imaturas, porém com pouca similaridade intra e inter-específica na dieta para a maioria delas, e que o tamanho das presas consumidas aumentou em relação ao tamanho do predador e foi variável entre as espécies. Assim, a dieta dos predadores depende da distribuição e colonização das espécies-presas no ambiente, morfologia e comportamento alimentar tanto das presas quanto dos predadores. Abstract in english The aim of this study was to evaluate the use of food resources by juveniles and adults of Acestrorhynchus lacustris, Hemisorubim platyrhynchos, Hoplias aff. malabaricus, Plagioscion squamosissimus, Pseudoplatystoma corruscans e Salminus brasiliensis from the upper Paraná River floodplain, sampled q [...] uarterly between March 2007 and December 2008. The quantitative trophic composition was obtained by prey volume (% volume) and diet niche breadth of each piscivorous species, as well as trophic relationships among them through diet similarity and prey size. The diet of the species was composed of fish-preys (42 species), crustaceans and insects, with ontogenetic diet changes, except to P. corruscans. The niche breadth was high to H. aff. malabaricus adults and low to P. corruscans adults and P. squamosissimus juveniles. Diet similarity was high to Characidae species consumers and low to P. squamosissimus juveniles, which consumed mainly crustaceans. Positive correlation was found between prey and predator size, however, each piscivorous species consumed different prey sizes, showing no correlation among them. Results showed that the six species consumed fish since juveniles, however, with low diet similarity intra and inter specific to most of them, and the prey size consumed increased in relation to predator size and varied among species. Thus, the piscivorous species diet depends of prey species distribution and colonization, morphology and feeding behavior of the prey as well as the predator.


    Scientific Electronic Library Online (English)

    Jonathan A, Guzmán; Walter, Sielfeld.

    Full Text Available Se estudió la dieta de Orestias agassii en tres lagunas asociadas al Salar del Huasco en el altiplano de la I Región. El contenido estomacal presentó; ostracodos, anfípodos, copépodos, moluscos, coleópteros, ácaros y algas macrófitas. Los resultados permiten afirmar que O. agassii es un predador car [...] nívoro, que consume una amplia variedad de microcrustaáeos que busca activamente entre la vegetación. Abstract in english The diet of Orestias agassii from fresh water springs associated to El Huasco Salt Lake were studied. Lhe stomachs analysis indicated depredation on Ostracoda, Cladocera, Amphipoda, Díptera, Copepoda, Mollusca, Coleóptera, Acari and macrofites. It is concluded that O. agassii is an active carnivore [...] in freshwater communities of the South-American altiplano.

  14. Ocorrência de Stethorus (Stehtorus) minutalus Gordon & Chapin (Coleoptera: Coccinellidae) predando Bemisia tabaci biótipo B (Hemiptera: Aleyrodidae) em algodoeiro no Brasil / Occurrence of Stethorus (Stethotrus) minutalus Gordon & Chapin (Coleoptera: Coccinellidae) preying Bemisia tabaci biotype B (Hemiptera: Aleyrodidae) on cotton plant in Brazil

    Scientific Electronic Library Online (English)

    Leonardo D., Silva; Jean P., Bonani.


    Full Text Available Este comunicado tem o objetivo de registrar, pela primeira vez no Brasil, o predador Stethorus (Stethorus) minutalus Gordon & Chapin (Scymninae, Stethorini). Larvas e adultos de S. minutalus foram observados alimentando-se de ovos e ninfas de Bemisia tabaci Gennadius biótipo B em algodoeiro em condi [...] ções de casa de vegetação em Piracicaba, SP. É provável que esse coccinelídeo seja uma espécie introduzida no país. Abstract in english This report has the objective of registering, for the first time in Brazil, the predator Stethorus (Stethorus) minutalus Gordon & Chapin (Scymninae, Stethorini). Larvae and adults were observed feeding on eggs and nymphs of the whitefly Bemisia tabaci Gennadius biotype B (Hemiptera: Aleyrodidae), on [...] cotton plants under greenhouse condition in Piracicaba, SP. Probably, this coccinelid is an introduced species in the Country.

  15. Dinámica de polifenoles y estudio anatomo-histoquímico en Schinus longifolius (Lindl. Speg. (Anacardiaceae en respuesta a la infección por Calophya mammifex (Hemiptera - Calophyidae

    Directory of Open Access Journals (Sweden)

    Ignacio AGUDELO


    Full Text Available Se analizaron los fenoles totales, taninos totales, proantocianidinas, flavonoides totales y ácidos hidroxicinámicos totales de hojas sanas y agallas de Schinus longifolius (Lindl. Speg. (Anacardiaceae infectado por Calophya mammifex (Hemiptera - Calophyidae. La agalla presenta una variación cuali-cuantitativa de los polifenoles estudiados, con una disminución de los fenoles, taninos, flavonoides y ácidos hidroxicinámicos y un aumento en el contenido de proantocianidinas, cuyo monómero se transforma en cianidina luego del clivaje ácido. Se realizó además un análisis anatómico de la agalla donde se encontraron acúmulos de esclereidas y un mayor desarrollo vascular respecto de la hoja sana y un ensayo histoquímico que mostró una expresión diferencial de metabolitos polifenólicos en sus tejidos. C. mammifex utiliza la agalla como refugio contra las condiciones climáticas adversas y predadores y provee además de alimento con menos compuestos potencialmente perjudiciales en las etapas tempranas de su desarrollo.

  16. Escalas e simplificações: exemplos em sistemas físicos e biológicos / Scaling and simplification: biological and physical system examples

    Scientific Electronic Library Online (English)

    Vicente Pereira de, Barros.


    Full Text Available Neste artigo são apresentados exemplos onde podem ser usadas simplificações matemáticas e adimensionalizações em sistemas físicos e biológicos. A importância destes procedimentos é discutida de forma didática. É feita uma rápida dedução de como este procedimento auxilia na resolução de um problema d [...] e mecânica clássica simples e posteriormente comparado com um sistema predador-presa em ecologia. Abstract in english In this article some examples are given where one can make use of mathematical simplification and adimensionalization procedures in physical and biological systems. The importance of this procedure is discussed in a didactic way. A simple deduction of the procedure is made in a classical mechanical [...] system and applied aftewards to the predato-prey system.

  17. New gall midges (Diptera, Cecidomyiidae) associated with two species of Eugenia (Myrtaceae) / Novos mosquitos de galhas (Diptera, Cecidomyiidae) associadas a duas espécies de Eugenia (Myrtaceae)

    Scientific Electronic Library Online (English)

    Valéria Cid, Maia; Pedro de Araújo Lima, Constantino; Ricardo Ferreira, Monteiro.


    Full Text Available Jorgenseniella eugeniae, gen. nov., sp. nov. e Dasineura marginalis, sp. nov. são descritos com base em material obtido de galhas foliares em Eugenia umbelliflora e E. rotundifolia (Myrtaceae). Ilustrações dos adultos, fases imaturas e galhas são fornecidas. Trotteria sp. (inquilino) e Lestodiplosis [...] sp. (predador) estão associados com as espécies galhadoras. Aspectos ecológicos das galhas e das espécies de cecidógenos são também apresentados. Abstract in english Jorgenseniella eugeniae, gen. nov., sp. nov. and Dasineura marginalis, sp. nov. are described based on material obtained from leaf galls on Eugenia umbelliflora and E. rotundifolia (Myrtaceae). Illustrations of adults, immature stages and galls are given. Trotteria sp. (inquiline) and Lestodiplosis [...] sp. (predator) are associated with the galling species. Ecological aspects of galls and gall midge species are also presented.

  18. New gall midges (Diptera, Cecidomyiidae associated with two species of Eugenia (Myrtaceae Novos mosquitos de galhas (Diptera, Cecidomyiidae associadas a duas espécies de Eugenia (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Valéria Cid Maia


    Full Text Available Jorgenseniella eugeniae, gen. nov., sp. nov. and Dasineura marginalis, sp. nov. are described based on material obtained from leaf galls on Eugenia umbelliflora and E. rotundifolia (Myrtaceae. Illustrations of adults, immature stages and galls are given. Trotteria sp. (inquiline and Lestodiplosis sp. (predator are associated with the galling species. Ecological aspects of galls and gall midge species are also presented.Jorgenseniella eugeniae, gen. nov., sp. nov. e Dasineura marginalis, sp. nov. são descritos com base em material obtido de galhas foliares em Eugenia umbelliflora e E. rotundifolia (Myrtaceae. Ilustrações dos adultos, fases imaturas e galhas são fornecidas. Trotteria sp. (inquilino e Lestodiplosis sp. (predador estão associados com as espécies galhadoras. Aspectos ecológicos das galhas e das espécies de cecidógenos são também apresentados.

  19. Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor (Acari: Phytoseiidae Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor (Acari: phytoseiidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva


    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulverizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The products' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  20. Toxicidade de formulações de nim (Azadirachta indica A. Juss.) ao ácaro-rajado e a Euseius alatus De Leon e Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae) / Toxicity of neem (Azadirachta indica A. Juss) formulations for twospotted spider mite and Euseius alatus De Leon and Phytoseiulus macropilis (Banks) (Acari: Phytoseiidae)

    Scientific Electronic Library Online (English)

    Hilda M., Brito; Manoel G.C., Gondim Jr.; José V. de, Oliveira; Cláudio A.G. da, Câmara.


    Full Text Available A toxicidade de formulações comerciais de nim a Tetranychus urticae Koch (Acari: Tetranychidae) e a dois ácaros predadores, Euseius alatus De Leon e Phytoseiulus macropilis (Banks) foi estudada. A toxicidade tópica foi avaliada com três formulações comerciais (Natuneem, Neemseto e Callneem) e com o [...] extrato de sementes de nim, todos na concentração de 1%, em comparação ao acaricida padrão, abamectina na concentração de 0,3ml/L e ao tratamento controle com água destilada. Com base no melhor efeito tópico sobre T. urticae, a formulação Neemseto foi selecionada para avaliar diferentes concentrações sobre ovos, e o efeito residual e repelente sobre adultos desses ácaros. O tratamento dos ovos consistiu na imersão em diluições de Neemseto por cinco segundos; e o efeito residual e repelente sobre adultos foi avaliado pela imersão de discos de folha nas diluições também por cinco segundos. A toxicidade de Neemseto a ovos e adultos foi maior para T. urticae comparada à toxicidade observada para os ácaros predadores. Neemseto foi repelente para T. urticae e E. alatus, quando testados nas concentrações 0,25; 0,50 e 1,00%, mas não afetou P. macropilis. A fecundidade de T. urticae foi reduzida significativamente por Neemseto em todas as concentrações, enquanto para os ácaros predadores, redução significante na fecundidade foi observada apenas nas maiores concentrações. Assim, nas formulações testadas, Neemseto foi o mais eficiente para o ácaro-rajado e provocou, relativamente, menor impacto aos ácaros predadores estudados. Abstract in english The toxicity of selected commercial formulations of neem on Tetranychus urticae Koch (Acari: Tetranychidae) and two predatory mites Euseius alatus De Leon and Phytoseiulus macropilis (Banks) was studied. Topical toxicity was tested with the commercial formulations (Natuneem, Neemseto and Callneem) a [...] nd extract of neem's seeds at concentration 1%, compared to the standard acaricide abamectin at concentration of 0.3 ml/L and the control treatment (distilled water). Based on the best performance against T. urticae through topical contact, the formulation Neemseto was selected to be evaluated using different concentrations against eggs, and residual and repellent effects on adults of the mites. Egg treatment consisted of dipping eggs into Neemseto dilutions and control treatment for five seconds. In addition, residual and repellent effects of Neemseto for adult mites consisted of using leaf discs dipped into the dilutions for five seconds. The toxicity of Neemseto on eggs and adults was greater for T. urticae compared to the toxicity observed for the predatory mites. Neemseto was repellent for T. urticae and E. alatus when tested at the concentrations of 0.25, 0.50 and 1.0%, and did not affect P. macropilis. Neemseto using all concentrations, while for the predatory mites significant reduction of mite fecundity was only observed at the largest concentrations reduced the fecundity of T. urticae significantly. So Neemseto, among tested neem formulations, performed better against the twospotted spider mite and exhibited relatively low impact against the predatory mites studied.

  1. Toxicidade residual de alguns agrotóxicos recomendado na agricultura sobre Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) / Residual toxicity of some pesticides recommended for citrus orchards on the predaceous mite Neoseiulus californicus (McGregor) (Acari: phytoseiidae)

    Scientific Electronic Library Online (English)

    Marcos Zatti da, Silva; Caralos Amadeu Leite de, Oliveira.


    Full Text Available O objetivo do trabalho foi avaliar a toxicidade residual de alguns agrotóxicos utilizados em citros sobre Neoseiulus californicus (McGregor) em condições de laboratório. O método de bioensaio adotado foi o de contato residual. Folhas de citros da variedade Pêra, acondicionadas em arenas, foram pulve [...] rizadas em torre de Potter. A toxicidade residual dos produtos foi avaliada duas horas e 1; 3; 5; 7; 10; 14 e 21 dias após a aplicação. Em cada arena, foram transferidas dez fêmeas adultas de N. californicus, juntamente com uma quantidade suficiente de Tetranychus urticae, como fonte de alimento. As avaliações de mortalidade foram realizadas 72 horas após a transferência dos ácaros para as arenas. Os agrotóxicos acrinathrin, deltamethrin, dinocap, enxofre, fenpropathrin, óxido de fenbutatin e propargite não causaram mortalidades significativas em adultos de N. californicus. Foram registradas mortalidades de 29,8; 24,0 e 34,1% para ácaros N. californicus expostos a resíduos de duas horas de idade de abamectim, azocyclotin e cyhexatin, respectivamente. Dicofol, pyridaben e chlorfenapyr causaram 100% de mortalidade aos ácaros predadores expostos aos resíduos tóxicos dos acaricidas, com duas horas de idade. Abamectin provocou mortalidade significativa por um período inferior a um dia. Resíduos dos acaricidas azocyclotin, cyhexatin, dicofol, pyridaben e chlorfenapyr provocaram mortalidades significativas por períodos de 1; 1; 10; 10 e 21dias, respectivamente. Os resultados obtidos no presente experimento servem de subsídio para a escolha adequada dos agrotóxicos a serem utilizados em pomares de citros nos quais N. californicus esteja presente ou naqueles em que o predador venha a ser liberado. Esses resultados também servem para a escolha do momento mais favorável para a liberação dos ácaros predadores dessa espécie no campo, após a aplicação de agrotóxicos nos pomares. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador. Abstract in english This study was carried out to evaluate the residual toxicity of some pesticides used in citrus orchards, on Neoseiulus californicus (McGregor) under laboratory conditions. The residual contact bioassay method was adopted. Citrus leaves of the variety "Pêra" were sprayed in a Potter tower. The produc [...] ts' residual toxicity was evaluated at two hours and 1, 3, 5, 7, 10, 14 and 21 days after treatment. Ten adult females of N. californicus were transferred to each arena together with an enough amount of Tetranychus urticae to feed the predator. Mortality evaluations were performed at 72 hours after transferring the predaceous mites to the arenas. The pesticides acrinathrin, deltamethrin, dinocap, sulphur, fenpropathrin, fenbutatin oxide and propargite did not cause significant mortalities to the adults of N. californicus. Abamectim, azocyclotin and cyhexatin caused mortalities of 29.8, 24.0 and 34.1%, respectively, for N. californicus adults exposed to two-hour pesticide residues. Dicofol, pyridaben and chlorfenapyr caused 100% of mortality to the predators exposed to the two-hour acaricide residues. Abamectin provoked significant mortalities for a period shorter than one day. Residues of azocyclotin, cyhexatin, dicofol, pyridaben and chlorfenapyr caused significant mortalities for periods of 1, 1, 10, 10 and 21 days, respectively. The results of this study provided basic information for choosing the adequate pesticides to be used in citrus orchards in which N. californicus is present, or in those the predator will be released. The results are also useful for the decision of the best releasing time for N. californicus in the field, after pesticide applications. Studies carried out in the field are still necessary to understand better the effect of these pesticides under the predaceous mite.

  2. Toxicidade Diferencial de Agroquímicos a Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) e Tetranychus urticae Koch (Acari: Tetranychidae) em Morangueiro / Differential Toxicity of Pesticides to Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) and Tetranychus urticae Koch (Acari: Tetranychidae) on Strawberry

    Scientific Electronic Library Online (English)



    Full Text Available Este trabalho teve por objetivo avaliar a toxicidade diferencial de agroquímicos a populações de ácaros das espécies Neoseiulus californicus (McGregor) e Tetranychus urticae Koch coletadas de cultivos comerciais de morangueiro (Fragaria sp.) em Atibaia, SP. No teste de toxicidade aguda, fêmeas adult [...] as de N. californicus foram tratadas através de pulverização direta utilizando torre de Potter. O ácaro predador N. californicus mostrou tolerância igual ou superior a T. urticae a diversos produtos, em condições de laboratório. A maior diferença foi observada para o acaricida propargite, para o qual o ácaro predador mostrou-se 25,1 vezes mais tolerante que o ácaro rajado. Este fitoseídeo também se mostrou 4,7; 2,9 e 2,5 vezes mais tolerante que o ácaro rajado, a clorfenapir, fempiroximate e ciexatim, respectivamente. No teste de toxicidade residual de agroquímicos, a pulverização foi realizada em canteiros de morango. Foram coletados folíolos em diferentes períodos após a aplicação e infestados artificialmente com fêmeas adultas de N. californicus. As avaliações de mortalidade foram realizadas 48h ou 72h após a infestação. Fempiroximate, fempropatrim, dimetoato, propargite, enxofre e benomil mostraram-se inócuos a N. californicus. Clorfenapir, ciexatim e abamectim foram significativamente prejudiciais ao ácaro predador causando mortalidades iniciais entre 37,5% e 57,5%. A utilização de ácaros predadores como desta população de N. californicus, que apresenta baixa suscetibilidade a diversos agroquímicos, poderia ser muito útil em programas de manejo de T. urticae em morangueiro no Brasil Abstract in english This work aimed to evaluate the differential toxicity of pesticides to populations of the mite species Neoseiulus californicus (McGregor) and Tetranychus urticae Koch collected from commercial crops of strawberry (Fragaria sp.) in Atibaia county, State of São Paulo, Brazil. In the test of acute toxi [...] city of pesticides, adult females of N. californicus received the pesticide treatment under Potter spray tower. The predaceous mite N. californicus showed the same or higher tolerance than T. urticae to various pesticides in laboratory. The highest difference was observed to the acaricide propargite, for which the predaceous mite was 25.1 times more tolerant than the two-spotted spider mite. This phytoseiid was also 4.7, 2.9 and 2.5 times more tolerant than T. urticae to chlorfenapyr, fenpyroximate, and cyhexatin, respectively. In the test of residual toxicity of pesticides, the chemicals were sprayed on plants of strawberry in the field. Leaves were collected after different periods from the treatment and artificially infested with adult females of N. californicus. The mortality was assessed 48h or 72h after treatment. Fenpyroximate, fenpropathrin, dimethoate, propargite, sulphur, and benomyl were innocuous to N. californicus. Chlorfenapyr, cyhexatin, and abamectin were significantly harmful to the predaceous mite causing initial mortality rates between 37.5% and 57.5%. The use of predaceous mites like of this population of N. californicus, which presents low susceptibility to various pesticides can be very useful for programs of management of T. urticae on strawberry in Brazil.

  3. Localização de presas à curta distância por Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): o papel dos aleloquímicos dos ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch (Acari: Tetranychidae) e da planta hospedeira, Malus domestica (Borkham) / Short-distance prey location by Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): the role of the allelochemicals from two phytophagous mites, Panonychus ulmi(Koch) and Tetranychus urticae Koch (Acari: Tetranychidae), and their host plant, Malus domestica (Borkham)

    Scientific Electronic Library Online (English)

    Karin F.S., Collier; Álvaro E., Eiras; Gilberto S., Albuquerque; Jacquelyn L., Blackmer; Marilaine C., Araújo; Lino B., Monteiro.


    Full Text Available Para conhecer os estímulos olfativos à curta distância que Neoseiulus californicus (McGregor) usa para encontrar seu alimento, isto é, os ácaros fitófagos Panonychus ulmi (Koch) e Tetranychus urticae Koch, estudaram-se as respostas deste ácaro predador em relação aos aleloquímicos voláteis oriundos [...] tanto das duas espécies de presa como de sua planta hospedeira, Malus domestica (Borkham). Na extremidade de um braço da trilha em Y foi introduzido um disco de folha sadia de macieira (= controle) e na outra um dos oito tipos de estímulo (= tratamento) seguintes: 1) folha sadia, 2) folha sadia com a presa, 3) folha sadia com cairomônios da presa, 4) folha sadia com a presa e seus cairomônios, 5) folha atacada limpa, 6) folha atacada com a presa, 7) folha atacada com cairomônios da presa e 8) folha atacada com a presa e seus cairomônios. Para cada tratamento, observou-se a direção do deslocamento do ácaro predador e analisou-se sua porcentagem de resposta. Para localizar P. ulmi, N. californicus orientou-se pelos estímulos oriundos de folhas sadias com a presa e seus cairomônios (T4), folhas atacadas com cairomônios da presa (T7) e folhas atacadas com a presa e seus cairomônios (T8). Com relação a T. urticae, o ácaro predador respondeu significativamente aos estímulos oriundos de folhas sadias com cairomônios da presa (T3) e de folhas sadias com a presa e seus cairomônios (T4), assim como de todas as combinações com folhas atacadas (T5-8). Estes resultados demonstram que os voláteis emanados pelos ácaros fitófagos, por seus subprodutos e pela planta por eles atacada, em conjunto ou isoladamente, são importantes fontes de informação para N. californicus localizar T. urticae à curta distância. Por outro lado, somente a combinação de dois ou mais estímulos olfativos parece sinalizar a localização de P. ulmi para o ácaro predador, principalmente se os cairomônios de suas fezes, ovos e exúvias estiveram incluídos em tal mistura. Abstract in english To understand how Neoseiulus californicus (McGregor) locates its prey, i.e. Panonychus ulmi (Koch) and Tetranychus urticae Koch, we studied the predator's short-distance responses to the volatile allelochemicals associated with these two phytophagous mites and their host plant, Malus domestica (Bork [...] ham). At the end of one branch of a Y-shape runway we placed an uninfested apple leaf disk (= control) and, at the other end, one of the eight following types of stimulus (= treatments): 1) uninfested leaf, 2) uninfested leaf + prey, 3) uninfested leaf + prey kairomones, 4) uninfested leaf + prey + prey kairomones, 5) infested leaf, 6) infested leaf + prey, 7) infested leaf + prey kairomones, and 8) infested leaf + prey + prey kairomones. We observed the predator's searching behavior on the runway and analyzed its percentage of response to each of the above stimuli. When P. ulmi was tested, significantly more predators went to the end of the branch with uninfested leaves and prey with its kairomones (T4), infested leaves and prey kairomones (T7), and infested leaves and prey with its kairomones (T8). In relation to T. urticae, the predaceous mite showed significant responses to uninfested leaves with prey kairomones (T3) and to uninfested leaves and prey with its kairomones (T4), as well as to all infested leaf combinations (T5-8). These results indicate that the volatiles associated with the phytophagous mites, their byproducts, and the host plant, either separately or combined, play an important role on the short-distance location of T. urticae by N. californicus. On the other hand, only a combination of two or more of those stimuli appear to signal the location of nearby colonies of P. ulmi to the predaceous mite, specially when the kairomones from their feces, eggs, and exuviae are included in such blend.

  4. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate Mortality factors at egg stage of Tuta absoluta (Meyrick (Lepidoptera: Gelechiidae on organic tomato system and on conventional tomato system

    Directory of Open Access Journals (Sweden)

    Maria Alice de Medeiros


    Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick (Lep.: Gelechiidae está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância desses fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1 coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2 exposição de ovos sentinelas no campo por 72 horas; 3 ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3, evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate.The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick (Lep.: Gelechiidae affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining. The objective of the present work was to quantify the role of each factor in the survivorship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1 tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2 tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3 cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32% than those kept in the field (methodology 2 and 3. However, under field conditions (method 2 and 3 by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

  5. Fatores de mortalidade na fase de ovo de Tuta absoluta em sistemas de produção orgânica e convencional de tomate / Mortality factors at egg stage of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on organic tomato system and on conventional tomato system

    Scientific Electronic Library Online (English)

    Maria Alice de, Medeiros; Edison Ryoiti, Sujii; Helena Castanheira de, Morais.

    Full Text Available A traça-do-tomateiro Tuta absoluta (Meyrick) (Lep.: Gelechiidae) está sujeita a fatores de mortalidade bióticos como predadores e parasitoides e fatores abióticos como água da irrigação e da chuva que influenciam sua dinâmica populacional. O objetivo deste trabalho foi quantificar a importância dess [...] es fatores na sobrevivência de ovos da traça-do-tomateiro. Os experimentos foram desenvolvidos na Embrapa Hortaliças, de 1/8/2004 a 7/11/2005, em plantio de tomate e tomate consorciado em sistema orgânico e tomate em sistema convencional. As avaliações consistiram em: 1) coleta de ovos no campo em diferentes épocas do ciclo da cultura e sua incubação em laboratório até a emergência do parasitoide ou eclosão da lagarta; 2) exposição de ovos sentinelas no campo por 72 horas; 3) ovos marcados e acompanhados a cada 24 horas até eclosão das lagartas em campo. Ovos coletados no campo e incubados em laboratório mostraram que a mortalidade por Trichogramma sp. foi de 32%. A mortalidade dos ovos que permaneceram no campo (metodologia 2 e 3), evidenciaram que o parasitismo por Trichogramma sp. foi de 12% e que os predadores e o efeito mecânico da água produziram 36% de mortalidade dos ovos. Essa diferença revela que a permanência dos ovos no campo os expõe à competição com predadores e a mortalidade causada pelo efeito mecânico da água reduzindo o recrutamento de Trichogramma sp. Parasitoides de ovos, predadores generalistas associados à ação da água acarretaram maior mortalidade de T. absoluta em sistemas de produção orgânica de tomate. Abstract in english The population dynamics of South American tomato pinworm Tuta absoluta (Meyrick) (Lep.: Gelechiidae) affected by several mortality biotic factors such as predators, parasitoids and water (irrigation and raining). The objective of the present work was to quantify the role of each factor in the surviv [...] orship of tomato pinworm eggs. The experiments were conducted at Embrapa Hortaliças from 01/08/2004 to 07/11/2005 in tomato and tomato-coriander organic system and traditional tomato crop system. The following methodology were conducted: 1) tomato pinworm eggs were collected in the field at different stages of the crop cycle and incubated in laboratory until the caterpillar/parasitoid emergency; 2) tomato pinworm eggs were marked and recollected after 72 hours, as sentinel prey; 3) cohorts of tomato pinworm eggs were marked and monitored each 24h until caterpillar eclosion. The eggs collected in the field and kept in the lab showed greater mortality by Trichogramma sp. (32%) than those kept in the field (methodology 2 and 3). However, under field conditions (method 2 and 3) by Trichogramma sp. was as lower as 12%, and mortality caused by predator and water effects reach 36%. This difference suggests that egg permanence in the field expose it to competition with predators and mortality caused by water effect, decreasing the recruitment of Trichogramma sp. Egg parasitoids, generalist predators associated with the water impact resulted in more mortality rates on eggs of T. absoluta in organic tomato cropping system.

  6. Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae) on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae) parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae) / Desenvolvimento ninfal e preferência alimentar de Podisus maculiventris (Heteroptera: Pentatomidae) em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae) parasitados ou não por Trichogramma brassicae (Hymenoptera: Trichogrammatidae)

    Scientific Electronic Library Online (English)

    H. N., Oliveira; P., De Clercq; J. C., Zanuncio; D., Pratissoli; E. P., Pedruzzi.


    Full Text Available Avaliou-se a predação de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa) ou não por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos às ninfas de P. maculiventris como alimento. Esse Pentatomidae só atingiu a fase [...] adulta quando se alimentou de ovos não parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criação desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estádio. Em teste de escolha, ninfas desse predador mostraram preferência por ovos não parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que é possível associar o uso de P. maculiventris com liberações de T. brassicae em programas de controle de lepidópteros pragas, Abstract in english Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae), parasitised or not by Trichogramma brassicae (pupae stage). Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventr [...] is as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that it is possible to combine the use of P. maculiventris with releases of T. brassicae in control programs of lepidopteran pests.

  7. Nymphal development and feeding preference of Podisus maculiventris (Heteroptera: Pentatomidae on eggs of Ephestia kuehniella (Lepidoptera: Pyralidae parasitised or not by Trichogramma brassicae (Hymenoptera: Trichogrammatidae Desenvolvimento ninfal e preferência alimentar de Podisus maculiventris (Heteroptera: Pentatomidae em ovos de Ephestia kuehniella (Lepidoptera: Pyralidae parasitados ou não por Trichogramma brassicae (Hymenoptera: Trichogrammatidae

    Directory of Open Access Journals (Sweden)

    H. N. Oliveira


    Full Text Available Predation by Podisus maculiventris nymphs, a predatory pentatomid, was evaluated with eggs of the flour moth Ephestia kuehniella (Pyralidae, parasitised or not by Trichogramma brassicae (pupae stage. Eggs of this pyralid were glued on rectangular cardboard and presented to nymphs of P. maculiventris as food. The pentatomid successfully reached adult stage when feeding on unparasitised eggs, indicating that flour moth eggs can be used as a factitious food for rearing this predator. Pentatomid nymphs that received only parasitised eggs died before reaching fourth instar. In choice tests, P. maculiventris showed a preference for preying on unparasitised eggs of E. kuehniella rather than those containing pupae of T. brassicae. These results show that it is possible to combine the use of P. maculiventris with releases of T. brassicae in control programs of lepidopteran pests.Avaliou-se a predação de ninfas de Podisus maculiventris sobre ovos de Ephestia kuehniella parasitados (em fase de pupa ou não por Trichogramma brassicae. Esses ovos foram colados em cartelas retangulares e oferecidos às ninfas de P. maculiventris como alimento. Esse Pentatomidae só atingiu a fase adulta quando se alimentou de ovos não parasitados desse Pyralidae, indicando que os mesmos podem ser usados como hospedeiro alternativo para criação desse predador. Ninfas de P. maculiventris que receberam ovos parasitados morreram antes do quarto estádio. Em teste de escolha, ninfas desse predador mostraram preferência por ovos não parasitados em vez de por aqueles parasitados que continham em seu interior uma pupa de T. brassicae. Esses resultados mostram que é possível associar o uso de P. maculiventris com liberações de T. brassicae em programas de controle de lepidópteros pragas,

  8. Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas Acarofauna in physic nut culture and associated spontaneous weeds

    Directory of Open Access Journals (Sweden)

    Wilton Pires da Cruz


    Full Text Available O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas por meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos.The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

  9. Acarofauna em cultivo de pinhão-manso e plantas espontâneas associadas / Acarofauna in physic nut culture and associated spontaneous weeds

    Scientific Electronic Library Online (English)

    Wilton Pires da, Cruz; Renato Almeida, Sarmento; Adenir Vieira, Teodoro; Eduardo Andrea Lemus, Erasmo; Marçal, Pedro Neto; Maíra, Ignacio; Diogenis Fontenele, Ferreira Junior.


    Full Text Available O objetivo deste trabalho foi identificar ácaros na cultura de pinhão-manso e em espécies de plantas espontâneas associadas. Para isso, foram avaliadas a riqueza e a abundância de ácaros em plantas de pinhão-manso e em 14 espécies de plantas espontâneas associadas. As amostragens foram realizadas po [...] r meio de coletas mensais de folhas de plantas de pinhão-manso e de plantas espontâneas, nas entrelinhas do cultivo. Foram encontradas quatro espécies de ácaros predadores - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo e Typhlodromalus clavicus -, com potencial para uso no controle biológico de ácaros-praga na cultura do pinhão-manso, e duas importantes espécies de ácaros fitófagos - Brevipalpus phoenicis e Tarsonemus confusus - desconhecidas como praga da cultura. Entre as plantas espontâneas avaliadas, quatro espécies - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica e Andropogon gayanus - abrigam grande riqueza e abundância de ácaros predadores, enquanto oito destacaram-se pela diversidade de ácaros fitófagos. Abstract in english The objective of this work was to identify mites in physic nut culture, and in associated spontaneous weed species. For this, mite richness and abundance on physic nut plants and on 14 species of associated spontaneous weeds were evaluated. Samplings were done with monthy collections of leaves from [...] physic nut plants and from weeds, between planting lines. Four species of predatory mites - Amblyseius tamatavensis, Paraphytoseius multidentatus, Typhlodromalus aripo and Typhlodromalus clavicus -, with potential for biological control of pest mites on physic nut culture, and two species of phytophagous mites - Brevipalpus phoenicis and Tarsonemus confusus -, not yet known as pests of the culture were found. Among the evaluated spontaneous weeds, four species - Hyptis suaveolens, Peltaea riedelii, Urochloa mutica and Andropogon gayanus - harbor great richness and abundance of predatory mites, whereas eight harbored a high diversity of phytophagous mites.

  10. First record of the fireworm Hermodice carunculata (Annelida, Polychaeta) preying on colonies of the fire coral Millepora alcicornis (Cnidaria, Hydrozoa) / Primeiro registro do verme de fogo Hermodice carunculata (Annelida, Polychaeta) predando colônias do coral de fogo Millepora alcicornis (Cnidaria, Hydrozoa)

    Scientific Electronic Library Online (English)

    Carlos Daniel, Pérez; Paula Braga, Gomes.


    Full Text Available O poliqueta Hermodice carunculata é um voraz predador de vários organismos bentônicos e um dos grupos preferenciais na sua dieta é o dos cnidários. No presente trabalho se apresenta o primeiro registro de predação do verme de fogo sobre o hidrocoral Millepora alcicornis. O verme engolfa os ramos ter [...] minais do hidrocoral e fica vários minutos raspando a superfície e retirando os tecidos moles. Apesar deste hidrocoral ser um dos representantes mais comuns dos recifes do norte e nordeste brasileiros e de albergar uma vasta comunidade associada, nunca tinha sido registrada esta associação. Esta nova descoberta alerta na necessidade de se estudar esta associação já que geralmente os danos ocasionados pelo poliqueta são irreversíveis e dependendo da quantidade de predadores pode alterar a saúde dos recifes ou modificar os componentes da comunidade recifal. Abstract in english The polychaete Hermodice carunculata is a voracious predator of several benthic organisms and one of the preferential groups in its diet is that of the cnidarians. This note presents the first record of a fireworm preying on the calcified hydroid Millepora alcicornis. The fireworm engulfs the termin [...] al branches of the fire coral and spends several minutes scraping the surface and removing the soft tissues. Despite this being one of the most common calcified hydroids of the Brazilian northern and northeastern regions (and home to a vast associated community), this kind of association had never been recorded. This discovery points to the need of studying such associations because the damage caused by this polychaete is irreversible and depending on the amount of predators might alter reefs' health or modify the components of the reef community.

  11. Diet of the chola guitarfish, Rhinobatos percellens (Rhinobatidae), in the Paranaguá Estuarine complex

    Scientific Electronic Library Online (English)

    Wanessa P.D. do, Carmo; Hugo, Bornatowski; Elton C., Oliveira; Luís L., Fávaro.

    Full Text Available A raia viola, Rhinobatos percellens, é um dos batoídeos mais capturados na costa brasileira, e é um importante predador da comunidade bêntica. Estômagos de R. percellens foram amostrados no complexo estuarino de Paranaguá (Março/2006 a Março/2007 e Outubro/2008 a Setembro/2009). Os estômagos obtidos [...] foram utilizados para descrever a dieta de R. percellens, e verificar se há diferenças sazonais e ontogenéticas em sua alimentação nesta área estuarina. A análise geral mostrou uma dieta especializada com a predominância de três espécies em seu conteúdo alimentar: Leptochela serratorbita, restos de Caridea e Ogyrides alphaerostris. Análises ontogenéticas e sazonais não revelaram diferenças significantes no consumo de alimento. Estes dados revelam que R. percellens é um predador especialista