WorldWideScience

Sample records for chlorophenol derivatives promoted

  1. Oxidative degradation of chlorophenol derivatives promoted by microwaves or power ultrasound: a mechanism investigation.

    Science.gov (United States)

    Cravotto, Giancarlo; Binello, Arianna; Di Carlo, Stefano; Orio, Laura; Wu, Zhi-Lin; Ondruschka, Bernd

    2010-03-01

    Phenols are the most common pollutants in industrial wastewaters (particularly from oil refineries, resin manufacture, and coal processing). In the last two decades, it has become common knowledge that they can be effectively destroyed by nonconventional techniques such as power ultrasound (US) and/or microwave (MW) irradiation. Both techniques may strongly promote advanced oxidation processes (AOPs). The present study aimed to shed light on the effect and mechanism of US- and MW-promoted oxidative degradation of chlorophenols; 2,4-dichlorophenoxyacetic acid (2,4-D), a pesticide widespread in the environment, was chosen as the model compound. 2,4-D degradation by AOPs was carried out either under US (20 and 300 kHz) in aqueous solutions (with and without the addition of Fenton reagent) or solvent-free under MW with sodium percarbonate (SPC). All these reactions were monitored by gas chromatography-mass spectrometry (GC-MS) analysis and compared with the classical Fenton reaction in water under magnetic stirring. The same set of treatments was also applied to 2,4-dichlorophenol (2,4-DCP) and phenol, the first two products that occur a step down in the degradation sequence. Fenton and Fenton-like reagents were employed at the lowest active concentration. The effects of US and MW irradiation were investigated and compared with those of conventional treatments. Detailed mechanisms of Fenton-type reactions were suggested for 2,4-D, 2,4-DCP, and phenol, underlining the principal degradation products identified. MW-promoted degradation under solvent-free conditions with solid Fenton-like reagents (viz. SPC) is extremely efficient and mainly follows pyrolytic pathways. Power US strongly accelerates the degradation of 2,4-D in water through a rapid generation of highly reactive radicals; it does not lead to the formation of more toxic dimers. We show that US and MW enhance the oxidative degradation of 2,4-D and that a considerable saving of oxidants and cutting down of

  2. Photo-oxidation. Of the system chrome hexavalent-4-chlorophenol

    International Nuclear Information System (INIS)

    Gil Pavas, Edison; Cabrera Limpias, Marianela; Jaramillo Jimenez, Sergio Alejandro

    2003-01-01

    As a proposal to eliminate highly toxic chemical components derived from industrial waste, the researchers study the behavior of the compound hexavalent chromium / 4-chlorophenol system when subjected to photo degradation in a photo-reactor compound parabolic cylinder (CPC) to scale pilot. The effect is analyzed in order to determine the operation conditions to reach the highest degradation levels possible. The analyzed variables were pH, concentration of catalyst (TiO 2 ), time of recirculation and the relation of initial concentrations among polluting agents. The factor that most influences the levels of removal reached is the pH, which has a different effect for each of the pollutants. This implies that, theoretically, you cannot adopt a unique group of operation parameters to favor the degradation of both however, in the practice; high levels of degradation of both pollutants are obtained in the optimal point of operation of the chrome. It is also observed that the catalyst concentration does not influence the degradation of the polluting agents significantly, at least for the initial concentrations studied. The recirculation time is closely related to the kinetics of degradation of each polluting agent. Elevated degradation levels are reached in a short time for 4-chlorophenol, while more prolonged recirculation times are required for hexavalent chromium. The relation of initial concentrations of the polluting agents also exerts an opposite effect on the degradation levels reached for each polluting agent; the hexavalent chromium reduction is favored with high initial concentrations of 4-chlorophenol, whereas the oxidation of 4-chlorophenol is favored with high initial hexavalent chromium concentrations, which suggests some synergy between the oxidation-reduction reactions of 4-chlorophenol and hexavalent chromium. Finally, a 97% hexavalent chromium reduction and a 94.9% oxidation of 4-chlorophenol were obtained

  3. Catalytic wet air oxidation of 2-chlorophenol over sewage sludge-derived carbon-based catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Yuting [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Xiong, Ya; Tian, Shuanghong [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou 510275 (China); Kong, Lingjun [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Descorme, Claude, E-mail: claude.descorme@ircelyon.univ-lyon1.fr [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)

    2014-07-15

    Highlights: • A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared. • FeSC exhibited high catalytic activity in the wet air oxidation of 2-chlorophenol. • A strong correlation was observed between the 2-CP conversion, the iron leaching and the pH. • Using an acetate buffer, the iron leaching was suppressed while keeping some catalytic activity. • A simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst. - Abstract: A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared and used in the Catalytic Wet Air Oxidation (CWAO) of 2-chlorophenol (2-CP). The catalysts were characterized in terms of elemental composition, surface area, pH{sub PZC}, XRD and SEM. The performances of the FeSC catalyst in the CWAO of 2-CP was assessed in a batch reactor operated at 120 °C under 0.9 MPa oxygen partial pressure. Complete decomposition of 2-CP was achieved within 5 h and 90% Total Organic Carbon (TOC) was removed after 24 h of reaction. Quite a straight correlation was observed between the 2-CP conversion, the amount of iron leached in solution and the pH of the reaction mixture at a given reaction time, indicating a strong predominance of the homogeneous catalysis contribution. The iron leaching could be efficiently prevented when the pH of the solution was maintained at values higher than 4.5, while the catalytic activity was only slightly reduced. Upon four successive batch CWAO experiments, using the same FeSC catalyst recovered by filtration after pH adjustment, only a very minor catalyst deactivation was observed. Finally, based on all the identified intermediates, a simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst.

  4. Reductive dehalogenation of chlorophenols by Desulfomonile tiedjei DCB-1.

    Science.gov (United States)

    Mohn, W W; Kennedy, K J

    1992-01-01

    Reductive dehalogenation of chlorophenols has been reported in undefined anaerobic cultures but never before in an anaerobic pure culture. We found that the sulfate-reducing bacterium Desulfomonile tiedjei DCB-1 reductively dehalogenates pentachlorophenol (PCP) and other chlorophenols. The maximum rate of PCP dechlorination observed was 54 mu mol of Cl- h-1 g of protein-1. 3-Chlorobenzoate appeared to serve as a required inducer for PCP dehalogenation; however, neither PCP nor 3-chlorophenol induced dehalogenation. Dehalogenation was catalyzed by living cells, and formate served as a required electron donor. D. tiedjei dehalogenated meta-chlorine substituents of chlorophenols (i.e., PCP was degraded to 2,4,6-trichlorophenol). Generally, more highly chlorinated phenol congeners were more readily dechlorinated, and 3-chlorophenol was not dehalogenated. Growing cultures dehalogenated PCP, but greater than 10 microM PCP (approximately 1.7 mmol g of protein-1) reversibly inhibited growth. PMID:1599254

  5. [Biodegradation characteristics of o-chlorophenol with photosynthetic bacteria PSB-1D].

    Science.gov (United States)

    Hu, Xiao-min; Dong, Yi-hu; Li, Liang; Lu, Juan; He, Ying-dian; Gao, Yang

    2010-07-01

    A strain of photosynthetic bacteria named PSB-1D with degradation of o-chlorophenol (2-CP) was isolated and screened from the shallow substrate sludge in downstream side of the sewage outfall of an insecticide factory. The PSB-1D is identified preliminarily as Rhodopseudomonas sp. according to its colony and cell morphological properties, physiological biochemical characteristics and absorption spectrum analysis of living cells. The experiments results of relationship between PSB-1D growth and o-chlorophenol degradation showed that the degradation rate of o-chlorophenol was up to 57.26% after 7 days cultural time. The main environmental factors including way of illumination and oxygen, initial pH, cultural temperature, illumination intensity had distinctly influenced on the o-chlorophenol degradation with PSB-1D. The results showed that the optimum conditions were as following: an anaerobic light, pH 7.0, temperature 30 degrees C, illumination intensity 4000 lx,initial o-chlorophenol concentration 50 mg/L. Under that cultural condition, the degradation rate of o-chlorophenol could reach to 62.08%. The degradation kinetic data fitted the Andrews model well. In addition, the biodegradation process of o-chlorophenol can be well described by enzymatic reaction of high concentration inhibition, with the maximum substrate utilization rate 0.309 d(-1), Michaelis-Menten constant 2.733 mg/L, inhibitory constant 230.15 mg/L respectively.

  6. In vitro and in silico investigations of the binding interactions between chlorophenols and trypsin

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yan-Qing, E-mail: wyqing76@126.com [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Tan, Chun-Yun [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Zhuang, Shu-Lin [Institute of Environmental Science, College of Environmental and Resource Science, Zhejiang University, Hangzhou 310058 (China); Zhai, Peng-Zhan; Cui, Yun; Zhou, Qiu-Hua; Zhang, Hong-Mei [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Fei, Zhenghao [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China)

    2014-08-15

    Graphical abstract: - Highlights: • Binding interactions of five chlorophenols with trypsin were investigated. • The number of chlorine atoms of chlorophenols partly affected the binding ability of them to trypsin. • Noncovalent interactions stabilized the trypsin–chlorophenols complexes. • There was the one main binding site of trypsin for chlorophenols. - Abstract: Being the first-degree toxic pollutants, chlorophenols (CP) have potential carcinogenic and mutagenic activity and toxicity. Since there still lacks studies on molecular interactions of chlorophenols with trypsin, one major binding target of many exogenous environmental pollutants, the binding interactions between five chlorophenols, 2-CP, 2,6-DCP, 2,4,6-TCP, 2,4,6-TCP, 2,3,4,6-TCP and PCP and trypsin were characterized by the combination of multispectroscopic techniques and molecular modeling. The chlorophenols bind at the one main site of trypsin and the binding induces the changes of microenvironment and global conformations of trypsin. Different number of chloride atoms significantly affects the binding and the binding constants K{sub A} ranks as K{sub A} (2-CP) < K{sub A} (2,6-DCP) ≈ K{sub A} (2,4,6-TCP) < K{sub A} (2,3,4,6-TCP) < K{sub A} (PCP). These chlorophenols interacts with trypsin mainly through hydrophobic interactions and via hydrogen bonding interactions and aromatic–aromatic π–π stacking interaction. Our results offer insights into the binding mechanism of chlorophenols with trypsin and provide important information for possible toxicity risk of chlorophenols to human health.

  7. p-Chlorophenol Oxidation in Industrial Effluent by Ultrasonic/Fenton Technology

    Directory of Open Access Journals (Sweden)

    Abdolmotaleb Seid Mohammadi

    2012-01-01

    Full Text Available Phenolic compounds have become a cause for of worldwide concern due to their persistence, toxicity and health risks. Hence, removal of these pollutants from aqueous effluents is an important practical problem. Ultrasonic technology may be used for water and wastewater treatment as an advanced oxidation process. Application of this technology, leads to the decomposition of many organic compounds during cavitation process. The degradation of 4-chlorophenol in aqueous solution under sonolysis at 45 kHz coupled with fFenton process was is investigated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, catalyst (FeSO4 and initial p-chlorophenol concentration. The experimental results showed that the decomposition of p-chlorophenol was affected by the various reaction conditions. The optimum conditions obtained for the best degradation rate were pH=3, H2O2 concentration of 0.05 mol/L and 0.025 mmol/L for catalyst, respectively. Also it was observed that the degradation of p-chlorophenol depended on its initial concentration

  8. Toxicity and bioaccumulation of chlorophenols in earthworms, in relation to bioavailability in soil

    Energy Technology Data Exchange (ETDEWEB)

    van Gestel, C.A.; Ma, W.C.

    1988-06-01

    The acute toxicity of five chlorophenols for two earthworm species was determined in two sandy soils differing in organic matter content and the results were compared with adsorption data. Adsorption increased with increasing organic matter content of the soils, but for tetra- and pentachlorophenol was also influenced by soil pH. Earthworm toxicity was significantly higher in the soil with a low level of organic matter. This difference disappeared when LC50 values were recalculated to concentrations in soil solution using adsorption data. Eisenia fetida andrei showed LC50 values lower than those of Lumbricus rubellus although bioaccumulation was generally higher in the latter species. Toxicity and bioaccumulation based on soil solution concentrations increased with increasing lipophilicity of the chlorophenols. The present results indicate that the toxicity and bioaccumulation and therefore the bioavailability of chlorophenols in soil to earthworms are dependent on the concentration in soil solution and can be predicted on the basis of adsorption data. Both the toxicity of and bioaccumulation data on chlorophenols in earthworms demonstrated surprisingly good agreement with those on chlorophenols in fish.

  9. Efficient photocatalytic reductive dechlorination of 4-chlorophenol to phenol on {0 0 1}/{1 0 1} facets co-exposed TiO_2 nanocrystals

    International Nuclear Information System (INIS)

    Jiang, Guodong; Wei, Meng; Yuan, Songdong; Chang, Qing

    2016-01-01

    Graphical abstract: - Highlights: • 4-Chlorophenol is dechlorinated over {0 0 1}/{1 0 1} co-exposed TiO_2 nanocrystals. • Photo-electrons are accumulated on {1 0 1} facets due to surface heterojunction. • Fluorine will trap photoelectrons to depress the dechlorination performance. • Sufficient isopropanol promotes the dechlorination activity and selectivity. - Abstract: 4-chlorophenol could be efficiently photoreductively dechlorinated over anatase TiO_2 nanocrystals with co-exposed {0 0 1} and {1 0 1} facets, which were synthesized and further characterized by scanning electron microscope (SEM), transmission electron microscope (TEM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Although fluorine could adsorb on {0 0 1} facets to decrease their surface energy, enabling TiO_2 to expose high energy {0 0 1} facets, the surface bonded fluorine might depress the photoreductive dechlorination efficiency of 4-chlorophenol, attributed to the electron trapping role of surface ≡Ti−F groups. Due to the formation of a surface heterojunction between {1 0 1} and {0 0 1} facets in a single TiO_2 nanocrystal, electrons and holes were spontaneously self-separated and selectively migrate to {1 0 1} and {0 0 1} facets, respectively. Electron trapping experiments demonstrated that photogenerated electrons are the responsible for the reductive dechlorinaton of 4-chlorophenol to phenol. To avoid the oxidative degradation of 4-chlorophenol by holes and ensure sufficient electrons to reductively dechlorinate the substrate, moderate scavengers were required in the reaction system and dissolved oxygen, which might deplete electron on TiO_2, also should be removed. With the optimal scavengers, the conversion efficiency of 4-chlorophenol (4-CP) achieved 97.5% and the selectivity for phenol was 92.5%, which were much higher than that of commercial TiO_2 P25.

  10. Biodegradation of 4-chlorophenol by adsorptive immobilized Alcaligenes sp. A 7-2 in soil.

    Science.gov (United States)

    Balfanz, J; Rehm, H J

    1991-08-01

    Alcaligenes sp. A 7-2 immobilized on granular clay has been applied in a percolator to degrade 4-chlorophenol in sandy soil. Good adsorption rates on granular clay were achieved using cell suspensions with high titres and media at pH 8.0. The influence of various parameters such as aeration rate, pH, temperature, concentration of 4-chlorophenol and size of inoculum on the degradation rate were investigated. During fed-batch fermentations under optimal culture conditions, concentrations of 4-chlorophenol up to 160 mg.l-1 could be degraded. Semicontinuous culture experiments demonstrated that the degradation potential in soil could be well established and enhanced by the addition of immobilized bacteria. Continuous fermentation was performed with varying 4-chlorophenol concentrations in the feed and different input levels. The maximum degradation rate was 1.64 g.l-1.day-1.

  11. Efficient photocatalytic reductive dechlorination of 4-chlorophenol to phenol on {0 0 1}/{1 0 1} facets co-exposed TiO{sub 2} nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Guodong; Wei, Meng; Yuan, Songdong [College of Chemistry and chemical engineering, Hubei Collaborative Innovation Center for High Efficient Utilization of Solar Energy, Hubei University of Technology, Wuhan 430068 (China); Chang, Qing, E-mail: changqinghust@163.com [Key Laboratory of Catalysis and Materials Science of the State Ethnic Affairs Commission and Ministry of Education, College of Resources and Environmental Science, South-Central University for Nationalities, Wuhan 430074 (China)

    2016-01-30

    Graphical abstract: - Highlights: • 4-Chlorophenol is dechlorinated over {0 0 1}/{1 0 1} co-exposed TiO{sub 2} nanocrystals. • Photo-electrons are accumulated on {1 0 1} facets due to surface heterojunction. • Fluorine will trap photoelectrons to depress the dechlorination performance. • Sufficient isopropanol promotes the dechlorination activity and selectivity. - Abstract: 4-chlorophenol could be efficiently photoreductively dechlorinated over anatase TiO{sub 2} nanocrystals with co-exposed {0 0 1} and {1 0 1} facets, which were synthesized and further characterized by scanning electron microscope (SEM), transmission electron microscope (TEM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Although fluorine could adsorb on {0 0 1} facets to decrease their surface energy, enabling TiO{sub 2} to expose high energy {0 0 1} facets, the surface bonded fluorine might depress the photoreductive dechlorination efficiency of 4-chlorophenol, attributed to the electron trapping role of surface ≡Ti−F groups. Due to the formation of a surface heterojunction between {1 0 1} and {0 0 1} facets in a single TiO{sub 2} nanocrystal, electrons and holes were spontaneously self-separated and selectively migrate to {1 0 1} and {0 0 1} facets, respectively. Electron trapping experiments demonstrated that photogenerated electrons are the responsible for the reductive dechlorinaton of 4-chlorophenol to phenol. To avoid the oxidative degradation of 4-chlorophenol by holes and ensure sufficient electrons to reductively dechlorinate the substrate, moderate scavengers were required in the reaction system and dissolved oxygen, which might deplete electron on TiO{sub 2}, also should be removed. With the optimal scavengers, the conversion efficiency of 4-chlorophenol (4-CP) achieved 97.5% and the selectivity for phenol was 92.5%, which were much higher than that of commercial TiO{sub 2} P25.

  12. The cooperative electrochemical oxidation of chlorophenols in anode-cathode compartments

    International Nuclear Information System (INIS)

    Wang Hui; Wang Jianlong

    2008-01-01

    By using a self-made carbon/polytetrafluoroethylene (C/PTFE) O 2 -fed as the cathode and Ti/IrO 2 /RuO 2 as the anode, the degradation of three organic compounds (phenol, 4-chlorophenol, and 2,4-dichlorophenol) was investigated in the diaphragm (with terylene as diaphragm material) electrolysis device by electrochemical oxidation process. The result indicated that the concentration of hydrogen peroxide (H 2 O 2 ) was 8.3 mg/L, and hydroxyl radical (HO·) was determined in the cathodic compartment by electron spin resonance spectrum (ESR). The removal efficiency for organic compounds reached about 90% after 120 min, conforming to the sequence of phenol, 4-chlorophenol, and 2,4-dichlorophenol. And the dechlorination degree of 4-chlorophenol exceeded 90% after 80 min. For H 2 O 2 , HO· existed in the catholyte and reduction dechlorination at the cathode, the mineralization of organics in the cathodic compartment was better than that in the anodic compartment. The degradation of organics was supposed to be cooperative oxidation by direct or indirect electrochemical oxidation at the anode and H 2 O 2 , HO· produced by oxygen reduction at the cathode. High-performance liquid chromatography (HPLC) allowed identifying phenol as the dechlorination product of 4-chlorophenol in the cathodic compartment, and hydroquinone, 4-chlorocatechol, benzoquinone, maleic, fumaric, oxalic, and formic acids as the main oxidation intermediates in the cathodic and anodic compartments. A reaction scheme involving all these intermediates was proposed

  13. Mineralization of 2-chlorophenol by sequential electrochemical reductive dechlorination and biological processes

    Energy Technology Data Exchange (ETDEWEB)

    Arellano-González, Miguel Ángel; González, Ignacio [Universidad Autónoma Metropolitana-Iztapalapa, Departamento de Química, Av. San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D.F. (Mexico); Texier, Anne-Claire, E-mail: actx@xanum.uam.mx [Universidad Autónoma Metropolitana-Iztapalapa, Departamento de Biotecnología, Av. San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico, D.F. (Mexico)

    2016-08-15

    Highlights: • Dechlorination of 2-chlorophenol to phenol was 100% efficient on Pd-Ni/Ti electrode. • An ECCOCEL reactor was efficient and selective to obtain phenol from 2-chlorophenol. • Phenol was totally mineralized in a coupled denitrifying biorreactor. • Global time of 2-chlorophenol mineralization in the combined system was 7.5 h. - Abstract: In this work, a novel approach was applied to obtain the mineralization of 2-chlorophenol (2-CP) in an electrochemical-biological combined system where an electrocatalytic dehydrogenation process (reductive dechlorination) was coupled to a biological denitrification process. Reductive dechlorination of 2-CP was conducted in an ECCOCEL-type reactor on a Pd-Ni/Ti electrode at a potential of −0.40 V vs Ag/AgCl{sub (s)}/KCl{sub (sat)}, achieving 100 percent transformation of 2-CP into phenol. The electrochemically pretreated effluent was fed to a rotating cylinder denitrifying bioreactor where the totality of phenol was mineralized by denitrification, obtaining CO{sub 2} and N{sub 2} as the end products. The total time required for 2-CP mineralization in the combined electrochemical-biological process was 7.5 h. This value is close to those previously reported for electrochemical and advanced oxidation processes but in this case, an efficient process was obtained without accumulation of by-products or generation of excessive energy costs due to the selective electrochemical pretreatment. This study showed that the use of electrochemical reductive pretreatment combined with biological processes could be a promising technology for the removal of recalcitrant molecules, such as chlorophenols, from wastewaters by more efficient, rapid, and environmentally friendly processes.

  14. THE INFLUENCES OF Fe(III ION and Fe(OH3 COLLOID ON THE PHOTODEGRADATION of p-CHLOROPHENOL CATALYZED BY TiO2

    Directory of Open Access Journals (Sweden)

    Endang Tri Wahyuni

    2010-06-01

    Full Text Available The influences of ionic Fe(III and colloidal Fe(OH3 on the effectiveness of p-chlorophenol photodegradation catalyzed by TiO2 has been studied. Photodegradation was carried out in a batch system by irradiating a suspension of TiO2, p-chlorophenol, and Fe(III as ionic or colloidal forms, using UV lamp for a period of time accompanied by magnetic stirring. Concentration of photodegraded p-chlorophenol was calculated by subtracting the initial concentration with that of undegraded p-chlorophenol. Concentration of undegraded p-chlorophenol was determined by gas chromatography. In this study, TiO2 mass and the photodegradation time were optimized. The influences of concentration of Fe(III solution, mass of Fe(OH3, and pH of the solution have also been systematically studied. The research results showed that the presence of Fe(III ions improved the effectiveness of photocatalytical degradation of p-chlorophenol, which was proportional to the concentrations of Fe(III ion. In contrast, the increasing mass of Fe(OH3 led to a decrease in the degree of p-chlorophenol photodegradation. Furthermore, it was observed that increasing pH of the solution resulted in a decrease in the photodegradation of p-chlorophenol. This phenomena may be due to the different species of TiO2 available at the surface of photocatalyst and of ionic Fe(III and colloidal Fe(OH3 in the solution resulted from the pH alteration. The highest photodegradation degree, ca. 80 % was obtained when 20 mg of TiO2 was applied in the photodegradation of 50 mL of 100 ppm p-chlorophenol solution in the presence of 100 ppm Fe3+ irradiated by UV-light for 25 hours.    Keywords: p-chlorophenol photodegradation, TiO2, Fe(III species

  15. Gamma radiolytic degradation of 4-chlorophenol determination of degraded products with HPLC and GC-MS

    International Nuclear Information System (INIS)

    Butt, S.B.; Masood, M.N.

    2007-01-01

    Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process that has been thought to be one of the promising treatments to deal with this problem. This radiolytic study was carried out in methanolic 4-CP (4-chlorophenol) samples. Among several factors effecting radiolytic degradation of 4-CP, dose and concentration are important that were evaluated under atmospheric conditions. A degradation yield (G -value) for 4- CP of 0.38 and 1.35 was achieved in 20 and 100 mg/dm/sup 3/ solution. It was observed that degradation yield decreases with increasing 4-CP concentration. Gamma radiolysis produce free radicals in solvent which further react with 4-CP molecules to generate different products. The identification of degradation products was proposed using HPLC and GC-MS. (author)

  16. 2-Chlorophenol Removal of Aqueous Solution Using Advanced Oxidation Processes Resulting from Iron/ Persulfate and Ultra Violet/ Persulfate

    Directory of Open Access Journals (Sweden)

    Shokufeh Astereki

    2016-06-01

    Full Text Available Background: Advanced oxidation processes are used to remove toxic aromatic compounds with low biodegradability, such as 2-chlorophenol. This study investigated the use of sulfate (SO4- and persulfate (S2O82- radicals, as one of the advanced oxidation methods, to remove 2- chlorophenol from aquatic solutions. Methods: This experimental and pilot-scale study was carried out using two chemical batch reactors; one of the reactors equipped with UV lamps and the other was on the hot plate. In iron/ persulfate (Fe/S2O82- and ultra violet/ persulfate (UV/S2O82- processes different parameters were investigated. Results: Iron, UV, the initial pH of the solution, persulfate concentration have considerable effects on the elimination of 2-chlorophenol in both processes. In both processes, the maximum elimination occurred in acidic conditions. The elimination efficiency was increased by increasing the concentration of 2-chlorophenol and UV intensity, and also by decreasing the concentration of persulfate and iron. Accordingly, in iron/ persulfate and ultra violet/ persulfate processes 2-chlorophenol was eliminated with 99.96% and 99.58% efficiencies, respectively. Conclusion: Sulfate radicals produced from activated persulfate ions with hot-Fe ion and UV radiation have significant impact on the removal of 2-chlorophenol. Therefore, the processes of Fe/S2O82- and UV/S2O82- can be regarded as good choices for industrial wastewater treatment plants operators in the future.

  17. Preparation of three-dimensionally ordered macroporous polycysteine film and application in sensitive detection of 4-chlorophenol

    International Nuclear Information System (INIS)

    Zhang, Shenghui; Shi, Zhen; Wang, Jinshou; Cheng, Qin; Wu, Kangbing

    2014-01-01

    Highlights: • Polycysteine film with three-dimensionally ordered porous structures was prepared. • 3-DOM polycysteine film exhibited large active area and signal enhancement effects. • 3-DOM polycysteine film increased oxidation signal of 4-chlorophenol by 5-fold. - Abstract: Polystyrene microspheres with diameter of 350 nm were prepared, and then used to arrange on the surface of glassy carbon electrode (GCE) as structure-directing template. By successive cyclic sweeps between −1.0 V and 2.0 V in pH 7 phosphate buffer containing 10 mM cysteine, polycysteine film was electrodeposited on polystyrene microspheres-arranged GCE. After removing polystyrene template, a three-dimensionally ordered macroporous (3-DOM) polycysteine film was achieved, as confirmed by scanning electron microscopy measurements. Electrochemical responses of K 3 [Fe(CN) 6 ] probe indicated that 3-DOM polycysteine film-modified GCE exhibited larger active area, compared with GCE, polycysteine film-modified GCE and electrochemically oxidized GCE. The application of 3-DOM polycysteine film in electrochemical detection of 4-chlorophenol was studied. Due to ordered porous structures, the 3-DOM polycysteine film-modified GCE displayed signal enhancement effects, and enhanced the oxidation peak currents of 4-chlorophenol. As a result, a sensitive electrochemical method was developed for the detection of 4-chlorophenol, and the detection limit was 1.67 × 10 −8 M. This new method was used to detect 4-chlorophenol in water samples, and the value of recovery was over the range from 99.6% to 107%

  18. Removal of 4-Chlorophenol from Aqueous Solutions Using Graphene Oxide Nanoporous Adsorbent

    Directory of Open Access Journals (Sweden)

    akbar eslami

    2015-03-01

    Full Text Available In this study, graphene oxide was used as a nanostructured adsorbent with properties supposedly better than other common adsorbents to remove 4-chlorophenol from aqueous solutions. For this purpose, graphene oxide was initially synthesized using the Hummer's method and x-ray diffraction and scanning electron microscopy were employed to identify its morphology and structure. The variables involved in the absorption process (including 4-chlorophenol initial concentration, adsorbent dosage, and pH were investigated based on the one-factor-at-a-time method. Eventually, the data were confirmed against the Langmuir and Freundlich isotherms. It was found that the adsorption process reached equilibrium in 20 minutes. A dosage of 0.4 g/L graphene oxide at pH=8 brought about 90% removal of 10 mg/L 4-chlorophenol within 5 minutes. The adsorption isotherm was described well by the Langmuir isotherm model and the values for R2 and RL were recorded as 0.99 for and 0.34, respectively. Being a low cost and highly efficient process, the adsorption process using graphene oxide adsorbent may be recommended for the reduction and elimination of pollutants in the environment, especially those in aqueous solutions.

  19. The toxic effects of chlorophenols and associated mechanisms in fish

    International Nuclear Information System (INIS)

    Ge, Tingting; Han, Jiangyuan; Qi, Yongmei; Gu, Xueyan; Ma, Lin; Zhang, Chen; Naeem, Sajid; Huang, Dejun

    2017-01-01

    Highlights: • We review the toxic effects of chlorophenols (CPs) and underlying mechanisms in fish. • CPs induce lethal effects, oxidative stress, endocrine disruption, reproductive toxicity and apoptosis in fish. • CPs exhibit toxicity through multiple signaling pathways in fish and different pathways co-exist under the same conditions. • Studies on DNA methylation provide new insights into our understanding of epigenetic mechanisms of CPs-induced toxicity. • Mechanisms studies on CPs toxicity performed under environmental concentrations need more attentions. - Abstract: Chlorophenols (CPs) are ubiquitous contaminants in the environment primarily released from agricultural and industrial wastewater. These compounds are not readily degraded naturally, and easily accumulate in organs, tissues and cells via food chains, further leading to acute and chronic toxic effects on aquatic organisms. Herein, we review the available literature regarding CP toxicity in fish, with special emphasis on the potential toxic mechanisms. CPs cause oxidative stress via generation of reactive oxygen species, induction of lipid peroxidation and/or oxidative DNA damage along with inhibition of antioxidant systems. CPs affect immune system by altering the number of mature B cells and macrophages, while suppressing phagocytosis and down-regulating the expression of immune factors. CPs also disrupt endocrine function by affecting hormone levels, or inducing abnormal gene expression and interference with hormone receptors. CPs at relatively higher concentrations induce apoptosis via mitochondria-mediated pathway, cell death receptor-mediated pathway, and/or DNA damage-mediated pathway. CPs at relatively lower concentrations promote cell proliferation, and foster cancers-prone environment by increasing the rate of point mutations and oxidative DNA lesions. These toxic effects in fish are induced directly by CPs per se or indirectly by their metabolic products. In addition, recent

  20. The toxic effects of chlorophenols and associated mechanisms in fish

    Energy Technology Data Exchange (ETDEWEB)

    Ge, Tingting; Han, Jiangyuan; Qi, Yongmei; Gu, Xueyan; Ma, Lin; Zhang, Chen; Naeem, Sajid; Huang, Dejun, E-mail: huangdj@lzu.edu.cn

    2017-03-15

    Highlights: • We review the toxic effects of chlorophenols (CPs) and underlying mechanisms in fish. • CPs induce lethal effects, oxidative stress, endocrine disruption, reproductive toxicity and apoptosis in fish. • CPs exhibit toxicity through multiple signaling pathways in fish and different pathways co-exist under the same conditions. • Studies on DNA methylation provide new insights into our understanding of epigenetic mechanisms of CPs-induced toxicity. • Mechanisms studies on CPs toxicity performed under environmental concentrations need more attentions. - Abstract: Chlorophenols (CPs) are ubiquitous contaminants in the environment primarily released from agricultural and industrial wastewater. These compounds are not readily degraded naturally, and easily accumulate in organs, tissues and cells via food chains, further leading to acute and chronic toxic effects on aquatic organisms. Herein, we review the available literature regarding CP toxicity in fish, with special emphasis on the potential toxic mechanisms. CPs cause oxidative stress via generation of reactive oxygen species, induction of lipid peroxidation and/or oxidative DNA damage along with inhibition of antioxidant systems. CPs affect immune system by altering the number of mature B cells and macrophages, while suppressing phagocytosis and down-regulating the expression of immune factors. CPs also disrupt endocrine function by affecting hormone levels, or inducing abnormal gene expression and interference with hormone receptors. CPs at relatively higher concentrations induce apoptosis via mitochondria-mediated pathway, cell death receptor-mediated pathway, and/or DNA damage-mediated pathway. CPs at relatively lower concentrations promote cell proliferation, and foster cancers-prone environment by increasing the rate of point mutations and oxidative DNA lesions. These toxic effects in fish are induced directly by CPs per se or indirectly by their metabolic products. In addition, recent

  1. Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

    Science.gov (United States)

    McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

    2014-02-01

    A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia.

  2. Removal of 4-chlorophenol from aqueous solution by granular activated carbon/nanoscale zero valent iron based on Response Surface Modeling

    Directory of Open Access Journals (Sweden)

    Majlesi Monireh

    2017-12-01

    Full Text Available The phenolic compounds are known as priority pollutants, even in low concentrations, as a result of their toxicity and non-biodegradability. For this reason, strict standards have been established for them. In addition, chlorophenols are placed in the 38th to 43th in highest priority order of toxic pollutants. As a consequence, contaminated water or wastewaters with phenolic compounds have to be treated before discharging into the receiving water. In this study, Response Surface Methodology (RSM has been used in order to optimize the effect of main operational variables responsible for the higher 4-chlorophenol removal by Activated Carbon-Supported Nanoscale Zero Valent Iron (AC/NZVI. A Box-Behnken factorial Design (BBD with three levels was applied to optimize the initial concentration, time, pH, and adsorbent dose. The characterization of adsorbents was conducted by using SEM-EDS and XRD analyses. Furthermore, the adsorption isotherm and kinetics of 4-chlorophenol on AC and AC/NZVI under various conditions were studied. The model anticipated 100% removal efficiency for AC/NZVI at the optimum concentration (5.48 mg 4-chlorophenol/L, pH (5.44, contact time (44.7 min and dose (0.65g/L. Analysis of the response surface quadratic model signified that the experiments are accurate and the model is highly significant. Moreover, the synthetic adsorbent is highly efficient in removing of 4-chlorophenol.

  3. Performance and Mechanism of Piezo-Catalytic Degradation of 4-Chlorophenol: Finding of Effective Piezo-Dechlorination.

    Science.gov (United States)

    Lan, Shenyu; Feng, Jinxi; Xiong, Ya; Tian, Shuanghong; Liu, Shengwei; Kong, Lingjun

    2017-06-06

    Piezo-catalysis was first used to degrade a nondye pollutant, 4-chlorophenol (4-CP). In this process, hydrothermally synthesized tetragonal BaTiO 3 nano/micrometer-sized particles were used as the piezo-catalyst, and the ultrasonic irradiation with low frequency was selected as the vibration energy to cause the deformation of tetragonal BaTiO 3 . It was found that the piezoelectric potential from the deformation could not only successfully degrade 4-chlorophenol but also effectively dechlorinate it at the same time, and five kinds of dechlorinated intermediates, hydroquinone, benzoquinone, phenol, cyclohexanone, and cyclohexanol, were determined. This is the first sample of piezo-dechlorination. Although various active species, including h + , e - , •H, •OH, •O 2 - , 1 O 2 , and H 2 O 2 , were generated in the piezoelectric process, it was confirmed by ESR, scavenger studies, and LC-MS that the degradation and dechlorination were mainly attributed to •OH radicals. These •OH radicals were chiefly derived from the electron reduction of O 2 , partly from the hole oxidation of H 2 O. These results indicated that the piezo-catalysis was an emerging and effective advanced oxidation technology for degradation and dechlorination of organic pollutants.

  4. PENJERAPAN P-KHLOROFENOL DALAM AIR LIMBAH DENGAN ZEOLIT (Adsorption of p-Chlorophenol from Wastewater using Zeolite

    Directory of Open Access Journals (Sweden)

    Sarto Sarto

    2007-07-01

    Full Text Available ABSTRAK Penelitian ini bertujuan untuk mempelajari kemampuan zeolit untuk menjerap p-khlorofenol dari limbah cair secara batch, pada suhu 30 °C dan tekanan 1 atmosfer. Hasil penelitian menunjukkan bahwa proses penjerapan mengikuti persamaan Freundlich dan bersifat reversibel sebagian. Nisbah kinerja desorbsi dan penjerapan adalah antara 31,85 % dan 49,36 %. Kemampuan zeolit untuk menjerap p-khlorofenol meningkat dengan semakin rendahnya pH. pada nilai pH 3,92, berat zeolit 30 g, dan konsentrasi awal p-khlorofenol 97,302 mg/L. Adapun jumlah p-khlorofenol yang terjerap adalah sebesar 8,319 mg/L.   ABSTRACT The aim of this research is to study the characteristics of zeolit to adsorb p-chlorophenol from wastewater in a batch reactor at 30 oC and atmospheric conditions. The experimental results show that the adsorbtion process is partially reversible and fits with Freundlich Equation. The ratio of  desorption and adsortion performance is between 31.85 % and 49.36 %.  The performance of zeolit to adsorb p-chlorophenol increases with decreasing pH. At  pH about 3.92, using 30 g zeolit and 97.302 mg  p-chlorophenol/L. The concentration of adsorbed p-chlorophenol is about 8.319 mg/L.

  5. Sorption of chlorophenols from aqueous solution by granular activated carbon, filter coal, pine and hardwood.

    Science.gov (United States)

    Hossain, G S M; McLaughlan, R G

    2012-09-01

    Wood and coal, as low-cost sorbents, have been evaluated as an alternative to commercial granular activated carbon (GAC) for chlorophenol removal. Kinetic experiments indicated that filter coal had a significantly lower rate of uptake (approximately 10% of final uptake was achieved after three hours) than the other sorbents, owing to intra-particle diffusion limitations. The data fitted a pseudo-second-order model. Sorption capacity data showed that GAC had a high sorption capacity (294-467 mg g(-1)) compared with other sorbents (3.2-7.5 mg(g-1)). However, wood and coal had a greater sorption capacity per unit surface area than GAC. Sorption equilibrium data was best predicted using a Freundlich adsorption model. The sorption capacity for all sorbents was 2-chlorophenol coal than the other sorbents. The results showed that pine, hardwood and filter coal can be used as sorbent materials for the removal of chlorophenol from water; however, kinetic considerations may limit the application of filter coal.

  6. Removal of 4-chlorophenol from synthetic wastewater by the granulated graphene oxide nano particles

    Directory of Open Access Journals (Sweden)

    A Eslami

    2016-09-01

    Full Text Available Abstract Introduction: 4-chlorophenols one of the most common pollutants in wastewater is generated from the chemical and petrochemical industries. It is due to the presence of chloride and benzene ring is resistant to biodegradation. In this study, the use of granulated graphene oxide nano particles as an adsorbent nanostructure with better properties than other adsorbents for Removal of 4- chlorophenol from aqueous solution were investigated Methods: This research was implemented during the year 2013-2014 where the Granules of Graphene oxide nanoparticles were prepared using sodium silicate and X-ray diffraction techniques and electron microscope were used to identify the morphology and structure of the adsorbent of.  Parameters  affecting the adsorption process such as initial concentration of  4-chlorophenol(5,10,15,20,25,30mg/L, amount of adsorbent(20,40,60,80% by weight, contact time (3,5,10,20,30 min and pH(4,6,7,8,9 were investigated by changing one factor at a time. Finally, the data fitness with Langmuir and Freundlich isotherms were showed. Results: Adsorption process reached to equilibrium after 20 minutes. 2 g/L of graphene oxide granules at 3 minutes and 7 = pH could remove 5 mg/L 4-chlorophenol up to 58%. Freundlich isotherm have describing adsorption process and R2 =0.92. Conclusion: Absorbed process by the granules of Graphene oxide nanoparticles is low-cost high-efficiency and it could used to reduce and eliminate environmental pollutants particularly aqueous solutions.  

  7. COMPARISON OF DIFFERENT ADVANCED OXIDATION PROCESSES DEGRADING P-CHLOROPHENOL IN AQUEOUS SOLUTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، A. M. Seid Mohammadi ، A. Assadi

    2009-07-01

    Full Text Available In present study, degradation of p-chlorophenol using several oxidation systems involving advanced oxidation processes such as ultraviolet/H2O2, microwave/H2O2 and both in the absence of hydrogen peroxide in batch mode by photolytic pilot plant and modified domestic microwave oven was evaluated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, irradiation time and microwave power. The optimum conditions obtained for the best degradation rate were pH=7 and H2O2 concentration of 0.05 mol/L for ultraviolet/H2O2 system and pH=10.5, H2O2 concentration of about 0.1 mol/L and microwave irradiation power of about 600W for microwave/H2O2 system at constant p-chlorophenol concentration. The degradation of p-chlorophenol by different types of oxidation processes followed first order rate decay kinetics. The rate constants were 0.137, 0.012, 0.02 and 0.004/min1 for ultraviolet/H2O2, microwave/H2O2, ultraviolet and microwave irradiation alone. Finally a comparison of the specific energy consumption showed that ultraviolet/H2O2 process reduced the energy consumption by at least 67% compared with the microwave/H2O2 process.

  8. The Photocatalytic Removal of Ortho Chlorophenol from Aqueous Solution Using Modified Fly Ash - Titanium Dioxide

    Directory of Open Access Journals (Sweden)

    Mohamad Malakootian

    2016-05-01

    Full Text Available The photocatalytic process is a useful method for the effective removal of phenolic compounds. Conducted in the spring‒summer 2013 at the Engineering Research Center for Environmental Health, Kerman University of Medical Sciences, this experimental study used a modified fly ash‒TiO2 mixture to enhance the photocatalytic removal efficiency of ortho-chlorophenol. Fly ash obatined from the Thermal Power Plant in Zarand, Kerman, was initially washed with sulfuric acid before being oxidized with potassium permanganate. The mixture of modified fly ash and TiO2 was then used for the removal of ortho-chlorophenol in the presence of UV light and the factors involved in the removal process were optimized. It was found that the ortho-chlorophenol removal efficiency recorded by the mixture of modified fly ash and TiO2 was higher than that by each of the modified fly ash or TiO2/UV alone. It was, further, observed that removal efficiency with a modified fly ash to TiO2 ratio of 3:1 rose to 98.8% under optimum conditions (i.e., pH: 2; contact time: 2 h; room temperature (29±2˚C, and a catalyst dose of 0.6 g. The ortho-chlorophenol removal efficiency in real wastewater from the Coal Wash Plant in Zarand was recorded at 88.4%. Based on the results obtained from simultaneous use of modified fly ash and TiO2, the proposed method may be recommended for industrial applications.

  9. Usefulness of a PARAFAC decomposition in the fiber selection procedure to determine chlorophenols by means SPME-GC-MS.

    Science.gov (United States)

    Morales, Rocío; Cruz Ortiz, M; Sarabia, Luis A

    2012-05-01

    In this work, a procedure based on solid-phase microextraction and gas chromatography coupled with mass spectrometry is proposed to determine chlorophenols in water without derivatization. The following chlorophenols are studied: 2,4-dichlorophenol; 2,4,6-trichlorophenol; 2,3,4,6-tetrachlorophenol and pentachlorophenol. Three kinds of SPME fibers, polyacrylate, polydimethylsiloxane, and polydimethylsiloxane/divinylbenzene are compared to identify the most suitable one for the extraction process on the basis of two criteria: (a) to select the equilibrium time studying the kinetics of the extraction, and (b) to obtain the best values of the figures of merit. In both cases, a three-way PARAllel FACtor analysis decomposition is used. For the first step, the three-way experimental data are arranged as follows: if I extraction times are considered, the tensor of data, X, of dimensions I × J × K is generated by concatenating the I matrices formed by the abundances of the J m/z ions recorded in K elution times around the retention time for each chlorophenol. The second-order property of PARAFAC (or PARAFAC2) assesses the unequivocal identification of each chlorophenol, as consequence, the loadings in the first mode estimated by the PARAFAC decomposition are the kinetic profile. For the second step, a calibration based on a PARAFAC decomposition is used for each fiber. The best figures of merit were obtained with PDMS/DVB fiber. The values of decision limit, CCα, achieved are between 0.29 and 0.67 μg L(-1) for the four chlorophenols. The accuracy (trueness and precision) of the procedure was assessed. This procedure has been applied to river water samples.

  10. An adsorption diffusion model for removal of para-chlorophenol by activated carbon derived from bituminous coal.

    Science.gov (United States)

    Sze, M F F; McKay, G

    2010-05-01

    Batch adsorption experiments were carried out to study the adsorptive removal and diffusion mechanism of para-chlorophenol (p-CP) onto Calgon Filtrasorb 400 (F400) activated carbon. The external mass transfer resistance is negligible in the adsorption process carried out under different conditions in batch operation. Intraparticle diffusion model plots were used to correlate the batch p-CP adsorption data; three distinct linear sections were obtained for every batch operation. The textural properties of F400 activated carbon showed that it has a large portion of supermicropores, which is comparable to the size of the p-CP molecules. Due to the stronger interactions between p-CP molecules and F400 micropores, p-CP molecules predominantly diffused and occupied active sites in micropore region by hopping mechanism, and eventually followed by a slow filling of mesopores and micropores. This hypothesis is proven by the excellent agreement of the intraparticle diffusion model plots and the textural properties of F400 activated carbon. Copyright 2009 Elsevier Ltd. All rights reserved.

  11. Structural and antimicrobial studies of coordination compounds of VO(II, Co(II, Ni(II and Cu(II with some Schiff bases involving 2-amino-4-chlorophenol

    Directory of Open Access Journals (Sweden)

    A. P. MISHRA

    2009-05-01

    Full Text Available Complexes of tailor-made ligands with life essential metal ions may be an emerging area to answer the problem of multi-drug resistance (MDR. The coordination complexes of VO(II, Co(II, Ni(II and Cu(II with the Schiff bases derived from 2-hydroxyacetophenone/2-chlorobenzaldehyde with 2-ami¬no-4-chlorophenol were synthesized and characterized by elemental analysis, molar conductance, electronic spectra, FT-IR, ESR, FAB mass, thermal and magnetic susceptibility measurements. The FAB mass and thermal data show degradation of the complexes. The ligand A (2-hydroxyacetophenone-2amino-4-chlorophenol behaved as tridentate and ligand B (2-chlorobenzylidene-2-amino-4-chlorophenol as bidentate, coordinating through O and N donors. The complexes [VO(A(H2O]×xH2O, [M(A(H2On]×xH2O for Co and Ni, [Cu(A(H2O] and [VO(B2]×xH2O, [M(B2(H2On] for Co and Cu and [Ni(B2] exhibited coordination numbers 4, 5 or 6. X-ray powder diffraction data (a = 11.00417 Å, b = 11.706081 Å and c = 54.46780 Å showed that [Cu(CACP2(H2O2], complex 8, crystallized in the orthorhombic system. The in vitro biological screening effects of the investigated compounds were tested against the bacteria Escherichia coli, Staphylococcus aureus and Streptococcus fecalis and the fungi Aspergillus niger, Trichoderma polysporum and Candida albicans by the serial dilution method. A comparative study of the MIC values of the Schiff base and their [M(B2(H2O2] complexes (Co(II, complex 6 and Cu(II, complex 8, indicated that the metal complexes exhibited a higher or lower antimicrobial activity than 2-chlorobenzylidene-2-amino-4-chlorophenol as the free ligand (B.

  12. Adsorbed states of chlorophenol on Cu(110) and controlled switching of single-molecule junctions

    Energy Technology Data Exchange (ETDEWEB)

    Okuyama, H., E-mail: hokuyama@kuchem.kyoto-u.ac.jp; Kitaguchi, Y.; Hattori, T.; Ueda, Y.; Ferrer, N. G.; Hatta, S.; Aruga, T. [Department of Chemistry, Graduate School of Science, Kyoto University, Kyoto 606-8502 (Japan)

    2016-06-28

    A molecular junction of substituted benzene (chlorophenol) is fabricated and controlled by using a scanning tunneling microscope (STM). Prior to the junction formation, the bonding geometry of the molecule on the surface is characterized by STM and electron energy loss spectroscopy (EELS). EELS shows that the OH group of chlorophenol is dissociated on Cu(110) and that the molecule is bonded nearly flat to the surface via an O atom, with the Cl group intact. We demonstrate controlled contact of an STM tip to the “available” Cl group and lift-up of the molecule while it is anchored to the surface via an O atom. The asymmetric bonding motifs of the molecule to the electrodes allow for reversible control of the junction.

  13. Catalytic wet air oxidation of chlorophenols over supported ruthenium catalysts

    International Nuclear Information System (INIS)

    Li Ning; Descorme, Claude; Besson, Michele

    2007-01-01

    A series of noble metal (Pt, Pd, Ru) loaded zirconia catalysts were evaluated in the catalytic wet air oxidation (CWAO) of mono-chlorophenols (2-CP, 3-CP, 4-CP) under relatively mild reaction conditions. Among the investigated noble metals, Ru appeared to be the best to promote the CWAO of CPs as far as incipient-wetness impregnation was used to prepare all the catalysts. The position of the chlorine substitution on the aromatic ring was also shown to have a significant effect on the CP reactivity in the CWAO over 3 wt.% Ru/ZrO 2 . 2-CP was relatively easier to degradate compared to 3-CP and 4-CP. One reason could be the higher adsorption of 2-CP on the catalyst surface. Further investigations suggested that 3 wt.% Ru/ZrO 2 is a very efficient catalyst in the CWAO of 2-CP as far as high 2-CP conversion and TOC abatement could still be reached at even lower temperature (393 K) and lower total pressure (3 MPa). Additionally, the conversion of 2-CP was demonstrated to increase with the initial pH of the 2-CP solution. The dechlorination reaction is promoted at higher pH. In all cases, the adsorption of the reactants and the reaction intermediates was shown to play a major role. All parameters that would control the molecule speciation in solution or the catalyst surface properties would have a key effect

  14. Degradation of 4-chlorophenol by ozonation, γ radiation as well as ozonation combined with γ radiation

    International Nuclear Information System (INIS)

    Hu, J.; Wang, J.L.

    2005-01-01

    The radiolysis of aqueous 4-chlorophenol (4-CP) by gamma radiation in the presence of air and ozone was investigated. The 4-CP degradation, release of chloride ion, UV absorption spectrum, total organic carbon (TOC) and adsorbable organic halogens (AOX) was measured. Under the conditions of synergistic effect of ozone and radiation a complete degradation of 100 mg/L 4-CP was obtained at a dose of 6 kGy, without ozone the 4-chlorophenol was completely decomposed at 15 kGy. The total organic carbon (TOC) was reduced by 26% when ionizing radiation (at 15 kGy) combined with ozonation, and by 17% without ozone, respectively. Analysis of intermediate products resulting from synergistic effect of ozone and radiation of 4-CP was performed by using the GC/MS method. Some primary influencing factors such as irradiation time and initial 4-CP concentration were also discussed. The results showed that the degradation of 4-chlorophenol could described by first-order reaction kinetic model. There is potential for combination of irradiation with ozonation, which can remarkably reduce the irradiation dose increase the degradation efficiency of 4-CP.

  15. Development and validation of a simple thin-layer chromatographic method for the analysis of p-chlorophenol in treated wastewater

    Directory of Open Access Journals (Sweden)

    Tešić Živoslav

    2012-01-01

    Full Text Available A thin-layer chromatographic method with densitometric detection was established for quantification of p-chlorophenol in waste water. Degradation efficiency of p-chlorophenol was monitored after each treatment of the wastewater samples. Degradation of p-chlorophenol was performed with advanced oxidation processes (AOPs, using UV, H2O2/UV, O3/H2O2/UV, O3 and O3/UV. Developed TLC procedure has been found to be simple, rapid and precise. The method was characterized by high sensitivity (limit of detection was 11 ng per band and limit of quantification 35 ng per band, linear range (from 75 to 500 ng per band, r = 0.9965, and high precision, accuracy (mean percentage recovery 98.6%, and specificity. Additionally, the efficiency of degradation was monitored using HPLC giving comparable results with RP TLC measurements. [Acknowledgement. This work was performed within the framework of the research project No. 172017 supported by the Ministry of Education and Science of Serbia.

  16. Electro-oxidation of chlorophenols on poly(3,4-ethylenedioxythiophene)-poly(styrene sulphonate) composite electrode

    International Nuclear Information System (INIS)

    Pigani, L.; Musiani, M.; Pirvu, C.; Terzi, F.; Zanardi, C.; Seeber, R.

    2007-01-01

    The electrochemical behaviour of chlorinated phenols on Pt/poly(3,4-ethylenedioxy)thiophene,LiClO 4 and on Pt/poly(3,4-ethylenedioxy)thiophene,poly(sodium-4-styrenesulphonate) electrodes has been investigated in phosphate buffer solution. Poly(sodium-4-styrenesulphonate) exerts remarkable effect against the electrode fouling induced by oxidation of chlorophenols, allowing us to record the relevant anodic response even after repeated potential cycles. Hypotheses about the role exerted by poly(sodium 4-styrenesulphonate) are made, on the basis of evidences provided by several techniques, such as cyclic voltammetry, electrochemical impedance spectroscopy, electrochemical microgravimetry and atomic force microscopy. Thanks to the fact that different chlorophenols show differences in the voltammetric responses, depending on number and position of the chloro substituents on the aromatic ring, applications of the modified electrode in the analysis of mixtures of chlorinated phenols are possible

  17. Formation of industrial mixed culture biofilm in chlorophenol cultivated medium of microbial fuel cell

    Science.gov (United States)

    Hassan, Huzairy; Jin, Bo; Dai, Sheng; Ngau, Cornelius

    2016-11-01

    The formation of microbial biofilm while maintaining the electricity output is a challenging topic in microbial fuel cell (MFC) studies. This MFC critical factor becomes more significant when handling with industrial wastewater which normally contains refractory and toxic compounds. This study explores the formation of industrial mixed culture biofilm in chlorophenol cultivated medium through observing and characterizing microscopically its establishment on MFC anode surface. The mixed culture was found to develop its biofilm on the anode surface in the chlorophenol environment and established its maturity and dispersal stages with concurrent electricity generation and phenolic degradation. The mixed culture biofilm engaged the electron transfer roles in MFC by generating current density of 1.4 mA/m2 and removing 53 % of 2,4-dichlorophenol. The results support further research especially on hazardous wastewater treatment using a benign and sustainable method.

  18. Evaluation of toxicity and genotoxicity of 2-chlorophenol on bacteria, fish and human cells.

    Science.gov (United States)

    Vlastos, Dimitris; Antonopoulou, Maria; Konstantinou, Ioannis

    2016-05-01

    Due to the extensive use of chlorophenols (CPs) in anthropogenic activities, 2-Chlorophenol (2-CP), among other CPs, can enter aquatic ecosystems and can be harmful to a variety of organisms, including bacteria, fish and humans, that are exposed directly and/or indirectly to such contaminated environments. Based on the existing knowledge and in order to move a step forward, the purpose of this study is to investigate the toxic and mainly the genotoxic effects of 2-CP using a combination of bioassays. The tests include the marine bacterium Vibrio fischeri and micronuclei induction in the erythrocytes of Carassius auratus as well as in cultured human lymphocytes. The results obtained reveal that 2-CP is able to induce dose-dependent toxic and genotoxic effects on the selected tested concentrations under the specific experimental conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Fabrication of a novel hydrophobic/ion-exchange mixed-mode adsorbent for the dispersive solid-phase extraction of chlorophenols from environmental water samples.

    Science.gov (United States)

    Gao, Li; Wei, Yinmao

    2016-08-01

    A novel mixed-mode adsorbent was prepared by functionalizing silica with tris(2-aminoethyl)amine and 3-phenoxybenzaldehyde as the main mixed-mode scaffold due to the presence of the plentiful amino groups and benzene rings in their molecules. The adsorption mechanism was probed with acidic, natural and basic compounds, and the mixed hydrophobic and ion-exchange interactions were found to be responsible for the adsorption of analytes. The suitability of dispersive solid-phase extraction was demonstrated in the determination of chlorophenols in environmental water. Several parameters, including sample pH, desorption solvent, ionic strength, adsorbent dose, and extraction time were optimized. Under the optimal extraction conditions, the proposed dispersive solid-phase extraction coupled with high-performance liquid chromatography showed good linearity range and acceptable limits of detection (0.22∽0.54 ng/mL) for five chlorophenols. Notably, the higher extraction recoveries (88.7∽109.7%) for five chlorophenols were obtained with smaller adsorbent dose (10 mg) and shorter extraction time (15 min) compared with the reported methods. The proposed method might be potentially applied in the determination of trace chlorophenols in real water samples. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Kinetics of the degradation of 2-chlorophenol by ozonation at pH 3

    International Nuclear Information System (INIS)

    Sung Menghau; Huang, C.P.

    2007-01-01

    Prediction of byproduct distribution during ozonation is of importance to the design of treatment process. In this study, degradation products in direct ozonation of 2-chlorophenol in aqueous solution were identified by employing the chemical derivatization technique, specifically, silylation. Transient distribution of degradation products, in a semi-batch reactor under three ozone dosages were identified and determined by HPLC analysis. An empirical degradation pathway was proposed to describe the ozonation reaction. A mathematical protocol consisting of 11 equations and 12 rate constants was developed to solve and optimize the kinetic parameters. Modeling results revealed that the empirical pathway was capable of predicting the ozonation reaction at the beginning phase under a higher ozone dosage (e.g., greater than 6 mg/L g ). The degree of agreement between predicted and experimental data decreased as the ozone dosage decreased to 1.2 mg/L g . Results suggested that there was a dosage-dependent pathway in the direct ozonation of 2-chlorophenol

  1. Gamma radiation treatment of pentachlorophenol, 2,4-dichlorophenol and 2-chlorophenol in water

    International Nuclear Information System (INIS)

    He Yongke; Liu Jun; Wu Jilan

    2001-01-01

    The aim of this work was to investigate γ radiation treatment of pentachlorophenol (PCP), 2,4- dichlorophenol (DCP) and o-chlorophenol (o-CP) in water. The dechlorination of PCP, DCP and o-CP has been studied using γ radiation as well as ozonization. G(CI-) is always much higher than the corresponding G(-PCP),this means that some primary radiolytic products are unstable during post irradiation. PCP is much easier to be decomposed under irradiation than that of simple chlorophenol. Some stable radiolytic intermediates were be detected. Primary analysis reveals some quinones among the final products with toxicity that remains unclear. In the pulse radiolytic experiment, it was determined that about 53% of radicals undergo electrotransfer and others undergo addition when OH radicals react with PCP. The values of COD(Mn) after irradiating PCP in dosage were determined. It is recommended to bubble ozone simultaneously when radiation (or electron beam) treat CPs contaminating water. (author)

  2. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    International Nuclear Information System (INIS)

    Suryaman, Dhanus; Hasegawa, Kiyoshi

    2010-01-01

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L -1 , each: 25 mg L -1 ). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h -1 , whereas by the combined photocatalytic-biological treatment was 10.5 mg h -1 . After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO 2 particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  3. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    Energy Technology Data Exchange (ETDEWEB)

    Suryaman, Dhanus, E-mail: dhanussuryaman@yahoo.com [Agency for the Assessment and Application of Technology, M.H. Thamrin No. 8, Jakarta 10340 (Indonesia); Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan); Hasegawa, Kiyoshi [Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan)

    2010-11-15

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L{sup -1}, each: 25 mg L{sup -1}). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h{sup -1}, whereas by the combined photocatalytic-biological treatment was 10.5 mg h{sup -1}. After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO{sub 2} particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  4. An adsorption diffusion model for removal of para-chlorophenol by activated carbon derived from bituminous coal

    International Nuclear Information System (INIS)

    Sze, M.F.F.; McKay, G.

    2010-01-01

    Batch adsorption experiments were carried out to study the adsorptive removal and diffusion mechanism of para-chlorophenol (p-CP) onto Calgon Filtrasorb 400 (F400) activated carbon. The external mass transfer resistance is negligible in the adsorption process carried out under different conditions in batch operation. Intraparticle diffusion model plots were used to correlate the batch p-CP adsorption data; three distinct linear sections were obtained for every batch operation. The textural properties of F400 activated carbon showed that it has a large portion of supermicropores, which is comparable to the size of the p-CP molecules. Due to the stronger interactions between p-CP molecules and F400 micropores, p-CP molecules predominantly diffused and occupied active sites in micropore region by hopping mechanism, and eventually followed by a slow filling of mesopores and micropores. This hypothesis is proven by the excellent agreement of the intraparticle diffusion model plots and the textural properties of F400 activated carbon. - Integration of intraparticle diffusion model plots and textural properties of F400 activated carbon explain the diffusion mechanism of p-CP into porous carbon.

  5. Determination of chlorophenols in landfill leachate using headspace sampling with ionic liquid-coated solid-phase microextraction fibers combined with gas chromatography–mass spectrometry

    International Nuclear Information System (INIS)

    Ho, Tse-Tsung; Chen, Chung-Yu; Li Zuguang; Yang, Thomas Ching-Cherng; Lee, Maw-Rong

    2012-01-01

    Highlights: ► Ionic liquid (IL), ([C 4 MIM][PF 6 ]), was rapid synthesized by microwave radiation. ► Trace chlorophenols in landfill leachate were extract by SPME coated IL. ► The IL-coated SPME-GC/MS method is low-cost, solvent-free and sensitive. - Abstract: A new microextraction technique based on ionic liquid solid-phase microextraction (IL-SPME) was developed for determination of trace chlorophenols (CPs) in landfill leachate. The synthesized ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ([C 4 MIM][PF 6 ]), was coated onto the spent fiber of SPME for extraction of trace CPs. After extraction, the absorbed analytes were desorbed and quantified using gas chromatography–mass spectrometry (GC/MS). The term of the proposed method is as ionic liquid-coated of solid-phase microextraction combined with gas chromatography–mass spectrometry (IL-SPME-GC/MS). No carryover effect was found, and every laboratory-made ionic liquids-coated-fiber could be used for extraction at least eighty times without degradation of efficiency. The chlorophenols studied were 2,4-dichlorophenol (2,4-DP), 2,4,6-trichlorophenol (2,4,6-TCP), 2,3,4,6-tetrachlorophenol (2,3,4,6-TeCP), and pentachlorophenol (PCP). The best results of chlorophenols analysis were obtained with landfill leachate at pH 2, headspace extraction for 4 min, and thermal desorption with the gas chromatograph injector at 240 °C for 4 min. Linearity was observed from 0.1 to 1000 μg L −1 with relative standard deviations (RSD) less than 7% and recoveries were over 87%. The limit of detection (LOD) for pentachlorophenol was 0.008 μg L −1 . The proposed method was tested by analyzing landfill leachate from a sewage farm. The concentrations of chlorophenols were detected to range from 1.1 to 1.4 μg L −1 . The results demonstrate that the IL-SPME-GC/MS method is highly effective in analyzing trace chlorophenols in landfill leachate.

  6. Determination of chlorophenols in landfill leachate using headspace sampling with ionic liquid-coated solid-phase microextraction fibers combined with gas chromatography-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Tse-Tsung; Chen, Chung-Yu [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); Li Zuguang [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); College of Chemical Engineering and Materials Science, Zhejiang University of Technology, Hangzhou 310014, Zhejiang (China); Yang, Thomas Ching-Cherng [Department of Chemistry, National Kaohsiung Normal University, Kaohsiung 82444, Taiwan (China); Lee, Maw-Rong, E-mail: mrlee@dragon.nchu.edu.tw [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China)

    2012-01-27

    Highlights: Black-Right-Pointing-Pointer Ionic liquid (IL), ([C{sub 4}MIM][PF{sub 6}]), was rapid synthesized by microwave radiation. Black-Right-Pointing-Pointer Trace chlorophenols in landfill leachate were extract by SPME coated IL. Black-Right-Pointing-Pointer The IL-coated SPME-GC/MS method is low-cost, solvent-free and sensitive. - Abstract: A new microextraction technique based on ionic liquid solid-phase microextraction (IL-SPME) was developed for determination of trace chlorophenols (CPs) in landfill leachate. The synthesized ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ([C{sub 4}MIM][PF{sub 6}]), was coated onto the spent fiber of SPME for extraction of trace CPs. After extraction, the absorbed analytes were desorbed and quantified using gas chromatography-mass spectrometry (GC/MS). The term of the proposed method is as ionic liquid-coated of solid-phase microextraction combined with gas chromatography-mass spectrometry (IL-SPME-GC/MS). No carryover effect was found, and every laboratory-made ionic liquids-coated-fiber could be used for extraction at least eighty times without degradation of efficiency. The chlorophenols studied were 2,4-dichlorophenol (2,4-DP), 2,4,6-trichlorophenol (2,4,6-TCP), 2,3,4,6-tetrachlorophenol (2,3,4,6-TeCP), and pentachlorophenol (PCP). The best results of chlorophenols analysis were obtained with landfill leachate at pH 2, headspace extraction for 4 min, and thermal desorption with the gas chromatograph injector at 240 Degree-Sign C for 4 min. Linearity was observed from 0.1 to 1000 {mu}g L{sup -1} with relative standard deviations (RSD) less than 7% and recoveries were over 87%. The limit of detection (LOD) for pentachlorophenol was 0.008 {mu}g L{sup -1}. The proposed method was tested by analyzing landfill leachate from a sewage farm. The concentrations of chlorophenols were detected to range from 1.1 to 1.4 {mu}g L{sup -1}. The results demonstrate that the IL-SPME-GC/MS method is highly effective in

  7. Bioconcentration of atrazine and chlorophenols into roots and shoots of rice seedlings

    International Nuclear Information System (INIS)

    Su Yuhong; Zhu Yongguan

    2006-01-01

    Accumulation of o-chlorophenol (CP), 2,4-dichlorophenol (DCP), and atrazine (ATR), as single and mixed contaminants, from hydroponic solutions into roots and shoots of rice seedlings was studied following 48-h exposure of the plant roots. As single contaminants at low levels, the observed bioconcentration factors (BCFs) of CP and DCP with roots approximated the equilibrium values according to the partition-limited model. The BCF of atrazine with roots was about half the partition limit for unknown reasons. The BCFs of CP and ATR with shoots also approximated the partition limits, while the BCF for more lipophilic DCP with shoots was about half the estimated limit, due to insufficient water transport into plants for DCP. As mixed contaminants at low levels, the BCFs with both roots and shoots were comparable with those for the single contaminants; at high levels, the BCFs generally decreased because of the enhanced mixed-contaminant phytotoxicity, as manifested by the greatly reduced plant transpiration rate. - Uptakes of o-chlorophenol, 2,4-dichlorophenol, and atrazine at various levels from nutrient solution by roots and shoots of rice seedlings were investigated using a partition-limited model

  8. Adsorption and bio-sorption of nickel ions and reuse for 2-chlorophenol catalytic ozonation oxidation degradation from water

    International Nuclear Information System (INIS)

    Ma, Wei; Zong, Panpan; Cheng, Zihong; Wang, Baodong; Sun, Qi

    2014-01-01

    Highlights: • Biomass and fly ash which were widespread for adsorption of heavy metal ions. • Preparation of catalyst by saturated adsorbents for 2-chlorophenol ozone degradation. • This work demonstrated that the O 3 /catalyst process was an effective pathway. • The use of nickel ions, fly ash and sawdust to achieve the recycling utilization of resources. -- Abstract: This work explored the preparation of an effective and low-cost catalyst and investigated its catalytic capacity for 2-chlorophenol ozonation oxidation degradation in wastewater by using an ozone oxidation batch reactor. The catalyst was directly prepared by the reuse of fly ash and sawdust after saturated adsorption of nickel ions from wastewater, which was proposed as an efficient and economic approach. The obtained catalyst was characterized by TGA, BET, FTIR, XRD, and SEM, the results showed that fly ash as the basic framework has high specific surface area and the addition of sawdust as the porogen agent could improve the pore structure of the catalyst. The adsorption of nickel ions by fly ash and sawdust from aqueous solution was also investigated in this study. The results obtained from the experiments indicated that adsorption of nickel ions by fly ash and biomass sawdust could be well described by Langmuir isotherm model and pseudo second order kinetic model. The catalytic performance of catalyst was studied in terms of the effect of time, liquid–solid ratio and pH on 2-chlorophenol ozonation degradation. It was found that the catalyst could effectively improve the ozonation reaction rate at pH = 7 with a 2:1 liquid–solid ratio. The kinetic study demonstrated that the reaction followed the first order model, and the rate constant increased 267% (0.03–0.1 min −1 ) of 2-chlorophenol ozonation degradation with 5 mmol/L concentration at pH = 7.0 compared with ozonation alone

  9. Combined Effect of Temperature and Dissolved Oxygen on Degradation of 4-chlorophenol in Photo Microreactor

    Czech Academy of Sciences Publication Activity Database

    Vondráčková, Magdalena; Hejda, S.; Stavárek, Petr; Křišťál, Jiří; Klusoň, Petr

    2015-01-01

    Roč. 94, SI (2015), s. 35-38 ISSN 0255-2701 R&D Projects: GA ČR(CZ) GAP105/12/0664 Institutional support: RVO:67985858 Keywords : photo microreactor * phthalocyanine * chlorophenol oxidation Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.154, year: 2015

  10. Elimination of 2-chlorophenol from aqueous solutions by marine algae: Evidences of the mechanism of adsorption

    International Nuclear Information System (INIS)

    Cuizano, N.A.; Llanos, B.P.

    2009-01-01

    The mechanism of the removal of 2-chlorophenol onto the marine algae Lessonia nigrescens Bory and Macrocystis integrifolia Bory from aqueous solutions was investigated in batch experiments. The effect of the presence of metallic ions in the adsorptive process was evaluated. The results show that lead slightly increases the adsorption of 2-chlorophenol. This suggests two different types of adsorption of both types of pollutants by the two marine algae and a possible synergic effect. Scanning electron microscopy and energy dispersive X-ray analyses predominantly indicated a surface adsorption. Finally, the change in Gibbs free energy (ΔG 0 ) of the process was determined. The results show that the adsorption is not spontaneous for none of the algae. This also corroborates the absence of electrostatic interactions and the existence of a polar interaction in an unfavorable environment surrounded by hydroxyl groups. (author)

  11. Solar efficiency of a new deposited titania photocatalyst. Chlorophenol, pesticide and dye removal applications

    Energy Technology Data Exchange (ETDEWEB)

    Guillard, Chantal; Disdier, Jean; Maldonado, Manuel I.; Herrmann, Jean-Marie [Laboratoire D' Application de la Chimie a l' Environnement LACE (UMR 5634), Universite Claude Bernard Lyon I, Bat Jules Raulin, 69622 Villeurbanne Cedex (France); Monnet, Christine; Dussaud, Joseph [AHLSTROM Research and Services, ZI de l' Abbaye, 38780 Pont-Eveque (France); Malato, Sixto; Blanco, Julian [Plataforma Solar de Almeria-CIEMAT, Ctra. Senes Km. 4, 04200 Tabernas, Almeria (Spain)

    2003-11-10

    A specially designed titania photocatalyst was prepared by coating Ahlstrom non-woven paper, used as a flexible photocatalytic support, with Millennium PC500 anatase. At the same time, a new solar photoreactor (STEP) was designed based on the multi-step cascade falling-film principle to ensure good exposure to sunlight and good oxygenation of the effluent to be treated. Several types of reactants were treated: 4-chlorophenol as a model organic pollutant; formetanate, a widely used pesticide in horticulture; a mixture of pesticides used in vineyards; and indigo carmine (IC) and Congo red (CR), which are complex multifunctional dye molecules. Each reaction was performed simultaneously in a solar CPC slurry photoreactor and in the STEP photoreactor under identical solar exposure to better evaluate and validate the results obtained. The STEP solar reactor was found to be as efficient as the CPC for 4-chlorophenol and formetanate total degradation. In contrast, both dyes required longer treatment in STEP experiments. This new system, in which the final tedious filtration can actually be avoided, constitutes a good alternative to slurries.

  12. Radiation-induced degradation of chlorophenols in aqueous solution

    International Nuclear Information System (INIS)

    Hu Jun; Wang Jianlong

    2005-01-01

    Radiation processing is a promising technology for applications in environmental protection, which includes wastewater treatment, micro-polluted drinking water treatment and the treatment of industrial wastewater containing various toxic and nonbiodegradable pollutants, municipal sewage and sludge disinfection, and flue gas desulfuration, etc. The paper reviews manly the recent progresses in radiolysis of chlorinated phenols in aqueous solution. Advantages and existing problems of the method in this particular application ar discussed. Mechanisms of radiation-induced degradation of chlorophenols, and the factors affecting the degradation efficiency, are discussed, too. It is concluded that combined approaches, such ozone oxidation and other methods, are of great help to the radiation processing application, in terms of lowering down the dose and increasing the efficient of pollutant removal. (authors)

  13. Thermodynamic Study of Adsorption of Phenol, 4-Chlorophenol, and 4-Nitrophenol on Activated Carbon Obtained from Eucalyptus Seed

    Directory of Open Access Journals (Sweden)

    Nelson Giovanny Rincón-Silva

    2015-01-01

    Full Text Available Activated carbons from shell eucalyptus (Eucalyptus globulus were prepared by chemical activation through impregnation with solutions of two activators: sulfuric acid and sodium hydroxide, the surface areas for activated carbons with base were 780 and 670 m2 g−1 and the solids activated with acid were 150 and 80 m2 g−1. These were applying in adsorption of priority pollutants: phenol, 4-nitrophenol, and 4-chlorophenol from aqueous solution. Activated carbon with the highest adsorption capacity has values of 2.12, 2.57, and 3.89 on phenol, 4-nitrophenol, and 4-chlorophenol, respectively, and was activated with base. In general, all carbons adsorption capacity was given in the following order: 4-chlorophenol > 4-nitrophenol > phenol. Adsorption isotherms of phenols on activated carbons were fitted to the Langmuir, Freundlich, and Dubinin-Radusckevisch-Kanager models, finding great association between them and experimental data. A thermodynamic study was performed, the exothermic nature and spontaneous nature of the adsorption process were confirmed, and the favorability of adsorption on activated carbons with NaOH was confirmed by energy relations and concluded that the adsorption process of phenolic compounds from the activated carbon obtained is physical. The pH of solutions and pH at point of zero charge of the solid play an important role in the adsorption process.

  14. Enhanced degradation of p-chlorophenol in a novel pulsed high voltage discharge reactor.

    Science.gov (United States)

    Bian, Wenjuan; Ying, Xiangli; Shi, Junwen

    2009-03-15

    The yields of active specie such as ozone, hydrogen peroxide and hydroxyl radical were all enhanced in a novel discharge reactor. In the reactor, the original formation rate of hydroxyl radical was 2.27 x 10(-7) mol L(-1)s(-1), which was about three times than that in the contrast reactor. Ozone was formed in gas-phase and was transferred into the liquid. The characteristic of mass transfer was better in the novel reactor than that in the contrast reactor, which caused much higher ozone concentration in liquid. The dissociation of hydrogen peroxide was more evident in the former, which promoted the formations of hydroxyl radical. The p-chlorophenol (4-CP) degradation was also enhanced. Most of the ozone transferred into the liquid and hydrogen peroxide generated by discharge could be utilized by the degradation process of 4-CP. About 97% 4-CP was removed in 36 min discharge in the novel reactor. Organic acids such as formic, acetic, oxalic, propanoic and maleic acid were generated and free chloride ions were released in the degradation process. With the formation of organic acid, the pH was decreased and the conductivity was increased.

  15. Enhanced degradation of p-chlorophenol in a novel pulsed high voltage discharge reactor

    Energy Technology Data Exchange (ETDEWEB)

    Bian Wenjuan [School of Chemistry and Chemical Engineering, Soochow University, Suzhou 215123 (China)], E-mail: bwenjuan@suda.edu.cn; Ying Xiangli; Shi Junwen [School of Chemistry and Chemical Engineering, Soochow University, Suzhou 215123 (China)

    2009-03-15

    The yields of active specie such as ozone, hydrogen peroxide and hydroxyl radical were all enhanced in a novel discharge reactor. In the reactor, the original formation rate of hydroxyl radical was 2.27 x 10{sup -7} mol L{sup -1} s{sup -1}, which was about three times than that in the contrast reactor. Ozone was formed in gas-phase and was transferred into the liquid. The characteristic of mass transfer was better in the novel reactor than that in the contrast reactor, which caused much higher ozone concentration in liquid. The dissociation of hydrogen peroxide was more evident in the former, which promoted the formations of hydroxyl radical. The p-chlorophenol (4-CP) degradation was also enhanced. Most of the ozone transferred into the liquid and hydrogen peroxide generated by discharge could be utilized by the degradation process of 4-CP. About 97% 4-CP was removed in 36 min discharge in the novel reactor. Organic acids such as formic, acetic, oxalic, propanoic and maleic acid were generated and free chloride ions were released in the degradation process. With the formation of organic acid, the pH was decreased and the conductivity was increased.

  16. Enhanced degradation of p-chlorophenol in a novel pulsed high voltage discharge reactor

    International Nuclear Information System (INIS)

    Bian Wenjuan; Ying Xiangli; Shi Junwen

    2009-01-01

    The yields of active specie such as ozone, hydrogen peroxide and hydroxyl radical were all enhanced in a novel discharge reactor. In the reactor, the original formation rate of hydroxyl radical was 2.27 x 10 -7 mol L -1 s -1 , which was about three times than that in the contrast reactor. Ozone was formed in gas-phase and was transferred into the liquid. The characteristic of mass transfer was better in the novel reactor than that in the contrast reactor, which caused much higher ozone concentration in liquid. The dissociation of hydrogen peroxide was more evident in the former, which promoted the formations of hydroxyl radical. The p-chlorophenol (4-CP) degradation was also enhanced. Most of the ozone transferred into the liquid and hydrogen peroxide generated by discharge could be utilized by the degradation process of 4-CP. About 97% 4-CP was removed in 36 min discharge in the novel reactor. Organic acids such as formic, acetic, oxalic, propanoic and maleic acid were generated and free chloride ions were released in the degradation process. With the formation of organic acid, the pH was decreased and the conductivity was increased

  17. Adsorption and bio-sorption of nickel ions and reuse for 2-chlorophenol catalytic ozonation oxidation degradation from water

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Wei, E-mail: chmawv@yahoo.com [School of Chemical Engineering, Dalian University of Technology, Dalian 116024 (China); Zong, Panpan; Cheng, Zihong [School of Chemical Engineering, Dalian University of Technology, Dalian 116024 (China); Wang, Baodong; Sun, Qi [National Institute of Clean-and-low Carbon Energy, Beijing 102209 (China)

    2014-02-15

    Highlights: • Biomass and fly ash which were widespread for adsorption of heavy metal ions. • Preparation of catalyst by saturated adsorbents for 2-chlorophenol ozone degradation. • This work demonstrated that the O{sub 3}/catalyst process was an effective pathway. • The use of nickel ions, fly ash and sawdust to achieve the recycling utilization of resources. -- Abstract: This work explored the preparation of an effective and low-cost catalyst and investigated its catalytic capacity for 2-chlorophenol ozonation oxidation degradation in wastewater by using an ozone oxidation batch reactor. The catalyst was directly prepared by the reuse of fly ash and sawdust after saturated adsorption of nickel ions from wastewater, which was proposed as an efficient and economic approach. The obtained catalyst was characterized by TGA, BET, FTIR, XRD, and SEM, the results showed that fly ash as the basic framework has high specific surface area and the addition of sawdust as the porogen agent could improve the pore structure of the catalyst. The adsorption of nickel ions by fly ash and sawdust from aqueous solution was also investigated in this study. The results obtained from the experiments indicated that adsorption of nickel ions by fly ash and biomass sawdust could be well described by Langmuir isotherm model and pseudo second order kinetic model. The catalytic performance of catalyst was studied in terms of the effect of time, liquid–solid ratio and pH on 2-chlorophenol ozonation degradation. It was found that the catalyst could effectively improve the ozonation reaction rate at pH = 7 with a 2:1 liquid–solid ratio. The kinetic study demonstrated that the reaction followed the first order model, and the rate constant increased 267% (0.03–0.1 min{sup −1}) of 2-chlorophenol ozonation degradation with 5 mmol/L concentration at pH = 7.0 compared with ozonation alone.

  18. CHLOROBENZENES, CHLOROPHENOLS, PHAS AND LOW CHLORINATED DIOXIN/FURAN POST-BOILER TOXICITY INDICATORS IN MUNICIPAL SOLID WASTE INCINERATORS

    Science.gov (United States)

    Research has sought indicator compounds for fast and less costly predictive monitoring of polychlorinated dibenzo-p-dioxin and furans, PCDD/F, toxic equivalent concentrations or TEQs. Studies have shown chlorobenzenes and chlorophenols had a good correlation with TEQ, suggesting ...

  19. Experimental and DFT study of the degradation of 4-chlorophenol on hierarchical micro-/nanostructured oxide films

    Czech Academy of Sciences Publication Activity Database

    Guerin, V. M.; Žouželka, Radek; Bíbová-Lipšová, Hana; Jirkovský, Jaromír; Rathouský, Jiří; Pauporté, T.

    2015-01-01

    Roč. 168, JUN 01 (2015), s. 132-140 ISSN 0926-3373 R&D Projects: GA MK(CZ) DF11P01OVV012 Keywords : 4-Chlorophenol degradation * DFT modeling * ZnO hierarchical nanostructures Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.328, year: 2015

  20. Application of Azolla for 2-Chlorophenol and 4-Chrorophenol Removal from Aqueous Solutions

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Zazouli

    2013-09-01

    Full Text Available Background and purpose: The 2-chlorophenol (2-CP and 4-chlorophenol (4-CP are phenolic compounds which may have adverse effects on human and environment. Therefore, removing these compounds from water and wastewater is necessary. This study aims to analyze 2-CP and 4-CP removal by using Azolla filiculoides biomass. Materials & Methods: Azolla biomass was sun dried, crushed and sieved to particle sizes ranging 1-2 mm. Then it was treated with 0.1M HCl for 5h followed by washing with distilled water and it was used as adsorbent. The residues concentration of 2-CP and 4-CP was measured by spectrophotometer in λmax of 274 and 280 nm, respectively. Results: The solute removed increases as contact time rises. The equilibrium time for 2-CP and 4-CP is 90 and 75, respectively. The removal efficiency of 4-CP is more than 2-CP. An increase in initial concentration of both compounds can lead to decrease of their removal efficiency. The optimum pH to remove both compounds is 5. The equilibrium data matched best on Freundlich isotherm and the adsorption kinetic model follows pseudo-second model. Conclusion: The results indicated that Azolla is an effective adsorbent for removing 2-CP and 4-CP from water and wastewater.

  1. Rapid and effective decontamination of chlorophenol-contaminated soil by sorption into commercial polymers: concept demonstration and process modeling.

    Science.gov (United States)

    Tomei, M Concetta; Mosca Angelucci, Domenica; Ademollo, Nicoletta; Daugulis, Andrew J

    2015-03-01

    Solid phase extraction performed with commercial polymer beads to treat soil contaminated by chlorophenols (4-chlorophenol, 2,4-dichlorophenol and pentachlorophenol) as single compounds and in a mixture has been investigated in this study. Soil-water-polymer partition tests were conducted to determine the relative affinities of single compounds in soil-water and polymer-water pairs. Subsequent soil extraction tests were performed with Hytrel 8206, the polymer showing the highest affinity for the tested chlorophenols. Factors that were examined were polymer type, moisture content, and contamination level. Increased moisture content (up to 100%) improved the extraction efficiency for all three compounds. Extraction tests at this upper level of moisture content showed removal efficiencies ≥70% for all the compounds and their ternary mixture, for 24 h of contact time, which is in contrast to the weeks and months, normally required for conventional ex situ remediation processes. A dynamic model characterizing the rate and extent of decontamination was also formulated, calibrated and validated with the experimental data. The proposed model, based on the simplified approach of "lumped parameters" for the mass transfer coefficients, provided very good predictions of the experimental data for the absorptive removal of contaminants from soil at different individual solute levels. Parameters evaluated from calibration by fitting of single compound data, have been successfully applied to predict mixture data, with differences between experimental and predicted data in all cases being ≤3%. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Formulation and stabilization of an Arthrobacter strain with good storage stability and 4-chlorophenol-degradation activity for bioremediation

    NARCIS (Netherlands)

    Bjerketorp, Joakim; Röling, Wilfred F.M.; Feng, Xin Mei; Garcia, Armando Hernández; Heipieper, Hermann J.; Håkansson, Sebastian

    Chlorophenols are widespread and of environmental concern due to their toxic and carcinogenic properties. Development of less costly and less technically challenging remediation methods are needed; therefore, we developed a formulation based on micronized vermiculite that, when air-dried, resulted

  3. Chlorophenols Sorption on Multi-Walled Carbon Nanotubes: DFT Modeling and Structure-Property Relationship Analysis

    OpenAIRE

    Watkins, Marquita; Sizochenko, Natalia; Moore, Quentarius; Golebiowski, Marek; Leszczynska, Danuta; Leszczynski, Jerzy

    2017-01-01

    Presence of chlorophenols in drinking water could be hazardous to human health. Optimization and computational modeling of experimental conditions of adsorption lead to understanding the mechanisms of this process and to creating the efficient experimental equipment. In the current study, we investigated multi-walled carbon nanotubes by means of density functional theory (DFT) approach. This is applied to study selected types of interactions between six solvents, five types of nanotubes, and ...

  4. A sensitive electrochemical chlorophenols sensor based on nanocomposite of ZnSe quantum dots and cetyltrimethylammonium bromide

    International Nuclear Information System (INIS)

    Li, Jianjun; Li, Xiao; Yang, Ran; Qu, Lingbo; Harrington, Peter de B.

    2013-01-01

    Graphical abstract: A very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The nanocomposite of ZnSe–CTAB introduced a favorable access for the electron transfer and showed excellent electrocatalytic activity for the oxidation of CPs. -- Highlights: •Nanocomposite based ZnSe QDs and CTAB was prepared and characterized. •A novel electrochemical sensor for the determination of CPs was built. •The proposed sensor was more sensitive, simple and environment-friendly. -- Abstract: In this work, a very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on a nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The composite of ZnSe–CTAB introduced a favorable access for the electron transfer and gave superior electrocatalytic activity for the oxidation of CPs than ZnSe QDs and CTAB alone. Differential pulse voltammetry (DPV) was used for the quantitative determination of the CPs including 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP) and pentachlorophenol (PCP). Under the optimum conditions, the peak currents of the CPs were proportional to their concentrations in the range from 0.02 to 10.0 μM for 2-CP, 0.006 to 9.0 μM for 2,4-DCP, and 0.06 to 8.0 for PCP. The detection limits were 0.008 μM for 2-CP, 0.002 μM for 2,4-DCP, and 0.01 μM for PCP, respectively. The method was successfully applied for the determination of CPs in waste water with satisfactory recoveries. This ZnSe–CTAB electrode system provides operational access to design environment-friendly CPs sensors

  5. The Pd-catalyzed hydrodechlorination of chlorophenols in aqueous solutions under mild conditions: A promising approach to practical use in wastewater

    International Nuclear Information System (INIS)

    Xia Chuanhai; Liu Ying; Zhou Shiwei; Yang Cuiyun; Liu Sujing; Xu Jie; Yu Junbao; Chen Jiping; Liang Xinmiao

    2009-01-01

    Catalytic hydrotreating of chlorophenols was carried out in water with Pd/C at 25 deg. C under atmospheric pressure. 1.0% (w/w) monocholophenols was completely dechlorinated within 60 min. Phenol, cyclohexanone and cyclohexanol were formed. In contrast to the dechlorination of monochlorophenols, the hydrogenation reaction of polychlorinated phenols became difficult and reaction rates were strongly dependent upon the number of the chlorine atoms. The solvent property had a considerably important influence on the dechlorination reaction. Water as a solvent showed more advantages than organic solvents. It was much easier to be hydrodechlorinated for chlorophenols in aqueous solutions. However, the presence of THF, dioxane, DMSO or DMF in water was disadvantageous to the reaction and easily to cause Pd/C deactivation. Additionally, when different halogenated organic compounds were present in aqueous solution, the dehalogenation reaction was the competitive hydrogenation process.

  6. The Pd-catalyzed hydrodechlorination of chlorophenols in aqueous solutions under mild conditions: A promising approach to practical use in wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Xia Chuanhai, E-mail: chuanhaixia@gmail.com [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Liu Ying; Zhou Shiwei; Yang Cuiyun; Liu Sujing [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Xu Jie [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China); Yu Junbao [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Chen Jiping; Liang Xinmiao [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China)

    2009-09-30

    Catalytic hydrotreating of chlorophenols was carried out in water with Pd/C at 25 deg. C under atmospheric pressure. 1.0% (w/w) monocholophenols was completely dechlorinated within 60 min. Phenol, cyclohexanone and cyclohexanol were formed. In contrast to the dechlorination of monochlorophenols, the hydrogenation reaction of polychlorinated phenols became difficult and reaction rates were strongly dependent upon the number of the chlorine atoms. The solvent property had a considerably important influence on the dechlorination reaction. Water as a solvent showed more advantages than organic solvents. It was much easier to be hydrodechlorinated for chlorophenols in aqueous solutions. However, the presence of THF, dioxane, DMSO or DMF in water was disadvantageous to the reaction and easily to cause Pd/C deactivation. Additionally, when different halogenated organic compounds were present in aqueous solution, the dehalogenation reaction was the competitive hydrogenation process.

  7. CHLOROPHENOL DEGRADATION BY ELECTROCATALYSIS COMBINED WITH UV RADIATION%电催化与紫外光辐射降解氯酚

    Institute of Scientific and Technical Information of China (English)

    吴祖成; 叶倩; 周明华; 丛燕青

    2002-01-01

    @@ Chlorinated organic compounds, especially chlorophenols are well-known water priority pollutant family due to their toxicity and potential health hazard. As biological treatment processes for the degradation of chlorinated phenols have not been effective, various technologies and processes such as activated carbon adsorption[1], chemical oxidation[2], have been conventionally attempted for phenolic waster treatment. Recently, advanced oxidation processes (AOPs) have attracted a great deal of attention for treatment of phenolic wastewater, among these chemical oxidation ultraviolet (UV) oxidation system[3], anodic oxidation and indirect electro-oxidation have been widely studied[4]. Though a number of researchers worked on the degradation of chlorophenol by UV radiation or electrochemical processes, there are few reports on both methods for organic wastewater treatment. If these two processes can operate in harmony, the degradation efficiency would be enhanced.

  8. Kojyl cinnamate ester derivatives promote adiponectin production during adipogenesis in human adipose tissue-derived mesenchymal stem cells.

    Science.gov (United States)

    Rho, Ho Sik; Hong, Soo Hyun; Park, Jongho; Jung, Hyo-Il; Park, Young-Ho; Lee, John Hwan; Shin, Song Seok; Noh, Minsoo

    2014-05-01

    The subcutaneous fat tissue mass gradually decreases with age, and its regulation is a strategy to develop anti-aging compounds to ameliorate the photo-aging of human skin. The adipogenesis of human adipose tissue-mesenchymal stem cells (hAT-MSCs) can be used as a model to discover novel anti-aging compounds. Cinnamomum cassia methanol extracts were identified as adipogenesis-promoting agents by natural product library screening. Cinnamates, the major chemical components of Cinnamomum cassia extracts, promoted adipogenesis in hAT-MSCs. We synthesized kojyl cinnamate ester derivatives to improve the pharmacological activity of cinnamates. Structure-activity studies of kojyl cinnamate derivatives showed that both the α,β-unsaturated carbonyl ester group and the kojic acid moiety play core roles in promoting adiponectin production during adipogenesis in hAT-MSCs. We conclude that kojyl cinnamate ester derivatives provide novel pharmacophores that can regulate adipogenesis in hAT-MSCs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source

    Energy Technology Data Exchange (ETDEWEB)

    Vital-Jacome, Miguel [Department of Biotechnology and Bioengineering, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav-IPN), Av. IPN 2508, 07360 México DF, México (Mexico); Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor [Laboratory for Research on Advanced Process for Water Treatment, Unidad Académica Juriquilla, Instituto de Ingeniería, Universidad Nacional Autónoma de México, Blvd. Juriquilla 3001, Querétaro 76320, México (Mexico); Thalasso, Frederic, E-mail: thalasso@cinvestav.mx [Department of Biotechnology and Bioengineering, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav-IPN), Av. IPN 2508, 07360 México DF, México (Mexico)

    2016-08-05

    Highlights: • Microrespirometry was used to characterize aerobic granules. • Kinetic parameters for 4-chorophenol degradation were determined. • Intrinsic and apparent kinetic parameters were quantified and contrasted. • Aerobic granules presented lower μ{sub max} and higher K{sub S} than disaggregated granules. • Microrespirometry can be useful in model development and calibration. - Abstract: In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9 kg COD m{sup −3} d{sup −1}, and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems.

  10. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source

    International Nuclear Information System (INIS)

    Vital-Jacome, Miguel; Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor; Thalasso, Frederic

    2016-01-01

    Highlights: • Microrespirometry was used to characterize aerobic granules. • Kinetic parameters for 4-chorophenol degradation were determined. • Intrinsic and apparent kinetic parameters were quantified and contrasted. • Aerobic granules presented lower μ_m_a_x and higher K_S than disaggregated granules. • Microrespirometry can be useful in model development and calibration. - Abstract: In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9 kg COD m"−"3 d"−"1, and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems.

  11. Experimental Evaluation Use of Semifluidized Bed Adsorber for the Treatment of P-chlorophenol and O-cresol in Wastewater using Activated Carbon as Adsorbent

    Directory of Open Access Journals (Sweden)

    Saad Hanash Ammar

    2015-12-01

    Full Text Available In the present work the performance of semifluidized bed adsorber was evaluated for removal of phenolic compound from wastewater using commercial activated carbon as adsorbent. P-chlorophenol (4-Chlorophenol and o-cresol (2-methylphenol was selected as a phenolic compound for that purpose. The phenols percent removal, in term of breakthrough curves were studied as affected by hydrodynamics limitations which include minimum and maximum semifluidization velocities and packed bed formation in the column by varying various parameters such as inlet liquid superficial velocity (from Uminsf to 8Uminsf m/s, and retaining grid (sometimes referred to as adsorbent loading to initial static bed height ratio (from 3-4.5. Inlet phenols concentration (50-400 mg/l and initial pH of the liquid solutions feed (from 4 to 10 were also studied. The experimental semifluidized adsorber unit was designed and constructed in Chem. Eng. labs at Al-Nahrain University (consisted of a QVF glass tube 2.54 cm inside diameter, and 70cm length. The results showed that the initial percent removal of phenolic compounds (P-chlorophenol and o-cresol decrease with increasing the superficial liquid velocity while the time required reaching equilibrium state decreased. Also it slightly affected with the increase in the retaining grid height and the time required to reach the equilibrium value decreased.

  12. Preparation and characterizations of CuO doped ZnO nano-structure for the photocatalytic degradation of 4-chlorophenol under visible light

    Directory of Open Access Journals (Sweden)

    Afsaneh Shokri

    2016-12-01

    Full Text Available In the present investigation, a ZnO nanostructure was synthesized by means of precipitation and sonochemical methods. The X-ray diffraction (XRD pattern indicated that the wurtzite structure of ZnO had a hexagonal symmetry and there was no impurity. The average ZnO particles crystallite size was calculated at about 41 nm. The SEM and TEM images revealed nanostructure ZnO particles with a cauliflower-like and rod morphology with dimensions of 85, 79 and 117 nm. In order to investigate the increment of ZnO photoactivity under visible light, the CuO doped ZnO nanostructures were fabricated by a wet impregnation method using copper oxide as the copper source and ZnO as the precursor. The XRD analysis confirmed that the CuO phase was present in the as-prepared sample and the average size of nano crystalline decreased to about 36 nm. The DRS spectra indicated the extended absorption of CuO-ZnO to the visible range as a result of band gap reduction to 2.9 eV (in comparison of 3.2 eV in ZnO. In order to investigate the photocatalytic activity of the synthesized photocatalyst, the degradation of 4-Chlorophenol under visible light was performed. Sixteen experiments using full factorial were executed by adjusting four parameters (amount of catalyst, initial concentration of 4-Chlorophenol, pH, and time of irradiation. An empirical expression was proposed and successfully used to model the photocatalytic process with a high correlation, and an optimal experimental region was also obtained. According to the developed model for degradation and the subsequent ANOVA test using Design Expert software, the time of irradiation with a 46.57% effect played the most important role in the photocatalytic activity, while the influences of parameters on each other were negligible. Optimal experimental conditions for 4-Chlorophenol concentration (0.01 g/L were found at an initial pH =8 and a catalyst loading of 0.07 g/L. The results indicated that CuO-ZnO can remove 95

  13. Room-temperature Pd-catalyzed C-H chlorination by weak coordination: one-pot synthesis of 2-chlorophenols with excellent regioselectivity.

    Science.gov (United States)

    Sun, Xiuyun; Sun, Yonghui; Zhang, Chao; Rao, Yu

    2014-02-07

    A room-temperature Pd(II)-catalyzed regioselective chlorination reaction has been developed for a facile one-pot synthesis of a broad range of 2-chlorophenols. The reaction demonstrates an excellent regioselectivity and reactivity for C-H chlorination. This reaction represents one of the rare examples of mild C-H functionalization at ambient temperature.

  14. [Using Excess Activated Sludge Treated 4-Chlorophenol Contained Waste Water to Cultivate Chlorella vulgaris].

    Science.gov (United States)

    Wang, Lu; Chen, Xiu-rong; Yan, Long; He, Yi-xuan; Shi, Zhen-dong

    2015-04-01

    Using different rations of sludge extracts and supernate from 4-Chlorophenol (4-CP) simulated wastewater's excess sludge after centrifugation to cultivate the Chlorella vulgaris to achieve the goal of excess sludge utilization together with chlorella cultivating. The experiments were performed in 500 mL flasks with different rations of sludge extracts & BG-11 and supernate & BG-11 in a light growth chamber respectively. Number of algal cells, Chlorophyll, enzyme activity, oil and water total nitrogen (TN), total phosphorus (TP), total organic carbon (TOC), toxicity index were investigated. Result showed that the nutrition supplies and toxicity in the excess sludge were removed efficiently via Chlorella vulgaris, the removal rates of TN and TP were at least 40% and 90% respectively; After 10 days cultivation, the density growth of 50% sludge extracts was 20 times higher of the beginning while its chlorophyll content was lower than that of the blank group. Sludge extracts could promote the proliferation of algae, but were not conducive to the synthesis of chlorophyll. The quantity of SOD in per cell showed Chlorella vulgaris gave a positive response via stimulation from toxicant in sludge extracts and supernate. The best time for collecting chlorella vulgaris was the fifth day of cultivation, taking neutral oil accumulation as the evaluating indicator for its utilization combined with the removal of supplies and toxicity.

  15. Modeling of adsorption isotherms of phenol and chlorophenols onto granular activated carbon. Part I. Two-parameter models and equations allowing determination of thermodynamic parameters.

    Science.gov (United States)

    Hamdaoui, Oualid; Naffrechoux, Emmanuel

    2007-08-17

    The adsorption equilibrium isotherms of five phenolic compounds from aqueous solutions onto granular activated carbon (GAC) were studied and modeled. Phenol (Ph), 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP), and 2,4,6-trichlorophenol (TCP) were chosen for the adsorption tests. To predict the adsorption isotherms and to determine the characteristic parameters for process design, seven isotherm models: Langmuir (five linear forms), Freundlich, Elovich, Temkin, Fowler-Guggenheim, Kiselev, and Hill-de Boer models were applied to experimental data. The results reveal that the adsorption isotherm models fitted the data in the order: Fowler-Guggenheim>Hill-de Boer>Temkin>Freundlich>Kiselev>Langmuir isotherms. Adsorption isotherms modeling shows that the interaction of phenolic compounds with activated carbon surface is localized monolayer adsorption, that is adsorbed molecules are adsorbed at definite, localized sites. Each site can accommodate only one molecule. The interaction among adsorbed molecules is repulsive and there is no association between them, adsorption is carried out on energetically different sites and is an exothermic process. Uptake of phenols increases in the order Ph<2-CP<4-CPchlorophenols, it seems that the magnitude of adsorption is directly proportional to their degree of chlorination.

  16. Degradation of 4-Chlorophenol Under Sunlight Using ZnO Nanoparticles as Catalysts

    Science.gov (United States)

    Rajar, Kausar; Sirajuddin; Balouch, Aamna; Bhanger, M. I.; Sherazi, Tufail H.; Kumar, Raj

    2018-03-01

    Herein we demonstrate a simplistic microwave assisted chemical precipitation approach regarding the synthesis of zinc oxide nanoparticles. As-prepared ZnO nanoparticles (NPs) were characterized by UV-visible spectroscopy, Fourier transform infra-red spectroscopy, atomic force microscopy and x-ray diffractometry and scrutinized as photo-catalysts for degradation of 4-chlorophenol (4-CP) under sunlight. The study substantiated that 98.5% of 4-CP was degraded within 20 min in the absence of initiator like H2O2 which reflects an outstanding prospective use for ZnO NPs as photo-catalysts. The nanocatalysts were recycled four times and still showed catalytic efficiency up to 95.5% for degradation of 4-CP in the specified 20 min.

  17. Rotating biological contractor treatment of 2-nitrophenol and 2-chlorophenol containing hazardous wastes

    International Nuclear Information System (INIS)

    Tokuz, R.Y.

    1990-01-01

    Rotating Biological Contactors (RBCs) have a number of advantages over other biological treatment systems. For example, they can provide high treatment efficiencies of activated sludge systems with much lower energy inputs. Organic shock loads are handled well because large biomass is present. No bulking, foaming, or floating of sludge occurs and sludge has good settleability and dewaterability. Another advantage of RBC systems is the minimal labor requirement for operation and maintenance. Even though RBC systems have these advantages, their acceptance was slow mainly due to operational problems with the earlier units (such as shaft failures) and the lack of considerable design and operation data. A review of literature shows that there is only limited information available on the wastewater treatment with RBCs. Recently, there has been considerable contributions to the knowledge on RBC technology. However, information on the treatment of organic hazardous wastes using RBCs is still very limited. This paper reports that a considerable number of studies on the biological treatment of organic hazardous compounds was sponsored by U.S. Environmental Protection Agency (EPA). For example, an EPA sponsored study examined the effect of such compounds on the performance of activated sludge process. Bench-scale continuous-flow and batch units were used. Influent was settled municipal wastewater to which toxic compounds were added. In batch operations, 2-chlorophenol and pentachlorophenol caused an increase in the effluent Chemical Oxygen Demand (COD) at an influent concentration of 5 mg/L. No adverse effect of 2-nitrophenol on the batch system was reports. 2-Chlorophenol was one of the compounds that upset the performance of continuous-flow activated sludge units, yielding higher than normal levels of effluent suspended solids

  18. Caracterización del proceso de adsorción de 3-cloro fenol desde solución acuosa sobre carbon activado por calorimetria de inmersión Characterization of 3-chlorophenol adsorption process from aqueous solution on activated carbon by immersion calorimetry

    Directory of Open Access Journals (Sweden)

    Liliana Giraldo

    2009-01-01

    Full Text Available The immersion enthalpy of activated carbon in 3-chlorophenol solutions, of 100 mg L-1, is determined at different pH values between 3 and 11 with results between 37.6 and 21.2 J g-1. The 3-chlorophenol adsorbed quantities on the activated carbon during the calorimetric experience, are between 1.13 and 2.19 mg g-1, for different pH values of the solution. The 3-chlorophenol adsorbed quantity and the immersion enthalpy decrease by increasing of the pH solution, while increasing the adsorbed quantity increases the immersion enthalpy value.

  19. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Yijing; Tang, Huijuan; Guo, Yan; Guo, Jing; Huang, Bangxing; Fang, Fang; Cai, Jing, E-mail: caijingmmm@hotmail.com; Wang, Zehua, E-mail: zehuawang@163.net

    2015-09-10

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs.

  20. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    International Nuclear Information System (INIS)

    Chu, Yijing; Tang, Huijuan; Guo, Yan; Guo, Jing; Huang, Bangxing; Fang, Fang; Cai, Jing; Wang, Zehua

    2015-01-01

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs

  1. Chronic exposure to chlorophenol related compounds in the pesticide production workplace and lung cancer: a meta-analysis.

    Science.gov (United States)

    Zendehdel, Rezvan; Tayefeh-Rahimian, Raana; Kabir, Ali

    2014-01-01

    Chlorophenols (CPs) and related phenoxyacetic acids (PAs) are pesticide groups contaminated with highly toxic 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD) during production. PAs and CPs exposure is associated with risk of cancer, but the situation regarding lung cancer has not been clearly defined. We proposed a meta-analysis of published researches to evaluate relationship between chronic exposure to PAs and CPs in pesticide production workplaces and the risk of lung cancer. After searching PubMed, Scopus, Scholar Google, Web of Sciences until August 2013, the association between chronic PAs and CPs exposure in production workplace and lung cancer was studied in 15 cohort studies. The standardized mortality rate (SMR) and 95% confidence intervals (CI) were collected from the papers. We used random or fixed-effects models, Egger test, funnel plot and meta regression in our analysis. Five papers with six reports were included in the final analysis. The standardized mortality rate for lung cancer from the random model was 1.18 (95% CI: 1.03-1.35, p=0.014) with moderate heterogeneity. Publication bias was not found for included studies in meta-analysis (p=0.9). Our findings has strengthen the evidence of lung cancer from chronic exposure to chlorophenol related compounds (PAs, CPs).

  2. Shoot-derived abscisic acid promotes root growth.

    Science.gov (United States)

    McAdam, Scott A M; Brodribb, Timothy J; Ross, John J

    2016-03-01

    The phytohormone abscisic acid (ABA) plays a major role in regulating root growth. Most work to date has investigated the influence of root-sourced ABA on root growth during water stress. Here, we tested whether foliage-derived ABA could be transported to the roots, and whether this foliage-derived ABA had an influence on root growth under well-watered conditions. Using both application studies of deuterium-labelled ABA and reciprocal grafting between wild-type and ABA-biosynthetic mutant plants, we show that both ABA levels in the roots and root growth in representative angiosperms are controlled by ABA synthesized in the leaves rather than sourced from the roots. Foliage-derived ABA was found to promote root growth relative to shoot growth but to inhibit the development of lateral roots. Increased root auxin (IAA) levels in plants with ABA-deficient scions suggest that foliage-derived ABA inhibits root growth through the root growth-inhibitor IAA. These results highlight the physiological and morphological importance, beyond the control of stomata, of foliage-derived ABA. The use of foliar ABA as a signal for root growth has important implications for regulating root to shoot growth under normal conditions and suggests that leaf rather than root hydration is the main signal for regulating plant responses to moisture. © 2015 John Wiley & Sons Ltd.

  3. EFFECT OF NATURAL IRON OXIDE, HYDROGEN PEROXIDE, AND OXALIC ACID ON PHOTOCHEMICAL DEGRADATION OF 2-CHLOROPHENOL

    Directory of Open Access Journals (Sweden)

    W REMACHE

    2014-07-01

    Full Text Available The voluntary or accidental release of chemical compounds in the environment is a major cause of pollution of natural waters. Most of chlorophenols are toxic and hardly biodegradable and are difficult to remove from the environment. Therefore, it is important to find innovative and economical methods for the safe and complete destruction. The objective of this work is to test the activity photocatalytic of natural iron oxide (NIO in the photodegradation of 2-chlorophenol (2-CP. The analysis chromatographic with HPLC of solutions exposed under UV irradiation revealed that the degradation of 2-CP was negligible under the condition of using only natural iron oxide. The effect of wavelength on photoreactivity of NIO was also investigated in this process: at high wavelength thus at low energy the efficiency of degradation is important. We have also investigated the activation of NIO by hydrogen peroxide and oxalic acid, The results showed that the photodegradation of 2-CP under UVA irradiation could be enhanced greatly in the presence of oxalate. 2-CP was completly removed after 240 minutes of irradiation when the concentration of oxalic acid is equal to 2.10-3 M. The use of 2.0 % of isopropanol as a scavenger confirmed the intervention of hydroxyl radicals in the photodegradation of 2-CP.

  4. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate

    International Nuclear Information System (INIS)

    He Di; Guan Xiaohong; Ma Jun; Yang Xue; Cui Chongwei

    2010-01-01

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai) > soil HAs > commercial HA (Fluka) > aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of C=C moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R 2 > 0.75) implied that π-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The π-π interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH = 7.0.

  5. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate.

    Science.gov (United States)

    He, Di; Guan, Xiaohong; Ma, Jun; Yang, Xue; Cui, Chongwei

    2010-10-15

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai)>soil HAs>commercial HA (Fluka)>aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of CC moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R(2)>0.75) implied that pi-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The pi-pi interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH=7.0. 2010 Elsevier B.V. All rights reserved.

  6. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate

    Energy Technology Data Exchange (ETDEWEB)

    He Di, E-mail: hedy1997@hotmail.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Guan Xiaohong, E-mail: hitgxh@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Ma Jun, E-mail: majun@hit.edu.cn [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Yang Xue, E-mail: yangxue1_ok@163.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Cui Chongwei, E-mail: cuichongwei1991@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China)

    2010-10-15

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai) > soil HAs > commercial HA (Fluka) > aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of C=C moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R{sup 2} > 0.75) implied that {pi}-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The {pi}-{pi} interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH = 7.0.

  7. Novel polyamide-based nanofibers prepared by electrospinning technique for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bagheri, Habib, E-mail: bagheri@sharif.edu [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of); Aghakhani, Ali; Baghernejad, Masoud; Akbarinejad, Alireza [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of)

    2012-02-24

    A novel solid phase microextraction (SPME) fiber was fabricated by electrospinning method in which a polymeric solution was converted to nanofibers using high voltages. A thin stainless steel wire was coated by the network of polymeric nanofibers. The polymeric nanofiber coating on the wire was mechanically stable due to the fine and continuous nanofibers formation around the wire with a three dimensional structure. Polyamide (nylon 6), due to its suitable characteristics was used to prepare the unbreakable SPME nanofiber. The scanning electron microscopy (SEM) images of this new coating showed a diameter range of 100-200 nm for polyamide nanofibers with a homogeneous and porous surface structure. The extraction efficiency of new coating was investigated for headspace solid-phase microextraction (HS-SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography-mass spectrometry (GC-MS) analysis. Effect of different parameters influencing the extraction efficiency including extraction temperature, extraction time, ionic strength and polyamide amount were investigated and optimized. In order to improve the chromatographic behavior of phenolic compounds, all the analytes were derivatized prior to the extraction process using basic acetic anhydride. The detection limits of the method under optimized conditions were in the range of 2-10 ng L{sup -1}. The relative standard deviations (RSD) (n = 3) at the concentration level of 1.7-6.7 ng mL{sup -1} were obtained between 1 and 7.4%. The calibration curves of chlorophenols showed linearity in the range of 27-1330 ng L{sup -1} for phenol and monochlorophenols and 7-1000 ng L{sup -1} for dichloro and trichlorophenols. Also, the proposed method was successfully applied to the extraction of phenol and chlorophenols from real water samples and relative recoveries were between 84 and 98% for all the selected analytes except for 2,4,6 tricholophenol which was between 72 and 74%.

  8. Cold Incineration of Chlorophenols in Aqueous Solution by Advanced Electrochemical Process Electro-Fenton. Effect of Number and Position of Chlorine Atoms on the Degradation Kinetics

    Science.gov (United States)

    Oturan, Nihal; Panizza, Marco; Oturan, Mehmet A.

    2009-09-01

    This study reports the kinetics of the degradation of several chlorophenols (CPs), such as monochlorophenols (2-chlorophenol and 4-chlorophenol), dichlorophenols (2,4-dichlorophenol and 2,6- dichlorophenol), trichlorophenols (2,3,5- trichlorophenol and 2,4,5-trichlorophenol), 2,3,5,6-tetrachlorophenol, and pentachlorophenol, by the electro-Fenton process using a carbon felt cathode and a Pt anode. The effect of number and the position of the chlorine atoms in the aromatic ring on the oxidative degradation rate was evaluated and discussed. The oxidation reaction of all the CPs with hydroxyl radicals evidenced a pseudo-first-order kinetics and the rate constant decreased with increasing the number of chlorine atoms. The absolute rate constant of second-order reaction kinetics between CPs and •OH was determined by the competition kinetics method in the range of (3.56-7.75) × 109 M-1 s-1 and follows the same sequence of the apparent rate constants. The mineralization of several CPs and of a mixture of all CPs under study was monitored by the total organic carbon (TOC) removal and the chlorine release during mineralization was followed by ion chromatography. Our results demonstrated that more chlorinated phenols are more difficult to mineralize; however for all the tested CPs, almost quantitative release of chloride ions was obtained after 6 h of treatment.

  9. SILAR BiOI-Sensitized TiO2 Films for Visible-Light Photocatalytic Degradation of Rhodamine B and 4-Chlorophenol.

    Science.gov (United States)

    Odling, Gylen; Robertson, Neil

    2017-04-05

    BiOI nanoplates were deposited upon a film of TiO 2 nanoparticles derived from a commercial source using a simple room temperature sequential ionic layer adsorption and reaction (SILAR) method. X-ray diffraction, X-ray photoelectron spectroscopy and electron microscopies have been used to confirm the crystal phase, chemical states of key elements and morphology of the BiOI nanoplate-TiO 2 composites. Using both valence band X-ray photoelectron spectroscopy and UV/Vis diffuse reflectance measurements the band structure of the composites is determined to be that of a type II heterojunction. Through initial screening of the photocatalytic activity of the SILAR-modified films it was determined that five SILAR cycles are optimal in the photocatalytic degradation of rhodamine B. The visible-light sensitisation effect of BiOI was then proven by examination of the photocatalytic degradation of the colourless organic pollutant 4-chlorophenol, showing a large enhancement over an equivalent TiO 2 film. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. COMBINED BIOLOGICAL-PHOTOCATALYTIC TREATMENT FOR THE MINERALIZATION OF A MIXTURE OF CHLOROPHENOLS IN AN ELECTROLYTE-CONTAINING MODEL WATER AND SPONTANEOUS SEDIMENTATION OF TITANIUM DIOXIDE

    Directory of Open Access Journals (Sweden)

    Dhanus Suryaman

    2010-06-01

    Full Text Available To shorten the biological treating time and to examine the effect of electrolytes in a model water on the photocatalytic treatment, the combined biological-photocatalytic treatment was evaluated for removal of a mixture (total: 100 mg L-1, each: 25 mg L-1 of 2-chlorophenol (2-CP, 2,4-dichlorophenol (2,4-DCP, 2,4,5-trichlorophenol (2,4,5-TCP, and pentachlorophenol (PCP in tap water. The mineralization of the four phenols was performed by a flow (biological treatment-circulative flow (photocatalytic treatment operation under black light and sunlight irradiations. After a large portion of biodegradable 2-CP and 2,4-DCP, and around half amount of slightly biodegradable 2,4,5-TCP were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant PCP, and  biodegradation products were completely removed by the subsequent photocatalytic treatment. The combined treatment significantly shortened the degradation time only the biotreatment. High circulative flow rate (600 mL min-1 enabled for TiO2 particles to completely suspend in a tubular photoreactor and resulted in high removals of chlorophenols and TOC. Sunlight irradiation was successfully used and the saving of the electric energy of black light was possible. Since TiO2 particles in the tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined system can be operated by integrating it with the TiO2 separation.   Keywords: photocatalysis, titanium dioxide, biodegradation, pollutant, wastewater

  11. Aqueous hydrodechlorination of 4-chlorophenol over an Rh/reduced graphene oxide synthesized by a facile one-pot solvothermal process under mild conditions

    International Nuclear Information System (INIS)

    Ren, Yanlin; Fan, Guangyin; Wang, Chenyu

    2014-01-01

    Graphical abstract: The Rh nanoparticles/reduced graphene oxide (Rh NPs/RGO) nanocatalyst synthesized by a solvothermal technique showed high activity and stability for the hydrodechlorination of 4-chlorophenol under mild conditions. - Highlights: • Rh/RGO was synthesized through a one-pot polyol reduction of GO and RhCl 3 . • Complete HDC of 4-chlorophenol was obtained in aqueous phase without any additive. • The Rh/RGO exhibited an excellent catalytic performance for HDC reaction. - Abstract: Reduced graphene oxide (RGO) supported rhodium nanoparticles (Rh-NPs/RGO) was synthesized through one-pot polyol co-reduction of graphene oxide (GO) and rhodium chloride. The catalytic property of Rh-NPs/RGO was investigated for the aqueous phase hydrodechlorination (HDC) of 4-chlorophenol (4-CP). A complete conversion of 4-CP into high valued products of cyclohexanone (selectivity: 23.2%) and cyclohexanol (selectivity: 76.8%) was successfully achieved at 303 K and balloon hydrogen pressure in a short reaction time of 50 min when 1.5 g/L of 4-CP was introduced. By comparing with Rh-NPs deposited on the other supports, Rh-NPs/RGO delivered the highest initial rate (111.4 mmol/g Rh min) for 4-CP HDC reaction under the identical conditions. The substantial catalytic activity of Rh-NPs/RGO can be ascribed to the small and uniform particle size of Rh (average particle size was 1.7 ± 0.14 nm) on the surface of the RGO sheets and an electron-deficient state of Rh in the catalyst as a result of the strong interaction between the active sites and the surface function groups of RGO

  12. Amorphous TiO2 doped with carbon for visible light photodegradation of rhodamine B and 4-chlorophenol

    International Nuclear Information System (INIS)

    Shao, Penghui; Tian, Jiayu; Zhao, Zhiwei; Shi, Wenxin; Gao, Shanshan; Cui, Fuyi

    2015-01-01

    Graphical abstract: - Highlights: • Amorphous TiO 2 doped with carbon is prepared as a visible photocatalyst. • RhB and 4-chlorophenol are decomposed effectively by carbon-doped amorphous TiO 2 . • The mechanism for visible light photocatalysis is discussed detailedly. - Abstract: Visible light photocatalytic activity of amorphous TiO 2 doped with carbon is prepared by a facile sol-gel route for the first time. The most active sample with mesostructure of amorphous phase, high surface area (273 m 2 g −1 ) and large pore volume (0.33 cm 3 g −1 ) is identified by X-ray diffractometer, Raman spectrometer, transmission electron microscope and N 2 adsorption–desorption isotherms. In addition, the most active sample is characterized by Fourier transform-infrared spectrometer, X-ray photoelectron spectrometer, UV–vis diffuse reflectance spectrometer and luminescence spectrometer. The results show that the most active sample with oxygenic groups has a narrower bandgap and lower recombination of electron–hole, due to the carbon doping and phase of amorphous. Effective photodegradation capability and stability of rhodamine B and colorless 4-chlorophenol are verified by photocatalytic tests under visible light irradiation. A possible mechanism of amorphous TiO 2 doped with carbon for visible light photocatalysis is proposed. The findings of this paper will provide new insights to design visible light-induced photocatalyst based on amorphous TiO 2 for organic removal

  13. Bioremediation of 2-chlorophenol containing wastewater by aerobic granules-kinetics and toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Mohammad Zain [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India); Mondal, Pijush Kanti, E-mail: pijushamu@gmail.com [Environmental Research laboratory, Department of Applied Chemistry, Faculty of Engineering and Technology, Aligarh Muslim University, Aligarh 202002, UP (India); Sabir, Suhail, E-mail: sabirsuhail09@gmail.com [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India)

    2011-06-15

    Highlights: {yields} 2-Chlorophenol degrading aerobic granules were cultivated in sequencing batch reactor in presence of glucose and the organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} during the experiment. {yields} Spectral studies confirmed that the biodegradation occurs via chlorocatechol pathway and modified ortho-cleavage. {yields} Biodegradation kinetics of 2-CP followed the Haldane model with kinetic parameters (R{sup 2} > 0.9) V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. {yields} Genotoxic examination by plasmid nicking assay confirmed that the effluent was non-toxic. - Abstract: 2-Chlorophenol (2-CP) degrading aerobic granules were cultivated in a sequencing batch reactor (SBR) in presence of glucose. The organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} (1150-1617 mg L{sup -1}COD per cycle) during the experiment. The alkalinity (1000 mg L{sup -1} as CaCO{sub 3}) was maintained throughout the experiment. The specific cell growth rate was found to be 0.013 d{sup -1}. A COD removal efficiency of 94% was achieved after steady state at 8 h HRT (hydraulic retention time). FTIR, UV, GC, GC/MS studies confirmed that the biodegradation of 2-CP occurs via chlorocatechol (modified ortho-cleavage) pathway. Biodegradation kinetics followed the Haldane model with kinetic parameters: V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. Abiotic losses of 2-CP due to volatilization and photo degradation by sunlight were less than 3% and the results of genotoxicity showed that the degradation products are eco-friendly.

  14. Sorption of 2-Chlorophenol from aqueous solutions by functionalized cross-linked polymers

    Directory of Open Access Journals (Sweden)

    Rodrigo Martins Fráguas

    2013-01-01

    Full Text Available This manuscript describes the synthesis of three polymers based on styrene (STY, divinylbenzene (DVB and two different vinyl monomers: methyl methacrylate (MMA and acrylonitrile (AN. The STY-DVB, STY-DVB-MMA and STY-DVB-AN polymers were synthesized employing the aqueous suspension technique. Reaction yields were 73%, 81% and 75%, respectively. They were morphological and chemically characterized using different techniques. The extraction capacity of the polymers was evaluated using 2-chlorophenol. The polymer extraction capacities were evaluated varying contact time the (1 h, 3 h and 5 h, temperature (30 °C, 35 °C and 40 °C, and pH (3, 5.6 and 8. The STY-DVB-AN polymer was the most efficient; it removed around 95% of the analyte using a contact time 50 h.

  15. An IPTG-inducible derivative of the fission yeast nmt promoter

    DEFF Research Database (Denmark)

    Kjærulff, Søren; Nielsen, Olaf

    2015-01-01

    We here describe an IPTG-inducible system that reveals that the lac repressor alone can function as a potent transmodulator to regulate gene expression in the fission yeast, Schizosaccharomyces pombe. This expression system is a derivative of the Sz. pombe nmt promoter, which normally is strongly...

  16. Novel polyamide-based nanofibers prepared by electrospinning technique for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    International Nuclear Information System (INIS)

    Bagheri, Habib; Aghakhani, Ali; Baghernejad, Masoud; Akbarinejad, Alireza

    2012-01-01

    A novel solid phase microextraction (SPME) fiber was fabricated by electrospinning method in which a polymeric solution was converted to nanofibers using high voltages. A thin stainless steel wire was coated by the network of polymeric nanofibers. The polymeric nanofiber coating on the wire was mechanically stable due to the fine and continuous nanofibers formation around the wire with a three dimensional structure. Polyamide (nylon 6), due to its suitable characteristics was used to prepare the unbreakable SPME nanofiber. The scanning electron microscopy (SEM) images of this new coating showed a diameter range of 100–200 nm for polyamide nanofibers with a homogeneous and porous surface structure. The extraction efficiency of new coating was investigated for headspace solid-phase microextraction (HS-SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography–mass spectrometry (GC–MS) analysis. Effect of different parameters influencing the extraction efficiency including extraction temperature, extraction time, ionic strength and polyamide amount were investigated and optimized. In order to improve the chromatographic behavior of phenolic compounds, all the analytes were derivatized prior to the extraction process using basic acetic anhydride. The detection limits of the method under optimized conditions were in the range of 2–10 ng L −1 . The relative standard deviations (RSD) (n = 3) at the concentration level of 1.7–6.7 ng mL −1 were obtained between 1 and 7.4%. The calibration curves of chlorophenols showed linearity in the range of 27–1330 ng L −1 for phenol and monochlorophenols and 7–1000 ng L −1 for dichloro and trichlorophenols. Also, the proposed method was successfully applied to the extraction of phenol and chlorophenols from real water samples and relative recoveries were between 84 and 98% for all the selected analytes except for 2,4,6 tricholophenol which was between 72 and 74%.

  17. [Degradation of 4-chlorophenol in aqueous solution by high-voltage pulsed discharge-ozone technology].

    Science.gov (United States)

    Wen, Yuezhong; Jiang, Xuanzhen; Liu, Weiping

    2002-03-01

    The combination of high voltage pulse discharge and ozonation as an advanced oxidation technology was used to investigate the degradation of 4-chlorophenol (4-CP) in water. The factors that affect the rate of degradation were discussed. The 1.95 x 10(-3) mol/L solutions of 4-CP were almost completely (96%) degraded after the discharge treatment of 30 min. The degradation of 4-CP was investigated as a function of the ozone concentration, radical scavenger and electrode distance. The rate of 4-CP degradation increases with an increase in ozone concentration and a decrease in the electrode distance from 20 mm to 10 mm. The presence of radical scavenger decreased the rate of 4-CP degradation.

  18. Porcine cholecyst–derived scaffold promotes full-thickness wound healing in rabbit

    Directory of Open Access Journals (Sweden)

    Deepa Revi

    2013-12-01

    Full Text Available Graft-assisted healing is an important strategy for treating full-thickness skin wounds. This study evaluated the properties of porcine cholecyst–derived scaffold and its use for treating full-thickness skin wound in rabbit. The physical properties of cholecyst-derived scaffold were congenial for skin-graft application. Compared to a commercially available skin-graft substitute made of porcine small intestinal submucosa, the cholecyst-derived scaffold was rich in natural biomolecules like elastin and glycosaminoglycans. When used as a xenograft, it promoted healing with excess cell proliferation at early phases and acceptable collagen deposition in the later remodelling phases.

  19. p-Chlorophenol adsorption on activated carbons with basic surface properties

    Science.gov (United States)

    Lorenc-Grabowska, Ewa; Gryglewicz, Grażyna; Machnikowski, Jacek

    2010-05-01

    The adsorption of p-chlorophenol (PCP) from aqueous solution on activated carbons (ACs) with basic surface properties has been studied. The ACs were prepared by two methods. The first method was based on the modification of a commercial CWZ AC by high temperature treatment in an atmosphere of ammonia, nitrogen and hydrogen. The second approach comprised the carbonization followed by activation of N-enriched polymers and coal tar pitch using CO 2 and steam as activation agent. The resultant ACs were characterized in terms of porous structure, elemental composition and surface chemistry (pH PZC, acid/base titration, XPS). The adsorption of PCP was carried out from an aqueous solution in static conditions. Equilibrium adsorption isotherm was of L2 type for polymer-based ACs, whereas L3-type isotherm was observed for CWZ ACs series. The Langmuir monolayer adsorption capacity was related to the porous structure and the amount of basic sites. A good correlation was found between the adsorption capacity and the volume of micropores with a width water molecule adsorption on the PCP uptake is discussed.

  20. The enhanced photoactivity of nanosized Bi2WO6 catalyst for the degradation of 4-chlorophenol

    International Nuclear Information System (INIS)

    Fu Hongbo; Yao Wenqing; Zhang Liwu; Zhu Yongfa

    2008-01-01

    Nanosized Bi 2 WO 6 catalyst exhibited the enhanced photoactivity for the degradation of 4-chlorophenol (4-CP) under visible irradiation compared to the sample prepared by high-temperature solid reaction. The photoactivity of the catalyst was sensitive to pH variation of the suspension. Nanosized Bi 2 WO 6 catalyst showed the highest activity at pH 7.2. The photodegradation of 4-CP by nanosized Bi 2 WO 6 catalyst followed a pseudo-first-order reaction. After three recycling runs for the photodegradation of 4-CP, the activity of the catalyst did not show any significant loss, suggesting that the catalyst was stable under visible irradiation

  1. Brain-derived neurotrophic factor promoter methylation and cortical thickness in recurrent major depressive disorder

    OpenAIRE

    Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo

    2016-01-01

    Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the gr...

  2. Exosomes derived from gastric cancer cells activate NF-κB pathway in macrophages to promote cancer progression.

    Science.gov (United States)

    Wu, Lijun; Zhang, Xu; Zhang, Bin; Shi, Hui; Yuan, Xiao; Sun, Yaoxiang; Pan, Zhaoji; Qian, Hui; Xu, Wenrong

    2016-09-01

    Exosomes are nano-sized membrane vesicles secreted by both normal and cancer cells. Emerging evidence indicates that cancer cells derived exosomes contribute to cancer progression through the modulation of tumor microenvironment. However, the effects of exosomes derived from gastric cancer cells on macrophages are not well understood. In this study, we investigated the biological role of gastric cancer cells derived exosomes in the activation of macrophages. We demonstrated that gastric cancer cells derived exosomes activated macrophages to express increased levels of proinflammatory factors, which in turn promoted tumor cell proliferation and migration. In addition, gastric cancer cells derived exosomes remarkably upregulated the phosphorylation of NF-κB in macrophages. Inhibiting the activation of NF-κB reversed the upregulation of proinflammatory factors in macrophages and blocked their promoting effects on gastric cancer cells. Moreover, we found that gastric cancer cells derived exosomes could also activate macrophages from human peripheral blood monocytes through the activation of NF-κB. In conclusion, our results suggest that gastric cancer cells derived exosomes stimulate the activation of NF-κB pathway in macrophages to promote cancer progression, which provides a potential therapeutic approach for gastric cancer by interfering with the interaction between exosomes and macrophages in tumor microenvironment.

  3. PENGUJIAN AKTIVITAS KOMPOSIT Fe2O3-SiO2 SEBAGAI FOTOKATALIS PADA FOTODEGRADASI 4-KLOROFENOL (The Activity Test of Fe2O3-SiO2 Composite As Photocatalyst on 4-Chlorophenol Photodegradation

    Directory of Open Access Journals (Sweden)

    Eko Sri Kunarti

    2009-03-01

    Full Text Available ABSTRAK  Pada penelitian ini telah dilakukan pengujian aktivitas komposit Fe2O3-SiO2 sebagai fotokatalis pada fotodegradasi 4-klorofenol. Penelitian diawali dengan preparasi dan karakterisasi fotokatalis Fe2O3-SiO2. Preparasi dilakukan dengan metode sol-gel pada temperatur kamar menggunakan tetraetil ortosilikat (TEOS dan besi (III nitrat sebagai prekursor diikuti dengan perlakuan termal pada temperature 500 oC. Karakterisasi dilakukan dengan metode spektrometri inframerah, difraksi sinar-X dan spektrometri fluoresensi sinar-X. Uji aktivitas komposit untuk fotodegradasi 4-klorofenol dilakukan dalam reaktor tertutup yang dilengkapi dengan lampu UV. Pada uji ini telah dipelajari pengaruh waktu penyinaran dan pH larutan terhadap efektivitas fotodegradasi 4-klorofenol. Hasil penelitian menunjukkan bahwa komposit Fe2O3-SiO2 dapat dipreparasi dengan metode sol-gel pada temperatur kamar diikuti perlakuan termal. Komposit Fe2O3-SiO2 dapat meningkatkan efektivitas fotodegradasi 4-klorofenol dari 11,86 % menjadi 55,38 %. Efektivitas fotodegradasi 4- klorofenol dipengaruhi waktu penyinaran dan pH larutan yang semakin lama waktu penyinaran efektifitas fotodegradasi semakin tinggi, namun waktu penyinaran yang lebih lama dari 4 jam dapat menurunkan efektivitasnya. pH larutan memberikan pengaruh yang berbeda-beda pada efektivitas fotodegradasi 4-klorofenol.   ABSTRACT The activity test of Fe2O3-SiO2 composite as photocatalyst on 4-chlorophenol photodegradation has been studied. The research was initiated by preparation of Fe2O3-SiO2 photocatalyst and followed by characterization. The preparation was conducted by sol-gel method at room temperature using tetraethylorthosilicate (TEOS and iron (III nitrate as precursors followed by thermal treatment at a temperature of 500oC. The characterizations were performed by X-ray Diffraction (XRD, Infrared and X-ray Fluorescence Spectrophotometry. The photocatalytic activity test of composites for 4 chlorophenol

  4. Gastric cancer-derived exosomes promote peritoneal metastasis by destroying the mesothelial barrier.

    Science.gov (United States)

    Deng, Guang; Qu, Jinglei; Zhang, Ye; Che, Xiaofang; Cheng, Yu; Fan, Yibo; Zhang, Simeng; Na, Di; Liu, Yunpeng; Qu, Xiujuan

    2017-07-01

    An intact mesothelium serves as a protective barrier to inhibit peritoneal carcinomatosis. Cancer-derived exosomes can mediate directional tumor metastasis; however, little is known about whether gastric cancer-derived exosomes will destroy the mesothelial barrier and promote peritoneal dissemination. Here, we demonstrate that gastric cancer-derived exosomes facilitate peritoneal metastasis by causing mesothelial barrier disruption and peritoneal fibrosis. Injury of peritoneal mesothelial cells elicited by gastric cancer-derived exosomes is through concurrent apoptosis and mesothelial-to-mesenchymal transition (MMT). Additionally, upregulation of p-ERK in peritoneal mesothelial cells is primarily responsible for the MMT while contributing little to apoptosis. Together, these data support the concept that exosomes play a crucial role in remodeling the premetastatic microenvironment and identify a novel mechanism for peritoneal metastasis of gastric carcinoma. © 2017 Federation of European Biochemical Societies.

  5. Spectroscopic studies of some lanthanide(III nitrate complexes synthesized from a new ligand 2,6-bis-(salicylaldehyde hydrazone-4-chlorophenol

    Directory of Open Access Journals (Sweden)

    A.S. Sall

    2003-06-01

    Full Text Available The ligand 2,6-bis-(salicylaldehydehydrazone-4-chlorophenol (H5L and its binuclear lanthanide(III nitrate complexes {[Ln2(H4L3(NO3](NO32.mH2O} where Ln = La, Ce, Pr, Nd, Sm, Gd, Dy, Er, Yb and Y, have been synthesized. The complexes were characterized by chemical analysis, conductance, magnetic moment measurements and infrared spectra. Infrared study indicates that the ligand behaves both as neutral and ionic O donors and as neutral N donors.

  6. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    International Nuclear Information System (INIS)

    Ji, S.Q.; Cao, J.; Zhang, Q.Y.; Li, Y.Y.; Yan, Y.Q.; Yu, F.X.

    2013-01-01

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis

  7. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    Energy Technology Data Exchange (ETDEWEB)

    Ji, S.Q.; Cao, J. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Zhang, Q.Y.; Li, Y.Y. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China); Yan, Y.Q. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Yu, F.X. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China)

    2013-09-27

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis.

  8. Comparison of different chlorophenols degradation in aqueous solutions by gamma irradiation under reducing conditions

    International Nuclear Information System (INIS)

    Peng, Yunxia; He, Shijun; Wang, Jianlong; Gong, Wenqi

    2012-01-01

    The reductive degradation of chlorophenols (CPs), including 2-CP, 4-CP and 2,4-DCP by gamma irradiation was investigated and compared. The results showed that the most efficient degradation took place with 2,4-DCP, followed by 2-CP and then 4-CP. This confirmed that the number and position of chlorine atoms existing in the benzene ring have significant impact on dechlorination and decomposition of CPs. The G-values of decomposition of CPs, the formation of intermediate products and chloride ion, and the degradation rate (K CPs and K Cl −1 ) were also determined. - Highlights: ► Reductive degradation of 2-CP, 4-CP and 2,4-DCP by γ radiation was compared. ► Number and position of chlorine affect their dechlorination and decomposition. ► G-values of CPs decomposition, intermediate formation and chloride release were determined.

  9. Photochemical transformation of anionic 2-nitro-4-chlorophenol in surface waters: Laboratory and model assessment of the degradation kinetics, and comparison with field data

    Energy Technology Data Exchange (ETDEWEB)

    Sur, Babita [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Department of Chemical Engineering, Calcutta University, 92 Acharya P. C. Road, Kolkata 700009 (India); De Laurentiis, Elisa; Minella, Marco; Maurino, Valter; Minero, Claudio [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Vione, Davide [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 5, 10125 Torino (Italy); Centro Interdipartimentale NatRisk, Universita di Torino, Via Leonardo da Vinci 44, 10095 Grugliasco (Italy)

    2012-06-01

    Anionic 2-nitro-4-chlorophenol (NCP) may occur in surface waters as a nitroderivative of 4-chlorophenol, which is a transformation intermediate of the herbicide dichlorprop. Here we show that NCP would undergo efficient photochemical transformation in environmental waters, mainly by direct photolysis and reaction with {center_dot}OH. NCP has a polychromatic photolysis quantum yield {Phi}{sub NCP} = (1.27 {+-} 0.22) {center_dot} 10{sup -5}, a rate constant with {center_dot}OH k{sub NCP,}{center_dot}{sub OH} = (1.09 {+-} 0.09) {center_dot} 10{sup 10} M{sup -1} s{sup -1}, a rate constant with {sup 1}O{sub 2}k{sub NCP,1O2} = (2.15 {+-} 0.38) {center_dot} 10{sup 7} M{sup -1} s{sup -1}, a rate constant with the triplet state of anthraquinone-2-sulphonate k{sub NCP,3AQ2S*} = (5.90 {+-} 0.43) {center_dot} 10{sup 8} M{sup -1} s{sup -1}, and is poorly reactive toward CO{sub 3}{sup -}{center_dot}. The k{sub NCP,3AQ2S*} value is representative of reaction with the triplet states of chromophoric dissolved organic matter. The inclusion of photochemical reactivity data into a model of surface-water photochemistry allowed the NCP transformation kinetics to be predicted as a function of water chemical composition and column depth. Very good agreement between model predictions and field data was obtained for the shallow lagoons of the Rhone delta (Southern France). Highlights: Black-Right-Pointing-Pointer Phototransformation kinetics of 2-nitro-4-chlorophenol, relevant to surface waters. Black-Right-Pointing-Pointer Determination of photochemical reactivity data in the laboratory. Black-Right-Pointing-Pointer Model approach to combine photochemical reactivity with environmental variables. Black-Right-Pointing-Pointer Good agreement with field data in lagoon water (Rhone delta, Southern France). Black-Right-Pointing-Pointer Direct photolysis and reaction with {center_dot}OH as main photoprocesses in the environment.

  10. A novel sol-gel-based amino-functionalized fiber for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bagheri, Habib [Department of Chemistry, Sharif University of Technology, P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of)], E-mail: Bagheri@sharif.edu; Babanezhad, Esmaeil; Khalilian, Faezeh [Department of Chemistry, Sharif University of Technology, P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of)

    2008-05-26

    A novel amino-functionalized polymer was synthesized using 3-(trimethoxysilyl) propyl amine (TMSPA) as precursor and hydroxy-terminated polydimethylsiloxane (OH-PDMS) by sol-gel technology and coated on fused-silica fiber. The synthesis was designed in a way to impart polar moiety into the coating network. The scanning electron microscopy (SEM) images of this new coating showed the homogeneity and the porous surface structure of the film. The efficiency of new coating was investigated for headspace solid-phase microextraction (SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography-mass spectrometry (GC-MS) analysis. Effect of different parameters influencing the extraction efficiency such as extraction temperature, extraction time, ionic strength and pH was investigated and optimized. In order to improve the separation efficiency of phenolic compounds on chromatography column all the analytes were derivatized prior to extraction using acetic anhydride at alkaline condition. The detection limits of the method under optimized conditions were in the range of 0.02-0.05 ng mL{sup -1}. The relative standard deviations (R.S.D.) (n = 6) at a concentration level of 0.5 ng mL{sup -1} were obtained between 6.8 and 10%. The calibration curves of chlorophenols showed linearity in the range of 0.5-200 ng mL{sup -1}. The proposed method was successfully applied to the extraction from spiked tap water samples and relative recoveries were higher than 90% for all the analytes.

  11. Photoelectron and UV absorption spectroscopy for determination of electronic configurations of negative molecular ions: Chlorophenols

    International Nuclear Information System (INIS)

    Tseplin, E.E.; Tseplina, S.N.; Tuimedov, G.M.; Khvostenko, O.G.

    2009-01-01

    The photoelectron and UV absorption spectra of p-, m-, and o-chlorophenols in the gas phase have been obtained. On the basis of DFT B3LYP/6-311++G(d, p) calculations, the photoelectron bands have been assigned to occupied molecular orbitals. From the TDDFT B3LYP/6-311++G(d, p) calculation results, the UV absorption bands have been assigned to excited singlet states of the molecules under investigation. For each excited state a dominant transition was found. It has been shown that the energies of these singlet transitions correlate with the energy differences between the ground-state molecular orbitals participating in them. Using the UV spectra interpretation, the electronic states of molecular anions detected earlier for the same compounds by means of the resonant electron capture mass-spectrometry have been determined.

  12. Degradation mechanisms of 4-chlorophenol in a novel gas-liquid hybrid discharge reactor by pulsed high voltage system with oxygen or nitrogen bubbling.

    Science.gov (United States)

    Zhang, Yi; Zhou, Minghua; Hao, Xiaolong; Lei, Lecheng

    2007-03-01

    The effect of gas bubbling on the removal efficiency of 4-chlorophenol (4-CP) in aqueous solution has been investigated using a novel pulsed high voltage gas-liquid hybrid discharge reactor, which generates gas-phase discharge above the water surface simultaneously with the spark discharge directly in the liquid. The time for 100% of 4-CP degradation in the case of oxygen bubbling (7 min) was much shorter than that in the case of nitrogen bubbling (25 min) as plenty of hydrogen peroxide and ozone formed in oxygen atmosphere enhanced the removal efficiency of 4-CP. Except for the main similar intermediates (4-chlorocatechol, hydroquinone and 1,4-benzoquinone) produced in the both cases of oxygen and nitrogen bubbling, special intermediates (5-chloro-3-nitropyrocatechol, 4-chloro-2-nitrophenol, nitrate and nitrite ions) were produced in nitrogen atmosphere. The reaction pathway of 4-CP in the case of oxygen bubbling was oxygen/ozone attack on the radical hydroxylated derivatives of 4-CP. However, in the case of nitrogen bubbling, hydroxylation was the main reaction pathway with effect of N atom on degradation of 4-CP.

  13. A field-practical assay for rapid detection of chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Washburn, K.S.; Phillips, T.D. [Texas A and M Univ., College Station, TX (United States). Dept. of Veterinary Anatomy and Public Health

    1994-12-31

    Water-solvated chlorophenols (CPs) are environmental toxins associated with wood preservation and pesticide synthesis and usage. Their toxicity and association with dioxin-contaminated wastes are well-documented, as is their stability in most environmental settings. Several analytical procedures, mainly HPLC and GC/MS, are currently used to detect and quantify CPs, but these procedures are based on expensive equipment and technical expertise in a laboratory setting. The authors have developed an inexpensive, field-practical method for CPs, utilizing a small, packed glass minicolumn and derivatization of target CP molecules with dansyl chloride (5-dimethylaminonaphthalene-1sulfonyl chloride), or DsCl. A nonfluorescent borosilicate glass tube was used to house an array of inorganic sorbent materials, including preparative layers and a reactive neutral alumina interface separated by sand. DsCl is a substituted naphthalene with a conjugated X system that is responsible for its fluorescent complexation. Amines that reacted with DsCl were removed with a small amount of phyllosilicate clay to avoid interference. A neutral alumina/sand interface was used to strongly bind and immobilize the dansylated CPs. Activities greater than 3.0 for the alumina were avoided to prevent loss of selectivity, intensity and color of the fluorescence at the reactive interface. The results indicated that this assay was capable of rapidly screening potable water samples and detecting CP contamination at very low concentrations (i.e., 1.0 ppb of pentachlorophenol in drinking water).

  14. Role of iron species in the photo-transformation of phenol in artificial and natural seawater

    International Nuclear Information System (INIS)

    Calza, Paola; Massolino, Cristina; Pelizzetti, Ezio; Minero, Claudio

    2012-01-01

    The role played by iron oxides (goethite and akaganeite) and iron(II)/(III) species as photo-sensitizers toward the transformation of organic matter was examined in saline water using phenol as a model molecule. The study was carried out in NaCl 0.7 M solution at pH 8, artificial (ASW) and natural (NSW) seawater, in a device simulating solar light spectrum and intensity. Under illumination phenol decomposition occurs in all the investigated cases. Conversely, dark experiments show that no reaction takes place, implying that phenol transformation is a light- activated process. Following the addition of Fe(II) ions to aerated solutions, Fe(II) is easily oxidized to Fe(III) and hydrogen peroxide is formed. Regardless of the addition of Fe(II) or Fe(III) ions, photo-activated degradation is mediated by Fe(III) species. Several (and different) hydroxylated and halogenated intermediates were identified. In ASW, akaganeite promotes the formation of ortho and para chloro derivatives (2- and 4-chlorophenol, 2,4-dichlorophenol and 2,4,6-trichlorophenol), while goethite induces the formation of 3-chlorophenol and bromophenols. Conversely, Fe(II) or Fe(III) addition causes the formation of 3- and 4-chlorophenol and 2,3- or 3,4-dichlorophenol. 4-Bromophenol was only identified when irradiating Fe(II) spiked solutions. Natural seawater sampled in the Gulf of Trieste, Italy, has been spiked with phenol and irradiated. Phenol photo-induced transformation in NSW mediated by natural photosensitizers occurs and leads to the formation of numerous halophenols, condensed products and nitrophenols. When NSW is spiked with phenol and iron oxides, Fe(II) or Fe(III), halophenols production is enhanced. A close analogy exists between Fe(III), Fe(II)/goethite in ASW and NSW products. Different halophenols production in the natural seawater samples depends on Fe(II)/goethite (above all for 3-chlorophenol, 2,3-dichlorophenol and 4-bromophenol formation) and on Fe(III) colloidal species (3

  15. Quantitative assessment on the contribution of direct photolysis and radical oxidation in photochemical degradation of 4-chlorophenol and oxytetracycline.

    Science.gov (United States)

    Liu, Yiqing; He, Xuexiang; Fu, Yongsheng; Dionysiou, Dionysios D

    2016-07-01

    In UV-254 nm/H2O2 advanced oxidation process (AOP), the potential degradation pathways for organic pollutants include (1) hydrolysis, (2) direct H2O2 oxidation, (3) UV direct photolysis, and (4) hydroxyl radical (HO(•)) reaction. In this study, the contribution of these pathways was quantitatively assessed in the photochemical destruction of 4-chlorophenol (4-CP), demonstrating pathways (3) and (4) to be predominantly responsible for the removal of 4-CP by UV/H2O2 in 50 mM phosphate buffer solution. Increasing reaction pH could significantly enhance the contribution of direct photolysis in UV/H2O2 process. The contribution of HO(•) oxidation was improved with increasing initial H2O2 concentration probably due to the increased formation of HO(•). Presence of sodium carbonate (Na2CO3) as in UV/H2O2/Na2CO3 system promoted the degradation of 4-CP, with carbonate radical (CO3 (•-)) reaction and direct photolysis identified to be the main contributing pathways. The trends in the contribution of each factor were further evaluated and validated on the degradation of the antibiotic compound oxytetracycline (OTC). This study provides valuable information on the relative importance of different reaction pathways on the photochemical degradation of organic contaminants such as 4-CP and OTC in the presence and absence of a CO3 (•-) precursor.

  16. Sirt6 Promotes DNA End Joining in iPSCs Derived from Old Mice

    Directory of Open Access Journals (Sweden)

    Wen Chen

    2017-03-01

    Full Text Available Induced pluripotent stem cells (iPSCs have great potential for treating age-related diseases, but the genome integrity of iPSCs is critically important. Here, we demonstrate that non-homologous end joining (NHEJ, rather than homologous recombination (HR, is less efficient in iPSCs from old mice than young mice. We further find that Sirt6 is downregulated in iPSCs from old mice. Sirt6 directly binds to Ku80 and facilitates the Ku80/DNA-PKcs interaction, thus promoting DNA-PKcs phosphorylation at residue S2056, leading to efficient NHEJ. Rescue experiments show that introducing a combination of Sirt6 and the Yamanaka factors during reprogramming significantly promotes DNA double-strand break (DSB repair by activating NHEJ in iPSCs derived from old mice. Thus, our study suggests a strategy to improve the quality of iPSCs derived from old donors by activating NHEJ and stabilizing the genome.

  17. CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis.

    Science.gov (United States)

    Dondossola, Eleonora; Rangel, Roberto; Guzman-Rojas, Liliana; Barbu, Elena M; Hosoya, Hitomi; St John, Lisa S; Molldrem, Jeffrey J; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2013-12-17

    Angiogenesis is fundamental to tumorigenesis and an attractive target for therapeutic intervention against cancer. We have recently demonstrated that CD13 (aminopeptidase N) expressed by nonmalignant host cells of unspecified types regulate tumor blood vessel development. Here, we compare CD13 wild-type and null bone marrow-transplanted tumor-bearing mice to show that host CD13(+) bone marrow-derived cells promote cancer progression via their effect on angiogenesis. Furthermore, we have identified CD11b(+)CD13(+) myeloid cells as the immune subpopulation directly regulating tumor blood vessel development. Finally, we show that these cells are specifically localized within the tumor microenvironment and produce proangiogenic soluble factors. Thus, CD11b(+)CD13(+) myeloid cells constitute a population of bone marrow-derived cells that promote tumor progression and metastasis and are potential candidates for the development of targeted antiangiogenic drugs.

  18. Gastritis promotes an activated bone marrow-derived mesenchymal stem cell with a phenotype reminiscent of a cancer-promoting cell.

    Science.gov (United States)

    Donnelly, Jessica M; Engevik, Amy C; Engevik, Melinda; Schumacher, Michael A; Xiao, Chang; Yang, Li; Worrell, Roger T; Zavros, Yana

    2014-03-01

    Bone marrow-derived mesenchymal stem cells (BM-MSCs) promote gastric cancer in response to gastritis. In culture, BM-MSCs are prone to mutation with continued passage but it is unknown whether a similar process occurs in vivo in response to gastritis. The purpose of this study was to identify the role of chronic gastritis in the transformation of BM-MSCs leading to an activated cancer-promoting phenotype. Age matched C57BL/6 (BL/6) and gastrin deficient (GKO) mice were used for isolation of stomach, serum and mesenchymal stem cells (MSCs) at 3 and 6 months of age. MSC activation was assessed by growth curve analysis, fluorescence-activated cell sorting and xenograft assays. To allow for the isolation of bone marrow-derived stromal cells and assay in response to chronic gastritis, IRG/Vav-1(Cre) mice that expressed both enhanced green fluorescent protein-expressing hematopoietic cells and red fluorescent protein-expressing stromal cells were generated. In a parabiosis experiment, IRG/Vav-1(Cre) mice were paired to either an uninfected Vav-1(Cre) littermate or a BL/6 mouse inoculated with Helicobacter pylori. GKO mice displayed severe atrophic gastritis accompanied by elevated gastric tissue and circulating transforming growth factor beta (TGFβ) by 3 months of age. Compared to BM-MSCs isolated from uninflamed BL/6 mice, BM-MSCs isolated from GKO mice displayed an increased proliferative rate and elevated phosphorylated-Smad3 suggesting active TGFβ signaling. In xenograft assays, mice injected with BM-MSCs from 6-month-old GKO animals displayed tumor growth. RFP+ stromal cells were rapidly recruited to the gastric mucosa of H. pylori parabionts and exhibited changes in gene expression. Gastritis promotes the in vivo activation of BM-MSCs to a phenotype reminiscent of a cancer-promoting cell.

  19. Health Promoting Effects of Brassica-Derived Phytochemicals: From Chemopreventive and Anti-Inflammatory Activities to Epigenetic Regulation

    Directory of Open Access Journals (Sweden)

    Anika Eva Wagner

    2013-01-01

    Full Text Available A high intake of brassica vegetables may be associated with a decreased chronic disease risk. Health promoting effects of Brassicaceae have been partly attributed to glucosinolates and in particular to their hydrolyzation products including isothiocyanates. In vitro and in vivo studies suggest a chemopreventive activity of isothiocyanates through the redox-sensitive transcription factor Nrf2. Furthermore, studies in cultured cells, in laboratory rodents, and also in humans support an anti-inflammatory effect of brassica-derived phytochemicals. However, the underlying mechanisms of how these compounds mediate their health promoting effects are yet not fully understood. Recent findings suggest that brassica-derived compounds are regulators of epigenetic mechanisms. It has been shown that isothiocyanates may inhibit histone deacetylase transferases and DNA-methyltransferases in cultured cells. Only a few papers have dealt with the effect of brassica-derived compounds on epigenetic mechanisms in laboratory animals, whereas data in humans are currently lacking. The present review aims to summarize the current knowledge regarding the biological activities of brassica-derived phytochemicals regarding chemopreventive, anti-inflammatory, and epigenetic pathways.

  20. Adipose-Derived Stem Cells Promote Peripheral Nerve Regeneration In Vivo without Differentiation into Schwann-Like Lineage.

    Science.gov (United States)

    Sowa, Yoshihiro; Kishida, Tsunao; Imura, Tetsuya; Numajiri, Toshiaki; Nishino, Kenichi; Tabata, Yasuhiko; Mazda, Osam

    2016-02-01

    During recent decades, multipotent stem cells were found to reside in the adipose tissue, and these adipose-derived stem cells were shown to play beneficial roles, like those of Schwann cells, in peripheral nerve regeneration. However, it has not been well established whether adipose-derived stem cells offer beneficial effects to peripheral nerve injuries in vivo as Schwann cells do. Furthermore, the in situ survival and differentiation of adipose-derived stem cells after transplantation at the injured peripheral nerve tissue remain to be fully elucidated. Adipose-derived stem cells and Schwann cells were transplanted with gelatin hydrogel tubes at the artificially blunted sciatic nerve lesion in mice. Neuroregenerative abilities of them were comparably estimated. Cre-loxP-mediated fate tracking was performed to visualize survival in vivo of transplanted adipose-derived stem cells and to investigate whether they differentiated into Schwann linage cells at the peripheral nerve injury site. The transplantation of adipose-derived stem cells promoted regeneration of axons, formation of myelin, and restoration of denervation muscle atrophy to levels comparable to those achieved by Schwann cell transplantation. The adipose-derived stem cells survived for at least 4 weeks after transplantation without differentiating into Schwann cells. Transplanted adipose-derived stem cells did not differentiate into Schwann cells but promoted peripheral nerve regeneration at the injured site. The neuroregenerative ability was comparable to that of Schwann cells. Adipose-derived stem cells at an undifferentiated stage may be used as an alternative cell source for autologous cell therapy for patients with peripheral nerve injury.

  1. Regulatory T cells-derived IL-35 promotes the growth of adult acute myeloid leukemia blasts.

    Science.gov (United States)

    Tao, Qianshan; Pan, Ying; Wang, Yiping; Wang, Huiping; Xiong, Shudao; Li, Qing; Wang, Jia; Tao, Lili; Wang, Zhitao; Wu, Fan; Zhang, Rui; Zhai, Zhimin

    2015-11-15

    Tumor immune escape mechanism mediated by CD4+CD25+regulatory T cells (Tregs) is a key factor in the pathogenesis of acute myeloid leukemia (AML). IL-35, as a novel inhibitory cytokine, is produced by Tregs specially and regulates functions of Tregs in murine. However, IL-35 expression of Tregs in human is still disputed, and its role in AML is yet to be elucidated. In this study, we found that IL-35 was expressed highly in peripheral blood plasma of adult patients with AML and significantly correlated with the clinical stages of malignancy. Tregs-derived from adult AML patients produced IL-35 in a stimulation-dependent manner. IL-35 promoted AML blasts immune escape by expanding Tregs and inhibiting CD4+CD25-effector T cells (Teffs). Furthermore, IL-35 directly promoted the proliferation of AML blasts and reduced the apoptosis of AML blasts. Together, our study demonstrates that IL-35-derived from Tregs promotes the growth of adult AML blasts, suggesting that IL-35 has an important role in the pathogenesis of AML. © 2015 UICC.

  2. Mint3 in bone marrow-derived cells promotes lung metastasis in breast cancer model mice.

    Science.gov (United States)

    Hara, Toshiro; Murakami, Yoshinori; Seiki, Motoharu; Sakamoto, Takeharu

    2017-08-26

    Breast cancer is one of the most common cancers in women in the world. Although breast cancer is well treatable at the early stage, patients with distant metastases show a poor prognosis. Data from recent studies using transplantation models indicate that Mint3/APBA3 might promote breast cancer malignancy. However, whether Mint3 indeed contributes to tumor development, progression, or metastasis in vivo remains unclear. To address this, here we examined whether Mint3 depletion affects tumor malignancy in MMTV-PyMT breast cancer model mice. In MMTV-PyMT mice, Mint3 depletion did not affect tumor onset and tumor growth, but attenuated lung metastases. Experimental lung metastasis of breast cancer Met-1 cells derived from MMTV-PyMT mice also decreased in Mint3-depleted mice, indicating that host Mint3 expression affected lung metastasis of MMTV-PyMT-derived breast cancer cells. Further bone marrow transplant experiments revealed that Mint3 in bone marrow-derived cells promoted lung metastasis in MMTV-PyMT mice. Thus, targeting Mint3 in bone marrow-derived cells might be a good strategy for preventing metastasis and improving the prognosis of breast cancer patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Keratinocyte-derived laminin-332 protein promotes melanin synthesis via regulation of tyrosine uptake.

    Science.gov (United States)

    Chung, Heesung; Jung, Hyejung; Lee, Jung-Hyun; Oh, Hye Yun; Kim, Ok Bin; Han, Inn-Oc; Oh, Eok-Soo

    2014-08-01

    Melanocytes, which produce the pigment melanin, are known to be closely regulated by neighboring keratinocytes. However, how keratinocytes regulate melanin production is unclear. Here we report that melanin production in melanoma cells (B16F10 and MNT-1) was increased markedly on a keratinocyte-derived extracellular matrix compared with a melanoma cell-derived extracellular matrix. siRNA-mediated reduction of keratinocyte-derived laminin-332 expression decreased melanin synthesis in melanoma cells, and laminin-332, but not fibronectin, enhanced melanin content and α-melanocyte-stimulating hormone-regulated melanin production in melanoma cells. Similar effects were observed in human melanocytes. Interestingly, however, laminin-332 did not affect the expression or activity of tyrosinase. Instead, laminin-332 promoted the uptake of extracellular tyrosine and, subsequently, increased intracellular levels of tyrosine in both melanocytes and melanoma cells. Taken together, these data strongly suggest that keratinocyte-derived laminin-332 contributes to melanin production by regulating tyrosine uptake. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Enhanced chlorophenol sorption of soils by rice-straw-ash amendment

    International Nuclear Information System (INIS)

    Liu, Jen-Chyi; Tzou, Yu-Min; Lu, Yi-Hsien; Wu, Jeng-Tzung; Cheng, Mei-Ping; Wang, Shan-Li

    2010-01-01

    Rice-straw burning is a common post-harvest practice on rice paddy land, which results in the accumulation of rice-straw ash (RSA) in paddy soil. Because the occurrence of RSA in soil may affect the fate and transport of contaminants, this study investigated the sorption of 3-chlorophenol (3-CP) on RSA and RSA amended soils to evaluate the sorptive properties of RSA in soils. The results showed that the sorption of 3-CP to RSA proceeds through a surface reaction rather than through partitioning and that the neutral form of 3-CP is preferentially sorbed to the surface when compared to the deprotonated anionic form of 3-CP. The addition of RSA to the soils enhanced the overall 3-CP sorption, indicating that RSA amendment may be applied to retard the movement of 3-CP in contaminated soils. As the RSA content in the soils was increased from 0% to 2%, the Langmuir sorption maximum of the soils increased from 18-80 to 256-274 mg kg -1 . Thus, RSA contributed more to the total sorption of the soils than other major components in the soils. Nonetheless, the 3-CP sorption of the soils containing RSA was less than the combination of pure RSA and the soils, thereby indicating that the 3-CP sorption of RSA was suppressed. This may be attributed to the competition of organic matter or other soil components for the surface binding sites of RSA.

  5. Milk-Derived Nanoparticle Fraction Promotes the Formation of Small Osteoclasts But Reduces Bone Resorption

    NARCIS (Netherlands)

    Oliveira, M.C.; Di Ceglie, I.; Arntz, O.J.; Berg, W.B. van den; Hoogen, F.H.J. van den; Ferreira, A.V.; Lent, P.L.E.M. van; Loo, F.A.J. van de

    2017-01-01

    The general consensus is that milk promotes bone growth and density because is a source of calcium and contains components that enhance intestinal calcium uptake or directly affect bone metabolism. In this study, we investigated the effect of bovine-derived milk 100,000 g pellet (P100), which

  6. Development of an energy-saving anaerobic hybrid membrane bioreactors for 2-chlorophenol-contained wastewater treatment.

    Science.gov (United States)

    Wang, Yun-Kun; Pan, Xin-Rong; Sheng, Guo-Ping; Li, Wen-Wei; Shi, Bing-Jing; Yu, Han-Qing

    2015-12-01

    A novel energy-saving anaerobic hybrid membrane bioreactor (AnHMBR) with mesh filter, which takes advantage of anaerobic membrane bioreactor and fixed-bed biofilm reactor, is developed for low-strength 2-chlorophenol (2-CP)-contained wastewater treatment. In this system, the anaerobic membrane bioreactor is stuffed with granular activated carbon to construct an anaerobic hybrid fixed-bed biofilm membrane bioreactor. The effluent turbidity from the AnHMBR system was low during most of the operation period, and the chemical oxygen demand and 2-CP removal efficiencies averaged 82.3% and 92.6%, respectively. Furthermore, a low membrane fouling rate was achieved during the operation. During the AnHMBR operation, the only energy consumption was for feed pump. And a low energy demand of 0.0045-0.0063kWhm(-3) was estimated under the current operation conditions. All these results demonstrated that this novel AnHMBR is a sustainable technology for treating 2-CP-contained wastewater. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Epithelial-derived IL-33 promotes intestinal tumorigenesis in Apc Min/+ mice.

    Science.gov (United States)

    He, Zhengxiang; Chen, Lili; Souto, Fabricio O; Canasto-Chibuque, Claudia; Bongers, Gerold; Deshpande, Madhura; Harpaz, Noam; Ko, Huaibin M; Kelley, Kevin; Furtado, Glaucia C; Lira, Sergio A

    2017-07-14

    Increased expression of Interleukin (IL)-33 has been detected in intestinal samples of patients with ulcerative colitis, a condition associated with increased risk for colon cancer, but its role in the development of colorectal cancer has yet to be fully examined. Here, we investigated the role of epithelial expressed IL-33 during development of intestinal tumors. IL-33 expression was detected in epithelial cells in colorectal cancer specimens and in the Apc Min/+ mice. To better understand the role of epithelial-derived IL-33 in the intestinal tumorigenesis, we generated transgenic mice expressing IL-33 in intestinal epithelial cells (V33 mice). V33 Apc Min/+ mice, resulting from the cross of V33 with Apc Min/+ mice, had increased intestinal tumor burden compared with littermate Apc Min/+ mice. Consistently, Apc Min/+ mice deficient for IL-33 receptor (ST2), had reduced polyp burden. Mechanistically, overexpression of IL-33 promoted expansion of ST2 + regulatory T cells, increased Th2 cytokine milieu, and induced alternatively activated macrophages in the gut. IL-33 promoted marked changes in the expression of antimicrobial peptides, and antibiotic treatment of V33 Apc Min/+ mice abrogated the tumor promoting-effects of IL-33 in the colon. In conclusion, elevated IL-33 signaling increases tumor development in the Apc Min/+ mice.

  8. Chlorophenol and alkylphenol concentrations in sediment and mussel tissues collected from selected locations in Kentucky Lake, USA

    Energy Technology Data Exchange (ETDEWEB)

    Loganathan, B.; Brown, B.; Owen, D. [Murray State Univ., Murray, KY (United States); Sajwan, K. [Savannah State Univ., Savannah, GA (United States)

    2004-09-15

    Kentucky (KY) Lake is one the major human-constructed lakes in the US. It serves as an ultimate repository of substances entering this watershed from portions of seven southeastern states, which include a sizeable fraction of the U.S. chemical processing, agricultural chemical products and electronics manufacturing industries. Although a few studies have examined the levels of chlorinated organics in the KY Lake and the lowermost Tennessee River, there have been no reports on the distribution on the levels of chlorophenols and alkylphenols in sediment and/or biological tissues from this region. In this study, sediment, and freshwater mussels were collected from selected locations in KY Lake and Lake Barkley and analyzed for CPs and APs. Furthermore, wood samples from abandoned docks, navigational towers and wood found in the lake bottom were also analyzed to examine the sources of CPs to the lakes.

  9. Proliferation-promoting effect of platelet-rich plasma on human adipose-derived stem cells and human dermal fibroblasts.

    Science.gov (United States)

    Kakudo, Natsuko; Minakata, Tatsuya; Mitsui, Toshihito; Kushida, Satoshi; Notodihardjo, Frederik Zefanya; Kusumoto, Kenji

    2008-11-01

    This study evaluated changes in platelet-derived growth factor (PDGF)-AB and transforming growth factor (TGF)-beta1 release from platelets by platelet-rich plasma activation, and the proliferation potential of activated platelet-rich plasma and platelet-poor plasma on human adipose-derived stem cells and human dermal fibroblasts. Platelet-rich plasma was prepared using a double-spin method, with the number of platelets counted in each preparation stage. Platelet-rich and platelet-poor plasma were activated with autologous thrombin and calcium chloride, and levels of platelet-released PDGF-AB and TGF-beta1 were determined by enzyme-linked immunosorbent assay. Cells were cultured for 1, 4, or 7 days in serum-free Dulbecco's Modified Eagle Medium supplemented with 5% whole blood plasma, nonactivated platelet-rich plasma, nonactivated platelet-poor plasma, activated platelet-rich plasma, or activated platelet-poor plasma. In parallel, these cells were cultured for 1, 4, or 7 days in serum-free Dulbecco's Modified Eagle Medium supplemented with 1%, 5%, 10%, or 20% activated platelet-rich plasma. The cultured human adipose-derived stem cells and human dermal fibroblasts were assayed for proliferation. Platelet-rich plasma contained approximately 7.9 times as many platelets as whole blood, and its activation was associated with the release of large amounts of PDGF-AB and TGF-beta1. Adding activated platelet-rich or platelet-poor plasma significantly promoted the proliferation of human adipose-derived stem cells and human dermal fibroblasts. Adding 5% activated platelet-rich plasma to the medium maximally promoted cell proliferation, but activated platelet-rich plasma at 20% did not promote it. Platelet-rich plasma can enhance the proliferation of human adipose-derived stem cells and human dermal fibroblasts. These results support clinical platelet-rich plasma application for cell-based, soft-tissue engineering and wound healing.

  10. Fabrication of a novel PbO2 electrode with a graphene nanosheet interlayer for electrochemical oxidation of 2-chlorophenol

    International Nuclear Information System (INIS)

    Duan, Xiaoyue; Zhao, Cuimei; Liu, Wei; Zhao, Xuesong; Chang, Limin

    2017-01-01

    Highlights: • A novel PbO 2 electrode with a GNS interlayer (GSN-PbO 2 ) was prepared. • The GNS interlayer reduced grain size of β-PbO 2 crystals. • The GNS interlayer enhanced electrochemical activity of PbO 2 electrode. • The lifetime of GSN-PbO 2 electrode was 1.93 times that of PbO 2 electrode. • An electrochemical mineralization mechanism of 2-chlorophenol was proposed. - Abstract: A novel PbO 2 electrode with a graphene nanosheet interlayer (marked as GNS-PbO 2 ) was prepared combining electrophoretic deposition and electro-deposition technologies. The micro morphology, crystal structure and surface chemical states of GNS-PbO 2 electrodes were characterized using scanning electronic microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). Their electrochemical properties and stability were determined using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), ·OH radicals test and accelerated life test, and compared with traditional PbO 2 electrodes. Besides, their potential application in the electrochemical degradation of 2-chlorophenol (2-CP) was investigated. The GNS-PbO 2 electrode possessed perfect octahedral β-PbO 2 microcrystals, and its grain size was much smaller than that of traditional PbO 2 electrode. It exhibited higher electrochemical activity than traditional PbO 2 electrode due to its larger electrochemical active surface area and stronger ·OH radicals generation ability. The service lifetime of GNS-PbO 2 electrode (107.9 h) was 1.93 times longer than that of traditional PbO 2 electrode (55.9 h). The electrochemical degradation rate constant of 2-CP on GNS-PbO 2 electrode (k app = 2.75 × 10 −2 min −1 ) is much higher than for PbO 2 electrode (k app = 1.76 × 10 −2 min −1 ). 2-CP oxidation yielded intermediates including aromatic compounds (catechol, phenol and ortho-benzoquinone) and organic acids (oxalic acid, maleic acid and

  11. Brain-derived neurotrophic factor promoter methylation and cortical thickness in recurrent major depressive disorder.

    Science.gov (United States)

    Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo

    2016-02-15

    Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the groups. The right medial orbitofrontal, right lingual, right lateral occipital, left lateral orbitofrontal, left pars triangularis, and left lingual cortices were thinner in patients with MDD than in healthy controls. Among the MDD group, right pericalcarine, right medical orbitofrontal, right rostral middle frontal, right postcentral, right inferior temporal, right cuneus, right precuneus, left frontal pole, left superior frontal, left superior temporal, left rostral middle frontal and left lingual cortices had inverse correlations with methylation of BDNF promoters. Higher levels of BDNF promoter methylation may be closely associated with the reduced cortical thickness among patients with MDD. Serum BDNF levels were significantly lower in MDD, and showed an inverse relationship with BDNF methylation only in healthy controls. Particularly the prefrontal and occipital cortices seem to indicate key regions in which BDNF methylation has a significant effect on structure.

  12. Optimization of headspace experimental factors to determine chlorophenols in water by means of headspace solid-phase microextraction and gas chromatography coupled with mass spectrometry and parallel factor analysis.

    Science.gov (United States)

    Morales, Rocío; Cruz Ortiz, M; Sarabia, Luis A

    2012-11-19

    In this work an analytical procedure based on headspace solid-phase microextraction and gas chromatography coupled with mass spectrometry (HS-SPME-GC/MS) is proposed to determine chlorophenols with prior derivatization step to improve analyte volatility and therefore the decision limit (CCα). After optimization, the analytical procedure was applied to analyze river water samples. The following analytes are studied: 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TrCP), 2,3,4,6-tetrachlorophenol (2,4,6-TeCP) and pentachlorophenol (PCP). A D-optimal design is used to study the parameters affecting the HS-SPME process and the derivatization step. Four experimental factors at two levels and one factor at three levels were considered: (i) equilibrium/extraction temperature, (ii) extraction time, (iii) sample volume, (iv) agitation time and (v) equilibrium time. In addition two interactions between four of them were considered. The D-optimal design enables the reduction of the number of experiments from 48 to 18 while maintaining enough precision in the estimation of the effects. As every analysis took 1h, the design is blocked in 2 days. The second-order property of the PARAFAC (parallel factor analysis) decomposition avoids the need of fitting a new calibration model each time that the experimental conditions change. In consequence, the standardized loadings in the sample mode estimated by a PARAFAC decomposition are the response used in the design because they are proportional to the amount of analyte extracted. It has been found that block effect is significant and that 60°C equilibrium temperature together with 25min extraction time are necessary to achieve the best extraction for the chlorophenols analyzed. The other factors and interactions were not significant. After that, a calibration based in a PARAFAC2 decomposition provided the following values of CCα: 120, 208, 86, 39ngL(-1) for 2,4-DCP, 2,4,6-TrCP, 2,3,4,5-TeCP and PCP respectively for a

  13. Parameter Identification of the 2-Chlorophenol Oxidation Model Using Improved Differential Search Algorithm

    Directory of Open Access Journals (Sweden)

    Guang-zhou Chen

    2015-01-01

    Full Text Available Parameter identification plays a crucial role for simulating and using model. This paper firstly carried out the sensitivity analysis of the 2-chlorophenol oxidation model in supercritical water using the Monte Carlo method. Then, to address the nonlinearity of the model, two improved differential search (DS algorithms were proposed to carry out the parameter identification of the model. One strategy is to adopt the Latin hypercube sampling method to replace the uniform distribution of initial population; the other is to combine DS with simplex method. The results of sensitivity analysis reveal the sensitivity and the degree of difficulty identified for every model parameter. Furthermore, the posteriori probability distribution of parameters and the collaborative relationship between any two parameters can be obtained. To verify the effectiveness of the improved algorithms, the optimization performance of improved DS in kinetic parameter estimation is studied and compared with that of the basic DS algorithm, differential evolution, artificial bee colony optimization, and quantum-behaved particle swarm optimization. And the experimental results demonstrate that the DS with the Latin hypercube sampling method does not present better performance, while the hybrid methods have the advantages of strong global search ability and local search ability and are more effective than the other algorithms.

  14. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Nahyun Choi

    2018-02-01

    Full Text Available Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs. We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif ligand 1 (CXCL1, platelet-derived endothelial cell growth factor (PD-ECGF, and platelet-derived growth factor-C (PDGF-C. Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2 phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.

  15. Minoxidil Promotes Hair Growth through Stimulation of Growth Factor Release from Adipose-Derived Stem Cells

    Science.gov (United States)

    Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk

    2018-01-01

    Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622

  16. Gastric cancer-derived MSC-secreted PDGF-DD promotes gastric cancer progression.

    Science.gov (United States)

    Huang, Feng; Wang, Mei; Yang, Tingting; Cai, Jie; Zhang, Qiang; Sun, Zixuan; Wu, Xiaodan; Zhang, Xu; Zhu, Wei; Qian, Hui; Xu, Wenrong

    2014-11-01

    This study was designed to investigate the role of PDGF-DD secreted by gastric cancer-derived mesenchymal stem cells (GC-MSCs) in human gastric cancer progression. Gastric cancer cells were indirectly co-cultured with GC-MSCs in a transwell system. The growth and migration of gastric cancer cells were evaluated by cell colony formation assay and transwell migration assay, respectively. The production of PDGF-DD in GC-MSCs was determined by using Luminex and ELISA. Neutralization of PDGFR-β by su16f and siRNA interference of PDGF-DD in GC-MSCs was used to demonstrate the role of PDGF-DD produced by GC-MSCs in gastric cancer progression. GC-MSC conditioned medium promoted gastric cancer cell proliferation and migration in vitro and in vivo. Co-culture with GC-MSCs increased the phosphorylation of PDGFR-β in SGC-7901 cells. Neutralization of PDGFR-β by su16f blocked the promoting role of GC-MSC conditioned medium in gastric cancer cell proliferation and migration. Recombinant PDGF-DD duplicated the effects of GC-MSC conditioned medium on gastric cancer cells. Knockdown of PDGF-DD in GC-MSCs abolished its effects on gastric cancer cells in vitro and in vivo. PDGF-DD secreted by GC-MSCs is capable of promoting gastric cancer cell progression in vitro and in vivo. Targeting the PDGF-DD/PDGFR-β interaction between MSCs and gastric cancer cells may represent a novel strategy for gastric cancer therapy.

  17. Transplantation of bone marrow derived cells promotes pancreatic islet repair in diabetic mice

    International Nuclear Information System (INIS)

    Gao Xiaodong; Song Lujun; Shen Kuntang; Wang Hongshan; Niu Weixin; Qin Xinyu

    2008-01-01

    The transplantation of bone marrow (BM) derived cells to initiate pancreatic regeneration is an attractive but as-yet unrealized strategy. Presently, BM derived cells from green fluorescent protein transgenic mice were transplanted into diabetic mice. Repair of diabetic islets was evidenced by reduction of hyperglycemia, increase in number of islets, and altered pancreatic histology. Cells in the pancreata of recipient mice co-expressed BrdU and insulin. Double staining revealed β cells were in the process of proliferation. BrdU + insulin - PDX-1 + cells, Ngn3 + cells and insulin + glucagon + cells, which showed stem cells, were also found during β-cell regeneration. The majority of transplanted cells were mobilized to the islet and ductal regions. In recipient pancreas, transplanted cells simultaneously expressed CD34 but did not express insulin, PDX-1, Ngn3, Nkx2.2, Nkx6.1, Pax4, Pax6, and CD45. It is concluded that BM derived cells especially CD34 + cells can promote repair of pancreatic islets. Moreover, both proliferation of β cells and differentiation of pancreatic stem cells contribute to the regeneration of β cells

  18. Solid-phase extraction of chlorophenols in seawater using a magnetic ionic liquid molecularly imprinted polymer with incorporated silicon dioxide as a sorbent.

    Science.gov (United States)

    Ma, Wanwan; Row, Kyung Ho

    2018-07-20

    A type of magnetic ionic liquid based molecularly imprinted polymer coated on SiO 2 (Fe 3 O 4 @SiO 2 @IL-MIPs) was prepared with 1-vinyl-3-ethylimidazole ionic liquid as functional monomer, and 1,4-butane-3,3'-bis-1-ethylimidazole ionic liquid as cross linker, 4-Chlorophenol as template was successfully applied as a selective adsorbent for selective extraction of 5 chlorophenols in seawater samples by using the magnetic solid-phase extraction (MSPE) method. 11 types of Fe 3 O 4 @SiO 2 @IL-MIPs were synthesized and investigated for their different compositions of functional monomer (such as [C 2 min][Br], [C 2 min][BF 4 ], [C 2 min][PF 6 ], acrylamide, methacrylic acid and 4-vinyl pyridine) and cross-linker (such as [C 4 min 2 ][Br], [C 4 min 2 ][BF 4 ], [C 4 min 2 ][PF 6 ], divinylbenzene, and ethylene glycol dimethacrylate), respectively. The [C 2 min][BF 4 ] and [C 4 min 2 ][PF 6 ] based Fe 3 O 4 @SiO 2 @IL-MIP with the highest extraction efficiencies was applied to the optimization experiment of MSPE process (including extraction time, adsorbent mass and desorption solvents). Good linearity was obtained with correlation coefficients (R 2 ) over 0.9990 and the relative standard deviations for the intra-day and inter-day determination were less than 3.10% with the extraction recoveries ranged from 85.0% to 98.4%. The results indicated that the proposed Fe 3 O 4 @SiO 2 @IL-MIPs possesses great identification and adsorption properties, and could be used as a good sorbent for selective extraction of CPs in environment waters. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Visible-light-promoted redox neutral C-H amidation of heteroarenes with hydroxylamine derivatives.

    Science.gov (United States)

    Qin, Qixue; Yu, Shouyun

    2014-07-03

    A room temperature redox neutral direct C-H amidation of heteroarenes has been achieved. Hydroxylamine derivatives, which are easily accessed, have been employed as tunable nitrogen sources. These reactions were enabled by a visible-light-promoted single-electron transfer pathway without a directing group. A variety of heteroarenes, such as indoles, pyrroles, and furans, could go through this amidation with high yields (up to 98%). These reactions are highly regioselective, and all the products were isolated as a single regioisomer.

  20. Promotion of seminomatous tumors by targeted overexpression of glial cell line-derived neurotrophic factor in mouse testis

    NARCIS (Netherlands)

    Meng, X.; de rooij, D. G.; Westerdahl, K.; Saarma, M.; Sariola, H.

    2001-01-01

    We show with transgenic mice that targeted overexpression of glial cell line-derived neurotrophic factor (GDNF) in undifferentiated spermatogonia promotes malignant testicular tumors, which express germ-cell markers. The tumors are invasive and contain aneuploid cells, but no distant metastases have

  1. Melanoma cell-derived exosomes promote epithelial-mesenchymal transition in primary melanocytes through paracrine/autocrine signaling in the tumor microenvironment

    Science.gov (United States)

    Xiao, Deyi; Barry, Samantha; Kmetz, Daniel; Egger, Michael; Pan, Jianmin; Rai, Shesh N; Qu, Jifu; McMasters, Kelly M.; Hao, Hongying

    2016-01-01

    The tumor microenvironment is abundant with exosomes that are secreted by the cancer cells themselves. Exosomes are nanosized, organelle-like membranous structures that are increasingly being recognized as major contributors in the progression of malignant neoplasms. A critical element in melanoma progression is its propensity to metastasize, but little is known about how melanoma cell-derived exosomes modulate the microenvironment to optimize conditions for tumor progression and metastasis. Here, we provide evidence that melanoma cell-derived exosomes promote phenotype switching in primary melanocytes through paracrine/autocrine signaling. We found that the mitogen-activated protein kinase (MAPK) signaling pathway was activated during the exosome-mediated epithelial-to-mesenchymal transition (EMT)-resembling process, which promotes metastasis. Let-7i, an miRNA modulator of EMT, was also involved in this process. We further defined two other miRNA modulators of EMT (miR-191 and let-7a) in serum exosomes for differentiating stage I melanoma patients from non-melanoma subjects. These results provide the first strong molecular evidence that melanoma cell-derived exosomes promote the EMT-resembling process in the tumor microenvironment. Thus, novel strategies targeting EMT and modulating the tumor microenvironment may emerge as important approaches for the treatment of metastatic melanoma. PMID:27063098

  2. Enhanced aerobic degradation of 4-chlorophenol with iron-nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Wenjuan; Mu, Yi; Wang, Bingning; Ai, Zhihui, E-mail: jennifer.ai@mail.ccnu.edu.cn; Zhang, Lizhi

    2017-01-30

    Highlights: • Bimetallic iron-nickel nanoparticles possessed an enhanced performance on aerobic degradation of 4-CP. • Hydroxyl radicals were the major active species contributed to aerobic 4-CP degradation with nZVI. • Superoxide radicals predominated the 4-CP degradation in the nZVIN/Air process. • The 4-CP degradation pathways were dependent on the generated superoxide radicals in the nZVIN/Air process. - Abstract: In this study, we demonstrate that the bimetallic iron-nickel nanoparticles (nZVIN) possessed an enhanced performance in comparison with nanoscale zero-valent iron (nZVI) on aerobic degradation of 4-chlorophenol (4-CP). The 4-CP degradation rate constant in the aerobic nZVIN process (nZVIN/Air) was 5 times that in the classic nZVI counterpart system (nZVI/Air). Both reactive oxygen species measurement and inhibition experimental results suggested that hydroxyl radicals were the major active species contributed to aerobic 4-CP degradation with nZVI, on contrast, superoxide radicals predominated the 4-CP degradation in the nZVIN/Air process. High performance liquid chromatography and gas chromatography-mass spectrometer analysis indicated the intermediates of the nZVI/Air system were p-benzoquinone and hydroquinone, which were resulted from the bond cleavage between the chlorine and carbon atom in the benzene ring by hydroxyl radicals. However, the primary intermediates of 4-CP found in the nZVIN/Air system were phenol via the direct dechlorination by superoxide radicals, accompanying with the formation of chloride ions. On the base of experimental results, a superoxide radicals mediated enhancing mechanism was proposed for the aerobic degradation of 4-CP in the nZVIN/Air system. This study provides new insight into the role of bimetallic nickel on enhancing removal of organic pollutants with nZVI.

  3. L-Threonine-derived novel bifunctional phosphine-sulfonamide catalyst-promoted enantioselective aza-morita-Baylis-Hillman reaction

    KAUST Repository

    Zhong, Fangrui

    2011-03-18

    A series of novel bifunctional phosphine-sulfonamide organic catalysts were designed and readily prepared from natural amino acids, and they were utilized to promote enantioselective aza-Morita-Baylis-Hillman (MBH) reactions. l-Threonine-derived phosphine-sulfonamide 9b was found to be the most efficient catalyst, affording the desired aza-MBH adducts in high yields and with excellent enantioselectivities. © 2011 American Chemical Society.

  4. Macrophage-derived microvesicles promote proliferation and migration of Schwann cell on peripheral nerve repair

    Energy Technology Data Exchange (ETDEWEB)

    Zhan, Chuan, E-mail: zhchuansy@163.com; Ma, Cheng-bin; Yuan, Hong-mou; Cao, Bao-yuan; Zhu, Jia-jun

    2015-12-04

    Background: Macrophages have been implicated in peripheral nerve regeneration. However, whether macrophages-derived microvesicles (MVs) are involved in this process remains unknown. In the present study, the effects of macrophages-derived MVs on proliferation and migration of Schwann cells (SCs) were evaluated in both in vitro and in vivo. Methods: Human monocytic leukaemia cell line (THP-1) was successfully driven to M1 and M2 phenotypes by delivery of either IFN-γ or IL-4, respectively. SCs incubated with M1 or M2 macrophages-derived MVs, the cell migration and proliferation were assessed, and expression levels of nerve growth factor (NGF) and Laminin were measured. A rat model of sciatic nerve was established and the effects of macrophages-derived MVs on nerve regeneration were investigated. Results: M2-derived MVs elevated migration, proliferation, NFG and Laminin protein levels of SCs compared with M1-or M0-derived MVs. The relative expression levels of miR-223 were also increased in M2 macrophages and M2-derived MVs. Transfected M2 macrophages with miR-223 inhibitor then co-incubated with SCs, an inhibition of cell migration and proliferation and a down-regulated levels of NFG and Laminin protein expression were observed. In vivo, M2-derived MVs significantly increased the infiltration and axon number of SCs. Conclusion: M2-derived MVs promoted proliferation and migration of SCs in vitro and in vivo, which provided a therapeutic strategy for nerve regeneration. - Highlights: • M2 macrophages-derived MVs elevated migration and proliferation of SCs. • M2 macrophages-derived MVs up-regulated NFG and Laminin expression of SCs. • MiR-223 expression was increased in M2 macrophages-derived MVs. • MiR-223 inhibitor reduced migration and proliferation of SCs co-incubated with MVs. • MiR-223 inhibitor down-regulated NFG and Laminin levels of SCs co-incubated with MVs.

  5. A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

    International Nuclear Information System (INIS)

    Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A.; Delgado, F.; Alcaraz, Y.; FRobles, J.; Martinez A, M.

    2014-01-01

    An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, 1 H NMR and 13 C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

  6. A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)

    2014-10-01

    An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

  7. Alginate-Derived Oligosaccharide Inhibits Neuroinflammation and Promotes Microglial Phagocytosis of β-Amyloid

    Directory of Open Access Journals (Sweden)

    Rui Zhou

    2015-09-01

    Full Text Available Alginate from marine brown algae has been widely applied in biotechnology. In this work, the effects of alginate-derived oligosaccharide (AdO on lipopolysaccharide (LPS/β-amyloid (Aβ-induced neuroinflammation and microglial phagocytosis of Aβ were studied. We found that pretreatment of BV2 microglia with AdO prior to LPS/Aβ stimulation led to a significant inhibition of production of nitric oxide (NO and prostaglandin E2 (PGE2, expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 and secretion of proinflammatory cytokines. We further demonstrated that AdO remarkably attenuated the LPS-activated overexpression of toll-like receptor 4 (TLR4 and nuclear factor (NF-κB in BV2 cells. In addition to the impressive inhibitory effect on neuroinflammation, we also found that AdO promoted the phagocytosis of Aβ through its interaction with TLR4 in microglia. Our results suggested that AdO exerted the inhibitory effect on neuroinflammation and the promotion effect on microglial phagocytosis, indicating its potential as a nutraceutical or therapeutic agent for neurodegenerative diseases, particularly Alzheimer’s disease (AD.

  8. Neuron-derived orphan receptor 1 promoted human pulmonary artery smooth muscle cells proliferation.

    Science.gov (United States)

    Wang, Chang-Guo; Lei, Wei; Li, Chang; Zeng, Da-Xiong; Huang, Jian-An

    2015-05-01

    As a transcription factor of the nuclear receptor superfamily, neuron-derived orphan receptor 1 (NOR1) is induced rapidly in response to various extracellular stimuli. But, it is still unclear its role in pulmonary artery smooth muscle cells proliferation. Human PASMCs were cultured in vitro and stimulated by serum. The special antisense oligodeoxynucleotides (AS-ODNs) were used to knockdown human NOR1 gene expression. Real-time PCR and Western-blot were used to evaluate the gene expression and protein levels. Fetal bovine serum (FBS) induced human PASMCs proliferation in a dose dependent manner. Furthermore, FBS promoted NOR1 gene expression in a dose dependent manner and a time dependent manner. 10% FBS induced a maximal NOR1 mRNA levels at 2 h. FBS also induced a significant higher NOR1 protein levels as compared with control. The NOR1 over-expressed plasmid significantly promoted DNA synthesis and cells proliferation. Moreover, the special AS-ODNs against human NOR1 not only prevented NOR1 expression but also inhibited DNA synthesis and cells proliferation significantly. The NOR1 over-expression plasmid could up-regulate cyclin D1 expression markedly, but the AS-ODNs inhibited cyclin D1 expression significantly. So, we concluded that NOR1 could promote human PASMCs proliferation. Cyclin D1 might be involved in this process.

  9. Corneal wound healing promoted by 3 blood derivatives: an in vitro and in vivo comparative study.

    Science.gov (United States)

    Freire, Vanesa; Andollo, Noelia; Etxebarria, Jaime; Hernáez-Moya, Raquel; Durán, Juan A; Morales, María-Celia

    2014-06-01

    The aim of this study was to compare the effect on corneal wound healing of 3 differently manufactured blood derivatives [autologous serum (AS), platelet-rich plasma, and serum derived from plasma rich in growth factors (s-PRGF)]. Scratch wound-healing assays were performed on rabbit primary corneal epithelial cultures and human corneal epithelial cells. Additionally, mechanical debridement of rabbit corneal epithelium was performed. Wound-healing progression was assessed by measuring the denuded areas remaining over time after treatment with each of the 3 blood derivatives or a control treatment. In vitro data show statistically significant differences in the healing process with all the derivatives compared with the control, but 2 of them (AS and s-PRGF) induced markedly faster wound healing. In contrast, although the mean time required to complete in vivo reepithelization was similar to that of AS and s-PRGF treatment, only wounds treated with s-PRGF were significantly smaller in size from 2.5 days onward with respect to the control treatment. All 3 blood derivatives studied are promoters of corneal reepithelization. However, the corneal wound-healing progresses differently with each derivative, being faster in vitro under AS and s-PRGF treatment and producing in vivo the greatest decrease in wound size under s-PRGF treatment. These findings highlight that the manufacturing process of the blood derivatives may modulate the efficacy of the final product.

  10. Physical and biological parameters that determine the fate of p-chlorophenol in laboratory test systems

    International Nuclear Information System (INIS)

    Pritchard, P.H.; O'Neill, E.J.; Spain, C.M.; Ahearn, D.G.

    1987-01-01

    Shake-flask and microcosm studies were conducted to determine the fate of para-chlorophenol (p-CP) in water and sediment systems and the role of sediment and nonsediment surfaces in the biodegradation process. Biodegradation of p-CP in estuarine water samples in shake flasks was slow over incubation periods of 300 h. The addition of detrital sediment resulted in immediate and rapid degradation evidence by the production of 14 CO 2 from [ 14 C]p-CP. The addition of sterile sediment, glass beads, or sand resulted in approximately four to six times more CO 2 evolution than observed in the water alone. Densities of p-CP-degrading bacteria associated with the detrital sediment were 100 times greater than those enumerated in water. Bacteria in the water and associated with the sediment after preexposure of both water and sediment of p-CP demonstrated enhanced biodegradation. In some microcosms, p-CP was degraded completely in the top 1.0 cm of intact sediment beds. Sediment reworking activities by benthic invertebrates from one site were sufficient to mix p-CP deep into the sediment bed faster than biodegradation or molecular diffusion. p-CP was persistent at lower depths of the sediment, possibly a result of reduced oxygen conditions preventing aerobic biodegradation

  11. Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs.

    Science.gov (United States)

    Chen, Ming; Xu, Piao; Zeng, Guangming; Yang, Chunping; Huang, Danlian; Zhang, Jiachao

    2015-11-01

    Increasing soil pollution problems have caused world-wide concerns. Large numbers of contaminants such as polycyclic aromatic hydrocarbons (PAHs), petroleum and related products, pesticides, chlorophenols and heavy metals enter the soil, posing a huge threat to human health and natural ecosystem. Chemical and physical technologies for soil remediation are either incompetent or too costly. Composting or compost addition can simultaneously increase soil organic matter content and soil fertility besides bioremediation, and thus is believed to be one of the most cost-effective methods for soil remediation. This paper reviews the application of composting/compost for soil bioremediation, and further provides a critical view on the effects of this technology on microbial aspects in contaminated soils. This review also discusses the future research needs for contaminated soils. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Predicting adsorptive removal of chlorophenol from aqueous solution using artificial intelligence based modeling approaches.

    Science.gov (United States)

    Singh, Kunwar P; Gupta, Shikha; Ojha, Priyanka; Rai, Premanjali

    2013-04-01

    The research aims to develop artificial intelligence (AI)-based model to predict the adsorptive removal of 2-chlorophenol (CP) in aqueous solution by coconut shell carbon (CSC) using four operational variables (pH of solution, adsorbate concentration, temperature, and contact time), and to investigate their effects on the adsorption process. Accordingly, based on a factorial design, 640 batch experiments were conducted. Nonlinearities in experimental data were checked using Brock-Dechert-Scheimkman (BDS) statistics. Five nonlinear models were constructed to predict the adsorptive removal of CP in aqueous solution by CSC using four variables as input. Performances of the constructed models were evaluated and compared using statistical criteria. BDS statistics revealed strong nonlinearity in experimental data. Performance of all the models constructed here was satisfactory. Radial basis function network (RBFN) and multilayer perceptron network (MLPN) models performed better than generalized regression neural network, support vector machines, and gene expression programming models. Sensitivity analysis revealed that the contact time had highest effect on adsorption followed by the solution pH, temperature, and CP concentration. The study concluded that all the models constructed here were capable of capturing the nonlinearity in data. A better generalization and predictive performance of RBFN and MLPN models suggested that these can be used to predict the adsorption of CP in aqueous solution using CSC.

  13. Reduction of saliva-promoted adhesion of Streptococcus mutans MT8148 and dental biofilm development by tragacanth gum and yeast-derived phosphomannan.

    Science.gov (United States)

    Shimotoyodome, A; Kobayashi, H; Nakamura, J; Tokimitsu, I; Hase, T; Inoue, T; Matsukubo, T; Takaesu, Y

    2006-01-01

    The aim of this study was to investigate materials which reduce saliva-promoted adhesion of Streptococcus mutans onto enamel surfaces, and their potential in preventing dental biofilm development. The effects of hydroxyapatite (HA) surface pretreatment with hydrophilic polysaccharides on saliva-promoted S. mutans adhesion in vitro and de novo dental biofilm deposition in vivo were examined. Saliva-promoted adhesion of S. mutans MT8148 was significantly reduced by pretreatment of the HA surface with tragacanth gum (TG) and yeast-derived phosphoglycans. Extracellular phosphomannan (PM) from Pichia capsulata NRRL Y-1842 and TG reduced biofilm development on lower incisors in plaque-susceptible rats when administered via drinking water at concentrations of 0.5% and 0.01%, respectively. The inhibitory effect of TG on de novo dental biofilm formation was also demonstrated when administered via mouthwash in humans. It is concluded that TG and yeast-derived PM have the potential for use as anti-adherent agents and are effective in reducing de novo dental biofilm formation.

  14. PEDF-derived peptide promotes skeletal muscle regeneration through its mitogenic effect on muscle progenitor cells.

    Science.gov (United States)

    Ho, Tsung-Chuan; Chiang, Yi-Pin; Chuang, Chih-Kuang; Chen, Show-Li; Hsieh, Jui-Wen; Lan, Yu-Wen; Tsao, Yeou-Ping

    2015-08-01

    In response injury, intrinsic repair mechanisms are activated in skeletal muscle to replace the damaged muscle fibers with new muscle fibers. The regeneration process starts with the proliferation of satellite cells to give rise to myoblasts, which subsequently differentiate terminally into myofibers. Here, we investigated the promotion effect of pigment epithelial-derived factor (PEDF) on muscle regeneration. We report that PEDF and a synthetic PEDF-derived short peptide (PSP; residues Ser(93)-Leu(112)) induce satellite cell proliferation in vitro and promote muscle regeneration in vivo. Extensively, soleus muscle necrosis was induced in rats by bupivacaine, and an injectable alginate gel was used to release the PSP in the injured muscle. PSP delivery was found to stimulate satellite cell proliferation in damaged muscle and enhance the growth of regenerating myofibers, with complete regeneration of normal muscle mass by 2 wk. In cell culture, PEDF/PSP stimulated C2C12 myoblast proliferation, together with a rise in cyclin D1 expression. PEDF induced the phosphorylation of ERK1/2, Akt, and STAT3 in C2C12 myoblasts. Blocking the activity of ERK, Akt, or STAT3 with pharmacological inhibitors attenuated the effects of PEDF/PSP on the induction of C2C12 cell proliferation and cyclin D1 expression. Moreover, 5-bromo-2'-deoxyuridine pulse-labeling demonstrated that PEDF/PSP stimulated primary rat satellite cell proliferation in myofibers in vitro. In summary, we report for the first time that PSP is capable of promoting the regeneration of skeletal muscle. The signaling mechanism involves the ERK, AKT, and STAT3 pathways. These results show the potential utility of this PEDF peptide for muscle regeneration. Copyright © 2015 the American Physiological Society.

  15. Salt-inducible promoter derivable from a lactic acid bacterium, and its use in a lactic acid bacterium for production of a desired protein

    NARCIS (Netherlands)

    Sanders, Jan Willem; Kok, Jan; Venema, Gerard; Ledeboer, Adrianus Marinus

    1998-01-01

    The invention provides a salt-inducible promoter present in SEQ ID NO: 10 and derivable from a lactic acid bacterium in isolation from the coding sequence normally controlled by said promoter in a wild-type lactic acid bacterium, with modifications and important parts thereof. Also provided are a

  16. Enhanced fluorescence detection of dansyl derivatives of phenolic compounds using a postcolumn photochemical reactor and application to chlorophenols in river water

    Energy Technology Data Exchange (ETDEWEB)

    de Ruiter, C.; Bohle, J.F.; de Jong, G.J.; Brinkman, U.A.T.; Frei, R.W.

    1988-04-01

    Photochemical decomposition by ultraviolet (UV) irradiation of dansyl derivatives of phenolic compounds in methanol-water mixtures leads to the formation of highly fluorescent dansyl-OH and dansyl-OCH/sub 3/. With substituted phenols as model compounds, it is demonstrated that inductive effects, caused by the substituents, play a major role in the gain in fluorescence signal (up to 8000-fold) that is obtained after postcolumn UV irradiation of the dansyl derivative, compared to that of the nonirradiated derivative. The optimal irradiation time for the dansyl derivatives is about 5.5 s. All monosubstituted phenolic dansyl derivatives now have a comparable limit of detection of approximately 200 pg (S/N = 3). The calibration curve of dansylated pentachlorophenol, using the postcolumn photochemical reactor under optimal conditions, is linear over at least 3 orders of magnitude with a correlation coefficient of 0.9999 (n = 9). Application of the system to the liquid chromatographic determination of highly chlorinated phenols in river water is presented. The repeatability of the system for a river water sample, spiked with 1 ppb pentachlorophenol, is 2.4% relative standard deviation (n = 5).

  17. Endothelial cell-derived matrix promotes the metabolic functional maturation of hepatocyte via integrin-Src signalling.

    Science.gov (United States)

    Guo, Xinyue; Li, Weihong; Ma, Minghui; Lu, Xin; Zhang, Haiyan

    2017-11-01

    The extracellular matrix (ECM) microenvironment is involved in the regulation of hepatocyte phenotype and function. Recently, the cell-derived extracellular matrix has been proposed to represent the bioactive and biocompatible materials of the native ECM. Here, we show that the endothelial cell-derived matrix (EC matrix) promotes the metabolic maturation of human adipose stem cell-derived hepatocyte-like cells (hASC-HLCs) through the activation of the transcription factor forkhead box protein A2 (FOXA2) and the nuclear receptors hepatocyte nuclear factor 4 alpha (HNF4α) and pregnane X receptor (PXR). Reducing the fibronectin content in the EC matrix or silencing the expression of α5 integrin in the hASC-HLCs inhibited the effect of the EC matrix on Src phosphorylation and hepatocyte maturation. The inhibition of Src phosphorylation using the inhibitor PP2 or silencing the expression of Src in hASC-HLCs also attenuated the up-regulation of the metabolic function of hASC-HLCs in a nuclear receptor-dependent manner. These data elucidate integrin-Src signalling linking the extrinsic EC matrix signals and metabolic functional maturation of hepatocyte. This study provides a model for studying the interaction between hepatocytes and non-parenchymal cell-derived matrix. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  18. Photocatalytic activity of V doped ZnO nanoparticles thin films for the removal of 2- chlorophenol from the aquatic environment under natural sunlight exposure.

    Science.gov (United States)

    Salah, Numan; Hameed, A; Aslam, M; Babkair, Saeed S; Bahabri, F S

    2016-07-15

    Vanadium doped ZnO powders were used as precursors to deposit thin films of V(5+) incorporated ZnO nanoparticles on glass substrates by the pulsed laser deposition technique. The observed variations in Raman signals, visible region shift in the diffuse reflectance spectra along with a small shift in the (101) reflections of the X-ray diffraction (XRD) confirmed the insertion of V(5+) ions in ZnO lattice. No other additional reflection in the XRD results other than ZnO further endorsed the occupation of lattice positions by V entities rather than independent oxide formation. The asymmetric XPS peaks of Zn2p and V2p core levels confirmed the existence of both in the vicinity. The existence of minimal proportion of V(3+) along with V(5+) states varied the alteration of the oxidation states V in the synthetic route. The SEM images at various resolutions displayed the uniform distribution identical nanoparticles without the presence of additional phases in the deposited films. The SEM cross-section measurements revealed the uniform thickness of ∼90 nm of each film, whereas the surface studies of the films were performed by AFM. The as-synthesized films were tested for photocatalytic activity in sunlight illumination for the removal of 2-chlorophenol. The unique feature of the study was the estimation of the photocatalytic activity 20 ppm of 2-chlorophenol by exposing the low exposed area. The degradation of the substrate was measured by liquid phase UV-vis spectroscopy, whereas total organic carbon measurement revealed the mineralization of the substrate. The released Cl(-) ions were also measured by ion chromatography. The estimated flatband potentials and pHzpc values of the V doped materials, by Mott-Schottky analysis and zeta potential measurements respectively, were correlated with the photocatalytic activity. The kinetics of the photocatalytic degradation/mineralization process was estimated and results were correlated with the plausible mechanism. Copyright

  19. Platelets promote osteosarcoma cell growth through activation of the platelet-derived growth factor receptor-Akt signaling axis

    OpenAIRE

    Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-hara, Tomoko; Fujita, Naoya

    2014-01-01

    The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the pro...

  20. Gelatin-Derived Graphene–Silicate Hybrid Materials Are Biocompatible and Synergistically Promote BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells

    Energy Technology Data Exchange (ETDEWEB)

    Zou, Yulong [Department of Orthopaedic; Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Qazvini, Nader Taheri [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Zane, Kylie [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Sadati, Monirosadat [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Wei, Qiang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Liao, Junyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Fan, Jiaming [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Song, Dongzhe [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department of Conservative Dentistry and Endodontics, West China School of Stomatology, Sichuan University, Chengdu 610041, China; Liu, Jianxiang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; amp, Technology, Wuhan 430022, China; Ma, Chao [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Departments of Neurosurgery and Otolaryngology-Head; amp, Neck Surgery, The Affiliated Zhongnan Hospital of Wuhan University, Wuhan 430071, China; Qu, Xiangyang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Chen, Liqun [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Yu, Xinyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Zhicai [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; amp, Technology, Wuhan 430022, China; Zhao, Chen [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zeng, Zongyue [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Ruyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Yan, Shujuan [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Wu, Tingting [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Departments of Neurosurgery and Otolaryngology-Head; amp, Neck Surgery, The Affiliated Zhongnan Hospital of Wuhan University, Wuhan 430071, China; Wu, Xingye [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Shu, Yi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Li, Yasha [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Wenwen [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; Reid, Russell R. [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department of Surgery, Section of Plastic; Lee, Michael J. [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Wolf, Jennifer Moritis [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Tirrell, Matthew [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; He, Tong-Chuan [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; de Pablo, Juan J. [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Deng, Zhong-Liang [Department of Orthopaedic

    2017-05-04

    Graphene-based materials are used in many fields but have found only limited applications in biomedicine, including bone tissue engineering. Here, we demonstrate that novel hybrid materials consisting of gelatin-derived graphene and silicate nanosheets of Laponite (GL) are biocompatible and promote osteogenic differentiation of mesenchymal stem cells (MSCs). Homogeneous cell attachment, long-term proliferation, and osteogenic differentiation of MSCs on a GL-scaffold were confirmed using optical microscopy and scanning electron microscopy. GL-powders made by pulverizing the GL-scaffold were shown to promote bone morphogenetic protein (BMP9)-induced osteogenic differentiation. GL-powders increased the alkaline phosphatase (ALP) activity in immortalized mouse embryonic fibroblasts but decreased the ALP activity in more-differentiated immortalized mouse adipose-derived cells. Note, however, that GL-powders promoted BMP9-induced calcium mineral deposits in both MSC lines, as assessed using qualitative and quantitative alizarin red assays. Furthermore, the expression of chondro-osteogenic regulator markers such as Runx2, Sox9, osteopontin, and osteocalcin was upregulated by the GL-powder, independent of BMP9 stimulation; although the powder synergistically upregulated the BMP9-induced Osterix expression, the adipogenic marker PPAR gamma was unaffected. Furthermore, in vivo stem cell implantation experiments demonstrated that GL-powder could significantly enhance the BMP9-induced ectopic bone formation from MSCs. Collectively, our results strongly suggest that the GL hybrid materials promote BMP9-induced osteogenic differentiation of MSCs and hold promise for the development of bone tissue engineering platforms.

  1. Effect of operational factors on bioregeneration of binary phenol and 4-chlorophenol-loaded granular activated carbon using PVA-immobilized biomass cryogels.

    Science.gov (United States)

    Leong, Kwok-Yii; Adnan, Rohana; Lim, Poh-Eng; Ng, Si-Ling; Seng, Chye-Eng

    2017-09-01

    The effects of dry biomass density in cryogel beads, shaking speed and initial concentration ratio of phenol to 4-chlorophenol (4-CP) on the bioregeneration efficiencies of binary phenol and 4-CP-loaded granular activated carbon (GAC) for phenol and 4-CP, respectively, were investigated under the simultaneous adsorption and biodegradation approach. The results revealed higher bioregeneration efficiencies of binary-loaded GAC for phenol and 4-CP at higher dry biomass density but moderate shaking speed. The optimum dry biomass density in cryogel beads and shaking speed for use in bioregeneration were found to be 0.01 g/mL and 250 rpm, respectively. With respect to the initial phenol to 4-CP concentration ratio, the bioregeneration efficiencies were lower under increasing phenol and 4-CP initial concentrations, respectively, with the effect being more conspicuous under increasing 4-CP concentration. Higher bioregeneration efficiencies were achieved with the use of immobilized rather than suspended biomasses.

  2. Sorption performance and mechanism of a sludge-derived char as porous carbon-based hybrid adsorbent for benzene derivatives in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Kong, Lingjun [School of Environmental Science and Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Xiong, Ya, E-mail: cesxya@mail.sysu.edu.cn [School of Environmental Science and Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou, 510275 (China); Sun, Lianpeng; Tian, Shuanghong [School of Environmental Science and Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou, 510275 (China); Xu, Xianyan; Zhao, Cunyuan [School of Chemistry and Chemical Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Luo, Rongshu [School of Environmental Science and Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Yang, Xin [School of Environmental Science and Engineering, Sun Yat-Sen (Zhongshan) University, Guangzhou, 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou, 510275 (China); Shih, Kaimin [Department of Civil Engineering, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); Liu, Haiyang [Department of Chemistry, South China University of Technology, Guangzhou, 510641 (China)

    2014-06-01

    Highlights: • Hierarchical porous sludge char were fabricated by pyrolysis at 500 °C. • A stronger Si–O bond (1.83 Å and 1.87 Å) between the carboxyl and SiO{sub 2} was found. • Quantum chemistry calculation confirmed the interaction of Si–O and H–O bonds. • Multiple model (Q{sub T} = Q{sub A} + K{sub P}Ce) was presented in the sludge char sorption process. - Abstract: A porous sludge-derived char was prepared by a new one-step pyrolytic process with citric acid–ZnCl{sub 2} mixed fabricating-pore agents. The sludge-derived char was confirmed to be a hierarchically porous hybrid adsorbent containing-elemental carbon, -highly carbonized organic species and -inorganic ash with a great surface area of 792.4 m{sup 2} g{sup −1}. It was used as a carbon-based hybrid adsorbent for four benzene derivatives including 4-chlorophenol, phenol, benzoic acid and 4-hydroxylbenzoic acid in aqueous solution. Results showed that their sorption isotherms were nonlinear at low concentrations and linear at high concentrations. The sorption performance could be described by a multiple sorption model (Q{sub T} = Q{sub A} + K{sub P}C{sub e}). The order of these partition sorption coefficients (K{sub P}) of these benzene derivatives was consistent with their octanol–water partition coefficients (log K{sub ow}), but those saturated amounts (Q{sub A}) were inconsistent with their log K{sub ow}. The inconstancy was found to be considerably dependent on the preferential interaction of benzoic acid with SiO{sub 2} in the sludge-derived char. Quantum theoretical calculation confirmed that the preferential interaction was attributed to the formation of hydrogen bonds (1.61 and 1.69 Å) and new Si–O bonds (1.83 and 1.87 Å) between the carboxyl of benzoic acid and the SiO{sub 2} surface in the sorption process.

  3. Gold nanoparticles promote osteogenic differentiation in human adipose-derived mesenchymal stem cells through the Wnt/β-catenin signaling pathway

    Directory of Open Access Journals (Sweden)

    Choi SY

    2015-07-01

    Full Text Available Seon Young Choi,1 Min Seok Song,1 Pan Dong Ryu,1 Anh Thu Ngoc Lam,2 Sang-Woo Joo,2 So Yeong Lee1 1Laboratory of Veterinary Pharmacology, Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, 2Department of Chemistry, Soongsil University, Seoul, South Korea Abstract: Gold nanoparticles (AuNPs are attractive materials for use in biomedicine due to their physical properties. Increasing evidence suggests that several nanoparticles induce the differentiation of human mesenchymal stem cells into osteoblasts and adipocytes. In this study, we hypothesized that chitosan-conjugated AuNPs promote the osteogenic differentiation of human adipose-derived mesenchymal stem cells. For the evaluation of osteogenic differentiation, alizarin red staining, an alamarBlue® assay, and a quantitative real-time polymerase chain reaction analysis were performed. In order to examine specific signaling pathways, immunofluorescence and a western blotting assay were performed. Our results demonstrate that chitosan-conjugated AuNPs increase the deposition of calcium content and the expression of marker genes related to osteogenic differentiation in human adipose-derived mesenchymal stem cells at nontoxic concentrations. These results indicate that chitosan-conjugated AuNPs promote osteogenesis through the Wnt/β-catenin signaling pathway. Therefore, chitosan-conjugated AuNPs can be used as a reagent for promoting bone formation. Keywords: chitosan-conjugated gold nanoparticle, mineralization, nonphosphorylated beta-catenin

  4. Exosomes Derived from Human Bone Marrow Mesenchymal Stem Cells Promote Tumor Growth Through Hedgehog Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Jin Qi

    2017-08-01

    Full Text Available Background/Aims: Mesenchymal stem/stromal cells (MSCs are known to home to sites of tumor microenvironments where they participate in the formation of the tumor microenvironment and to interplay with tumor cells. However, the potential functional effects of MSCs on tumor cell growth are controversial. Here, we, from the view of bone marrow MSC-derived exosomes, study the molecular mechanism of MSCs on the growth of human osteosarcoma and human gastric cancer cells. Methods: MSCs derived from human bone marrow (hBMSCs were isolated and cultured in complete DMEM/F12 supplemented with 10% exosome-depleted fetal bovine serum and 1% penicillin-streptomycin, cell culture supernatants containing exosomes were harvested and exosome purification was performed by ultracentrifugation. Osteosarcoma (MG63 and gastric cancer (SGC7901 cells, respectively, were treated with hBMSC-derived exosomes in the presence or absence of a small molecule inhibitor of Hedgehog pathway. Cell viability was measured by transwell invasion assay, scratch migration assay and CCK-8 test. The expression of the signaling molecules Smoothened, Patched-1, Gli1 and the ligand Shh were tested by western blot and RT-PCR. Results: In this study, we found that hBMSC-derived exosomes promoted MG63 and SGC7901 cell growth through the activation of Hedgehog signaling pathway. Inhibition of Hedgehog signaling pathway significantly suppressed the process of hBMSC-derived exosomes on tumor growth. Conclusion: Our findings demonstrated the new roles of hedgehog signaling pathway in the hBMSCs-derived exosomes induced tumor progression.

  5. Natural Hematite and Siderite as Heterogeneous Catalysts for an Effective Degradation of 4-Chlorophenol via Photo-Fenton Process

    Directory of Open Access Journals (Sweden)

    Haithem Bel Hadjltaief

    2018-06-01

    Full Text Available This paper describes a simple and low-cost process for the degradation of 4-Chlorophenol (4-CP from aqueous solution, using natural Tunisian Hematite (M1 and Siderite (M2. Two natural samples were collected in the outcroppings of the Djerissa mining site (Kef district, northwestern Tunisia. Both Hematite and Siderite ferrous samples were characterized using several techniques, including X-Ray Diffraction (XRD, Nitrogen Physisorption (BET, Infrared Spectroscopy (FTIR, H2-Temperature Programmed Reduction (H2-TPR, Scanning Electronic Microscopy (SEM linked with Energy Dispersive X-ray (EDS and High-Resolution Transmission Electron Microscopy (HRTEM. Textural, structural and chemical characterization confirmed the presence of Hematite and Siderite phases with a high amount of iron on the both surface materials. Their activity was evaluated in the oxidation of 4-CP in aqueous medium under heterogeneous photo-Fenton process. Siderite exhibited higher photocatalytic oxidation activity than Hematite at pH 3. The experimental results also showed that 100% conversion of 4-CP and 54% TOC removal can be achieved using Siderite as catalyst. Negligible metal leaching and catalyst reutilization without any loss of activity point towards an excellent catalytic stability for both natural catalysts.

  6. Enzymatic removal of phenol and p-chlorophenol in enzyme reactor: Horseradish peroxidase immobilized on magnetic beads

    International Nuclear Information System (INIS)

    Bayramoglu, Guelay; Arica, M. Yakup

    2008-01-01

    Horseradish peroxidase was immobilized on the magnetic poly(glycidylmethacrylate-co-methylmethacrylate) (poly(GMA-MMA)), via covalent bonding and used for the treatment of phenolic wastewater in continuous systems. For this purposes, horseradish peroxidase (HRP) was covalently immobilized onto magnetic poly(GMA-MMA) beds using glutaraldehyde (GA) as a coupling agent. The maximum HRP immobilization capacity of the magnetic poly(GMA-MMA)-GA beads was 3.35 mg g -1 . The immobilized HRP retained 79% of the activity of the free HRP used for immobilization. The immobilized HRP was used for the removal of phenol and p-chlorophenol via polymerization of dissolved phenols in the presence of hydrogen peroxide (H 2 O 2 ). The effect of pH and temperature on the phenol oxidation rate was investigated. The results were compared with the free HRP, which showed that the optimum pH value for the immobilized HRP is similar to that for the free HRP. The optimum pH value for free and immobilized HRP was observed at pH 7.0. The optimum temperature for phenols oxidation with immobilized HRP was between 25 and 35 deg. C and the immobilized HRP has more resistance to temperature inactivation than that of the free form. Finally, the immobilized HRP was operated in a magnetically stabilized fluidized bed reactor, and phenols were successfully removed in the enzyme reactor

  7. Molecular structure effects in photodegradation of phenol and its chlorinated derivatives with phthalocyanines

    Czech Academy of Sciences Publication Activity Database

    Klusoň, P.; Drobek, M.; Krejčíková, S.; Krýsa, J.; Kalaji, A.; Cajthaml, Tomáš; Rakušan, J.

    2008-01-01

    Roč. 80, 3-4 (2008), s. 321-326 ISSN 0926-3373 R&D Projects: GA AV ČR KAN400720701 Grant - others:CZ(CZ) GD203/03/H140; Mšk(CZ) IM4531433201 Program:GD Institutional research plan: CEZ:AV0Z50200510 Keywords : phthalocyanines * phenol * chlorophenols Subject RIV: EE - Microbiology, Virology Impact factor: 4.853, year: 2008

  8. mPGES-1-derived prostaglandin E2 stimulates Stat3 to promote podocyte apoptosis.

    Science.gov (United States)

    Yu, Jing; Wu, Yimei; Wang, Lu; Zhang, Wen; Xu, Man; Song, Jiayu; Fu, Yu; Cui, Yiyun; Gong, Wei; Li, Shuzhen; Xia, Weiwei; Huang, Songming; Zhang, Aihua; Jia, Zhanjun

    2017-11-01

    We previously reported that microsomal prostaglandin E synthase-1 (mPGES-1) contributed to adriamycin (Adr)-induced podocyte apoptosis. However, the molecular mechanism remains unclear. Here we studied the role of mPGES-1/PGE2 cascade in activating Stat3 signaling and the contribution of Stat3 in PGE2- and Adr-induced podocyte apoptosis. In murine podocytes, PGE2 dose- and time-dependently increased the phosphorylation of Stat3 in line with the enhanced cell apoptosis and reduced podocyte protein podocin. In agreement with the increased Stat3 phosphorylation, Stat3-derived cytokines including IL-6, IL-17, MCP-1, and ICAM-1 were significantly upregulated following PGE2 treatment. By application of a specific Stat3 inhibitor S3I-201, PGE2-induced podocyte apoptosis was largely abolished in parallel with a blockade of podocin reduction. Next, we observed that Adr treatment also enhanced p-Stat3 and activated mPGES-1/PGE2 cascade. Blockade of Stat3 by S3I-201 significantly ameliorated Adr-induced cell apoptosis and podocin reduction. More interestingly, silencing mPGES-1 in podocytes by mPGES-1 siRNA blocked Adr-induced increments of Stat-3 phosphorylation, PGE2 production, and Stat3-derived inflammatory cytokines. Taken together, this study suggested that mPGES-1-derived PGE2 could activate Stat3 signaling to promote podocyte apoptosis. Targeting mPGES-1/PGE2/Stat3 signaling might be a potential strategy for the treatment of podocytopathy.

  9. Surgical sutures filled with adipose-derived stem cells promote wound healing.

    Directory of Open Access Journals (Sweden)

    Ann Katharin Reckhenrich

    Full Text Available Delayed wound healing and scar formation are among the most frequent complications after surgical interventions. Although biodegradable surgical sutures present an excellent drug delivery opportunity, their primary function is tissue fixation. Mesenchymal stem cells (MSC act as trophic mediators and are successful in activating biomaterials. Here biodegradable sutures were filled with adipose-derived mesenchymal stem cells (ASC to provide a pro-regenerative environment at the injured site. Results showed that after filling, ASCs attach to the suture material, distribute equally throughout the filaments, and remain viable in the suture. Among a broad panel of cytokines, cell-filled sutures constantly release vascular endothelial growth factor to supernatants. Such conditioned media was evaluated in an in vitro wound healing assay and showed a significant decrease in the open wound area compared to controls. After suturing in an ex vivo wound model, cells remained in the suture and maintained their metabolic activity. Furthermore, cell-filled sutures can be cryopreserved without losing their viability. This study presents an innovative approach to equip surgical sutures with pro-regenerative features and allows the treatment and fixation of wounds in one step, therefore representing a promising tool to promote wound healing after injury.

  10. Xenobiotic organic compounds in wastewater

    DEFF Research Database (Denmark)

    Eriksson, Eva; Baun, Anders; Henze, Mogens

    2002-01-01

    hundred of XOCs, among them mainly originating from hygiene products: chlorophenols, detergents and phthalates. Several compounds not deriving from hygiene products were also identified e.g. flame-retardants and drugs. A environmental hazard identification showed that a large number of compounds with high...

  11. Adsorption of 4-chlorophenol from aqueous solutions by xad-4 resin: Isotherm, kinetic, and thermodynamic analysis

    International Nuclear Information System (INIS)

    Bilgili, M. Sinan

    2006-01-01

    Removal of 4-chlorophenol (4-CP) from synthetic aqueous solutions through adsorption on Amberlite XAD-4 resin, a non-ionic macroreticular resins, under batch equilibrium experimental conditions at 298, 308 and 318 K was investigated. It is necessary to propose a suitable model to a better understanding on the mechanism of 4-CP adsorption. For this purpose, Langmiur, Freundlich, Toth, and Redlich-Peterson (RP) isotherm models were compared. The two and three parameters in the adopted adsorption isotherm models were determined by the help of MATLAB package program. It was determined that best fitted adsorption isotherm models were obtained to be in the order: Redlich-Peterson > Langmuir > Toth > Freundlich isotherms. The pseudo-second-order kinetic model provided the best correlation to the experimental results. Results of the intra-particle diffusion model show that the pore diffusion is not the only rate limiting step. The lower correlation of the data to the Bangham's equation also represents that the diffusion of the adsorbate into pores of the sorbent is not the only rate-controlling step. The thermodynamic constants of adsorption phenomena; ΔG o , ΔH o , and ΔS o were found as -4.17 (at 298 K) kJ/mol, -42.01 kJ/mol, and -0.127 kJ/(mol K), respectively. The results showed that adsorption of 4-CP on Amberlite XAD-4, a nonionic polymeric resin was exothermic and spontaneous

  12. Oxidative degradation of phenols in sono-Fenton-like systems upon high-frequency ultrasound irradiation

    Science.gov (United States)

    Aseev, D. G.; Sizykh, M. R.; Batoeva, A. A.

    2017-12-01

    The kinetics of oxidative degradation of phenol and chlorophenols upon acoustic cavitation in the megahertz range (1.7 MHz) is studied experimentally in model systems, and the involvement of in situ generated reactive oxygen species (ROSs) is demonstrated. The phenols subjected to high frequency ultrasound (HFUS) are ranked in terms of their rate of conversion: 2,4,6-trichlorophenol > 2,4-dichlorophenol 2-chlorophenol > 4-chlorophenol phenol. Oxidative degradation upon HFUS irradiation is most efficient at low concentrations of pollutants, due to the low steady-state concentrations of the in situ generated ROSs. A dramatic increase is observed in the efficiency of oxidation in several sonochemical oxidative systems (HFUS in combination with other chemical oxidative factors). The system with added Fe2+ (a sono-Fenton system) derives its efficiency from hydrogen peroxide generated in situ as a result of the recombination of OH radicals. The S2O8 2-/Fe2+/HFUS system has a synergetic effect on substrate oxidation that is attributed to a radical chain mechanism. In terms of the oxidation rates, degrees of conversion, and specific energy efficiencies of 4-chlorophenol oxidation based on the amount of oxidized substance per unit of expended energy the considered sonochemical oxidative systems form the series HFUS < S2O8 2-/HFUS < S2O8 2-/Fe2+/HFUS.

  13. Cell-derived microparticles promote coagulation after moderate exercise.

    Science.gov (United States)

    Sossdorf, Maik; Otto, Gordon P; Claus, Ralf A; Gabriel, Holger H W; Lösche, Wolfgang

    2011-07-01

    Cell-derived procoagulant microparticles (MP) might be able to contribute to exercise-induced changes in blood hemostasis. This study aimed to examine (i) the concentration and procoagulant activity of cell-derived MP after a moderate endurance exercise and (ii) the differences in the release, clearance, and activity of MP before and after exercise between trained and untrained individuals. All subjects performed a single bout of physical exercise on a bicycle ergometer for 90 min at 80% of their individual anaerobic threshold. MP were identified and quantified by flow cytometry measurements. Procoagulant activity of MP was measured by a prothrombinase activity assay as well as tissue factor-induced fibrin formation in MP-containing plasma. At baseline, no differences were observed for the absolute number and procoagulant activities of MP between trained and untrained subjects. However, trained individuals had a lower number of tissue factor-positive monocyte-derived MP compared with untrained individuals. In trained subjects, exercise induced a significant increase in the number of MP derived from platelets, monocytes, and endothelial cells, with maximum values at 45 min after exercise and returned to basal levels at 2 h after exercise. Untrained subjects revealed a similar increase in platelet-derived MP, but their level was still increased at 2 h after exercise, indicating a reduced clearance compared with trained individuals. Procoagulant activities of MP were increased immediately after exercise and remained elevated up to 2 h after exercise. We conclude that increased levels of MP were found in healthy individuals after an acute bout of exercise, that the amount of circulating MP contributes to an exercise-induced increase of hemostatic potential, and that there were differences in kinetic and dynamic characteristics between trained and untrained individuals.

  14. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  15. Y{sub 2}O{sub 3} modified TiO{sub 2} nanosheets enhanced the photocatalytic removal of 4-chlorophenol and Cr (VI) in sun light

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Xiaona; Wu, Pei [Department of Physics and Key Laboratory of Artificial Micro-and Nano-structures of Ministry of Education, Wuhan University, Wuhan 430072 (China); Liu, Min [State Grid Zhejiang Electric Power Research Institute, Hangzhou, Zhejiang 310007 (China); Lu, Dingze [Department of Physics and Key Laboratory of Artificial Micro-and Nano-structures of Ministry of Education, Wuhan University, Wuhan 430072 (China); Ming, Junlan [State Grid Zhejiang Electric Power Research Institute, Hangzhou, Zhejiang 310007 (China); Li, Chunhe; Ding, Junqian; Yan, Qiuyang [Department of Physics and Key Laboratory of Artificial Micro-and Nano-structures of Ministry of Education, Wuhan University, Wuhan 430072 (China); Fang, Pengfei, E-mail: fangpf@whu.edu.cn [Department of Physics and Key Laboratory of Artificial Micro-and Nano-structures of Ministry of Education, Wuhan University, Wuhan 430072 (China)

    2017-07-15

    Highlights: • Y{sub 2}O{sub 3}@TNSswithsynergisticphotocatalyticactivitywerepreparedbyone-potmethod. • Y{sub 2}O{sub 3} loading resulted in the structure evolution of TNSs and content increment of Ti{sup 3+} ions. • Modification on TNSs led to an obvious red shift of the optical absorption edge. • Appropriate amount of Y{sub 2}O{sub 3} can effectively improve the separation efficiency of the h{sup +}/e{sup −} pairs. - Abstract: Y{sub 2}O{sub 3} modified TiO{sub 2} nanosheets (Y{sub 2}O{sub 3}@TNSs), capable of exhibiting sun light, were synthesized through one pot/hydrothermal method using Y (NO{sub 3}){sub 3} as precursor. Multiple techniques were applied to investigate the structures, morphologies, optical and electronic properties and photocatalytic performance of the as-prepared samples. The Y{sub 2}O{sub 3}@TNSs, with thickness of approximately 3–4 nm, large surface area of 240–350 m{sup 2}/g, were full of Y{sub 2}O{sub 3} nanoparticles highly dispersed on the surface. The introduction of Y{sub 2}O{sub 3} influenced the crystallinity and the structure evolution of TNSs, besides, improved the light absorption ability. The surface photo-current and fluorescence spectral studies revealed that the photo-generated charge carrier separation efficiency could be improved by an appropriate modification. The degradation activity of this sun-light-induced photocatalytic has enhanced apparently on 4-Chlorophenol and K{sub 2}Cr{sub 2}O{sub 7} solution, the degradation efficiency of 4-Chlorophenol reached 5.69 times than that of P25, and the maximum TOC removal obtained after 120 min was 67.6%, indicating that most organic compounds were released from the solution. The enhancement in the photocatalytic activity was attributed to the synergetic effect of the Y{sub 2}O{sub 3} and TNSs, which led to a fast separation and slow recombination of photo-induced electron-hole pairs. Consequently, the high efficiency in the experiments showed a promising application of

  16. Zinc Promotes Adipose-Derived Mesenchymal Stem Cell Proliferation and Differentiation towards a Neuronal Fate.

    Science.gov (United States)

    Moon, Mi-Young; Kim, Hyun Jung; Choi, Bo Young; Sohn, Min; Chung, Tae Nyoung; Suh, Sang Won

    2018-01-01

    Zinc is an essential element required for cell division, migration, and proliferation. Under zinc-deficient conditions, proliferation and differentiation of neural progenitors are significantly impaired. Adipose-derived mesenchymal stem cells (AD-MSCs) are multipotent stem cells that can differentiate into neurons. The aim of this study was to evaluate the effect of zinc on AD-MSC proliferation and differentiation. We initially examined the effect of zinc on stem cell proliferation at the undifferentiated stage. AD-MSCs showed high proliferation rates on day 6 in 30  μ M and 100  μ M of ZnCl 2 . Zinc chelation inhibited AD-MSC proliferation via downregulation of ERK1/2 activity. We then assessed whether zinc was involved in cell migration and neurite outgrowth during differentiation. After three days of neuronal differentiation, TUJ-1-positive cells were observed, implying that AD-MSCs had differentiated into early neuron or neuron-like cells. Neurite outgrowth was increased in the zinc-treated group, while the CaEDTA-treated group showed diminished, shrunken neurites. Furthermore, we showed that zinc promoted neurite outgrowth via the inactivation of RhoA and led to the induction of neuronal gene expression (MAP2 and nestin) in differentiated stem cells. Taken together, zinc promoted AD-MSC proliferation and affected neuronal differentiation, mainly by increasing neurite outgrowth.

  17. Zinc Promotes Adipose-Derived Mesenchymal Stem Cell Proliferation and Differentiation towards a Neuronal Fate

    Directory of Open Access Journals (Sweden)

    Mi-Young Moon

    2018-01-01

    Full Text Available Zinc is an essential element required for cell division, migration, and proliferation. Under zinc-deficient conditions, proliferation and differentiation of neural progenitors are significantly impaired. Adipose-derived mesenchymal stem cells (AD-MSCs are multipotent stem cells that can differentiate into neurons. The aim of this study was to evaluate the effect of zinc on AD-MSC proliferation and differentiation. We initially examined the effect of zinc on stem cell proliferation at the undifferentiated stage. AD-MSCs showed high proliferation rates on day 6 in 30 μM and 100 μM of ZnCl2. Zinc chelation inhibited AD-MSC proliferation via downregulation of ERK1/2 activity. We then assessed whether zinc was involved in cell migration and neurite outgrowth during differentiation. After three days of neuronal differentiation, TUJ-1-positive cells were observed, implying that AD-MSCs had differentiated into early neuron or neuron-like cells. Neurite outgrowth was increased in the zinc-treated group, while the CaEDTA-treated group showed diminished, shrunken neurites. Furthermore, we showed that zinc promoted neurite outgrowth via the inactivation of RhoA and led to the induction of neuronal gene expression (MAP2 and nestin in differentiated stem cells. Taken together, zinc promoted AD-MSC proliferation and affected neuronal differentiation, mainly by increasing neurite outgrowth.

  18. Egr-1 activation by cancer-derived extracellular vesicles promotes endothelial cell migration via ERK1/2 and JNK signaling pathways.

    Directory of Open Access Journals (Sweden)

    Yae Jin Yoon

    Full Text Available Various mammalian cells, including cancer cells, shed extracellular vesicles (EVs, also known as exosomes and microvesicles, into surrounding tissues. These EVs play roles in tumor growth and metastasis by promoting angiogenesis. However, the detailed mechanism of how cancer-derived EVs elicit endothelial cell activation remains unknown. Here, we provide evidence that early growth response-1 (Egr-1 activation in endothelial cells is involved in the angiogenic activity of colorectal cancer cell-derived EVs. Both RNA interference-mediated downregulation of Egr-1 and ERK1/2 or JNK inhibitor significantly blocked EV-mediated Egr-1 activation and endothelial cell migration. Furthermore, lipid raft-mediated endocytosis inhibitor effectively blocked endothelial Egr-1 activation and migration induced by cancer-derived EVs. Our results suggest that Egr-1 activation in endothelial cells may be a key mechanism involved in the angiogenic activity of cancer-derived EVs. These findings will improve our understanding regarding the proangiogenic activities of EVs in diverse pathological conditions including cancer, cardiovascular diseases, and neurodegenerative diseases.

  19. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  20. Catalytic decomposition of hydrogen peroxide and 4-chlorophenol in the presence of modified activated carbons.

    Science.gov (United States)

    Huang, Hsu-Hui; Lu, Ming-Chun; Chen, Jong-Nan; Lee, Cheng-Te

    2003-06-01

    The objective of this research was to examine the heterogeneous catalytic decomposition of H(2)O(2) and 4-chlorophenol (4-CP) in the presence of activated carbons modified with chemical pretreatments. The decomposition of H(2)O(2) was suppressed significantly by the change of surface properties including the decreased pH(pzc) modified with oxidizing agent and the reduced active sites occupied by the adsorption of 4-CP. The apparent reaction rate of H(2)O(2) decomposition was dominated by the intrinsic reaction rates on the surface of activated carbon rather than the mass transfer rate of H(2)O(2) to the solid surface. By the detection of chloride ion in suspension, the reduction of 4-CP was not only attributed to the advanced adsorption but also the degradation of 4-CP. The catalytic activity toward 4-CP for the activated carbon followed the inverse sequence of the activity toward H(2)O(2), suggesting that acidic surface functional group could retard the H(2)O(2) loss and reduce the effect of surface scavenging resulting in the increase of the 4-CP degradation efficiency. Few effective radicals were expected to react with 4-CP for the strong effect of surface scavenging, which could explain why the degradation rate of 4-CP observed in this study was so slow and the dechlorination efficiency was independent of the 4-CP concentration in aqueous phase. Results show that the combination of H(2)O(2) and granular activated carbon (GAC) did increase the total removal of 4-CP than that by single GAC adsorption.

  1. Iron oxyhydroxide nanorods with high electrochemical reactivity as a sensitive and rapid determination platform for 4-chlorophenol

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yuanyuan [Key Laboratory for Material Chemistry of Energy Conversion and Storage, Ministry of Education, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Britton Chance Center for Biomedical Photonics at Wuhan, National Laboratory for Optoelectronics-Hubei Bioinformatics & Molecular Imaging Key Laboratory, Systems Biology Theme, Department of Biomedical Engineering, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074 (China); Cheng, Qin; Zheng, Meng [Key Laboratory for Material Chemistry of Energy Conversion and Storage, Ministry of Education, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Liu, Xin [Britton Chance Center for Biomedical Photonics at Wuhan, National Laboratory for Optoelectronics-Hubei Bioinformatics & Molecular Imaging Key Laboratory, Systems Biology Theme, Department of Biomedical Engineering, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074 (China); Wu, Kangbing, E-mail: kbwu@hust.edu.cn [Key Laboratory for Material Chemistry of Energy Conversion and Storage, Ministry of Education, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)

    2016-04-15

    Highlights: • Prepared FeOOH nanorods exhibited high reactivity toward the oxidation of 4-CP. • Response signals and detection sensitivity of 4-CP increased greatly by FeOOH. • Highly-sensitive and rapid determination platform was developed for 4-CP. • Practical application in water samples was studied, and the accuracy was good. - Abstract: Iron oxyhydroxide (FeOOH) nanorods were prepared through solvothermal reaction, and characterized using Raman spectroscopy, X-ray diffraction, energy dispersive X-ray spectroscopy, transmission electron microscopy and scanning electron microscopy. Thereafter, the prepared FeOOH nanorods were used as sensing material to construct a novel detection platform for 4-chlorophenol (4-CP). The electrochemical behaviors of 4-CP were studied, and the oxidation peak currents increased greatly on the surface of FeOOH nanorods. The signal enhancement mechanism was studied for 4-CP, and it was found that the prepared FeOOH nanorods remarkably improved the electron transfer ability and surface adsorption efficiency of 4-CP. The influences of pH value, amount of FeOOH nanorods and accumulation time were examined. As a result, a highly-sensitive electrochemical method was developed for the rapid determination of 4-CP. The linear range was from 10 to 500 nM, and the detection limit was 3.2 nM. It was used in different water samples, and the results consisted with the values that obtained by high-performance liquid chromatography.

  2. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  3. MGE-derived nNOS+ interneurons promote fear acquisition in nNOS-/- mice.

    Science.gov (United States)

    Zhang, Lin; Yuan, Hong-Jin; Cao, Bo; Kong, Cheng-Cheng; Yuan, Fang; Li, Jun; Ni, Huan-Yu; Wu, Hai-Yin; Chang, Lei; Liu, Yan; Luo, Chun-Xia

    2017-12-02

    Neuronal nitric oxide synthase (nNOS) 1 , mainly responsible for NO release in central nervous system (CNS) 2 , plays a significant role in multiple physiological functions. However, the function of nNOS + interneurons in fear learning has not been much explored. Here we focused on the medial ganglionic eminences (MGE) 3 -derived nNOS + interneurons in fear learning. To determine the origin of nNOS + interneurons, we cultured neurons in vitro from MGE, cortex, lateral ganglionic eminence (LGE) 4 , caudal ganglionic eminences (CGE) 5 and preoptic area (POA) 6 . The results showed that MGE contained the most abundant precursors of nNOS + interneurons. Moreover, donor cells from E12.5 embryos demonstrated the highest positive rate of nNOS + interneurons compared with other embryonic periods (E11.5, E12, E13, E13.5 and E14). Additionally, these cells from E12.5 embryos showed long axonal and abundant dendritic arbors after 10 days culture, indicating the capability to disperse and integrate in host neural circuits after transplantation. To investigate the role of MGE-derived nNOS + interneurons in fear learning, donor MGE cells were transplanted into dentate gyrus (DG) 7 of nNOS knock-out (nNOS -/- ) or wild-type mice. Results showed that the transplantation of MGE cells promoted the acquisition of nNOS -/- but not the wild-type mice, suggesting the importance of nNOS + neurons in fear acquisition. Moreover, we transplanted MGE cells from nNOS -/- mice or wild-type mice into DG of the nNOS -/- mice and found that only MGE cells from wild-type mice but not the nNOS -/- mice rescued the deficit in acquisition of the nNOS -/- mice, further confirming the positive role of nNOS + neurons in fear learning. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Determination of chlorophenols in honey samples using in-situ ionic liquid-dispersive liquid-liquid microextraction as a pretreatment method followed by high-performance liquid chromatography.

    Science.gov (United States)

    Fan, Chen; Li, Nai; Cao, Xueli

    2015-05-01

    In-situ ionic liquid-dispersive liquid-liquid microextraction (IL-DLLME) method was developed as a pretreatment method for the detection of six chlorophenols (CPs) in honey samples. The hydrophobic ionic liquid [C4MIM][NTf2], formed in-situ by the hydrophilic ionic liquid [C4MIM][BF4] and the ion exchange reagent LiNTf2 was used as the microextractant solvent of CPs from honey sample. Then the enriched analytes were back-extracted into 40 μL of 0.14 M NaOH solution and finally subjected to analysis by high-performance liquid chromatography. The method showed low limit of detection of CPs, 0.8-3.2 μg/L and high enrichment factor, 34-65 with the recoveries range from 91.60% to 114.33%. The method is simple, rapid, environmentally friendly and with high extraction efficiency. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Silk fibroin/chitosan thin film promotes osteogenic and adipogenic differentiation of rat bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Li, Da-Wei; He, Jin; He, Feng-Li; Liu, Ya-Li; Liu, Yang-Yang; Ye, Ya-Jing; Deng, Xudong; Yin, Da-Chuan

    2018-04-01

    As a biodegradable polymer thin film, silk fibroin/chitosan composite film overcomes the defects of pure silk fibroin and chitosan films, respectively, and shows remarkable biocompatibility, appropriate hydrophilicity and mechanical properties. Silk fibroin/chitosan thin film can be used not only as metal implant coating for bone injury repair, but also as tissue engineering scaffold for skin, cornea, adipose, and other soft tissue injury repair. However, the biocompatibility of silk fibroin/chitosan thin film for mesenchymal stem cells, a kind of important seed cell of tissue engineering and regenerative medicine, is rarely reported. In this study, silk fibroin/chitosan film was prepared by solvent casting method, and the rat bone marrow-derived mesenchymal stem cells were cultured on the silk fibroin/chitosan thin film. Osteogenic and adipogenic differentiation of rat bone marrow-derived mesenchymal stem cells were induced, respectively. The proliferation ability, osteogenic and adipogenic differentiation abilities of rat bone marrow-derived mesenchymal stem cells were systematically compared between silk fibroin/chitosan thin film and polystyrene tissue culture plates. The results showed that silk fibroin/chitosan thin film not only provided a comparable environment for the growth and proliferation of rat bone marrow-derived mesenchymal stem cells but also promoted their osteogenic and adipogenic differentiation. This work provided information of rat bone marrow-derived mesenchymal stem cells behavior on silk fibroin/chitosan thin film and extended the application of silk fibroin/chitosan thin film. Based on the results, we suggested that the silk fibroin/chitosan thin film could be a promising material for tissue engineering of bone, cartilage, adipose, and skin.

  6. The hematopoietic chemokine CXCL12 promotes integration of human endothelial colony forming cell-derived cells into immature vessel networks.

    Science.gov (United States)

    Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M

    2014-11-15

    Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.

  7. Inhibition of dehydrogenase activity in petroleum refinery wastewater bacteria by phenolic compounds

    OpenAIRE

    Gideon C. Okpokwasili; Christian Okechukwu Nweke

    2010-01-01

    The toxicity of phenol, 2-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol, 2-chlorophenol, 4-chlorophenol, 4-bromophenol and 3,5-dimethylphenol on Pseudomonas, Bacillus and Escherichia species isolated from petroleum refinery wastewater was assessed via inhibition of dehydrogenase enzyme activity. At low concentrations, 2-nitrophenol, 2-chlorophenol, 4-chlorophenol, 4-bromophenol and 3,5-dimethylphenol stimulated dehydrogenase activity and at sufficient concentrations, phenolic compounds inhibi...

  8. Petunia AGAMOUS enhancer-derived chimeric promoters specify a carpel-, stamen- and petal-specific expression pattern sufficient for engineering male and female sterility in tobacco

    Science.gov (United States)

    Previous studies have shown that the AtAGIP promoter derived from the Arabidopsis AGAMOUS (AG) second intron/enhancer specifies a carpel- and stamen-specific pattern of expression in its native host species but not in heterologous species, such as tobacco which restricts its application in the engin...

  9. Tumor-Derived CXCL1 Promotes Lung Cancer Growth via Recruitment of Tumor-Associated Neutrophils

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-01-01

    Full Text Available Neutrophils have a traditional role in inflammatory process and act as the first line of defense against infections. Although their contribution to tumorigenesis and progression is still controversial, accumulating evidence recently has demonstrated that tumor-associated neutrophils (TANs play a key role in multiple aspects of cancer biology. Here, we detected that chemokine CXCL1 was dramatically elevated in serum from 3LL tumor-bearing mice. In vitro, 3LL cells constitutively expressed and secreted higher level of CXCL1. Furthermore, knocking down CXCL1 expression in 3LL cells significantly hindered tumor growth by inhibiting recruitment of neutrophils from peripheral blood into tumor tissues. Additionally, tumor-infiltrated neutrophils expressed higher levels of MPO and Fas/FasL, which may be involved in TAN-mediated inhibition of CD4+ and CD8+ T cells. These results demonstrate that tumor-derived CXCL1 contributes to TANs infiltration in lung cancer which promotes tumor growth.

  10. Taurine Promotes the Cartilaginous Differentiation of Human Umbilical Cord-Derived Mesenchymal Stem Cells in Vitro.

    Science.gov (United States)

    Yao, Xiuhua; Huang, Huiling; Li, Zhou; Liu, Xiaohua; Fan, Weijia; Wang, Xinping; Sun, Xuelian; Zhu, Jianmin; Zhou, Hongrui; Wei, Huaying

    2017-08-01

    Taurine has been reported to influence osteogenic differentiation, but the role of taurine on cartilaginous differentiation using human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) remains unclear. In this study, we investigated the effect of taurine (0, 1, 5 and 10 mM) on the proliferation and chondrogenesis of hUC-MSCs by analyzing cell proliferation, accumulation of glycosaminoglycans and expression of cartilage specific mRNA. The results show though taurine did not affected the proliferation of hUC-MSCs, 5 mM of taurine is sufficient to enhanced the accumulation of glycosaminoglycans and up-regulate cartilage specific mRNA expression, namely collagen type II, aggrecan and SOX9. Taurine also inhibits chondrocyte dedifferentiation by reducing expression of collagen type I mRNA. Taken together, our study reveals that taurine promotes and maintains the chondrogenesis of hUC-MSCs.

  11. Artificial promoter libraries for selected organisms and promoters derived from such libraries

    DEFF Research Database (Denmark)

    1998-01-01

    or organisms may be selected from prokaryotes and from eukaryotes; and in prokaryotes the consensus sequences to be retained most often will comprise the -35 signal (-35 to -30): TTGACA and the -10 signal (-12 to -7): TATAAT or parts of both comprising at least 3 conserved nucleotides of each, while...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....

  12. A 3D Porous Gelatin-Alginate-Based-IPN Acts as an Efficient Promoter of Chondrogenesis from Human Adipose-Derived Stem Cells

    OpenAIRE

    Dinescu, Sorina; Galateanu, Bianca; Radu, Eugen; Hermenean, Anca; Lungu, Adriana; Stancu, Izabela Cristina; Jianu, Dana; Tumbar, Tudorita; Costache, Marieta

    2015-01-01

    Cartilage has limited regeneration potential. Thus, there is an imperative need to develop new strategies for cartilage tissue engineering (CTE) amenable for clinical use. Recent CTE approaches rely on optimal cell-scaffold interactions, which require a great deal of optimization. In this study we attempt to build a novel gelatin- (G-) alginate- (A-) polyacrylamide (PAA) 3D interpenetrating network (IPN) with superior performance in promoting chondrogenesis from human adipose-derived stem cel...

  13. A direct comparison amongst different technologies (aerobic granular sludge, SBR and MBR) for the treatment of wastewater contaminated by 4-chlorophenol

    International Nuclear Information System (INIS)

    Carucci, Alessandra; Milia, Stefano; Cappai, Giovanna; Muntoni, Aldo

    2010-01-01

    Environmental concern on chlorinated phenols is rising due to their extreme toxicity even at low concentrations and their persistency in water and soils. Since the high amount of published data often lacks in terms of uniformity, direct comparisons amongst different treatment technologies are very difficult, or even impossible. In this study, granular sludge developed in an acetate-fed Granular sludge Sequencing Batch Reactor (GSBR) was used for the aerobic degradation of low chlorinated 4-chlorophenol (4CP), with readily biodegradable sodium acetate (NaAc) as growth substrate. A conventional Sequencing Batch Reactor (SBR) and a Membrane BioReactor (MBR) were operated in parallel under the same 4CP influent concentrations and/or 4CP volumetric organic loading rates as the GSBR, in order to carry out a direct comparison in terms of 4CP removal efficiencies and specific removal rates, effluent quality, waste sludge production, system simplicity, land area requirement, start-up times, NaAc dosage as growth substrate and maximum applied 4CP volumetric organic loading rate. A decision matrix was built to define the best technology to suit different scenarios: the GSBR was proved to be the most suitable technology when system simplicity, low land area requirement and short start-up times were considered as critical parameters for decision making.

  14. Degradation of aqueous phenol solutions by coaxial DBD reactor

    Science.gov (United States)

    Dojcinovic, B. P.; Manojlovic, D.; Roglic, G. M.; Obradovic, B. M.; Kuraica, M. M.; Puric, J.

    2008-07-01

    Solutions of 2-chlorophenol, 4-chlorophenol and 2,6-dichlorophenol in bidistilled and water from the river Danube were treated in plasma reactor. In this reactor, based on coaxial dielectric barrier discharge at atmospheric pressure, plasma is formed over a thin layer of treated water. After one pass through the reactor, starting chlorophenols concentration of 20 mg/l was diminished up to 95 %. Kinetics of the chlorophenols degradation was monitored by High Pressure Liquid Chromatography method (HPLC).

  15. [Multi-channel promotion of lung cancer progress by bone marrow derived mesenchymal stem cells in tumor microenvironment].

    Science.gov (United States)

    Luo, D; Hu, S Y; Liu, G X

    2018-02-23

    Objective: To observe the growth and metastasis of lung cancer promoted by bone marrow derived mesenchymal stem cells (BMSCs) in tumor microenvironment and investigate the underlined mechanisms. Methods: Specific chemotaxis of BMSCs towards lung cancer was observed, and the tumor growth and metastasis were assessed in vivo . Furthermore, CD34 expression determined by immunohistochemistry was used to assess the microvessel density (MVD), and the expressions of GFP and α-SMA determined by immunofluorescence were used to detect the BMSCs derived mesenchymal cells. We investigated the effect of BMSCs on migration, invasion of lung cancer cells including A549 and H446 cells by using scratch assays and Transwell Assay in vitro. We also explored the effect of BMSCs on epithelial mesenchymal transition of A549 and H446 cells by observing the phenotype transition and E-Cadherin protein expression detected by Western blot. At last, we screened the potentially key soluble factors by enzyme linked immunosorbent assay (ELISA). Results: In NOD mice, labeled BMSCs injected via tail vein were special chemotaxis to tumor cells, and promoted the tumor growth [the time of tumor formation in A549+ BMSCs and A549 alone was (5.0±1.5) days and (10.0±3.6) days, respectively, P cell carcinoma and promoted the migration and invasion of lung cancer cells (the A of cells in the migrated lower chambers of A549+ BMSCs and A549 alone was 1.9±0.2 and 1.1±0.1, respectively, P cells in the migrated lower chambers of H446+ BMSCs and H446 alone was 1.9±0.3 and 0.9±0.2, respectively, P cell shape was longer and sharper, the intercellular junctions were reduced and the relative expression level of E-Cadherin protein in A549 co-cultured with BMDCs was 0.36, significantly down-regulated when compared to 0.55 of A549 alone ( P cells alone ( P <0.05). The concentration of IL-6 in the conditional medium of BMSCs, A549 co-cultured with BMSCs and H446 co-cultured with BMSCs was 910.5, 957.2, and 963

  16. Robust heat-inducible gene expression by two endogenous hsp70-derived promoters in transgenic Aedes aegypti

    Science.gov (United States)

    Carpenetti, Tiffany L. G.; Aryan, Azadeh; Myles, Kevin M.; Adelman, Zach N.

    2011-01-01

    Aedes aegypti is an important vector of the viruses that cause dengue fever, dengue hemorrhagic fever, and yellow fever. Reverse genetic approaches to the study of gene function in this mosquito have been limited by the lack of a robust inducible promoter to allow precise temporal control over a protein-encoding or hairpin RNA transgene. Likewise, investigations into the molecular and biochemical basis of vector competence would benefit from the ability to activate an anti-pathogen molecule at specific times during infection. We have characterized the ability of genomic sequences derived from two Ae. aegypti hsp70 genes to drive heat-inducible expression of a reporter in both transient and germline transformation contexts. AaHsp70-luciferase transcripts accumulated specifically after heat shock, and displayed a pattern of rapid induction and decay similar to endogenous AaHsp70 genes. Luciferase expression in transgenic Ae. aegypti increased by ∼25-50 fold in whole adults by four hours after heat-shock, with significant activity (∼20 fold) remaining at 24 hr. Heat-induced expression was even more dramatic in midgut tissues, with one strain showing a ∼2500-fold increase in luciferase activity. The AaHsp70 promoters described could be valuable for gene function studies as well as for the precise timing of the expression of anti-pathogen molecules. PMID:22142225

  17. Glial cell line-derived neurotrophic factor and endothelial cells promote self-renewal of rabbit germ cells with spermatogonial stem cell properties.

    Science.gov (United States)

    Kubota, Hiroshi; Wu, Xin; Goodyear, Shaun M; Avarbock, Mary R; Brinster, Ralph L

    2011-08-01

    Previous studies suggest that exogenous factors crucial for spermatogonial stem cell (SSC) self-renewal are conserved among several mammalian species. Since glial cell line-derived neurotrophic factor (GDNF) and fibroblast growth factor 2 (FGF2) are critical for rodent SSC self-renewal, we hypothesized that they might promote self-renewal of nonrodent SSCs. Therefore, we cultured testicular germ cells from prepubertal rabbits in the presence of GDNF and FGF2 and found they proliferated indefinitely as cellular clumps that displayed characteristics previously identified for rodent SSCs. The rabbit germ cells could not be maintained on mouse embryonic fibroblast (STO) feeders that support rodent SSC self-renewal in vitro but were rather supported on mouse yolk sac-derived endothelial cell (C166) feeder layers. Proliferation of rabbit germ cells was dependent on GDNF. Of critical importance was that clump-forming rabbit germ cells colonized seminiferous tubules of immunodeficient mice, proliferated for at least 6 mo, while retaining an SSC phenotype in the testes of recipient mice, indicating that they were rabbit SSCs. This study demonstrates that GDNF is a mitogenic factor promoting self-renewal that is conserved between rodent and rabbit SSCs; with an evolutionary separation of ∼ 60 million years. These findings provide a foundation to study the mechanisms governing SSC self-renewal in nonrodent species.

  18. Performance study of SOL&PID system for the degradation of Acid Red 26 and 4-Chlorophenol

    International Nuclear Information System (INIS)

    Zhu, Li; Cui, Lingyun; Huang, Qunwu; Wang, Yiping; Vivar, Marta; Jin, Yanchao; Sun, Yong; Cui, Yong; Fan, Jiangyang

    2017-01-01

    Highlights: • A new water purification system with solar and UV-LED powered by PV was proposed. • UV-LED was driven by PV directly without any transformation. • More than 92% of P_m generated by PV was used to drive UV-LED array. • Visible and near-infra light was converted to UV via PV and UV-LED. • The flowing water makes PV and LED work at lower temperature. - Abstract: To increase the photocatalytic reaction rate and make full use of electricity generated by photovoltaics (PV), a water purification system (SOL&PID) with solar and ultraviolet-light emitting diode (UV-LED) powered by a hybrid PV photocatalytic reactor was designed and tested in this paper. The SOL&PID system is based on Solar Water Purification and Renewable Electricity Generation system (SOLWAT). Photovoltaic and photocatalytic performances of SOL&PID system were evaluated in comparison with SOLWAT by the degradation of Acid Red 26 (AR 26) and 4-chlorophenol (4-CP) using suspended TiO_2. To assess the directly-coupled performance between PV and UV-LED array, the power consumption percentage of UV-LED array from the maximum output power of PV was analyzed. The results show an adequate coupling between the UV-LED array and the photovoltaics. More than 92% of the maximum output power generated by PV modules is used to drive the LED array. The photocatalytic reaction rate constants in SOL&PID system increase respectively 29–37% and 31–78% during AR 26 and 4-CP experiments, in comparison with SOLWAT system. Besides, the SOL&PID system achieved lower solar module temperature and lower UV-LED pin temperature than the reference systems by the addition of flow channel.

  19. Fenton-like oxidation of 4-chlorophenol using H2O2 in situ generated by Zn-Fe-CNTs composite.

    Science.gov (United States)

    Liu, Yong; Fan, Qing; Liu, Yanlan; Wang, Jianlong

    2018-05-15

    In this paper, a zinc-iron-carbon nanotubes (Zn-Fe-CNTs) composite was prepared, characterized and used to develop a Fenton-like system of Zn-Fe-CNTs/O 2 for the degradation of 4-chlorophenol (4-CP), in which H 2 O 2 was generated in situ from zinc-carbon galvanic cells and oxygen in aqueous solution was activated by iron attached on the surface of CNTs to produce ·OH radicals for the oxidation of 4-CP. The experimental results showed that the particles of Zn and Fe in Zn-Fe-CNTs composite were adhered to the surface of CNTs, which accelerated the electron transfer process. The BET area of Zn-Fe-CNTs composite was 32.9 m 2 /g. The contents of Zn and Fe (% w) in the composite were 44.7% and 4.2%, respectively. The removal efficiency of 4-CP and TOC in Zn-Fe-CNTs/O 2 system was 90.8% and 52.9%, respectively, with the initial pH of 2.0, O 2 flow rate of 800 mL/min, Zn-Fe-CNTs dosage of 1.0 g/L, 4-CP concentration of 50 mg/L and reaction time of 20 min. Based on the analysis of the degradation intermediate products with LC-MS and IC, a possible degradation pathway of 4-CP in Zn-Fe-CNTs/O 2 system was proposed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Bone marrow-derived fibrocytes promote stem cell-like properties of lung cancer cells.

    Science.gov (United States)

    Saijo, Atsuro; Goto, Hisatsugu; Nakano, Mayuri; Mitsuhashi, Atsushi; Aono, Yoshinori; Hanibuchi, Masaki; Ogawa, Hirohisa; Uehara, Hisanori; Kondo, Kazuya; Nishioka, Yasuhiko

    2018-05-01

    Cancer stem cells (CSCs) represent a minor population that have clonal tumor initiation and self-renewal capacity and are responsible for tumor initiation, metastasis, and therapeutic resistance. CSCs reside in niches, which are composed of diverse types of stromal cells and extracellular matrix components. These stromal cells regulate CSC-like properties by providing secreted factors or by physical contact. Fibrocytes are differentiated from bone marrow-derived CD14 + monocytes and have features of both macrophages and fibroblasts. Accumulating evidence has suggested that stromal fibrocytes might promote cancer progression. However, the role of fibrocytes in the CSC niches has not been revealed. We herein report that human fibrocytes enhanced the CSC-like properties of lung cancer cells through secreted factors, including osteopontin, CC-chemokine ligand 18, and plasminogen activator inhibitor-1. The PIK3K/AKT pathway was critical for fibrocytes to mediate the CSC-like functions of lung cancer cells. In human lung cancer specimens, the number of tumor-infiltrated fibrocytes was correlated with high expression of CSC-associated protein in cancer cells. These results suggest that fibrocytes may be a novel cell population that regulates the CSC-like properties of lung cancer cells in the CSC niches. Copyright © 2018. Published by Elsevier B.V.

  1. Decreased nuclear stiffness via FAK-ERK1/2 signaling is necessary for osteopontin-promoted migration of bone marrow-derived mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Lingling, E-mail: liulingling2012@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Luo, Qing, E-mail: qing.luo@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Sun, Jinghui, E-mail: sunjhemail@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Wang, Aoli, E-mail: leaf13332@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Shi, Yisong, E-mail: shiyis@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Ju, Yang, E-mail: ju@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Morita, Yasuyuki, E-mail: morita@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Song, Guanbin, E-mail: song@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China)

    2017-06-15

    Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.

  2. Decreased nuclear stiffness via FAK-ERK1/2 signaling is necessary for osteopontin-promoted migration of bone marrow-derived mesenchymal stem cells

    International Nuclear Information System (INIS)

    Liu, Lingling; Luo, Qing; Sun, Jinghui; Wang, Aoli; Shi, Yisong; Ju, Yang; Morita, Yasuyuki; Song, Guanbin

    2017-01-01

    Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.

  3. Gelatin-Based Hydrogels Promote Chondrogenic Differentiation of Human Adipose Tissue-Derived Mesenchymal Stem Cells In Vitro

    Science.gov (United States)

    Salamon, Achim; van Vlierberghe, Sandra; van Nieuwenhove, Ine; Baudisch, Frank; Graulus, Geert-Jan; Benecke, Verena; Alberti, Kristin; Neumann, Hans-Georg; Rychly, Joachim; Martins, José C.; Dubruel, Peter; Peters, Kirsten

    2014-01-01

    Due to the weak regeneration potential of cartilage, there is a high clinical incidence of articular joint disease, leading to a strong demand for cartilaginous tissue surrogates. The aim of this study was to evaluate a gelatin-based hydrogel for its suitability to support chondrogenic differentiation of human mesenchymal stem cells. Gelatin-based hydrogels are biodegradable, show high biocompatibility, and offer possibilities to introduce functional groups and/or ligands. In order to prove their chondrogenesis-supporting potential, a hydrogel film was developed and compared with standard cell culture polystyrene regarding the differentiation behavior of human mesenchymal stem cells. Cellular basis for this study were human adipose tissue-derived mesenchymal stem cells, which exhibit differentiation potential along the adipogenic, osteogenic and chondrogenic lineage. The results obtained show a promotive effect of gelatin-based hydrogels on chondrogenic differentiation of mesenchymal stem cells in vitro and therefore encourage subsequent in vivo studies. PMID:28788517

  4. The effect of different exposed facets on the photoelectrocatalytic degradation of o-chlorophenol using p-type Cu_2O crystals

    International Nuclear Information System (INIS)

    Sang, Wenjing; Zhang, Gong; Lan, Huachun; An, Xiaoqiang; Liu, Huijuan

    2017-01-01

    Although it is known that the efficacy of photoelectrocatalysts is enhanced by increasing the amount of high energy surface exposed, the development of a universal synthesis method with both superior activity and simplicity is needed for scalable applications. We herein controllably fabricated cuprous oxide (Cu_2O) micro crystals with different morphologies, evolving from cubes, cuboctahedra, truncated octahedra and finally to octahedra on indium tin oxide (ITO) glass substrates, by a facile electrochemical deposition method. The structures of facet-engineered Cu_2O samples and the underlying mechanism for the morphology evolution were investigated. The separation of photogenerated hole-electron pairs on Cu_2O crystals with different exposed facets was characterized by measuring the photocurrent densities with chopped illumination, which increased with the increased concentrations of PVP: the octahedral Cu_2O crystals, with the highest proportion of {111} facets exposed, exhibited the lowest electro-hole recombination in contrast to the cubes, cuboctahedra, and truncated octahedra, respectively. The photoelectrocatalytic degradation efficiency of the o-chlorophenol (2-CP) pollutant under sunlight irradiation with Cu_2O-coated photocathode was further investigated to reveal the effect of different exposed facets. Due to the increased number of surface active sites available for degradation reactions, the octahedral Cu_2O microcrystals presented higher photoelectrocatalytic activity compared to other shapes. Active oxygen species detected by electron spin-resonance (ESR) spectrometry implied that abundant superoxide radicals (O_2"●"−) were the dominant active radicals in the degradation.

  5. Asymmetric allylation of α-ketoester-derived N-benzoylhydrazones promoted by chiral sulfoxides/N-oxides Lewis bases: highly enantioselective synthesis of quaternary α-substituted α-allyl-α-amino acids.

    Science.gov (United States)

    Reyes-Rangel, Gloria; Bandala, Yamir; García-Flores, Fred; Juaristi, Eusebio

    2013-09-01

    Chiral sulfoxides/N-oxides (R)-1 and (R,R)-2 are effective chiral promoters in the enantioselective allylation of α-keto ester N-benzoylhydrazone derivatives 3a-g to generate the corresponding N-benzoylhydrazine derivatives 4a-g, with enantiomeric excesses as high as 98%. Representative hydrazine derivatives 4a-b were subsequently treated with SmI2, and the resulting amino esters 5a-b with LiOH to obtain quaternary α-substituted α-allyl α-amino acids 6a-b, whose absolute configuration was assigned as (S), with fundament on chemical correlation and electronic circular dichroism (ECD) data. © 2013 Wiley Periodicals, Inc.

  6. Caspase-1 from Human Myeloid-Derived Suppressor Cells Can Promote T Cell-Independent Tumor Proliferation.

    Science.gov (United States)

    Zeng, Qi; Fu, Juan; Korrer, Michael; Gorbounov, Mikhail; Murray, Peter J; Pardoll, Drew; Masica, David L; Kim, Young J

    2018-05-01

    Immunosuppressive myeloid-derived suppressive cells (MDSCs) are characterized by their phenotypic and functional heterogeneity. To better define their T cell-independent functions within the tumor, sorted monocytic CD14 + CD11b + HLA-DR low/- MDSCs (mMDSC) from squamous cell carcinoma patients showed upregulated caspase-1 activity, which was associated with increased IL1β and IL18 expression. In vitro studies demonstrated that mMDSCs promoted caspase-1-dependent proliferation of multiple squamous carcinoma cell lines in both human and murine systems. In vivo , growth rates of B16, MOC1, and Panc02 were significantly blunted in chimeric mice adoptively transferred with caspase-1 null bone marrow cells under T cell-depleted conditions. Adoptive transfer of wild-type Gr-1 + CD11b + MDSCs from tumor-bearing mice reversed this antitumor response, whereas caspase-1 inhibiting thalidomide-treated MDSCs phenocopied the antitumor response found in caspase-1 null mice. We further hypothesized that MDSC caspase-1 activity could promote tumor-intrinsic MyD88-dependent carcinogenesis. In mice with wild-type caspase-1, MyD88-silenced tumors displayed reduced growth rate, but in chimeric mice with caspase-1 null bone marrow cells, MyD88-silenced tumors did not display differential tumor growth rate. When we queried the TCGA database, we found that caspase-1 expression is correlated with overall survival in squamous cell carcinoma patients. Taken together, our findings demonstrated that caspase-1 in MDSCs is a direct T cell-independent mediator of tumor proliferation. Cancer Immunol Res; 6(5); 566-77. ©2018 AACR . ©2018 American Association for Cancer Research.

  7. Human umbilical cord derived mesenchymal stem cells promote interleukin-17 production from human peripheral blood mononuclear cells of healthy donors and systemic lupus erythematosus patients.

    Science.gov (United States)

    Ren, S; Hu, J; Chen, Y; Yuan, T; Hu, H; Li, S

    2016-03-01

    Inflammation instigated by interleukin (IL)-17-producing cells is central to the development and pathogenesis of several human autoimmune diseases and animal models of autoimmunity. The expansion of IL-17-producing cells from healthy donors is reportedly promoted by mesenchymal stem cells derived from fetal bone marrow. In the present study, human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) were examined for their effects on lymphocytes from healthy donors and from patients with systemic lupus erythematosus (SLE). Significantly higher levels of IL-17 were produced when CD4(+) T cells from healthy donors were co-cultured with hUC-MSCs than those that were cultured alone. Blocking experiments identified that this effect might be mediated partially through prostaglandin E2 (PGE2 ) and IL-1β, without IL-23 involvement. We then co-cultured hUC-MSCs with human CD4(+) T cells from systemic lupus erythematosus patients. Ex-vivo inductions of IL-17 by hUC-MSCs in stimulated lymphocytes were significantly higher in SLE patients than in healthy donors. This effect was not observed for IL-23. Taken together, our results represent that hUC-MSCs can promote the IL-17 production from CD4(+) T cells in both healthy donor and SLE patients. PGE2 and IL-1β might also be partially involved in the promotive effect of hUC-MSCs. © 2015 British Society for Immunology.

  8. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    International Nuclear Information System (INIS)

    Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya

    2015-01-01

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation

  9. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    Energy Technology Data Exchange (ETDEWEB)

    Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)

    2015-08-14

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.

  10. Electrodeposition of palladium and reduced graphene oxide nanocomposites on foam-nickel electrode for electrocatalytic hydrodechlorination of 4-chlorophenol

    International Nuclear Information System (INIS)

    Liu, Yong; Liu, Lan; Shan, Jun; Zhang, Jingdong

    2015-01-01

    Highlights: • Pd and reduced graphene oxide are deposited on foam-Ni via electrodeposition. • Pd particles supported on RGO possess large active surface area. • Pd/RGO/foam-Ni shows high electrocatalytic activity for dechlorination of 4-CP. • 100% 4-CP can be removed on Pd/RGO/foam-Ni under optimum ECH conditions. - Abstract: A high-performance palladium (Pd) and reduced graphene oxide (RGO) composite electrode was prepared on foam-nickel (foam-Ni) via two-step electrodeposition processes. The scanning electron microscopic (SEM) observation showed that the obtained Pd/RGO/foam-Ni composite electrode displayed a uniform and compact morphology. The X-ray diffraction (XRD) and X-ray photoelectron spectroscopic (XPS) analysis confirmed the successful deposition of Pd and RGO on nickel substrate. The cyclic voltammetric (CV) measurements indicated that the presence of RGO greatly enhanced the active surface area of Pd particles deposited on foam-Ni. The as-deposited Pd/RGO/foam-Ni electrode was applied to electrocatalytic hydrodechlorination (ECH) of 4-chlorophenol (4-CP). Various factors influencing the dechlorination of 4-CP such as dechlorination current, initial concentration of 4-CP, Na 2 SO 4 concentration and initial pH were systematically investigated. The thermodynamic analysis showed that the dechlorination reaction of 4-CP at different temperatures followed the first-order kinetics and the activation energy for 4-CP dechlorination on Pd/RGO/foam-Ni electrode was calculated to be 51.96 kJ mol −1 . Under the optimum conditions, the dechlorination efficiency of 4-CP could reach 100% after 60-min ECH treatment. Moreover, the prepared Pd/RGO/foam-Ni composite electrode showed good stability for recycling utilization in ECH of 4-CP

  11. Neurotrophin-3 promotes proliferation and cholinergic neuronal differentiation of bone marrow- derived neural stem cells via notch signaling pathway.

    Science.gov (United States)

    Yan, Yu-Hui; Li, Shao-Heng; Gao, Zhong; Zou, Sa-Feng; Li, Hong-Yan; Tao, Zhen-Yu; Song, Jie; Yang, Jing-Xian

    2016-12-01

    Recently, the potential for neural stem cells (NSCs) to be used in the treatment of Alzheimer's disease (AD) has been reported; however, the therapeutic effects are modest by virtue of the low neural differentiation rate. In our study, we transfected bone marrow-derived NSCs (BM-NSCs) with Neurotrophin-3 (NT-3), a superactive neurotrophic factor that promotes neuronal survival, differentiation, and migration of neuronal cells, to investigate the effects of NT-3 gene overexpression on the proliferation and differentiation into cholinergic neuron of BM-NSCs in vitro and its possible molecular mechanism. BM-NSCs were generated from BM mesenchymal cells of adult C57BL/6 mice and cultured in vitro. After transfected with NT-3 gene, immunofluorescence and RT-PCR method were used to determine the ability of BM-NSCs on proliferation and differentiation into cholinergic neuron; Acetylcholine Assay Kit was used for acetylcholine (Ach). RT-PCR and WB analysis were used to characterize mRNA and protein level related to the Notch signaling pathway. We found that NT-3 can promote the proliferation and differentiation of BM-NSCs into cholinergic neurons and elevate the levels of acetylcholine (ACh) in the supernatant. Furthermore, NT-3 gene overexpression increase the expression of Hes1, decreased the expression of Mash1 and Ngn1 during proliferation of BM-NSCs. Whereas, the expression of Hes1 was down-regulated, and Mash1 and Ngn1 expression were up-regulated during differentiation of BM-NSCs. Our findings support the prospect of using NT-3-transduced BM-NSCs in developing therapies for AD due to their equivalent therapeutic potential as subventricular zone-derived NSCs (SVZ-NSCs), greater accessibility, and autogenous attributes. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Collagen-derived dipeptide prolyl-hydroxyproline promotes differentiation of MC3T3-E1 osteoblastic cells

    International Nuclear Information System (INIS)

    Kimira, Yoshifumi; Ogura, Kana; Taniuchi, Yuri; Kataoka, Aya; Inoue, Naoki; Sugihara, Fumihito; Nakatani, Sachie; Shimizu, Jun; Wada, Masahiro; Mano, Hiroshi

    2014-01-01

    Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression

  13. Gelatin-Based Hydrogels Promote Chondrogenic Differentiation of Human Adipose Tissue-Derived Mesenchymal Stem Cells In Vitro

    Directory of Open Access Journals (Sweden)

    Achim Salamon

    2014-02-01

    Full Text Available Due to the weak regeneration potential of cartilage, there is a high clinical incidence of articular joint disease, leading to a strong demand for cartilaginous tissue surrogates. The aim of this study was to evaluate a gelatin-based hydrogel for its suitability to support chondrogenic differentiation of human mesenchymal stem cells. Gelatin-based hydrogels are biodegradable, show high biocompatibility, and offer possibilities to introduce functional groups and/or ligands. In order to prove their chondrogenesis-supporting potential, a hydrogel film was developed and compared with standard cell culture polystyrene regarding the differentiation behavior of human mesenchymal stem cells. Cellular basis for this study were human adipose tissue-derived mesenchymal stem cells, which exhibit differentiation potential along the adipogenic, osteogenic and chondrogenic lineage. The results obtained show a promotive effect of gelatin-based hydrogels on chondrogenic differentiation of mesenchymal stem cells in vitro and therefore encourage subsequent in vivo studies.

  14. Determination of Phenols in Water Samples using a Supported ...

    African Journals Online (AJOL)

    The sample preparation method was tested for the determination of phenols in river water samples and landfill leachate. Concentrations of phenols in river water were found to be in the range 4.2 μg L–1 for 2-chlorophenol to 50 μg L–1 for 4-chlorophenol. In landfill leachate, 4-chlorophenol was detected at a concentration ...

  15. Platelets promote osteosarcoma cell growth through activation of the platelet-derived growth factor receptor-Akt signaling axis.

    Science.gov (United States)

    Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-Hara, Tomoko; Fujita, Naoya

    2014-08-01

    The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the proliferation of osteosarcomas. Co-culture of platelets with MG63 or HOS osteosarcoma cells, which could induce platelet aggregation, enhanced the proliferation of each cell line in vitro. Analysis of phospho-antibody arrays revealed that co-culture of MG63 cells with platelets induced the phosphorylation of platelet derived growth factor receptor (PDGFR) and Akt. The addition of supernatants of osteosarcoma-platelet reactants also increased the growth of MG63 and HOS cells as well as the level of phosphorylated-PDGFR and -Akt. Sunitinib or LY294002, but not erlotinib, significantly inhibited the platelet-induced proliferation of osteosarcoma cells, indicating that PDGF released from platelets plays an important role in the proliferation of osteosarcomas by activating the PDGFR and then Akt. Our results suggest that inhibitors that specifically target osteosarcoma-platelet interactions may eradicate osteosarcomas. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  16. Cell-derived micro-environment helps dental pulp stem cells promote dental pulp regeneration.

    Science.gov (United States)

    Zhang, Xuexin; Li, Hui; Sun, Jingjing; Luo, Xiangyou; Yang, Hefeng; Xie, Li; Yang, Bo; Guo, Weihua; Tian, Weidong

    2017-10-01

    The function of the dental pulp is closely connected to the extracellular matrix (ECM) structure, and ECM has received significant attention due to its biological functions for regulating cells. As such, the interaction between the ECM niche and cells is worth exploring for potential clinical uses. In this study, dental pulp stem cell (DPSC)-derived ECM (DPM) was prepared through cell culture and decellularization to function as the cell niche, and changes in DPSC behaviour and histological analysis of dental pulp tissue regeneration were evaluated following the DPM culture. DPM promoted the replication of DPSCs and exhibited retention of their mineralization. Then, the DPM-based culture strategy under odontogenic culture medium was further investigated, and the mineralization-related markers showed that DPSCs were regulated towards odontogenic differentiation. Dental pulp-like tissue with well-arranged ECM was harvested after a 2-month subcutaneous implantation in nude mice with DPM application. Additionally, DPSCs cultured on the plastic culture surface showed the up-regulation of mineralization makers in vitro, but there was a disorder in matrix formation and mineralization when the cells were cultured in vivo. DPM-based cultivation could serve as a cell niche and modulate DPSC behaviour, and this method also provided an alternative to harvest tissue-specific ECM and provided a strategy for ECM-cell interaction. © 2017 John Wiley & Sons Ltd.

  17. Carbon nanotube-based substrates promote cardiogenesis in brown adipose-derived stem cells via β1-integrin-dependent TGF-β1 signaling pathway

    Science.gov (United States)

    Sun, Hongyu; Mou, Yongchao; Li, Yi; Li, Xia; Chen, Zi; Duval, Kayla; Huang, Zhu; Dai, Ruiwu; Tang, Lijun; Tian, Fuzhou

    2016-01-01

    Stem cell-based therapy remains one of the promising approaches for cardiac repair and regeneration. However, its applications are restricted by the limited efficacy of cardiac differentiation. To address this issue, we examined whether carbon nanotubes (CNTs) would provide an instructive extracellular microenvironment to facilitate cardiogenesis in brown adipose-derived stem cells (BASCs) and to elucidate the underlying signaling pathways. In this study, we systematically investigated a series of cellular responses of BASCs due to the incorporation of CNTs into collagen (CNT-Col) substrates that promoted cell adhesion, spreading, and growth. Moreover, we found that CNT-Col substrates remarkably improved the efficiency of BASCs cardiogenesis by using fluorescence staining and quantitative real-time reverse transcription-polymerase chain reaction. Critically, CNTs in the substrates accelerated the maturation of BASCs-derived cardiomyocytes. Furthermore, the underlying mechanism for promotion of BASCs cardiac differentiation by CNTs was determined by immunostaining, quantitative real-time reverse transcription-polymerase chain reaction, and Western blotting assay. It is notable that β1-integrin-dependent TGF-β1 signaling pathway modulates the facilitative effect of CNTs in cardiac differentiation of BASCs. Therefore, it is an efficient approach to regulate cardiac differentiation of BASCs by the incorporation of CNTs into the native matrix. Importantly, our findings can not only facilitate the mechanistic understanding of molecular events initiating cardiac differentiation in stem cells, but also offer a potentially safer source for cardiac regenerative medicine. PMID:27660434

  18. Inflammatory Human Umbilical Cord-Derived Mesenchymal Stem Cells Promote Stem Cell-Like Characteristics of Cancer Cells in an IL-1β-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Xiaohe Luo

    2018-01-01

    Full Text Available To ensure the safety of clinical applications of MSCs, thorough understanding of their impacts on tumor initiation and progression is essential. Here, to further explore the complex dialog between MSCs and tumor cells, umbilical cord-derived mesenchymal stem cells (UC-MSCs were employed to be cocultured with either breast or ovarian cancer cells. Though having no obvious influence on proliferation or apoptosis, UC-MSCs exerted intense stem cell-like properties promoting effects on both cancer models. Cocultured cancer cells showed enriched side population, enhanced sphere formation ability, and upregulated pluripotency-associated stem cell markers. Human cytokine array and real-time PCR revealed a panel of MSC-derived prostemness cytokines CCL2, CXCL1, IL-8, and IL-6 which were induced upon coculturing. We further revealed IL-1β, a well-characterized proinflammatory cytokine, to be the inducer of these prostemness cytokines, which was generated from inflammatory UC-MSCs in an autocrine manner. Additionally, with introduction of IL-1RA (an IL-1 receptor antagonist into the coculturing system, the stem cell-like characteristics promoting effects of inflammatory UC-MSCs were partially blocked. Taken together, these findings suggest that transduced inflammatory MSCs work as a major source of IL-1β in tumor microenvironment and initiate the formation of prostemness niche via regulating their secretome in an IL-1β-dependent manner.

  19. Ionic Liquid-Promoted Synthesis of Novel Chromone-Pyrimidine Coupled Derivatives, Antimicrobial Analysis, Enzyme Assay, Docking Study and Toxicity Study

    Directory of Open Access Journals (Sweden)

    Shailee V. Tiwari

    2018-02-01

    Full Text Available Herein, we report an environmentally friendly, rapid, and convenient ionic liquid ([Et3NH][HSO4]-promoted facile synthesis of ethyl 4-(6-substituted-4-oxo-4H-chromen-3-yl-6-methyl-2-thioxo/oxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate derivatives 4(a–f and 4-(6-substituted-4-oxo-4H-chromen-3-yl-6-methyl-2-thioxo/oxo-1,2,3,4-tetrahydropyrimidine-5- carbohydrazide derivatives 6(a–f. All the synthesized derivatives 4(a–f and 6(a–f were evaluated for their in vitro antifungal and antibacterial activity, by method recommended by National Committee for Clinical Laboratory Standards (NCCLS. The compound 6c bearing a fluoro group on the chromone ring and oxygen and a hydrazino group (–NHNH2 on the pyrimidine ring, was found to be the most potent antibacterial compound amongst the synthesized derivatives. The compound 6f bearing a methoxy group (–OCH3 on the chromone ring and sulphur group on the pyrimidine ring, was found to exhibit equipotent antifungal activity when compared with the standard drug miconazole. A d-alanine-d-alanine ligase (DdlB enzyme assay study and an ergosterol extraction and quantitation assay study were performed to predict the mode of action of the synthesized compounds. A molecular docking study was performed to predict the binding interactions with receptors and mode of action of the synthesized derivatives. Further, analysis of the ADMET parameters for the synthesized compounds has shown that these compounds have good oral drug-like properties and can be developed as oral drug candidates. To establish the antimicrobial selectivity and safety, the most active compounds 6c and 6f were further tested for cytotoxicity against the human cancer cell line HeLa and were found to be non-cytotoxic in nature. An in vivo acute oral toxicity study was also performed for the most active compounds 6c and 6f and the results indicated that the compounds are non-toxic in nature.

  20. Toxicity assessment of 4-chlorophenol to aerobic granular sludge and its interaction with extracellular polymeric substances

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Dong; Wang, Yifan; Wang, Xiaodong; Li, Mengting; Han, Fei; Ju, Luyu; Zhang, Ge; Shi, Li; Li, Kai; Wang, Bingfeng [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Du, Bin, E-mail: dubin61@gmail.com [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Wei, Qin [Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China)

    2015-05-30

    Highlights: • Toxicity of 4-CP to aerobic granular sludge process was evaluated. • 3D-EEM characterized the interaction between EPS and 4-CP. • Tryptophan was the main substance result in fluorescence quenching. • The mechanism of fluorescence quenching belongs to static quenching. - Abstract: The main objective of this study was to evaluate the toxicity of 4-chlorophenol (4-CP) to aerobic granular sludge in the process of treating ammonia rich wastewater. In the short-term exposure of 4-CP of 5 and 10 mg/L, ammonia nitrogen removal efficiencies in the batch reactors decreased to 87.18 ± 2.81 and 41.16 ± 3.55%, which were remarkably lower than that of control experiment (99.83 ± 0.54%). Correspondingly, the respirometric activities of heterotrophic and autotrophic bacteria of aerobic granular sludge were significantly inhibited in the presence of 4-CP. Moreover, the main components of extracellular polymeric substances (EPS) including polysaccharides and proteins increased from 18.74 ± 0.29 and 22.57 ± 0.34 mg/g SS to 27.79 ± 0.51 and 24.69 ± 0.38 mg/g SS, respectively, indicating that the presence of 4-CP played an important role on the EPS production. Three-dimensional excitation-emission matrix (3D-EEM) fluorescence spectroscopy further showed that the intensities of EPS samples were obviously quenched with the increased of 4-CP concentrations. To be more detailed, synchronous fluorescence spectra indicated that the interaction between EPS and 4-CP was mainly caused by tryptophan residues. The mechanism of fluorescence quenching belongs to static quenching with a formation constant (K{sub A}) of 0.07 × 10{sup 4} L/mol, implying the strong formation of EPS and 4-CP complex. The results could provide reliable and accurate information to determine the potential toxicity of 4-CP on the performance of aerobic granular sludge system.

  1. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  2. Brain-derived neurotrophic factor promotes VEGF-C-dependent lymphangiogenesis by suppressing miR-624-3p in human chondrosarcoma cells.

    Science.gov (United States)

    Lin, Chih-Yang; Wang, Shih-Wei; Chen, Yen-Ling; Chou, Wen-Yi; Lin, Ting-Yi; Chen, Wei-Cheng; Yang, Chen-Yu; Liu, Shih-Chia; Hsieh, Chia-Chu; Fong, Yi-Chin; Wang, Po-Chuan; Tang, Chih-Hsin

    2017-08-03

    Chondrosarcoma is the second most common primary malignancy of bone, and one of the most difficult bone tumors to diagnose and treat. It is well known that increased levels of vascular endothelial growth factor-C (VEGF-C) promote active tumor lymphangiogenesis and lymphatic tumor spread to regional lymph nodes. Brain-derived neurotrophic factor (BDNF) is known to promote metastasis in human chondrosarcoma cells. Knowing more about the mechanism of BDNF in VEGF-C expression and lymphangiogenesis in human chondrosarcoma would improve our understanding as how to prevent chondrosarcoma angiogenesis and metastasis, which currently lacks effective adjuvant treatment. Here, we found that BDNF expression was at least 2.5-fold higher in the highly migratory JJ012(S10) cell line as compared with the primordial cell line (JJ012). In addition, VEGF-C expression and secretion was markedly increased in JJ012(S10) cells. Conditioned medium from JJ012(S10) cells significantly promoted migration and tube formation of human lymphatic endothelial cells (LECs), whereas knockdown of BDNF attenuated LEC migration and tube formation by suppressing VEGF-C production in JJ012(S10) cells. Mechanistic investigations indicated that BDNF facilitated VEGF-C-dependent lymphangiogenesis through the MEK/ERK/mTOR signaling pathway. We also showed that microRNA (miR)-624-3p expression was negatively regulated by BDNF via the MEK/ERK/mTOR cascade. Importantly, BDNF knockdown profoundly inhibited tumor-associated lymphangiogenesis in vivo. Further analyses identified that BDNF promoted tumor lymphangiogenesis by downregulating miR-624-3p in human chondrosarcoma tissues. In conclusion, this study is the first to reveal the mechanism underlying BDNF-induced lymphangiogenesis. We suggest that BDNF may serve as a promising therapeutic target for the restriction of VEGF-C-mediated tumor lymphangiogenesis and lymphatic metastasis.

  3. Elastin-derived peptides promote abdominal aortic aneurysm formation by modulating M1/M2 macrophage polarization1

    Science.gov (United States)

    Dale, Matthew A; Xiong, Wanfen; Carson, Jeffrey S; Suh, Melissa K; Karpisek, Andrew D.; Meisinger, Trevor M.; Casale, George P.; Baxter, B. Timothy

    2016-01-01

    Abdominal aortic aneurysm (AAA) is a dynamic vascular disease characterized by inflammatory cell invasion and extracellular matrix (ECM) degradation. Damage to elastin in the ECM results in release of elastin-derived peptides (EDPs), which are chemotactic for inflammatory cells such as monocytes. Their effect on macrophage polarization is less well known. Pro-inflammatory M1 macrophages initially are recruited to sites of injury but, if their effects are prolonged, they can lead to chronic inflammation that prevents normal tissue repair. Conversely, anti-inflammatory M2 macrophages reduce inflammation and aid in wound healing. Thus, a proper M1/M2 ratio is vital for tissue homeostasis. AAA tissue reveals a high M1/M2 ratio where pro-inflammatory cells and their associated markers dominate. In the present study, in vitro treatment of bone marrow-derived macrophages with EDPs induced M1 macrophage polarization. By using C57Bl/6 mice, antibody-mediated neutralization of EDPs reduced aortic dilation, matrix metalloproteinase activity, and pro-inflammatory cytokine expression at early and late time points after aneurysm induction. Furthermore, direct manipulation of the M1/M2 balance altered aortic dilation. Injection of M2 polarized macrophages reduced aortic dilation after aneurysm induction. EDPs promoted a pro-inflammatory environment in aortic tissue by inducing M1 polarization and neutralization of EDPs attenuated aortic dilation. The M1/M2 imbalance is vital to aneurysm formation. PMID:27183603

  4. Topical administration of orbital fat-derived stem cells promotes corneal tissue regeneration.

    Science.gov (United States)

    Lin, Ko-Jo; Loi, Mei-Xue; Lien, Gi-Shih; Cheng, Chieh-Feng; Pao, Hsiang-Yin; Chang, Yun-Chuang; Ji, Andrea Tung-Qian; Ho, Jennifer Hui-Chun

    2013-06-14

    Topical administration of eye drops is the major route for drug delivery to the cornea. Orbital fat-derived stem cells (OFSCs) possess an in vitro corneal epithelial differentiation capacity. Both the safety and immunomodulatory ability of systemic OFSC transplantation were demonstrated in our previous work. In this study, we investigated the safety, therapeutic effect, and mechanism(s) of topical OFSC administration in an extensive alkali-induced corneal wound. Corneal injury was created by contact of a piece of 0.5 N NaOH-containing filter paper on the corneal surface of a male Balb/c mouse for 30 s. The area of the filter paper covered the central 70% or 100% of the corneal surface. OFSCs (2 × 10(5)) in 5 μl phosphate-buffered saline (PBS) were given by topical administration (T) twice a day or by two intralimbal (IL) injections in the right cornea, while 5 μl of PBS in the left cornea served as the control. Topical OFSCs promoted corneal re-epithelialization of both the limbal-sparing and limbal-involved corneal wounds. In the first three days, topical OFSCs significantly reduced alkali-induced corneal edema and stromal infiltration according to a histopathological examination. Immunohistochemistry and immunofluorescence staining revealed that transplanted cells were easily detectable in the corneal epithelium, limbal epithelium and stroma, but only some of transplanted cells at the limbal epithelium had differentiated into cytokeratin 3-expressing cells. OFSCs did not alter neutrophil (Ly6G) levels in the cornea, but significantly reduced macrophage (CD68) infiltration and inducible nitrous oxide synthetase (iNOS) production during acute corneal injury as quantified by a Western blot analysis. Continuous topical administration of OFSCs for seven days improved corneal transparency, and this was accompanied by diffuse stromal engraftment of transplanted cells and differentiation into p63-expressing cells at the limbal area. The therapeutic effect of the

  5. Topical administration of orbital fat-derived stem cells promotes corneal tissue regeneration

    Science.gov (United States)

    2013-01-01

    Introduction Topical administration of eye drops is the major route for drug delivery to the cornea. Orbital fat-derived stem cells (OFSCs) possess an in vitro corneal epithelial differentiation capacity. Both the safety and immunomodulatory ability of systemic OFSC transplantation were demonstrated in our previous work. In this study, we investigated the safety, therapeutic effect, and mechanism(s) of topical OFSC administration in an extensive alkali-induced corneal wound. Methods Corneal injury was created by contact of a piece of 0.5 N NaOH-containing filter paper on the corneal surface of a male Balb/c mouse for 30 s. The area of the filter paper covered the central 70% or 100% of the corneal surface. OFSCs (2 × 105) in 5 μl phosphate-buffered saline (PBS) were given by topical administration (T) twice a day or by two intralimbal (IL) injections in the right cornea, while 5 μl of PBS in the left cornea served as the control. Results Topical OFSCs promoted corneal re-epithelialization of both the limbal-sparing and limbal-involved corneal wounds. In the first three days, topical OFSCs significantly reduced alkali-induced corneal edema and stromal infiltration according to a histopathological examination. Immunohistochemistry and immunofluorescence staining revealed that transplanted cells were easily detectable in the corneal epithelium, limbal epithelium and stroma, but only some of transplanted cells at the limbal epithelium had differentiated into cytokeratin 3-expressing cells. OFSCs did not alter neutrophil (Ly6G) levels in the cornea, but significantly reduced macrophage (CD68) infiltration and inducible nitrous oxide synthetase (iNOS) production during acute corneal injury as quantified by a Western blot analysis. Continuous topical administration of OFSCs for seven days improved corneal transparency, and this was accompanied by diffuse stromal engraftment of transplanted cells and differentiation into p63-expressing cells at the limbal area. The

  6. Hollow-fiber-supported liquid phase microextraction with in situ derivatization and gas chromatography-mass spectrometry for determination of chlorophenols in human urine samples.

    Science.gov (United States)

    Ito, Rie; Kawaguchi, Migaku; Honda, Hidehiro; Koganei, Youji; Okanouchi, Noriya; Sakui, Norihiro; Saito, Koichi; Nakazawa, Hiroyuki

    2008-09-01

    A simple and highly sensitive method that involves hollow-fiber-supported liquid phase microextraction (HF-LPME) with in situ derivatization and gas chromatography-mass spectrometry (GC-MS) was developed for the determination of chlorophenols (CPs) such as 2,4-dichlorophenol (DCP), 2,4,6-trichlorophenol (TrCP), 2,3,4,6-tetrachlorophenol (TeCP) and pentachlorophenol (PCP) in human urine samples. Human urine samples were enzymatically de-conjugated with beta-glucuronidase and sulfatase. After de-conjugation, HF-LPME with in situ derivatization was performed. After extraction, 2 microl of extract was carefully withdrawn into a syringe and injected into the GC-MS system. The limits of detection (S/N=3) and quantification (S/N>10) of CPs in the human urine samples are 0.1-0.2 ng ml(-1) and 0.5-1 ng ml(-1), respectively. The calibration curve for CPs is linear with a correlation coefficient of >0.99 in the range of 0.5-500 ng ml(-1) for DCP and TrCP, and of 1-500 ng ml(-1) for TeCP and PCP, respectively. The average recoveries of CPs (n=6) in human urine samples are 81.0-104.0% (R.S.D.: 1.9-6.6%) with correction using added surrogate standards. When the proposed method was applied to human urine samples, CPs were detected at sub-ng ml(-1) level.

  7. Triisobutylaluminium (TIBAL Promoted Rearrangement of C-glycosides

    Directory of Open Access Journals (Sweden)

    P. Sinay

    2005-08-01

    Full Text Available Triisobutylaluminium-promoted rearrangement of unsaturated glycosides containing electron-donating aglycons, such as C-aryl glycosides, provides direct access to highly functionalised cyclohexane derivatives.

  8. Physical Selectivity of Molecularly Imprinted polymers evaluated through free volume size distributions derived from Positron Lifetime Spectroscopy

    Science.gov (United States)

    Pasang, T.; Ranganathaiah, C.

    2015-06-01

    The technique of imprinting molecules of various sizes in a stable structure of polymer matrix has derived multitudes of applications. Once the template molecule is extracted from the polymer matrix, it leaves behind a cavity which is physically (size and shape) and chemically (functional binding site) compatible to the particular template molecule. Positron Annihilation Lifetime Spectroscopy (PALS) is a well known technique to measure cavity sizes precisely in the nanoscale and is not being used in the field of MIPs effectively. This method is capable of measuring nanopores and hence suitable to understand the physical selectivity of the MIPs better. With this idea in mind, we have prepared molecular imprinted polymers (MIPs) with methacrylicacid (MAA) as monomer and EGDMA as cross linker in different molar ratio for three different size template molecules, viz. 4-Chlorophenol (4CP)(2.29 Å), 2-Nephthol (2NP) (3.36 Å) and Phenolphthalein (PP) (4.47Å). FTIR and the dye chemical reactions are used to confirm the complete extraction of the template molecules from the polymer matrix. The free volume size and its distribution have been derived from the measured o-Ps lifetime spectra. Based on the free volume distribution analysis, the percentage of functional cavities for the three template molecules are determined. Percentage of functional binding cavities for 4-CP molecules has been found out to be 70.2% and the rest are native cavities. Similarly for 2NP it is 81.5% and nearly 100% for PP. Therefore, PALS method proves to be very precise and accurate for determining the physical selectivity of MIPs.

  9. Preparation of three-dimensional mesoporous polymer in situ polymerization solid phase microextraction fiber and its application to the determination of seven chlorophenols.

    Science.gov (United States)

    Wang, Xuemei; Wang, Huan; Huang, Pengfei; Ma, Xiaomin; Lu, Xiaoquan; Du, Xinzhen

    2017-01-06

    A superior solid-phase microextraction (SPME) fiber-coating material, three dimensional order mesoporous polymers with Ia-3d bicontinuous cubic structure (3D-OMPs) was in situ coated on a stainless steel wire by solvent evaporation induced self-assembly (EISA) and thermo-polymerization. Fourier-transform infrared spectrometry (FTIR), transmission electron microscopy (TEM), scanning electron microscopy (SEM), small-angel X-ray diffraction (SAXRD), N 2 adsorption-desorption transmission, and thermogravimetry analysis (TGA) were applied to the characterization of the synthesized 3D-OMPs coating. The performance and feasibility of the homemade fiber was evaluated through direct immersion (DI) SPME followed by high-performance liquid chromatography-UV detector (HPLC-UV) for the simultaneous extraction of seven chlorophenols in water samples. Under the optimum conditions, the prepared fiber exhibited excellent extraction properties as compared to three commercial fibers, the DI-SPME-HPLC-UV method showed low limits of detection (0.32-1.85μgL -1 ), wide linear ranges (5.0-1000μgL -1 ), and acceptable reproducibility (relative standard deviation, RSD<7.6% for one fiber, RSD<8.9% for fiber to fiber). Moreover, the method was further successfully applied to the analysis of seven CPs in real samples with good recoveries (80.5-99.5%) and satisfactory precisions (RSD<9.2%). It was confirmed that the proposed method has high sensitivity, outstanding selectivity and good reproducibility to the determination of trace CPs in the environmental water. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Impact of Environmental Factors on Bacteriocin Promoter Activity in Gut-Derived Lactobacillus salivarius.

    Science.gov (United States)

    Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D

    2015-11-01

    Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. N-Cadherin Upregulation Promotes the Neurogenic Differentiation of Menstrual Blood-Derived Endometrial Stem Cells.

    Science.gov (United States)

    Liu, Yanli; Yang, Fen; Liang, Shengying; Liu, Qing; Fu, Sulei; Wang, Zhenyu; Yang, Ciqing; Lin, Juntang

    2018-01-01

    Peripheral nerve injuries are typically caused by either trauma or medical disorders, and recently, stem cell-based therapies have provided a promising treatment approach. Menstrual blood-derived endometrial stem cells (MenSCs) are considered an ideal therapeutic option for peripheral nerve repair due to a noninvasive collection procedure and their high proliferation rate and immunological tolerance. Here, we successfully isolated MenSCs and examined their biological characteristics including their morphology, multipotency, and immunophenotype. Subsequent in vitro studies demonstrated that MenSCs express high levels of neurotrophic factors, such as NT3, NT4, BDNF, and NGF, and are capable of transdifferentiating into glial-like cells under conventional induction conditions. Moreover, upregulation of N-cadherin (N-cad) mRNA and protein expression was observed after neurogenic differentiation. In vivo studies clearly showed that N-cad knockdown via in utero electroporation perturbed the migration and maturation of mouse neural precursor cells (NPCs). Finally, a further transfection assay also confirmed that N-cad upregulation in MenSCs results in the expression of S100. Collectively, our results confirmed the paracrine effect of MenSCs on neuroprotection as well as their potential for transdifferentiation into glial-like cells and demonstrated that N-cad upregulation promotes the neurogenic differentiation of MenSCs, thereby providing support for transgenic MenSC-based therapy for peripheral nerve injury.

  12. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  13. Interval and continuous exercise regimens suppress neutrophil-derived microparticle formation and neutrophil-promoted thrombin generation under hypoxic stress.

    Science.gov (United States)

    Chen, Yi-Ching; Ho, Ching-Wen; Tsai, Hsing-Hua; Wang, Jong-Shyan

    2015-04-01

    Acute hypoxic exposure increases vascular thrombotic risk. The release of procoagulant-rich microparticles from neutrophils accelerates the pathogenesis of inflammatory thrombosis. The present study explicates the manner in which interval and continuous exercise regimens affect neutrophil-derived microparticle (NDMP) formation and neutrophil/NDMP-mediated thrombin generation (TG) under hypoxic condition. A total of 60 sedentary males were randomized to perform either aerobic interval training [AIT; 3-min intervals at 40% and 80% V̇O2max (maximal O2 consumption)] or moderate continuous training (MCT; sustained 60% V̇O2max) for 30 min/day, 5 days/week for 5 weeks, or to a control (CTL) group who did not receive any form of training. At rest and immediately after hypoxic exercise test (HE, 100 W under 12% O2 for 30 min), the NDMP characteristics and dynamic TG were measured by flow cytometry and thrombinography respectively. Before the intervention, HE (i) elevated coagulant factor VIII/fibrinogen concentrations and shortened activated partial thromboplastin time (aPTT), (ii) increased total and tissue factor (TF)-rich/phosphatidylserine (PS)-exposed NDMP counts and (iii) enhanced the peak height and rate of TG promoted by neutrophils/NDMPs. Following the 5-week intervention, AIT exhibited higher enhancement of V̇O2max than did MCT. Notably, both MCT and AIT attenuated the extents of HE-induced coagulant factor VIII/fibrinogen elevations and aPTT shortening. Furthermore, the two exercise regimens significantly decreased TF-rich/PS-exposed NDMP formation and depressed neutrophil/NDMP-mediated dynamic TG at rest and following HE. Hence, we conclude that AIT is superior to MCT for enhancing aerobic capacity. Moreover, either AIT or MCT effectively ameliorates neutrophil/NDMP-promoted TG by down-regulating expression of procoagulant factors during HE, which may reduce thrombotic risk evoked by hypoxia. Moreover, either AIT or MCT effectively ameliorates neutrophil/NDMP-promoted

  14. Gastric cancer tissue-derived mesenchymal stem cells impact peripheral blood mononuclear cells via disruption of Treg/Th17 balance to promote gastric cancer progression.

    Science.gov (United States)

    Wang, Mei; Chen, Bin; Sun, Xiao-Xian; Zhao, Xiang-Dong; Zhao, Yuan-Yuan; Sun, Li; Xu, Chang-Gen; Shen, Bo; Su, Zhao-Liang; Xu, Wen-Rong; Zhu, Wei

    2017-12-01

    Gastric cancer tissue-derived mesenchymal stem cells (GC-MSCs) are important resident stromal cells in the tumor microenvironment (TME) and have been shown to play a key role in gastric cancer progression. Whether GC-MSCs exert a tumor-promoting function by affecting anti-tumor immunity is still unclear. In this study, we used GC-MSC conditioned medium (GC-MSC-CM) to pretreat peripheral blood mononuclear cells (PBMCs) from healthy donors. We found that GC-MSC-CM pretreatment markedly reversed the inhibitory effect of PBMCs on gastric cancer growth in vivo, but did not affect functions of PBMCs on gastric cancer cell proliferation, cell cycle and apoptosis in vitro. PBMCs pretreated with GC-MSC-CM significantly promoted gastric cancer migration and epithelial-mesenchymal transition in vitro and liver metastases in vivo. Flow cytometry analysis showed that GC-MSC-CM pretreatment increased the proportion of Treg cells and reduced that of Th17 cells in PBMCs. CFSE labeling and naïve CD4 + T cells differentiation analysis revealed that GC-MSC-CM disrupted the Treg/Th17 balance in PBMCs by suppressing Th17 cell proliferation and inducing differentiation of Treg cells. Overall, our collective results indicate that GC-MSCs impair the anti-tumor immune response of PBMCs through disruption of Treg/Th17 balance, thus providing new evidence that gastric cancer tissue-derived MSCs contribute to the immunosuppressive TME. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Calreticulin Fragment 39-272 Promotes B16 Melanoma Malignancy through Myeloid-Derived Suppressor Cells In Vivo

    Directory of Open Access Journals (Sweden)

    Xiao-Yan He

    2017-10-01

    Full Text Available Calreticulin (CRT, a multifunctional Ca2+-binding glycoprotein mainly located in the endoplasmic reticulum, is a tumor-associated antigen that has been shown to play protective roles in angiogenesis suppression and anti-tumor immunity. We previously reported that soluble CRT (sCRT was functionally similar to heat shock proteins or damage-associated molecular patterns in terms of ability to activate myeloid cells and elicit strong inflammatory cytokine production. In the present study, B16 melanoma cell lines expressing recombinant CRT fragment 39-272 (sCRT/39-272 in secreted form (B16-CRT, or recombinant enhanced green fluorescence protein (rEGFP (B16-EGFP, were constructed for investigation on the roles of sCRT in tumor development. When s.c. inoculated into C57BL/6 mice, the B16-CRT cells were significantly more aggressive (in terms of solid tumor growth rate than B16-EGFP controls in a TLR4- and myeloid-derived suppressor cells (MDSC-dependent manner. The B16-CRT-bearing mice showed increased Gr1+ MDSC infiltration in tumor tissues, accelerated proliferation of CD11b+Ly6G+Ly6Clow (G-MDSC precursors in bone marrow, and higher percentages of G-MDSCs in spleen and blood, which was mirrored by decreased percentage of dendritic cells (DC in periphery. In in vitro studies, recombinant sCRT/39-272 was able to promote migration and survival of tumor-derived MDSCs via interaction with TLR4, inhibit MDSC differentiation into DC, and also elicit expression of inflammatory proteins S100A8 and S100A9 which are essential for functional maturation and chemotactic migration of MDSCs. Our data provide solid evidence for CRT as a double-edged sword in tumor development.

  16. Promoting effects of adipose-derived stem cells on breast cancer cells are reversed by radiation therapy.

    Science.gov (United States)

    Baaße, Annemarie; Juerß, Dajana; Reape, Elaine; Manda, Katrin; Hildebrandt, Guido

    2018-04-01

    Partial breast irradiation of early breast cancer patients after lumpectomy and the use of endogenous adipose tissue (AT) for breast reconstruction are promising applications to reduce the side effects of breast cancer therapy. This study tries to investigate the possible risks associated with these therapeutic approaches. It also examines the influence of adipose derived stem cells (ADSCs) as part of the breast cancer microenvironment, and endogenous AT on breast cancer cells following radiation therapy. ADSCs, isolated from human reduction mammoplasties of healthy female donors, exhibited multilineage capacity and specific surface markers. The promoting effects of ADSCs on the growth and survival fraction of breast cancer cells were reversed by treatment with high (8 Gy) or medium (2 Gy) radiation doses. In addition, a suppressing influence on breast cancer growth could be detected by co-culturing with irradiated ADSCs (8 Gy). Furthermore the clonogenic survival of unirradiated tumor cells was reduced by medium of irradiated ADSCs. In conclusion, radiation therapy changed the interactions of ADSCs and breast cancer cells. On the basis of our work, the importance of further studies to exclude potential risks of ADSCs in regenerative applications and radiotherapy has been emphasized.

  17. Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuro-regenerative mechanisms.

    Science.gov (United States)

    Sakai, Kiyoshi; Yamamoto, Akihito; Matsubara, Kohki; Nakamura, Shoko; Naruse, Mami; Yamagata, Mari; Sakamoto, Kazuma; Tauchi, Ryoji; Wakao, Norimitsu; Imagama, Shiro; Hibi, Hideharu; Kadomatsu, Kenji; Ishiguro, Naoki; Ueda, Minoru

    2012-01-01

    Spinal cord injury (SCI) often leads to persistent functional deficits due to loss of neurons and glia and to limited axonal regeneration after injury. Here we report that transplantation of human dental pulp stem cells into the completely transected adult rat spinal cord resulted in marked recovery of hind limb locomotor functions. Transplantation of human bone marrow stromal cells or skin-derived fibroblasts led to substantially less recovery of locomotor function. The human dental pulp stem cells exhibited three major neuroregenerative activities. First, they inhibited the SCI-induced apoptosis of neurons, astrocytes, and oligodendrocytes, which improved the preservation of neuronal filaments and myelin sheaths. Second, they promoted the regeneration of transected axons by directly inhibiting multiple axon growth inhibitors, including chondroitin sulfate proteoglycan and myelin-associated glycoprotein, via paracrine mechanisms. Last, they replaced lost cells by differentiating into mature oligodendrocytes under the extreme conditions of SCI. Our data demonstrate that tooth-derived stem cells may provide therapeutic benefits for treating SCI through both cell-autonomous and paracrine neuroregenerative activities.

  18. Adipose-derived stem cells seeded in Pluronic F-127 hydrogel promotes diabetic wound healing.

    Science.gov (United States)

    Kaisang, Lin; Siyu, Wang; Lijun, Fan; Daoyan, Pan; Xian, Cory J; Jie, Shen

    2017-09-01

    Chronic nonhealing wound is a multifactorial complication of diabetes that results specifically as a consequence of impaired angiogenesis and currently lacks in effective treatments. Although a stem cell-based therapy may provide a novel treatment to augment diabetic wound healing, inferior cell survival at the diabetic skin wound is one of the key causes that are responsible for the low efficacy of the stem cell therapy. In this work, we used an injectable, biocompatible, and thermosensitive hydrogel Pluronic F-127 to encapsulate allogeneic nondiabetic adipose-derived stem cells (ADSCs) and topically applied the cells to a full-thickness cutaneous wound in the streptozotocin-induced diabetic model in rats. The cells seeded in the hydrogel enhanced angiogenesis (CD31 marker) and promoted the cell proliferation (Ki67 marker) at the wound site and significantly accelerated wound closure, which was accompanied by facilitated regeneration of granulation tissue. Consistently, levels of the messenger RNA expression of key angiogenesis growth factor, vascular endothelial growth factor, and key wound healing growth factor, transforming growth factor beta 1, were also upregulated in the cell-treated wounds when compared with untreated wounds. The results indicated that the transplantation of allogeneic ADSCs via the hydrogel improves the efficiency of cell delivery and optimizes the performance of ADSCs for augmenting diabetic wound healing. In conclusion, this ADSC-based therapy may provide a novel therapeutic strategy for the treatment of nonhealing diabetic foot ulcers. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Cobalt Ion Promoted Redox Cascade: A Route to Spiro Oxazine-Oxazepine Derivatives and a Dinuclear Cobalt(III) Complex of an N-(1,4-Naphthoquinone)-o-aminophenol Derivative.

    Science.gov (United States)

    Mondal, Sandip; Bera, Sachinath; Maity, Suvendu; Ghosh, Prasanta

    2017-11-06

    The study discloses that the redox activity of N-(1,4-naphthoquinone)-o-aminophenol derivatives (L R H 2 ) containing a (phenol)-NH-(1,4-naphthoquinone) fragment is notably different from that of a (phenol)-NH-(phenol) precursor. The former is a platform for a redox cascade. L R H 2 is redox noninnocent and exists in Cat-N-(1,4-naphthoquinone)(2-) (L R 2- ) and SQ-N-(1,4-naphthoquinone) (L R •- ) states in the complexes. Reactions of L R H 2 with cobalt(II) salts in MeOH in air promote a cascade affording spiro oxazine-oxazepine derivatives ( OX L R ) in good yields, when R = H, Me, t Bu. Spiro oxazine-oxazepine derivatives are bioactive, and such a molecule has so far not been isolated by a schematic route. In this context this cascade is significant. Dimerization of L R H 2 → OX L R in MeOH is a (6H + + 6e) oxidation reaction and is composed of formations of four covalent bonds and 6-exo-trig and 7-endo-trig cyclization based on C-O coupling reactions, where MeOH is the source of a proton and the ester function. It was established that the active cascade precursor is [(L Me •- )Co III Cl 2 ] (A). Notably, formation of a spiro derivative was not detected in CH 3 CN and the reaction ends up furnishing A. The route of the reaction is tunable by R, when R = NO 2 , it is a (2e + 4H + ) oxidation reaction affording a dinuclear L R 2- complex of cobalt(III) of the type [(L NO2 2- ) 2 Co III 2 (OMe) 2 (H 2 O) 2 ] (1) in good yields. No cascade occurs with zinc(II) ion even in MeOH and produces a L Me •- complex of type [(L Me •- )Zn II Cl 2 ] (2). The intermediate A and 2 exhibit strong EPR signals at g = 2.008 and 1.999, confrming the existence of L Me •- coordinated to low-spin cobalt(III) and zinc(II) ions. The intermediates of L R H 2 → OX L R conversion were analyzed by ESI mass spectrometry. The molecular geometries of OX L R and 1 were confirmed by X-ray crystallography, and the spectral features were elucidated by TD DFT calculations.

  20. Either brain-derived neurotrophic factor or neurotrophin-3 only neurotrophin-producing grafts promote locomotor recovery in untrained spinalized cats.

    Science.gov (United States)

    Ollivier-Lanvin, Karen; Fischer, Itzhak; Tom, Veronica; Houlé, John D; Lemay, Michel A

    2015-01-01

    Background. Transplants of cellular grafts expressing a combination of 2 neurotrophic factors, brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) have been shown to promote and enhance locomotor recovery in untrained spinalized cats. Based on the time course of recovery and the absence of axonal growth through the transplants, we hypothesized that recovery was due to neurotrophin-mediated plasticity within the existing locomotor circuitry of the lumbar cord. Since BDNF and NT-3 have different effects on axonal sprouting and synaptic connectivity/strengthening, it becomes important to ascertain the contribution of each individual neurotrophins to recovery. Objective. We studied whether BDNF or NT-3 only producing cellular grafts would be equally effective at restoring locomotion in untrained spinal cats. Methods. Rat fibroblasts secreting one of the 2 neurotrophins were grafted into the T12 spinal transection site of adult cats. Four cats in each group (BDNF alone or NT-3 alone) were evaluated. Locomotor recovery was tested on a treadmill at 3 and 5 weeks post-transection/grafting. Results. Animals in both groups were capable of plantar weight-bearing stepping at speed up to 0.8 m/s as early as 3 weeks and locomotor capabilities were similar at 3 and 5 weeks for both types of graft. Conclusions. Even without locomotor training, either BDNF or NT-3 only producing grafts promote locomotor recovery in complete spinal animals. More clinically applicable delivery methods need to be developed. © The Author(s) 2014.

  1. Histone deacetylase 4 promotes TGF-beta1-induced synovium-derived stem cell chondrogenesis but inhibits chondrogenically differentiated stem cell hypertrophy.

    Science.gov (United States)

    Pei, Ming; Chen, Demeng; Li, Jingting; Wei, Lei

    2009-12-01

    The transforming growth factor-beta (TGF-beta) superfamily members play diverse roles in cartilage development and maintenance. TGF-beta up-regulates chondrogenic gene expression by enhancing transcription factor SRY (sex determining region Y)-box 9 (Sox9) and inhibits osteoblast differentiation by repressing runt-related transcription factor 2 (Runx2). Recently, histone deacetylases (HDACs) were reported to act as negative regulators of chondrocyte hypertrophy. It was speculated that HDAC4 may promote TGF-beta1-induced MSC chondrogenesis. In this study, the adenovirus-mediated HDAC4 gene (Ad.HDAC4) was utilized to infect synovium-derived stem cells (SDSCs). Adenovirus-mediated LacZ (Ad.LacZ) served as a control. The infected cells were centrifuged to form SDSC pellets followed by incubation in a serum-free chondrogenic medium for 15 days with or without 10ng/mL TGF-beta1. Transfection efficiency was determined in SDSCs using Ad.LacZ. Cytotoxicity was measured using lactate dehydrogenase assay. Histology, immunostaining, biochemical analysis, and real-time polymerase chain reaction were performed to assess chondrogenesis at protein and mRNA levels in infected SDSCs. Our data demonstrated that supplementation with TGF-beta1 could initiate and promote SDSC chondrogenesis; however, TGF-beta1 alone was insufficient to fully differentiate SDSCs into chondrocytes. Ad.HDAC4 could be efficiently transfected into SDSCs. Without TGF-beta1 treatment, HDAC4 had no effect on SDSC chondrogenesis; however, in the presence of TGF-beta1, HDAC4 could speed up and maintain a high level of chondrogenesis while down-regulating the hypertrophic marker - type X collagen expression. This study is the first report showing that HDAC4 overexpression promotes TGF-beta1-induced SDSC chondrogenesis but inhibits chondrogenically differentiated stem cell hypertrophy. The mechanism underlying this process needs further investigation.

  2. Rapid photo-degradation of 2-chlorophenol under visible light irradiation using cobalt oxide-loaded TiO2/reduced graphene oxide nanocomposite from aqueous media.

    Science.gov (United States)

    Sharma, Ajit; Lee, Byeong-Kyu

    2016-01-01

    The photocatalytic removal of 2-chlorophenol (2-CP) from water environment was investigated by TiO2-RGO-CoO. Cobalt oxide-loaded TiO2 (TiO2-CoO) supported with reduced graphene oxide (RGO) was synthesized using a sol-gel method and then annealed at 500 °C for 5 min. The material characteristics were analyzed by UV-Vis analysis, Fourier transform infrared (FTIR) spectroscopy, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), scanning electron microscopy (SEM) and energy dispersive X-ray (EDX) spectroscopy. Incorporation of cobalt oxide and RGO into the TiO2 system (TiO2-RGO-CoO) lowered the band gap energy to 2.83 eV, which greatly enhanced the visible light absorption. The TiO2-RGO-CoO photocatalyst showed complete removal of 20 mg/L 2-CP within 8 h with the addition of 0.01% H2O2 under 100 W visible light irradiation. The photo-degradation efficiency of 2-CP (10 mg/L) was 35.2, 48.9, 58.9 and 98.2% for TiO2, TiO2-RGO, TiO2-CoO and TiO2-RGO-CoO, respectively, in the presence of visible light irradiation at solution pH of 6.0. The TiO2-RGO-CoO photocatalyst retained its high removal efficiency even after five photocatalytic cycles. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Systemic T Cells Immunosuppression of Glioma Stem Cell-Derived Exosomes Is Mediated by Monocytic Myeloid-Derived Suppressor Cells.

    Directory of Open Access Journals (Sweden)

    Rossana Domenis

    Full Text Available A major contributing factor to glioma development and progression is its ability to evade the immune system. Nano-meter sized vesicles, exosomes, secreted by glioma-stem cells (GSC can act as mediators of intercellular communication to promote tumor immune escape. Here, we investigated the immunomodulatory properties of GCS-derived exosomes on different peripheral immune cell populations. Healthy donor peripheral blood mononuclear cells (PBMCs stimulated with anti-CD3, anti-CD28 and IL-2, were treated with GSC-derived exosomes. Phenotypic characterization, cell proliferation, Th1/Th2 cytokine secretion and intracellular cytokine production were analysed by distinguishing among effector T cells, regulatory T cells and monocytes. In unfractionated PBMCs, GSC-derived exosomes inhibited T cell activation (CD25 and CD69 expression, proliferation and Th1 cytokine production, and did not affect cell viability or regulatory T-cell suppression ability. Furthermore, exosomes were able to enhance proliferation of purified CD4+ T cells. In PBMCs culture, glioma-derived exosomes directly promoted IL-10 and arginase-1 production and downregulation of HLA-DR by unstimulated CD14+ monocytic cells, that displayed an immunophenotype resembling that of monocytic myeloid-derived suppressor cells (Mo-MDSCs. Importantly, the removal of CD14+ monocytic cell fraction from PBMCs restored T-cell proliferation. The same results were observed with exosomes purified from plasma of glioblastoma patients. Our results indicate that glioma-derived exosomes suppress T-cell immune response by acting on monocyte maturation rather than on direct interaction with T cells. Selective targeting of Mo-MDSC to treat glioma should be considered with regard to how immune cells allow the acquirement of effector functions and therefore counteracting tumor progression.

  4. Lanthanum-promoted copper-based hydrotalcites derived mixed oxides for NO{sub x} adsorption, soot combustion and simultaneous NO{sub x}-soot removal

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhongpeng [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom); Yan, Xiaotong; Bi, Xinlin; Wang, Liguo [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Zhang, Zhaoliang, E-mail: chm_zhangzl@ujn.edu.cn [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Jiang, Zheng; Xiao, Tiancun [Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom); Umar, Ahmad [Department of Chemistry, College of Science and Arts, Najran University, P.O. Box 1988, Najran 11001 (Saudi Arabia); Promising Centre for Sensors and Electronic Devices (PCSED), Najran University, P.O. Box 1988, Najran 11001 (Saudi Arabia); Wang, Qiang, E-mail: qiang.wang.ox@gmail.com [College of Environmental Science and Engineering, Beijing Forestry University, 35 Tsinghua East Road, Beijing 100083 (China)

    2014-03-01

    Graphical abstract: - Highlights: • The addition of La in Cu-based oxides increased the types of active oxygen. • NO{sub x} adsorption, soot oxidation and simultaneous NO{sub x}-soot removal were enhanced. • The possible catalytic mechanism was studied via in situ FTIR analysis. • Soot oxidation was promoted by the NO{sub 2} intermediate. - Abstract: La-promoted Cu-based hydrotalcites derived mixed oxides were prepared and their catalytic activities for NO{sub x} adsorption, soot oxidation, and simultaneous NO{sub x}-soot removal were investigated. The catalysts were characterized by XRD, DTG, BET, FTIR, H2-TPR, TPD and TPO techniques. The oxides catalysts exhibited mesoporous properties with specific surface area of 45–160 m{sup 2}/g. The incorporation of La and Cu decreased the amount of basic sites due to the large decrease in surface areas. Under O{sub 2} atmosphere, La incorporation is dominant for soot oxidation activity, while Cu favors high selectivity to CO{sub 2} formation. A synergetic effect between La and Cu for catalyzed soot oxidation lies in the improved redox property and suitable basicity. The presence of NO in O{sub 2} significantly promoted soot oxidation on the catalysts with the ignition temperature decreased to about 300 °C. In O{sub 2}/NO atmosphere, NO{sub 2} acts as an intermediate which oxidizes soot to CO{sub 2} at a lower temperature with itself reduced to NO or N{sub 2}, contributing to the high catalytic performance in simultaneous removal of NO{sub x} and soot.

  5. Low-frequency pulsed electromagnetic field pretreated bone marrow-derived mesenchymal stem cells promote the regeneration of crush-injured rat mental nerve.

    Science.gov (United States)

    Seo, NaRi; Lee, Sung-Ho; Ju, Kyung Won; Woo, JaeMan; Kim, BongJu; Kim, SoungMin; Jahng, Jeong Won; Lee, Jong-Ho

    2018-01-01

    Bone marrow-derived mesenchymal stem cells (BMSCs) have been shown to promote the regeneration of injured peripheral nerves. Pulsed electromagnetic field (PEMF) reportedly promotes the proliferation and neuronal differentiation of BMSCs. Low-frequency PEMF can induce the neuronal differentiation of BMSCs in the absence of nerve growth factors. This study was designed to investigate the effects of low-frequency PEMF pretreatment on the proliferation and function of BMSCs and the effects of low-frequency PEMF pre-treated BMSCs on the regeneration of injured peripheral nerve using in vitro and in vivo experiments. In in vitro experiments, quantitative DNA analysis was performed to determine the proliferation of BMSCs, and reverse transcription-polymerase chain reaction was performed to detect S100 (Schwann cell marker), glial fibrillary acidic protein (astrocyte marker), and brain-derived neurotrophic factor and nerve growth factor (neurotrophic factors) mRNA expression. In the in vivo experiments, rat models of crush-injured mental nerve established using clamp method were randomly injected with low-frequency PEMF pretreated BMSCs, unpretreated BMSCs or PBS at the injury site (1 × 10 6 cells). DiI-labeled BMSCs injected at the injury site were counted under the fluorescence microscope to determine cell survival. One or two weeks after cell injection, functional recovery of the injured nerve was assessed using the sensory test with von Frey filaments. Two weeks after cell injection, axonal regeneration was evaluated using histomorphometric analysis and retrograde labeling of trigeminal ganglion neurons. In vitro experiment results revealed that low-frequency PEMF pretreated BMSCs proliferated faster and had greater mRNA expression of growth factors than unpretreated BMSCs. In vivo experiment results revealed that compared with injection of unpretreated BMSCs, injection of low-frequency PEMF pretreated BMSCs led to higher myelinated axon count and axon density and

  6. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora; Marasco, Ramona; Saderi, Stefano; Corretto, Erika; Mapelli, Francesca; Cherif, Ameur; Borin, Sara; Valenti, Leonardo; Sorlini, Claudia; Daffonchio, Daniele

    2016-01-01

    of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant

  7. T Follicular Helper Cells Promote a Beneficial Gut Ecosystem for Host Metabolic Homeostasis by Sensing Microbiota-Derived Extracellular ATP.

    Science.gov (United States)

    Perruzza, Lisa; Gargari, Giorgio; Proietti, Michele; Fosso, Bruno; D'Erchia, Anna Maria; Faliti, Caterina Elisa; Rezzonico-Jost, Tanja; Scribano, Daniela; Mauri, Laura; Colombo, Diego; Pellegrini, Giovanni; Moregola, Annalisa; Mooser, Catherine; Pesole, Graziano; Nicoletti, Mauro; Norata, Giuseppe Danilo; Geuking, Markus B; McCoy, Kathy D; Guglielmetti, Simone; Grassi, Fabio

    2017-03-14

    The ATP-gated ionotropic P2X7 receptor regulates T follicular helper (Tfh) cell abundance in the Peyer's patches (PPs) of the small intestine; deletion of P2rx7, encoding for P2X7, in Tfh cells results in enhanced IgA secretion and binding to commensal bacteria. Here, we show that Tfh cell activity is important for generating a diverse bacterial community in the gut and that sensing of microbiota-derived extracellular ATP via P2X7 promotes the generation of a proficient gut ecosystem for metabolic homeostasis. The results of this study indicate that Tfh cells play a role in host-microbiota mutualism beyond protecting the intestinal mucosa by induction of affinity-matured IgA and suggest that extracellular ATP constitutes an inter-kingdom signaling molecule important for selecting a beneficial microbial community for the host via P2X7-mediated regulation of B cell help. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. T Follicular Helper Cells Promote a Beneficial Gut Ecosystem for Host Metabolic Homeostasis by Sensing Microbiota-Derived Extracellular ATP

    Directory of Open Access Journals (Sweden)

    Lisa Perruzza

    2017-03-01

    Full Text Available The ATP-gated ionotropic P2X7 receptor regulates T follicular helper (Tfh cell abundance in the Peyer’s patches (PPs of the small intestine; deletion of P2rx7, encoding for P2X7, in Tfh cells results in enhanced IgA secretion and binding to commensal bacteria. Here, we show that Tfh cell activity is important for generating a diverse bacterial community in the gut and that sensing of microbiota-derived extracellular ATP via P2X7 promotes the generation of a proficient gut ecosystem for metabolic homeostasis. The results of this study indicate that Tfh cells play a role in host-microbiota mutualism beyond protecting the intestinal mucosa by induction of affinity-matured IgA and suggest that extracellular ATP constitutes an inter-kingdom signaling molecule important for selecting a beneficial microbial community for the host via P2X7-mediated regulation of B cell help.

  9. Hepatocyte growth factor is constitutively produced by donor-derived bone marrow cells and promotes regeneration of pancreatic β-cells

    International Nuclear Information System (INIS)

    Izumida, Yoshihiko; Aoki, Takeshi; Yasuda, Daisuke; Koizumi, Tomotake; Suganuma, Chisaki; Saito, Koji; Murai, Noriyuki; Shimizu, Yoshinori; Hayashi, Ken; Odaira, Masanori; Kusano, Tomokazu; Kushima, Miki; Kusano, Mitsuo

    2005-01-01

    Recent studies have demonstrated that the transplantation of bone marrow cells following diabetes induced by streptozotocin can support the recovery of pancreatic β-cell mass and a partial reversal of hyperglycemia. To address this issue, we examined whether the c-Met/hepatocyte growth factor (HGF) signaling pathway was involved in the recovery of β-cell injury after bone marrow transplantation (BMT). In this model, donor-derived bone marrow cells were positive for HGF immunoreactivity in the recipient spleen, liver, lung, and pancreas as well as in the host hepatocytes. Indeed, plasma HGF levels were maintained at a high value. The frequency of c-Met expression and its proliferative activity and differentiative response in the pancreatic ductal cells in the BMT group were greater than those in the PBS-treated group, resulting in an elevated number of endogenous insulin-producing cells. The induction of the c-Met/HGF signaling pathway following BMT promotes pancreatic regeneration in diabetic rats

  10. Oxidation of 2,4,6,-tri-chlorophenol catalyzed by iron phthalocyanines covalently bound to silica. Oxydation du 2,4,6-trichlorophenol catalyse par des phtalocyanines de fer greffees sur silice par liaisons covalentes

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, M.; Hadasch, A.; Meunier, B. (Centre National de la Recherche Scientifique (CNRS), 31 - Toulouse (France). Laboratoire de Chimie de Coordination); Rabion, A. (Elf-Atochem, 64 - Artix (France). Centre de Recherche)

    1999-04-01

    The degradation of recalcitrant pollutants remains a high priority in order to preserve our environment. For example, chlorinated aromatic compounds are extremely persistent in the environment because of their slow biodegradation by microorganisms. One of the most notable toxic offenders is 2,4,6-tri-chlorophenol (TCP) which is produced by paper mills and also used as a biocide. Thus TCP is an obvious benchmark for research on the decontamination of waste waters. In this work, the covalent attachment of an iron phthalocyanine with chloro-sulfonyl substituents (FePcSO[sub 2]Cl) onto a functionalized 3-amino-propyl-silica has been achieved. This supported catalyst FePcSO[sub 2]Cl-silica is able to degrade a recalcitrant pollutant like TCP with hydrogen peroxide as oxidant. In order to improve the catalytic efficiency of the grafted iron phthalocyanine complex, modifications of the macrocycle substituents, passivation of the silica surface, variation of the loading of the carrier and addition of an organic co solvent to the reaction mixture were carried out. (authors) 21 refs.

  11. FOXO1 orchestrates the bone-suppressing function of gut-derived serotonin

    Science.gov (United States)

    Kode, Aruna; Mosialou, Ioanna; Silva, Barbara C.; Rached, Marie-Therese; Zhou, Bin; Wang, Ji; Townes, Tim M.; Hen, Rene; DePinho, Ronald A.; Guo, X. Edward; Kousteni, Stavroula

    2012-01-01

    Serotonin is a critical regulator of bone mass, fulfilling different functions depending on its site of synthesis. Brain-derived serotonin promotes osteoblast proliferation, whereas duodenal-derived serotonin suppresses it. To understand the molecular mechanisms of duodenal-derived serotonin action on osteoblasts, we explored its transcriptional mediation in mice. We found that the transcription factor FOXO1 is a crucial determinant of the effects of duodenum-derived serotonin on bone formation We identified two key FOXO1 complexes in osteoblasts, one with the transcription factor cAMP-responsive element–binding protein 1 (CREB) and another with activating transcription factor 4 (ATF4). Under normal levels of circulating serotonin, the proliferative activity of FOXO1 was promoted by a balance between its interaction with CREB and ATF4. However, high circulating serotonin levels prevented the association of FOXO1 with CREB, resulting in suppressed osteoblast proliferation. These observations identify FOXO1 as the molecular node of an intricate transcriptional machinery that confers the signal of duodenal-derived serotonin to inhibit bone formation. PMID:22945629

  12. Brain-Derived Neurotrophic Factor Elevates Activating Transcription Factor 4 (ATF4 in Neurons and Promotes ATF4-Dependent Induction of Sesn2

    Directory of Open Access Journals (Sweden)

    Jin Liu

    2018-03-01

    Full Text Available Activating transcription factor 4 (ATF4 plays important physiologic roles in the brain including regulation of learning and memory as well as neuronal survival and death. Yet, outside of translational regulation by the eIF2α-dependent stress response pathway, there is little information about how its levels are controlled in neurons. Here, we show that brain-derived neurotrophic factor (BDNF promotes a rapid and sustained increase in neuronal ATF4 transcripts and protein levels. This increase is dependent on tropomyosin receptor kinase (TrkB signaling, but independent of levels of phosphorylated eIF2α. The elevation in ATF4 protein occurs both in nuclei and processes. Transcriptome analysis revealed that ATF4 mediates BDNF-promoted induction of Sesn2 which encodes Sestrin2, a protector against oxidative and genotoxic stresses and a mTor complex 1 inhibitor. In contrast, BDNF-elevated ATF4 did not affect expression of a number of other known ATF4 targets including several with pro-apoptotic activity. The capacity of BDNF to elevate neuronal ATF4 may thus represent a means to maintain this transcription factor at levels that provide neuroprotection and optimal brain function without risk of triggering neurodegeneration.

  13. Adsorption of phenolic compound by aged-refuse

    Energy Technology Data Exchange (ETDEWEB)

    Chai Xiaoli [State Key Laboratory of Pollution Control and Resource Reuse, School of Enviromental Science and Engineering, Tongji University, Siping Road 1239, Shanghai 200092 (China)]. E-mail: xlchai@mail.tongji.edu.cn; Zhao Youcai [State Key Laboratory of Pollution Control and Resource Reuse, School of Enviromental Science and Engineering, Tongji University, Siping Road 1239, Shanghai 200092 (China)

    2006-09-01

    The adsorption of phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol by aged-refuse has been studied. Adsorption isotherms have been determined for phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol and the data fits well to the Freundlich equation. The chlorinated phenols are absorbed more strongly than the phenol and the adsorption capacity has an oblivious relationship with the numbers and the position of chlorine subsistent. The experiment data suggests that both the partition function and the chemical adsorption involve in the adsorption process. Pseudo-first-order and pseudo-second-order model were applied to investigate the kinetics of the adsorption and the results show that it fit the pseudo-second-order model. More than one step involves in the adsorption process and the overall rate of the adsorption process appears to be controlled by the chemical reaction. The thermodynamic analysis indicates that the adsorption is spontaneous and endothermic.

  14. Adsorption of phenolic compound by aged-refuse

    International Nuclear Information System (INIS)

    Chai Xiaoli; Zhao Youcai

    2006-01-01

    The adsorption of phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol by aged-refuse has been studied. Adsorption isotherms have been determined for phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol and the data fits well to the Freundlich equation. The chlorinated phenols are absorbed more strongly than the phenol and the adsorption capacity has an oblivious relationship with the numbers and the position of chlorine subsistent. The experiment data suggests that both the partition function and the chemical adsorption involve in the adsorption process. Pseudo-first-order and pseudo-second-order model were applied to investigate the kinetics of the adsorption and the results show that it fit the pseudo-second-order model. More than one step involves in the adsorption process and the overall rate of the adsorption process appears to be controlled by the chemical reaction. The thermodynamic analysis indicates that the adsorption is spontaneous and endothermic

  15. Alpinumisoflavone and abyssinone V 4'-methylether derived from Erythrina lysistemon (Fabaceae) promote HDL-cholesterol synthesis and prevent cholesterol gallstone formation in ovariectomized rats.

    Science.gov (United States)

    Mvondo, Marie A; Njamen, Dieudonné; Kretzschmar, Georg; Imma Bader, Manuela; Tanee Fomum, Stephen; Wandji, Jean; Vollmer, Günter

    2015-07-01

    Erythrina lysistemon was found to improve lipid profile in ovariectomized rats. Alpinumisoflavone (AIF) and abyssinone V 4'-methylether (AME) derived from this plant induced analogous effects on lipid profile and decreased atherogenic risks. To highlight the molecular mechanism of action of these natural products, we evaluated their effects on the expression of some estrogen-sensitive genes associated with cholesterol synthesis (Esr1 and Apoa1) and cholesterol clearance (Ldlr, Scarb1 and Cyp7a1). Ovariectomized rats were subcutaneously treated for three consecutive days with either compound at the daily dose of 0.1, 1 and 10 mg/kg body weight (BW). Animals were sacrificed thereafter and their liver was collected. The mRNA of genes of interest was analysed by quantitative real-time polymerase chain reaction. Both compounds downregulated the mRNA expression of Esr1, a gene associated with cholesterogenesis and cholesterol gallstone formation. AME leaned the Apoa1/Scarb1 balance in favour of Apoa1, an effect promoting high-density lipoprotein (HDL)-cholesterol formation. It also upregulated the mRNA expression of Ldlr at 1 mg/kg/BW per day (25%) and 10 mg/kg/BW per day (133.17%), an effect favouring the clearance of low-density lipoprotein (LDL)-cholesterol. Both compounds may also promote the conversion of cholesterol into bile acids as they upregulated Cyp7a1 mRNA expression. AIF and AME atheroprotective effects may result from their ability to upregulate mechanisms promoting HDL-cholesterol and bile acid formation. © 2015 Royal Pharmaceutical Society.

  16. Determination of Phenols in Water Samples using a Supported ...

    African Journals Online (AJOL)

    NJD

    in the range 4.2 µg L–1 for 2-chlorophenol to 50 µg L–1 for 4-chlorophenol. In landfill leachate ... industries.1 Phenols are also used as part of the raw materials in ... chemical detection.20 In all of the above cases of mem- brane-based ...

  17. Bioinspired onion epithelium-like structure promotes the maturation of cardiomyocytes derived from human pluripotent stem cells.

    Science.gov (United States)

    Xu, Cong; Wang, Li; Yu, Yue; Yin, Fangchao; Zhang, Xiaoqing; Jiang, Lei; Qin, Jianhua

    2017-08-22

    Organized cardiomyocyte alignment is critical to maintain the mechanical properties of the heart. In this study, we present a new and simple strategy to fabricate a biomimetic microchip designed with an onion epithelium-like structure and investigate the guided behavior of human induced pluripotent stem cell derived cardiomyocytes (hiPSC-CMs) on the substrate. The hiPSC-CMs were observed to be confined by the three dimensional surficial features morphologically, analogous to the in vivo microenvironment, and exhibited an organized anisotropic alignment on the onion epithelium-like structure with good beating function. The calcium imaging of hiPSC-CMs demonstrated a more mature Ca 2+ spark pattern as well. Furthermore, the expression of sarcomere genes (TNNI3, MYH6 and MYH7), potassium channel genes (KCNE1 and KCNH2), and calcium channel genes (RYR2) was significantly up-regulated on the substrate with an onion epithelium-like structure instead of the surface without the structure, indicating a more matured status of cardiomyocytes induced by this structure. It appears that the biomimetic micropatterned structure, analogous to in vivo cellular organization, is an important factor that might promote the maturation of hiPSC-CMs, providing new biological insights to guide hiPSC-CM maturation by biophysical factors. The established approach may offer an effective in vitro model for investigating cardiomyocyte differentiation, maturation and tissue engineering applications.

  18. Pour on application of growth promoters in veal calves: analytical and histological results

    NARCIS (Netherlands)

    Schilt, R.; Groot, M.J.; Berende, P.L.M.; Rammazza, V.; Ossenkoppele, J.S.; Haasnoot, W.; Bennekom, van E.O.; Brouwer, L.; Hooijerink, H.

    1998-01-01

    To investigate the possibilities for screening and confirmation methods when the 'pour on' method of application is used for administration of growth promoters, an animal experiment was performed using a cocktail of a combination of growth promoters derived from (illegal) practice. Two cocktails

  19. Exosomal DMBT1 from human urine-derived stem cells facilitates diabetic wound repair by promoting angiogenesis.

    Science.gov (United States)

    Chen, Chun-Yuan; Rao, Shan-Shan; Ren, Lu; Hu, Xiong-Ke; Tan, Yi-Juan; Hu, Yin; Luo, Juan; Liu, Yi-Wei; Yin, Hao; Huang, Jie; Cao, Jia; Wang, Zhen-Xing; Liu, Zheng-Zhao; Liu, Hao-Ming; Tang, Si-Yuan; Xu, Ran; Xie, Hui

    2018-01-01

    Chronic non-healing wounds represent one of the most common complications of diabetes and need advanced treatment strategies. Exosomes are key mediators of cell paracrine action and can be directly utilized as therapeutic agents for tissue repair and regeneration. Here, we explored the effects of exosomes from human urine-derived stem cells (USC-Exos) on diabetic wound healing and the underlying mechanism. Methods: USCs were characterized by flow cytometry and multipotent differentiation potential analyses. USC-Exos were isolated from the conditioned media of USCs and identified by transmission electron microscopy and flow cytometry. A series of functional assays in vitro were performed to assess the effects of USC-Exos on the activities of wound healing-related cells. Protein profiles in USC-Exos and USCs were examined to screen the candidate molecules that mediate USC-Exos function. The effects of USC-Exos on wound healing in streptozotocin-induced diabetic mice were tested by measuring wound closure rates, histological and immunofluorescence analyses. Meanwhile, the role of the candidate protein in USC-Exos-induced regulation of angiogenic activities of endothelial cells and diabetic wound healing was assessed. Results: USCs were positive for CD29, CD44, CD73 and CD90, but negative for CD34 and CD45. USCs were able to differentiate into osteoblasts, adipocytes and chondrocytes. USC-Exos exhibited a cup- or sphere-shaped morphology with a mean diameter of 51.57 ± 2.93 nm and positive for CD63 and TSG101. USC-Exos could augment the functional properties of wound healing-related cells including the angiogenic activities of endothelial cells. USC-Exos were enriched in the proteins that are involved in regulation of wound healing-related biological processes. Particularly, a pro-angiogenic protein called deleted in malignant brain tumors 1 (DMBT1) was highly expressed in USC-Exos. Further functional assays showed that DMBT1 protein was required for USC

  20. Human umbilical cord blood-derived stem cells and brain-derived neurotrophic factor protect injured optic nerve: viscoelasticity characterization

    Directory of Open Access Journals (Sweden)

    Xue-man Lv

    2016-01-01

    Full Text Available The optic nerve is a viscoelastic solid-like biomaterial. Its normal stress relaxation and creep properties enable the nerve to resist constant strain and protect it from injury. We hypothesized that stress relaxation and creep properties of the optic nerve change after injury. More-over, human brain-derived neurotrophic factor or umbilical cord blood-derived stem cells may restore these changes to normal. To validate this hypothesis, a rabbit model of optic nerve injury was established using a clamp approach. At 7 days after injury, the vitreous body re-ceived a one-time injection of 50 µg human brain-derived neurotrophic factor or 1 × 106 human umbilical cord blood-derived stem cells. At 30 days after injury, stress relaxation and creep properties of the optic nerve that received treatment had recovered greatly, with patho-logical changes in the injured optic nerve also noticeably improved. These results suggest that human brain-derived neurotrophic factor or umbilical cord blood-derived stem cell intervention promotes viscoelasticity recovery of injured optic nerves, and thereby contributes to nerve recovery.

  1. Evolutionary history of 7SL RNA-derived SINEs in Supraprimates.

    Science.gov (United States)

    Kriegs, Jan Ole; Churakov, Gennady; Jurka, Jerzy; Brosius, Jürgen; Schmitz, Jürgen

    2007-04-01

    The evolutionary relationships of 7SL RNA-derived SINEs such as the primate Alu or the rodent B1 elements have hitherto been obscure. We established an unambiguous phylogenetic tree for Supraprimates, and derived intraordinal relationships of the 7SL RNA-derived SINEs. As well as new elements in Tupaia and primates, we also found that the purported ancestral fossil Alu monomer was restricted to Primates, and provide here the first description of a potential chimeric promoter box region in SINEs.

  2. Prospective Teachers' Reactions to "Right-or-Wrong" Tasks: The Case of Derivatives of Absolute Value Functions

    Science.gov (United States)

    Tsamir, Pessia; Rasslan, Shaker; Dreyfus, Tommy

    2006-01-01

    This paper illustrates the role of a "Thinking-about-Derivatives" task in identifying learners' derivative conceptions and for promoting their critical thinking about derivatives of absolute value functions. The task included three parts: "Define" the derivative of a function f(x) at x = x[subscript 0], "Solve-if-Possible" the derivative of f(x) =…

  3. Visible-light photoactivity of plasmonic silver supported on mesoporous TiO2 nanoparticles (Ag-MTN) for enhanced degradation of 2-chlorophenol: Limitation of Ag-Ti interaction

    Science.gov (United States)

    Jaafar, N. F.; Jalil, A. A.; Triwahyono, S.

    2017-01-01

    Various weight loadings of Ag (1-10 wt.%) were introduced to mesoporous titania nanoparticles (MTN) via a direct in-situ electrochemical method. The catalysts were characterized by XRD, surface area analysis, FTIR, ESR, FESEM-EDX and TEM. Characterization results indicated that the introduction of Ag onto MTN decreased the particles size and band gap of the MTN while increasing the number of oxygen vacancies (OV) and Ti3+ site defects (TSD). The activity performance of Ag-MTN on photodegradation of 2-chlorophenol (2-CP) under visible light irradiation was in the following order: 5 wt% Ag-MTN> 1 wt% Ag-MTN > MTN > 10 wt% Ag-MTN, with degradation percentages of 97, 88, 80 and 63%, respectively. The synergistic effect between Ag0 and MTN seemed to play an important role in the system. The Ag0 acted as both an electron trap and a plasmonic sensitizer which suppressed the electron-hole recombination, while OV and TSD in the MTN accelerated the production of hydroxyl radicals for enhanced degradation of 2-CP. However, the formation of Ti-O-Ag in 10 wt% Ag-MTN was found to decrease the photoactivity due to the decrease in the formation of Ag0, TSD and OV as well as the increase in band gap energy. The photodegradation of 5 wt% Ag-MTN followed a pseudo-first-order Langmuir- Hinshelwood model and the catalyst was still stable after five cycles.

  4. DNA structure in human RNA polymerase II promoters

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

    1998-01-01

    with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...

  5. MicroRNAs promote skeletal muscle differentiation of mesodermal iPSC-derived progenitors

    NARCIS (Netherlands)

    Giacomazzi, G. (Giorgia); Holvoet, B. (Bryan); Trenson, S. (Sander); Caluwé, E. (Ellen); Kravic, B. (Bojana); Grosemans, H. (Hanne); Cortés-Calabuig, Á. (Álvaro); Deroose, C.M. (Christophe M.); D. Huylebroeck (Danny); Hashemolhosseini, S. (Said); S. Janssens (Stefan); McNally, E. (Elizabeth); Quattrocelli, M. (Mattia); Sampaolesi, M. (Maurilio)

    2017-01-01

    textabstractMuscular dystrophies (MDs) are often characterized by impairment of both skeletal and cardiac muscle. Regenerative strategies for both compartments therefore constitute a therapeutic avenue. Mesodermal iPSC-derived progenitors (MiPs) can regenerate both striated muscle types

  6. Electrocatalytic Reduction-oxidation of Chlorinated Phenols using a Nanostructured Pd-Fe Modified Graphene Catalyst

    International Nuclear Information System (INIS)

    Shi, Qin; Wang, Hui; Liu, Shaolei; Pang, Lei; Bian, Zhaoyong

    2015-01-01

    A Pd-Fe modified graphene (Pd-Fe/G) catalyst was prepared by the Hummers oxidation method and bimetallic co-deposition method. The catalyst was then characterized by various characterization techniques and its electrochemical property toward the electrocatalytic reduction-oxidation of chlorinated phenols was investigated by using cyclic voltammetry and differential pulse voltammetry. The results of the characterization show that the Pd-Fe/G catalyst in which the weight proportion of Pd and Fe is 1:1 has an optimal surface performance. The diameter of the Pd-Fe particles is approximately 5.2 ± 0.3 nm, with a uniform distribution on the supporting graphene. This is smaller than the Pd particles of a Pd-modified graphene (Pd/G) catalyst. The Pd-Fe/G catalyst shows a higher electrocatalytic activity than the Pd/G catalyst for reductive dechlorination when feeding with hydrogen gas. The reductive peak potentials of −0.188 V, −0.836 V and −0.956 V in the DPV curves are attributed to the dechlorination of ortho-Cl, meta-Cl, and para-Cl in 2-chlorophenol, 3-chlorophenol and 4-chlorophenol, respectively. In accordance with an analysis of the frontier orbital theory, the order of ease of dechlorination with Pd-Fe/G catalyst is 2-chlorophenol > 3-chlorophenol > 4-chlorophenol. The Pd-Fe/G catalyst has a greater activity than the Pd/G catalyst in accelerating the two-electron reduction of O_2 to H_2O_2, which is attributed to the higher current of the reduction peak at approximately −0.40 V when feeding with oxygen gas. Therefore, the Pd-Fe/G catalyst exhibits a higher electrocatalytic activity than the Pd/G catalyst for the reductive dechlorination and acceleration of the two-electron reduction of O_2 to H_2O_2.

  7. Promotions, dismissals, and employee selection: Theory and evidence

    DEFF Research Database (Denmark)

    Frederiksen, Anders; Takáts, Elód

    2011-01-01

    Firms offer highly complex contracts to their employees. These contracts contain a mix of incentives, such as fixed wages, bonus payments, promotion options, and dismissals or threats of dismissal. In this article, we show that firms having a production process that is sensitive to employee quality...... may find it optimal to combine cost-efficient incentives such as bonuses and promotions with dismissals. Based on this result, we derive a hierarchy of incentives. Furthermore, we demonstrate the close link between the optimal contract and the employee sorting and selection and use this to analyse...

  8. β5 Integrin Up-Regulation in Brain-Derived Neurotrophic Factor Promotes Cell Motility in Human Chondrosarcoma

    Science.gov (United States)

    Li, Te-Mao; Fong, Yi-Chin; Liu, Shan-Chi; Chen, Po-Chun; Tang, Chih-Hsin

    2013-01-01

    Chondrosarcoma is a primary malignant bone cancer, with a potent capacity to invade locally and cause distant metastasis; it has a poor prognosis and shows a predilection for metastasis to the lungs. Brain derived neurotrophic factor (BDNF) is a small-molecule protein from the neurotrophin family of growth factors that is associated with the disease status and outcomes of cancers. However, the effect of BDNF on migration activity in human chondrosarcoma cells is mostly unknown. Here, we found that human chondrosarcoma tissues showed significant expression of BDNF, which was higher than that in normal cartilage and primary chondrocytes. We also found that BDNF increased the migration and expression of β5 integrin in human chondrosarcoma cells. In addition, knockdown of BDNF expression markedly inhibited migratory activity. BDNF-mediated migration and β5 integrin up-regulation were attenuated by antibody, inhibitor, or siRNA against the TrkB receptor. Pretreatment of chondrosarcoma cells with PI3K, Akt, and NF-κB inhibitors or mutants also abolished BDNF-promoted migration and integrin expression. The PI3K, Akt, and NF-κB signaling pathway was activated after BDNF treatment. Taken together, our results indicate that BDNF enhances the migration of chondrosarcoma by increasing β5 integrin expression through a signal transduction pathway that involves the TrkB receptor, PI3K, Akt, and NF-κB. BDNF thus represents a promising new target for treating chondrosarcoma metastasis. PMID:23874483

  9. Human Platelet-Rich Plasma- and Extracellular Matrix-Derived Peptides Promote Impaired Cutaneous Wound Healing In Vivo

    Science.gov (United States)

    Demidova-Rice, Tatiana N.; Wolf, Lindsey; Deckenback, Jeffry; Hamblin, Michael R.; Herman, Ira M.

    2012-01-01

    Previous work in our laboratory has described several pro-angiogenic short peptides derived from endothelial extracellular matrices degraded by bacterial collagenase. Here we tested whether these peptides could stimulate wound healing in vivo. Our experiments demonstrated that a peptide created as combination of fragments of tenascin X and fibrillin 1 (comb1) applied into cranial dermal wounds created in mice treated with cyclophosphamide to impair wound healing, can improve the rate of wound closure. Furthermore, we identify and characterize a novel peptide (UN3) created and modified from two naturally-occurring peptides, which are present in human platelet-rich plasma. In vitro testing of UN3 demonstrates that it causes a 50% increase in endothelial proliferation, 250% increase in angiogenic response and a tripling of epithelial cell migration in response to injury. Results of in vivo experiments where comb1 and UN3 peptides were added together to cranial wounds in cyclophosphamide-treated mice leads to improvement of wound vascularization as shown by an increase of the number of blood vessels present in the wound beds. Application of the peptides markedly promotes cellular responses to injury and essentially restores wound healing dynamics to those of normal, acute wounds in the absence of cyclophosphamide impairment. Our current work is aimed at understanding the mechanisms underlying the stimulatory effects of these peptides as well as identification of the cellular receptors mediating these effects. PMID:22384158

  10. Natural product derivative BIO promotes recovery after myocardial infarction via unique modulation of the cardiac microenvironment

    Science.gov (United States)

    Kim, Yong Sook; Jeong, Hye-yun; Kim, Ah Ra; Kim, Woong-Hee; Cho, Haaglim; Um, JungIn; Seo, Youngha; Kang, Wan Seok; Jin, Suk-Won; Kim, Min Chul; Kim, Yong-Chul; Jung, Da-Woon; Williams, Darren R.; Ahn, Youngkeun

    2016-01-01

    The cardiac microenvironment includes cardiomyocytes, fibroblasts and macrophages, which regulate remodeling after myocardial infarction (MI). Targeting this microenvironment is a novel therapeutic approach for MI. We found that the natural compound derivative, BIO ((2′Z,3′E)-6-Bromoindirubin-3′-oxime) modulated the cardiac microenvironment to exert a therapeutic effect on MI. Using a series of co-culture studies, BIO induced proliferation in cardiomyocytes and inhibited proliferation in cardiac fibroblasts. BIO produced multiple anti-fibrotic effects in cardiac fibroblasts. In macrophages, BIO inhibited the expression of pro-inflammatory factors. Significantly, BIO modulated the molecular crosstalk between cardiac fibroblasts and differentiating macrophages to induce polarization to the anti-inflammatory M2 phenotype. In the optically transparent zebrafish-based heart failure model, BIO induced cardiomyocyte proliferation and completely recovered survival rate. BIO is a known glycogen synthase kinase-3β inhibitor, but these effects could not be recapitulated using the classical inhibitor, lithium chloride; indicating novel therapeutic effects of BIO. We identified the mechanism of BIO as differential modulation of p27 protein expression and potent induction of anti-inflammatory interleukin-10. In a rat MI model, BIO reduced fibrosis and improved cardiac performance. Histological analysis revealed modulation of the cardiac microenvironment by BIO, with increased presence of anti-inflammatory M2 macrophages. Our results demonstrate that BIO produces unique effects in the cardiac microenvironment to promote recovery post-MI. PMID:27510556

  11. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhonghua [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China); Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Wang, Haiqin [Department of Obstetrics and Gynecology, The Fifth People' s Hospital Of Jinan, Jinan 250022 (China); Yang, Bo; Sun, Yukai [Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Huo, Ran, E-mail: rhuo12@163.com [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China)

    2015-12-01

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing.

  12. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    International Nuclear Information System (INIS)

    Li, Zhonghua; Wang, Haiqin; Yang, Bo; Sun, Yukai; Huo, Ran

    2015-01-01

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing

  13. A 3' UTR-derived non-coding RNA RibS increases expression of cfa and promotes biofilm formation of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Zhao, Xin; Liu, Rui; Tang, Hao; Osei-Adjei, George; Xu, Shungao; Zhang, Ying; Huang, Xinxiang

    2018-05-08

    Bacterial non-coding RNAs (ncRNAs) are widely studied and found to play important roles in regulating various cellular processes. Recently, many ncRNAs have been discovered to be transcribed or processed from 3' untranslated regions (3' UTRs). Here we reported a novel 3' UTR-derived ncRNA, RibS, which could influence biofilm formation of Salmonella enterica serovar Typhi (S. Typhi). RibS was confirmed to be a ∼700 nt processed product produced by RNase III-catalyzed cleavage from the 3' UTR of riboflavin synthase subunit alpha mRNA, RibE. Overexpression of RibS increased the expression of the cyclopropane fatty acid synthase gene, cfa, which was located at the antisense strand. Biofilm formation of S. Typhi was enhanced by overexpressing RibS both in the wild type strain and cfa deletion mutant. Deletion of cfa attenuated biofilm formation of S. Typhi, while complementation of cfa partly restored the phenotype. Moreover, overexpressing cfa enhanced the biofilm formation of S. Typhi. In summary, RibS has been identified as a novel ncRNA derived from the 3' UTR of RibE that promotes biofilm formation of S. Typhi, and it appears to do so, at least in part, by increasing the expression of cfa. Copyright © 2018 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  14. Experimental strategies to promote functional recovery after peripheral nerve injuries.

    Science.gov (United States)

    Gordon, Tessa; Sulaiman, Olawale; Boyd, J Gordon

    2003-12-01

    The capacity of Schwann cells (SCs) in the peripheral nervous system to support axonal regeneration, in contrast to the oligodendrocytes in the central nervous system, has led to the misconception that peripheral nerve regeneration always restores function. Here, we consider how prolonged periods of time that injured neurons remain without targets during axonal regeneration (chronic axotomy) and that SCs in the distal nerve stumps remain chronically denervated (chronic denervation) progressively reduce the number of motoneurons that regenerate their axons. We demonstrate the effectiveness of low-dose, brain-derived neurotrophic and glial-derived neurotrophic factors to counteract the effects of chronic axotomy in promoting axonal regeneration. High-dose brain-derived neurotrophic factor (BDNF) on the other hand, acting through the p75 receptor, inhibits axonal regeneration and may be a factor in stopping regenerating axons from forming neuromuscular connections in skeletal muscle. The immunophilin, FK506, is also effective in promoting axonal regeneration after chronic axotomy. Chronic denervation of SCs (>1 month) severely deters axonal regeneration, although the few motor axons that do regenerate to reinnervate muscles become myelinated and form enlarged motor units in the reinnervated muscles. We found that in vitro incubation of chronically denervated SCs with transforming growth factor-beta re-established their growth-supportive phenotype in vivo, consistent with the idea that the interaction between invading macrophages and denervated SCs during Wallerian degeneration is essential to sustain axonal regeneration by promoting the growth-supportive SC phenotype. Finally, we consider the effectiveness of a brief period of 20 Hz electrical stimulation in promoting the regeneration of axons across the surgical gap after nerve repair.

  15. The Biodistribution and Immune Suppressive Effects of Breast Cancer-Derived Exosomes.

    Science.gov (United States)

    Wen, Shu Wen; Sceneay, Jaclyn; Lima, Luize Goncalves; Wong, Christina S F; Becker, Melanie; Krumeich, Sophie; Lobb, Richard J; Castillo, Vanessa; Wong, Ke Ni; Ellis, Sarah; Parker, Belinda S; Möller, Andreas

    2016-12-01

    Small membranous secretions from tumor cells, termed exosomes, contribute significantly to intercellular communication and subsequent reprogramming of the tumor microenvironment. Here, we use optical imaging to determine that exogenously administered fluorescently labeled exosomes derived from highly metastatic murine breast cancer cells distributed predominantly to the lung of syngeneic mice, a frequent site of breast cancer metastasis. At the sites of accumulation, exosomes were taken up by CD45 + bone marrow-derived cells. Subsequent long-term conditioning of naïve mice with exosomes from highly metastatic breast cancer cells revealed the accumulation of myeloid-derived suppressor cells in the lung and liver. This favorable immune suppressive microenvironment was capable of promoting metastatic colonization in the lung and liver, an effect not observed from exosomes derived from nonmetastatic cells and liposome control vesicles. Furthermore, we determined that breast cancer exosomes directly suppressed T-cell proliferation and inhibited NK cell cytotoxicity, and hence likely suppressed the anticancer immune response in premetastatic organs. Together, our findings provide novel insight into the tissue-specific outcomes of breast cancer-derived exosome accumulation and their contribution to immune suppression and promotion of metastases. Cancer Res; 76(23); 6816-27. ©2016 AACR. ©2016 American Association for Cancer Research.

  16. Degradation of Jatropha curcas phorbol esters derived from Jatropha oil cake and their tumor-promoting activity.

    Science.gov (United States)

    Nakao, Motoyuki; Hasegawa, Go; Yasuhara, Tadashi; Ishihara, Yoko

    2015-04-01

    Large amount of oil cake is generated during biodiesel production from Jatropha seeds. Although Jatropha oil cake is rich in plant nutrients, presence of toxic phorbol esters restricts the usage of oil cake as a fertilizer. The objective of this study is to evaluate the components and tumor promoting activity of phorbol esters in Jatropha oil cake-supplemented soil and plants grown in the treated soil. Contents and their biological activity of Jatropha phorbol esters in soil and plants were sequentially analyzed by high-performance liquid chromatography (HPLC) and in vitro cell transformation assay, respectively. Disappearance of Jatropha phorbol-ester-specific peaks were followed with HPLC during incubation of Jatropha oil cake with soil for five weeks. Along with the degradation of Jatropha phorbol ester in soil, tumor-promoting activity in the sample was also attenuated and ultimately disappeared. Jatropha phorbol esters and tumor promoting activity were not detected from mustard spinach grown in the Jatropha oil cake-supplemented soil. In addition, the esterase KM109 degrades DHPB (see definition below; Jatropha phorbol ester) and reduced its tumor-promoting activity. From these data, we conclude: (1) components and tumor promoting activity of Jatropha phorbol esters in the oil cake disappeared completely by incubation with soil for five-week, (2) Jatropha phorbol esters did not transfer into plants grown in the Jatropha oil cake-supplemented soil, and (3) DHPB can be degraded by esterase from soil bacterium. These observations are useful for utilization of Jatropha oil cake as a fertilizer. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    International Nuclear Information System (INIS)

    Gao Donghong; Mondal, Tapan K.; Lawrence, David A.

    2007-01-01

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) ± PbCl 2 . At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS ± Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-α levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway

  18. Synergistic photocatalysis of Cr(VI) reduction and 4-Chlorophenol degradation over hydroxylated α-Fe{sub 2}O{sub 3} under visible light irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ji-Chao; Ren, Juan [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450002 (China); Yao, Hong-Chang, E-mail: yaohongchang@zzu.edu.cn [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450002 (China); Zhang, Lin; Wang, Jian-She; Zang, Shuang-Quan [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450002 (China); Han, Li-Feng [Henan Provincial Key Laboratory of Surface & Interface Science, Zhengzhou University of Light Industry, Zhengzhou 450002 (China); Li, Zhong-Jun, E-mail: lizhongjun@zzu.edu.cn [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450002 (China)

    2016-07-05

    Highlights: • The surface hydroxyl of Fe{sub 2}O{sub 3} influences on the Cr(VI) reduction activity. • The synergistic photocatalysis enhances degradation activity of Cr(VI) and 4-CP. • The Fe{sub 2}O{sub 3} catalyst exhibits good stability and degradation activity after 9 runs. - Abstract: A series of Fe{sub 2}O{sub 3} materials with hydroxyl are synthesized in different monohydric alcohol (C{sub 2} – C{sub 5}) solvents by solvothermal method and characterized by XRD, BET, XPS, TG and EA. The amount of hydroxyl is demonstrated to be emerged on the surface of the as-synthesized Fe{sub 2}O{sub 3} particles and their contents are determined to be from 7.99 to 3.74 wt%. The Cr(VI) reduction experiments show that the hydroxyl content of Fe{sub 2}O{sub 3} samples exacts great influence on the photocatalytic activity under visible light irradiation (λ > 400 nm) and that the Fe{sub 2}O{sub 3} sample synthesized in n-butyl alcohol exhibits the optimal photocatalytic activity. The synergistic photocatalysis for 4-Chlorophenol (4-CP) degradation and Cr(VI) reduction over above Fe{sub 2}O{sub 3} sample is further investigated. The photocatalytic ratio of Cr(VI) reduction are enhanced from 24.8% to 70.2% while that of 4-CP oxidation are increased from 13.5% to 47.8% after 1 h visible light irradiation. The Fe{sub 2}O{sub 3} sample keeps good degradation rates of mixed pollutants after 9 runs. The active oxygen intermediates O{sub 2}{sup −}·, ·OH and H{sub 2}O{sub 2} formed in the photoreaction process are discovered by ESR measurement and UV–vis test. The photocatalytic degradation mechanism is proposed accordingly.

  19. Parabola-like shaped pH-rate profile for phenols oxidation by aqueous permanganate.

    Science.gov (United States)

    Du, Juanshan; Sun, Bo; Zhang, Jing; Guan, Xiaohong

    2012-08-21

    Oxidation of phenols by permanganate in the pH range of 5.0-9.0 generally exhibits a parabola-like shape with the maximum reaction rate obtained at pH close to phenols' pK(a). However, a monotonic increase or decrease is observed if phenols' pK(a) is beyond the pH range of 5.0-9.0. A proton transfer mechanism is proposed in which the undissociated phenol is directly oxidized by permanganate to generate products while a phenolate-permanganate adduct, intermediate, is formed between dissociated phenol and permanganate ion and this is the rate-limiting step for phenolates oxidation by permanganate. The intermediate combines with H(+) and then decomposes to products. Rate equations derived based on the steady-state approximation can well simulate the experimentally derived pH-rate profiles. Linear free energy relationships (LFERs) were established among the parameters obtained from the modeling, Hammett constants, and oxygen natural charges in phenols and phenolates. LFERs reveal that chlorine substituents have opposite influence on the susceptibility of phenols and phenolates to permanganate oxidation and phenolates are not necessarily more easily oxidized than their neutral counterparts. The chlorine substituents regulate the reaction rate of chlorophenolates with permanganate mainly by influencing the natural charges of the oxygen atoms of dissociated phenols while they influence the oxidation of undissociated chlorophenols by permanganate primarily by forming intramolecular hydrogen bonding with the phenolic group.

  20. Copper-promoted methylene C-H oxidation to a ketone derivative by O2.

    Science.gov (United States)

    Deville, Claire; McKee, Vickie; McKenzie, Christine J

    2017-01-17

    The methylene group of the ligand 1,2-di(pyridin-2-yl)-ethanone oxime (dpeo) is slowly oxygenated by the O 2 in air under ambient conditions when [Cu(dpeo) 2 ](ClO 4 ) 2 is dissolved in ethanol or acetonitrile. An initial transient ketone product, 2-(hydroxyimino)-1,2-di(pyridine-2-yl)ethanone, (hidpe) was characterized in the heteroleptic copper(ii) complex [Cu(bpca)(hidpe)](ClO 4 ). The co-ligand in this complex, N-(2'-pyridylcarbonyl)pyridine-2-carboximidate (bpca - ), is derived from a copper-promoted Beckmann rearrangement of hidpe. In the presence of bromide only [Cu(bpca)Br] is isolated. When significant water is present in reaction mixtures copper complexes of dpeo, hidpe and bpca - are not recovered and [Cu(pic) 2 H 2 O] is isolated. This occurs since two equivalents of picolinate are ultimately generated from one equivalent of oxidized and hydrolysed dpeo. The copper-dependent O 2 activation and consequent stoichiometric dpeo C-H oxidation is reminiscent of the previously observed catalysis of dpeo oxidation by Mn(ii) [C. Deville, S. K. Padamati, J. Sundberg, V. McKee, W. R. Browne, C. J. McKenzie, Angew. Chem., Int. Ed., 2016, 55, 545-549]. By contrast dpeo oxidation is not observed during complexation reactions with other late transition metal(ii) ions (M = Fe, Co, Ni, Zn) under aerobic conditions. In these cases bis and tris complexes of bidentate dpeo are isolated in good yields. It is interesting to note that dpeo is not oxidised by H 2 O 2 in the absence of Cu or Mn, suggesting that metal-based oxidants capable of C-H activation are produced from the dpeo-Cu/Mn systems and specifically O 2 . The metastable copper complexes [Cu(dpeo) 2 ](ClO 4 ) 2 and [Cu(bpca)(hidpe)](ClO 4 ), along with [NiX 2 (dpeo) 2 ] (X = Cl, Br), [Ni(dpeo) 3 ](ClO 4 ) 2 , [Co(dpeo) 3 ](ClO 4 ) 3 and the mixed valence complex [Fe III Fe(dpeo-H) 3 (dpeo) 3 ](PF 6 ) 4 , have been structurally characterized.

  1. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  2. Hematopoietic stem cell-derived exosomes promote hematopoietic differentiation of mouse embryonic stem cells in vitro via inhibiting the miR126/Notch1 pathway.

    Science.gov (United States)

    Liao, Feng-Ling; Tan, Lin; Liu, Hua; Wang, Jin-Ju; Ma, Xiao-Tang; Zhao, Bin; Chen, Yanfang; Bihl, Ji; Yang, Yi; Chen, Ri-Ling

    2018-04-01

    Cell-derived exosomes (EXs) can modulate target cell differentiation via microRNAs (miRs) that they carried. Previous studies have shown that miR126 is highly expressed in hematopoietic stem cells (HSCs) and plays a role in hematopoiesis via modulating the Notch pathway that participates in progenitors' cell fate decisions. In this study we investigated whether HSC-derived EXs (HSC-EXs) could affect the differentiation of mouse embryonic stem cells (ESCs) into HSCs. We prepared HSC-EXs con , HSC-EXs sc and HSC-EXs miR126 from control HSCs and the HSCs transfected with scramble control or miR126 mimics, respectively. HSC-EXs were isolated by ultracentrifugation and analyzed using nanoparticle tracking analysis. We incubated the collected EXs with mouse ESCs over a 10-d differentiation induction period, during which HSC-EXs and a Notch pathway activator (Jagged1, 100 ng/mL) were added to the cultures every 3 d. After the 10-d differentiation period, the expression levels of miR126, SSEA1, CD117, Sca1, Notch1 and Hes1 in ESCs were assessed. The generated HSCs were validated by flow cytometry using antibodies against HSC markers (CD117, CD34 and Sca1). Our results revealed that: (1) transfection with miR126 mimics significantly increased miR126 levels in HSC-EXs miR126 . (2) HSC-EX co-culture promoted mouse ESCs differentiation into HSCs with the most prominent effect found in the HSC-EXs miR126 co-culture. (3) HSC differentiation was verified by reduced SSEA1 expression and increased CD117 and Sca1 expression. (4) All the effects caused by HSC-EXs were accompanied by significant reduction of Notch1 and Hes1 expression, thus inhibition of the Notch1/Hes1 pathway, whereas activation of Notch by Jagged1 abolished the effects of HSC-EXs miR126 . In conclusion, HSC-EXs promote hematopoietic differentiation of mouse ESCs in vitro by inhibiting the miR126/Notch1 pathway.

  3. Health Promotion: A developing focus area over the years.

    Science.gov (United States)

    Povlsen, Lene; Borup, Ina

    2015-08-01

    In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation - an associate professorship was established with a focus on health promotion. Nevertheless, the concept of health promotion had been integrated with or mentioned in courses run prior to the new post. Subsequently, a wide spectrum of courses in health promotion was introduced, such as 'Empowerment for Child and Adolescent Health Promotion', 'Salutogenesis--from theory to practice' and 'Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007 with bi-annual meetings at NHV. © 2015 the Nordic Societies of Public Health.

  4. Fluorogenic Strain-Promoted Alkyne-Diazo Cycloadditions.

    Science.gov (United States)

    Friscourt, Frédéric; Fahrni, Christoph J; Boons, Geert-Jan

    2015-09-28

    Fluorogenic reactions, in which non- or weakly fluorescent reagents produce highly fluorescent products, are attractive for detecting a broad range of compounds in the fields of bioconjugation and material sciences. Herein, we report that a dibenzocyclooctyne derivative modified with a cyclopropenone moiety (Fl-DIBO) can undergo fast strain-promoted cycloaddition reactions under catalyst-free conditions with azides, nitrones, nitrile oxides, as well as mono- and disubstituted diazo-derivatives. Although the reaction with nitrile oxides, nitrones, and disubstituted diazo compounds gave cycloadducts with low quantum yield, monosubstituted diazo reagents produced 1H-pyrazole derivatives that exhibited an approximately 160-fold fluorescence enhancement over Fl-DIBO combined with a greater than 10,000-fold increase in brightness. Concluding from quantum chemical calculations, fluorescence quenching of 3H-pyrazoles, which are formed by reaction with disubstituted diazo-derivatives, is likely due to the presence of energetically low-lying (n,π*) states. The fluorogenic probe Fl-DIBO was successfully employed for the labeling of diazo-tagged proteins without detectable background signal. Diazo-derivatives are emerging as attractive reporters for the labeling of biomolecules, and the studies presented herein demonstrate that Fl-DIBO can be employed for visualizing such biomolecules without the need for probe washout. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Intra-articular injection of synovium-derived mesenchymal stem cells and hyaluronic acid promote regeneration of massive cartilage defects in rabbits

    Directory of Open Access Journals (Sweden)

    Vyacheslav Ogay

    2014-01-01

    Full Text Available Introduction: The purpose of this study was to investigate whether intra-articular injection of synovium-derived mesenchymal stem cells (SD MSCs with low molecular weight hyaluronic acid (HA could promote regeneration of massive cartilage in rabbits. Material and methods: The SD MSCs were harvested from the knees of 10 Flemish giant rabbits, expanded in culture, and characterized. A reproducible 4-mm cylindrical defect was created in the intercondylar groove area using a kit for the mosaic chondroplasty of femoral condyle COR (De Puy, Mitek. The defect was made within the cartilage layer without destruction of subchondral bone. Two weeks after the cartilage defect, SD MSCs (2 × 106 cell/0.15 ml were suspended in 0.5% low molecular weight HA (0.15 ml and injected into the left knee, and HA solution (0.30 ml alone was placed into the right knee. Cartilage regeneration in the experimental and control groups were evaluated by macroscopically and histologically at 10, 30, and 60 days. Results: On day 10, after intra-articular injection of SD MSCs, we observed an early process of cartilage regeneration in the defect area. Histological studies revealed that cartilage defect was covered by a thin layer of spindle-shaped undifferentiated cells and proliferated chodroblasts. In contrast, an injection of HA did not induce reparation of cartilage in the defect area. At 30 days, macroscopic observation showed that the size of cartilage defect after SD MSC injection was significantly smaller than after HA injection. Histological score was also better in the MSC- treated intercondylar defect. At 60 days after MSC treatment, cartilage defect was nearly nonexistent and looked similar to an intact cartilage. Conclusion: Thus, intra-articular injection of SD MSCs can adhere to the defect in the intercondylar area, and promote cartilage regeneration in rabbits.

  6. Linguistic Derivations and Filtering. Minimalism and Optimality Theory

    NARCIS (Netherlands)

    Broekhuis, H.; Vogel, R.

    2013-01-01

    This volume focuses on the role of the postulated derivational and filtering devices in current linguistic theory and aims to promote the exchange of ideas between the proponents of MP and OT in order to evaluate the role of these devices in the two frameworks. It sheds more light on the tenability

  7. Inhibition of dehydrogenase activity in petroleum refinery wastewater bacteria by phenolic compounds

    Directory of Open Access Journals (Sweden)

    Gideon C. Okpokwasili

    2010-04-01

    Full Text Available The toxicity of phenol, 2-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol, 2-chlorophenol, 4-chlorophenol, 4-bromophenol and 3,5-dimethylphenol on Pseudomonas, Bacillus and Escherichia species isolated from petroleum refinery wastewater was assessed via inhibition of dehydrogenase enzyme activity. At low concentrations, 2-nitrophenol, 2-chlorophenol, 4-chlorophenol, 4-bromophenol and 3,5-dimethylphenol stimulated dehydrogenase activity and at sufficient concentrations, phenolic compounds inhibited dehydrogenase activities. Generally, phenol is less toxic than substituted phenols. Estimations of the degree of inhibition/stimulation of dehydrogenase activities showed significant dose-dependent responses that are describable by logistic functions. The toxicity thresholds varied significantly (P < 0.05 among the bacterial strains and phenolic compounds. The median inhibitory concentrations (IC50s ranged from 4.118 ± 0.097 mg.L-1 for 4-nitrophenol against Pseudomonas sp. DAF1 to 1407.997 ± 7.091 mg.L-1 for phenol against Bacillus sp. DISK1. This study suggested that the organisms have moderate sensitivity to phenols and have the potential to be used as indicators for assessment of chemical toxicity. They could also be used as catalysts for degradation of phenols in effluents.

  8. Cyclosporin A promotes mineralization by human cementoblastoma-derived cells in culture.

    Science.gov (United States)

    Arzate, Higinio; Alvarez, Marco A; Narayanan, A Sampath

    2005-06-01

    The immunosuppressive drug cyclosporin A has been shown to induce cementum deposition in vivo in experimental animals. Using cementoblastoma-derived cells, we have studied whether this drug will be useful to study cementum mineralization and differentiation in vitro. Human cementoblastoma cells and gingival fibroblasts (controls) were cultured and treated with 0.5, 1.0 and 5.0 microg/ml of cyclosporin A. Cell proliferation was evaluated by MTT (tetrazolium) assay and cell number, and cell viability was assessed by trypan blue dye exclusion. Induction of mineralization was evaluated by alizarin red S staining to detect mineralized nodules and by reverse transcription-polymerase chain reaction (RT-PCR) to assess the expression of bone differentiation markers alkaline phosphatase, osteocalcin, bone sialoprotein and core-binding factor a1 (Cbfa1). Cyclosporin A at 5.0 microg/ml concentration reduced significantly the increase in the number of cementoblastoma cells. A dose-dependent increase in the number of mineralized nodules occurred in cultures of cementoblastoma-derived cells treated with cyclosporin A, and RT-PCR analyses showed significantly higher levels of expression of alkaline phosphatase, bone sialoprotein, type I collagen, matrix metalloproteinase-1, osteocalcin, osteopontin, and Cbfa1. Human gingival fibroblast proliferation and cell number were not affected. Mineralized nodules were not detected in gingival fibroblasts and bone specific proteins were not expressed. Presence of cyclosporin A during 14-day culture period appears to suppress the proliferation of cementoblastoma cells and induce the formation mineralized-like tissue by these cells.

  9. Potential of Food and Natural Products to Promote Endothelial and Vascular Health.

    Science.gov (United States)

    Auger, Cyril; Said, Amissi; Nguyen, Phuong Nga; Chabert, Philippe; Idris-Khodja, Noureddine; Schini-Kerth, Valérie B

    2016-07-01

    Endothelial dysfunction is now well established as a pivotal early event in the development of major cardiovascular diseases including hypertension, atherosclerosis, and diabetes. The alteration of the endothelial function is often triggered by an imbalance between the endothelial formation of vasoprotective factors including nitric oxide (NO) and endothelium-dependent hyperpolarization, and an increased level of oxidative stress involving several prooxidant enzymes such as NADPH oxidase and, often also, the appearance of cyclooxygenase-derived vasoconstrictors. Preclinical studies have indicated that polyphenol-rich food and food-derived products such as grape-derived products, black and red berries, green and black teas and cocoa, and omega-3 fatty acids can trigger activating pathways in endothelial cells promoting an increased formation of nitric oxide and endothelium-dependent hyperpolarization. Moreover, intake of such food-derived products has been associated with the prevention and/or the improvement of an established endothelial dysfunction in several experimental models of cardiovascular diseases and in humans with cardiovascular diseases. This review will discuss both experimental and clinical evidences indicating that different types of food and natural products are able to promote endothelial and vascular health, as well as the underlying mechanisms.

  10. Formation of chlorinated organic compounds in fluidized bed combustion of recycled fuels; Kloorattujen orgaanisten yhdisteiden muodostuminen kierraetyspolttoaineiden leijukerrospoltossa

    Energy Technology Data Exchange (ETDEWEB)

    Vesterinen, R.; Kallio, M.; Kirjalainen, T.; Kolsi, A.; Merta, M. [VTT Energy, Jyvaeskylae (Finland)

    1997-10-01

    Four tests of co-combustion of recycled fuels (REP) with peat and coal in the 15 kW fluidized bed reactor were performed. The recycled fuel was so-called dry fraction in four vessels sampling at Keltinmaeki. In three tests a part of peat energy was replaced with coal. The mixtures were prepared so that in all mixtures 25 % of energy was recycled fuel and 75 % was either peat or the mixture of peat and coal. The concentrations of polyaromatic hydrocarbons (PAH), polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) and chlorophenols decreased with increasing part of coal due to the increasing sulphur/chlorine ratio. Principal Component Analysis (PCA) and Partial Least Square regression analysis (PLS) showed that the chlorine, copper and sulphur contents of the fuel effected most on the concentrations of chlorophenols, chlorobenzenes, PCBs and PCDDs/PCDFs. Other variables influencing on a model were the lead concentration and the sulphur/chlorine ratio in fuel and the hydrogen chloride concentration of the flue gas. The concentrations of chlorophenols and chlorobenzenes were also significant for PCDD/PCDF concentrations in flue gas. The sulphur, chlorine, copper and chromium contents in fly ash and the temperature of the reactor influenced on the chlorophenol, chlorobenzene, PCB and PCDD/PCDF concentrations in fly ash. The chlorophenol and chlorobenzene contents in fly ash, the sulphur/chlorine ratio and the lead content in fuel, the sulphur dioxide, hydrogen chloride and carbon monoxide concentrations in flue gas had also influence on PCDD/PCDF concentrations in fly ash

  11. Formation of chlorinated organic compounds in fluidized bed combustion of recycled fuels

    International Nuclear Information System (INIS)

    Vesterinen, R.; Kallio, M.; Kirjalainen, T.; Kolsi, A.; Merta, M.

    1997-01-01

    Four tests of co-combustion of recycled fuels (REP) with peat and coal in the 15 kW fluidized bed reactor were performed. The recycled fuel was so-called dry fraction in four vessels sampling at Keltinmaeki. In three tests a part of peat energy was replaced with coal. The mixtures were prepared so that in all mixtures 25 % of energy was recycled fuel and 75 % was either peat or the mixture of peat and coal. The concentrations of polyaromatic hydrocarbons (PAH), polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) and chlorophenols decreased with increasing part of coal due to the increasing sulphur/chlorine ratio. Principal Component Analysis (PCA) and Partial Least Square regression analysis (PLS) showed that the chlorine, copper and sulphur contents of the fuel effected most on the concentrations of chlorophenols, chlorobenzenes, PCBs and PCDDs/PCDFs. Other variables influencing on a model were the lead concentration and the sulphur/chlorine ratio in fuel and the hydrogen chloride concentration of the flue gas. The concentrations of chlorophenols and chlorobenzenes were also significant for PCDD/PCDF concentrations in flue gas. The sulphur, chlorine, copper and chromium contents in fly ash and the temperature of the reactor influenced on the chlorophenol, chlorobenzene, PCB and PCDD/PCDF concentrations in fly ash. The chlorophenol and chlorobenzene contents in fly ash, the sulphur/chlorine ratio and the lead content in fuel, the sulphur dioxide, hydrogen chloride and carbon monoxide concentrations in flue gas had also influence on PCDD/PCDF concentrations in fly ash

  12. Epigenetic and phenotypic profile of fibroblasts derived from induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Kyle J Hewitt

    2011-02-01

    Full Text Available Human induced pluripotent stem (hiPS cells offer a novel source of patient-specific cells for regenerative medicine. However, the biological potential of iPS-derived cells and their similarities to cells differentiated from human embryonic stem (hES cells remain unclear. We derived fibroblast-like cells from two hiPS cell lines and show that their phenotypic properties and patterns of DNA methylation were similar to that of mature fibroblasts and to fibroblasts derived from hES cells. iPS-derived fibroblasts (iPDK and their hES-derived counterparts (EDK showed similar cell morphology throughout differentiation, and patterns of gene expression and cell surface markers were characteristic of mature fibroblasts. Array-based methylation analysis was performed for EDK, iPDK and their parental hES and iPS cell lines, and hierarchical clustering revealed that EDK and iPDK had closely-related methylation profiles. DNA methylation analysis of promoter regions associated with extracellular matrix (ECM-production (COL1A1 by iPS- and hESC-derived fibroblasts and fibroblast lineage commitment (PDGFRβ, revealed promoter demethylation linked to their expression, and patterns of transcription and methylation of genes related to the functional properties of mature stromal cells were seen in both hiPS- and hES-derived fibroblasts. iPDK cells also showed functional properties analogous to those of hES-derived and mature fibroblasts, as seen by their capacity to direct the morphogenesis of engineered human skin equivalents. Characterization of the functional behavior of ES- and iPS-derived fibroblasts in engineered 3D tissues demonstrates the utility of this tissue platform to predict the capacity of iPS-derived cells before their therapeutic application.

  13. Pre-evaluated safe human iPSC-derived neural stem cells promote functional recovery after spinal cord injury in common marmoset without tumorigenicity.

    Directory of Open Access Journals (Sweden)

    Yoshiomi Kobayashi

    Full Text Available Murine and human iPSC-NS/PCs (induced pluripotent stem cell-derived neural stem/progenitor cells promote functional recovery following transplantation into the injured spinal cord in rodents. However, for clinical applicability, it is critical to obtain proof of the concept regarding the efficacy of grafted human iPSC-NS/PCs (hiPSC-NS/PCs for the repair of spinal cord injury (SCI in a non-human primate model. This study used a pre-evaluated "safe" hiPSC-NS/PC clone and an adult common marmoset (Callithrix jacchus model of contusive SCI. SCI was induced at the fifth cervical level (C5, followed by transplantation of hiPSC-NS/PCs at 9 days after injury. Behavioral analyses were performed from the time of the initial injury until 12 weeks after SCI. Grafted hiPSC-NS/PCs survived and differentiated into all three neural lineages. Furthermore, transplantation of hiPSC-NS/PCs enhanced axonal sparing/regrowth and angiogenesis, and prevented the demyelination after SCI compared with that in vehicle control animals. Notably, no tumor formation occurred for at least 12 weeks after transplantation. Quantitative RT-PCR showed that mRNA expression levels of human neurotrophic factors were significantly higher in cultured hiPSC-NS/PCs than in human dermal fibroblasts (hDFs. Finally, behavioral tests showed that hiPSC-NS/PCs promoted functional recovery after SCI in the common marmoset. Taken together, these results indicate that pre-evaluated safe hiPSC-NS/PCs are a potential source of cells for the treatment of SCI in the clinic.

  14. Root-associated bacteria promote grapevine growth: from the laboratory to the field

    KAUST Repository

    Rolli, Eleonora

    2016-08-18

    Background and Aims: Laboratory and greenhouse experiments have shown that root-associated bacteria have beneficial effects on grapevine growth; however, these effects have not been tested in the field. Here, we aimed to demonstrate whether bacteria of different geographical origins derived from different crop plants can colonize grapevine to gain a beneficial outcome for the plant leading to promote growth at the field scale. Methods: To link the ecological functions of bacteria to the promotion of plant growth, we sorted fifteen bacterial strains from a larger isolate collection to study in vitro Plant Growth Promoting (PGP) traits. We analysed the ability of these strains to colonise the root tissues of grapevine and Arabidopsis using green-fluorescent-protein-labelled strain derivatives and a cultivation independent approach. We assessed the ability of two subsets randomly chosen from the 15 selected strains to promote grapevine growth in two field-scale experiments in north and central Italy over two years. Parameters of plant vigour were measured during the vegetative season in de novo grafted vine cuttings and adult productive plants inoculated with the bacterial strains. Results: Beneficial bacteria rapidly and intimately colonized the rhizoplane and the root system of grapevine. In the field, plants inoculated with bacteria isolated from grapevine roots out-performed untreated plants. In both the tested vineyards, bacteria-promotion effects largely rely in the formation of an extended epigeal system endowed of longer shoots with larger diameters and more nodes than non-inoculated plants. Conclusions: PGP bacteria isolated in the laboratory can be successfully used to promote growth of grapevines in the field. The resulting larger canopy potentially increased the photosynthetic surface of the grapevine, promoting growth.

  15. Characterization of a Lactococcus lactis promoter for heterologous protein production

    Directory of Open Access Journals (Sweden)

    Christian E. Ogaugwu

    2018-03-01

    Full Text Available Constitutively active promoter elements for heterologous protein production in Lactococcus lactis are scarce. Here, the promoter of the PTS-IIC gene cluster from L. lactis NZ3900 is described. This promoter was cloned upstream of an enhanced green fluorescent protein, GFPmut3a, and transformed into L. lactis. Transformants produced up to 13.5 μg of GFPmut3a per milliliter of log phase cells. Addition of cellobiose further increased the production of GFPmut3a by up to two-fold when compared to glucose. Analysis of mutations at two specific positions in the PTS-IIC promoter showed that a ‘T’ to ‘G’ mutation within the −35 element resulted in constitutive expression in glucose, while a ‘C’ at nucleotide 7 in the putative cre site enhanced promoter activity in cellobiose. Finally, this PTS-IIC promoter is capable of mediating protein expression in Bacillus subtilis and Escherichia coli Nissle 1917, suggesting the potential for future biotechnological applications of this element and its derivatives.

  16. Ultraviolet B preconditioning enhances the hair growth-promoting effects of adipose-derived stem cells via generation of reactive oxygen species.

    Science.gov (United States)

    Jeong, Yun-Mi; Sung, Young Kwan; Kim, Wang-Kyun; Kim, Ji Hye; Kwack, Mi Hee; Yoon, Insoo; Kim, Dae-Duk; Sung, Jong-Hyuk

    2013-01-01

    Hypoxia induces the survival and regenerative potential of adipose-derived stem cells (ASCs), but there are tremendous needs to find alternative methods for ASC preconditioning. Therefore, this work investigated: (1) the ability of low-dose ultraviolet B (UVB) radiation to stimulate the survival, migration, and tube-forming activity of ASCs in vitro; (2) the ability of UVB preconditioning to enhance the hair growth-promoting capacity of ASCs in vivo; and (3) the mechanism of action for ASC stimulation by UVB. Although high-dose UVB decreased the proliferation of ASCs, low-dose (10 or 20 mJ/cm(2)) treatment increased their survival, migration, and tube-forming activity. In addition, low-dose UVB upregulated the expression of ASC-derived growth factors, and a culture medium conditioned by UVB-irradiated ASCs increased the proliferation of dermal papilla and outer root sheet cells. Notably, injection of UVB-preconditioned ASCs into C(3)H/HeN mice significantly induced the telogen-to-anagen transition and increased new hair weight in vivo. UVB treatment significantly increased the generation of reactive oxygen species (ROS) in cultured ASCs, and inhibition of ROS generation by diphenyleneiodonium chloride (DPI) significantly attenuated UVB-induced ASC stimulation. Furthermore, NADPH oxidase 4 (Nox4) expression was induced in ASCs by UVB irradiation, and Nox4 silencing by small interfering RNA, like DPI, significantly reduced UVB-induced ROS generation. These results suggest that the primary involvement of ROS generation in UVB-mediated ASC stimulation occurs via the Nox4 enzyme. This is the first indication that a low dose of UVB radiation and/or the control of ROS generation could potentially be incorporated into a novel ASC preconditioning method for hair regeneration.

  17. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    International Nuclear Information System (INIS)

    Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi

    2015-01-01

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs

  18. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.

  19. Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor

    International Nuclear Information System (INIS)

    Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank

    2006-01-01

    Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology

  20. On (in)stabilities of perturbations in mimetic models with higher derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Yunlong; Shen, Liuyuan [Department of Physics, Nanjing University, Nanjing 210093 (China); Mou, Yicen; Li, Mingzhe, E-mail: zylakx@163.com, E-mail: sly12271103@163.com, E-mail: moinch@mail.ustc.edu.cn, E-mail: limz@ustc.edu.cn [Interdisciplinary Center for Theoretical Study, University of Science and Technology of China, Hefei, Anhui 230026 (China)

    2017-08-01

    Usually when applying the mimetic model to the early universe, higher derivative terms are needed to promote the mimetic field to be dynamical. However such models suffer from the ghost and/or the gradient instabilities and simple extensions cannot cure this pathology. We point out in this paper that it is possible to overcome this difficulty by considering the direct couplings of the higher derivatives of the mimetic field to the curvature of the spacetime.

  1. Measuring the diffusion of innovative health promotion programs.

    Science.gov (United States)

    Steckler, A; Goodman, R M; McLeroy, K R; Davis, S; Koch, G

    1992-01-01

    Once a health promotion program has proven to be effective in one or two initial settings, attempts may be made to transfer the program to new settings. One way to conceptualize the transference of health promotion programs from one locale to another is by considering the programs to be innovations that are being diffused. In this way, diffusion of innovation theory can be applied to guide the process of program transference. This article reports on the development of six questionnaires to measure the extent to which health promotion programs are successfully disseminated: Organizational Climate, Awareness-Concern, Rogers's Adoption Variables, Level of Use, Level of Success, and Level of Institutionalization. The instruments are being successfully used in a study of the diffusion of health promotion/tobacco prevention curricula to junior high schools in North Carolina. The instruments, which measure the four steps of the diffusion process, have construct validity since they were developed within existing theories and are derived from the work of previous researchers. No previous research has attempted to use instruments like these to measure sequentially the stages of the diffusion process.

  2. DNER, an epigenetically modulated gene, regulates glioblastoma-derived neurosphere cell differentiation and tumor propagation.

    Science.gov (United States)

    Sun, Peng; Xia, Shuli; Lal, Bachchu; Eberhart, Charles G; Quinones-Hinojosa, Alfredo; Maciaczyk, Jarek; Matsui, William; Dimeco, Francesco; Piccirillo, Sara M; Vescovi, Angelo L; Laterra, John

    2009-07-01

    Neurospheres derived from glioblastoma (GBM) and other solid malignancies contain neoplastic stem-like cells that efficiently propagate tumor growth and resist cytotoxic therapeutics. The primary objective of this study was to use histone-modifying agents to elucidate mechanisms by which the phenotype and tumor-promoting capacity of GBM-derived neoplastic stem-like cells are regulated. Using established GBM-derived neurosphere lines and low passage primary GBM-derived neurospheres, we show that histone deacetylase (HDAC) inhibitors inhibit growth, induce differentiation, and induce apoptosis of neoplastic neurosphere cells. A specific gene product induced by HDAC inhibition, Delta/Notch-like epidermal growth factor-related receptor (DNER), inhibited the growth of GBM-derived neurospheres, induced their differentiation in vivo and in vitro, and inhibited their engraftment and growth as tumor xenografts. The differentiating and tumor suppressive effects of DNER, a noncanonical Notch ligand, contrast with the previously established tumor-promoting effects of canonical Notch signaling in brain cancer stem-like cells. Our findings are the first to implicate noncanonical Notch signaling in the regulation of neoplastic stem-like cells and suggest novel neoplastic stem cell targeting treatment strategies for GBM and potentially other solid malignancies.

  3. Adipose-derived stem cells enhance myogenic differentiation in the mdx mouse model of muscular dystrophy via paracrine signaling

    Directory of Open Access Journals (Sweden)

    Ji-qing Cao

    2016-01-01

    Full Text Available Adipose-derived stem cells have been shown to promote peripheral nerve regeneration through the paracrine secretion of neurotrophic factors. However, it is unclear whether these cells can promote myogenic differentiation in muscular dystrophy. Adipose-derived stem cells (6 × 10 6 were injected into the gastrocnemius muscle of mdx mice at various sites. Dystrophin expression was found in the muscle fibers. Phosphorylation levels of Akt, mammalian target of rapamycin (mTOR, eIF-4E binding protein 1 and S6 kinase 1 were increased, and the Akt/mTOR pathway was activated. Simultaneously, myogenin levels were increased, whereas cleaved caspase 3 and vimentin levels were decreased. Necrosis and fibrosis were reduced in the muscle fibers. These findings suggest that adipose-derived stem cells promote the regeneration and survival of muscle cells by inhibiting apoptosis and fibrosis, thereby alleviating muscle damage in muscular dystrophy.

  4. Screening for Identification of Personalized Food to Promote Adiponectin Secretion in Patients with Cancer.

    Science.gov (United States)

    Sakaue, Miki; Maeda, Kazuhisa; Ohno, Satoshi; Ito, Toshinori

    2016-07-01

    Adiponectin is secreted specifically from adipose tissue. Low serum adiponectin levels may cause metabolic syndrome, which is also a risk factor for carcinogenesis. Several studies have suggested a negative correlation between adiponectin and risk of cancers. This study examined the adiponectin secretion-promoting effect of food ingredients in adipose-derived stem cells (ADSCs) obtained from patients with cancer. ADSCs from 7 lifestyle disease cancer patients were differentiated into adipocytes. Subsequently, the adipocytes were treated with 49 food constituents. The adiponectin levels in cell culture supernatants were measured after 48 and 96 h. Soy genistein extract, lychee low-molecular-weight polyphenol, olive extract and turmeric promoted adiponectin secretion. Food constituents that promoted adiponectin secretion were identified using ADSCs derived from patients. This study suggested the possibility of a new treatment approach to prevent cancer recurrence. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Procedures vs. Incentives: The University Promotion System in Italy

    Science.gov (United States)

    Rettore, Enrico; Rocco, Lorenzo; Dal Maso, Carlo

    2018-01-01

    We evaluate two reforms that modified the procedures of recruitment and promotion in Italian academia to balance the preeminent role of the recruiting school and to counter nepotism. We theoretically derive the decision rule of the evaluation committees and test it against data including information from all selections to associate and full…

  6. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  7. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  8. Implementing health promotion tools in Australian Indigenous primary health care.

    Science.gov (United States)

    Percival, Nikki A; McCalman, Janya; Armit, Christine; O'Donoghue, Lynette; Bainbridge, Roxanne; Rowley, Kevin; Doyle, Joyce; Tsey, Komla

    2018-02-01

    In Australia, significant resources have been invested in producing health promotion best practice guidelines, frameworks and tools (herein referred to as health promotion tools) as a strategy to improve Indigenous health promotion programmes. Yet, there has been very little rigorous implementation research about whether or how health promotion tools are implemented. This paper theorizes the complex processes of health promotion tool implementation in Indigenous comprehensive primary healthcare services. Data were derived from published and grey literature about the development and the implementation of four Indigenous health promotion tools. Tools were theoretically sampled to account for the key implementation types described in the literature. Data were analysed using the grounded-theory methods of coding and constant comparison with construct a theoretical implementation model. An Indigenous Health Promotion Tool Implementation Model was developed. Implementation is a social process, whereby researchers, practitioners and community members collectively interacted in creating culturally responsive health promotion to the common purpose of facilitating empowerment. The implementation of health promotion tools was influenced by the presence of change agents; a commitment to reciprocity and organizational governance and resourcing. The Indigenous Health Promotion Tool Implementation Model assists in explaining how health promotion tools are implemented and the conditions that influence these actions. Rather than simply developing more health promotion tools, our study suggests that continuous investment in developing conditions that support empowering implementation processes are required to maximize the beneficial impacts and effectiveness of health promotion tools. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  9. Heparin binding chitosan derivatives for production of pro-angiogenic hydrogels for promoting tissue healing

    Energy Technology Data Exchange (ETDEWEB)

    Yar, Muhammad, E-mail: drmyar@ciitlahore.edu.pk [Interdisciplinary Research Center in Biomedical Materials, COMSATS Institute of Information Technology, Lahore 54000 (Pakistan); Shahzad, Sohail [Interdisciplinary Research Center in Biomedical Materials, COMSATS Institute of Information Technology, Lahore 54000 (Pakistan); Department of Chemistry, The Islamia University of Bahawalpur, Bahawalpur 63100 (Pakistan); Shahzadi, Lubna [Interdisciplinary Research Center in Biomedical Materials, COMSATS Institute of Information Technology, Lahore 54000 (Pakistan); Shahzad, Sohail Anjum [Department of Chemistry, COMSATS Institute of Information Technology, Abbottabad 22060 (Pakistan); Mahmood, Nasir [Department of Allied Health Sciences and Chemical Pathology, University of Health Sciences, Lahore (Pakistan); Department of Human Genetics and Molecular Biology, University of Health Sciences, Lahore (Pakistan); Chaudhry, Aqif Anwar [Interdisciplinary Research Center in Biomedical Materials, COMSATS Institute of Information Technology, Lahore 54000 (Pakistan); Rehman, Ihtesham ur [Interdisciplinary Research Center in Biomedical Materials, COMSATS Institute of Information Technology, Lahore 54000 (Pakistan); Materials Science and Engineering, North Campus, University of Sheffield, Broad Lane, Sheffield S3 7HQ (United Kingdom); MacNeil, Sheila, E-mail: s.macneil@sheffield.ac.uk [Materials Science and Engineering, North Campus, University of Sheffield, Broad Lane, Sheffield S3 7HQ (United Kingdom)

    2017-05-01

    Our aim was to develop a biocompatible hydrogel that could be soaked in heparin and placed on wound beds to improve the vasculature of poorly vascularized wound beds. In the current study, a methodology was developed for the synthesis of a new chitosan derivative (CSD-1). Hydrogels were synthesized by blending CSD-1 for either 4 or 24 h with polyvinyl alcohol (PVA). The physical/chemical interactions and the presence of specific functional groups were confirmed by Fourier transform infrared (FT-IR) spectroscopy and proton nuclear magnetic resonance ({sup 1}H NMR). The porous nature of the hydrogels was confirmed by scanning electron microscopy (SEM). Thermal gravimetric analysis (TGA) showed that these hydrogels have good thermal stability which was slightly increased as the blending time was increased. Hydrogels produced with 24 h of blending supported cell attachment more and could be loaded with heparin to induce new blood vessel formation in a chick chorionic allantoic membrane assay. - Highlights: • Chitosan based hydrogels were designed to stimulate angiogenesis. • Two new derivatives of chitosan were produced using a Mannich type reaction. • Blending a chitosan derivative with PVA gave a porous biocompatible hydrogel. • Heparin bound to the hydrogel on immersion changing its morphology. • Heparin loaded hydrogel stimulated blood vessel formation in a chick model.

  10. A novel iron-containing polyoxometalate heterogeneous photocatalyst for efficient 4-chlorophennol degradation by H{sub 2}O{sub 2} at neutral pH

    Energy Technology Data Exchange (ETDEWEB)

    Zhai, Qian; Zhang, Lizhong [Department of Chemistry and Applied Chemistry, Changji University, Changji 831100 (China); Zhao, Xiufeng, E-mail: zhaoxiufeng19670@126.com [Department of Chemistry and Applied Chemistry, Changji University, Changji 831100 (China); Chen, Han; Yin, Dongju [Department of Chemistry and Applied Chemistry, Changji University, Changji 831100 (China); Li, Jianhui [Department of Chemistry and Applied Chemistry, Changji University, Changji 831100 (China); National Engineering Laboratory for Green Chemical Productions of Alcohols-Ethers-Esters, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China)

    2016-07-30

    Graphical abstract: An iron-containing polyoxometalate (Fe{sup III}LysSiW) catalyst showes good performance in the degradation of 4-chlorophenol by H{sub 2}O{sub 2}, especially in irradiated system. The catalytic activity of Fe{sup III}LysSiW stems from synergetic effect of ferric iron for Fenton-like catalysis and SiW{sub 12}O{sub 40}{sup 4−} for photocatalysis, respectively. The chemisorption of H{sub 2}O{sub 2} on Fe{sup III}LysSiW surface by hydrogen bonding also promotes both the Fenton-like and photocatalytic processes. - Highlights: • An iron-containing POM was synthesized as heterogeneous Fenton-like catalyst. • The catalyst has both the Fenton-like and photocatalytic activity at neutral pH. • The activity stems from the co-existence of iron and heteropolyanion in the catalyst. • The hydrogen bonding of H{sub 2}O{sub 2} on the catalyst surface enhances the reaction rate. - Abstract: An iron-containing polyoxometalate (Fe{sup III}LysSiW) was synthesized from ferric chloride (Fe{sup III}), lysine (Lys) and silicotungstic acid (SiW), and characterized using ICP-AES, TG, FT-IR, UV–vis DRS, XRD and SEM. The chemical formula of Fe{sup III}LysSiW was determined as [Fe(H{sub 2}O){sub 5}(C{sub 6}H{sub 14}N{sub 2}O{sub 2})]HSiW{sub 12}O{sub 40}·8H{sub 2}O, with Keggin-structured SiW{sub 12}O{sub 40}{sup 4−} heteropolyanion and lysine moiety. As a heterogeneous catalyst, the as prepared Fe{sup III}LysSiW showed good performance in the degradation of 4-chlorophenol by H{sub 2}O{sub 2} in both the dark and irradiated systems. Under the conditions of 4-chlorophenol 100 mg/L, Fe{sup III}LysSiW 1.0 g/L, H{sub 2}O{sub 2} 20 mmol/L and pH 6.5, 4-chlorophenol could be completely degraded in ca. 40 min in the dark and ca. 15 min upon irradiation. Prolonging the reaction time to 3 h, the TOC removal reached to ca. 71.3% in the dark and ca. 98.8% under irradiation. The catalytic activity of Fe{sup III}LysSiW stems from synergetic effect of ferric iron and Si

  11. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration

    Directory of Open Access Journals (Sweden)

    Yu T

    2016-02-01

    proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely used as systemic gene vectors. Keywords: pigment epithelium-derived factor gene, nanoparticles based on PLGA derivative, gene delivery, systemic delivery, tumor

  12. Autocrine Effects of Tumor-Derived Complement

    Directory of Open Access Journals (Sweden)

    Min Soon Cho

    2014-03-01

    Full Text Available We describe a role for the complement system in enhancing cancer growth. Cancer cells secrete complement proteins that stimulate tumor growth upon activation. Complement promotes tumor growth via a direct autocrine effect that is partially independent of tumor-infiltrating cytotoxic T cells. Activated C5aR and C3aR signal through the PI3K/AKT pathway in cancer cells, and silencing the PI3K or AKT gene in cancer cells eliminates the progrowth effects of C5aR and C3aR stimulation. In patients with ovarian or lung cancer, higher tumoral C3 or C5aR mRNA levels were associated with decreased overall survival. These data identify a role for tumor-derived complement proteins in promoting tumor growth, and they therefore have substantial clinical and therapeutic implications.

  13. Emerging paradigms and questions on pro-angiogenic bone marrow-derived myelomonocytic cells.

    Science.gov (United States)

    Laurent, Julien; Touvrey, Cédric; Botta, Francesca; Kuonen, François; Ruegg, Curzio

    2011-01-01

    Cancer-related inflammation has emerged in recent years as a major event contributing to tumor angiogenesis, tumor progression and metastasis formation. Bone marrow-derived and inflammatory cells promote tumor angiogenesis by providing endothelial progenitor cells that differentiate into mature endothelial cells, and by secreting pro-angiogenic factors and remodeling the extracellular matrix to stimulate angiogenesis though paracrine mechanisms. Several bone marrow-derived myelonomocytic cells, including monocytes and macrophages, have been identified and characterized by several laboratories in recent years. While the central role of these cells in promoting tumor angiogenesis, tumor progression and metastasis is nowadays well established, many questions remain open and new ones are emerging. These include the relationship between their phenotype and function, the mechanisms of pro-angiogenic programming, their contribution to resistance to anti-angiogenic treatments and to metastasis and their potential clinical use as biomarkers of angiogenesis and anti-angiogenic therapies. Here, we will review phenotypical and functional aspects of bone marrow-derived myelonomocytic cells and discuss some of the current outstanding questions.

  14. Column operation studies for the removal of dyes and phenols using a low cost adsorbent

    International Nuclear Information System (INIS)

    Gupta, V. K.; Suhas; Tyagi, I.

    2016-01-01

    Fertilizer plant waste carbon slurry has been investigated after some processing used as efficient adsorbent for the fast removal and rapid adsorption of dyes and phenols using columns. The results reveals that the adsorbent developed from carbon slurry is carbonaceous in nature and having appreciable surface area (380 m2/g) can remove dyes both cationic (meldola blue, methylene blue, chrysoidine G, crystal violet) as well as anionic (ethyl orange, metanil yellow, acid blue 113), and phenols (phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol) fruitfully from water. The column type continuous flow operations were used to obtain the breakthrough curves. The breakthrough capacity, exhaustion capacity and degree of column utilization were optimized and evaluated from the plots. The results obtained revealed that the degree of column utilization for dyes falls in range from 60 to 76% while for phenols was in the range 53-58%. The exhaustion capacities were quite high as compared to the breakthrough capacities and were found to be 217, 211, 104, 126, 233, 248, 267 mg/g for meldola blue, crystal violet, chrysoidine G, methylene blue, ethyl orange, metanil yellow, acid blue 113, respectively and 25.6, 72.2, 82.2 and 197.3 mg/g for phenol, 2-chlorophenol, 4- chlorophenol and 2,4-dichlorophenol, respectively.

  15. Inhibitory concentrations of 2,4D and its possible intermediates in sulfate reducing biofilms

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Cruz, Ulises [Department of Biotechnology, Environmental Science and Technology, Universidad Autonoma Metropolitana-Iztapalapa, Ave. San Rafael Atlixco 186, Vicentina, 09340 D.F. (Mexico); Celis, Lourdes B. [Division de Ciencias Ambientales, Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la Presa San Jose 2055, Lomas 4a. Seccion, 78216 San Luis Potosi, S.L.P. (Mexico); Poggi, Hector [Department of Biotechnology and Bioengineering, CINVESTAV, Av. Instituto Politecnico Nacional 2508, Col. San Pedro Zacatenco, 07360 D.F. (Mexico); Meraz, Monica, E-mail: meraz@xanum.uam.mx [Department of Biotechnology, Environmental Science and Technology, Universidad Autonoma Metropolitana-Iztapalapa, Ave. San Rafael Atlixco 186, Vicentina, 09340 D.F. (Mexico)

    2010-07-15

    Different concentrations of the herbicide 2,4-dichlorophenoxyacetic acid (2,4D) and its possible intermediates such as 2,4-dichlorophenol (2,4DCP), 4-chlorophenol (4CP), 2-chlorophenol (2CP) and phenol, were assayed to evaluate the inhibitory effect on sulfate and ethanol utilization in a sulfate reducing biofilm. Increasing concentrations of the chlorophenolic compounds showed an adverse effect on sulfate reduction rate and ethanol conversion to acetate, being the intermediate 2,4DCP most toxic than the herbicide. The monochlorophenol 4CP (600 ppm) caused the complete cessation of sulfate reduction and ethanol conversion. The ratio of the electron acceptor to the electron donor utilized as well as the sulfate utilization volumetric rates, diminished when chlorophenols and phenol concentrations were increased, pointing out to the inhibition of the respiratory process and electrons transfer. The difference found in the IC{sub 50} values obtained was due to the chemical structure complexity of the phenolic compounds, the number of chlorine atoms as much as the chlorine atom position in the phenol ring. The IC{sub 50} values (ppm) indicated that the acute inhibition on the biofilm was caused by 2,4DCP (17.4) followed by 2,4D (29.0), 2CP (99.8), 4CP (108.0) and phenol (143.8).

  16. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  17. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  18. MARKET ALLOCATION RULES FOR NONPRICE PROMOTION WITH FARM PROGRAMS: U.S. COTTON

    OpenAIRE

    Ding, Lily; Kinnucan, Henry W.

    1996-01-01

    Rules are derived to indicate the optimal allocation of a fixed promotion budget between domestic and export markets when the commodity in question represents a significant portion of world trade and is protected in the domestic market by a deficiency-payment program. Optimal allocation decisions are governed by advertising elasticities in the domestic and export markets and the export market share. PromotionÂ’'s ability to lower deficiency payments is inversely related to the absolute value ...

  19. Advances in Microalgae-Derived Phytosterols for Functional Food and Pharmaceutical Applications.

    Science.gov (United States)

    Luo, Xuan; Su, Peng; Zhang, Wei

    2015-07-09

    Microalgae contain a variety of bioactive lipids with potential applications in aquaculture feed, biofuel, food and pharmaceutical industries. While microalgae-derived polyunsaturated fatty acid (PUFA) and their roles in promoting human health have been extensively studied, other lipid types from this resource, such as phytosterols, have been poorly explored. Phytosterols have been used as additives in many food products such as spread, dairy products and salad dressing. This review focuses on the recent advances in microalgae-derived phytosterols with functional bioactivities and their potential applications in functional food and pharmaceutical industries. It highlights the importance of microalgae-derived lipids other than PUFA for the development of an advanced microalgae industry.

  20. Glycerol positive promoters for tailored metabolic engineering of the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Ho, Ping-Wei; Klein, Mathias; Futschik, Matthias; Nevoigt, Elke

    2018-05-01

    Glycerol offers several advantages as a substrate for biotechnological applications. An important step toward using the popular production host Saccharomyces cerevisiae for glycerol-based bioprocesses has been the fact that in recent studies commonly used S. cerevisiae strains were engineered to grow in synthetic medium containing glycerol as the sole carbon source. For metabolic engineering projects of S. cerevisiae growing on glycerol, characterized promoters are missing. In the current study, we used transcriptome analysis and a yECitrine-based fluorescence reporter assay to select and characterize 25 useful promoters. The promoters of the genes ALD4 and ADH2 showed 4.2-fold and 3-fold higher activities compared to the well-known strong TEF1 promoter. Moreover, the collection contains promoters with graded activities in synthetic glycerol medium and different degrees of glucose repression. To demonstrate the general applicability of the promoter collection, we successfully used a subset of the characterized promoters with graded activities in order to optimize growth on glycerol in an engineered derivative of CEN.PK, in which glycerol catabolism exclusively occurs via a non-native DHA pathway.

  1. [Adipose-derived stem cell transplantation promotes the expression of netrin-1 in the rat cortex after focal cerebral ischemia].

    Science.gov (United States)

    Wang, Jiehua; Hong, Zhuquan; Pan, Ying; Li, Guoqian

    2017-01-01

    Objective To observe the effect of adipose-derived stem cells (ADSCs) transplantation on the expression of netrin-1 in rats after focal cerebral ischemia. Methods Male SD rats were randomly divided into control group, model group and ADSC group. ADSCs were harvested and purified. Focal cerebral ischemia models were established in rats by the suture method. ADSCs were injected into the lateral ventricle of ADSC group rats and the same does of PBS was given to model group rats. At day 4, 7 and 14 after reperfusion, six rats were sacrificed to remove the brain tissues at each time point. The expression of netrin-1 was detected by reverse-transcription PCR, Western blotting and immunohistochemistry. Results Compared with the control group, the expression of netrin-1 in the brain tissues of the model group increased after focal cerebral ischemia, reached the peak at 4 days, and the expression of netrin-1 was significantly higher than that of the control group at each time point. Compared with the model group, the expression of netrin-1 in the ADSC group increased further, reached the peak at 7 days, and the expression of netrin-1 in the ADSC group was significantly higher than that of the model group at each time point. Conclusion ADSC transplantation could up-regulate the expression of netrin-1, and promote axon regeneration and the recovery of neurological functions.

  2. Cadmium Telluride-Titanium Dioxide Nanocomposite for Photodegradation of Organic Substance.

    Science.gov (United States)

    Ontam, Areeporn; Khaorapapong, Nithima; Ogawa, Makoto

    2015-12-01

    Cadmium telluride-titanium dioxide nanocomposite was prepared by hydrothermal reaction of sol-gel derived titanium dioxide and organically modified cadmium telluride. The crystallinity of titanium dioxide in the nanocomposite was higher than that of pure titanium dioxide obtained by the reaction under the same temperature and pressure conditions, showing that cadmium telluride induced the crystallization of titanium dioxide. Diffuse reflectance spectrum of the nanocomposite showed the higher absorption efficiency in the UV-visible region due to band-gap excitation of titanium dioxide. The nanocomposite significantly showed the improvement of photocatalytic activity for 4-chlorophenol with UV light.

  3. A 3D Porous Gelatin-Alginate-Based-IPN Acts as an Efficient Promoter of Chondrogenesis from Human Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Sorina Dinescu

    2015-01-01

    Full Text Available Cartilage has limited regeneration potential. Thus, there is an imperative need to develop new strategies for cartilage tissue engineering (CTE amenable for clinical use. Recent CTE approaches rely on optimal cell-scaffold interactions, which require a great deal of optimization. In this study we attempt to build a novel gelatin- (G- alginate- (A- polyacrylamide (PAA 3D interpenetrating network (IPN with superior performance in promoting chondrogenesis from human adipose-derived stem cells (hADSCs. We show that our G-A-PAA scaffold is capable of supporting hADSCs proliferation and survival, with no apparent cytotoxic effect. Moreover, we find that after exposure to prochondrogenic conditions a key transcription factor known to induce chondrogenesis, namely, Sox9, is highly expressed in our hADSCs/G-A-PAA bioconstruct, along with cartilage specific markers such as collagen type II, CEP68, and COMP extracellular matrix (ECM components. These data suggest that our G-A-PAA structural properties and formulation might enable hADSCs conversion towards functional chondrocytes. We conclude that our novel G-A-PAA biomatrix is a good candidate for prospective in vivo CTE applications.

  4. Synthesis and characterization of La{sub 2}O{sub 3}/TiO{sub 2-x}F{sub x} and the visible light photocatalytic oxidation of 4-chlorophenol

    Energy Technology Data Exchange (ETDEWEB)

    Cao Guangxiu [State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai 201620 (China); Department of Chemistry, Shangqiu Normal University, Shangqiu 476000 (China); Li Yaogang [State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai 201620 (China); Zhang Qinghong, E-mail: zhangqh@dhu.edu.cn [Engineering Research Center of Advanced Glasses Manufacturing Technology, MOE, Donghua University, Shanghai 201620 (China); Wang Hongzhi, E-mail: wanghz@dhu.edu.cn [State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai 201620 (China)

    2010-06-15

    In this work, we investigated the synergetic effect of La and F on the visible light photocatalytic activity of TiO{sub 2} catalysts. La{sub 2}O{sub 3}/TiO{sub 2-x}F{sub x} photocatalysts were prepared by a simple sol-gel process using tetrabutyl titanate (TBT), La(NO{sub 3}){sub 3} and NH{sub 4}F as precursors. XPS results revealed that La{sub 2}O{sub 3} accumulated on the surface of TiO{sub 2}, which enhanced the surface area of TiO{sub 2} and inhibited the recombination of electron-hole pairs. It also showed that two kinds of fluorine species were formed and these increased the acid active sites and enhanced the oxidation potential of the photogenerated holes in the valance band. UV-vis diffuse reflection spectra of La{sub 2}O{sub 3}/TiO{sub 2-x}F{sub x} showed that intraband gap states were present and these are probably responsible for its absorption of visible light while the intrinsic absorption band was shifted slightly to a longer wavelength. At molar ratios of La and F to Ti of 1.5:100 and 5:100 and after calcination at 500 deg. C, the degradation rate of 4-chlorophenol (4-CP) over the sample was about 1.2-3.0 times higher than that of the other doped samples and undoped TiO{sub 2}. The total organic carbon (TOC) removal rates of 4-CP showed that 4-CP was mineralized efficiently in the presence of the sample under visible light illumination.

  5. Carcinostatic effects of diverse ascorbate derivatives in comparison with aliphatic chain moiety structures: Promotion by combined hyperthermia and reduced cytotoxicity to normal cells.

    Science.gov (United States)

    Asada, Ryoko; Kageyama, Katsuhiro; Tanaka, Hiroshi; Kimura, Masatugu; Saitoh, Yasukazu; Miwa, Nobuhiko

    2012-05-01

    In this study, using human tongue squamous carcinoma cells (HSC-4) carcinostatic activity was compared for diverse L-ascorbic acid (Asc) derivatives, including the 'straight-C(16)-chain types', 6-O-palmitoyl-Asc (A6-P) and Asc-2-phosphate-6-O-palmitate sodium salt (APPS), as well as the 'branched-C(16)-chain types', Asc-2-phosphate-6-O-(2'-hexyl)decanoate (APHD), an isomer of APPS, and Asc-2,3,5,6-O-tetra-(2'-hexyl)decanoate (VCIP). The order of magnitude of the carcinostatic effects at 37°C was: APPS>A6-P = APHD>VCIP and at 42°C was APPS = A6-P>APHD>VCIP. Therefore, the two straight-C(16)-chain derivatives, APPS and A6-P, had a greater effect compared to the two branched-C(16)-chain Asc derivatives, which are considered to have more difficulty with 'orientation along cell-membrane-glycerolipid direction'. APPS-treated HCS-4 cells were observed for a decrease in cell number, cell shrinkage, pycnosis indicative of apoptosis and cell deformation. The order of cytotoxicity for the normal human dermal fibroblasts (OUMS-36) at 37°C was: A6-P (50% inhibitory concentration: 150-300 μM)>APHD (450-600 μM)>Asc = APPS (800-1000 μM). Accordingly, APHD was more cytotoxic than APPS, since the straight-C(16)-chain type, which was eliminated after the enzymatic esterolysis of APPS, is metabolized via the 'fatty acid β-oxidation cycle' more efficiently in normal cells. Thus, APPS had a greater advantage over APHD, A6-P and VCIP in terms of carcinostatic effects at 37°C, carcinostasis promotion at 42°C and a decrease of cytotoxicity to normal cells. This observation suggests a marked potential for aliphatic chain-moiety structures as anticancer agents, due to their cancer-selective carcinostasis and combined efficacy with hyperthermia, without causing side effects.

  6. Characterization of Chondrogenic Gene Expression and Cartilage Phenotype Differentiation in Human Breast Adipose-Derived Stem Cells Promoted by Ginsenoside Rg1 In Vitro

    Directory of Open Access Journals (Sweden)

    Fang-Tian Xu

    2015-11-01

    Full Text Available Background/Aims: Investigating and understanding chondrogenic gene expression during the differentiation of human breast adipose-derived stem cells (HBASCs into chondrogenic cells is a prerequisite for the application of this approach for cartilage repair and regeneration. In this study, we aim to characterize HBASCs and to examine chondrogenic gene expression in chondrogenic inductive culture medium containing ginsenoside Rg1. Methods: Human breast adipose-derived stem cells at passage 3 were evaluated based on specific cell markers and their multilineage differentiation capacity. Cultured HBASCs were treated either with basic chondrogenic inductive conditioned medium alone (group A, control or with basic chondrogenic inductive medium plus 10 µg/ml (group B, 50 µg/ml (group C, or 100µg/ml ginsenoside Rg1 (group D. Cell proliferation was assessed using the CCK-8 assay for a period of 9 days. Two weeks after induction, the expression of chondrogenic genes (collagen type II, collagen type XI, ACP, COMP and ELASTIN was determined using real-time PCR in all groups. Results: The different concentrations of ginsenoside Rg1 that were added to the basic chondrogenic inductive culture medium promoted the proliferation of HBASCs at earlier stages (groups B, C, and D but resulted in chondrogenic phenotype differentiation and higher mRNA expression of collagen type II (CO-II, collagen type XI (CO-XI, acid phosphatase (ACP, cartilage oligomeric matrix protein (COMP and ELASTIN compared with the control (group A at later stages. The results reveal an obvious positive dose-effect relationship between ginsenoside Rg1 and the proliferation and chondrogenic phenotype differentiation of HBASCs in vitro. Conclusions: Human breast adipose-derived stem cells retain stem cell characteristics after expansion in culture through passage 3 and serve as a feasible source of cells for cartilage regeneration in vitro. Chondrogenesis in HBASCs was found to be prominent

  7. Mesenchymal Stromal Cell-Derived Interleukin-6 Promotes Epithelial-Mesenchymal Transition and Acquisition of Epithelial Stem-Like Cell Properties in Ameloblastoma Epithelial Cells.

    Science.gov (United States)

    Jiang, Chunmiao; Zhang, Qunzhou; Shanti, Rabie M; Shi, Shihong; Chang, Ting-Han; Carrasco, Lee; Alawi, Faizan; Le, Anh D

    2017-09-01

    Epithelial-mesenchymal transition (EMT), a biological process associated with cancer stem-like or cancer-initiating cell formation, contributes to the invasiveness, metastasis, drug resistance, and recurrence of the malignant tumors; it remains to be determined whether similar processes contribute to the pathogenesis and progression of ameloblastoma (AM), a benign but locally invasive odontogenic neoplasm. Here, we demonstrated that EMT- and stem cell-related genes were expressed in the epithelial islands of the most common histologic variant subtype, the follicular AM. Our results revealed elevated interleukin (IL)-6 signals that were differentially expressed in the stromal compartment of the follicular AM. To explore the stromal effect on tumor pathogenesis, we isolated and characterized both mesenchymal stromal cells (AM-MSCs) and epithelial cells (AM-EpiCs) from follicular AM and demonstrated that, in in vitro culture, AM-MSCs secreted a significantly higher level of IL-6 as compared to the counterpart AM-EpiCs. Furthermore, both in vitro and in vivo studies revealed that exogenous and AM-MSC-derived IL-6 induced the expression of EMT- and stem cell-related genes in AM-EpiCs, whereas such effects were significantly abrogated either by a specific inhibitor of STAT3 or ERK1/2, or by knockdown of Slug gene expression. These findings suggest that AM-MSC-derived IL-6 promotes tumor-stem like cell formation by inducing EMT process in AM-EpiCs through STAT3 and ERK1/2-mediated signaling pathways, implying a role in the etiology and progression of the benign but locally invasive neoplasm. Stem Cells 2017;35:2083-2094. © 2017 AlphaMed Press.

  8. Organizational change theory: implications for health promotion practice.

    Science.gov (United States)

    Batras, Dimitri; Duff, Cameron; Smith, Ben J

    2016-03-01

    Sophisticated understandings of organizational dynamics and processes of organizational change are crucial for the development and success of health promotion initiatives. Theory has a valuable contribution to make in understanding organizational change, for identifying influential factors that should be the focus of change efforts and for selecting the strategies that can be applied to promote change. This article reviews select organizational change models to identify the most pertinent insights for health promotion practitioners. Theoretically derived considerations for practitioners who seek to foster organizational change include the extent to which the initiative is modifiable to fit with the internal context; the amount of time that is allocated to truly institutionalize change; the ability of the agents of change to build short-term success deliberately into their implementation plan; whether or not the shared group experience of action for change is positive or negative and the degree to which agencies that are the intended recipients of change are resourced to focus on internal factors. In reviewing theories of organizational change, the article also addresses strategies for facilitating the adoption of key theoretical insights into the design and implementation of health promotion initiatives in diverse organizational settings. If nothing else, aligning health promotion with organizational change theory promises insights into what it is that health promoters do and the time that it can take to do it effectively. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. The Pericytic Phenotype of Adipose Tissue-Derived Stromal Cells Is Promoted by NOTCH2

    NARCIS (Netherlands)

    Terlizzi, Vincenzo; Kolibabka, Matthias; Burgess, Janette Kay; Hammes, Hans Peter; Harmsen, Martin Conrad

    Long-term diabetes leads to macrovascular and microvascular complication. In diabetic retinopathy (DR), persistent hyperglycemia causes permanent loss of retinal pericytes and aberrant proliferation of microvascular endothelial cells (ECs). Adipose tissue-derived stromal cells (ASCs) may serve to

  10. Fisetin: A Dietary Antioxidant for Health Promotion

    OpenAIRE

    Khan, Naghma; Syed, Deeba N.; Ahmad, Nihal; Mukhtar, Hasan

    2013-01-01

    Significance: Diet-derived antioxidants are now being increasingly investigated for their health-promoting effects, including their role in the chemoprevention of cancer. In general, botanical antioxidants have received much attention, as they can be consumed for longer periods of time without any adverse effects. Flavonoids are a broadly distributed class of plant pigments that are regularly consumed in the human diet due to their abundance. One such flavonoid, fisetin (3,3′,4′,7-tetrahydrox...

  11. Simultaneous removal of Cr(VI) and 4-chlorophenol through photocatalysis by a novel anatase/titanate nanosheet composite: Synergetic promotion effect and autosynchronous doping

    International Nuclear Information System (INIS)

    Liu, Wen; Sun, Weiling; Borthwick, Alistair G.L.; Wang, Ting; Li, Fan; Guan, Yidong

    2016-01-01

    Highlights: • TNS composed of anatase and titanate synthesized via a facile one-step method. • Cr(VI) and 4-CP can be simultaneously removed by TNS through photocatalysis. • Photocatalytic efficiencies of Cr(VI) and 4-CP greatly enhanced when coexisting. • Synergetic promotion effect occurs due to separation of electron-hole pairs. • Autosynchronous doping after Cr(III) adsorption leads to narrowed energy gap. - Abstract: Clean-up of wastewaters with coexisting heavy metals and organic contaminants is a huge issue worldwide. In this study, a novel anatase/titanate nanosheet composite material (labeled as TNS) synthesized through a one-step hydrothermal reaction was demonstrated to achieve the goal of simultaneous removal of Cr(VI) and 4-cholophenol (4-CP) from water. TEM and XRD analyses indicated the TNS was a nano-composite of anatase and titanate, with anatase acting as the primary photocatalysis center and titanate as the main adsorption site. Enhanced photocatalytic removal of co-existent Cr(VI) and 4-CP was observed in binary systems, with apparent rate constants (k_1) for photocatalytic reactions of Cr(VI) and 4-CP about 3.1 and 2.6 times of that for single systems. In addition, over 99% of Cr(VI) and 4-CP was removed within 120 min through photocatalysis by TNS at pH 7 in the binary system. Mechanisms for enhanced photocatalytic efficiency in the binary system are identified as: (1) a synergetic effect on the photo-reduction of Cr(VI) and photo-oxidation of 4-CP due to efficient separation of electron-hole pairs, and (2) autosynchronous doping because of reduced Cr(III) adsorption onto TNS. Furthermore, TNS could be efficiently reused after a simple acid-base treatment.

  12. Simultaneous removal of Cr(VI) and 4-chlorophenol through photocatalysis by a novel anatase/titanate nanosheet composite: Synergetic promotion effect and autosynchronous doping

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wen, E-mail: wzl0025@auburn.edu [Jiangsu Key Laboratory of Atmospheric Environment Monitoring and Pollution Control, School of Environmental Science and Engineering, Nanjing University of Information Science and Technology, Nanjing 210044 (China); The Key Laboratory of Water and Sediment Sciences, Ministry of Education, Department of Environmental Engineering, Peking University, Beijing 100871 (China); Environmental Engineering Program, Department of Civil Engineering, Auburn University, Auburn, AL 36849 (United States); Sun, Weiling [The Key Laboratory of Water and Sediment Sciences, Ministry of Education, Department of Environmental Engineering, Peking University, Beijing 100871 (China); Borthwick, Alistair G.L. [School of Engineering, The University of Edinburgh, The King’s Buildings, Edinburgh EH9 3JL (United Kingdom); Wang, Ting [The Key Laboratory of Water and Sediment Sciences, Ministry of Education, Department of Environmental Engineering, Peking University, Beijing 100871 (China); Li, Fan [Environmental Engineering Program, Department of Civil Engineering, Auburn University, Auburn, AL 36849 (United States); Guan, Yidong, E-mail: yidongguan@nuist.edu.cn [Jiangsu Key Laboratory of Atmospheric Environment Monitoring and Pollution Control, School of Environmental Science and Engineering, Nanjing University of Information Science and Technology, Nanjing 210044 (China); Environmental Engineering Program, Department of Civil Engineering, Auburn University, Auburn, AL 36849 (United States)

    2016-11-05

    Highlights: • TNS composed of anatase and titanate synthesized via a facile one-step method. • Cr(VI) and 4-CP can be simultaneously removed by TNS through photocatalysis. • Photocatalytic efficiencies of Cr(VI) and 4-CP greatly enhanced when coexisting. • Synergetic promotion effect occurs due to separation of electron-hole pairs. • Autosynchronous doping after Cr(III) adsorption leads to narrowed energy gap. - Abstract: Clean-up of wastewaters with coexisting heavy metals and organic contaminants is a huge issue worldwide. In this study, a novel anatase/titanate nanosheet composite material (labeled as TNS) synthesized through a one-step hydrothermal reaction was demonstrated to achieve the goal of simultaneous removal of Cr(VI) and 4-cholophenol (4-CP) from water. TEM and XRD analyses indicated the TNS was a nano-composite of anatase and titanate, with anatase acting as the primary photocatalysis center and titanate as the main adsorption site. Enhanced photocatalytic removal of co-existent Cr(VI) and 4-CP was observed in binary systems, with apparent rate constants (k{sub 1}) for photocatalytic reactions of Cr(VI) and 4-CP about 3.1 and 2.6 times of that for single systems. In addition, over 99% of Cr(VI) and 4-CP was removed within 120 min through photocatalysis by TNS at pH 7 in the binary system. Mechanisms for enhanced photocatalytic efficiency in the binary system are identified as: (1) a synergetic effect on the photo-reduction of Cr(VI) and photo-oxidation of 4-CP due to efficient separation of electron-hole pairs, and (2) autosynchronous doping because of reduced Cr(III) adsorption onto TNS. Furthermore, TNS could be efficiently reused after a simple acid-base treatment.

  13. Evaluación de un electrodo de carbón vítreo modificado con Zeolita tipo “A” en la adsorción de 2-clorofenol

    Directory of Open Access Journals (Sweden)

    Aurora Molina

    2009-10-01

    Full Text Available Glassy carbon electrodes modified with Zeolite “A” were studied in order to evidence the adsorption of 2-chlorophenol. Synthesis of zeolite was undertaken by a hydrothermal method using calcined kaolin as raw material. The zeolite was first exchanged with calcium ions. Then, it was modified with the cationic surfactant CTAB (cetyl trimethyl ammonium bromide or the non-ionic surfactant Triton X-100 (t-octylphenoxy-polyethoxyethanol. Adsorption of 2-chlorophenol was evaluated by cyclic voltammetry, once it was adsorbed onto the modified electrode. Electrochemical results indicated that the films surfactant-zeolites were able to adsorb the 2-chlorophenol from an aqueous alkaline medium. The best results were achieved when the cationic surfactant CTAB was used. The importance of electrode surface cleaning to guarantee the complete adherence between the vitreous carbon and the modified surfactant zeolite was determinated. Polishing and cleaning processes depend on the type of surfactant used.

  14. Cell-to-cell transformation in Escherichia coli: a novel type of natural transformation involving cell-derived DNA and a putative promoting pheromone.

    Directory of Open Access Journals (Sweden)

    Rika Etchuuya

    Full Text Available Escherichia coli is not assumed to be naturally transformable. However, several recent reports have shown that E. coli can express modest genetic competence in certain conditions that may arise in its environment. We have shown previously that spontaneous lateral transfer of non-conjugative plasmids occurs in a colony biofilm of mixed E. coli strains (a set of a donor strain harbouring a plasmid and a plasmid-free recipient strain. In this study, with high-frequency combinations of strains and a plasmid, we constructed the same lateral plasmid transfer system in liquid culture. Using this system, we demonstrated that this lateral plasmid transfer was DNase-sensitive, indicating that it is a kind of transformation in which DNase-accessible extracellular naked DNA is essential. However, this transformation did not occur with purified plasmid DNA and required a direct supply of plasmid from co-existing donor cells. Based on this feature, we have termed this transformation type as 'cell-to-cell transformation'. Analyses using medium conditioned with the high-frequency strain revealed that this strain released a certain factor(s that promoted cell-to-cell transformation and arrested growth of the other strains. This factor is heat-labile and protease-sensitive, and its roughly estimated molecular mass was between ∼9 kDa and ∼30 kDa, indicating that it is a polypeptide factor. Interestingly, this factor was effective even when the conditioned medium was diluted 10(-5-10(-6, suggesting that it acts like a pheromone with high bioactivity. Based on these results, we propose that cell-to-cell transformation is a novel natural transformation mechanism in E. coli that requires cell-derived DNA and is promoted by a peptide pheromone. This is the first evidence that suggests the existence of a peptide pheromone-regulated transformation mechanism in E. coli and in Gram-negative bacteria.

  15. Photocatalytic activity of porous multiwalled carbon nanotube-TiO{sub 2} composite layers for pollutant degradation

    Energy Technology Data Exchange (ETDEWEB)

    Zouzelka, Radek [J. Heyrovsky Institute of Physical Chemistry, v.i.i., Academy of Sciences of the Czech Republic, Dolejskova 3, 18223 Prague 8 (Czech Republic); Department of Physical Chemistry, University of Chemistry and Technology Prague, 16628 Prague (Czech Republic); Kusumawati, Yuly [Chimie ParisTech, PSL Research University, CNRS, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France); Remzova, Monika [J. Heyrovsky Institute of Physical Chemistry, v.i.i., Academy of Sciences of the Czech Republic, Dolejskova 3, 18223 Prague 8 (Czech Republic); Department of Physical Chemistry, University of Chemistry and Technology Prague, 16628 Prague (Czech Republic); Rathousky, Jiri [J. Heyrovsky Institute of Physical Chemistry, v.i.i., Academy of Sciences of the Czech Republic, Dolejskova 3, 18223 Prague 8 (Czech Republic); Pauporté, Thierry, E-mail: thierry.pauporte@chimie-paristech.fr [Chimie ParisTech, PSL Research University, CNRS, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France)

    2016-11-05

    Highlights: • A simple method for TiO{sub 2}/graphene nanocomposite layer preparation. • Stable coatings on glass substrate. • Mesoporous nanocomposite films with high internal surface area. • High photoactivity for 4-chlorophenol degradation. • Analysis of photocatalysis enhancement mechanism. - Abstract: TiO{sub 2} nanoparticles are suitable building blocks nanostructures for the synthesis of porous functional thin films. Here we report the preparation of films using brookite, P25 titania and anatase pristine nanoparticles and of nanocomposite layers combining anatase nanoparticles and multi-walled carbon nanotube (MWCNT) at various concentrations. The structure and phase composition of the layers were characterized by X-ray diffraction and Raman spectroscopy. Their morphology and texture properties were determined by scanning electron microscopy and krypton adsorption experiments, respectively. Additionally to a strong absorption in the UV range, the composites exhibited light absorption in the visible range as well. The photocatalytic performance of the layers was tested in the degradation of aqueous solutions of 4-chlorophenol serving as a model of an eco-persistent pollutant. Besides the determination of the decrease in the concentration of 4-chlorophenol, also the formation of intermediate degradation products, namely hydroquinone and benzoquinone, was followed. The presence of MWCNTs had a beneficial effect on the photocatalytic performance, a marked increase in the photocatalytic degradation rate constant being observed even at very low concentrations of MWCNTs. Compared to a P25 reference layer, the first order rate reaction constant increased by about 100% for the composite films containing MWCNTs at concentrations above 0.6 wt%. The key parameters for the enhancement of the photocatalytic performance are discussed. The presence of carbon nanotubes influences beneficially the degradation of 4-chlorophenol by an attack of the primarily

  16. Virally and physically transgenized equine adipose-derived stromal cells as a cargo for paracrine secreted factors

    Directory of Open Access Journals (Sweden)

    Cavirani Sandro

    2010-09-01

    Full Text Available Abstract Background Adipose-Derived Stromal Cells have been shown to have multiple lineage differentiation properties and to be suitable for tissues regeneration in many degenerative processes. Their use has been proposed for the therapy of joint diseases and tendon injuries in the horse. In the present report the genetic manipulation of Equine Adipose-Derived Stromal Cells has been investigated. Results Equine Adipose-Derived Stromal Cells were successfully virally transduced as well as transiently and stably transfected with appropriate parameters, without detrimental effect on their differentiation properties. Moreover, green fluorescent protein alone, fused to neo gene, or co-expressed as bi-cistronic reporter constructs, driven by viral and house-keeping gene promoters, were tested. The better expressed cassette was employed to stably transfect Adipose-Derived Stromal Cells for cell therapy purposes. Stably transfected Equine Adipose-Derived Stromal Cells with a heterologous secreted viral antigen were able to immunize horses upon injection into the lateral wall of the neck. Conclusion This study provides the methods to successfully transgenize Adipose-Derived Stromal Cells both by lentiviral vector and by transfection using optimized constructs with suitable promoters and reporter genes. In conclusion these findings provide a working platform for the delivery of potentially therapeutic proteins to the site of cells injection via transgenized Equine Adipose-Derived Stromal Cells.

  17. Strecker degradation of amino acids promoted by a camphor-derived sulfonamide

    Directory of Open Access Journals (Sweden)

    M. Fernanda N. N. Carvalho

    2016-04-01

    Full Text Available A camphor-derived sulfonimine with a conjugated carbonyl group, oxoimine 1 (O2SNC10H13O, reacts with amino acids (glycine, L-alanine, L-phenylalanine, L-leucine to form a compound O2SNC10H13NC10H14NSO2 (2 which was characterized by spectroscopic means (MS and NMR and supported by DFT calculations. The product, a single diastereoisomer, contains two oxoimine units connected by a –N= bridge, and thus has a structural analogy to the colored product Ruhemann´s purple obtained by the ninhydrin reaction with amino acids. A plausible reaction mechanism that involves zwitterions, a Strecker degradation of an intermediate imine and water-catalyzed tautomerizations was developed by means of DFT calculations on potential transition states.

  18. Advances in Microalgae-Derived Phytosterols for Functional Food and Pharmaceutical Applications

    Science.gov (United States)

    Luo, Xuan; Su, Peng; Zhang, Wei

    2015-01-01

    Microalgae contain a variety of bioactive lipids with potential applications in aquaculture feed, biofuel, food and pharmaceutical industries. While microalgae-derived polyunsaturated fatty acid (PUFA) and their roles in promoting human health have been extensively studied, other lipid types from this resource, such as phytosterols, have been poorly explored. Phytosterols have been used as additives in many food products such as spread, dairy products and salad dressing. This review focuses on the recent advances in microalgae-derived phytosterols with functional bioactivities and their potential applications in functional food and pharmaceutical industries. It highlights the importance of microalgae-derived lipids other than PUFA for the development of an advanced microalgae industry. PMID:26184233

  19. Fetal liver stromal cells promote hematopoietic cell expansion

    International Nuclear Information System (INIS)

    Zhou, Kun; Hu, Caihong; Zhou, Zhigang; Huang, Lifang; Liu, Wenli; Sun, Hanying

    2009-01-01

    Future application of hematopoietic stem and progenitor cells (HSPCs) in clinical therapies largely depends on their successful expansion in vitro. Fetal liver (FL) is a unique hematopoietic organ in which hematopoietic cells markedly expand in number, but the mechanisms involved remain unclear. Stromal cells (StroCs) have been suggested to provide a suitable cellular environment for in vitro expansion of HSPCs. In this study, murine StroCs derived from FL at E14.5, with a high level of Sonic hedgehog (Shh) and Wnt expression, were found to have an increased ability to support the proliferation of HSPCs. This effect was inhibited by blocking Shh signaling. Supplementation with soluble Shh-N promoted the proliferation of hematopoietic cells by activating Wnt signaling. Our findings suggest that FL-derived StroCs support proliferation of HSPCs via Shh inducing an autocrine Wnt signaling loop. The use of FL-derived StroCs and regulation of the Shh pathway might further enhance HPSC expansion.

  20. Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance.

    Science.gov (United States)

    Lobb, Richard J; van Amerongen, Rosa; Wiegmans, Adrian; Ham, Sunyoung; Larsen, Jill E; Möller, Andreas

    2017-08-01

    Non-small cell lung cancer (NSCLC) is the most common lung cancer type and the most common cause of mortality in lung cancer patients. NSCLC is often associated with resistance to chemotherapeutics and together with rapid metastatic spread, results in limited treatment options and poor patient survival. NSCLCs are heterogeneous, and consist of epithelial and mesenchymal NSCLC cells. Mesenchymal NSCLC cells are thought to be responsible for the chemoresistance phenotype, but if and how this phenotype can be transferred to other NSCLC cells is currently not known. We hypothesised that small extracellular vesicles, exosomes, secreted by mesenchymal NSCLC cells could potentially transfer the chemoresistance phenotype to surrounding epithelial NSCLC cells. To explore this possibility, we used a unique human bronchial epithelial cell (HBEC) model in which the parental cells were transformed from an epithelial to mesenchymal phenotype by introducing oncogenic alterations common in NSCLC. We found that exosomes derived from the oncogenically transformed, mesenchymal HBECs could transfer chemoresistance to the parental, epithelial HBECs and increase ZEB1 mRNA, a master EMT transcription factor, in the recipient cells. Additionally, we demonstrate that exosomes from mesenchymal, but not epithelial HBECs contain the ZEB1 mRNA, thereby providing a potential mechanism for the induction of a mesenchymal phenotype in recipient cells. Together, this work demonstrates for the first time that exosomes derived from mesenchymal, oncogenically transformed lung cells can transfer chemoresistance and mesenchymal phenotypes to recipient cells, likely via the transfer of ZEB1 mRNA in exosomes. © 2017 UICC.

  1. Safety of recombinant human platelet-derived growth factor-BB in Augment® Bone Graft

    Directory of Open Access Journals (Sweden)

    Luis A Solchaga

    2012-12-01

    Full Text Available This article discusses nonclinical and clinical data regarding the safety of recombinant human platelet-derived growth factor-BB as a component of the Augment® Bone Graft (Augment. Augment is a bone graft substitute intended to be used as an alternative to autologous bone graft in the fusion of hindfoot and ankle joints. Nonclinical studies included assessment of the pharmacokinetic profile of intravenously administered recombinant human platelet-derived growth factor-BB in rat and dog, effects of intravenous administration of recombinant human platelet-derived growth factor-BB in a reproductive and development toxicity study in rats, and chronic toxicity and carcinogenicity of Augment in a 12-month implantation model. These studies showed that systemic exposure was brief and clearance was rapid. No signs of toxicity, carcinogenicity, or tumor promotion were observed even with doses far exceeding the maximum clinical dose. Results of clinical trials (605 participants and commercial use of recombinant human platelet-derived growth factor-BB containing products indicate that these products are not associated with increased incidence of adverse events or cancer. The safety data presented provide evidence that recombinant human platelet-derived growth factor-BB is a safe therapeutic when used in combination products as a single administration during surgical procedures for bone repair and fusion. There is no evidence associating use of recombinant human platelet-derived growth factor-BB in Augment with chronic toxicity, carcinogenicity, or tumor promotion.

  2. Peptides modeled after the alpha-domain of metallothionein induce neurite outgrowth and promote survival of cerebellar granule neurons

    DEFF Research Database (Denmark)

    Asmussen, Johanne Wirenfeldt; Ambjørn, Malene; Bock, Elisabeth

    2009-01-01

    amino acids, as potent stimulators of neuronal differentiation and survival of primary neurons. In addition, we show that a peptide derived from the N-terminus of the MT beta-domain, EmtinBn, promotes neuronal survival. The neuritogenic and survival promoting effects of EmtinAc, similar to MT and Emtin...

  3. Laminin-111-derived peptide conjugated fibrin hydrogel restores salivary gland function.

    Directory of Open Access Journals (Sweden)

    Kihoon Nam

    Full Text Available Hyposalivation reduces the patient quality of life, as saliva is important for maintaining oral health. Current treatments for hyposalivation are limited to medications such as the muscarinic receptor agonists, pilocarpine and cevimeline. However, these therapies only provide temporary relief. Therefore, alternative therapies are essential to restore salivary gland function. An option is to use bioengineered scaffolds to promote functional salivary gland regeneration. Previous studies demonstrated that the laminin-111 protein is critical for intact salivary gland cell cluster formation and organization. However, laminin-111 protein as a whole is not suitable for clinical applications as some protein domains may contribute to unwanted side effects such as degradation, tumorigenesis and immune responses. Conversely, the use of synthetic laminin-111 peptides makes it possible to minimize the immune reactivity or pathogen transfer. In addition, it is relatively simple and inexpensive as compared to animal-derived proteins. Therefore, the goal of this study was to demonstrate whether a 20 day treatment with laminin-111-derived peptide conjugated fibrin hydrogel promotes tissue regeneration in submandibular glands of a wound healing mouse model. In this study, laminin-111-derived peptide conjugated fibrin hydrogel significantly accelerated formation of salivary gland tissue. The regenerated gland tissues displayed not only structural but also functional restoration.

  4. PU.1 is essential for CD11c expression in CD8(+/CD8(- lymphoid and monocyte-derived dendritic cells during GM-CSF or FLT3L-induced differentiation.

    Directory of Open Access Journals (Sweden)

    Xue-Jun Zhu

    Full Text Available Dendritic cells (DCs regulate innate and acquired immunity through their roles as antigen-presenting cells. Specific subsets of mature DCs, including monocyte-derived and lymphoid-derived DCs, can be distinguished based on distinct immunophenotypes and functional properties. The leukocyte integrin, CD11c, is considered a specific marker for DCs and it is expressed by all DC subsets. We created a strain of mice in which DCs and their progenitors could be lineage traced based on activity of the CD11c proximal promoter. Surprisingly, we observed levels of CD11c promoter activity that were similar in DCs and in other mature leukocytes, including monocytes, granulocytes, and lymphocytes. We sought to identify DNA elements and transcription factors that regulate DC-associated expression of CD11c. The ets transcription factor, PU.1, is a key regulator of DC development, and expression of PU.1 varies in different DC subsets. GM-CSF increased monocyte-derived DCs in mice and from mouse bone marrow cultured in vitro, but it did not increase CD8(+ lymphoid-derived DCs or B220(+ plasmacytoid DCs. FLT3L increased both monocyte-derived DCs and lymphoid-derived DCs from mouse bone marrow cultured in vitro. GM-CSF increased the 5.3 Kb CD11c proximal promoter activity in monocyte-derived DCs and CD8(+ lymphoid-derived DCs, but not in B220(+ plasmacytoid DCs. In contrast, FLT3L increased the CD11c proximal promoter activity in both monocyte-derived DCs and B220(+ plasmacytoid DCs. We used shRNA gene knockdown and chromatin immunoprecipitation to demonstrate that PU.1 is required for the effects of GM-CSF or FLT3L on monocyte-derived DCs. We conclude that both GM-CSF and FLT3L act through PU.1 to activate the 5.3 Kb CD11c proximal promoter in DCs and to induce differentiation of monocyte-derived DCs. We also confirm that the CD11c proximal promoter is not sufficient to direct lineage specificity of CD11c expression, and that additional DNA elements are required

  5. Induced pluripotent stem cells-derived myeloid-derived suppressor cells regulate the CD8+ T cell response

    Directory of Open Access Journals (Sweden)

    Daniel Joyce

    2018-05-01

    Full Text Available Myeloid-derived suppressor cells (MDSCs are markedly increased in cancer patients and tumor-bearing mice and promote tumor growth and survival by inhibiting host innate and adaptive immunity. In this study, we generated and characterized MDSCs from murine-induced pluripotent stem cells (iPSCs. The iPSCs were co-cultured with OP9 cells, stimulated with GM-CSF, and became morphologically heterologous under co-culturing with hepatic stellate cells. Allogeneic and OVA-specific antigen stimulation demonstrated that iPS-MDSCs have a T-cell regulatory function. Furthermore, a popliteal lymph node assay and autoimmune hepatitis model showed that iPS-MDSCs also regulate immune responsiveness in vivo and have a therapeutic effect against hepatitis. Taken together, our results demonstrated a method of generating functional MDSCs from iPSCs and highlighted the potential of iPS-MDSCs as a key cell therapy resource for transplantation and autoimmune diseases. Keywords: Myeloid-derived suppressor cells, Induced pluripotent stem cells, T cell response

  6. Allelopathic Effects of Plant-Derived Aerosol Smoke on Seed Germination of Arabidopsis thaliana (L.) Heynh

    International Nuclear Information System (INIS)

    Pennacchio, M.; Jefferson, L.V.; Havens, K.

    2007-01-01

    The role that plant-derived smoke plays in promoting seed germination is well documented, but little is known about its ability to inhibit seed germination. To better understand this phenomenon, we tested the effects of eight aerosol smoke treatments on the Columbia-3 ecotype of non dormant Arabidopsis thaliana (L.) Heynh. seeds. Our results revealed that aerosol smoke significantly inhibits germination when seeds were exposed to prolonged periods of aerosol smoke. Short durations of smoke treatments significantly promoted the rate of germination of A. thaliana seed. We briefly discuss this dual regulation of smoke and its possible impact on conservation and restoration practices. We also propose that plant-derived smoke may be another vehicle by which allelo chemicals can be introduced into the environment.

  7. IL-33 activates tumor stroma to promote intestinal polyposis.

    Science.gov (United States)

    Maywald, Rebecca L; Doerner, Stephanie K; Pastorelli, Luca; De Salvo, Carlo; Benton, Susan M; Dawson, Emily P; Lanza, Denise G; Berger, Nathan A; Markowitz, Sanford D; Lenz, Heinz-Josef; Nadeau, Joseph H; Pizarro, Theresa T; Heaney, Jason D

    2015-05-12

    Tumor epithelial cells develop within a microenvironment consisting of extracellular matrix, growth factors, and cytokines produced by nonepithelial stromal cells. In response to paracrine signals from tumor epithelia, stromal cells modify the microenvironment to promote tumor growth and metastasis. Here, we identify interleukin 33 (IL-33) as a regulator of tumor stromal cell activation and mediator of intestinal polyposis. In human colorectal cancer, IL-33 expression was induced in the tumor epithelium of adenomas and carcinomas, and expression of the IL-33 receptor, IL1RL1 (also referred to as IL1-R4 or ST2), localized predominantly to the stroma of adenoma and both the stroma and epithelium of carcinoma. Genetic and antibody abrogation of responsiveness to IL-33 in the Apc(Min/+) mouse model of intestinal tumorigenesis inhibited proliferation, induced apoptosis, and suppressed angiogenesis in adenomatous polyps, which reduced both tumor number and size. Similar to human adenomas, IL-33 expression localized to tumor epithelial cells and expression of IL1RL1 associated with two stromal cell types, subepithelial myofibroblasts and mast cells, in Apc(Min/+) polyps. In vitro, IL-33 stimulation of human subepithelial myofibroblasts induced the expression of extracellular matrix components and growth factors associated with intestinal tumor progression. IL-33 deficiency reduced mast cell accumulation in Apc(Min/+) polyps and suppressed the expression of mast cell-derived proteases and cytokines known to promote polyposis. Based on these findings, we propose that IL-33 derived from the tumor epithelium promotes polyposis through the coordinated activation of stromal cells and the formation of a protumorigenic microenvironment.

  8. Fiscal 2000 survey report. Research on laser-aided photolysis of environmental pollutant in liquid phase system; 2000 nendo ekisokei ni okeru kankyo osen busshitsu no laser hikari bunkai gijutsu ni kansuru kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Experiments were conducted on laser-aided decomposition and removal of chemical substances in liquid phase systems on the assumption that there existed chemical pollutants in wastewater or water after washing burned ash. The aim of the research was to split carbon-chlorine bonds and break benzene rings, the two being the cause of harmfulness, and experiments were conducted using chlorophenol. The photolytic lasers were ArF excimer laser and KrF excimer laser. It was found that the reduction rate of chlorophenol in a water solution under excimer laser irradiation was 1.7 times higher under KrF laser than under ArF laser. For mediums other than water, isopropanol was used, more convenient than chlorophenol in separating organic pollutants from burned ash and the like. In this case, organochlorine compounds were generated at the beginning, but they disappeared when irradiation was prolonged. It was demonstrated that the laser-aided environmental cleaning technology would find a very wide scope of application as an effective photolytic means. (NEDO)

  9. Ultrasonics Promoted Synthesis of 5-(Pyrazol-4-yl-4,5-Dihydropyrazoles Derivatives

    Directory of Open Access Journals (Sweden)

    Manuel Nogueras

    2013-04-01

    Full Text Available A series of new 1,3-diaryl-5-(1-phenyl-3-methyl-5-chloropyrazol-4-yl-4,5-dihydropyrazole derivatives have been synthesized under sonication conditions in ethanol or methanol/glacial acetic acid mixture (5/1 ratio with two equivalents of hydrazines and seven kinds of chalcone-like heteroanalogues obtained from 5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde. The structures were established on the basis of NMR, IR, MS and element analysis. This method provides several advantages over current reaction methodologies, including a simple work-up procedure, shorter reaction times (2–20 min and good yields (65%–80%.

  10. Mixed Fibronectin-Derived Peptides Conjugated to a Chitosan Matrix Effectively Promotes Biological Activities through Integrins, α4β1, α5β1, αvβ3, and Syndecan

    Directory of Open Access Journals (Sweden)

    Hozumi Kentaro

    2016-11-01

    Full Text Available Mimicking the biological function of the extracellular matrix is an approach to developing cell adhesive biomaterials. The RGD peptide, derived from fibronectin (Fn, mainly binds to integrin αvβ3 and has been widely used as a cell adhesive peptide on various biomaterials. However, cell adhesion to Fn is thought to be mediated by several integrin subtypes and syndecans. In this study, we synthesized an RGD-containing peptide (FIB1 and four integrin α4β1-binding-related motif-containing peptides (LDV, IDAPS, KLDAPT, and PRARI and constructed peptide-chitosan matrices. The FIB1-chitosan matrix promoted human dermal fibroblast (HDF attachment, and the C-terminal elongated PRARI (ePRARI-C-conjugated chitosan matrix significantly promoted HDF attachment through integrin α4β1 and syndecan binding. Next, we constructed a mixed ePRARI-C- and FIB1-chitosan matrix to develop a Fn mimetic biomaterial. The mixed ePRARI-C/FIB1-chitosan matrix promoted significantly better cell attachment and neurite outgrowth compared to those of either ePRARI-C- or FIB1-chitosan matrices. HDF adhesion to the ePRARI-C/FIB1-chitosan matrix was mediated by integrin, α4β1, α5β1, and αvβ3, similar to HDF adhesion to Fn. These data suggest that an ePRARI-C/FIB1-chitosan matrix can be used as a tool to analyze the multiple functions of Fn and can serve as a Fn-mimetic biomaterial.

  11. Extracellular matrix-derived hydrogels for dental stem cell delivery.

    Science.gov (United States)

    Viswanath, Aiswarya; Vanacker, Julie; Germain, Loïc; Leprince, Julian G; Diogenes, Anibal; Shakesheff, Kevin M; White, Lisa J; des Rieux, Anne

    2017-01-01

    Decellularized mammalian extracellular matrices (ECM) have been widely accepted as an ideal substrate for repair and remodelling of numerous tissues in clinical and pre-clinical studies. Recent studies have demonstrated the ability of ECM scaffolds derived from site-specific homologous tissues to direct cell differentiation. The present study investigated the suitability of hydrogels derived from different source tissues: bone, spinal cord and dentine, as suitable carriers to deliver human apical papilla derived mesenchymal stem cells (SCAP) for spinal cord regeneration. Bone, spinal cord, and dentine ECM hydrogels exhibited distinct structural, mechanical, and biological characteristics. All three hydrogels supported SCAP viability and proliferation. However, only spinal cord and bone derived hydrogels promoted the expression of neural lineage markers. The specific environment of ECM scaffolds significantly affected the differentiation of SCAP to a neural lineage, with stronger responses observed with spinal cord ECM hydrogels, suggesting that site-specific tissues are more likely to facilitate optimal stem cell behavior for constructive spinal cord regeneration. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 319-328, 2017. © 2016 Wiley Periodicals, Inc.

  12. Tumor-Derived Exosomes and Their Role in Cancer Progression.

    Science.gov (United States)

    Whiteside, Theresa L

    2016-01-01

    Tumor cells actively produce, release, and utilize exosomes to promote tumor growth. Mechanisms through which tumor-derived exosomes subserve the tumor are under intense investigation. These exosomes are information carriers, conveying molecular and genetic messages from tumor cells to normal or other abnormal cells residing at close or distant sites. Tumor-derived exosomes are found in all body fluids. Upon contact with target cells, they alter phenotypic and functional attributes of recipients, reprogramming them into active contributors to angiogenesis, thrombosis, metastasis, and immunosuppression. Exosomes produced by tumors carry cargos that in part mimic contents of parent cells and are of potential interest as noninvasive biomarkers of cancer. Their role in inhibiting the host antitumor responses and in mediating drug resistance is important for cancer therapy. Tumor-derived exosomes may interfere with cancer immunotherapy, but they also could serve as adjuvants and antigenic components of antitumor vaccines. Their biological roles in cancer development or progression as well as cancer therapy suggest that tumor-derived exosomes are critical components of oncogenic transformation. © 2016 Elsevier Inc. All rights reserved.

  13. Exercise promotes the expression of brain derived neurotrophic factor (BDNF) through the action of the ketone body β-hydroxybutyrate.

    Science.gov (United States)

    Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V

    2016-06-02

    Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF.

  14. Homogeneous MGMT immunoreactivity correlates with an unmethylated MGMT promoter status in brain metastases of various solid tumors.

    Directory of Open Access Journals (Sweden)

    Barbara Ingold

    Full Text Available The O(6-methylguanine-methyltransferase (MGMT promoter methylation status is a predictive parameter for the response of malignant gliomas to alkylating agents such as temozolomide. First clinical reports on treating brain metastases with temozolomide describe varying effects. This may be due to the fact that MGMT promoter methylation of brain metastases has not yet been explored in depth. Therefore, we assessed MGMT promoter methylation of various brain metastases including those derived from lung (n = 91, breast (n = 72 kidney (n = 49 and from malignant melanomas (n = 113 by methylation-specific polymerase chain reaction (MS-PCR and MGMT immunoreactivity. Fifty-nine of 199 brain metastases (29.6% revealed a methylated MGMT promoter. The methylation rate was the highest in brain metastases derived from lung carcinomas (46.5% followed by those from breast carcinoma (28.8%, malignant melanoma (24.7% and from renal carcinoma (20%. A significant correlation of homogeneous MGMT-immunoreactivity (>95% MGMT positive tumor cells and an unmethylated MGMT promoter was found. Promoter methylation was detected in 26 of 61 (43% tumors lacking MGMT immunoreactivity, in 17 of 63 (27% metastases with heterogeneous MGMT expression, but only in 5 of 54 brain metastases (9% showing a homogeneous MGMT immunoreactivity. Our results demonstrate that a significant number of brain metastases reveal a methylated MGMT-promoter. Based on an obvious correlation between homogeneous MGMT immunoreactivity and unmethylated MGMT promoter, we hypothesize that immunohistochemistry for MGMT may be a helpful diagnostic tool to identify those tumors that probably will not benefit from the use of alkylating agents. The discrepancy between promoter methylation and a lack of MGMT immunoreactivity argues for assessing MGMT promoter methylation both by immunohistochemical as well as by molecular approaches for diagnostic purposes.

  15. Human induced pluripotent stem cell (hiPSC)-derived neurons respond to convulsant drugs when co-cultured with hiPSC-derived astrocytes.

    Science.gov (United States)

    Ishii, Misawa Niki; Yamamoto, Koji; Shoji, Masanobu; Asami, Asano; Kawamata, Yuji

    2017-08-15

    Accurate risk assessment for drug-induced seizure is expected to be performed before entering clinical studies because of its severity and fatal damage to drug development. Induced pluripotent stem cell (iPSC) technology has allowed the use of human neurons and glial cells in toxicology studies. Recently, several studies showed the advantage of co-culture system of human iPSC (hiPSC)-derived neurons with rodent/human primary astrocytes regarding neuronal functions. However, the application of hiPSC-derived neurons for seizure risk assessment has not yet been fully addressed, and not at all when co-cultured with hiPSC-derived astrocytes. Here, we characterized hiPSC-derived neurons co-cultured with hiPSC-derived astrocytes to discuss how hiPSC-derived neurons are useful to assess seizure risk of drugs. First, we detected the frequency of spikes and synchronized bursts hiPSC-derived neurons when co-cultured with hiPSC-derived astrocytes for 8 weeks. This synchronized burst was suppressed by the treatment with 6-cyano-7-nitroquinoxaline-2,3-dione, α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor antagonist, and D-(-)-2-amino-5-phosphonopentanoic acid, an N-Methyl-d-aspartate (NMDA) receptor antagonist. These data suggested that co-cultured hiPSC-derived neurons formed synaptic connections mediated by AMPA and NMDA receptors. We also demonstrated that co-cultured hiPSC-derived neurons showed epileptiform activity upon treatment with gabazine or kaliotoxin. Finally, we performed single-cell transcriptome analysis in hiPSC-derived neurons and found that hiPSC-derived astrocytes activated the pathways involved in the activities of AMPA and NMDA receptor functions, neuronal polarity, and axon guidance in hiPSC-derived neurons. These data suggested that hiPSC-derived astrocytes promoted the development of action potential, synaptic functions, and neuronal networks in hiPSC-derived neurons, and then these functional alterations result in the epileptiform

  16. E1A FUNCTIONS AS A COACTIVATOR OF RETINOIC ACID-DEPENDENT RETINOIC ACID RECEPTOR-BETA-2 PROMOTER ACTIVATION

    NARCIS (Netherlands)

    KRUYT, FAE; FOLKERS, GE; WALHOUT, AJM; VANDERLEEDE, BM; VANDERSAAG, PT; Kruyt, Frank

    The retinoic acid (RA) receptor (RAR) beta2 promoter is strongly activated by RA in embryonal carcinoma (EC) cells. We examined this activation in the P19 EC-derived END-2 cell line and in E1A-expressing counterparts and found strong RA-dependent RARbeta2 promoter activation in the E1A-expressing

  17. Removing 3,5-Dichlorophenol from Wastewater by Alternative Adsorbents

    Directory of Open Access Journals (Sweden)

    Kobetičová Hana

    2014-12-01

    Full Text Available The main objective of this paper is to evaluate an efficiency of 3,5 - dichlorophenol removal from wastewater by using alternative adsorbents. Chlorophenols are organic compounds consisting of a benzene ring, OH groups and also atoms of chlorine. Chlorophenols may have a huge isomere variety that means there are differences in their chemical and physical properties. Due to their toxicity it is necessary to remove them from waste water and in this paper an alternative way of such process is described.

  18. Adsorption Isotherms of Phenol and 4-Chlorophenol on Petroleum Asphaltenes Adsorption du phénol et du 4-chlorophénol sur les asphaltènes pétroliers

    Directory of Open Access Journals (Sweden)

    Jaoui M.

    2006-11-01

    Full Text Available The adsorption isotherms for phenol and 4-chlorophenol from water onto asphaltenes flocculated in bulk and asphaltenes deposited on silica were established by frontal analysis chromatography at 293, 298, 303, and 308 K. The adsorption was more important with asphaltenes flocculated in bulk and corresponded to a Freundlich isotherm mechanism. The high adsorbed amount of phenols suggests possible migration of phenols through the loose asphaltene structure. Isotherms observed with the silica coated by asphaltenes showed that adsorption occurs in two stages corresponding probably to two different organizations of solute molecules at the surface. Les isothermes d'adsorption du phénol et du 4-chlorophénol en solution dans l'eau sur des asphaltènes floculés en masse et sur des asphaltènes déposés sur de la silice ont été déterminés par analyse chromatographique frontale à 293, 298, 303 et 308 K. L'adsorption sur des asphaltènes floculés en masse était la plus importante avec des isothermes correspondant à un mécanisme de Freundlich. La quantité élevée de phénols adsorbés suggère une migration possible des molécules du phénol à travers la structure peu compacte des asphaltènes. Les isothermes observés dans le cas de silice tapissée d'asphaltènes ont montré que l'adsorption se produit en deux étapes correspondant probablement à deux organisations différentes des molécules de soluté à la surface.

  19. Influence of rice straw-derived dissolved organic matter on lactic acid fermentation by Rhizopus oryzae.

    Science.gov (United States)

    Chen, Xingxuan; Wang, Xiahui; Xue, Yiyun; Zhang, Tian-Ao; Li, Yuhao; Hu, Jiajun; Tsang, Yiu Fai; Zhang, Hongsheng; Gao, Min-Tian

    2018-01-31

    Rice straw can be used as carbon sources for lactic acid fermentation. However, only a small amount of lactic acid is produced even though Rhizopus oryzae can consume glucose in rice straw-derived hydrolysates. This study correlated the inhibitory effect of rice straw with rice straw-derived dissolved organic matter (DOM). Lactic acid fermentations with and without DOM were conducted to investigate the effect of DOM on lactic acid fermentation by R. oryzae. Fermentation using control medium with DOM showed a similar trend to fermentation with rice straw-derived hydrolysates, showing that DOM contained the major inhibitor of rice straw. DOM assay indicated that it mainly consisted of polyphenols and polysaccharides. The addition of polyphenols and polysaccharides derived from rice straw confirmed that lactic acid fermentation was promoted by polysaccharides and significantly inhibited by polyphenols. The removal of polyphenols also improved lactic acid production. However, the loss of polysaccharides during the removal of polyphenols resulted in low glucose consumption. This study is the first to investigate the effects of rice straw-derived DOM on lactic acid fermentation by R. oryzae. The results may provide a theoretical basis for identifying inhibitors and promoters associated with lactic acid fermentation and for establishing suitable pretreatment methods. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Kallikrein-related peptidase 4 induces cancer-associated fibroblast features in prostate-derived stromal cells.

    Science.gov (United States)

    Kryza, Thomas; Silva, Lakmali M; Bock, Nathalie; Fuhrman-Luck, Ruth A; Stephens, Carson R; Gao, Jin; Samaratunga, Hema; Lawrence, Mitchell G; Hooper, John D; Dong, Ying; Risbridger, Gail P; Clements, Judith A

    2017-10-01

    The reciprocal communication between cancer cells and their microenvironment is critical in cancer progression. Although involvement of cancer-associated fibroblasts (CAF) in cancer progression is long established, the molecular mechanisms leading to differentiation of CAFs from normal fibroblasts are poorly understood. Here, we report that kallikrein-related peptidase-4 (KLK4) promotes CAF differentiation. KLK4 is highly expressed in prostate epithelial cells of premalignant (prostatic intraepithelial neoplasia) and malignant lesions compared to normal prostate epithelia, especially at the peristromal interface. KLK4 induced CAF-like features in the prostate-derived WPMY1 normal stromal cell line, including increased expression of alpha-smooth muscle actin, ESR1 and SFRP1. KLK4 activated protease-activated receptor-1 in WPMY1 cells increasing expression of several factors (FGF1, TAGLN, LOX, IL8, VEGFA) involved in prostate cancer progression. In addition, KLK4 induced WPMY1 cell proliferation and secretome changes, which in turn stimulated HUVEC cell proliferation that could be blocked by a VEGFA antibody. Importantly, the genes dysregulated by KLK4 treatment of WPMY1 cells were also differentially expressed between patient-derived CAFs compared to matched nonmalignant fibroblasts and were further increased by KLK4 treatment. Taken together, we propose that epithelial-derived KLK4 promotes tumour progression by actively promoting CAF differentiation in the prostate stromal microenvironment. © 2017 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  1. Tandem Aldol-Michael Reactions in Aqueous Diethylamine Medium: A Greener and Efficient Approach to Bis-Pyrimidine Derivatives

    Directory of Open Access Journals (Sweden)

    Abdullah M. Al-Majid

    2013-12-01

    Full Text Available A simple protocol, involving the green synthesis for the construction of novel bis-pyrimidine derivatives, 3a–i and 4a–e are accomplished by the aqueous diethylamine media promoted tandem Aldol-Michael reaction between two molecules of barbituric acid derivatives 1a,b with various aldehydes. This efficient synthetic protocol using an economic and environmentally friendly reaction media with versatility and shorter reaction time provides bis-pyrimidine derivatives with high yields (88%–99%.

  2. Comparison of germination responses of Anigozanthos flavidus (Haemodoraceae), Gyrostemon racemiger and Gyrostemon ramulosus (Gyrostemonaceae) to smoke-water and the smoke-derived compounds karrikinolide (KAR1) and glyceronitrile.

    Science.gov (United States)

    Downes, Katherine S; Light, Marnie E; Pošta, Martin; Kohout, Ladislav; van Staden, Johannes

    2013-03-01

    A major germination-promoting chemical in smoke-water is 3-methyl-2H-furo[2,3-c]pyran-2-one (karrikinolide, KAR(1)). However, not all species that germinate in response to smoke-water are responsive to KAR(1), such as Tersonia cyathiflora (Gyrostemonaceae). In this study, a test was made of whether two Gyrostemon species (Gyrostemonaceae) that have previously been shown to respond to smoke-water, respond to KAR(1). If not, then the smoke-derived chemical that stimulates germination of these species is currently unknown. Recently, glyceronitrile was isolated from smoke-water and promoted the germination of certain Anigozanthos species (Haemodoraceae). Whether this chemical promotes Gyrostemon racemiger germination is also examined. Furthermore, an investigation was carried out into whether these species germinate in response to smoke-water derived from burning cellulose alone. Gyrostemon racemiger and G. ramulosus seeds were buried after collection and retrieved in autumn the following year when dormancy was alleviated and seeds had become responsive to smoke-water. Anigozanthos flavidus seeds were after-ripened at 35 °C to alleviate dormancy. Gyrostemon and Anigozanthos seeds were then tested with 'Seed Starter' smoke-water, KAR(1), glyceronitrile and cellulose-derived smoke-water. Although Gyrostemon racemiger, G. ramulosus and A. flavidus were all stimulated to germinate by 'Seed Starter' smoke-water, none of these species responded to KAR(1). Gyrostemon racemiger germination was not promoted by glyceronitrile. This is in contrast to A. flavidus, where glyceronitrile, at concentrations of 1-500 µm, promoted germination, although seedling growth was inhibited at ≥400 µm. Maximum A. flavidus germination occurred at glyceronitrile concentrations of 25-300 µm. Some Gyrostemon germination was promoted by cellulose-derived smoke-water. KAR(1) and glyceronitrile, chemicals in smoke-water that are known to stimulate germination in other species, did not promote the

  3. Targeting eradication of malignant cells derived from human bone marrow mesenchymal stromal cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yingbin [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); School of Life Science, Southwest University, Chongqing 400715 (China); Cai, Shaoxi, E-mail: sxcai@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Yang, Li [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); College of Pharmacy, Jinan University, Guangzhou 510632 (China); Yu, Shuhui [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Library of Southwest University, Chongqing 400715 (China); Jiang, Jiahuan; Yan, Xiaoqing [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Zhang, Haoxing [School of Life Science, Southwest University, Chongqing 400715 (China); Liu, Lan [Department of Laboratory of Medicine, Children' s Hospital of Chongqin Medical University, Chongqing 400014 (China); Liu, Qun [College of Life Science and Technology, Southwest University for Nationalities, Chengdu 610041 (China); Du, Jun [Center of Microbiology, Biochemistry, and Pharmacology, School of Pharmaceutical Science, Sun Yat-Sen University, Guangzhou 510080 (China); Cai, Shaohui [College of Pharmacy, Jinan University, Guangzhou 510632 (China); Sung, K.L. Paul [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Departments of Orthopaedic Surgery and Bioengineering, University of California, SD 0412 (United States)

    2010-12-10

    Human bone marrow mesenchymal stromal cells (hBMSC) have been shown to participate in malignant transformation. However, hampered by the low frequency of malignant transformation of hBMSC, we do not yet know how to prevent malignant transformation of implanted hBMSC. In this study, in order to establish a model for the eradication of hBMSC-derived malignant cells, a gene fusion consisting of a human telomerase (hTERT) promoter modified with both c-Myc and myeloid zinc finger protein2 (MZF-2) binding elements and followed by the E. coli cytosine deaminase (CD) and luciferase genes was stably transferred into hBMSC via lentiviral transduction; n-phosphonacelyl-L-aspartic acid (PALA) selection was used to generate malignant cell colonies derived from transduced hBMSC after treatment with the carcinogenic reagent BPDE. Cells that were amplified after PALA selection were used for transplantation and 5-FC pro-drug cytotoxicity tests. The results showed that PALA-resistant malignant cells could be generated from hBMSC co-induced with lentiviral transduction and treatment with Benzo(a)pyrene Diol Epoxide (BPDE); the modification of c-Myc and MZF-2 binding elements could remarkably enhance the transcriptional activities of the hTERT promoter in malignant cells, whereas transcriptional activity was depressed in normal hBMSC; malignant cells stably expressing CD under the control of the modified hTERT promoter could be eliminated by 5-FC administration. This study has provided a method for targeted eradication of malignant cells derived from hBMSC.

  4. Targeting eradication of malignant cells derived from human bone marrow mesenchymal stromal cells

    International Nuclear Information System (INIS)

    Yang, Yingbin; Cai, Shaoxi; Yang, Li; Yu, Shuhui; Jiang, Jiahuan; Yan, Xiaoqing; Zhang, Haoxing; Liu, Lan; Liu, Qun; Du, Jun; Cai, Shaohui; Sung, K.L. Paul

    2010-01-01

    Human bone marrow mesenchymal stromal cells (hBMSC) have been shown to participate in malignant transformation. However, hampered by the low frequency of malignant transformation of hBMSC, we do not yet know how to prevent malignant transformation of implanted hBMSC. In this study, in order to establish a model for the eradication of hBMSC-derived malignant cells, a gene fusion consisting of a human telomerase (hTERT) promoter modified with both c-Myc and myeloid zinc finger protein2 (MZF-2) binding elements and followed by the E. coli cytosine deaminase (CD) and luciferase genes was stably transferred into hBMSC via lentiviral transduction; n-phosphonacelyl-L-aspartic acid (PALA) selection was used to generate malignant cell colonies derived from transduced hBMSC after treatment with the carcinogenic reagent BPDE. Cells that were amplified after PALA selection were used for transplantation and 5-FC pro-drug cytotoxicity tests. The results showed that PALA-resistant malignant cells could be generated from hBMSC co-induced with lentiviral transduction and treatment with Benzo(a)pyrene Diol Epoxide (BPDE); the modification of c-Myc and MZF-2 binding elements could remarkably enhance the transcriptional activities of the hTERT promoter in malignant cells, whereas transcriptional activity was depressed in normal hBMSC; malignant cells stably expressing CD under the control of the modified hTERT promoter could be eliminated by 5-FC administration. This study has provided a method for targeted eradication of malignant cells derived from hBMSC.

  5. Bio-Detergent oil derivative used frying

    Directory of Open Access Journals (Sweden)

    Alfonso Jesús Torres Ortega

    2011-04-01

    Full Text Available Currently, the global trend towards sustainable development for environmental friendly products such as biosurfactants shows an excellent performance. Anionic surface active agents can be produced from renewable natural raw materials such as vegetable oils mainly derived from palm oil. Methyl ester sulfonate is an active component of highly biodegradable detergents, one advantage compared with detergents derived from petrochemicals which generate a high pollutant load. This paper proposes the study of sulfonation with sulfur trioxide of esters derived from waste cooking oil which main component is palm oil. The falling film reactor allows determining the conditions of the process at pilot scale. The experimentation allowed an enhancement of empirical equations in the equipment implemented for this purpose and to determine some physicochemical properties. The comparison obtained for this same process with petrochemicals compounds indicates that the model could be applied to any film sulfonation but adjusting the parameters and specific conditions, such as the physicochemical properties of the compounds used, since the sulfonation process described in this work is one of the more complicated cases. The technological development presented here seeks to contribute with the industrial needs to promote green chemical industry for the production of biosurfactant from waste frying oil.

  6. Biogenic silica fibre promotes carcinogenesis in mouse skin.

    Science.gov (United States)

    Bhatt, T; Coombs, M; O'Neill, C

    1984-10-15

    Silica fibres derived from plants are common contaminants of human diet in certain regions of the world where oesophageal cancer reaches extremely high incidences. We show here that one of these types of fibre (derived from Phalaris canariensis L) promotes the occurrence of tumours in the skin of mice initiated with a polycyclic carcinogen. Three experiments are described. In the first, the grain which bears these fibres was added to the diet. This did not result in any abnormality in any part of the gastrointestinal tract, but there was a significant induction of tumours in the skin around the mouth and nose; these were the areas of the body surface which most frequently came into contact with the grain. In the second experiment, the mice were separated from the grain by an intervening wire gauze barrier; a similar number of tumours appeared on initiated mice treated in this way. In this case, contact now occurred most frequently on the dorsal surface, which was rubbed against the gauze barrier, and it was on this surface that the tumours appeared. No tumours appeared if the grain was removed. In the third experiment, pure fibres were isolated from the surface of the grain and boiled in strong nitric acid so as to remove any organic material. When these acid-cleaned fibres were applied to the initiated skin with light pressure, they promoted carcinogenesis in the same way as croton oil. In each experiment the majority of tumours produced were benign neoplasms, together with at least one squamous carcinoma. It seems possible that the size and shape of these fibres are the critical properties determining their promoting activity. Their mean diameter is 15 microns, their modal length close to 200 microns, and they are sharply pointed with a tip diameter of 0.5 micron.

  7. Bacillus spp. from rainforest soil promote plant growth under limited nitrogen conditions.

    Science.gov (United States)

    Huang, X-F; Zhou, D; Guo, J; Manter, D K; Reardon, K F; Vivanco, J M

    2015-03-01

    The aim of this study was to evaluate effects of PGPR (plant growth-promoting rhizobacteria) isolated from rainforest soil on different plants under limited nitrogen conditions. Bacterial isolates from a Peruvian rainforest soil were screened for plant growth-promoting effects on Arabidopsis (Col-0). Four selected isolates including one Bacillus subtilis, two B. atrophaeus and one B. pumilus significantly promoted growth of Zea mays L. and Solanum lycopersicum under greenhouse conditions. Moreover, the PGPRs significantly promoted growth of S. lycopersicum in both low and nitrogen-amended soil conditions. These PGPR strains were further studied to obtain insights into possible mechanisms of plant growth promotion. Volatile chemicals from those isolates promoted Arabidopsis growth, and the expression of genes related to IAA production was induced in the Arabidopsis plants treated with PGPRs. Further, selected PGPR strains triggered induced systemic resistance (ISR) against Pseudomonas syringae pv tomato DC3000 in Arabidopsis. PGPR strains isolated from the rainforest soil promoted the plant growth of Arabidopsis, corn and tomato. New PGPR that have wider adaptability to different crops, soils and environmental conditions are needed to decrease our reliance on agricultural amendments derived from fossil-based fuels. The PGPRs isolated from a nonagricultural site constitute new plant growth-promoting strains that could be developed for agricultural uses. © 2014 The Society for Applied Microbiology.

  8. Ultrasound-Promoted One-Pot, Four-Component Synthesis of Pyridin-2(1H-One Derivatives

    Directory of Open Access Journals (Sweden)

    Jinming Yang

    2013-11-01

    Full Text Available An efficient one-pot synthesis of 1,6-diamino-2-oxo-1,2,3,4-tetrahydro- pyridine-3,5-dicarbonitrile derivatives by four-component piperidine-catalyzed reactions of a ketone, malononitrile, ethyl cyanoacetate and hydrazine hydrate under ultrasound irradiation is described. This method provides several advantages such as shorter reaction times, excellent yields, and a simple workup procedure.

  9. Effect of structural promoters on Fe-based Fischer-Tropsch synthesis of biomass derived syngas

    Science.gov (United States)

    Pratibha Sharma; Thomas Elder; Leslie H. Groom; James J. Spivey

    2014-01-01

    Biomass gasification and subsequent conversion of this syngas to liquid hydrocarbons using Fischer–Tropsch (F–T) synthesis is a promising source of hydrocarbon fuels. However, biomass-derived syngas is different from syngas obtained from other sources such as steam reforming of methane. Specifically the H2/CO ratio is less than 1/1 and the CO

  10. Promoting healthy exercise among older people in general practice: issues in designing and evaluating therapeutic interventions.

    OpenAIRE

    Tai, S S; Gould, M; Iliffe, S

    1997-01-01

    The potential health benefits derived from sustained physical activity in older people are numerous; however, whether exercise promotion should take place in general practice is unsubstantiated. Exercise promotion should use existing research evidence of the advantages of exercise for various conditions, and target those inactive individuals who currently have no intention of changing their level of physical activity. Research has also raised methodological issues and questions about the feas...

  11. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  12. Vaccine adjuvant MF59 promotes the intranodal differentiation of antigen-loaded and activated monocyte-derived dendritic cells.

    Directory of Open Access Journals (Sweden)

    Rossella Cioncada

    Full Text Available MF59 is an oil-in-water emulsion adjuvant approved for human influenza vaccination in European Union. The mode of action of MF59 is not fully elucidated yet, but results from several years of investigation indicate that MF59 establishes an immunocompetent environment at injection site which promotes recruitment of immune cells, including antigen presenting cells (APCs, that are facilitated to engulf antigen and transport it to draining lymph node (dLN where the antigen is accumulated. In vitro studies showed that MF59 promotes the differentiation of monocytes to dendritic cells (Mo-DCs. Since after immunization with MF59, monocytes are rapidly recruited both at the injection site and in dLN and appear to have a morphological change toward a DC-like phenotype, we asked whether MF59 could play a role in inducing differentiation of Mo-DC in vivo. To address this question we immunized mice with the auto-fluorescent protein Phycoerythrin (PE as model antigen, in presence or absence of MF59. We measured the APC phenotype and their antigen uptake within dLNs, the antigen distribution within the dLN compartments and the humoral response to PE. In addition, using Ovalbumin as model antigen, we measured the capacity of dLN APCs to induce antigen-specific CD4 T cell proliferation. Here, we show, for the first time, that MF59 promotes differentiation of Mo-DCs within dLNs from intranodal recruited monocytes and we suggest that this differentiation could take place in the medullary compartment of the LN. In addition we show that the Mo-DC subset represents the major source of antigen-loaded and activated APCs within the dLN when immunizing with MF59. Interestingly, this finding correlates with the enhanced triggering of antigen-specific CD4 T cell response induced by LN APCs. This study therefore demonstrates that MF59 is able to promote an immunocompetent environment also directly within the dLN, offering a novel insight on the mechanism of action of

  13. Increased HDAC1 deposition at hematopoietic promoters in AML and its association with patient survival

    DEFF Research Database (Denmark)

    Tickenbrock, Lara; Klein, Hans-Ulrich; Trento, Cristina

    2011-01-01

    Epigenetic changes play a crucial role in leukemogenesis. HDACs are frequently recruited to target gene promoters by balanced translocation derived oncogenic fusion proteins. As important epigenetic effector mechanisms, histone deacetylases (HDAC) have emerged as potential therapeutic targets...

  14. "A good spot": Health promotion discourse, healthy cities and heterogeneity in contemporary Denmark.

    Science.gov (United States)

    Larsen, Eva Ladekjaer; Manderson, Lenore

    2009-06-01

    Health promotion at a community level has gained popularity in recent decades within and outside academic environments. The health promotion discourse is part of a wider political discourse, aimed at empowering individuals to take control of their own lives and enabling them to be engaged, responsible and active citizens in their own communities. Key values of the discourse, deriving from a democratic and individualistic culture, are evident in how local authorities develop and implement policies aimed at promoting population health and wellbeing. In this article, we draw on data from a relatively poor multicultural Danish community incorporated in the WHO Healthy Cities Programme. We explore how key terms of the health promoting discourse are constructed, operationalized and resisted by different subgroups. The contradictions that emerge challenge how we comprehend communities in relation to safety and harmony, and how people within defined communities are involved in common community life.

  15. Comparative analysis of amino acids and amino-acid derivatives in protein crystallization

    International Nuclear Information System (INIS)

    Ito, Len; Shiraki, Kentaro; Yamaguchi, Hiroshi

    2010-01-01

    New types of aggregation suppressors, such as amino acids and their derivatives, were focused on as fourth-component additives. Data were obtained that indicated that the additives promote protein crystallization. Optimal conditions for protein crystallization are difficult to determine because proteins tend to aggregate in saturated solutions. This study comprehensively evaluates amino acids and amino-acid derivatives as additives for crystallization. This fourth component of the solution increases the probability of crystallization of hen egg-white lysozyme in various precipitants owing to a decrease in aggregation. These results suggest that the addition of certain types of amino acids and amino-acid derivatives, such as Arg, Lys and esterified and amidated amino acids, is a simple method of improving the success rate of protein crystallization

  16. Electrical stimulation of schwann cells promotes sustained increases in neurite outgrowth.

    Science.gov (United States)

    Koppes, Abigail N; Nordberg, Andrea L; Paolillo, Gina M; Goodsell, Nicole M; Darwish, Haley A; Zhang, Linxia; Thompson, Deanna M

    2014-02-01

    Endogenous electric fields are instructive during embryogenesis by acting to direct cell migration, and postnatally, they can promote axonal growth after injury (McCaig 1991, Al-Majed 2000). However, the mechanisms for these changes are not well understood. Application of an appropriate electrical stimulus may increase the rate and success of nerve repair by directly promoting axonal growth. Previously, DC electrical stimulation at 50 mV/mm (1 mA, 8 h duration) was shown to promote neurite outgrowth and a more pronounced effect was observed if both peripheral glia (Schwann cells) and neurons were co-stimulated. If electrical stimulation is delivered to an injury site, both the neurons and all resident non-neuronal cells [e.g., Schwann cells, endothelial cells, fibroblasts] will be treated and this biophysical stimuli can influence axonal growth directly or indirectly via changes to the resident, non-neuronal cells. In this work, non-neuronal cells were electrically stimulated, and changes in morphology and neuro-supportive cells were evaluated. Schwann cell response (morphology and orientation) was examined after an 8 h stimulation over a range of DC fields (0-200 mV/mm, DC 1 mA), and changes in orientation were observed. Electrically prestimulating Schwann cells (50 mV/mm) promoted 30% more neurite outgrowth relative to co-stimulating both Schwann cells with neurons, suggesting that electrical stimulation modifies Schwann cell phenotype. Conditioned medium from the electrically prestimulated Schwann cells promoted a 20% increase in total neurite outgrowth and was sustained for 72 h poststimulation. An 11-fold increase in nerve growth factor but not brain-derived neurotrophic factor or glial-derived growth factor was found in the electrically prestimulated Schwann cell-conditioned medium. No significant changes in fibroblast or endothelial morphology and neuro-supportive behavior were observed poststimulation. Electrical stimulation is widely used in

  17. Comparative genomic analysis of four representative plant growth-promoting rhizobacteria in Pseudomonas

    Science.gov (United States)

    2013-01-01

    Background Some Pseudomonas strains function as predominant plant growth-promoting rhizobacteria (PGPR). Within this group, Pseudomonas chlororaphis and Pseudomonas fluorescens are non-pathogenic biocontrol agents, and some Pseudomonas aeruginosa and Pseudomonas stutzeri strains are PGPR. P. chlororaphis GP72 is a plant growth-promoting rhizobacterium with a fully sequenced genome. We conducted a genomic analysis comparing GP72 with three other pseudomonad PGPR: P. fluorescens Pf-5, P. aeruginosa M18, and the nitrogen-fixing strain P. stutzeri A1501. Our aim was to identify the similarities and differences among these strains using a comparative genomic approach to clarify the mechanisms of plant growth-promoting activity. Results The genome sizes of GP72, Pf-5, M18, and A1501 ranged from 4.6 to 7.1 M, and the number of protein-coding genes varied among the four species. Clusters of Orthologous Groups (COGs) analysis assigned functions to predicted proteins. The COGs distributions were similar among the four species. However, the percentage of genes encoding transposases and their inactivated derivatives (COG L) was 1.33% of the total genes with COGs classifications in A1501, 0.21% in GP72, 0.02% in Pf-5, and 0.11% in M18. A phylogenetic analysis indicated that GP72 and Pf-5 were the most closely related strains, consistent with the genome alignment results. Comparisons of predicted coding sequences (CDSs) between GP72 and Pf-5 revealed 3544 conserved genes. There were fewer conserved genes when GP72 CDSs were compared with those of A1501 and M18. Comparisons among the four Pseudomonas species revealed 603 conserved genes in GP72, illustrating common plant growth-promoting traits shared among these PGPR. Conserved genes were related to catabolism, transport of plant-derived compounds, stress resistance, and rhizosphere colonization. Some strain-specific CDSs were related to different kinds of biocontrol activities or plant growth promotion. The GP72 genome

  18. Promotion time cure rate model with nonparametric form of covariate effects.

    Science.gov (United States)

    Chen, Tianlei; Du, Pang

    2018-05-10

    Survival data with a cured portion are commonly seen in clinical trials. Motivated from a biological interpretation of cancer metastasis, promotion time cure model is a popular alternative to the mixture cure rate model for analyzing such data. The existing promotion cure models all assume a restrictive parametric form of covariate effects, which can be incorrectly specified especially at the exploratory stage. In this paper, we propose a nonparametric approach to modeling the covariate effects under the framework of promotion time cure model. The covariate effect function is estimated by smoothing splines via the optimization of a penalized profile likelihood. Point-wise interval estimates are also derived from the Bayesian interpretation of the penalized profile likelihood. Asymptotic convergence rates are established for the proposed estimates. Simulations show excellent performance of the proposed nonparametric method, which is then applied to a melanoma study. Copyright © 2018 John Wiley & Sons, Ltd.

  19. Elaborating on systems thinking in health promotion practice.

    Science.gov (United States)

    Naaldenberg, Jenneken; Vaandrager, Lenneke; Koelen, Maria; Wagemakers, Anne-Marie; Saan, Hans; de Hoog, Kees

    2009-03-01

    Health and well-being are the result of a series of complex processes in which an individual interacts with other people and the environment. A systematic approach ensures incorporation of individual, ecological, social and political factors. However, interactions between these factors can be overlooked within a systematical approach. A systemic approach can provide additional information by incorporating interactions and communication. The opportunities of a systems thinking perspective for health promotion were investigated for this paper. Although others have also made attempts to explore systems thinking in the field of health promotion, the implications of systems thinking in practice need attention. Other fields such as agricultural extension studies, organizational studies and development studies provide useful experiences with the use of a systems thinking perspective in practice. Building on experiences from these fields, we give a theoretical background in which processes of social learning and innovation play an important role. From this background, we derive an overview of important concepts for the practical application of a systems thinking perspective. These concepts are the structure of the system, meanings attached to actions, and power relations between actors. To make these concepts more explicit and reduce the theoretical character of systems thinking, we use an illustration to elaborate on these concepts in practice. For this purpose, we describe a health promotion partnership in The Netherlands using the concepts structure, meaning and power relations. We show how a systems perspective increases insight in the functioning of a partnership and how this can facilitate processes of social learning and innovation. This article concludes by identifying future opportunities and challenges in adopting systems thinking for health promotion practice. A systems perspective towards health promotion can help projects reaching a more integral and

  20. Antagonizing Arachidonic Acid-Derived Eicosanoids Reduces Inflammatory Th17 and Th1 Cell-Mediated Inflammation and Colitis Severity

    Directory of Open Access Journals (Sweden)

    Jennifer M. Monk

    2014-01-01

    Full Text Available During colitis, activation of two inflammatory T cell subsets, Th17 and Th1 cells, promotes ongoing intestinal inflammatory responses. n-6 polyunsaturated fatty acid- (PUFA- derived eicosanoids, such as prostaglandin E2 (PGE2, promote Th17 cell-mediated inflammation, while n-3 PUFA antagonize both Th17 and Th1 cells and suppress PGE2 levels. We utilized two genetic mouse models, which differentially antagonize PGE2 levels, to examine the effect on Th17 cells and disease outcomes in trinitrobenzene sulfonic acid- (TNBS- induced colitis. Fat-1 mice contain the ω3 desaturase gene from C. elegans and synthesize n-3 PUFA de novo, thereby reducing the biosynthesis of n-6 PUFA-derived eicosanoids. In contrast, Fads1 Null mice contain a disrupted Δ5 desaturase gene and produce lower levels of n-6 PUFA-derived eicosanoids. Compared to Wt littermates, Fat-1 and Fads1 Null mice exhibited a similar colitic phenotype characterized by reduced colonic mucosal inflammatory eicosanoid levels and mRNA expression of Th17 cell markers (IL-17A, RORγτ, and IL-23, decreased percentages of Th17 cells and, improved colon injury scores (P≤0.05. Thus, during colitis, similar outcomes were obtained in two genetically distinct models, both of which antagonize PGE2 levels via different mechanisms. Our data highlight the critical impact of n-6 PUFA-derived eicosanoids in the promotion of Th17 cell-mediated colonic inflammation.

  1. Visible-light photoactivity of plasmonic silver supported on mesoporous TiO2 nanoparticles (Ag-MTN) for enhanced degradation of 2-chlorophenol: Limitation of Ag-Ti interaction

    International Nuclear Information System (INIS)

    Jaafar, N.F.; Jalil, A.A.; Triwahyono, S.

    2017-01-01

    Highlights: • Ag 0 loaded on MTN was prepared by a direct in-situ electrochemical method. • The introduction of Ag 0 lowers the band gap and increases the number of OV and TSD. • Ag 0 acted as an electrons trapper and also a plasmonic sensitizer. • The formation of Ti-O-Ag in 10 wt% Ag-MTN decreased the amount of Ag 0 , TSD and OV. • 5 wt% Ag-MTN gave the highest percentage of photodegradation of 2-CP. - Abstract: Various weight loadings of Ag (1–10 wt.%) were introduced to mesoporous titania nanoparticles (MTN) via a direct in-situ electrochemical method. The catalysts were characterized by XRD, surface area analysis, FTIR, ESR, FESEM-EDX and TEM. Characterization results indicated that the introduction of Ag onto MTN decreased the particles size and band gap of the MTN while increasing the number of oxygen vacancies (OV) and Ti 3+ site defects (TSD). The activity performance of Ag-MTN on photodegradation of 2-chlorophenol (2-CP) under visible light irradiation was in the following order: 5 wt% Ag-MTN> 1 wt% Ag-MTN > MTN > 10 wt% Ag-MTN, with degradation percentages of 97, 88, 80 and 63%, respectively. The synergistic effect between Ag 0 and MTN seemed to play an important role in the system. The Ag0 acted as both an electron trap and a plasmonic sensitizer which suppressed the electron-hole recombination, while OV and TSD in the MTN accelerated the production of hydroxyl radicals for enhanced degradation of 2-CP. However, the formation of Ti-O-Ag in 10 wt% Ag-MTN was found to decrease the photoactivity due to the decrease in the formation of Ag 0 , TSD and OV as well as the increase in band gap energy. The photodegradation of 5 wt% Ag-MTN followed a pseudo-first-order Langmuir- Hinshelwood model and the catalyst was still stable after five cycles.

  2. Breast cancer cell behaviors on staged tumorigenesis-mimicking matrices derived from tumor cells at various malignant stages

    International Nuclear Information System (INIS)

    Hoshiba, Takashi; Tanaka, Masaru

    2013-01-01

    Highlights: •Models mimicking ECM in tumor with different malignancy were prepared. •Cancer cell proliferation was suppressed on benign tumor ECM. •Benign tumor cell proliferation was suppressed on cancerous ECM. •Chemoresistance of cancer cell was enhanced on cancerous ECM. -- Abstract: Extracellular matrix (ECM) has been focused to understand tumor progression in addition to the genetic mutation of cancer cells. Here, we prepared “staged tumorigenesis-mimicking matrices” which mimic in vivo ECM in tumor tissue at each malignant stage to understand the roles of ECM in tumor progression. Breast tumor cells, MDA-MB-231 (invasive), MCF-7 (non-invasive), and MCF-10A (benign) cells, were cultured to form their own ECM beneath the cells and formed ECM was prepared as staged tumorigenesis-mimicking matrices by decellularization treatment. Cells showed weak attachment on the matrices derived from MDA-MB-231 cancer cells. The proliferations of MDA-MB-231 and MCF-7 was promoted on the matrices derived from MDA-MB-231 cancer cells whereas MCF-10A cell proliferation was not promoted. MCF-10A cell proliferation was promoted on the matrices derived from MCF-10A cells. Chemoresistance of MDA-MB-231 cells against 5-fluorouracil increased on only matrices derived from MDA-MB-231 cells. Our results showed that the cells showed different behaviors on staged tumorigenesis-mimicking matrices according to the malignancy of cell sources for ECM preparation. Therefore, staged tumorigenesis-mimicking matrices might be a useful in vitro ECM models to investigate the roles of ECM in tumor progression

  3. Breast cancer cell behaviors on staged tumorigenesis-mimicking matrices derived from tumor cells at various malignant stages

    Energy Technology Data Exchange (ETDEWEB)

    Hoshiba, Takashi [Graduate School of Science and Engineering, Yamagata University, 4-3-16 Jonan, Yonezawa, Yamagata 992-8510 (Japan); International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Tanaka, Masaru, E-mail: tanaka@yz.yamagata-u.ac.jp [Graduate School of Science and Engineering, Yamagata University, 4-3-16 Jonan, Yonezawa, Yamagata 992-8510 (Japan)

    2013-09-20

    Highlights: •Models mimicking ECM in tumor with different malignancy were prepared. •Cancer cell proliferation was suppressed on benign tumor ECM. •Benign tumor cell proliferation was suppressed on cancerous ECM. •Chemoresistance of cancer cell was enhanced on cancerous ECM. -- Abstract: Extracellular matrix (ECM) has been focused to understand tumor progression in addition to the genetic mutation of cancer cells. Here, we prepared “staged tumorigenesis-mimicking matrices” which mimic in vivo ECM in tumor tissue at each malignant stage to understand the roles of ECM in tumor progression. Breast tumor cells, MDA-MB-231 (invasive), MCF-7 (non-invasive), and MCF-10A (benign) cells, were cultured to form their own ECM beneath the cells and formed ECM was prepared as staged tumorigenesis-mimicking matrices by decellularization treatment. Cells showed weak attachment on the matrices derived from MDA-MB-231 cancer cells. The proliferations of MDA-MB-231 and MCF-7 was promoted on the matrices derived from MDA-MB-231 cancer cells whereas MCF-10A cell proliferation was not promoted. MCF-10A cell proliferation was promoted on the matrices derived from MCF-10A cells. Chemoresistance of MDA-MB-231 cells against 5-fluorouracil increased on only matrices derived from MDA-MB-231 cells. Our results showed that the cells showed different behaviors on staged tumorigenesis-mimicking matrices according to the malignancy of cell sources for ECM preparation. Therefore, staged tumorigenesis-mimicking matrices might be a useful in vitro ECM models to investigate the roles of ECM in tumor progression.

  4. PSC-derived Galectin-1 inducing epithelial-mesenchymal transition of pancreatic ductal adenocarcinoma cells by activating the NF-κB pathway

    Science.gov (United States)

    Tang, Dong; Zhang, Jingqiu; Yuan, Zhongxu; Zhang, Hongpeng; Chong, Yang; Huang, Yuqin; Wang, Jie; Xiong, Qingquan; Wang, Sen; Wu, Qi; Tian, Ying; Lu, Yongdie; Ge, Xiao; Shen, Wenjing; Wang, Daorong

    2017-01-01

    Galectin-1 has previously been shown to be strongly expressed in activated pancreatic stellate cells (PSCs) and promote the development and metastasis of pancreatic ductal adenocarcinoma (PDAC). However, the molecular mechanisms by which Galectin-1 promotes the malignant behavior of pancreatic cancer cells remain unclear. In this study, we examined the effects of Galectin-1 knockdown or overexpression in PSCs co-cultured with pancreatic cancer (PANC-1) cells. Immunohistochemical analysis showed expression of epithelial-mesenchymal transition (EMT) markers and MMP9 were positively associated with the expression of Galectin-1 in 66 human PDAC tissues. In addition, our in vitro studies showed PSC-derived Galectin-1 promoted the proliferation, invasion, and survival (anti-apoptotic effects) of PANC-1 cells. We also showed PSC-derived Galectin-1 induced EMT of PANC-1 cells and activated the NF-кB pathway in vitro. Our mixed (PSCs and PANC-1 cells) mouse orthotopic xenograft model indicated that overexpression of Galectin-1 in PSCs significantly promoted the proliferation, growth, invasion, and liver metastasis of the transplanted tumor. Moreover, Galectin-1 overexpression in PSCs was strongly associated with increased expression of EMT markers in both the orthotopic xenograft tumor in the pancreas and in metastatic lesions of naked mice. We conclude that PSC-derived Galectin-1 promotes the malignant behavior of PDAC by inducing EMT via activation of the NF-κB pathway. Our results suggest that targeting Galectin-1 in PSCs could represent a promising therapeutic strategy for PDAC progression and metastasis. PMID:29156810

  5. A Novel Growth-Promoting Pathway Formed by GDNF-Overexpressing Schwann Cells Promotes Propriospinal Axonal Regeneration, Synapse formation, and Partial Recovery of Function after Spinal Cord Injury

    Science.gov (United States)

    Deng, Lingxiao; Deng, Ping; Ruan, Yiwen; Xu, Zao Cheng; Liu, Naikui; Wen, Xuejun; Smith, George M.; Xu, Xiao-Ming

    2013-01-01

    Descending propriospinal neurons (DPSN) are known to establish functional relays for supraspinal signals, and they display a greater growth response after injury than do the long projecting axons. However, their regenerative response is still deficient due to their failure to depart from growth supportive cellular transplants back into the host spinal cord, which contains numerous impediments to axon growth. Here we report the construction of a continuous growth-promoting pathway in adult rats, formed by grafted Schwann cells (SCs) overexpressing glial cell line-derived neurotrophic factor (GDNF). We demonstrate that such a growth-promoting pathway, extending from the axonal cut ends to the site of innervation in the distal spinal cord, promoted regeneration of DPSN axons through and beyond the lesion gap of a spinal cord hemisection. Within the distal host spinal cord, regenerated DPSN axons formed synapses with host neurons leading to the restoration of action potentials and partial recovery of function. PMID:23536080

  6. Agrobacterium tumefaciens responses to plant-derived signaling molecules

    Science.gov (United States)

    Subramoni, Sujatha; Nathoo, Naeem; Klimov, Eugene; Yuan, Ze-Chun

    2014-01-01

    As a special phytopathogen, Agrobacterium tumefaciens infects a wide range of plant hosts and causes plant tumors also known as crown galls. The complexity of Agrobacterium–plant interaction has been studied for several decades. Agrobacterium pathogenicity is largely attributed to its evolved capabilities of precise recognition and response to plant-derived chemical signals. Agrobacterium perceives plant-derived signals to activate its virulence genes, which are responsible for transferring and integrating its Transferred DNA (T-DNA) from its Tumor-inducing (Ti) plasmid into the plant nucleus. The expression of T-DNA in plant hosts leads to the production of a large amount of indole-3-acetic acid (IAA), cytokinin (CK), and opines. IAA and CK stimulate plant growth, resulting in tumor formation. Agrobacterium utilizes opines as nutrient sources as well as signals in order to activate its quorum sensing (QS) to further promote virulence and opine metabolism. Intriguingly, Agrobacterium also recognizes plant-derived signals including γ-amino butyric acid and salicylic acid (SA) to activate quorum quenching that reduces the level of QS signals, thereby avoiding the elicitation of plant defense and preserving energy. In addition, Agrobacterium hijacks plant-derived signals including SA, IAA, and ethylene to down-regulate its virulence genes located on the Ti plasmid. Moreover, certain metabolites from corn (Zea mays) also inhibit the expression of Agrobacterium virulence genes. Here we outline the responses of Agrobacterium to major plant-derived signals that impact Agrobacterium–plant interactions. PMID:25071805

  7. Agrobacterium tumefaciens responses to plant-derived signaling molecules

    Directory of Open Access Journals (Sweden)

    Sujatha eSubramoni

    2014-07-01

    Full Text Available As a special phytopathogen, Agrobacterium tumefaciens infects a wide range of plant hosts and causes plant tumors also known as crown galls. The complexity of Agrobacterium-plant interaction has been studied for several decades. Agrobacterium pathogenicity is largely attributed to its evolved capabilities of precise recognition and response to plant-derived chemical signals. Agrobacterium perceives plant-derived signals to activate its virulence genes, which are responsible for transferring and integrating its T-DNA (Transferred DNA from its Tumour-inducing (Ti plasmid into the plant nucleus. The expression of T-DNA in plant hosts leads to the production of a large amount of indole-3-acetic acid (IAA, cytokinin (CK and opines. IAA and CK stimulate plant growth, resulting in tumor formation. Agrobacterium utilizes opines as nutrient sources as well as signals in order to activate its quorum sensing (QS to further promote virulence and opine metabolism. Intriguingly, Agrobacterium also recognizes plant-derived signals including -amino butyric acid (GABA and salicylic acid (SA to activate quorum quenching that reduces the level of QS signals, thereby avoiding the elicitation of plant defense and preserving energy. In addition, Agrobacterium hijacks plant-derived signals including SA, IAA, and ethylene (ET to down-regulate its virulence genes located on the Ti plasmid. Moreover, certain metabolites from corn (Zea mays also inhibit the expression of Agrobacterium virulence genes. Here we outline the responses of Agrobacterium to major plant-derived signals that impact Agrobacterium-plant interactions.

  8. Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...

    Indian Academy of Sciences (India)

    First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...

  9. Generation and periodontal differentiation of human gingival fibroblasts-derived integration-free induced pluripotent stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Xiaohui [Department of Periodontology, School and Hospital of Stomatology, Peking University, 22 South Avenue Zhong-Guan-Cun, Beijing 100081 (China); Peking University Stem Cell Research Center and Department of Cell Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Beijing 100191 (China); Li, Yang [Peking University Stem Cell Research Center and Department of Cell Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Beijing 100191 (China); Li, Jingwen [Department of Periodontology, School and Hospital of Stomatology, Peking University, 22 South Avenue Zhong-Guan-Cun, Beijing 100081 (China); Li, Peng [Faculty of Dentistry, The University of Hong Kong, 34 Hospital Road, Hong Kong SAR (China); Liu, Yinan [Peking University Stem Cell Research Center and Department of Cell Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Beijing 100191 (China); Wen, Jinhua, E-mail: jhwen@bjmu.edu.cn [Peking University Stem Cell Research Center and Department of Cell Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Beijing 100191 (China); Luan, Qingxian, E-mail: kqluanqx@126.com [Department of Periodontology, School and Hospital of Stomatology, Peking University, 22 South Avenue Zhong-Guan-Cun, Beijing 100081 (China)

    2016-05-06

    Induced pluripotent stem cells (iPSCs) have been recognized as a promising cell source for periodontal tissue regeneration. However, the conventional virus-based reprogramming approach is associated with a high risk of genetic mutation and limits their therapeutic utility. Here, we successfully generated iPSCs from readily accessible human gingival fibroblasts (hGFs) through an integration-free and feeder-free approach via delivery of reprogramming factors of Oct4, Sox2, Klf4, L-myc, Lin28 and TP53 shRNA with episomal plasmid vectors. The iPSCs presented similar morphology and proliferation characteristics as embryonic stem cells (ESCs), and expressed pluripotent markers including Oct4, Tra181, Nanog and SSEA-4. Additionally, these cells maintained a normal karyotype and showed decreased CpG methylation ratio in the promoter regions of Oct4 and Nanog. In vivo teratoma formation assay revealed the development of tissues representative of three germ layers, confirming the acquisition of pluripotency. Furthermore, treatment of the iPSCs in vitro with enamel matrix derivative (EMD) or growth/differentiation factor-5 (GDF-5) significantly up-regulated the expression of periodontal tissue markers associated with bone, periodontal ligament and cementum respectively. Taken together, our data demonstrate that hGFs are a valuable cell source for generating integration-free iPSCs, which could be sequentially induced toward periodontal cells under the treatment of EMD and GDF-5. - Highlights: • Integration-free iPSCs are successfully generated from hGFs via an episomal approach. • EMD promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • GDF-5 promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • hGFs-derived iPSCs could be a promising cell source for periodontal regeneration.

  10. Generation and periodontal differentiation of human gingival fibroblasts-derived integration-free induced pluripotent stem cells

    International Nuclear Information System (INIS)

    Yin, Xiaohui; Li, Yang; Li, Jingwen; Li, Peng; Liu, Yinan; Wen, Jinhua; Luan, Qingxian

    2016-01-01

    Induced pluripotent stem cells (iPSCs) have been recognized as a promising cell source for periodontal tissue regeneration. However, the conventional virus-based reprogramming approach is associated with a high risk of genetic mutation and limits their therapeutic utility. Here, we successfully generated iPSCs from readily accessible human gingival fibroblasts (hGFs) through an integration-free and feeder-free approach via delivery of reprogramming factors of Oct4, Sox2, Klf4, L-myc, Lin28 and TP53 shRNA with episomal plasmid vectors. The iPSCs presented similar morphology and proliferation characteristics as embryonic stem cells (ESCs), and expressed pluripotent markers including Oct4, Tra181, Nanog and SSEA-4. Additionally, these cells maintained a normal karyotype and showed decreased CpG methylation ratio in the promoter regions of Oct4 and Nanog. In vivo teratoma formation assay revealed the development of tissues representative of three germ layers, confirming the acquisition of pluripotency. Furthermore, treatment of the iPSCs in vitro with enamel matrix derivative (EMD) or growth/differentiation factor-5 (GDF-5) significantly up-regulated the expression of periodontal tissue markers associated with bone, periodontal ligament and cementum respectively. Taken together, our data demonstrate that hGFs are a valuable cell source for generating integration-free iPSCs, which could be sequentially induced toward periodontal cells under the treatment of EMD and GDF-5. - Highlights: • Integration-free iPSCs are successfully generated from hGFs via an episomal approach. • EMD promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • GDF-5 promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • hGFs-derived iPSCs could be a promising cell source for periodontal regeneration.

  11. Fibroblast-derived CXCL12 promotes breast cancer metastasis by facilitating tumor cell intravasation.

    Science.gov (United States)

    Ahirwar, Dinesh K; Nasser, Mohd W; Ouseph, Madhu M; Elbaz, Mohamad; Cuitiño, Maria C; Kladney, Raleigh D; Varikuti, Sanjay; Kaul, Kirti; Satoskar, Abhay R; Ramaswamy, Bhuvaneswari; Zhang, Xiaoli; Ostrowski, Michael C; Leone, Gustavo; Ganju, Ramesh K

    2018-05-03

    The chemokine CXCL12 has been shown to regulate breast tumor growth, however, its mechanism in initiating distant metastasis is not well understood. Here, we generated a novel conditional allele of Cxcl12 in mice and used a fibroblast-specific Cre transgene along with various mammary tumor models to evaluate CXCL12 function in the breast cancer metastasis. Ablation of CXCL12 in stromal fibroblasts of mice significantly delayed the time to tumor onset and inhibited distant metastasis in different mouse models. Elucidation of mechanisms using in vitro and in vivo model systems revealed that CXCL12 enhances tumor cell intravasation by increasing vascular permeability and expansion of a leaky tumor vasculature. Furthermore, our studies revealed CXCL12 enhances permeability by recruiting endothelial precursor cells and decreasing endothelial tight junction and adherence junction proteins. High expression of stromal CXCL12 in large cohort of breast cancer patients was directly correlated to blood vessel density and inversely correlated to recurrence and overall patient survival. In addition, our analysis revealed that stromal CXCL12 levels in combination with number of CD31+ blood vessels confers poorer patient survival compared to individual protein level. However, no correlation was observed between epithelial CXCL12 and patient survival or blood vessel density. Our findings describe the novel interactions between fibroblasts-derived CXCL12 and endothelial cells in facilitating tumor cell intrvasation, leading to distant metastasis. Overall, our studies indicate that cross-talk between fibroblast-derived CXCL12 and endothelial cells could be used as novel biomarker and strategy for developing tumor microenvironment based therapies against aggressive and metastatic breast cancer.

  12. A PEDF-Derived Peptide Inhibits Retinal Neovascularization and Blocks Mobilization of Bone Marrow-Derived Endothelial Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Richard Longeras

    2012-01-01

    Full Text Available Proliferative diabetic retinopathy is characterized by pathological retinal neovascularization, mediated by both angiogenesis (involving mature endothelial cells and vasculogenesis (involving bone marrow-derived circulating endothelial progenitor cells (EPCs. Pigment epithelium-derived factor (PEDF contains an N-terminal 34-amino acid peptide (PEDF-34 that has antiangiogenic properties. Herein, we present a novel finding that PEDF-34 also possesses antivasculogenic activity. In the oxygen-induced retinopathy (OIR model using transgenic mice that have Tie2 promoter-driven GFP expression, we quantified Tie2GFP+ cells in bone marrow and peripheral blood by fluorescence-activated cell sorting (FACS. OIR significantly increased the number of circulating Tie2-GFP+ at P16, correlating with the peak progression of neovascularization. Daily intraperitoneal injections of PEDF-34 into OIR mice decreased the number of Tie2-GFP+ cells in the circulation at P16 by 65% but did not affect the number of Tie2-GFP+ cells in the bone marrow. These studies suggest that PEDF-34 attenuates EPC mobilization from the bone marrow into the blood circulation during retinal neovascularization.

  13. Tissue Factor-Expressing Tumor-Derived Extracellular Vesicles Activate Quiescent Endothelial Cells via Protease-Activated Receptor-1

    Directory of Open Access Journals (Sweden)

    Sara P. Y. Che

    2017-11-01

    Full Text Available Tissue factor (TF-expressing tumor-derived extracellular vesicles (EVs can promote metastasis and pre-metastatic niche formation, but the mechanisms by which this occurs remain largely unknown. We hypothesized that generation of activated factor X (FXa by TF expressed on tumor-derived EV could activate protease-activated receptors (PARs on non-activated endothelial cells to induce a pro-adhesive and pro-inflammatory phenotype. We obtained EV from TF-expressing breast (MDA-MB-231 and pancreatic (BxPC3 and Capan-1 tumor cell lines. We measured expression of E-selectin and secretion of interleukin-8 (IL-8 in human umbilical vein endothelial cells after exposure to EV and various immunologic and chemical inhibitors of TF, FXa, PAR-1, and PAR-2. After 6 h of exposure to tumor-derived EV (pretreated with factor VIIa and FX in vitro, endothelial cells upregulated E-selectin expression and secreted IL-8. These changes were decreased with an anti-TF antibody, FXa inhibitors (FPRCK and EGRCK, and PAR-1 antagonist (E5555, demonstrating that FXa generated by TF-expressing tumor-derived EV was signaling through endothelial PAR-1. Due to weak constitutive PAR-2 expression, these endothelial responses were not induced by a PAR-2 agonist peptide (SLIGKV and were not inhibited by a PAR-2 antagonist (FSLLRY after exposure to tumor-derived EV. In conclusion, we found that TF-expressing cancer-derived EVs activate quiescent endothelial cells, upregulating E-selectin and inducing IL-8 secretion through generation of FXa and cleavage of PAR-1. Conversion of resting endothelial cells to an activated phenotype by TF-expressing cancer-derived EV could promote cancer metastases.

  14. Sendai virosomal infusion of an adeno-associated virus-derived construct containing neuropeptide Y into primary rat brain cultures.

    Science.gov (United States)

    Wu, P; de Fiebre, C M; Millard, W J; Elmstrom, K; Gao, Y; Meyer, E M

    1995-05-05

    A novel neuronal gene-delivery system was investigated in primary neuron-enriched cultures with respect to driving the expression of neuropeptide Y (NPY). This delivery system consists of an adeno-associated virus-derived (AAV) plasmid, pJDT95npy, encapsulated in reconstituted Sendai virosomes. pJDT95npy contains full length rat NPY cDNA inserted downstream from the P40 promoter in a cap-gene deleted AAV-derived construct. The rep-sequences under control of the P5 and P19 promoters are intact. Virosomally encapsulated pJDT95npy drove the expression of NPY mRNAs, predominantly by P40. Total cellular NPY immunoreactivity and release in the presence of depolarization increased following pJDT95npy-transfection. Neither empty virosomes nor virosomes containing pJDT95 affected NPY mRNA expression or immunoreactivity. This study demonstrates that an AAV-derived plasmid can drive exogenous gene expression in intact neurons after infusion by Sendai virosomes.

  15. Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum.

    Science.gov (United States)

    Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan

    2016-03-10

    Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a

  16. Production of phytotoxic cationic α-helical antimicrobial peptides in plant cells using inducible promoters.

    Directory of Open Access Journals (Sweden)

    Nuri Company

    Full Text Available Synthetic linear antimicrobial peptides with cationic α-helical structures, such as BP100, have potent and specific activities against economically important plant pathogenic bacteria. They are also recognized as valuable therapeutics and preservatives. However, highly active BP100 derivatives are often phytotoxic when expressed at high levels as recombinant peptides in plants. Here we demonstrate that production of recombinant phytotoxic peptides in transgenic plants is possible by strictly limiting transgene expression to certain tissues and conditions, and specifically that minimization of this expression during transformation and regeneration of transgenic plants is essential to obtain viable plant biofactories. On the basis of whole-genome transcriptomic data available online, we identified the Os.hsp82 promoter that fulfilled this requirement and was highly induced in response to heat shock. Using this strategy, we generated transgenic rice lines producing moderate yields of severely phytotoxic BP100 derivatives on exposure to high temperature. In addition, a threshold for gene expression in selected tissues and stages was experimentally established, below which the corresponding promoters should be suitable for driving the expression of recombinant phytotoxic proteins in genetically modified plants. In view of the growing transcriptomics data available, this approach is of interest to assist promoter selection for specific purposes.

  17. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  18. Stem Cell-Derived Exosome in Cardiovascular Diseases: Macro Roles of Micro Particles.

    Science.gov (United States)

    Yuan, Ye; Du, Weijie; Liu, Jiaqi; Ma, Wenya; Zhang, Lai; Du, Zhimin; Cai, Benzhi

    2018-01-01

    The stem cell-based therapy has emerged as the promising therapeutic strategies for cardiovascular diseases (CVDs). Recently, increasing evidence suggest stem cell-derived active exosomes are important communicators among cells in the heart via delivering specific substances to the adjacent/distant target cells. These exosomes and their contents such as certain proteins, miRNAs and lncRNAs exhibit huge beneficial effects on preventing heart damage and promoting cardiac repair. More importantly, stem cell-derived exosomes are more effective and safer than stem cell transplantation. Therefore, administration of stem cell-derived exosomes will expectantly be an alternative stem cell-based therapy for the treatment of CVDs. Furthermore, modification of stem cell-derived exosomes or artificial synthesis of exosomes will be the new therapeutic tools for CVDs in the future. In addition, stem cell-derived exosomes also have been implicated in the diagnosis and prognosis of CVDs. In this review, we summarize the current advances of stem cell-derived exosome-based treatment and prognosis for CVDs, including their potential benefits, underlying mechanisms and limitations, which will provide novel insights of exosomes as a new tool in clinical therapeutic translation in the future.

  19. Wnt inhibition promotes vascular specification of embryonic cardiac progenitors.

    Science.gov (United States)

    Reichman, David E; Park, Laura; Man, Limor; Redmond, David; Chao, Kenny; Harvey, Richard P; Taketo, Makoto M; Rosenwaks, Zev; James, Daylon

    2018-01-08

    Several studies have demonstrated a multiphasic role for Wnt signaling during embryonic cardiogenesis and developed protocols that enrich for cardiac derivatives during in vitro differentiation of human pluripotent stem cells (hPSCs). However, few studies have investigated the role of Wnt signaling in the specification of cardiac progenitor cells (CPCs) toward downstream fates. Using transgenic mice and hPSCs, we tracked endothelial cells (ECs) that originated from CPCs expressing NKX2.5. Analysis of EC-fated CPCs at discrete phenotypic milestones during hPSC differentiation identified reduced Wnt activity as a hallmark of EC specification, and the enforced activation or inhibition of Wnt reduced or increased, respectively, the degree of vascular commitment within the CPC population during both hPSC differentiation and mouse embryogenesis. Wnt5a, which has been shown to exert an inhibitory influence on Wnt signaling during cardiac development, was dynamically expressed during vascular commitment of hPSC-derived CPCs, and ectopic Wnt5a promoted vascular specification of hPSC-derived and mouse embryonic CPCs. © 2018. Published by The Company of Biologists Ltd.

  20. Curcumin and Turmeric Modulate the Tumor-Promoting Effects of Iron In Vitro.

    Science.gov (United States)

    Messner, Donald J; Robinson, Todd; Kowdley, Kris V

    2017-04-01

    Free or loosely chelated iron has tumor-promoting properties in vitro. Curcumin, a polyphenol derived from the food spice turmeric (Curcuma longa), is a potent antioxidant that binds iron. The primary aim of this study was to investigate whether curcuminoids prevent tumor-promoting effects of iron in T51B cells, a non-neoplastic rat liver epithelial cell line. Purified curcuminoids (curcumin) or a standardized turmeric extract similarly reduced oxidative stress and cytotoxicity associated with iron overload (IC 50 values near 10 μM, P turmeric for 16 wk in culture; subsequently assayed by soft agar colony formation) was nearly complete at 20 μM of total curcuminoids (P turmeric extract were taken up better by cells, had a longer half-life, and appeared more effective in blocking tumor promotion (P < 0.01), suggesting enhanced curcuminoid delivery to cells in culture. The primary finding that curcuminoids can inhibit tumor promotion caused by iron in T51B cells is tempered by evidence for an underlying increase in neoplastic transformation at lower concentrations.

  1. Influence of red blood cell-derived microparticles upon vasoregulation.

    Science.gov (United States)

    Said, Ahmed S; Doctor, Allan

    2017-10-01

    Here we review recent data and the evolving understanding of the role of red blood cell-derived microparticles (RMPs) in normal physiology and in disease progression. Microparticles (MPs) are small membrane vesicles derived from various parent cell types. MPs are produced in response to a variety of stimuli through several cytoskeletal and membrane phospholipid changes. MPs have been investigated as potential biomarkers for multiple disease processes and are thought to have biological effects, most notably in: promotion of coagulation, production and handling of reactive oxygen species, immune modulation, angiogenesis, and in apoptosis. Specifically, RMPs are produced normally during RBC maturation and their production is accelerated during processing and storage for transfusion. Several factors during RBC storage are known to trigger RMP production, including: increased intracellular calcium, increased potassium leakage, and energy failure with ATP depletion. Of note, RMP composition differs from that of intact RBCs, and the nature and composition of RMP components are affected by both storage duration and the character of storage solutions. Recognised RMP bioactivities include: promotion of coagulation, immune modulation, and promotion of endothelial adhesion, as well as influence upon vasoregulation via nitric oxide (NO) scavenging. Of particular relevance, RMPs are more avid NO scavengers than intact RBCs and this feature has been proposed as a mechanism for the impaired oxygen delivery homeostasis that has been observed following transfusion. Preliminary human studies demonstrate that circulating RMP abundance increases with RBC transfusion and is associated with altered plasma vasoactivity and abnormal vasoregulation. In summary, RMPs are submicron particles released from stored RBCs, with demonstrated vasoactive properties that appear to disturb oxygen delivery homeostasis. The clinical impact of RMPs in transfusion recipients is an area of continued

  2. CXCL17 expression by tumor cells recruits CD11b+Gr1 high F4/80- cells and promotes tumor progression.

    Directory of Open Access Journals (Sweden)

    Aya Matsui

    Full Text Available BACKGROUND: Chemokines are involved in multiple aspects of pathogenesis and cellular trafficking in tumorigenesis. In this study, we report that the latest member of the C-X-C-type chemokines, CXCL17 (DMC/VCC-1, recruits immature myeloid-derived cells and enhances early tumor progression. METHODOLOGY/PRINCIPAL FINDINGS: CXCL17 was preferentially expressed in some aggressive types of gastrointestinal, breast, and lung cancer cells. CXCL17 expression did not impart NIH3T3 cells with oncogenic potential in vitro, but CXCL17-expressing NIH3T3 cells could form vasculature-rich tumors in immunodeficient mice. Our data showed that CXCL17-expressing tumor cells increased immature CD11b(+Gr1(+ myeloid-derived cells at tumor sites in mice and promoted CD31(+ tumor angiogenesis. Extensive chemotactic assays proved that CXCL17-responding cells were CD11b(+Gr1(highF4/80(- cells (≈ 90% with a neutrophil-like morphology in vitro. Although CXCL17 expression could not increase the number of CD11b(+Gr1(+ cells in tumor-burdened SCID mice or promote metastases of low metastatic colon cancer cells, the existence of CXCL17-responding myeloid-derived cells caused a striking enhancement of xenograft tumor formation. CONCLUSIONS/SIGNIFICANCE: These results suggest that aberrant expression of CXCL17 in tumor cells recruits immature myeloid-derived cells and promotes tumor progression through angiogenesis.

  3. Axon Guidance of Sympathetic Neurons to Cardiomyocytes by Glial Cell Line-Derived Neurotrophic Factor (GDNF)

    NARCIS (Netherlands)

    Miwa, Keiko; Lee, Jong-Kook; Takagishi, Yoshiko; Opthof, Tobias; Fu, Xianming; Hirabayashi, Masumi; Watabe, Kazuhiko; Jimbo, Yasuhiko; Kodama, Itsuo; Komuro, Issei

    2013-01-01

    Molecular signaling of cardiac autonomic innervation is an unresolved issue. Here, we show that glial cell line-derived neurotrophic factor (GDNF) promotes cardiac sympathetic innervation in vitro and in vivo. In vitro, ventricular myocytes (VMs) and sympathetic neurons (SNs) isolated from neonatal

  4. Best Practices to Promote Diversity and Facilitate Inclusion

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, Mark A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Snyder, Johann D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    The intent of this guide is to provide a set of “best practices” for leaders to promote diversity and facilitate inclusion within their organization and throughout Sandia National Laboratories. These “best practices” are derived from personal experiences and build upon existing resources at Sandia to help us effect change to realize an inclusive work environment. As leaders, we play a critical role in setting the vision and shaping the culture of the organization by communicating expectations and modeling inclusive behavior. The “best practices” in this guide are presented in the spirit of promoting a learning culture that values continuous improvement in the ongoing effort to make diversity and inclusion an integral part of all that we do at Sandia. This guide seeks to articulate the importance of leading through example, taking positive actions, raising awareness of practices that provide an inclusive environment, and creating a space that welcomes diverse perspectives and input.

  5. State-of-the-art for food taxes to promote public health.

    Science.gov (United States)

    Jensen, J D; Smed, S

    2018-05-01

    The use of taxes to promote healthy nutritional behaviour has gained ground in the past decade. The present paper reviews existing applications of fiscal instruments in nutrition policy and derives some perspectives and recommendations from the experiences gained with these instruments. Many countries in different parts of the world have experiences with the taxation of sugar-sweetened beverages, in some cases in combination with taxes on unhealthy food commodities such as confectionery or high-fat foods. These tax schemes have many similarities, but also differ in their definitions of tax objects and in the applied tax rates. Denmark has been the only country in the world to operate a tax on saturated fat content in foods, from 2011 to 2012. Most of the existing food tax schemes have been introduced from fiscal motivations, with health promotion as a secondary objective, but a few have been introduced with health promotion as the primary objective. The diversity in experiences from existing tax schemes can provide valuable insights for future use of fiscal instruments to promote healthy nutrition, in terms of designing effective and efficient tax or subsidy instruments, and in terms of smooth and politically viable implementation of the instruments.

  6. Analysing learning outcomes in an Electrical Engineering curriculum using illustrative verbs derived from Bloom's Taxonomy

    Science.gov (United States)

    Meda, Lawrence; Swart, Arthur James

    2018-05-01

    Learning outcomes are essential to any curriculum in education, where they need to be clear, observable and measurable. However, some academics structure learning outcomes in a way that does not promote student learning. The purpose of this article is to present the analyses of learning outcomes of an Electrical Engineering curriculum offered at a University of Technology in South Africa, in order to determine if academics are structuring them in a way that enables student learning. A qualitative case study is used where the learning outcomes from 33 study guides are reviewed using illustrative verbs derived from Bloom's Taxonomy. Results indicate that 9% of all the learning outcomes are unclear, 10% are unobservable and 23% are unmeasurable. A key recommendation is to provide regular workshops to assist academics in reviewing their learning outcomes using the illustrative verbs derived from Bloom's Taxonomy, thereby ensuring that their learning outcomes promote student learning.

  7. Impact of phenolic substrate and growth temperature on the arthrobacter chlorophenolicus proteome

    Energy Technology Data Exchange (ETDEWEB)

    Unell, Maria; Abraham, Paul E.; Shah, Manesh; Zhang, Bing; Ruckert, Christian; VerBerkmoes, Nathan C.; Jansson, Janet K.

    2009-02-15

    We compared the Arthrobacter chlorophenolicus proteome during growth on 4-chlorophenol, 4-nitrophenol or phenol at 5 C and 28 C; both for the wild type and a mutant strain with mass spectrometry based proteomics. A label free workflow employing spectral counting identified 3749 proteins across all growth conditions, representing over 70% of the predicted genome and 739 of these proteins form the core proteome. Statistically significant differences were found in the proteomes of cells grown under different conditions including differentiation of hundreds of unknown proteins. The 4-chlorophenol-degradation pathway was confirmed, but not that for phenol.

  8. Probiotics promote endocytic allergen degradation in gut epithelial cells

    International Nuclear Information System (INIS)

    Song, Chun-Hua; Liu, Zhi-Qiang; Huang, Shelly; Zheng, Peng-Yuan; Yang, Ping-Chang

    2012-01-01

    Highlights: ► Knockdown of A20 compromised the epithelial barrier function. ► The fusion of endosome/lysosome was disturbed in the A20-deficient HT-29 cells. ► Antigens transported across A20-deficient HT-29 monolayers conserved antigenicity. ► Probiotic proteins increased the expression of A20 in HT-29 cells. -- Abstract: Background and aims: Epithelial barrier dysfunction plays a critical role in the pathogenesis of allergic diseases; the mechanism is to be further understood. The ubiquitin E3 ligase A20 (A20) plays a role in the endocytic protein degradation in the cells. This study aims to elucidate the role of A20 in the maintenance of gut epithelial barrier function. Methods: Gut epithelial cell line, HT-29 cell, was cultured into monolayers to evaluate the barrier function in transwells. RNA interference was employed to knock down the A20 gene in HT-29 cells to test the role of A20 in the maintenance of epithelial barrier function. Probiotic derived proteins were extracted from the culture supernatants using to enhance the expression of A20 in HT-29 cells. Results: The results showed that the knockdown of A20 compromised the epithelial barrier function in HT-29 monolayers, mainly increased the intracellular permeability. The fusion of endosome/lysosome was disturbed in the A20-deficient HT-29 cells. Allergens collected from the transwell basal chambers of A20-deficient HT-29 monolayers still conserved functional antigenicity. Treating with probiotic derived proteins increased the expression of A20 in HT-29 cells and promote the barrier function. Conclusion: A20 plays an important role in the maintenance of epithelial barrier function as shown by HT-29 monolayer. Probiotic derived protein increases the expression of A20 and promote the HT-29 monolayer barrier function.

  9. Probiotics promote endocytic allergen degradation in gut epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Song, Chun-Hua [Department of Epidemiology and Biostatistics, College of Public Health, Zhengzhou University, Zhengzhou (China); Liu, Zhi-Qiang [Department of Gastroenterology, The Second Hospital, Zhengzhou University, Zhengzhou (China); Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON (Canada); Huang, Shelly [Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON (Canada); Zheng, Peng-Yuan, E-mail: medp7123@126.com [Department of Gastroenterology, The Second Hospital, Zhengzhou University, Zhengzhou (China); Yang, Ping-Chang, E-mail: yangp@mcmaster.ca [Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON (Canada)

    2012-09-14

    Highlights: Black-Right-Pointing-Pointer Knockdown of A20 compromised the epithelial barrier function. Black-Right-Pointing-Pointer The fusion of endosome/lysosome was disturbed in the A20-deficient HT-29 cells. Black-Right-Pointing-Pointer Antigens transported across A20-deficient HT-29 monolayers conserved antigenicity. Black-Right-Pointing-Pointer Probiotic proteins increased the expression of A20 in HT-29 cells. -- Abstract: Background and aims: Epithelial barrier dysfunction plays a critical role in the pathogenesis of allergic diseases; the mechanism is to be further understood. The ubiquitin E3 ligase A20 (A20) plays a role in the endocytic protein degradation in the cells. This study aims to elucidate the role of A20 in the maintenance of gut epithelial barrier function. Methods: Gut epithelial cell line, HT-29 cell, was cultured into monolayers to evaluate the barrier function in transwells. RNA interference was employed to knock down the A20 gene in HT-29 cells to test the role of A20 in the maintenance of epithelial barrier function. Probiotic derived proteins were extracted from the culture supernatants using to enhance the expression of A20 in HT-29 cells. Results: The results showed that the knockdown of A20 compromised the epithelial barrier function in HT-29 monolayers, mainly increased the intracellular permeability. The fusion of endosome/lysosome was disturbed in the A20-deficient HT-29 cells. Allergens collected from the transwell basal chambers of A20-deficient HT-29 monolayers still conserved functional antigenicity. Treating with probiotic derived proteins increased the expression of A20 in HT-29 cells and promote the barrier function. Conclusion: A20 plays an important role in the maintenance of epithelial barrier function as shown by HT-29 monolayer. Probiotic derived protein increases the expression of A20 and promote the HT-29 monolayer barrier function.

  10. A Short Review on the Catalytic Activity of Hydrotalcite-Derived Materials for Dry Reforming of Methane

    Directory of Open Access Journals (Sweden)

    Radosław Dębek

    2017-01-01

    Full Text Available Nickel-containing hydrotalcite-derived materials have been recently proposed as promising materials for methane dry reforming (DRM. Based on a literature review and on the experience of the authors, this review focuses on presenting past and recent achievements on increasing activity and stability of hydrotalcite-based materials for DRM. The use of different NiMgAl and NiAl hydrotalcite (HT precursors, various methods for nickel introduction into HT structure, calcination conditions and promoters are discussed. HT-derived materials containing nickel generally exhibit high activity in DRM; however, the problem of preventing catalyst deactivation by coking, especially below 700 °C, is still an open question. The proposed solutions in the literature include: catalyst regeneration either in oxygen atmosphere or via hydrogasification; or application of various promoters, such as Zr, Ce or La, which was proven to enhance catalytic stability.

  11. Physical constraints determine the logic of bacterial promoter architectures

    Science.gov (United States)

    Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

    2014-01-01

    Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

  12. Lack of promoter IV-driven BDNF transcription results in depression-like behavior.

    Science.gov (United States)

    Sakata, K; Jin, L; Jha, S

    2010-10-01

    Transcription of Bdnf is controlled by multiple promoters, in which promoter IV contributes significantly to activity-dependent Bdnf transcription. We have generated promoter IV mutant mice [brain-derived neurotrophic factor (BDNF)-KIV] in which promoter IV-driven expression of BDNF is selectively disrupted by inserting a green fluorescent protein (GFP)-STOP cassette within the Bdnf exon IV locus. BDNF-KIV animals exhibited depression-like behavior as shown by the tail suspension test (TST), sucrose preference test (SPT) and learned helplessness test (LHT). In addition, BDNF-KIV mice showed reduced activity in the open field test (OFT) and reduced food intake in the novelty-suppressed feeding test (NSFT). The mutant mice did not display anxiety-like behavior in the light and dark box test and elevated plus maze tests. Interestingly, the mutant mice showed defective response inhibition in the passive avoidance test (PAT) even though their learning ability was intact when measured with the active avoidance test (AAT). These results suggest that promoter IV-dependent BDNF expression plays a critical role in the control of mood-related behaviors. This is the first study that directly addressed the effects of endogenous promoter-driven expression of BDNF in depression-like behavior. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

  13. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  14. Visible-light photoactivity of plasmonic silver supported on mesoporous TiO{sub 2} nanoparticles (Ag-MTN) for enhanced degradation of 2-chlorophenol: Limitation of Ag-Ti interaction

    Energy Technology Data Exchange (ETDEWEB)

    Jaafar, N.F. [Department of Chemistry, Faculty of Science, Universiti Teknologi Malaysia, UTM, 81310 Johor Bahru, Johor (Malaysia); Jalil, A.A., E-mail: aishahaj@utm.my [Centre of Hydrogen Energy, Institute of Future Energy, Universiti Teknologi Malaysia, UTM, 81310 Johor Bahru, Johor (Malaysia); Department of Chemical Engineering, Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, UTM, 81310 Johor Bahru, Johor (Malaysia); Triwahyono, S. [Department of Chemistry, Faculty of Science, Universiti Teknologi Malaysia, UTM, 81310 Johor Bahru, Johor (Malaysia); Centre for Sustainable Nanomaterials, Ibnu Sina Institute for Scientific and Industrial Research, Universiti Teknologi Malaysia, UTM, 81310 Johor Bahru, Johor (Malaysia)

    2017-01-15

    Highlights: • Ag{sup 0} loaded on MTN was prepared by a direct in-situ electrochemical method. • The introduction of Ag{sup 0} lowers the band gap and increases the number of OV and TSD. • Ag{sup 0} acted as an electrons trapper and also a plasmonic sensitizer. • The formation of Ti-O-Ag in 10 wt% Ag-MTN decreased the amount of Ag{sup 0}, TSD and OV. • 5 wt% Ag-MTN gave the highest percentage of photodegradation of 2-CP. - Abstract: Various weight loadings of Ag (1–10 wt.%) were introduced to mesoporous titania nanoparticles (MTN) via a direct in-situ electrochemical method. The catalysts were characterized by XRD, surface area analysis, FTIR, ESR, FESEM-EDX and TEM. Characterization results indicated that the introduction of Ag onto MTN decreased the particles size and band gap of the MTN while increasing the number of oxygen vacancies (OV) and Ti{sup 3+} site defects (TSD). The activity performance of Ag-MTN on photodegradation of 2-chlorophenol (2-CP) under visible light irradiation was in the following order: 5 wt% Ag-MTN> 1 wt% Ag-MTN > MTN > 10 wt% Ag-MTN, with degradation percentages of 97, 88, 80 and 63%, respectively. The synergistic effect between Ag{sup 0} and MTN seemed to play an important role in the system. The Ag0 acted as both an electron trap and a plasmonic sensitizer which suppressed the electron-hole recombination, while OV and TSD in the MTN accelerated the production of hydroxyl radicals for enhanced degradation of 2-CP. However, the formation of Ti-O-Ag in 10 wt% Ag-MTN was found to decrease the photoactivity due to the decrease in the formation of Ag{sup 0}, TSD and OV as well as the increase in band gap energy. The photodegradation of 5 wt% Ag-MTN followed a pseudo-first-order Langmuir- Hinshelwood model and the catalyst was still stable after five cycles.

  15. Transplantation of specific human astrocytes promotes functional recovery after spinal cord injury.

    Directory of Open Access Journals (Sweden)

    Stephen J A Davies

    2011-03-01

    Full Text Available Repairing trauma to the central nervous system by replacement of glial support cells is an increasingly attractive therapeutic strategy. We have focused on the less-studied replacement of astrocytes, the major support cell in the central nervous system, by generating astrocytes from embryonic human glial precursor cells using two different astrocyte differentiation inducing factors. The resulting astrocytes differed in expression of multiple proteins thought to either promote or inhibit central nervous system homeostasis and regeneration. When transplanted into acute transection injuries of the adult rat spinal cord, astrocytes generated by exposing human glial precursor cells to bone morphogenetic protein promoted significant recovery of volitional foot placement, axonal growth and notably robust increases in neuronal survival in multiple spinal cord laminae. In marked contrast, human glial precursor cells and astrocytes generated from these cells by exposure to ciliary neurotrophic factor both failed to promote significant behavioral recovery or similarly robust neuronal survival and support of axon growth at sites of injury. Our studies thus demonstrate functional differences between human astrocyte populations and suggest that pre-differentiation of precursor cells into a specific astrocyte subtype is required to optimize astrocyte replacement therapies. To our knowledge, this study is the first to show functional differences in ability to promote repair of the injured adult central nervous system between two distinct subtypes of human astrocytes derived from a common fetal glial precursor population. These findings are consistent with our previous studies of transplanting specific subtypes of rodent glial precursor derived astrocytes into sites of spinal cord injury, and indicate a remarkable conservation from rat to human of functional differences between astrocyte subtypes. In addition, our studies provide a specific population of human

  16. Non-thermal plasma-induced photocatalytic degradation of 4-chlorophenol in water.

    Science.gov (United States)

    Hao, Xiao Long; Zhou, Ming Hua; Lei, Le Cheng

    2007-03-22

    TiO(2) photocatalyst (P-25) (50mgL(-1)) was tentatively introduced into pulsed high-voltage discharge process for non-thermal plasma-induced photocatalytic degradation of the representative mode organic pollutant parachlorophenol (4-CP), including other compounds phenol and methyl red in water. The experimental results showed that rate constant of 4-CP degradation, energy efficiency for 4-CP removal and TOC removal with TiO(2) were obviously increased. Pulsed high-voltage discharge process with TiO(2) had a promoted effect for the degradation of these pollutants under a broad range of liquid conductivity. Furthermore, the apparent formation rates of chemically active species (e.g., ozone and hydrogen peroxide) were increased, the hydrogen peroxide formation rate from 1.10x10(-6) to 1.50x10(-6)Ms(-1), the ozone formation rate from 1.99x10(-8) to 2.35x10(-8)Ms(-1), respectively. In addition, this process had no influence on the photocatalytic properties of TiO(2). The introduction of TiO(2) photocatalyst into pulsed discharge plasma process in the utilizing of ultraviolet radiation and electric field in pulsed discharge plasma process enhanced the yields of chemically active species, which were available for highly efficient removal and mineralization of organic pollutants.

  17. Non-thermal plasma-induced photocatalytic degradation of 4-chlorophenol in water

    International Nuclear Information System (INIS)

    Hao Xiaolong; Zhou Ming Hua; Lei Lecheng

    2007-01-01

    TiO 2 photocatalyst (P-25) (50 mg L -1 ) was tentatively introduced into pulsed high-voltage discharge process for non-thermal plasma-induced photocatalytic degradation of the representative mode organic pollutant parachlorophenol (4-CP), including other compounds phenol and methyl red in water. The experimental results showed that rate constant of 4-CP degradation, energy efficiency for 4-CP removal and TOC removal with TiO 2 were obviously increased. Pulsed high-voltage discharge process with TiO 2 had a promoted effect for the degradation of these pollutants under a broad range of liquid conductivity. Furthermore, the apparent formation rates of chemically active species (e.g., ozone and hydrogen peroxide) were increased, the hydrogen peroxide formation rate from 1.10 x 10 -6 to 1.50 x 10 -6 M s -1 , the ozone formation rate from 1.99 x 10 -8 to 2.35 x 10 -8 M s -1 , respectively. In addition, this process had no influence on the photocatalytic properties of TiO 2 . The introduction of TiO 2 photocatalyst into pulsed discharge plasma process in the utilizing of ultraviolet radiation and electric field in pulsed discharge plasma process enhanced the yields of chemically active species, which were available for highly efficient removal and mineralization of organic pollutants

  18. Delayed rectifier potassium channels are involved in SO2 derivative-induced hippocampal neuronal injury.

    Science.gov (United States)

    Li, Guangke; Sang, Nan

    2009-01-01

    Recent studies implicate the possible neurotoxicity of SO(2), however, its mechanisms remain unclear. In the present study, we investigated SO(2) derivative-induced effect on delayed rectifier potassium channels (I(K)) and cellular death/apoptosis in primary cultured hippocampal neurons. The results demonstrate that SO(2) derivatives (NaHSO(3) and Na(2)SO(3), 3:1M/M) effectively augmented I(K) and promoted the activation of delayed rectifier potassium channels. Also, SO(2) derivatives increased neuronal death percentage and contributed to the formation of DNA ladder in concentration-dependent manners. Interestingly, the neuronal death and DNA ladder formation, caused by SO(2) derivatives, could be attenuated by the delayed rectifier potassium channel blocker (tetraethylammonium, TEA), but not by the transient outward potassium channel blocker (4-aminopyridine, 4-AP). It implies that stimulating delayed rectifier potassium channels were involved in SO(2) derivative-caused hippocampal neuronal insults, and blocking these channels might be one of the possibly clinical treatment for SO(2)-caused neuronal dysfunction.

  19. A significant association between BDNF promoter methylation and the risk of drug addiction.

    Science.gov (United States)

    Xu, Xuting; Ji, Huihui; Liu, Guili; Wang, Qinwen; Liu, Huifen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Zhou, Wenhua; Duan, Shiwei

    2016-06-10

    As a member of the neurotrophic factor family, brain derived neurotrophic factor (BDNF) plays an important role in the survival and differentiation of neurons. The aim of our work was to evaluate the role of BDNF promoter methylation in drug addiction. A total of 60 drug abusers (30 heroin and 30 methylamphetamine addicts) and 52 healthy age- and gender-matched controls were recruited for the current case control study. Bisulfite pyrosequencing technology was used to determine the methylation levels of five CpGs (CpG1-5) on the BDNF promoter. Among the five CpGs, CpG5 methylation was significantly lower in drug abusers than controls. Moreover, significant associations were found between CpG5 methylation and addictive phenotypes including tension-anxiety, anger-hostility, fatigue-inertia, and depression-dejection. In addition, luciferase assay showed that the DNA fragment of BDNF promoter played a key role in the regulation of gene expression. Our results suggest that BDNF promoter methylation is associated with drug addiction, although further studies are needed to understand the mechanisms by which BDNF promoter methylation contributes to the pathophysiology of drug addiction. Copyright © 2016. Published by Elsevier B.V.

  20. Molecular cloning and functional characterization of the human platelet-derived growth factor alpha receptor gene promoter

    NARCIS (Netherlands)

    Afink, G. B.; Nistér, M.; Stassen, B. H.; Joosten, P. H.; Rademakers, P. J.; Bongcam-Rudloff, E.; van Zoelen, E. J.; Mosselman, S.

    1995-01-01

    Expression of the platelet-derived growth factor alpha receptor (PDGF alpha R) is strictly regulated during mammalian development and tumorigenesis. The molecular mechanisms involved in the specific regulation of PDGF alpha R expression are unknown, but transcriptional regulation of the PDGF alpha R

  1. Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands

    Directory of Open Access Journals (Sweden)

    Alessandro Altieri

    2013-10-01

    Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.

  2. Human umbilical cord mesenchymal stem cells promote peripheral nerve repair via paracrine mechanisms

    Directory of Open Access Journals (Sweden)

    Zhi-yuan Guo

    2015-01-01

    Full Text Available Human umbilical cord-derived mesenchymal stem cells (hUCMSCs represent a promising young-state stem cell source for cell-based therapy. hUCMSC transplantation into the transected sciatic nerve promotes axonal regeneration and functional recovery. To further clarify the paracrine effects of hUCMSCs on nerve regeneration, we performed human cytokine antibody array analysis, which revealed that hUCMSCs express 14 important neurotrophic factors. Enzyme-linked immunosorbent assay and immunohistochemistry showed that brain-derived neurotrophic factor, glial-derived neurotrophic factor, hepatocyte growth factor, neurotrophin-3, basic fibroblast growth factor, type I collagen, fibronectin and laminin were highly expressed. Treatment with hUCMSC-conditioned medium enhanced Schwann cell viability and proliferation, increased nerve growth factor and brain-derived neurotrophic factor expression in Schwann cells, and enhanced neurite growth from dorsal root ganglion explants. These findings suggest that paracrine action may be a key mechanism underlying the effects of hUCMSCs in peripheral nerve repair.

  3. Matrix- and plasma-derived peptides promote tissue-specific injury responses and wound healing in diabetic swine.

    Science.gov (United States)

    Sheets, Anthony R; Massey, Conner J; Cronk, Stephen M; Iafrati, Mark D; Herman, Ira M

    2016-07-02

    Non-healing wounds are a major global health concern and account for the majority of non-traumatic limb amputations worldwide. However, compared to standard care practices, few advanced therapeutics effectively resolve these injuries stemming from cardiovascular disease, aging, and diabetes-related vasculopathies. While matrix turnover is disrupted in these injuries, debriding enzymes may promote healing by releasing matrix fragments that induce cell migration, proliferation, and morphogenesis, and plasma products may also stimulate these processes. Thus, we created matrix- and plasma-derived peptides, Comb1 and UN3, which induce cellular injury responses in vitro, and accelerate healing in rodent models of non-healing wounds. However, the effects of these peptides in non-healing wounds in diabetes are not known. Here, we interrogated whether these peptides stimulate healing in a diabetic porcine model highly reminiscent of human healing impairments in type 1 and type 2-diabetes. After 3-6 weeks of streptozotocin-induced diabetes, full-thickness wounds were surgically created on the backs of adult female Yorkshire swine under general anesthesia. Comb1 and UN3 peptides or sterile saline (negative control) were administered to wounds daily for 3-7 days. Following sacrifice, wound tissues were harvested, and quantitative histological and immunohistochemical analyses were performed for wound closure, angiogenesis and granulation tissue deposition, along with quantitative molecular analyses of factors critical for angiogenesis, epithelialization, and dermal matrix remodeling. Comb1 and UN3 significantly increase re-epithelialization and angiogenesis in diabetic porcine wounds, compared to saline-treated controls. Additionally, fluorescein-conjugated Comb1 labels keratinocytes, fibroblasts, and vascular endothelial cells in porcine wounds, and Far western blotting reveals these cell populations express multiple fluorescein-Comb1-interacting proteins in vitro. Further

  4. Desert hedgehog promotes ischemia-induced angiogenesis by ensuring peripheral nerve survival.

    Science.gov (United States)

    Renault, Marie-Ange; Chapouly, Candice; Yao, Qinyu; Larrieu-Lahargue, Frédéric; Vandierdonck, Soizic; Reynaud, Annabel; Petit, Myriam; Jaspard-Vinassa, Béatrice; Belloc, Isabelle; Traiffort, Elisabeth; Ruat, Martial; Duplàa, Cécile; Couffinhal, Thierry; Desgranges, Claude; Gadeau, Alain-Pierre

    2013-03-01

    Blood vessel growth and patterning have been shown to be regulated by nerve-derived signals. Desert hedgehog (Dhh), one of the Hedgehog family members, is expressed by Schwann cells of peripheral nerves. The purpose of this study was to investigate the contribution of Dhh to angiogenesis in the setting of ischemia. We induced hindlimb ischemia in wild-type and Dhh(-/-) mice. First, we found that limb perfusion is significantly impaired in the absence of Dhh. This effect is associated with a significant decrease in capillary and artery density in Dhh(-/-). By using mice in which the Hedgehog signaling pathway effector Smoothened was specifically invalidated in endothelial cells, we demonstrated that Dhh does not promote angiogenesis by a direct activation of endothelial cells. On the contrary, we found that Dhh promotes peripheral nerve survival in the ischemic muscle and, by doing so, maintains the pool of nerve-derived proangiogenic factors. Consistently, we found that denervation of the leg, immediately after the onset of ischemia, severely impairs ischemia-induced angiogenesis and decreases expression of vascular endothelial growth factor A, angiopoietin 1, and neurotrophin 3 in the ischemic muscle. This study demonstrates the crucial roles of nerves and factors regulating nerve physiology in the setting of ischemia-induced angiogenesis.

  5. Extracellular vesicles derived from mesenchymal stromal cells: a therapeutic option in respiratory diseases?

    Science.gov (United States)

    Abreu, Soraia C; Weiss, Daniel J; Rocco, Patricia R M

    2016-04-14

    Extracellular vesicles (EVs) are plasma membrane-bound fragments released from several cell types, including mesenchymal stromal cells (MSCs), constitutively or under stimulation. EVs derived from MSCs and other cell types transfer molecules (such as DNA, proteins/peptides, mRNA, microRNA, and lipids) and/or organelles with reparative and anti-inflammatory properties to recipient cells. The paracrine anti-inflammatory effects promoted by MSC-derived EVs have attracted significant interest in the regenerative medicine field, including for potential use in lung injuries. In the present review, we describe the characteristics, biological activities, and mechanisms of action of MSC-derived EVs. We also review the therapeutic potential of EVs as reported in relevant preclinical models of acute and chronic respiratory diseases, such as pneumonia, acute respiratory distress syndrome, asthma, and pulmonary arterial hypertension. Finally, we discuss possible approaches for potentiating the therapeutic effects of MSC-derived EVs so as to enable use of this therapy in clinical practice.

  6. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration.

    Science.gov (United States)

    Yu, Ting; Xu, Bei; He, Lili; Xia, Shan; Chen, Yan; Zeng, Jun; Liu, Yongmei; Li, Shuangzhi; Tan, Xiaoyue; Ren, Ke; Yao, Shaohua; Song, Xiangrong

    2016-01-01

    Anti-angiogenesis has been proposed as an effective therapeutic strategy for cancer treatment. Pigment epithelium-derived factor (PEDF) is one of the most powerful endogenous anti-angiogenic reagents discovered to date and PEDF gene therapy has been recognized as a promising treatment option for various tumors. There is an urgent need to develop a safe and valid vector for its systemic delivery. Herein, a novel gene delivery system based on the newly synthesized copolymer COOH-PEG-PLGA-COOH (CPPC) was developed in this study, which was probably capable of overcoming the disadvantages of viral vectors and cationic lipids/polymers-based nonviral carriers. PEDF gene loaded CPPC nanoparticles (D-NPs) were fabricated by a modified double-emulsion water-in-oil-in-water (W/O/W) solvent evaporation method. D-NPs with uniform spherical shape had relatively high drug loading (~1.6%), probably because the introduced carboxyl group in poly (D,L-lactide-co-glycolide) terminal enhanced the interaction of copolymer with the PEDF gene complexes. An excellent in vitro antitumor effect was found in both C26 and A549 cells treated by D-NPs, in which PEDF levels were dramatically elevated due to the successful transfection of PEDF gene. D-NPs also showed a strong inhibitory effect on proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely

  7. VEGF promotes tumorigenesis and angiogenesis of human glioblastoma stem cells

    International Nuclear Information System (INIS)

    Oka, Naoki; Soeda, Akio; Inagaki, Akihito; Onodera, Masafumi; Maruyama, Hidekazu; Hara, Akira; Kunisada, Takahiro; Mori, Hideki; Iwama, Toru

    2007-01-01

    There is increasing evidence for the presence of cancer stem cells (CSCs) in malignant brain tumors, and these CSCs may play a pivotal role in tumor initiation, growth, and recurrence. Vascular endothelial growth factor (VEGF) promotes the proliferation of vascular endothelial cells (VECs) and the neurogenesis of neural stem cells. Using CSCs derived from human glioblastomas and a retrovirus expressing VEGF, we examined the effects of VEGF on the properties of CSCs in vitro and in vivo. Although VEGF did not affect the property of CSCs in vitro, the injection of mouse brains with VEGF-expressing CSCs led to the massive expansion of vascular-rich GBM, tumor-associated hemorrhage, and high morbidity, suggesting that VEGF promoted tumorigenesis via angiogenesis. These results revealed that VEGF induced the proliferation of VEC in the vascular-rich tumor environment, the so-called stem cell niche

  8. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  9. Microwave-assisted synthesis and antioxidant properties of hydrazinyl thiazolyl coumarin derivatives

    Directory of Open Access Journals (Sweden)

    Osman Hasnah

    2012-04-01

    Full Text Available Abstract Background Coumarin derivatives exhibit a wide range of biological properties including promising antioxidant activity. Furthermore, microwave-assisted organic synthesis has delivered rapid routes to N- and O-containing heterocycles, including coumarins and thiazoles. Combining these features, the use of microwave-assisted processes will provide rapid access to a targeted coumarin library bearing a hydrazino pharmacophore for evaluation of antioxidant properties Results Microwave irradiation promoted 3 of the 4 steps in a rapid, convergent synthesis of a small library of hydrazinyl thiazolyl coumarin derivatives, all of which exhibited significant antioxidant activity comparable to that of the natural antioxidant quercetin, as established by DPPH and ABTS radical assays Conclusions Microwave dielectric heating provides a rapid and expedient route to a series of hydrazinyl thiazolyl coumarins to investigate their radical scavenging properties. Given their favourable properties, in comparison with known antioxidants, these coumarin derivatives are promising leads for further development and optimization.

  10. In vitro proliferation of haemopoietic cells in the presence of adherent cell layers. II. Differential effect of adherent cell layers derived from various organs

    NARCIS (Netherlands)

    Reimann, J.; Burger, H.

    1979-01-01

    Mouse bone marrow-derived adherent cell populations promoted proliferation of haemopoietic cells in vitro in a liquid culture system for at least 4 weeks. Adherent cell layers derived from other haemopoietic organs (foetal liver, adult spleen) and fibroblasts from embryonic tissues did not maintain

  11. Non-thermal plasma-induced photocatalytic degradation of 4-chlorophenol in water

    Energy Technology Data Exchange (ETDEWEB)

    Hao Xiaolong [Institute of Environmental Pollution Control Technologies, Xixi Campus, Zhejiang University, Hangzhou 310028, Zhejiang (China); Zhou Ming Hua [Institute of Environmental Pollution Control Technologies, Xixi Campus, Zhejiang University, Hangzhou 310028, Zhejiang (China); Lei Lecheng [Institute of Environmental Pollution Control Technologies, Xixi Campus, Zhejiang University, Hangzhou 310028, Zhejiang (China)]. E-mail: lclei@zju.edu.cn

    2007-03-22

    TiO{sub 2} photocatalyst (P-25) (50 mg L{sup -1}) was tentatively introduced into pulsed high-voltage discharge process for non-thermal plasma-induced photocatalytic degradation of the representative mode organic pollutant parachlorophenol (4-CP), including other compounds phenol and methyl red in water. The experimental results showed that rate constant of 4-CP degradation, energy efficiency for 4-CP removal and TOC removal with TiO{sub 2} were obviously increased. Pulsed high-voltage discharge process with TiO{sub 2} had a promoted effect for the degradation of these pollutants under a broad range of liquid conductivity. Furthermore, the apparent formation rates of chemically active species (e.g., ozone and hydrogen peroxide) were increased, the hydrogen peroxide formation rate from 1.10 x 10{sup -6} to 1.50 x 10{sup -6} M s{sup -1}, the ozone formation rate from 1.99 x 10{sup -8} to 2.35 x 10{sup -8} M s{sup -1}, respectively. In addition, this process had no influence on the photocatalytic properties of TiO{sub 2}. The introduction of TiO{sub 2} photocatalyst into pulsed discharge plasma process in the utilizing of ultraviolet radiation and electric field in pulsed discharge plasma process enhanced the yields of chemically active species, which were available for highly efficient removal and mineralization of organic pollutants.

  12. Tubule-Derived Wnts Are Required for Fibroblast Activation and Kidney Fibrosis.

    Science.gov (United States)

    Zhou, Dong; Fu, Haiyan; Zhang, Lu; Zhang, Ke; Min, Yali; Xiao, Liangxiang; Lin, Lin; Bastacky, Sheldon I; Liu, Youhua

    2017-08-01

    Cell-cell communication via Wnt ligands is necessary in regulating embryonic development and has been implicated in CKD. Because Wnt ligands are ubiquitously expressed, the exact cellular source of the Wnts involved in CKD remains undefined. To address this issue, we generated two conditional knockout mouse lines in which Wntless (Wls), a dedicated cargo receptor that is obligatory for Wnt secretion, was selectively ablated in tubular epithelial cells or interstitial fibroblasts. Blockade of Wnt secretion by genetic deletion of Wls in renal tubules markedly inhibited myofibroblast activation and reduced renal fibrosis after unilateral ureteral obstruction. This effect associated with decreased activation of β -catenin and downstream gene expression and preserved tubular epithelial integrity. In contrast, fibroblast-specific deletion of Wls exhibited little effect on the severity of renal fibrosis after obstructive or ischemia-reperfusion injury. In vitro , incubation of normal rat kidney fibroblasts with tubule-derived Wnts promoted fibroblast proliferation and activation. Furthermore, compared with kidney specimens from patients without CKD, biopsy specimens from patients with CKD also displayed increased expression of multiple Wnt proteins, predominantly in renal tubular epithelium. These results illustrate that tubule-derived Wnts have an essential role in promoting fibroblast activation and kidney fibrosis via epithelial-mesenchymal communication. Copyright © 2017 by the American Society of Nephrology.

  13. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...

  14. Properties of gasification-derived char and its utilization for catalytic tar reforming

    Science.gov (United States)

    Qian, Kezhen

    Char is a low-value byproduct of biomass gasification and pyrolysis with many potential applications, such as soil amendment and the synthesis of activated carbon. The overall goal of the proposed research was to develop novel methods to use char derived from gasification for high-value applications in syngas conditioning. The first objective was to investigate effects of gasification condition and feedstock on properties of char derived from fluidized bed gasification. Results show that the surface areas of most of the char were 1--10 m 2/g and increased as the equivalence ratio increased. Char moisture and fixed carbon contents decreased while ash content increased as equivalence ratio increased. The next objective was to study the properties of sorghum and red cedar char derived from downdraft gasifier. Red cedar char contained more aliphatic carbon and o-alkyl carbon than sorghum char. Char derived from downdraft gasification had higher heating values and lower ash contents than char derived from fluidized bed gasification. The gasification reactivity of red cedar char was higher than that of sorghum char. Then, red cedar char based catalysts were developed with different preparation method to reform toluene and naphthalene as model tars. The catalyst prepared with nickel nitrate was found to be better than that with nickel acetate. The nickel particle size of catalyst impregnated with nickel nitrate was smaller than that of catalyst impregnated with nickel acetate. The particle size of catalyst impregnated with nickel acetate decreased by hydrazine reduction. The catalyst impregnated with nickel nitrate had the highest toluene removal efficiency, which was 70%--100% at 600--800 °C. The presence of naphthalene in tar reduced the catalyst efficiency. The toluene conversion was 36--99% and the naphthalene conversion was 37%--93% at 700--900 °C. Finally, effects of atmosphere and pressure on catalytic reforming of lignin-derived tars over the developed catalyst

  15. Legionella pneumophila-Derived Outer Membrane Vesicles Promote Bacterial Replication in Macrophages.

    Directory of Open Access Journals (Sweden)

    Anna Lena Jung

    2016-04-01

    Full Text Available The formation and release of outer membrane vesicles (OMVs is a phenomenon of Gram-negative bacteria. This includes Legionella pneumophila (L. pneumophila, a causative agent of severe pneumonia. Upon its transmission into the lung, L. pneumophila primarily infects and replicates within macrophages. Here, we analyzed the influence of L. pneumophila OMVs on macrophages. To this end, differentiated THP-1 cells were incubated with increasing doses of Legionella OMVs, leading to a TLR2-dependent classical activation of macrophages with the release of pro-inflammatory cytokines. Inhibition of TLR2 and NF-κB signaling reduced the induction of pro-inflammatory cytokines. Furthermore, treatment of THP-1 cells with OMVs prior to infection reduced replication of L. pneumophila in THP-1 cells. Blocking of TLR2 activation or heat denaturation of OMVs restored bacterial replication in the first 24 h of infection. With prolonged infection-time, OMV pre-treated macrophages became more permissive for bacterial replication than untreated cells and showed increased numbers of Legionella-containing vacuoles and reduced pro-inflammatory cytokine induction. Additionally, miRNA-146a was found to be transcriptionally induced by OMVs and to facilitate bacterial replication. Accordingly, IRAK-1, one of miRNA-146a's targets, showed prolonged activation-dependent degradation, which rendered THP-1 cells more permissive for Legionella replication. In conclusion, L. pneumophila OMVs are initially potent pro-inflammatory stimulators of macrophages, acting via TLR2, IRAK-1, and NF-κB, while at later time points, OMVs facilitate L. pneumophila replication by miR-146a-dependent IRAK-1 suppression. OMVs might thereby promote spreading of L. pneumophila in the host.

  16. Synthesis of novel bioactive lactose-derived oligosaccharides by microbial glycoside hydrolases

    Science.gov (United States)

    Díez-Municio, Marina; Herrero, Miguel; Olano, Agustín; Moreno, F Javier

    2014-01-01

    Prebiotic oligosaccharides are increasingly demanded within the Food Science domain because of the interesting healthy properties that these compounds may induce to the organism, thanks to their beneficial intestinal microbiota growth promotion ability. In this regard, the development of new efficient, convenient and affordable methods to obtain this class of compounds might expand even further their use as functional ingredients. This review presents an overview on the most recent interesting approaches to synthesize lactose-derived oligosaccharides with potential prebiotic activity paying special focus on the microbial glycoside hydrolases that can be effectively employed to obtain these prebiotic compounds. The most notable advantages of using lactose-derived carbohydrates such as lactosucrose, galactooligosaccharides from lactulose, lactulosucrose and 2-α-glucosyl-lactose are also described and commented. PMID:24690139

  17. Exosomes derived from human umbilical cord blood mesenchymal stem cells stimulates rejuvenation of human skin.

    Science.gov (United States)

    Kim, Yoon-Jin; Yoo, Sae Mi; Park, Hwan Hee; Lim, Hye Jin; Kim, Yu-Lee; Lee, Seunghee; Seo, Kwang-Won; Kang, Kyung-Sun

    2017-11-18

    Human umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) play an important role in cutaneous wound healing, and recent studies suggested that MSC-derived exosomes activate several signaling pathways, which are conducive in wound healing and cell growth. In this study, we investigated the roles of exosomes that are derived from USC-CM (USC-CM Exos) in cutaneous collagen synthesis and permeation. We found that USC-CM has various growth factors associated with skin rejuvenation. Our in vitro results showed that USC-CM Exos integrate in Human Dermal Fibroblasts (HDFs) and consequently promote cell migration and collagen synthesis of HDFs. Moreover, we evaluated skin permeation of USC-CM Exos by using human skin tissues. Results showed that Exo-Green labeled USC-CM Exos approached the outermost layer of the epidermis after 3 h and gradually approached the epidermis after 18 h. Moreover, increased expressions of Collagen I and Elastin were found after 3 days of treatment on human skin. The results showed that USC-CM Exos is absorbed into human skin, it promotes Collagen I and Elastin synthesis in the skin, which are essential to skin rejuvenation and shows the potential of USC-CM integration with the cosmetics or therapeutics. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Which categories should direct marketers feature for which customers when using targeted promotions?

    DEFF Research Database (Denmark)

    Reutterer, Thomas; Boztug, Yasemin; Breugelmans, Els

    -stage procedure. For deriving segment-specific promotions at the product category level, this procedure takes both interdependencies in purchase behaviour across categories and customer heterogeneity with respect to cross-category effects in response to marketing actions into account. The resulting...... recommendations are empirically evaluated vis-à-vis alternative approaches in a controlled field experiment conducted in cooperation with a major online grocery retailer....

  19. Environmental Growth Conditions of Trichoderma spp. Affects Indole Acetic Acid Derivatives, Volatile Organic Compounds, and Plant Growth Promotion

    Science.gov (United States)

    Nieto-Jacobo, Maria F.; Steyaert, Johanna M.; Salazar-Badillo, Fatima B.; Nguyen, Dianne Vi; Rostás, Michael; Braithwaite, Mark; De Souza, Jorge T.; Jimenez-Bremont, Juan F.; Ohkura, Mana; Stewart, Alison

    2017-01-01

    Trichoderma species are soil-borne filamentous fungi widely utilized for their many plant health benefits, such as conferring improved growth, disease resistance and abiotic stress tolerance to their hosts. Many Trichoderma species are able to produce the auxin phytohormone indole-3-acetic acid (IAA), and its production has been suggested to promote root growth. Here we show that the production of IAA is strain dependent and diverse external stimuli are associated with its production. In in vitro assays, Arabidopsis primary root length was negatively affected by the interaction with some Trichoderma strains. In soil experiments, a continuum effect on plant growth was shown and this was also strain dependent. In plate assays, some strains of Trichoderma spp. inhibited the expression of the auxin reporter gene DR5 in Arabidopsis primary roots but not secondary roots. When Trichoderma spp. and A. thaliana were physically separated, enhancement of both shoot and root biomass, increased root production and chlorophyll content were observed, which strongly suggested that volatile production by the fungus influenced the parameters analyzed. Trichoderma strains T. virens Gv29.8, T. atroviride IMI206040, T. sp. “atroviride B” LU132, and T. asperellum LU1370 were demonstrated to promote plant growth through volatile production. However, contrasting differences were observed with LU1370 which had a negative effect on plant growth in soil but a positive effect in plate assays. Altogether our results suggest that the mechanisms and molecules involved in plant growth promotion by Trichoderma spp. are multivariable and are affected by the environmental conditions. PMID:28232840

  20. LMP1-mediated glycolysis induces myeloid-derived suppressor cell expansion in nasopharyngeal carcinoma.

    Directory of Open Access Journals (Sweden)

    Ting-Ting Cai

    2017-07-01

    Full Text Available Myeloid-derived suppressor cells (MDSCs are expanded in tumor microenvironments, including that of Epstein-Barr virus (EBV-associated nasopharyngeal carcinoma (NPC. The link between MDSC expansion and EBV infection in NPC is unclear. Here, we show that EBV latent membrane protein 1 (LMP1 promotes MDSC expansion in the tumor microenvironment by promoting extra-mitochondrial glycolysis in malignant cells, which is a scenario for immune escape initially suggested by the frequent, concomitant detection of abundant LMP1, glucose transporter 1 (GLUT1 and CD33+ MDSCs in tumor sections. The full process has been reconstituted in vitro. LMP1 promotes the expression of multiple glycolytic genes, including GLUT1. This metabolic reprogramming results in increased expression of the Nod-like receptor family protein 3 (NLRP3 inflammasome, COX-2 and P-p65 and, consequently, increased production of IL-1β, IL-6 and GM-CSF. Finally, these changes in the environment of malignant cells result in enhanced NPC-derived MDSC induction. One key step is the physical interaction of LMP1 with GLUT1 to stabilize the GLUT1 protein by blocking its K48-ubiquitination and p62-dependent autolysosomal degradation. This work indicates that LMP1-mediated glycolysis regulates IL-1β, IL-6 and GM-CSF production through the NLRP3 inflammasome, COX-2 and P-p65 signaling pathways to enhance tumor-associated MDSC expansion, which leads to tumor immunosuppression in NPC.

  1. Ultrasound-targeted stromal cell-derived factor-1-loaded microbubble destruction promotes mesenchymal stem cell homing to kidneys in diabetic nephropathy rats

    Directory of Open Access Journals (Sweden)

    Wu S

    2014-12-01

    control treatments in normal rats and DN rats. In conclusion, ultrasound-targeted MBSDF-1 destruction could promote the homing of MSCs to early DN kidneys and provide a novel potential therapeutic approach for DN kidney repair. Keywords: mesenchymal stem cell, ultrasound, microbubbles, homing, stromal cell-derived factor-1, diabetic nephropathy

  2. Fascin overexpression promotes neoplastic progression in oral squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Alam Hunain

    2012-01-01

    Full Text Available Abstract Background Fascin is a globular actin cross-linking protein, which plays a major role in forming parallel actin bundles in cell protrusions and is found to be associated with tumor cell invasion and metastasis in various type of cancers including oral squamous cell carcinoma (OSCC. Previously, we have demonstrated that fascin regulates actin polymerization and thereby promotes cell motility in K8-depleted OSCC cells. In the present study we have investigated the role of fascin in tumor progression of OSCC. Methods To understand the role of fascin in OSCC development and/or progression, fascin was overexpressed along with vector control in OSCC derived cells AW13516. The phenotype was studied using wound healing, Boyden chamber, cell adhesion, Hanging drop, soft agar and tumorigenicity assays. Further, fascin expression was examined in human OSCC samples (N = 131 using immunohistochemistry and level of its expression was correlated with clinico-pathological parameters of the patients. Results Fascin overexpression in OSCC derived cells led to significant increase in cell migration, cell invasion and MMP-2 activity. In addition these cells demonstrated increased levels of phosphorylated AKT, ERK1/2 and JNK1/2. Our in vitro results were consistent with correlative studies of fascin expression with the clinico-pathological parameters of the OSCC patients. Fascin expression in OSCC showed statistically significant correlation with increased tumor stage (P = 0.041, increased lymph node metastasis (P = 0.001, less differentiation (P = 0.005, increased recurrence (P = 0.038 and shorter survival (P = 0.004 of the patients. Conclusion In conclusion, our results indicate that fascin promotes tumor progression and activates AKT and MAPK pathways in OSCC-derived cells. Further, our correlative studies of fascin expression in OSCC with clinico-pathological parameters of the patients indicate that fascin may prove to be useful in prognostication and

  3. Fascin overexpression promotes neoplastic progression in oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Alam, Hunain; Kannanl, Sadhna; Gude, Rajiv; Kane, Shubhada; Dalal, Sorab N; Vaidya, Milind M; Bhate, Amruta V; Gangadaran, Prakash; Sawant, Sharda S; Salot, Shimul; Sehgal, Lalit; Dange, Prerana P; Chaukar, Devendra A; D'cruz, Anil K

    2012-01-01

    Fascin is a globular actin cross-linking protein, which plays a major role in forming parallel actin bundles in cell protrusions and is found to be associated with tumor cell invasion and metastasis in various type of cancers including oral squamous cell carcinoma (OSCC). Previously, we have demonstrated that fascin regulates actin polymerization and thereby promotes cell motility in K8-depleted OSCC cells. In the present study we have investigated the role of fascin in tumor progression of OSCC. To understand the role of fascin in OSCC development and/or progression, fascin was overexpressed along with vector control in OSCC derived cells AW13516. The phenotype was studied using wound healing, Boyden chamber, cell adhesion, Hanging drop, soft agar and tumorigenicity assays. Further, fascin expression was examined in human OSCC samples (N = 131) using immunohistochemistry and level of its expression was correlated with clinico-pathological parameters of the patients. Fascin overexpression in OSCC derived cells led to significant increase in cell migration, cell invasion and MMP-2 activity. In addition these cells demonstrated increased levels of phosphorylated AKT, ERK1/2 and JNK1/2. Our in vitro results were consistent with correlative studies of fascin expression with the clinico-pathological parameters of the OSCC patients. Fascin expression in OSCC showed statistically significant correlation with increased tumor stage (P = 0.041), increased lymph node metastasis (P = 0.001), less differentiation (P = 0.005), increased recurrence (P = 0.038) and shorter survival (P = 0.004) of the patients. In conclusion, our results indicate that fascin promotes tumor progression and activates AKT and MAPK pathways in OSCC-derived cells. Further, our correlative studies of fascin expression in OSCC with clinico-pathological parameters of the patients indicate that fascin may prove to be useful in prognostication and treatment of OSCC

  4. Studies on (acid + base) equilibria in substituted (phenol + n-butylamine) systems in acetonitrile

    Energy Technology Data Exchange (ETDEWEB)

    Kozak, A. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Czaja, M. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Chmurzynski, L. [Department of General Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)]. E-mail: lech@chem.univ.gda.pl

    2005-08-15

    (Acid + base) equilibria, including molecular heteroconjugation ones, between n-butylamine and one of the following phenols: 2-nitrophenol, 3-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol, 2,5-dinitrophenol, 3-chlorophenol, 4-chlorophenol, 2,3,4,5,6-pentachlorophenol and 2,4,6-tribromophenol have been studied potentiometrically in a protophobic polar aprotic solvent, acetonitrile. Among the phenols studied, 2,5-dinitrophenol exhibited the strongest tendency towards formation of asymmetric hydrogen bonds with n-butylamine, whereas a weakest complex was formed with 2-nitrophenol. In the (n-butylamine + 2,3,4,5,6-pentachlorophenol) and (n-butylamine + 2,4-dinitrophenol) systems proton transfer reactions occurred.

  5. Bone marrow-derived CD13+ cells sustain tumor progression

    Science.gov (United States)

    Dondossola, Eleonora; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2014-01-01

    Non-malignant cells found within neoplastic lesions express alanyl (membrane) aminopeptidase (ANPEP, best known as CD13), and CD13-null mice exhibit limited tumor growth and angiogenesis. We have recently demonstrated that a subset of bone marrow-derived CD11b+CD13+ myeloid cells accumulate within neoplastic lesions in several murine models of transplantable cancer to promote angiogenesis. If these findings were confirmed in clinical settings, CD11b+CD13+ myeloid cells could become a non-malignant target for the development of novel anticancer regimens. PMID:25339996

  6. Glycyrrhizic Acid Promotes M1 Macrophage Polarization in Murine Bone Marrow-Derived Macrophages Associated with the Activation of JNK and NF-κB.

    Science.gov (United States)

    Mao, Yulong; Wang, Baikui; Xu, Xin; Du, Wei; Li, Weifen; Wang, Youming

    2015-01-01

    The roots and rhizomes of Glycyrrhiza species (licorice) have been widely used as natural sweeteners and herbal medicines. The aim of this study is to investigate the effect of glycyrrhizic acid (GA) from licorice on macrophage polarization. Both phenotypic and functional activities of murine bone marrow-derived macrophages (BMDMs) treated by GA were assessed. Our results showed that GA obviously increased the cell surface expression of CD80, CD86, and MHCII molecules. Meanwhile, GA upregulated the expression of CCR7 and the production of TNF-α, IL-12, IL-6, and NO (the markers of classically activated (M1) macrophages), whereas it downregulated the expression of MR, Ym1, and Arg1 (the markers of alternatively activated (M2) macrophage). The functional tests showed that GA dramatically enhanced the uptake of FITC-dextran and E. coli K88 by BMDMs and decreased the intracellular survival of E. coli K88 and S. typhimurium. Moreover, we demonstrated that JNK and NF-κB activation are required for GA-induced NO and M1-related cytokines production, while ERK1/2 pathway exhibits a regulatory effect via induction of IL-10. Together, these findings indicated that GA promoted polarization of M1 macrophages and enhanced its phagocytosis and bactericidal capacity. The results expanded our knowledge about the role of GA in macrophage polarization.

  7. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  8. Biodistribution, Uptake and Effects Caused by Cancer-Derived Extracellular Vesicles

    Directory of Open Access Journals (Sweden)

    Lilite Sadovska

    2015-03-01

    Full Text Available Extracellular vesicles (EVs have recently emerged as important mediators of intercellular communication. They are released in the extracellular space by a variety of normal and cancerous cell types and have been found in all human body fluids. Cancer-derived EVs have been shown to carry lipids, proteins, mRNAs, non-coding and structural RNAs and even extra-chromosomal DNA, which can be taken up by recipient cells and trigger diverse physiological and pathological responses. An increasing body of evidence suggests that cancer-derived EVs mediate paracrine signalling between cancer cells. This leads to the increased invasiveness, proliferation rate and chemoresistance, as well as the acquisition of the cancer stem cell phenotype. This stimulates angiogenesis and the reprogramming of normal stromal cells into cancer-promoting cell types. Furthermore, cancer-derived EVs contribute to the formation of the pre-metastatic niche and modulation of anti-tumour immune response. However, as most of these data are obtained by in vitro studies, it is not entirely clear which of these effects are recapitulated in vivo . In the current review, we summarize studies that assess the tissue distribution, trafficking, clearance and uptake of cancer-derived EVs in vivo and discuss the impact they have, both locally and systemically.

  9. Perceptions of health promoters about health promotion ...

    African Journals Online (AJOL)

    2013-02-11

    Feb 11, 2013 ... regarding a health promotion programme for families with ... to contribute to high rates of not going to school (ibid. ... sector in order, amongst other objectives, to prevent health ... exercise and mental health promotion must be incorporated ..... (2009:141) identified ignorance and misconception about the.

  10. Far infrared promotes wound healing through activation of Notch1 signaling.

    Science.gov (United States)

    Hsu, Yung-Ho; Lin, Yuan-Feng; Chen, Cheng-Hsien; Chiu, Yu-Jhe; Chiu, Hui-Wen

    2017-11-01

    The Notch signaling pathway is critically involved in cell proliferation, differentiation, development, and homeostasis. Far infrared (FIR) has an effect that promotes wound healing. However, the underlying molecular mechanisms are unclear. In the present study, we employed in vivo and HaCaT (a human skin keratinocyte cell line) models to elucidate the role of Notch1 signaling in FIR-promoted wound healing. We found that FIR enhanced keratinocyte migration and proliferation. FIR induced the Notch1 signaling pathway in HaCaT cells and in a microarray dataset from the Gene Expression Omnibus database. We next determined the mRNA levels of NOTCH1 in paired normal and wound skin tissues derived from clinical patients using the microarray dataset and Ingenuity Pathway Analysis software. The result indicated that the Notch1/Twist1 axis plays important roles in wound healing and tissue repair. In addition, inhibiting Notch1 signaling decreased the FIR-enhanced proliferation and migration. In a full-thickness wound model in rats, the wounds healed more rapidly and the scar size was smaller in the FIR group than in the light group. Moreover, FIR could increase Notch1 and Delta1 in skin tissues. The activation of Notch1 signaling may be considered as a possible mechanism for the promoting effect of FIR on wound healing. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model. FIR stimulates keratinocyte migration and proliferation. Notch1 in keratinocytes has an essential role in FIR-induced migration and proliferation. NOTCH1 promotes TWIST1-mediated gene expression to assist wound healing. FIR might promote skin wound healing in a rat model.

  11. Endothelium derived nitric oxide synthase negatively regulates the PDGF-survivin pathway during flow-dependent vascular remodeling.

    Directory of Open Access Journals (Sweden)

    Jun Yu

    Full Text Available Chronic alterations in blood flow initiate structural changes in vessel lumen caliber to normalize shear stress. The loss of endothelial derived nitric oxide synthase (eNOS in mice promotes abnormal flow dependent vascular remodeling, thus uncoupling mechanotransduction from adaptive vascular remodeling. However, the mechanisms of how the loss of eNOS promotes abnormal remodeling are not known. Here we show that abnormal flow-dependent remodeling in eNOS knockout mice (eNOS (-/- is associated with activation of the platelet derived growth factor (PDGF signaling pathway leading to the induction of the inhibitor of apoptosis, survivin. Interfering with PDGF signaling or survivin function corrects the abnormal remodeling seen in eNOS (-/- mice. Moreover, nitric oxide (NO negatively regulates PDGF driven survivin expression and cellular proliferation in cultured vascular smooth muscle cells. Collectively, our data suggests that eNOS negatively regulates the PDGF-survivin axis to maintain proportional flow-dependent luminal remodeling and vascular quiescence.

  12. Development of protective autoimmunity by immunization with a neural-derived peptide is ineffective in severe spinal cord injury.

    Directory of Open Access Journals (Sweden)

    Susana Martiñón

    Full Text Available Protective autoimmunity (PA is a physiological response to central nervous system trauma that has demonstrated to promote neuroprotection after spinal cord injury (SCI. To reach its beneficial effect, PA should be boosted by immunizing with neural constituents or neural-derived peptides such as A91. Immunizing with A91 has shown to promote neuroprotection after SCI and its use has proven to be feasible in a clinical setting. The broad applications of neural-derived peptides make it important to determine the main features of this anti-A91 response. For this purpose, adult Sprague-Dawley rats were subjected to a spinal cord contusion (SCC; moderate or severe or a spinal cord transection (SCT; complete or incomplete. Immediately after injury, animals were immunized with PBS or A91. Motor recovery, T cell-specific response against A91 and the levels of IL-4, IFN-γ and brain-derived neurotrophic factor (BDNF released by A91-specific T (T(A91 cells were evaluated. Rats with moderate SCC, presented a better motor recovery after A91 immunization. Animals with moderate SCC or incomplete SCT showed significant T cell proliferation against A91 that was characterized chiefly by the predominant production of IL-4 and the release of BDNF. In contrast, immunization with A91 did not promote a better motor recovery in animals with severe SCC or complete SCT. In fact, T cell proliferation against A91 was diminished in these animals. The present results suggest that the effective development of PA and, consequently, the beneficial effects of immunizing with A91 significantly depend on the severity of SCI. This could mainly be attributed to the lack of T(A91 cells which predominantly showed to have a Th2 phenotype capable of producing BDNF, further promoting neuroprotection.

  13. Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1991-12-01

    The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT

  14. Subfractions of enamel matrix derivative differentially influence cytokine secretion from human oral fibroblasts

    Directory of Open Access Journals (Sweden)

    Oscar Villa

    2015-03-01

    Full Text Available Enamel matrix derivative is used to promote periodontal regeneration during the corrective phase of the treatment of periodontal defects. Our main goal was to analyze the bioactivity of different molecular weight fractions of enamel matrix derivative. Enamel matrix derivative, a complex mixture of proteins, was separated into 13 fractions using size-exclusion chromatography and characterized by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and liquid chromatography–electrospray ionization–tandem mass spectrometry. Human periodontal ligament fibroblasts were treated with either enamel matrix derivative or the different fractions. Proliferation and cytokine secretion to the cell culture medium were measured and compared to untreated cells. The liquid chromatography–electrospray ionization–tandem mass spectrometry analyses revealed that the most abundant peptides were amelogenin and leucine-rich amelogenin peptide related. The fractions containing proteins above 20 kDa induced an increase in vascular endothelial growth factor and interleukin-6 secretion, whereas lower molecular weight fractions enhanced proliferation and secretion of interleukin-8 and monocyte chemoattractant protein-1 and reduced interleukin-4 release. The various molecular components in the enamel matrix derivative formulation might contribute to reported effects on tissue regeneration through their influence on vascularization, the immune response, and chemotaxis.

  15. A Mineralized Collagen-Polycaprolactone Composite Promotes Healing of a Porcine Mandibular Defect.

    Science.gov (United States)

    Weisgerber, Daniel W; Milner, Derek J; Lopez-Lake, Heather; Rubessa, Marcello; Lotti, Sammi; Polkoff, Kathryn; Hortensius, Rebecca A; Flanagan, Colleen L; Hollister, Scott J; Wheeler, Matthew B; Harley, Brendan A C

    2018-02-01

    A tissue engineering approach to address craniofacial defects requires a biomaterial that balances macro-scale mechanical stiffness and strength with the micron-scale features that promote cell expansion and tissue biosynthesis. Such criteria are often in opposition, leading to suboptimal mechanical competence or bioactivity. We report the use of a multiscale composite biomaterial that integrates a polycaprolactone (PCL) reinforcement structure with a mineralized collagen-glycosaminoglycan scaffold to circumvent conventional tradeoffs between mechanics and bioactivity. The composite promotes activation of the canonical bone morphogenetic protein 2 (BMP-2) pathway and subsequent mineralization of adipose-derived stem cells in the absence of supplemental BMP-2 or osteogenic media. We subsequently examined new bone infill in the acellular composite, scaffold alone, or PCL support in 10 mm dia. ramus mandibular defects in Yorkshire pigs. We report an analytical approach to quantify radial, angular, and depth bone infill from micro-computed tomography data. The collagen-PCL composite showed improved overall infill, and significantly increased radial and angular bone infill versus the PCL cage alone. Bone infill was further enhanced in the composite for defects that penetrated the medullary cavity, suggesting recruitment of marrow-derived cells. These results indicate a multiscale mineralized collagen-PCL composite offers strategic advantages for regenerative repair of craniofacial bone defects.

  16. Health-promoting educational settings in Taiwan: development and evaluation of the Health-Promoting School Accreditation System.

    Science.gov (United States)

    Chen, Fu-Li; Lee, Albert

    2016-03-01

    The Taiwan Ministry of Health and Welfare and Ministry of Education launched the Health-Promoting School (HPS) program in 2002. One of the most significant barriers to evaluating HPS is the absence of adequate instruments. The main aim of this study is to develop the Taiwan Health-Promoting School Accreditation System (HPSAS) framework and then evaluate its accreditation effectiveness. The HPSAS accreditation standards were derived mainly from the World Health Organization (WHO) publication, WHO Health Promoting Schools: A Framework for Action in 2008 and the Taiwan School Health Act. Delphi technique and pilot test were used to confirm the availability and acceptability of the standards and procedures for HPSAS in 2011. After that, two rounds of school evaluations were completed in 2012 (214 participant schools) and 2014 (182 participant schools). The accreditation operation process included documentary reviews, national and international accredited commissioners conducted on-site visits. Descriptive analyses were used to indicate HPS award level distribution. The study established six key HPSAS standards. Each standard had at least two components; overall, there were 21 components and 47 scoring elements. Of the participating schools evaluated in 2012, four were at the gold, 14 silver, and 120 bronze levels, compared with five, 20, and 31, respectively, of schools evaluated in 2014. The study showed that schools at different award levels had different full-score rates in six standards. The schools at the gold level performed exceptionally well. The worst performance among the six standards at each award level was in the skill-based health curriculum. The HPSAS is an objective instrument used to evaluate the process and outcomes of the HPS program. In the future, combinations of different types of data (e.g. students' health behaviors, school climate, or teachers' health-teaching innovations) will enable further validation of the HPS effectiveness. © The Author

  17. Synthesis and Biological Activity of 3-[Phenyl(1,3-thiazol-2-yl-amino]propanoic Acids and Their Derivatives

    Directory of Open Access Journals (Sweden)

    Vytautas Mickevičius

    2013-12-01

    Full Text Available New N,N-disubstituted β-amino acids and their derivatives with thiazole, aromatic, and heterocyclic substituents were synthesized from N-phenyl-N-thiocarbamoyl-β-alanine by the Hantzsch method; derivatives with hydrazone fragments were also obtained. Some of the synthesized compounds exhibited discrete antimicrobial activity, and 3-[(4-oxo-4,5-dihydro-1,3-thiazol-2-yl(phenylamino]propanoic acid was found to promote rapeseed growth and to increase seed yield and oil content.

  18. SPORT PROMOTION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Alexandru Lucian MIHAI

    2013-10-01

    Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

  19. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene

    DEFF Research Database (Denmark)

    Efrat, S; Linde, S; Kofod, Hans

    1988-01-01

    Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....

  20. The study on Egr-1 promoter which is radioactive promoter

    International Nuclear Information System (INIS)

    Zhang Chunzhi; Guo Yang; Lv Zhonghong

    2006-01-01

    Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)

  1. Iron chloride catalysed PCDD/F-formation: Experiments and PCDD/F-signatures.

    Science.gov (United States)

    Zhang, Mengmei; Buekens, Alfons; Ma, Siyuan; Li, Xiaodong

    2018-01-01

    Iron chloride is often cited as catalyst of PCDD/F-formation, together with copper chloride. Conversely, iron chloride catalysis has been less studied during de novo tests. This paper presents such de novo test data, derived from model fly ash incorporating iron (III) chloride and established over a vast range of temperature and oxygen concentration in the gas phase. Both PCDD/F-output and its signature are extensively characterised, including homologue and congener profiles. For the first time, a complete isomer-specific analysis is systematically established, for all samples. Special attention is paid to the chlorophenols route PCDD/F, to the 2,3,7,8-substituted congeners, and to their relationship and antagonism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  3. Tumor microenvironment derived exosomes pleiotropically modulate cancer cell metabolism.

    Science.gov (United States)

    Zhao, Hongyun; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Bernard, Vincent; Moss, Tyler; Marini, Juan C; Tudawe, Thavisha; Seviour, Elena G; San Lucas, F Anthony; Alvarez, Hector; Gupta, Sonal; Maiti, Sourindra N; Cooper, Laurence; Peehl, Donna; Ram, Prahlad T; Maitra, Anirban; Nagrath, Deepak

    2016-02-27

    Cancer-associated fibroblasts (CAFs) are a major cellular component of tumor microenvironment in most solid cancers. Altered cellular metabolism is a hallmark of cancer, and much of the published literature has focused on neoplastic cell-autonomous processes for these adaptations. We demonstrate that exosomes secreted by patient-derived CAFs can strikingly reprogram the metabolic machinery following their uptake by cancer cells. We find that CAF-derived exosomes (CDEs) inhibit mitochondrial oxidative phosphorylation, thereby increasing glycolysis and glutamine-dependent reductive carboxylation in cancer cells. Through 13C-labeled isotope labeling experiments we elucidate that exosomes supply amino acids to nutrient-deprived cancer cells in a mechanism similar to macropinocytosis, albeit without the previously described dependence on oncogenic-Kras signaling. Using intra-exosomal metabolomics, we provide compelling evidence that CDEs contain intact metabolites, including amino acids, lipids, and TCA-cycle intermediates that are avidly utilized by cancer cells for central carbon metabolism and promoting tumor growth under nutrient deprivation or nutrient stressed conditions.

  4. Time-zero efficiency of European power derivatives markets

    International Nuclear Information System (INIS)

    Peña, Juan Ignacio; Rodriguez, Rosa

    2016-01-01

    We study time-zero efficiency of electricity derivatives markets. By time-zero efficiency is meant a sequence of prices of derivatives contracts having the same underlying asset but different times to maturity which implies that prices comply with a set of efficiency conditions that prevent profitable time-zero arbitrage opportunities. We investigate whether statistical tests, based on the law of one price, and trading rules, based on price differentials and no-arbitrage violations, are useful for assessing time-zero efficiency. We apply tests and trading rules to daily data of three European power markets: Germany, France and Spain. In the case of the German market, after considering liquidity availability and transaction costs, results are not inconsistent with time-zero efficiency. However, in the case of the French and Spanish markets, limitations in liquidity and representativeness are challenges that prevent definite conclusions. Liquidity in French and Spanish markets should improve by using pricing and marketing incentives. These incentives should attract more participants into the electricity derivatives exchanges and should encourage them to settle OTC trades in clearinghouses. Publication of statistics on prices, volumes and open interest per type of participant should be promoted. - Highlights: •We test time-zero efficiency of derivatives power markets in Germany, France and Spain. •Prices in Germany, considering liquidity and transaction costs, are time-zero efficient. •In France and Spain, limitations in liquidity and representativeness prevent conclusions. •Liquidity in France and Spain should improve by using pricing and marketing incentives. •Incentives attract participants to exchanges and encourage them to settle OTC trades in clearinghouses.

  5. Radiation promotive concept

    International Nuclear Information System (INIS)

    Shebaita, M.K.

    1975-01-01

    The concept of radiation promotion was proposed in this study. The proposal of this concept was dependent upon stimulation in growth weight of survived chicks when fertile eggs were exposed to 60 Co gamma radiation. It was found that female chick (Promotive Sex) responded to this proposal concept rather than the male. Moreover, the dose level of 640 rads was found to be the Promotive Dose. It is important before applying ionizing radiation as a growth promotive to take into consideration whether you want increasing egg or meat production, as meat promotion in layers breed is bound to decrease egg production. (orig.) [de

  6. Promoting Health in Early Childhood Environments: A Health-Promotion Approach

    Science.gov (United States)

    Minniss, Fiona Rowe; Wardrope, Cheryl; Johnston, Donni; Kendall, Elizabeth

    2013-01-01

    This paper investigates the mechanisms by which a health-promotion intervention might influence the health-promoting behaviours of staff members working in early childhood centres. The intervention was an ecological health-promotion initiative that was implemented within four early childhood centres in South-East Queensland, Australia. In-depth,…

  7. Promotion of Vascular Morphogenesis of Endothelial Cells Co-Cultured with Human Adipose-Derived Mesenchymal Stem Cells Using Polycaprolactone/Gelatin Nanofibrous Scaffolds

    Directory of Open Access Journals (Sweden)

    Yun-Min Kook

    2018-02-01

    Full Text Available New blood vessel formation is essential for tissue regeneration to deliver oxygen and nutrients and to maintain tissue metabolism. In the field of tissue engineering, in vitro fabrication of new artificial vessels has been a longstanding challenge. Here we developed a technique to reconstruct a microvascular system using a polycaprolactone (PCL/gelatin nanofibrous structure and a co-culture system. Using a simple electrospinning process, we fabricated three-dimensional mesh scaffolds to support the sprouting of human umbilical vein endothelial cells (HUVECs along the electrospun nanofiber. The co-culture with adipose-derived mesenchymal stem cells (ADSCs supported greater sprouting of endothelial cells (ECs. In a two-dimensional culture system, angiogenic cell assembly produced more effective direct intercellular interactions and paracrine signaling from ADSCs to assist in the vascular formation of ECs, compared to the influence of growth factor. Although vascular endothelial growth factor and sphingosine-1-phosphate were present during the culture period, the presence of ADSCs was the most important factor for the construction of a cell-assembled structure in the two-dimensional culture system. On the contrary, HUVECs co-cultured on PCL/gelatin nanofiber scaffolds produced mature and functional microvessel and luminal structures with a greater expression of vascular markers, including platelet endothelial cell adhesion molecule-1 and podocalyxin. Furthermore, both angiogenic factors and cellular interactions with ADSCs through direct contact and paracrine molecules contributed to the formation of enhanced engineered blood vessel structures. It is expected that the co-culture system of HUVECs and ADSCs on bioengineered PCL/gelatin nanofibrous scaffolds will promote robust and functional microvessel structures and will be valuable for the regeneration of tissue with restored blood vessels.

  8. DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

    Science.gov (United States)

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

    2010-06-18

    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

  9. Refuse derived soluble bio-organics enhancing tomato plant growth and productivity

    Energy Technology Data Exchange (ETDEWEB)

    Sortino, Orazio [Dipartimento di Scienze Agronomiche Agrochimiche e delle Produzioni Animali, Universita degli Studi di Catania, Via Valdisavoia 5, 95123 Catania (Italy); Dipasquale, Mauro [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 7, 10125 Torino (Italy); Montoneri, Enzo, E-mail: enzo.montoneri@unito.it [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 7, 10125 Torino (Italy); Tomasso, Lorenzo; Perrone, Daniele G. [Dipartimento di Chimica, Universita di Torino, Via P. Giuria 7, 10125 Torino (Italy); Vindrola, Daniela; Negre, Michele; Piccone, Giuseppe [Dipartimento di Valorizzazione e Protezione delle Risorse Agroforestali, Universita di Torino, Via L. da Vinci 44, 10095 Grugliasco (Italy)

    2012-10-15

    Highlights: Black-Right-Pointing-Pointer Municipal bio-wastes are a sustainable source of bio-based products. Black-Right-Pointing-Pointer Refuse derived soluble bio-organics promote chlorophyll synthesis. Black-Right-Pointing-Pointer Refuse derived soluble bio-organics enhance plant growth and fruit ripening rate. Black-Right-Pointing-Pointer Sustainable chemistry exploiting urban refuse allows sustainable development. Black-Right-Pointing-Pointer Chemistry, agriculture and the environment benefit from biowaste technology. - Abstract: Municipal bio-refuse (CVD), containing kitchen wastes, home gardening residues and public park trimmings, was treated with alkali to yield a soluble bio-organic fraction (SBO) and an insoluble residue. These materials were characterized using elemental analysis, potentiometric titration, and 13C NMR spectroscopy, and then applied as organic fertilizers to soil for tomato greenhouse cultivation. Their performance was compared with a commercial product obtained from animal residues. Plant growth, fruit yield and quality, and soil and leaf chemical composition were the selected performance indicators. The SBO exhibited the best performance by enhancing leaf chlorophyll content, improving plant growth and fruit ripening rate and yield. No product performance-chemical composition relationship could be assessed. Solubility could be one reason for the superior performance of SBO as a tomato growth promoter. The enhancement of leaf chlorophyll content is discussed to identify a possible link with the SBO photosensitizing properties that have been demonstrated in other work, and thus with photosynthetic performance.

  10. Refuse derived soluble bio-organics enhancing tomato plant growth and productivity

    International Nuclear Information System (INIS)

    Sortino, Orazio; Dipasquale, Mauro; Montoneri, Enzo; Tomasso, Lorenzo; Perrone, Daniele G.; Vindrola, Daniela; Negre, Michele; Piccone, Giuseppe

    2012-01-01

    Highlights: ► Municipal bio-wastes are a sustainable source of bio-based products. ► Refuse derived soluble bio-organics promote chlorophyll synthesis. ► Refuse derived soluble bio-organics enhance plant growth and fruit ripening rate. ► Sustainable chemistry exploiting urban refuse allows sustainable development. ► Chemistry, agriculture and the environment benefit from biowaste technology. - Abstract: Municipal bio-refuse (CVD), containing kitchen wastes, home gardening residues and public park trimmings, was treated with alkali to yield a soluble bio-organic fraction (SBO) and an insoluble residue. These materials were characterized using elemental analysis, potentiometric titration, and 13C NMR spectroscopy, and then applied as organic fertilizers to soil for tomato greenhouse cultivation. Their performance was compared with a commercial product obtained from animal residues. Plant growth, fruit yield and quality, and soil and leaf chemical composition were the selected performance indicators. The SBO exhibited the best performance by enhancing leaf chlorophyll content, improving plant growth and fruit ripening rate and yield. No product performance-chemical composition relationship could be assessed. Solubility could be one reason for the superior performance of SBO as a tomato growth promoter. The enhancement of leaf chlorophyll content is discussed to identify a possible link with the SBO photosensitizing properties that have been demonstrated in other work, and thus with photosynthetic performance.

  11. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  12. Localized Failure Promoted by Heterogeneous Stresses in Tectonic Mélanges

    Science.gov (United States)

    Phillips, N. J.; Rowe, C. D.; Ujiie, K.

    2017-12-01

    Within the shallow (PLC) toolbox developed at the University of Maine, which uses Asymptotic Expansion Homogenization (AEH) over a finite element mesh to determine the instantaneous stress distributions in a multiphase system. We model the shale matrix mélange to be deforming through a modified flow law for viscous creep based on coupled frictional sliding and pressure solution, where at a strain rate of 10-12 s-1 the flow stress is 10 MPa under the temperature (190 ºC) and pressure ( 100 MPa) conditions during deformation, and describe the behaviour of the basaltic blocks using experimentally-derived power law flow laws. The results show that at the strain rates calculated based on plate-rate motion, differential stresses high enough to cause comminution of the basalts ( 300 MPa) correspond strongly to areas around the blocks with basalt derived cataclasites. Within the basalt derived cataclasites, thin zones of ultracataclasite record localized slip. We hypothesize that the heterogeneous stress distributions within subduction mélanges: 1) fractures the strong basalt thereby facilitating weakening through fluid-rock interactions, and 2) promotes localized slip (and occasionally seismicity) within these zones of altered basalt along the margins of strong intact basalt.

  13. Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues

    OpenAIRE

    Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.

    2010-01-01

    MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...

  14. Construction of stably maintained non-mobilizable derivatives of RSF1010 lacking all known elements essential for mobilization

    Directory of Open Access Journals (Sweden)

    Tokmakova Irina L

    2007-11-01

    Full Text Available Abstract Background RSF1010 is a well-studied broad-host-range plasmid able to be mobilized to different bacteria and plants. RSF1010-derived plasmid vectors are widely used in both basic research and industrial applications. In the latter case, exploiting of mobilizable plasmids or even the plasmids possessing negligible mobilization frequency, but containing DNA fragments that could promote conjugal transfer, is undesirable because of biosafety considerations. Previously, several mutations significantly decreasing efficiency of RSF1010 mobilization have been selected. Nevertheless, construction of the RSF1010 derivative lacking all known loci involved in the conjugal transfer has not been reported yet. Results Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process have been obtained due to the exploiting of λRed-driven recombination between the plasmid and a constructed in vitro linear DNA fragment. To provide auto-regulated transcription of the essential replication gene, repB, the plasmid loci oriT, mobC and mobA were substituted by the DNA fragment containing PlacUV5→lacI. Mobilization of the obtained RSFmob plasmid was not detected in standard tests. The derivative of RSFmob with increased copy number has been obtained after lacI elimination. High stability of both constructed plasmids has been demonstrated in Escherichia coli and Pantoea ananatis. Design of RSFmob allows easy substitution of PlacUV5 by any desirable promoter for construction of novel derivatives with changed copy number or host range. Conclusion Novel non-mobilizable derivatives of RSF1010 lacking all known DNA sequences involved in the mobilization process and stably maintained at least in E. coli and P. ananatis have been constructed. The obtained plasmids became the progenitors of new cloning vectors answering all biosafety requirements of genetically modified organisms used in scale-up production.

  15. Characterization of goat inner cell mass derived cells in double kinase inhibition condition

    International Nuclear Information System (INIS)

    Wei, Qiang; Xi, Qihui; Liu, Xiaokun; Meng, Kai; Zhao, Xiaoe; Ma, Baohua

    2017-01-01

    The identification of small molecular inhibitors, which were reported to promote the derivation of mouse and human embryonic stem cells (ESCs), provides a potential strategy for the derivation of domesticated ungulate ESCs. In present study, goat inner cell mass (ICM) derived cells in the double inhibition (2i) condition, in which, mitogen-activated protein kinase kinase (MAP2K) and glycogen synthase kinase 3 (GSK3) were inhibited by PD0325901 and BIO respectively, were characterized. The results showed that goat ICM derived cells in 2i medium adding leukaemia inhibitor factor (LIF) possessed a mouse ES-like morphology. But these cells had much compromised proliferation capacity, resulting in difficulty in expansion. In 2i alone medium, goat ICM derived cells possessed primate ES-like morphology. These cells expressed pluripotent markers and could differentiate into derivatives of three germ layers in vitro. However, these cells could not be proliferated in long-term (persisted for 15 passages) because of spontaneously neural differentiation. Additionally, goat ICM derived cells could be inducing differentiated into neural lineage in vitro. Although goat ESCs could not be established in PD0325901 and BIO alone medium, this derivation condition provides a useful research system to find signaling molecular those regulate early embryonic development and pluripotency in goat. - Highlights: • Goat inner cell mass derived cells possessed finite pluripotency in 2i condition. • These cells could not be proliferated in long-term in 2i condition. • These cells could spontaneously and inductively differentiate into neural lineage.

  16. Effect of cigarette smoke on monocyte procoagulant activity: Focus on platelet-derived brain-derived neurotrophic factor (BDNF).

    Science.gov (United States)

    Amadio, Patrizia; Baldassarre, Damiano; Sandrini, Leonardo; Weksler, Babette B; Tremoli, Elena; Barbieri, Silvia S

    2017-01-01

    Cigarette smoke (CS) activates platelets, promotes vascular dysfunction, and enhances Tissue Factor (TF) expression in blood monocytes favoring pro-thrombotic states. Brain-derived neurotrophic factor (BDNF), a member of the family of neurotrophins involved in survival, growth, and maturation of neurons, is released by activated platelets (APLTs) and plays a role in the cardiovascular system. The effect of CS on circulating levels of BDNF is controversial and the function of circulating BDNF in atherothrombosis is not fully understood. Here, we have shown that human platelets, treated with an aqueous extract of CS (CSE), released BDNF in a dose-dependent manner. In addition, incubation of human monocytes with BDNF or with the supernatant of platelets activated with CSE increased TF activity by a Tropomyosin receptor kinase B (TrkB)-dependent mechanism. Finally, comparing serum and plasma samples of 12 male never smokers (NS) and 29 male active smokers (AS) we observed a significant increase in microparticle-associated TF activity (MP-TF) as well as BDNF in AS, while in serum, BDNF behaved oppositely. Taken together these findings suggest that platelet-derived BDNF is involved in the regulation of TF activity and that CS plays a role in this pathway by favoring a pro-atherothrombotic state.

  17. ESC-Derived BDNF-Overexpressing Neural Progenitors Differentially Promote Recovery in Huntington's Disease Models by Enhanced Striatal Differentiation

    Directory of Open Access Journals (Sweden)

    Tina Zimmermann

    2016-10-01

    Full Text Available Huntington's disease (HD is characterized by fatal motoric failures induced by loss of striatal medium spiny neurons. Neuronal cell death has been linked to impaired expression and axonal transport of the neurotrophin BDNF (brain-derived neurotrophic factor. By transplanting embryonic stem cell-derived neural progenitors overexpressing BDNF, we combined cell replacement and BDNF supply as a potential HD therapy approach. Transplantation of purified neural progenitors was analyzed in a quinolinic acid (QA chemical and two genetic HD mouse models (R6/2 and N171-82Q on the basis of distinct behavioral parameters, including CatWalk gait analysis. Explicit rescue of motor function by BDNF neural progenitors was found in QA-lesioned mice, whereas genetic mouse models displayed only minor improvements. Tumor formation was absent, and regeneration was attributed to enhanced neuronal and striatal differentiation. In addition, adult neurogenesis was preserved in a BDNF-dependent manner. Our findings provide significant insight for establishing therapeutic strategies for HD to ameliorate neurodegenerative symptoms.

  18. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  19. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  20. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Margarita Chumarina

    2017-03-01

    Full Text Available Mouse embryonic stem cell (mESC lines were derived by crossing heterozygous transgenic (tg mice expressing green fluorescent protein (GFP under the control of the rat tyrosine hydroxylase (TH promoter, with homozygous alpha-synuclein (aSYN mice expressing human mutant SNCAA53T under the control of the mouse Prion promoter (MoPrP, or wildtype (WT mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons.

  1. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  2. Suppression of autophagy by extracellular vesicles promotes myofibroblast differentiation in COPD pathogenesis

    Directory of Open Access Journals (Sweden)

    Yu Fujita

    2015-11-01

    Full Text Available Extracellular vesicles (EVs, such as exosomes and microvesicles, encapsulate proteins and microRNAs (miRNAs as new modulators of both intercellular crosstalk and disease pathogenesis. The composition of EVs is modified by various triggers to maintain physiological homeostasis. In response to cigarette smoke exposure, the lungs develop emphysema, myofibroblast accumulation and airway remodelling, which contribute to chronic obstructive pulmonary disease (COPD. However, the lung disease pathogenesis through modified EVs in stress physiology is not understood. Here, we investigated an EV-mediated intercellular communication mechanism between primary human bronchial epithelial cells (HBECs and lung fibroblasts (LFs and discovered that cigarette smoke extract (CSE-induced HBEC-derived EVs promote myofibroblast differentiation in LFs. Thorough evaluations of the modified EVs and COPD lung samples showed that cigarette smoke induced relative upregulation of cellular and EV miR-210 expression of bronchial epithelial cells. Using co-culture assays, we showed that HBEC-derived EV miR-210 promotes myofibroblast differentiation in LFs. Surprisingly, we found that miR-210 directly regulates autophagy processes via targeting ATG7, and expression levels of miR-210 are inversely correlated with ATG7 expression in LFs. Importantly, autophagy induction was significantly decreased in LFs from COPD patients, and silencing ATG7 in LFs led to myofibroblast differentiation. These findings demonstrate that CSE triggers the modification of EV components and identify bronchial epithelial cell-derived miR-210 as a paracrine autophagy mediator of myofibroblast differentiation that has potential as a therapeutic target for COPD. Our findings show that stressor exposure changes EV compositions as emerging factors, potentially controlling pathological disorders such as airway remodelling in COPD.

  3. Human adipose-derived mesenchymal stromal cell pigment epithelium-derived factor cytotherapy modifies genetic and epigenetic profiles of prostate cancer cells.

    Science.gov (United States)

    Zolochevska, Olga; Shearer, Joseph; Ellis, Jayne; Fokina, Valentina; Shah, Forum; Gimble, Jeffrey M; Figueiredo, Marxa L

    2014-03-01

    Adipose-derived mesenchymal stromal cells (ASCs) are promising tools for delivery of cytotherapy against cancer. However, ASCs can exert profound effects on biological behavior of tumor cells. Our study aimed to examine the influence of ASCs on gene expression and epigenetic methylation profiles of prostate cancer cells as well as the impact of expressing a therapeutic gene on modifying the interaction between ASCs and prostate cancer cells. ASCs were modified by lentiviral transduction to express either green fluorescent protein as a control or pigment epithelium-derived factor (PEDF) as a therapeutic molecule. PC3 prostate cancer cells were cultured in the presence of ASC culture-conditioned media (CCM), and effects on PC3 or DU145. Ras cells were examined by means of real-time quantitative polymerase chain reaction, EpiTect methyl prostate cancer-focused real-time quantitative polymerase chain reaction arrays, and luciferase reporter assays. ASCs transduced with lentiviral vectors were able to mediate expression of several tumor-inhibitory genes, some of which correlated with epigenetic methylation changes on cocultured PC3 prostate cancer cells. When PC3 cells were cultured with ASC-PEDF CCM, we observed a shift in the balance of gene expression toward tumor inhibition, which suggests that PEDF reduces the potential tumor-promoting activity of unmodified ASCs. These results suggest that ASC-PEDF CCM can promote reprogramming of tumor cells in a paracrine manner. An improved understanding of genetic and epigenetic events in prostate cancer growth in response to PEDF paracrine therapy would enable a more effective use of ASC-PEDF, with the goal of achieving safer yet more potent anti-tumor effects. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  4. Ginseng Berry Extract Promotes Maturation of Mouse Dendritic Cells.

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    Full Text Available Ginseng extract has been shown to possess certain anti-virus, anti-tumor and immune-activating effects. However, the immunostimulatory effect of ginseng berry extract (GB has been less well characterized. In this study, we investigated the effect of GB on the activation of mouse dendritic cells (DCs in vitro and in vivo. GB treatment induced up-regulation of co-stimulatory molecules in bone marrow-derived DCs (BMDCs. Interestingly, GB induced a higher degree of co-stimulatory molecule up-regulation than ginseng root extract (GR at the same concentrations. Moreover, in vivo administration of GB promoted up-regulation of CD86, MHC class I and MHC class II and production of IL-6, IL-12 and TNF-α in spleen DCs. GB also promoted the generation of Th1 and Tc1 cells. Furthermore, Toll like receptor 4 (TLR4 and myeloid differentiation primary response 88 (MyD88 signaling pathway were essential for DC activation induced by GB. In addition, GB strongly prompted the proliferation of ovalbumin (OVA-specific CD4 and CD8 T cells. Finally, GB induced DC activation in tumor-bearing mice and the combination of OVA and GB treatment inhibited B16-OVA tumor cell growth in C57BL/6 mice. These results demonstrate that GB is a novel tumor therapeutic vaccine adjuvant by promoting DC and T cell activation.

  5. NaHSO4-SiO2-Promoted Solvent-Free Synthesis of Benzoxazoles, Benzimidazoles, and Benzothiazole Derivatives

    Directory of Open Access Journals (Sweden)

    K. Ravi Kumar

    2013-01-01

    Full Text Available An efficient protocol has been developed for the preparation of a library of benzoxazole, benzimidazole, and benzothiazole derivatives from reactions of acyl chlorides with o-substituted aminoaromatics in the presence of catalytic amount of silica-supported sodium hydrogen sulphate under solvent-free conditions. Simple workup procedure, high yield, easy availability, reusability, and use of ecofriendly catalyst are some of the striking features of the present protocol.

  6. Promoting information diffusion through interlayer recovery processes in multiplex networks

    Science.gov (United States)

    Wang, Xin; Li, Weihua; Liu, Longzhao; Pei, Sen; Tang, Shaoting; Zheng, Zhiming

    2017-09-01

    For information diffusion in multiplex networks, the effect of interlayer contagion on spreading dynamics has been explored in different settings. Nevertheless, the impact of interlayer recovery processes, i.e., the transition of nodes to stiflers in all layers after they become stiflers in any layer, still remains unclear. In this paper, we propose a modified ignorant-spreader-stifler model of rumor spreading equipped with an interlayer recovery mechanism. We find that the information diffusion can be effectively promoted for a range of interlayer recovery rates. By combining the mean-field approximation and the Markov chain approach, we derive the evolution equations of the diffusion process in two-layer homogeneous multiplex networks. The optimal interlayer recovery rate that achieves the maximal enhancement can be calculated by solving the equations numerically. In addition, we find that the promoting effect on a certain layer can be strengthened if information spreads more extensively within the counterpart layer. When applying the model to two-layer scale-free multiplex networks, with or without degree correlation, similar promoting effect is also observed in simulations. Our work indicates that the interlayer recovery process is beneficial to information diffusion in multiplex networks, which may have implications for designing efficient spreading strategies.

  7. Global Derivatives

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    approaches to dealing in the global business environment." - Sharon Brown-Hruska, Commissioner, Commodity Futures Trading Commission, USA. "This comprehensive survey of modern risk management using derivative securities is a fine demonstration of the practical relevance of modern derivatives theory to risk......" provides comprehensive coverage of different types of derivatives, including exchange traded contracts and over-the-counter instruments as well as real options. There is an equal emphasis on the practical application of derivatives and their actual uses in business transactions and corporate risk...... management situations. Its key features include: derivatives are introduced in a global market perspective; describes major derivative pricing models for practical use, extending these principles to valuation of real options; practical applications of derivative instruments are richly illustrated...

  8. Novel Apo E-Derived ABCA1 Agonist Peptide (CS-6253 Promotes Reverse Cholesterol Transport and Induces Formation of preβ-1 HDL In Vitro.

    Directory of Open Access Journals (Sweden)

    Anouar Hafiane

    Full Text Available Apolipoprotein (apo mimetic peptides replicate some aspects of HDL function. We have previously reported the effects of compound ATI-5261 on its ability to replicate many functions of native apo A-I in the process of HDL biogenesis. ATI-5261 induced muscle toxicity in wild type C57Bl/6 mice, increased CPK, ALT and AST and increase in triglyceride (Tg levels. Aromatic phenylalanine residues on the non-polar face of ATI-5261, together with positively charged arginine residues at the lipid-water interface were responsible for these effects. This information was used to create a novel analog (CS-6253 that was non-toxic. We evaluated this peptide designed from the carboxyl terminus of apo E, in its ability to mimic apo A-I functionality. Our data shows that the lipidated particles generated by incubating cells overexpressing ABCA1 with lipid free CS-6253 enhances the rate of ABCA1 lipid efflux with high affinity interactions with native ABCA1 oligomeric forms and plasma membrane micro-domains. Interaction between ABCA1 and lipid free CS-6253 resulted in formation of nascent HDL-CS-6253 particles that are actively remodeled in plasma. Mature HDL-CS-6253 particles deliver cholesterol to liver cells via SR-BI in-vitro. CS-6253 significantly increases cholesterol efflux in murine macrophages and in human THP-1 macrophage-derived foam cells expressing ABCA1. Addition of CS-6253 to plasma dose-dependently displaced apo A-I from α-HDL particles and led to de novo formation of preβ-1 HDL that stimulates ABCA1 dependent cholesterol efflux efficiently. When incubated with human plasma CS-6253 was also found to bind with HDL and LDL and promoted the transfer of cholesterol from HDL to LDL predominantly. Our data shows that CS-6253 mimics apo A-I in its ability to promote ABCA1-mediated formation of nascent HDL particles, and enhances formation of preβ-1 HDL with increase in the cycling of apo A-I between the preβ and α-HDL particles in-vitro. These

  9. Enhanced Li-O_2 battery performance, using graphene-like nori-derived carbon as the cathode and adding LiI in the electrolyte as a promoter

    International Nuclear Information System (INIS)

    Zeng, Xiaoyuan; Leng, Limin; Liu, Fangfang; Wang, Guanghua; Dong, Yuanyuan; Du, Li; Liu, Lina; Liao, Shijun

    2016-01-01

    Highlights: • Graphene-like nori-derived carbon was prepared as a new cathode of Li-O_2 battery. • The battery showed superior round-trip efficiency and good cycling stability. • The NORI catalyst with LiI dramatically enhanced the performance of Li-O_2 battery. • The added LiI changed the morphology and chemical nature of the discharge products. - Abstract: To rapidly promote the development of electric vehicles, an efficient cathode catalyst for Li-O_2 batteries is urgently needed. In the present study, we prepared a new type of doped carbon catalyst derived from nori biomass for the cathode of Li-O_2 batteries, using a hydrothermal carbonization and pyrolysis method. The catalyst presented a graphene-like nanosheet structure, a high surface area, and excellent ORR/OER activity. Li-O_2 batteries with this catalyst exhibited superior round-trip efficiency (at current densities of 500 mA/g, the corresponding coulombic efficiency was 99.8%) and excellent cycling stability (100 stable cycles at 200 mA/g under capacity limitation). Furthermore, the charge–discharge overpotential could be reduced dramatically by adding LiI to the electrolyte, resulting in greatly enhanced battery performance. The battery’s energy efficiency was over 90%, even after 100 cycles at limited capacity. We concluded the following: (i) the high surface area and nanosheet structure of the nori catalyst provided sufficient space not only to accommodate the discharge products but also to guarantee that oxygen, soluble catalyst, and lithium ions could be freely transported; and (ii) these combined with the redox mediator LiI that was added to the electrolyte, which could freely access the interior of the air electrode, easily reacting with the solid discharge products and effectively changing the morphology and chemical nature of the discharge products. We believe these factors were responsible for the significantly enhanced performance of the resulting Li-O_2 batteries, suggesting

  10. Adipose-derived adult stem cells: available technologies for potential clinical regenerative applications in dentistry.

    Science.gov (United States)

    Catalano, Enrico; Cochis, Andrea; Varoni, Elena; Rimondini, Lia; Carrassi, Antonio; Azzimonti, Barbara

    2013-01-01

    Tissue homeostasis depends closely on the activity and welfare of adult stem cells. These cells represent a promising tool for biomedical research since they can aid in treatment and promote the regeneration of damaged organs in many human disorders. Adult stem cells indefinitely preserve their ability to self-renew and differentiate into various phenotypes; this capacity could be promoted in vitro by particular culture conditions (differentiation media) or spontaneously induced in vivo by exploiting the biochemical and mechanical properties of the tissue in which the stem cells are implanted. Among the different sources of adult stem cells, adipose tissue is an attractive possibility thanks to its ready availability and the standard extraction techniques at our disposal today. This review discusses the isolation, characterization, and differentiation of human adipose-derived adult stem cells, as well as regeneration strategies, therapeutic uses, and adverse effects of their delivery. In particular, since oral disorders (e.g., trauma, erosion, and chronic periodontitis) often cause the loss of dental tissue along with functional, phonetic, and aesthetic impairment, this review focuses on the application of human adipose-derived adult stem cells, alone or in combination with biomaterials, in treating oral diseases.

  11. Effect of Cell Seeding Density and Inflammatory Cytokines on Adipose Tissue-Derived Stem Cells: an in Vitro Study

    NARCIS (Netherlands)

    Sukho, P. (Panithi); J. Kirpensteijn (Jolle); Hesselink, J.W. (Jan Willem); G.J.V.M. van Osch (Gerjo); F. Verseijden (Femke); Y.M. Bastiaansen-Jenniskens (Yvonne)

    2017-01-01

    textabstractAdipose tissue-derived stem cells (ASCs) are known to be able to promote repair of injured tissue via paracrine factors. However, the effect of cell density and inflammatory cytokines on the paracrine ability of ASCs remains largely unknown. To investigate these effects, ASCs were

  12. Exosomes derived from hypoxic epithelial ovarian cancer deliver microRNA-940 to induce macrophage M2 polarization.

    Science.gov (United States)

    Chen, Xin; Ying, Xiang; Wang, Xinjing; Wu, Xiaoli; Zhu, Qinyi; Wang, Xipeng

    2017-07-01

    Hypoxia is a common feature of solid tumors. It is closely related to tumor progression. Exosomal microRNAs derived from cancers are considered to be mediators between cancer cells and the tumor microenvironment. In addition, the number of tumor-associated macrophages (TAMs) in the tumor microenvironment has also been demonstrated to correlate with tumor development. However, the relationship between tumor-secreted exosomes and TAM polarization under hypoxic conditions during tumor progression is not clear. Herein, we demonstrated that hypoxia induces the high expression of microRNA-940 (miR‑940) in exosomes derived from epithelial ovarian cancer (EOC). We also found that miR‑940 is highly expressed in exosomes isolated from ascites of EOC patients. Moreover, the overexpression of miR‑940 in macrophages delivered by exosomes stimulated M2 phenotype polarization, while the M2 subtype macrophages promoted EOC proliferation and migration. These results highlight the function of hypoxia in enhancing the high level of expression of miR‑940 in tumor exosomes taken up by macrophages. We also showed that the tumor-promoting function of miR‑940 is mediated by TAM polarization in EOC. These findings show that tumor-derived exosomal miR‑940 induced by hypoxia plays an important role in stimulating TAM polarization in the progression of EOC.

  13. Removal of 2,4-dichlorophenol and pentachlorophenol from waters by sorption using coal fly ash from a Portuguese thermal power plant

    International Nuclear Information System (INIS)

    Estevinho, Berta N.; Martins, Isabel; Ratola, Nuno; Alves, Arminda; Santos, Lucia

    2007-01-01

    Chlorophenols are one of the most important groups of priority pollutants, due to their high toxicity, mutagenicity and carcinogenicity. Although activated carbon has been the preferred choice for the removal of such pollutants from wastewaters, the search for cheaper alternative sorbents became common in the last years. Fly ash, a by-product from coal burning power plants, has a surface composition that may enable the sorption of specific organic compounds. Therefore, this feasibility study presents the optimization of the operating parameters of a fixed-bed column containing fly ash particles, percolated by aqueous solutions of 2,4-dichlorophenol (2,4-DCP) and pentachlorophenol (PCP) with concentrations of 1 and 100 μg/ml. Both chlorophenols were analysed by gas chromatography with electron capture detection (GC-ECD), after solid-phase microextraction (SPME), with limits of detection (LODs) of 7.28 μg/l for 2,4-DCP and 1.76 μg/l for PCP. Removal efficiencies above 99% were obtained for an initial concentration of 10 μg/ml of chlorophenols. Column saturation was achieved after 7 h of continuous operation for 2,4-DCP and 10 h for the PCP for feed levels of 10 μg/ml. Fly ash exhibited more affinity towards the sorption of PCP, in comparison to 2,4-DCP

  14. Chlorination Revisited: Does Cl- Serve as a Catalyst in the Chlorination of Phenols?

    Science.gov (United States)

    Lau, Stephanie S; Abraham, Sonali M; Roberts, A Lynn

    2016-12-20

    The aqueous chlorination of (chloro)phenols is one of the best-studied reactions in the environmental literature. Previous researchers have attributed these reactions to two chlorine species: HOCl (at circum-neutral and high pH) and H 2 OCl + (at low pH). In this study, we seek to examine the roles that two largely overlooked chlorine species, Cl 2 and Cl 2 O, may play in the chlorination of (chloro)phenols. Solution pH, chloride concentration, and chlorine dose were systematically varied in order to assess the importance of different chlorine species as chlorinating agents. Our findings indicate that chlorination rates at pH pH 6.0 and a chlorine dose representative of drinking water treatment, Cl 2 O is predicted to have at best a minor impact on chlorination reactions, whereas Cl 2 may contribute more than 80% to the overall chlorination rate depending on the (chloro)phenol identity and chloride concentration. While it is not possible to preclude H 2 OCl + as a chlorinating agent, we were able to model our low-pH data by considering Cl 2 only. Even traces of chloride can generate sufficient Cl 2 to influence chlorination kinetics, highlighting the role of chloride as a catalyst in chlorination reactions.

  15. Therapeutic Potential of Mesenchymal Stem Cell-Derived Exosomes in the Treatment of Eye Diseases.

    Science.gov (United States)

    Harrell, C Randall; Simovic Markovic, Bojana; Fellabaum, Crissy; Arsenijevic, Aleksandar; Djonov, Valentin; Arsenijevic, Nebojsa; Volarevic, Vladislav

    2018-05-18

    Mesenchymal stem cells (MSCs) were, due to their immunomodulatory and pro-angiogenic characteristics, extensively explored as new therapeutic agents in cell-based therapy of uveitis, glaucoma, retinal and ocular surface diseases.Since it was recently revealed that exosomes play an important role in biological functions of MSCs, herewith we summarized current knowledge about the morphology, structure, phenotype and functional characteristics of MSC-derived exosomes emphasizing their therapeutic potential in the treatment of eye diseases.MSC-derived exosomes were as efficient as transplanted MSCs in limiting the extent of eye injury and inflammation. Immediately after intravitreal injection, MSC-derived exosomes, due to nano-dimension, diffused rapidly throughout the retina and significantly attenuated retinal damage and inflammation. MSC-derived exosomes successfully delivered trophic and immunomodulatory factors to the inner retina and efficiently promoted survival and neuritogenesis of injured retinal ganglion cells. MSC-derived exosomes efficiently suppressed migration of inflammatory cells, attenuated detrimental Th1 and Th17 cell-driven immune response and ameliorated experimental autoimmune uveitis. MSC-derived exosomes were able to fuse with the lysosomes within corneal cells, enabling delivering of MSC-derived active β-glucuronidase and consequent catabolism of accumulated glycosaminoglycans, indicating their therapeutic potential in the treatment of Mucopolysaccharidosis VII (Sly Syndrome). Importantly, beneficent effects were noticed only in animals that received MSC-derived exosomes and were not seen after therapy with fibroblasts-derived exosomes confirming specific therapeutic potential of MSCs and their products in the treatment of eye diseases.In conclusion, MSC-derived exosomes represent potentially new therapeutic agents in the therapy of degenerative and inflammatory ocular diseases.

  16. Streamlining Appointment, Promotion, and Tenure Procedures to Promote Early-Career Faculty Success.

    Science.gov (United States)

    Smith, Shannon B; Hollerbach, Ann; Donato, Annemarie Sipkes; Edlund, Barbara J; Atz, Teresa; Kelechi, Teresa J

    2016-01-01

    A critical component of the progression of a successful academic career is being promoted in rank. Early-career faculty are required to have an understanding of appointment, promotion, and tenure (APT) guidelines, but many factors often impede this understanding, thwarting a smooth and planned promotion pathway for professional advancement. This article outlines the steps taken by an APT committee to improve the promotion process from instructor to assistant professor. Six sigma's DMAIC improvement model was selected as the guiding operational framework to remove variation in the promotion process. After faculty handbook revisions were made, several checklists developed, and a process review rubric was implemented; recently promoted faculty were surveyed on satisfaction with the process. Faculty opinions captured in the survey suggest increased transparency in the process and perceived support offered by the APT committee. Positive outcomes include a strengthened faculty support framework, streamlined promotion processes, and improved faculty satisfaction. Changes to the APT processes resulted in an unambiguous and standardized pathway for successful promotion. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Photocatalytic oxidation of organic compounds via waveguide-supported titanium dioxide films

    Science.gov (United States)

    Miller, Lawrence W.

    A photochemical reactor based on titanium dioxide (TiO2)-coated silica optical fibers was constructed to explore the use of waveguide-supported TiO2 films for photocatalytic oxidation of organic compounds. The reactor was used for the photocatalytic oxidation of 4-chlorophenol in water. It was confirmed that TiO2 films could be securely attached to silica optical fibers. The 4-chlorophenol (100 mumol/L in water) was successfully oxidized on the TiO2 surface when UV light (310 nm--380 nm) was propagated through the fibers to the films. Rates of 4-chlorophenol oxidation and UV light flux to the fibers were measured. The quantum efficiency of 4-chlorophenol oxidation [defined as the change in 4-chlorophenol concentration divided by the UV light absorbed by the catalyst] was determined as a function of TiO2 catalyst film thickness and internal incident angle of propagating UV light. A maximum quantum efficiency of 2.8% was measured when TiO2 film thickness was ca. 80 nm and the maximum internal incident angle of propagating light was 84°. Quantum efficiency increased with increasing internal angle of incidence of propagating light and decreased with TiO2 film thickness. UV-Visible internal reflection spectroscopy was used to determine whether UV light propagated through TiO2-coated silica waveguides in an ATR mode. Propagation of UV light in an ATR mode was confirmed by the similarities between internal reflection spectra of phenolphthalein obtained with uncoated and TiO2-coated silica crystals. Planar silica waveguides coated with TiO2 were employed in a photocatalytic reactor for the oxidation of formic acid (833 mumol/L in water). It was shown that the quantum yield of formic acid oxidation [defined as the moles of formic acid oxidized divided by the moles of UV photons absorbed by the catalyst] on the waveguide-supported TiO2 surface is enhanced when UV light propagates through the waveguides in an ATR mode. A maximum quantum yield of 3.9% was found for formic

  18. Erythropoietin promotes network formation of transplanted adipose tissue-derived microvascular fragments

    Directory of Open Access Journals (Sweden)

    P Karschnia

    2018-05-01

    Full Text Available The seeding of tissue constructs with adipose tissue-derived microvascular fragments (ad-MVF is an emerging pre-vascularisation strategy. Ad-MVF rapidly reassemble into new microvascular networks after in vivo implantation. Herein it was analysed whether this process was improved by erythropoietin (EPO. Ad-MVF were isolated from green fluorescent protein (GFP+ as well as wild-type C57BL/6 mice and cultivated for 24 h in medium supplemented with EPO (20 IU/mL or vehicle. Freshly isolated, non-cultivated ad-MVF served as controls. Protein expression, cell viability and proliferation of ad-MVF were assessed by proteome profiler array and fluorescence microscopy. GFP+ ad-MVF were seeded on collagen-glycosaminoglycan matrices, which were implanted into dorsal skinfold chambers of C57BL/6 mice, to analyse their vascularisation over 14 d by intravital fluorescence microscopy, histology and immunohistochemistry. Cultivation up-regulated the expression of pro- and anti-angiogenic factors within both vehicle- and EPO-treated ad-MVF when compared with non-cultivated controls. Moreover, EPO treatment suppressed cultivation-associated apoptosis and significantly increased the number of proliferating endothelial cells in ad-MVF when compared with vehicle-treated and non-cultivated ad-MVF. Accordingly, implanted matrices seeded with EPO-treated ad-MVF exhibited an improved vascularisation, as indicated by a significantly higher functional microvessel density. The matrices of the three groups contained a comparably large fraction of GFP+ microvessels originating from the ad-MVF, whereas the tissue surrounding the matrices seeded with EPO-treated ad-MVF exhibited a significantly increased microvessel density when compared with the other two groups. These findings indicated that EPO represents a promising cytokine to further boost the excellent vascularisation properties of ad-MVF in tissue-engineering applications.

  19. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    International Nuclear Information System (INIS)

    Yu, Ge; Wan, Rong; Hu, Yanling; Ni, Jianbo; Yin, Guojian; Xing, Miao; Shen, Jie; Tang, Maochun; Chen, Congying; Fan, Yuting; Xiao, Wenqin; Zhao, Yan; Wang, Xingpeng

    2014-01-01

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway

  20. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ge [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wan, Rong [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Hu, Yanling [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Ni, Jianbo [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Yin, Guojian; Xing, Miao [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Shen, Jie [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Tang, Maochun [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Chen, Congying [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Fan, Yuting; Xiao, Wenqin; Zhao, Yan [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wang, Xingpeng, E-mail: wangxingpeng@hotmail.com [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); and others

    2014-01-31

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway.