Characteristics of chitinase isolated from different part of snakehead fish (Channa striata) digestive tract

Science.gov (United States)

Baehaki, A.; Lestari, S. D.; Wahidman, Y.; Gofar, N.

2018-01-01

Naturally, snakehead fish (Channa striata) is a prodigious carnivore feeding mainly on live animals, including small shrimp. Based on its feeding habits, the digestrive tracts of snakehead is considered as auspicious source of various enzumes including chitinase. The purpose of this study was to partially characterize chitinase enzyme isolated from digestive tract of snakehead fish. Two parts of digestive tract, stomach and intestine were used as enzymes’ source. The results showed that chitinase activity from the stomach was higher than chitinase activity from the intestine. The pH and temperature optimum of chitinase activity from digestive tract (the stomach and the intestine) were 6.0 and 70 °C, respectively.

Chitinase and chitin synthase 1: counterbalancing activities in cell separation of Saccharomyces cerevisiae.

Science.gov (United States)

Cabib, E; Silverman, S J; Shaw, J A

1992-01-01

Previous results [E. Cabib, A. Sburlati, B. Bowers & S. J. Silverman (1989) Journal of Cell Biology 108, 1665-1672] strongly suggested that the lysis observed in daughter cells of Saccharomyces cerevisiae defective in chitin synthase 1 (Chs1) was caused by a chitinase that partially degrades the chitin septum in the process of cell separation. Consequently, it was proposed that in wild-type cells, Chs1 acts as a repair enzyme by replenishing chitin during cytokinesis. The chitinase requirement for lysis has been confirmed in two different ways: (a) demethylallosamidin, a more powerful chitinase inhibitor than the previously used allosamidin, is also a much better protector against lysis and (b) disruption of the chitinase gene in chs1 cells eliminates lysis. Reintroduction of a normal chitinase gene, by transformation of those cells with a suitable plasmid, restores lysis. The percentage of lysed cells in strains lacking Chs1 was not increased by elevating the chitinase level with high-copy-number plasmids carrying the hydrolase gene. Furthermore, the degree of lysis varied in different chs1 strains; lysis was abolished in chs1 mutants containing the scs1 suppressor. These results indicate that, in addition to chitinase, lysis requires other gene products that may become limiting.

Chitinase from phaseolus vulgaris leaves

International Nuclear Information System (INIS)

Boller, T.; Gehri, A.; Mauch, F.; Vogeli, V.

1988-01-01

This paper examines the effect of ethylene on chitinase activity in bean leaves. The authors have purified the enzyme in the course of their work. The purification method is detailed and the colorimetric and radiochemical assays are compared

Chitinase activity of Pseudomonas stutzeri PT5 in different fermentation condition

Science.gov (United States)

Chalidah, N.; Khotimah, I. N.; Hakim, A. R.; Meata, B. A.; Puspita, I. D.; Nugraheni, P. S.; Ustadi; Pudjiraharti, S.

2018-03-01

This study aimed to determine the incubation condition of Pseudomonas stutzeri PT5 in producing chitin degrading enzyme in various pH and temperatures; to compare the production of chitin degrading enzyme in chitin medium supplemented with additional nitrogen, carbon and a mixture of nitrogen and carbon sources and to observe the production of chitin degrading enzyme in 250 mL-shake flasks and 2 L-fermentor. The parameters tested during production were chitinase activity (U·mL-1) of culture supernatant and N-acetylglucosamine concentration (μg·mL-1) in the medium. The results showed that Pseudomonas stutzeri PT5 was able to produce the highest chitinase activity at pH 6 and temperature of 37 °C (0.024 U·mL-1). The addition of 0.1 % of ammonium phosphate and 0.1 % of maltose, increased the chitinase activity of Pseudomonas stutzeri PT5 by 3.24 and 8.08 folds, respectively, compared to the control. The addition of 0.1 % ammonium phosphate and 0.1 % maltose mixture to chitin medium resulted in the shorter time of chitinase production compared to the addition of sole nutrition. The production of chitinase using 2 L-fermentor shows that the highest chitinase activity produced by Pseudomonas stutzeri PT5 was reached at 1-day incubation (0.0283 U·mL-1), which was shorter than in 250 mL-shake flasks.

Chitinase production by Bacillus thuringiensis and Bacillus licheniformis: their potential in antifungal biocontrol.

Science.gov (United States)

Gomaa, Eman Zakaria

2012-02-01

Thirty bacterial strains were isolated from the rhizosphere of plants collected from Egypt and screened for production of chitinase enzymes. Bacillus thuringiensis NM101-19 and Bacillus licheniformis NM120-17 had the highest chitinolytic activities amongst those investigated. The production of chitinase by B. thuringiensis and B. licheniformis was optimized using colloidal chitin medium amended with 1.5% colloidal chitin, with casein as a nitrogen source, at 30°C after five days of incubation. An enhancement of chitinase production by the two species was observed by addition of sugar substances and dried fungal mats to the colloidal chitin media. The optimal conditions for chitinase activity by B. thuringiensis and B. licheniformis were at 40°C, pH 7.0 and pH 8.0, respectively. Na(+), Mg(2+), Cu(2+), and Ca(2+) caused enhancement of enzyme activities whereas they were markedly inhibited by Zn(2+), Hg(2+), and Ag(+). In vitro, B. thuringiensis and B. licheniformis chitinases had potential for cell wall lysis of many phytopathogenic fungi tested. The addition of B. thuringiensis chitinase was more effective than that of B. licheniformis in increasing the germination of soybean seeds infected with various phytopathogenic fungi.

Purification, characterization and antimicrobial activity of chitinase from marine-derived Aspergillus terreus

Directory of Open Access Journals (Sweden)

Aida M. Farag

2016-06-01

Full Text Available Chitinase (EC 3.2.1.14 was produced from the culture filtrate of marine-derived Aspergillus terreus and purified by 65% ammonium sulphate precipitation, followed by gel filtration on Sephadex G-100 and DEAE-Sephadex A-50 ion exchange chromatography, with 5.16-fold of purification and specific activity of 182.08 U/mg protein. The molecular weight of the purified chitinase was 60 kDa, determined by a sodium dodecyl sulphate polyacrylamide gel electrophoresis. The optimum pH and temperature of purified chitinase were 5.6 and 50 °C, respectively. The chitinase enzyme was stable from pH 5 to 7.5 and stable up to 70 °C. The effect of activators and inhibitors was studied, Hg+, pb, EDTA, ethanol, methanol and acetone strongly inhibited the enzyme activity, while, metal ions such as Ca2+, Mn2+ and Na2+ highly increased chitinase activity. The purified chitinase produced by A. terreus inhibited the growth of Aspergillus niger, Aspergillus oryzae, Penicillum oxysporium, Rhizocotonia solani, Candida albicans and Fusarium solani, while did not inhibit the growth of Rhizopus oryzae. Moreover, the purified enzyme had antibacterial effects against some pathogenic bacteria such as; Staphylococcus aureus, Salmonella typhi and Pseudomonas aeruginosa, while, it had not any activity against Escherichia coli, Aeromonas hydrophila and Photobacterium damsela.

In silico Identification of Novel Chitinase-Like Proteins in the Silkworm, Bombyx mori, Genome

Science.gov (United States)

Pan, Ye; Lü, Peng; Wang, Yong; Yin, Lijing; Ma, Hexiang; Ma, Guohong; Chen, Keping; He, Yuanqing

2012-01-01

In insects, chitinases participate in the periodic shedding of old exoskeletons and the turnover of peritrophic membranes. Chitinase family members have been identified in dozens of species, including Tribolium castaneum, Drosophila melanogaster, and Anopheles gambiae. In this study, nine chitinases and three hypothetical chitinases have been identified in Bombyx mori L. (Lepidoptera: Bombycidae) through genome-wide searching. Phylogenetic analyses revealed that seven of them belong to the seven chitinase groups, respectively. BmCht25 and BmCht26 could not be grouped into the known chitinase groups, and might belong to two new groups of the chitinase family. BmCht10, BmCht25, and BmIDGF have glutamate amino acid substitutions in the active catalytic domain. Only BmCht5 and BmCht10 contain CBD domain and PEST sequences (rich in proline, glutamic acid, serine, and threonine). BmCht5 and BmCht26 are located on chromosome 7, and others (BmCht6, BmCht7, BmCht10, BmCht11, BmCht20, BmIDGF) are located on separate chromosomes of Bombyx mori, respectively. The present study provides important background information for future studies using Bombyx mori as a model organism for insect development and virus and host interaction. PMID:23461297

Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

Science.gov (United States)

Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

2016-09-01

Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. Copyright © 2016 Elsevier B.V. All rights reserved.

Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding.

Directory of Open Access Journals (Sweden)

Hai Li

2010-01-01

Full Text Available Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function.Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain.Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A.

Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides

NARCIS (Netherlands)

Ghauharali-van der Vlugt, Karen; Bussink, Anton P.; Groener, Johanna E. M.; Boot, Rolf G.; Aerts, Johannes M. F. G.

2009-01-01

Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection.

Cloning of the Bacillus thuringiensis serovar sotto chitinase (Schi gene and characterization of its protein

Directory of Open Access Journals (Sweden)

Wan-Fang Zhong

2005-12-01

Full Text Available Chitinase plays a positive role in the pathogenicity of Bacillus thuringiensis to insect pests. We used touchdown PCR to clone the chitinase (Schi gene from Bacillus thuringiensis serovar sotto (Bt sotto chromosomal DNA. Our DNA sequencing analysis revealed that the Bt sotto Schi gene consists of an open reading frame (ORF of 2067 nucleotides with codes for the chitinase precursor. We also found that the putative promoter consensus sequences (the -35 and -10 regions of the Bt soto Schi gene are identical to those of the chiA71 gene from Bt Pakistani, the chiA74 gene from Bt kenyae and the ichi gene from Bt israelensis. The Schi chitinase precursor is 688 amino acids long with an estimated molecular mass of 75.75 kDa and a theoretical isoelectric point of 5.74, and contains four domains, which are, in sequence, a signal peptide, an N-terminal catalytic domain, a fibronectin type III like domain and a C-terminal chitin-binding domain. Sequence comparison and the evolutionary relationship of the Bt sotto Schi chitinase to other chitinase and chitinase-like proteins are also discussed.

A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

Science.gov (United States)

Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

2018-08-01

Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular modeling of human acidic mammalian chitinase in complex with the natural-product cyclopentapeptide chitinase inhibitor argifin.

Science.gov (United States)

Gouda, Hiroaki; Terashima, Shinichi; Iguchi, Kanami; Sugawara, Akihiro; Saito, Yoshifumi; Yamamoto, Tsuyoshi; Hirose, Tomoyasu; Shiomi, Kazuro; Sunazuka, Toshiaki; Omura, Satoshi; Hirono, Shuichi

2009-09-01

Human acidic mammalian chitinase (hAMCase) is an attractive target for developing anti-asthma medications. We used a variety of computational methods to investigate the interaction between hAMCase and the natural-product cyclopentapeptide chitinase inhibitor argifin. The three-dimensional structure of hAMCase was first constructed using homology modeling. The interaction mode and binding free energy between argifin and hAMCase were then examined by the molecular-docking calculation and the molecular mechanics Poisson-Boltzmann surface area method combined with molecular dynamics simulation, respectively. The results suggested that argifin binds to hAMCase in a similar fashion to the interaction mode observed in the crystal structure of argifin-human chitotriosidase complex, and possesses inhibitory activity against hAMCase in the micromolar range. We further designed argifin derivatives expected to be selective for hAMCase.

Cloning and characterization of a pathogen-induced chitinase in Brassica napus

DEFF Research Database (Denmark)

Rasmussen, U.; Bojsen, K.; Collinge, D.B.

1992-01-01

A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

Chitinase mRNA levels by quantitative PCR using the single standard DNA: acidic mammalian chitinase is a major transcript in the mouse stomach.

Directory of Open Access Journals (Sweden)

Misa Ohno

Full Text Available Chitinases hydrolyze the β-1-4 glycosidic bonds of chitin, a major structural component of fungi, crustaceans and insects. Although mammals do not produce chitin or its synthase, they express two active chitinases, chitotriosidase (Chit1 and acidic mammalian chitinase (AMCase. These mammalian chitinases have attracted considerable attention due to their increased expression in individuals with a number of pathological conditions, including Gaucher disease, Alzheimer's disease and asthma. However, the contribution of these enzymes to the pathophysiology of these diseases remains to be determined. The quantification of the Chit1 and AMCase mRNA levels and the comparison of those levels with the levels of well-known reference genes can generate useful and biomedically relevant information. In the beginning, we established a quantitative real-time PCR system that uses standard DNA produced by ligating the cDNA fragments of the target genes. This system enabled us to quantify and compare the expression levels of the chitinases and the reference genes on the same scale. We found that AMCase mRNA is synthesized at extraordinarily high levels in the mouse stomach. The level of this mRNA in the mouse stomach was 7- to 10-fold higher than the levels of the housekeeping genes and was comparable to that the level of the mRNA for pepsinogen C (progastricsin, a major component of the gastric mucosa. Thus, AMCase mRNA is a major transcript in mouse stomach, suggesting that AMCase functions as a digestive enzyme that breaks down polymeric chitin and as part of the host defense against chitin-containing pathogens in the gastric contents. Our methodology is applicable to the quantification of mRNAs for multiple genes across multiple specimens using the same scale.

Characterization of a novel chitinase from a moderately halophilic bacterium, Virgibacillus marismortui strain M3-23

OpenAIRE

Essghaier, Badiaa; Hedi, Abdeljabbar; Bajji, Mohammed; Jijakli, Haissam; Boudabous, Abdellatif; Sadfi-Zouaoui, Najla

2012-01-01

A new chitinase produced by the moderately halophilic bacterium Virgibacillus marismortui strain M3- 23 was identified and characterized. Distinguishable characteristics of high activity and stability at different pH, temperatures and salinity of M3-23 chitinase are reported. Analysis of the catalytic domain sequence from the enzyme highlighted its relationship to glycosyl hydrolase family 18. Comparison of the deduced chitinase sequence from strain M3-23 to known chitinases from Bacillus spe...

An investigation of a defensive chitinase against Fusarium oxysporum in pepper leaf tissue

Directory of Open Access Journals (Sweden)

Khemika S. Lomthaisong

2008-01-01

Full Text Available Plant chitinase is classified as a PR-protein involved in a defense mechanism against a pathogen. This research aims to investigate a specific type of chitinase which is produced by pepper in response to an early defense against Fusarium oxysporum, which causes wilt disease. The changes of chitinase isozyme patterns in the inter- and intracellular fluids in the leaf of four cultivars of pepper (Capsicum annuum L. at day 1, 3, 5, 7 and 10 from fungal inoculation were analysed using SDS-PAGE in polyacrylamide gel supplemented with glycol chitin as a substrate. The levels of disease severity in the four varieties of pepper were also compared with the isozyme patterns. The results showed that the resistance of pepper to F. oxysporum attack corresponded to the expression of ~70 kDa chitinase band (Chi-3 in the intercellular fluid. Therefore, such chitinase could possibly be used as a protein marker to identify the tolerant line and as a springboard for further study of wilt disease control.

Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

Directory of Open Access Journals (Sweden)

Saliou Niassy

2013-01-01

Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

Cerebrospinal fluid chitinase-3-like 2 and chitotriosidase are potential prognostic biomarkers in early multiple sclerosis

DEFF Research Database (Denmark)

Møllgaard, M; Degn, M; Sellebjerg, F

2016-01-01

: In a prospective cohort of 73 patients with ON as a first demyelinating episode and 26 age-matched healthy controls levels of CHI3L2 and chitotriosidase in CSF were explored by enzyme-linked immunosorbent assay. Associations with magnetic resonance imaging white matter lesions, CSF oligoclonal bands......BACKGROUND AND PURPOSE: The role of chitinases and chitinase-like proteins in multiple sclerosis (MS) is currently unknown; however, cerebrospinal fluid (CSF) levels of chitinase 3-like 1 (CHI3L1) predict prognosis in early MS. Whether this applies to other chitinases and chitinase-like proteins...... is yet to be established. Our objective was to investigate the potential of chitinase 3-like 2 (CHI3L2) and chitotriosidase as prognostic biomarkers in optic neuritis (ON) as the first demyelinating episode and to evaluate the ability of CHI3L2 to predict long-term MS risk and disability. METHODS...

Sequence analysis and gene expression of putative oil palm chitinase and chitinase-like proteins in response to colonization of Ganoderma boninense and Trichoderma harzianum.

Science.gov (United States)

Yeoh, K-A; Othman, A; Meon, S; Abdullah, F; Ho, C-L

2013-01-01

Chitinases are glycosyl hydrolases that cleave the β-1,4-glycosidic linkages between N-acetylglucosamine residues in chitin which is a major component of fungal cell wall. Plant chitinases hydrolyze fungal chitin to chitin oligosaccharides that serve as elicitors of plant defense system against fungal pathogens. However, plants synthesize many chitinase isozymes and some of them are not pathogenesis-related. In this study, three full-length cDNA sequences encoding a putative chitinase (EgChit3-1) and two chitinase-like proteins (EgChit1-1 and EgChit5-1) have been cloned from oil palm (Elaeis guineensis) by polymerase chain reaction (PCR). The abundance of these transcripts in the roots and leaves of oil palm seedlings treated with Ganoderma boninense (a fungal pathogen) or Trichoderma harzianum (an avirulent symbiont), and a combination of both fungi at 3, 6 and 12 weeks post infection were profiled by real time quantitative reverse-transcription (qRT)-PCR. Our findings showed that the gene expression of EgChit3-1 increased significantly in the roots of oil palm seedlings treated with either G. boninense or T. harzianum and a combination of both; whereas the gene expression of EgChit1-1 in the treated roots of oil palm seedlings was not significantly higher compared to those of the untreated oil palm roots. The gene expression of EgChit5-1 was only higher in the roots of oil palm seedlings treated with T. harzianum compared to those of the untreated oil palm roots. In addition, the gene expression of EgChit1-1 and EgChit3-1 showed a significantly higher gene expression in the leaf samples of oil palm seedlings treated with either G. boninense or T. harzianum.

Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides.

Science.gov (United States)

Ghauharali-van der Vlugt, Karen; Bussink, Anton P; Groener, Johanna E M; Boot, Rolf G; Aerts, Johannes M F G

2009-01-01

Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection. However, the relatively poor sensitivity poses a serious limitation. Here we report on a novel, much more sensitive assay for the detection of chito-oligosaccharide reaction products released by chitinases, based on fluorescent detection, following chemical labeling by 2-aminobenzoic acid. Comparison with existing UV-based assays, shows that the novel assay offers the same advantages yet allows detection of chito-oligosaccharides in the low picomolar range.

The Use of Crude Shrimp Shell Powder for Chitinase Production by Serratia marcescens WF

Directory of Open Access Journals (Sweden)

Jesús E. Mejía-Saulés

2006-01-01

Full Text Available From 102 Serratia marcescens strains screened, 57 strains showed chitinase activity and Serratia marcescens WF showed the highest chitinolytic activity so this strain was selected for further study on the use of crude shrimp waste for chitinase production. The concentration of crude shrimp shell content at 10–70 g/L, incubation temperature of 28–37 °C, pH=6–9, and time 24–96 h on kinetics of chitinase production by S. marcescens WF were evaluated. The maximal chitinase production related to process variables was obtained with the second order polynomial model: dry shrimp shell powder at 6 %, pH=6.5, temperature of 28 °C during fermentation for up to 72 h.

Differential expression of bean chitinase genes by virus infection, chemical treatment and UV irradiation

International Nuclear Information System (INIS)

Margis-Pinheiro, M.; Martin, C.; Didierjean, L.; Burkard, G.

1993-01-01

Three chitinases have been shown previously to be induced upon various stresses of bean leaves. Time course studies of mRNA accumulation of two of them (P3- and P4-chitinases) have been studied upon virus infection, mercuric chloride treatment and UV irradiation. In alfalfa mosaic virus (AlMV)-infected plants both mRNAs, absent in uninfected bean leaves, become detectable 36 h after inoculation. A maximum level of mRNAs is reached 84 h after inoculation and, whereas the amount of P3-ch mRNA decreases soon after having reached the maximum, the amount of P4-ch mRNA remains at high levels for several days. In mercuric chloride-treated leaves P4-ch mRNA becomes detectable 1-1.5 h after onset of treatment and a maximum level is observed between 6 h and 24 h after treatment; P3-ch mRNA becomes detectable later than P4-ch mRNA in treated leaves and reaches a maximum as late as 18 h after treatment has been applied. UV light also induces the synthesis of both mRNAs but, here again, important differences are observed in the accumulation rate of the two transcripts. The relative amounts of each mRNA induced by the different stresses have been compared. The most effective inducer of P3-ch mRNA is AlMV. In contrast, mercuric chloride induces P4-ch mRNA more efficiently than AlMV or UV light. We have also determined the complete nucleotide sequence of the cDNA encoding P3-chitinase that has been isolated from a cDNA library by using the cucumber lysozyme-chitinase cDNA as a probe. The 1072 bp P3-ch cDNA encodes a mature protein of 268 amino acid residues and the 25 residue NH2-terminal signal peptide of the precursor. Because of its high structural homology to the cucumber and Arabidopsis acidic chitinases as well as to the N-terminal amino acid sequence of the bifunctional lysozyme-chitinase from P. quinquifolia, bean P3-chitinase can be considered to belong to the class III chitinases. Southern blot analysis of bean genomic DNA revealed that P3-chitinase is encoded by a

Purification, crystallization and preliminary X-ray crystallographic analysis of chitinase from Bacillus cereus NCTU2

Energy Technology Data Exchange (ETDEWEB)

Kuo, Chueh-Yuan [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Wu, Yue-Jin [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Hsieh, Yin-Cheng; Guan, Hong-Hsiang [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Tsai, Huei-Ju [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Lin, Yi-Hung; Huang, Yen-Chieh; Liu, Ming-Yih [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Li, Yaw-Kuen, E-mail: ykl@cc.nctu.edu.tw [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Chen, Chun-Jung, E-mail: ykl@cc.nctu.edu.tw [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Department of Physics, National Tsing-Hua University, Hsinchu 30013,Taiwan (China)

2006-09-01

The crystallization of B. cereus chitinase is reported. Chitinases (EC 3.2.1.14) are found in a broad range of organisms, including bacteria, fungi and higher plants, and play different roles depending on their origin. A chitinase from Bacillus cereus NCTU2 (ChiNCTU2) capable of hydrolyzing chitin as a carbon and nitrogen nutrient has been identified as a member of the family 18 glycoside hydrolases. ChiNCTU2 of molecular weight 36 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of chitinase crystals at 1.10 Å resolution, the crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 50.79, b = 48.79, c = 66.87 Å, β = 99.31°. Preliminary analysis indicates there is one chitinase molecule in the asymmetric unit, with a solvent content of 43.4%.

Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

Energy Technology Data Exchange (ETDEWEB)

Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

2009-09-01

Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

Low chitinase activity in Acacia myrmecophytes: a potential trade-off between biotic and chemical defences?

Science.gov (United States)

Heil, M; Staehelin, C; McKey, D

2000-12-01

We determined chitinase activity in leaves of four myrmecophytic and four non-myrmecophytic leguminous species at the plants' natural growing sites in Mexico. Myrmecophytic plants (or 'ant plants') have obligate mutualisms with ants protecting them against herbivores and pathogenic fungi. Plant chitinases can be considered a reliable measure of plant resistance to pathogenic fungi. The myrmecophytic Acacia species, which were colonised by mutualistic ants, exhibited at least six-fold lower levels of chitinase activity compared with the non-myrmecophytic Acacia farnesiana and three other non-myrmecophytes. Though belonging to different phylogenetic groups, the myrmecophytic Acacia species formed one distinct group in the data set, which was clearly separated from the non-myrmecophytic species. These findings allowed for comparison between two recent hypotheses that attempt to explain low chitinase activity in ant plants. Most probably, chitinases are reduced in myrmecophytic plant species because these are effectively defended indirectly due to their symbiosis with mutualistic ants.

Transformation of pickling cucumber with chitinase-encoding genes using Agrobacterium tumefaciens.

Science.gov (United States)

Raharjo, S H; Hernandez, M O; Zhang, Y Y; Punja, Z K

1996-04-01

Transformation of cucumber cv. Endeavor was attempted using three Agrobacterium tumefaciens strains (a supervirulent leucinopine type, an octopine type and a nopaline type), each harbouring one of three binary vectors which contained an acidic chitinase gene from petunia, and basic chitinase genes from tobacco and bean, respectively, driven by the CaMV 35S promoter. Petiole explants were inoculated with a bacterial suspension (10(8) cells·ml(-1)), cocultivated for 48-96 h and placed on Murashige and Skoog (MS) medium with 5.0 μM each of 2,4-D and BA, 50 mg·l(-1) kanamycin and 500 mg·l(-1) carbenicillin. The frequency of embryogenic callus formation ranged from 0 to 12%, depending on strains/vectors used and length of cocultivation, with the highest being obtained using the leucinopine strain with petunia acidic chitinase gene. The kanamycin-resistant embryogenic calli were used to initiate suspension cultures (in liquid MS medium with 1.0/1.0 μM 2,4-D/BA, 50 mg·l(-1) kanamycin) for multiplication of embryogenic cell aggregates. Upon plating of cell aggregates onto solid MS medium with 1.0/1.0 μM NAA/BA and 50 mg·l(-1) kanamycin, calli continued to grow and later differentiated into plantlets. Transformation by the leucinopine strain and all three vectors was confirmed by PCR amplification of the NPT II gene in transgenic calli and plants, in addition to Southern analysis. Expression of the acidic chitinase gene (from petunia) and both basic chitinase genes (from tobacco and bean) in different transgenic cucumber lines was confirmed by Western analyses.

Purification, characterization, and antifungal activity of chitinases from pineapple (Ananas comosus) leaf.

Science.gov (United States)

Taira, Toki; Toma, Noriko; Ishihara, Masanobu

2005-01-01

Three chitinases, designated pineapple leaf chitinase (PL Chi)-A, -B, and -C were purified from the leaves of pineapple (Ananas comosus) using chitin affinity column chromatography followed by several column chromatographies. PL Chi-A is a class III chitinase having a molecular mass of 25 kDa and an isoelectric point of 4.4. PL Chi-B and -C are class I chitinases having molecular masses of 33 kDa and 39 kDa and isoelectric points of 7.9 and 4.6 respectively. PL Chi-C is a glycoprotein and the others are simple proteins. The optimum pHs of PL Chi-A, -B, and -C toward glycolchitin are pH 3, 4, and 9 respectively. The chitin-binding ability of PL Chi-C is higher than that of PL Chi-B, and PL Chi-A has lower chitin-binding ability than the others. At low ionic strength, PL Chi-B exhibits strong antifungal activity toward Trichoderma viride but the others do not. At high ionic strength, PL Chi-B and -C exhibit strong and weak antifungal activity respectively. PL Chi-A does not have antifungal activity.

Characterization of a chitinase with antifungal activity from a native Serratia marcescens B4A

Directory of Open Access Journals (Sweden)

Mandana Zarei

2011-09-01

Full Text Available Chitinases have the ability of chitin digestion that constitutes a main compound of the cell wall in many of the phytopathogens such as fungi. In the following investigation, a novel chitinase with antifungal activity was characterized from a native Serratia marcescens B4A. Partially purified enzyme had an apparent molecular mass of 54 kDa. It indicated an optimum activity in pH 5 at 45ºC. Enzyme was stable in 55ºC for 20 min and at a pH range of 3-9 for 90 min at 25ºC. When the temperature was raised to 60ºC, it might affect the structure of enzymes lead to reduction of chitinase activity. Moreover, the Km and Vmax values for chitin were 8.3 mg/ml and 2.4 mmol/min, respectively. Additionally, the effect of some cations and chemical compounds were found to stimulate the chitinase activity. In addition, Iodoacetamide and Idoacetic acid did not inhibit enzyme activity, indicating that cysteine residues are not part of the catalytic site of chitinase. Finally, chitinase activity was further monitored by scanning electronic microscopy data in which progressive changes in chitin porosity appeared upon treatment with chitinase. This enzyme exhibited antifungal activity against Rhizoctonia solani, Bipolaris sp, Alternaria raphani, Alternaria brassicicola, revealing a potential application for the industry with potentially exploitable significance. Fungal chitin shows some special features, in particular with respect to chemical structure. Difference in chitinolytic ability must result from the subsite structure in the enzyme binding cleft. This implies that why the enzyme didn't have significant antifungal activity against other Fungi.

A broad pH range and processive chitinase from a metagenome library

Directory of Open Access Journals (Sweden)

S.S. Thimoteo

Full Text Available Chitinases are hydrolases that degrade chitin, a polymer of N-acetylglucosamine linked β(1-4 present in the exoskeleton of crustaceans, insects, nematodes and fungal cell walls. A metagenome fosmid library from a wastewater-contaminated soil was functionally screened for chitinase activity leading to the isolation and identification of a chitinase gene named metachi18A. The metachi18A gene was subcloned and overexpressed in Escherichia coli BL21 and the MetaChi18A chitinase was purified by affinity chromatography as a 6xHis-tagged fusion protein. The MetaChi18A enzyme is a 92-kDa protein with a conserved active site domain of glycosyl hydrolases family 18. It hydrolyses colloidal chitin with an optimum pH of 5 and temperature of 50°C. Moreover, the enzyme retained at least 80% of its activity in the pH range from 4 to 9 and 98% at 600 mM NaCl. Thin layer chromatography analyses identified chitobiose as the main product of MetaChi18A on chitin polymers as substrate. Kinetic analysis showed inhibition of MetaChi18A activity at high concentrations of colloidal chitin and 4-methylumbelliferyl N,N′-diacetylchitobiose and sigmoid kinetics at low concentrations of colloidal chitin, indicating a possible conformational change to lead the chitin chain from the chitin-binding to the catalytic domain. The observed stability and activity of MetaChi18A over a wide range of conditions suggest that this chitinase, now characterized, may be suitable for application in the industrial processing of chitin.

Glucanase and Chitinase from Some Isolates of Endophytic Fungus Trichoderma spp.

Science.gov (United States)

Prasetyawan, Sasangka; Sulistyowati, Lilik; Aulanni'am

2018-01-01

Endophytic fungi are those fungi that are able to grow in plant tissue without causing symptoms of disease. It is thought that these fungi may confer on the host plants degree of resistance to parasitic invasion. Endophytic fungi have been isolated from stem tissue and these fungi are known to be antagonistic to pathogenic fungi. These endophytes produce chitinase and β-1,3-glucanase enzymes. Based on the fact that chitin and β-1,3-glucan are the main skeletal polysaccharides of the cell walls of fungal patogen. The aim of this research is to do potential test on some of isolates of Trichoderma’s endophytic (L-1, L-2, Is-1, Is-2 and Is-7) in the chitinase and β-1,3-glucanase activity in effort to determine endophytic which be chossen to be gene resource for the next research. The gene will be transformed to citrus plant japanese citroen in effort to make citrus plant transgenic resistance to phytopatogenic invasion. The result of this research is endofit namely L-1 is the most potential endophytic fungi with chitinase activities is 4,8 10-2 Unit and glucanase 24,2. 1012 Unit. The addition of chitin and cell wall of phytophtora causes chitinase activity significantly increase, and also addition of laminarin and cell wall of phytophtora makes glucanase activity increase.

Purification and characterisation of a novel chitinase from persimmon (Diospyros kaki) with antifungal activity.

Science.gov (United States)

Zhang, Jianzhi; Kopparapu, Narasimha Kumar; Yan, Qiaojuan; Yang, Shaoqing; Jiang, Zhengqiang

2013-06-01

A novel chitinase from the persimmon fruit was isolated, purified and characterised in this report. The Diospyros kaki chitinase (DKC) was found to be a monomer with a molecular mass of 29 kDa. It exhibited optimal activity at pH 4.5 with broad pH stability from pH 4.0-9.0. It has an optimal temperature of 60°C and thermostable up to 60°C when incubated for 30 min. The internal peptide sequences of DKC showed similarity with other reported plant chitinases. It has the ability to hydrolyse colloidal chitin into chito-oligomers such as chitotriose, chitobiose and into its monomer N-acetylglucosamine. It can be used to degrade chitin waste into useful products such as chito-oligosacchaarides. DKC exhibited antifungal activity towards pathogenic fungus Trichoderma viride. Chitinases with antifungal property can be used as biocontrol agents replacing chemical fungicides. Copyright © 2012 Elsevier Ltd. All rights reserved.

EXPRESSION OF A CHITINASE GENE FROM SERRATIA-MARCESCENS IN LACTOCOCCUS-LACTIS AND LACTOBACILLUS-PLANTARUM

NARCIS (Netherlands)

BRURBERG, MB; HAANDRIKMAN, AJ; LEENHOUTS, KJ; VENEMA, G; NES, IF

1994-01-01

A chitinase gene from the Gram-negative bacterium Serratia marcescens BJL200 was cloned in Lactococcus lactis subsp. lactis MG1363 and in the silage inoculum strain Lactobacillus plantarum E19b. The chitinase gene was expressed as an active enzyme at a low level in Lactococcus lactis, when cloned in

Chitinase and cellulase activity from Bacillus thuringiensis strains - doi: 10.5102/ucs.v7i1.974

Directory of Open Access Journals (Sweden)

Vinícius Fiúza Dumas

2009-12-01

Full Text Available The present study aimed to analyze the production of chitinase and cellulase enzymes by strains of Bacillus thuringiensis toxic to Spodoptera frugiperda and Anthonomus grandis larvae. In order to evaluate the relationship between cellular growth and the chitinase and cellulase production, in vitro assays were carried through with bacteria cultures grown for 16h, 24h, 48h and 72h. Chitinase and cellulase activity was determined by a colorimetric method. The amount of N-acetylglucosamine (GlcNAc or its equivalent was measured by development of color in acid medium. All strains presented enzymatic production after 16h of cellular growth until 72h. However, a Kruskal-Wallis test detected no significant differences among the chitinase and cellulase activity during the cellular growth. According to these results, was not possible to associate chitinase and cellulose activity with the different level of toxicity of Bt strains against S. frugiperda and A. grandis larvae.

Microbial and viral chitinases: Attractive biopesticides for integrated pest management.

Science.gov (United States)

Berini, Francesca; Katz, Chen; Gruzdev, Nady; Casartelli, Morena; Tettamanti, Gianluca; Marinelli, Flavia

2018-01-04

The negative impact of the massive use of synthetic pesticides on the environment and on human health has stimulated the search for environment-friendly practices for controlling plant diseases and pests. Among them, biocontrol, which relies on using beneficial organisms or their products (bioactive molecules and/or hydrolytic enzymes), holds the greatest promise and is considered a pillar of integrated pest management. Chitinases are particularly attractive to this purpose since they have fungicidal, insecticidal, and nematicidal activities. Here, current knowledge on the biopesticidal action of microbial and viral chitinases is reviewed, together with a critical analysis of their future development as biopesticides. Copyright © 2018 Elsevier Inc. All rights reserved.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

A class III chitinase without disulfide bonds from the fern, Pteris ryukyuensis: crystal structure and ligand-binding studies.

Science.gov (United States)

Kitaoku, Yoshihito; Umemoto, Naoyuki; Ohnuma, Takayuki; Numata, Tomoyuki; Taira, Toki; Sakuda, Shohei; Fukamizo, Tamo

2015-10-01

We first solved the crystal structure of class III catalytic domain of a chitinase from fern (PrChiA-cat), and found a structural difference between PrChiA-cat and hevamine. PrChiA-cat was found to have reduced affinities to chitin oligosaccharides and allosamidin. Plant class III chitinases are subdivided into enzymes with three disulfide bonds and those without disulfide bonds. We here referred to the former enzymes as class IIIa chitinases and the latter as class IIIb chitinases. In this study, we solved the crystal structure of the class IIIb catalytic domain of a chitinase from the fern Pteris ryukyuensis (PrChiA-cat), and compared it with that of hevamine, a class IIIa chitinase from Hevea brasiliensis. PrChiA-cat was found to adopt an (α/β)8 fold typical of GH18 chitinases in a similar manner to that of hevamine. However, PrChiA-cat also had two large loops that extruded from the catalytic site, and the corresponding loops in hevamine were markedly smaller than those of PrChiA-cat. An HPLC analysis of the enzymatic products revealed that the mode of action of PrChiA-cat toward chitin oligosaccharides, (GlcNAc) n (n = 4-6), differed from those of hevamine and the other class IIIa chitinases. The binding affinities of (GlcNAc)3 and (GlcNAc)4 toward the inactive mutant of PrChiA-cat were determined by isothermal titration calorimetry, and were markedly lower than those toward other members of the GH18 family. The affinity and the inhibitory activity of allosamidin toward PrChiA-cat were also lower than those toward the GH18 chitinases investigated to date. Several hydrogen bonds found in the crystal structure of hevamine-allosamidin complex were missing in the modeled structure of PrChiA-cat-allosamidin complex. The structural findings for PrChiA-cat successfully interpreted the functional data presented.

High-level expression and characterization of two chitinases, ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

International Nuclear Information System (INIS)

Huang, C.-J.; Chen, C.-Y.

2005-01-01

Many chitinase genes have been cloned and sequenced from prokaryotes and eukaryotes but overexpression of chitinases in Escherichia coli cells was less reported. ChiCH and ChiCW of Bacillus cereus 28-9 belong to two distinct groups based on their amino acid sequences of catalytic domains, and in addition, domain structures of two enzymes are different. In this study, we established an ideal method for high-level expression of chitinases in E. coli as glutathione-S-transferase fusion proteins using pGEX-6P-1 vector. Both ChiCH and ChiCW were successfully highly expressed in E. coli cells as soluble GST-chitinase fusion proteins, and recombinant native ChiCH and ChiCW could be purified after cleavage with PreScission protease to remove GST tag. Purified chitinases were used for biochemical characterization of kinetics, hydrolysis products, and binding activities. The results indicate that ChiCW is an endo-chitinase and effectively hydrolyzes chitin and chito-multimers to chito-oligomers and the end product chitobiose, and ChiCH is an exo-chitinase and degrades chito-oligomers to produce chitobiose. Furthermore, due to higher affinity of ChiCW toward colloidal chitin than Avicel, C-terminal domain of ChiCW should be classified as a chitin-binding domain not a cellulose-binding domain although that was revealed as a cellulose-binding domain by conserved domain analysis. Therefore, the method of high-level expression of chitinases is helpful to studies and applications of chitinases

Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

DEFF Research Database (Denmark)

Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.

1992-01-01

A pathogen-induced chitinase (EC 3.2.1.14) was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence.

Science.gov (United States)

Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

2005-01-01

Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain.

Identification and cloning of class II and III chitinases from alkaline floral nectar of Rhododendron irroratum, Ericaceae.

Science.gov (United States)

Zha, Hong-Guang; Milne, Richard I; Zhou, Hong-Xia; Chen, Xiang-Yang; Sun, Hang

2016-10-01

Class II and III chitinases belonging to different glycoside hydrolase families were major nectarins in Rhododendron irroratum floral nectar which showed significant chitinolytic activity. Previous studies have demonstrated antimicrobial activity in plant floral nectar, but the molecular basis for the mechanism is still poorly understood. Two chitinases, class II (Rhchi2) and III (Rhchi3), were characterized from alkaline Rhododendron irroratum nectar by both SDS-PAGE and mass spectrometry. Rhchi2 (27 kDa) and Rhchi3 (29 kDa) are glycoside hydrolases (family 19 and 18) with theoretical pI of 8.19 and 7.04. The expression patterns of Rhchi2 and Rhchi3 were analyzed by semi-quantitative RT-PCR. Rhchi2 is expressed in flowers (corolla nectar pouches) and leaves while Rhchi3 is expressed in flowers. Chitinase in concentrated protein and fresh nectar samples was visualised by SDS-PAGE and chitinolytic activity in fresh nectar was determined spectrophotometrically via chitin-azure. Full length gene sequences were cloned with Tail-PCR and RACE. The amino acid sequence deduced from the coding region for these proteins showed high identity with known chitinases and predicted to be located in extracellular space. Fresh R. irroratum floral nectar showed significant chitinolytic activity. Our results demonstrate that class III chitinase (GH 18 family) also exists in floral nectar. The functional relationship between class II and III chitinases and the role of these pathogenesis-related proteins in antimicrobial activity in nectar is suggested.

Differential induction of chitinase in Piper colubrinum in response to inoculation with Phytophthora capsici, the cause of foot rot in black pepper

Science.gov (United States)

Sandeep Varma, R.; Johnson George, K.; Balaji, S.; Parthasarathy, V.A.

2009-01-01

Plant chitinases have been of particular interest since they are known to be induced upon pathogen invasion. Inoculation of Piper colubrinum leaves with the foot rot fungus, Phytophthora capsici leads to increase in chitinase activity. A marked increase in chitinase activity in the inoculated leaves was observed, with the maximum activity after 60 h of inoculation and gradually decreased thereafter. Older leaves showed more chitinase activity than young leaves. The level of chitinase in black pepper (Piper nigrum L.) upon inoculation was found to be substantially high when compared to P. colubrinum. RT–PCR using chitinase specific primers revealed differential accumulation of mRNA in P. colubrinum leaves inoculated with P. capsici. However, hyphal extension assays revealed no obvious differences in the ability of the protein extracts to inhibit growth of P. capsici in vitro. PMID:23961037

Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.

2014-01-01

The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...... important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus...... chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases...

Alternative splicing originates different domain structure organization of Lutzomyia longipalpis chitinases.

Science.gov (United States)

Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria

2018-02-01

BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development.

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey.

Science.gov (United States)

Matusíková, Ildikó; Salaj, Ján; Moravcíková, Jana; Mlynárová, Ludmila; Nap, Jan-Peter; Libantová, Jana

2005-12-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolytic activity of leaf exudates, indicating that the reaction of sundew leaves depends on the molecular nature of the inducer applied. In situ hybridization of sundew leaves with a Drosera chitinase probe showed chitinase gene expression in different cell types of non-treated leaves, but not in the secretory cells of the glandular heads. Upon induction, chitinase mRNA was also present in the secretory cells of the sundew leaf. The combined results indicate that chitinase is likely to be involved in the decomposition of insect prey by carnivorous plants. This adds a novel role to the already broad function of chitinases in the plant kingdom and may contribute to our understanding of the molecular mechanisms behind the ecological success of carnivorous plants in nutritionally poor environments.

Chitinase-like proteins as regulators of innate immunity and tissue repair: helpful lessons for asthma?

Science.gov (United States)

Sutherland, Tara E

2018-02-19

Chitinases and chitinase-like proteins (CLPs) belong to the glycoside hydrolase family 18 of proteins. Chitinases are expressed in mammals and lower organisms, facilitate chitin degradation, and hence act as host-defence enzymes. Gene duplication and loss-of-function mutations of enzymatically active chitinases have resulted in the expression of a diverse range of CLPs across different species. CLPs are genes that are increasingly associated with inflammation and tissue remodelling not only in mammals but also across distant species. While the focus has remained on understanding the functions and expression patterns of CLPs during disease in humans, studies in mouse and lower organisms have revealed important and overlapping roles of the CLP family during physiology, host defence and pathology. This review will summarise recent insights into the regulatory functions of CLPs on innate immune pathways and discuss how these effects are not only important for host defence and tissue injury/repair after pathogen invasion, but also how they have extensive implications for pathological processes involved in diseases such as asthma. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Optimization of nutrition factors on chitinase production from a newly isolated Chitiolyticbacter meiyuanensis SYBC-H1

Directory of Open Access Journals (Sweden)

Zhikui Hao

2012-03-01

Full Text Available The present study reports statistical medial optimization for chitinase production by a novel bacterial strain isolated from soil recently, which the name Chitinolyticbacter meiyuanensis SYBC-H1 is proposed. A sequential statistical methodology comprising of Plackett-Burman and response surface methodology (RSM was applied to enhance the fermentative production of chitinase, in which inulin was firstly used as an effective carbon source. As a result, maximum chitinase activity of 5.17 U/mL was obtained in the optimized medium, which was 15.5-fold higher than that in the basal medium. The triplicate verification experiments were performed under the optimized nutrients levels which indicated that it well agreed with the predicted value.

Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family

Directory of Open Access Journals (Sweden)

Aronson Nathan N

2007-06-01

Full Text Available Abstract Background Chitinases (EC.3.2.1.14 hydrolyze the β-1,4-linkages in chitin, an abundant N-acetyl-β-D-glucosamine polysaccharide that is a structural component of protective biological matrices such as insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 (GH18 family of chitinases is an ancient gene family widely expressed in archea, prokaryotes and eukaryotes. Mammals are not known to synthesize chitin or metabolize it as a nutrient, yet the human genome encodes eight GH18 family members. Some GH18 proteins lack an essential catalytic glutamic acid and are likely to act as lectins rather than as enzymes. This study used comparative genomic analysis to address the evolutionary history of the GH18 multiprotein family, from early eukaryotes to mammals, in an effort to understand the forces that shaped the human genome content of chitinase related proteins. Results Gene duplication and loss according to a birth-and-death model of evolution is a feature of the evolutionary history of the GH18 family. The current human family likely originated from ancient genes present at the time of the bilaterian expansion (approx. 550 mya. The family expanded in the chitinous protostomes C. elegans and D. melanogaster, declined in early deuterostomes as chitin synthesis disappeared, and expanded again in late deuterostomes with a significant increase in gene number after the avian/mammalian split. Conclusion This comprehensive genomic study of animal GH18 proteins reveals three major phylogenetic groups in the family: chitobiases, chitinases/chitolectins, and stabilin-1 interacting chitolectins. Only the chitinase/chitolectin group is associated with expansion in late deuterostomes. Finding that the human GH18 gene family is closely linked to the human major histocompatibility complex paralogon on chromosome 1, together with the recent association of GH18 chitinase activity with Th2 cell inflammation, suggests that its late expansion

Statistical optimization of cultural conditions for chitinase production ...

African Journals Online (AJOL)

ONOS

2010-08-09

Aug 9, 2010 ... Deshpande, 1991), control of pathogenic fungi (Mathivanan ... play an important role in the synthesis of this enzyme. ... of mineral salt medium of the following composition(g/l): fish scales ... phosphate buffer (0.05 M, pH 5.2) and 1 ml distilled water. ..... Nusaire (2007) found that Cu ions increase chitinase.

Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

Directory of Open Access Journals (Sweden)

Ramli Aizi

2011-11-01

Full Text Available Abstract Background Cold-adapted enzymes are proteins produced by psychrophilic organisms that display a high catalytic efficiency at extremely low temperatures. Chitin consists of the insoluble homopolysaccharide β-(1, 4-linked N-acetylglucosamine, which is the second most abundant biopolymer found in nature. Chitinases (EC 3.2.1.14 play an important role in chitin recycling in nature. Biodegradation of chitin by the action of cold-adapted chitinases offers significant advantages in industrial applications such as the treatment of chitin-rich waste at low temperatures, the biocontrol of phytopathogens in cold environments and the biocontrol of microbial spoilage of refrigerated food. Results A gene encoding a cold-adapted chitinase (CHI II from Glaciozyma antarctica PI12 was isolated using Rapid Amplification of cDNA Ends (RACE and RT-PCR techniques. The isolated gene was successfully expressed in the Pichia pastoris expression system. Analysis of the nucleotide sequence revealed the presence of an open reading frame of 1,215 bp, which encodes a 404 amino acid protein. The recombinant chitinase was secreted into the medium when induced with 1% methanol in BMMY medium at 25°C. The purified recombinant chitinase exhibited two bands, corresponding to the non-glycosylated and glycosylated proteins, by SDS-PAGE with molecular masses of approximately 39 and 50 kDa, respectively. The enzyme displayed an acidic pH characteristic with an optimum pH at 4.0 and an optimum temperature at 15°C. The enzyme was stable between pH 3.0-4.5 and was able to retain its activity from 5 to 25°C. The presence of K+, Mn2+ and Co2+ ions increased the enzyme activity up to 20%. Analysis of the insoluble substrates showed that the purified recombinant chitinase had a strong affinity towards colloidal chitin and little effect on glycol chitosan. CHI II recombinant chitinase exhibited higher Vmax and Kcat values toward colloidal chitin than other substrates at low

Postharvest application of a novel chitinase cloned from Metschnikowia fructicola and overexpressed in Pichia pastoris to control brown rot of peaches.

Science.gov (United States)

Banani, Houda; Spadaro, Davide; Zhang, Dianpeng; Matic, Slavica; Garibaldi, Angelo; Gullino, Maria Lodovica

2015-04-16

Metschnikowia fructicola strain AP47 is a yeast antagonist against postharvest pathogens of fruits. The yeast was able to produce chitinase enzymes in the presence of pathogen cell wall. A novel chitinase gene MfChi (GenBank accession number HQ113461) was amplified from the genomic DNA of Metschnikowia fructicola AP47. Sequence analysis showed lack of introns, an open reading frame (ORF) of 1098 bp encoding a 365 amino acid protein with a calculated molecular weight of 40.9 kDa and a predicted pI of 5.27. MfChi was highly induced in Metschnikowia fructicola after interaction with Monilinia fructicola cell wall, suggesting a primary role of MfChi chitinase in the antagonistic activity of the yeast. The MfChi gene overexpressed in the heterologous expression system of Pichia pastoris KM71 and the recombinant chitinase showed high endochitinase activity towards 4-Nitrophenyl β-d-N,N',N″-triacetylchitotriose substrate. The antifungal activity of the recombinant chitinase was investigated against Monilinia fructicola and Monilinia laxa in vitro and on peaches. The chitinase significantly controlled the spore germination and the germ tube length of the tested pathogens in PDB medium and the mycelium diameter in PDA. The enzyme, when applied on peaches cv. Redhaven, successfully reduced brown rot severity. This work shows that the chitinase MfChi could be developed as a postharvest treatment with antimicrobial activity for fruit undergoing a short shelf life, and confirms that P. pastoris KM71 is a suitable microorganism for cost-effective large-scale production of recombinant chitinases. Copyright © 2015 Elsevier B.V. All rights reserved.

STRUCTURAL FEATURES OF PLANT CHITINASES AND CHITIN-BINDING PROTEINS

NARCIS (Netherlands)

BEINTEMA, JJ

1994-01-01

Structural features of plant chitinases and chitin-binding proteins are discussed. Many of these proteins consist of multiple domains,of which the chitin-binding hevein domain is a predominant one. X-ray and NMR structures of representatives of the major classes of these proteins are available now,

ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

Directory of Open Access Journals (Sweden)

Dominika Ďurechová

2013-02-01

Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

The chitinase C gene PsChiC from Pseudomonas sp. and its synergistic effects on larvicidal activity

Directory of Open Access Journals (Sweden)

Wanfang Zhong

2015-09-01

Full Text Available Pseudomonas sp. strain TXG6-1, a chitinolytic gram-negative bacterium, was isolated from a vegetable field in Taixing city, Jiangsu Province, China. In this study, a Pseudomonas chitinase C gene (PsChiC was isolated from the chromosomal DNA of this bacterium using a pair of specific primers. The PsChiC gene consisted of an open reading frame of 1443 nucleotides and encoded 480 amino acid residues with a calculated molecular mass of 51.66 kDa. The deduced PsChiC amino acid sequence lacked a signal sequence and consisted of a glycoside hydrolase family 18 catalytic domain responsible for chitinase activity, a fibronectin type III-like domain (FLD and a C-terminal chitin-binding domain (ChBD. The amino acid sequence of PsChiCshowed high sequence homology (> 95% with chitinase C from Serratia marcescens. SDS-PAGE showed that the molecular mass of chitinase PsChiC was 52 kDa. Chitinase assays revealed that the chitobiosidase and endochitinase activities of PsChiCwere 51.6- and 84.1-fold higher than those of pET30a, respectively. Although PsChiC showed little insecticidal activity towards Spodoptera litura larvae, an insecticidal assay indicated that PsChiC increased the insecticidal toxicity of SpltNPV by 1.78-fold at 192 h and hastened death. These results suggest that PsChiC from Pseudomonas sp. could be useful in improving the pathogenicity of baculoviruses.

Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

Science.gov (United States)

Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

2016-03-01

The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.

Expression analysis of chitinase upon challenge inoculation to Alternaria wounding and defense inducers in Brassica juncea

Directory of Open Access Journals (Sweden)

Sandhya Rawat

2017-03-01

Full Text Available Chitinases are the hydrolytic enzymes which belong to the pathogenesis-related (PR protein family and play an important role not only in plant defense but also in various abiotic stresses. However, only a limited number of chitinase genes have been characterised in B. juncea. In this study, we have characterised B. juncea class IV chitinase gene (accession no EF586206 in response to fungal infection, salicylic acid (SA, jasmonic acid (JA treatments and wounding. Gene expression studies revealed that the transcript levels of Bjchitinase (BjChp gene increases significantly both in local and distal tissues after Alternaria infection. Bjchitinase gene was also induced by jasmonic acid and wounding but moderately by salicylic acid. A 2.5 kb class IV chitinase promoter of this gene was isolated from B. juncea by Genome walking (accession no KF055403.1. In-silico analysis of this promoter revealed a number of conserved cis-regulatory elements related to defense, wounding and signalling molecules like SA, and JA. For validation, chitinase promoter was fused to the GUS gene, and the resultant construct was then introduced into Arabidopsis plants. Histochemical analysis of T2 transgenic Arabidopsis plants showed that higher GUS activity in leaves after fungal infection, wounding and JA treatment but weakly by SA. GUS activity was seen in meristematic tissues, young leaves, seeds and siliques. Finally investigation has led to the identification of a pathogen-inducible, developmentally regulated and organ-specific promoter. Present study revealed that Bjchitinase (BjChp promoter is induced during biotic and environmental stress and it can be used in developing finely tuned transgenics.

Extraction and partial purification of chitinase from mycosymbiont and its relation with mycorrhiza association process

International Nuclear Information System (INIS)

Darusman, L.K.; Purwakusumah, E.D.; Nurlia, N.

1999-01-01

Extraction effectivity and partial purification of chitinase extracellular metabolite from Scleroderma columnare, Pisolithus tinctorius, Trichoderma harzianum and the root of Shorea selanica have been searched. S. columnare and P. tinctorius were the mycosymbiont for S. selanica while T. harzianum was not. (NH4)2SO4 was the very effective solvent for crude extracellular enzyme extraction, followed by PEG-6000 and ethanol 50 percent respectively. The activity of P. tinctorius was the lowest among the microbe while S. columnare was the highest. The activity lowered by purification process but specific activity was not. The chitinase activity of inoculated root was higher in the S. columnare association than P. tinctorius's also the percentage of root chitin content and infection rate. It mean that S. columnare more effective as mycosymbiont. The periods of association lowered the activity of root chitinase but this phenomenon did not happen in the root of S. selanica with T. harzianum infection

Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca

NARCIS (Netherlands)

Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene

Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

International Nuclear Information System (INIS)

Morpurgo, R.; Duren, M. Van; Grasso, G.; Afza, R.

1997-01-01

Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs

Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

Energy Technology Data Exchange (ETDEWEB)

Morpurgo, R; Duren, M Van; Grasso, G; Afza, R [Agriculture and Biotechnology Laboratory, International Atomic Energy Agency, Seibersdorf (Austria)

1997-07-01

Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs.

Comparative molecular evolution of Trichoderma chitinases in response to mycoparasitic interactions

DEFF Research Database (Denmark)

Ihrmark, Katarina; Asmail, Nashwan; Ubhayasekera, Wimal

2010-01-01

Certain species of the fungal genus Trichoderma are potent mycoparasites and are used for biological control of fungal diseases on agricultural crops. In Trichoderma, whole-genome sequencing reveal between 20 and 36 different genes encoding chitinases, hydrolytic enzymes that are involved...... in the mycoparasitic attack. Sequences of Trichoderma chitinase genes chi18-5, chi18-13, chi18-15 and chi18-17, which all exhibit specific expression during mycoparasitism-related conditions, were determined from up to 13 different taxa and studied with regard to their evolutionary patterns. Two of them, chi18......-usage and contains five codons that evolve under positive selection and three groups of co-evolving sites. Regions of high amino acid variability are preferentially localized to substrate- or product side of the catalytic clefts. Differences in amino acid diversity/conservation patterns between different Trichoderma...

Characterization of an exo-chitinase from a Citrobacter strain isolated from the intestine content of large yellow croakers.

Science.gov (United States)

Xu, Jie; Yang, Yalin; Liu, Yang; Ran, Chao; Li, Juan; He, Suxu; Xu, Li; Ai, Xhunxiang; Zhou, Zhigang

2016-07-04

We isolated bacterial strains with chitin-degrading activity from the digesta of large yellow croakers (Pseudosciaena crocea) fed with chitin-enriched trash fish, and characterized potential chitinases thereof. Chitin-degrading strains were screened with colloidal chitin agar from the digesta of P. crocea fed with trash fish. The chitinase gene (chi-X) was cloned and expressed in Escherichia coli, and the enzymatic properties of the chitinase (CHI-X) were characterized. A Citrobacter freundii strain with chitin-degrading activity was isolated. The chitinase gene encodes a protein containing 493 amino acid residues, with a proposed glycoside hydrolase family-18 catalytic domain. CHI-X could hydrolyze colloidal chitin. The optimal pH for CHI-X was 4.0 at optimal temperature (60 ℃). CHI-X was active over a broad pH range, with around 90% of the activity maintained after incubation at pH between 3.0 and 11 for 1 h. The enzymatic activity of CHI-X was stimulated by Mn2+, Li+, and K+, but inhibited by Ag+. The enzyme was stable after treatment by proteases and grouper intestinal juice. CHI-X hydrolyzes colloidal chitin into GlcNAc and (GlcNAc)2. Furthermore, an synergic effect was observed between CHIX and ChiB565 (a chitinase from Aeromonas veronii B565) on colloidal chitin. CHI-X from intestinal bacterium may be potentially used as feed additive enzyme for warm water marine fish.

Chitinase Expression Due to Reduction in Fusaric Acid Level in an Antagonistic Trichoderma harzianum S17TH.

Science.gov (United States)

Sharma, Vivek; Bhandari, Pamita; Singh, Bikram; Bhatacharya, Amita; Shanmugam, Veerubommu

2013-06-01

To study the effect of reduction in phytotoxin level on fungal chitinases, antagonistic Trichoderma spp. were screened for their ability to reduce the level of fusaric acid (FA), the phytotoxin produced by Fusarium spp. A T. harzianum isolate S17TH was able to tolerate high levels of FA (up to 500 ppm) but was unable to reduce the toxin to a significant level (non-toxic) added to minimal synthetic broth (MSB). However, the isolate was able to reduce 400 ppm FA in the liquid medium after 7 days to a non-toxic level and displayed similar level of antagonism over the control (without FA). In studies of the effect of the reduction in FA (400 ppm) level on chitinase gene expression in PCR assays, nag1 was significantly repressed but ech42 expression was only slightly repressed. Chitinase activity was either reduced or absent in the extracellular proteins of MSB supplemented with 400 ppm FA, which could be attributed to the effect of residual FA or its breakdown products through unknown mechanisms. Selection of S17TH as a toxin insensitive isolate that could commensurate the negative effect on chitinase activity makes it a potential antagonist against Fusarium spp.

A class V chitinase from Arabidopsis thaliana: gene responses, enzymatic properties, and crystallographic analysis

DEFF Research Database (Denmark)

Ohnuma, Takayuki; Numata, Tomoyuki; Osawa, Takuo

2011-01-01

Expression of a class V chitinase gene (At4g19810, AtChiC) in Arabidopsis thaliana was examined by quantitative real-time PCR and by analyzing microarray data available at Genevestigator. The gene expression was induced by the plant stress-related hormones abscisic acid (ABA) and jasmonic acid (JA......, the amino acid residues responsible for substrate binding were found to be well conserved when compared with those of the class V chitinase from Nicotiana tabacum (NtChiV). All of the structural and functional properties of AtChiC are quite similar to those obtained for NtChiV, and seem to be common...

Industrially Important Carbohydrate Degrading Enzymes from Yeasts: Pectinases, Chitinases, and β-1,3-Glucanases

Science.gov (United States)

Gummadi, Sathyanarayana N.; Kumar, D. Sunil; Dash, Swati S.; Sahu, Santosh Kumar

Polysaccharide degrading enzymes are hydrolytic enzymes, which have a lot of industrial potential and also play a crucial role in carbon recycling. Pectinases, chitinases and glucanases are the three major polysaccharide degrading enzymes found abundantly in nature and these enzymes are mainly produced by fungal strains. Production of these enzymes by yeasts is advantageous over fungi, because the former are easily amenable to genetic manipulations and time required for growth and production is less than that of the latter. Several yeasts belonging to Saccharomyces, Pichia, Rhodotorula and Cryptococcus produce extracellular pectinases, glucanases and chitinases. This chapter emphasizes on the biological significance of these enzymes, their production and their industrial applications.

Cloning and functional characterization of a class III chitinase gene ...

African Journals Online (AJOL)

Analysis of the VvChiF III amino acid sequence showed that this gene corresponds to the Glyco-hydro-18 super family that consisting of a signal peptide with the length of 25 amino acids. Purified VvChiF III showed chitinase activity toward the soluble substrate, glycolchitin and antifungal activity against Botrytis cinerea.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

Science.gov (United States)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

2017-11-15

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

Isolation and molecular identification chitinase-producing Streptomyces strains and examination of their in-vitro antagonistic effects

Directory of Open Access Journals (Sweden)

Alireza Dehnad

2015-12-01

Full Text Available Introduction: The chemical fungicides are used widely in the world. To reduce the application of synthetic fungicides in treating plant diseases, biological methods are considered as an alternative way to control plant diseases. Many actinomycetes, particularly Streptomyces species are biological agents against a broad spectrum of fungal plant pathogens. The purpose of this study was using the kitinolitik actinomycetes isolated from soil of Eastern Azerbaijan province In order to produce biological pesticides. Materials and methods: Soil samples were taken from different areas of Eastern Azerbaijan province. According to Streptomyces morphological features, single colonies were isolated. To identify the bacteria by molecular characteristic, the genomic DNA was extracted and then the sequences of 16S rDNA were replicated. By using specific primers the bacterial isolates containing chitinase gene were screened. The isolates consisted Chitinase enzyme and were antagonistically cultured with Alternaria genus which is a fungal plant pathogen. Results: Out of 60 soil collected samples, 31 Streptomyces bacterial isolates were separated. Four isolates showed positive results to selectivity action of the chitinase enzyme. Treatment of 3 bacterial isolates with 2 pathogenic fungi showed that AE09 is the most effective anti-fungal isolates. Discussion and conclusion: Soils in Eastern Azerbaijan province are rich of Streptomyces bacteria which generate antifungal compounds. Obtaining the Streptomyces bacteria which have chitinase gene, can lead to identification of very effective strains as anti-fungal.

Oat (Avena sativa) Seed Extract as an Antifungal Food Preservative Through the Catalytic Activity of a Highly Abundant Class I Chitinase

DEFF Research Database (Denmark)

Sørensen, Hans; Madsen, Lone; Petersen, Jørgen

2009-01-01

candidates included thaumatin-like proteins, 1,3-beta-glucanase, permatin precursor, pathogenesis-related protein type 1, and chitinases of class I and II. Class I chitinase could be specifically removed from the extracts and was found to be indispensable for 50% of the P. roqueforti inhibiting activity...

A computational analysis of the binding mode of closantel as inhibitor of the Onchocerca volvulus chitinase: insights on macrofilaricidal drug design

Science.gov (United States)

Segura-Cabrera, Aldo; Bocanegra-García, Virgilio; Lizarazo-Ortega, Cristian; Guo, Xianwu; Correa-Basurto, José; Rodríguez-Pérez, Mario A.

2011-12-01

Onchocerciasis is a leading cause of blindness with at least 37 million people infected and more than 120 million people at risk of contracting the disease; most (99%) of this population, threatened by infection, live in Africa. The drug of choice for mass treatment is the microfilaricidal Mectizan® (ivermectin); it does not kill the adult stages of the parasite at the standard dose which is a single annual dose aimed at disease control. However, multiple treatments a year with ivermectin have effects on adult worms. The discovery of new therapeutic targets and drugs directed towards the killing of the adult parasites are thus urgently needed. The chitinase of filarial nematodes is a new drug target due to its essential function in the metabolism and molting of the parasite. Closantel is a potent and specific inhibitor of chitinase of Onchocerca volvulus (OvCHT1) and other filarial chitinases. However, the binding mode and specificity of closantel towards OvCHT1 remain unknown. In the absence of a crystallographic structure of OvCHT1, we developed a homology model of OvCHT1 using the currently available X-ray structures of human chitinases as templates. Energy minimization and molecular dynamics (MD) simulation of the model led to a high quality of 3D structure of OvCHIT1. A flexible docking study using closantel as the ligand on the binding site of OvCHIT1 and human chitinases was performed and demonstrated the differences in the closantel binding mode between OvCHIT1 and human chitinase. Furthermore, molecular dynamics simulations and free-energy calculation were employed to determine and compare the detailed binding mode of closantel with OvCHT1 and the structure of human chitinase. This comparative study allowed identification of structural features and properties responsible for differences in the computationally predicted closantel binding modes. The homology model and the closantel binding mode reported herein might help guide the rational development of

Cloning, Site-Directed Mutagenesis, and Functional Analysis of Active Residues in Lymantria dispar Chitinase.

Science.gov (United States)

Fan, Xiao-Jun; Yang, Chun; Zhang, Chang; Ren, Hui; Zhang, Jian-Dong

2018-01-01

Chitinases are glycosyl hydrolases that catalyze the hydrolysis of β-(1,4)-glycosidic bonds in chitin, the major structural polysaccharide presented in the cuticle and gut peritrophic matrix of insects. Two aspartate residues (D143, D145) and one tryptophan (W146) in the Lymantria dispar chitinase are highly conserved residues observed within the second conserved motif of the family 18 chitinase catalytic region. In this study, a chitinase cDNA, LdCht5, was cloned from L. dispar, and the roles of the three residues were investigated using site-directed mutagenesis and substituting them with three other amino acids. Seven mutant proteins, D143E, D145E, W146G, D143E/D145E, D143E/W146G, D145E/W146G, and D143E/D145E/W146G, as well as the wild-type enzyme, were produced using the baculovirus-insect cell line expression system. The enzymatic and kinetic properties of these mutant enzymes were measured using the oligosaccharide substrate MU-(GlcNAc) 3 . Among the seven mutants, the D145E, D143E/D145E, and D145E/W146G mutations kept some extant catalytic activity toward MU-(GlcNAc) 3 , while the D143E, W146G, D143E/W146G, and D143E/D145E/W146G mutant enzymes were inactivated. Compared with the mutant enzymes, the wild-type enzyme had higher values of k cat and k cat / K m . A study of the multiple point mutations in the second conserved catalytic region would help to elucidate the role of the critical residues and their relationships.

Effect of different growth parameters on chitinase enzyme activity ...

African Journals Online (AJOL)

Optimization of culture conditions revealed that the enzyme production was maximum in pH 7.5 (107.4 ± 0.50 U/ml), temperature 35°C (103.15 ± 1.74 U/ml) when the carbon and the nitrogen sources used were CMC (106.0 ± 1.89 U/ml) and KNO3 (91.2 ± 1.51 U/ml), respectively. The total chitinase production for all optimum ...

Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

Directory of Open Access Journals (Sweden)

Tina Schäfer

2012-01-01

Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

Accumulation of defence-related transcripts and cloning of a chitinase mRNA from pea leaves (Pisum sativum L.) inoculated with Ascochyta pisi Lib

DEFF Research Database (Denmark)

Vad, Knud; de Neergaard, Eigil; Madriz-Ordeñana, Kenneth

1993-01-01

The race specific resistance of pea to Ascochyta pisi Lib. was shown to be exhibited as a hypersensitive response associated with the production of polyphenolic substances in epidermal and mesophyll cells. The levels of transcripts representing a pathogenesis-related (PR) protein (chitinase......) and an enzyme of phytoalexin biosynthesis (chalcone synthase) were shown to accumulate more rapidly during the hypersensitive response than during lesion development in the compatible interaction. A full-length (1143 bp) cDNA sequence of a pea chitinase (EC 3.2.1.14) (coding for an approx. 34 500 Da protein......) was deduced by combining the overlapping sequences of three clones obtained following PCR amplification of cDNA prepared from mRNA isolated 24 h after inoculation of pea leaves with Ascochyta pisi. The combined sequences were identified as a class I chitinase corresponding to the basic A1-chitinase enzyme...

In vitro antagonism of cotton seedlings fungi and characterization of chitinase isozyme activities in Trichoderma harzianum.

Science.gov (United States)

Asran-Amal, A; Moustafa-Mahmoud, S M; Sabet, K K; El Banna, O H

2010-04-01

The antagonistic fungus Trichoderma harzianum is widely recognized as a potential biocontrol agent against several soil-borne plant pathogens. T. harzinum is rich source of chitinoltic enzymes. In vitro screening of 5 isolates of T. harzinum, one isolate of Chaetomium globosum and one isolate of Conetherium mentance, revealed that all of them had reduced growth area of Macrophomina phaseolina, Fusarium solani and Rhizoctonia solani on PDA medium, significantly. The inhibition percentage ranged from 77.9 % to 55.9% for M. phaseolina and 59.2% to 40.4% for R. solani by T. harzinum and C. mentance, respectively. Inhibition for F. solani ranged from 76.5% to 55.7% by T. harzinum and C. globosum, respectively. Isozyme gel electrophoresis was used to assess chitinase activity secreted by selected isolates of T. harzinum under different pH degrees and temperatures. Obtained results indicated that activity of chitinase isozyme produced at 30 °C was higher than 15-20 °C for all tested isolates and activity of chitinase produced by isolates No. 4 and 5 of T. harzinum at pH (7-7.5) was higher than at pH 6, respectively.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity

OpenAIRE

Kidibule, Peter E; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M. Carmen; Remacha, Miguel; Plou Gasca, Francisco José; Sanz-Aparicio, J.; Fernández Lobato, María

2018-01-01

Abstract Background Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of t...

Enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, Evert; Barends, Thomas; Terwisscha van Scheltinga, Anke C.; Dijkstra, Bauke W.; Beintema, Jaap J.

2000-01-01

The enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis, were studied in detail with a new enzyme assay. In this assay, the enzyme reaction products were derivatized by reductive coupling to a chromophore, Products mere separated by HPLC and the amount of product was

A fast, sensitive and easy colorimetric assay for chitinase and cellulase activity detection.

NARCIS (Netherlands)

Ferrari, Alessandro; Gaber, Yasser; Fraaije, Marco

2014-01-01

BACKGROUND: Most of the current colorimetric methods for detection of chitinase or cellulase activities on the insoluble natural polymers chitin and cellulose depend on a chemical redox reaction. The reaction involves the reducing ends of the hydrolytic products. The Schales' procedure and the

Expression, purification, crystallization and preliminary crystallographic analysis of chitinase A from Vibrio carchariae

International Nuclear Information System (INIS)

Songsiriritthigul, Chomphunuch; Yuvaniyama, Jirundon; Robinson, Robert C.; Vongsuwan, Archara; Suginta, Wipa

2005-10-01

Chitinase A of Vibrio carchariae was functionally expressed in Escherichia coli M15 host cells as a C-terminally proteolytic processed fragment using the pQE60 expression vector. The yield of the 63-kDa protein was purified, yielding ∼70 mg per liter of bacterial culture. Crystals of recombinant chitinase A were obtained by the hanging-drop vapor diffusion method in a precipitant containing 10% (v/v) PEG 400, 0.1 M sodium acetate p H 4.6 and 0.125 M CaCl 2 . The crystals belonged to the tetragonal space group P422 with two molecules per asymmetric unit and unit-cell parameters a = b 127.64 Angstrom, and c = 171.42 Angstrom. A complete diffraction data set was collected to 2.14 Angstrom resolution, using a Rigaku/MSC R-AXIS IV ++ detector system mounted on an RU-H3R rotating-anode X-ray generator

Applications of Plackett–Burman and Central Composite Design for the Optimization of Novel Brevundimonas diminuta KT277492 Chitinase Production, Investigation of its Antifungal Activity

Directory of Open Access Journals (Sweden)

E. Ashour Warda

Full Text Available ABSTRACT Biological control strategy which can damage chitin, a vital component of pathogenic fungi and arthropods promises a safe solution for many fungal problems. And it’s more favorable than chemicals which increase health risks and environmental problems. Thus, the chitinase producers appear potential candidates of biological control of pathogenic fungi. Brevundimonus diminuta KT277492 is a new isolate that has been isolated recently from Egyptian soil. Significant factors that affecting the chitinase enzyme production were studied and optimized using Plackett-Burman and Response Surface Methodology (RSM. As a result, maximum production of chitinase enzyme was 832.87 IUL-1, this result presented about 8.767-fold increase in the enzyme production. In the last phase of the study, partially purified chitinase enzyme obtained from B. diminuta KT277492 was tested against two pathogenic fungi and the results showed good inhibitory activity against A. alternata and F. solani with IZD of 31±0.25 and 25±0.91 mm respectively. Finally, obtained results indicated the value of optimization process and the optimized chitinase enzyme could be an excellent choice in application of food and biotechnology as a biofungicide. This reflects the necessity of studying the characteristics and kinetics of the enzyme in the forthcoming study.

Crystallization of Hevamine, an Enzyme with Lysozyme/Chitinase Activity from Hevea brasiliensis Latex

NARCIS (Netherlands)

ROZEBOOM, HJ; BUDIANI, A; BEINTEMA, JJ

1990-01-01

Hevamine, an enzyme with both lysozyme and chitinase activity, was isolated and purified from Hevea brasiliensis (rubber tree) latex. The enzyme (molecular weight 29,000) is homologous to certain “pathogenesis-related” proteins from plants, but not to hen egg-white or phage T4 lysozyme. To

Biological activity of Bacillus thuringiensis (Bacillales: Bacillaceae) chitinase against Caenorhabditis elegans (Rhabditida: Rhabditidae)

Czech Academy of Sciences Publication Activity Database

Zhang, L.; Yu, J.; Xie, Y.; Lin, H.; Huang, Z.; Xu, L.; Gelbič, Ivan; Guan, X.

2014-01-01

Roč. 107, č. 2 (2014), s. 551-558 ISSN 0022-0493 Institutional support: RVO:60077344 Keywords : Bacillus thuringiensis * Caenorhabditis elegans * chitinase Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.506, year: 2014 http://www.bioone.org/doi/pdf/10.1603/EC13201

Draft Genome Sequence of a Chitinase-producing Biocontrol Bacterium Serratia sp. C-1

Directory of Open Access Journals (Sweden)

Seur Kee Park

2015-09-01

Full Text Available The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

Identification, purification, and expression patterns of chitinase from psychrotolerant Pedobacter sp. PR-M6 and antifungal activity in vitro.

Science.gov (United States)

Song, Yong-Su; Seo, Dong-Jun; Jung, Woo-Jin

2017-06-01

In this study, a novel psychrotolerant chitinolytic bacterium Pedobacter sp. PR-M6 that displayed strong chitinolytic activity on 0.5% colloidal chitin was isolated from the soil of a decayed mushroom. Chitinase activity of PR-M6 at 25 °C (C25) after 6 days of incubation with colloidal chitin increased rapidly to a maximum level (31.3 U/mg proteins). Three chitinase isozymes (chiII, chiIII, and chiIV) from the crude enzyme at 25 °C (C25) incubation were expressed on SDS-PAGE gels at 25 °C. After purification by chitin-affinity chromatography, six chitinase isozymes (chiI, chiII, chiIII, chiIV, chiV, and chiVI) from C25-fractions were expressed on SDS-PAGE gels at 25 °C. Major bands of chitinase isozymes (chiI, chiII, and chiIII) from C4-fractions were strongly expressed on SDS-PAGE gels at 25 °C. Pedobacter sp. PR-M6 showed high inhibition rate of 60.9% and 57.5% against Rhizoctonia solani and Botrytis cinerea, respectively. These results indicated that psychrotolerant Pedobacter sp. PR-M6 could be applied widely as a microorganism agent for the biocontrol of agricultural phytopathogens at low temperatures. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cloning of a chitinase gene from Ewingella americana, a pathogen of the cultivated mushroom, Agaricus bisporus

Directory of Open Access Journals (Sweden)

P.W. Inglis

2000-09-01

Full Text Available We have isolated a gene encoding a chitinase (EC 3.2.1.14 from Ewingella americana, a recently described pathogen of the mushroom Agaricus bisporus. This gene, designated chiA (EMBL/Genbank/DDBJ accession number X90562, was cloned by expression screening of a plasmid-based E. americana HindIII genomic library in Escherichia coli using remazol brilliant violet-stained carboxymethylated chitin incorporated into selective medium. The chiA gene has a 918-bp ORF, terminated by a TAA codon, with a calculated polypeptide size of 33.2 kDa, likely corresponding to a previously purified and characterised 33-kDa endochitinase from E. americana. The deduced amino acid sequence shares 33% identity with chitinase II from Aeromonas sp. No. 10S-24 and 7.8% identity with a chitinase from Saccharopolyspora erythraeus. Homology to other chitinase sequences was otherwise low. The peptide sequence deduced from chiA lacks a typical N-terminal signal sequence and also lacks the chitin binding and type III fibronectin homology units common to many bacterial chitinases. The possibility that this chitinase is not primarily adapted for the environmental mineralisation of pre-formed chitin, but rather for the breakdown of nascent chitin, is discussed in the context of mushroom disease.O gene que codifica uma quitinase (EC 3.2.1.14 foi isolado de Ewingella americana, recentemente descrita como patógeno do cogumelo Agaricus bisporus. Este gene, denominado chiA (EMBL/Genebank/DDBJ número de acesso X9061, foi clonado e selecionado a partir de livraria genômica construída por digestão do DNA de E. americana com HindIII e ligação em plasmídio de expressão em E. coli, utilizando meio seletivo contendo quitina carboximetilada, corada com "remazol brilliant violet'' para seleção de clones. O gene chiA apresenta uma ORF de 918 bp, código terminador TAA, tendo o tamanho do polipeptídeo sido calculado como 33,2 kDa, o qual corresponde ao tamanho de 33 kDa da endoquitinase

Nitrogen regulates chitinase gene expression in a marine bacterium

DEFF Research Database (Denmark)

Delpin, Marina; Goodman, A.E.

2009-01-01

Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures con...... GlcNAc, transcription initiated from two putative sigma(54)-dependent promoters and (3) glt, transcription initiated from all three putative promoters. The ISME Journal (2009) 3, 1064-1069; doi:10.1038/ismej.2009.49; published online 14 May 2009...

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

OpenAIRE

Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolyti...

Stabilization of a chitinase from Serratia marcescens by Gly-->Ala and Xxx-->Pro mutations.

NARCIS (Netherlands)

Gaseidnes, S.; Synstad, B.; Jia, X.; Kjellesvik, H.; Vriend, G.; Eijsink, V.G.

2003-01-01

This paper describes attempts to increase the kinetic stability of chitinase B from Serratia marcescens (ChiB) by the introduction of semi-automatically designed rigidifying mutations of the Gly-->Ala and Xxx-->Pro type. Of 15 single mutants, several displayed significant increases in thermal

Nutrition supply affects the activity of pathogenesis-related β-1,3-glucanases and chitinases in wheat

Czech Academy of Sciences Publication Activity Database

Maglovski, M.; Gregorová, Z.; Rybanský, L.; Mészáros, P.; Moravčíková, J.; Hauptvogel, P.; Adamec, Lubomír; Matušíková, I.

2017-01-01

Roč. 81, č. 3 (2017), s. 443-453 ISSN 0167-6903 Institutional support: RVO:67985939 Keywords : glucanhydrolases * chitinases * nitrogen Subject RIV: ED - Physiology OBOR OECD: Plant sciences, botany Impact factor: 2.646, year: 2016

CHITINASE-B FROM SERRATIA-MARCESCENS-BJL200 IS EXPORTED TO THE PERIPLASM WITHOUT PROCESSING

NARCIS (Netherlands)

BRURBERG, MB; EIJSINK, VGH; HAANDRIKMAN, AJ; VENEMA, G; NES, IF

A gene encoding a chitinase from Serratia marcescens BJL200 was cloned and expressed in Escherichia coli and S. marcescens. Nucleotide sequencing revealed an open reading frame encoding a 55.5 kDa protein of 499 amino acids without a typical signal peptide for export. The cellular localization of

THE PRIMARY STRUCTURE OF HEVAMINE, AN ENZYME WITH LYSOZYME CHITINASE ACTIVITY FROM HEVEA-BRASILIENSIS LATEX

NARCIS (Netherlands)

JEKEL, PA; HARTMANN, JBH; BEINTEMA, JJ

1991-01-01

The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Hevea brasiliensis latex, has been determined predominantly with conventional non-automatic methods. The positions of three disulfide bridges have been determined. The sequence has about 60% identity with that of a

Characterization of Thermotolerant Chitinases Encoded by a Brevibacillus laterosporus Strain Isolated from a Suburban Wetland

Directory of Open Access Journals (Sweden)

Pulin Liu

2015-12-01

Full Text Available To isolate and characterize chitinases that can be applied with practical advantages, 57 isolates of chitin-degrading bacteria were isolated from the soil of a suburban wetland. 16S rRNA gene analysis revealed that the majority of these strains belonged to two genera, Paenibacillus and Brevibacillus. Taking thermostability into account, the chitinases (ChiA and ChiC of a B. laterosporus strain were studied further. Ni-NTA affinity-purified ChiA and ChiC were optimally active at pH 7.0 and 6.0, respectively, and showed high temperature stability up to 55 °C. Kinetic analysis revealed that ChiC has a lower affinity and stronger catalytic activity toward colloidal chitin than ChiA. With their stability in a broad temperature range, ChiA and ChiC can be utilized for the industrial bioconversion of chitin wastes into biologically active products.

Novel Chitinase Gene LOC_Os11g47510 from Indica Rice Tetep Provides Enhanced Resistance against Sheath Blight Pathogen Rhizoctonia solani in Rice

Directory of Open Access Journals (Sweden)

Tilak R. Sharma

2017-04-01

Full Text Available Sheath blight disease (ShB, caused by the fungus Rhizoctonia solani Kühn, is one of the most destructive diseases of rice (Oryza sativa L., causing substantial yield loss in rice. In the present study, a novel rice chitinase gene, LOC_Os11g47510 was cloned from QTL region of R. solani tolerant rice line Tetep and used for functional validation by genetic transformation of ShB susceptible japonica rice line Taipei 309 (TP309. The transformants were characterized using molecular and functional approaches. Molecular analysis by PCR using a set of primers specific to CaMv 35S promoter, chitinase and HptII genes confirmed the presence of transgene in transgenic plants which was further validated by Southern hybridization. Further, qRT-PCR analysis of transgenic plants showed good correlation between transgene expression and the level of sheath blight resistance among transformants. Functional complementation assays confirmed the effectiveness of the chitinase mediated resistance in all the transgenic TP309 plants with varying levels of enhanced resistance against R. solani. Therefore, the novel chitinase gene cloned and characterized in the present study from the QTL region of rice will be of significant use in molecular plant breeding program for developing sheath blight resistance in rice.

Characterization of a novel Salmonella typhimurium chitinase which hydrolyzes chitin, chitooligosaccharides and an N-acetyllactosamine conjugate

DEFF Research Database (Denmark)

Larsen, Tanja; Petersen, Bent O.; Storgaard, Birgit Groth

2011-01-01

Salmonella contain genes annotated as chitinases; however, their chitinolytic activities have never been verified. We now demonstrate such an activity for a chitinase assigned to glycoside hydrolase family 18 encoded by the SL0018 (chiA) gene in Salmonella enterica Typhimurium SL1344. A C......-terminal truncated form of chiA lacking a putative chitin-binding domain was amplified by PCR, cloned and expressed in Escherichia coli BL21 (DE3) with an N-terminal (His)(6) tag. The purified enzyme hydrolyzes 4-nitrophenyl N,N'-diacetyl-ß-D-chitobioside, 4-nitrophenyl ß...

Structural analysis of group II chitinase (ChtII) catalysis completes the puzzle of chitin hydrolysis in insects.

Science.gov (United States)

Chen, Wei; Qu, Mingbo; Zhou, Yong; Yang, Qing

2018-02-23

Chitin is a linear homopolymer of N -acetyl-β-d-glucosamines and a major structural component of insect cuticles. Chitin hydrolysis involves glycoside hydrolase family 18 (GH18) chitinases. In insects, chitin hydrolysis is essential for periodic shedding of the old cuticle ecdysis and proceeds via a pathway different from that in the well studied bacterial chitinolytic system. Group II chitinase (ChtII) is a widespread chitinolytic enzyme in insects and contains the greatest number of catalytic domains and chitin-binding domains among chitinases. In Lepidopterans, ChtII and two other chitinases, ChtI and Chi-h, are essential for chitin hydrolysis. Although ChtI and Chi-h have been well studied, the role of ChtII remains elusive. Here, we investigated the structure and enzymology of Of ChtII, a ChtII derived from the insect pest Ostrinia furnacalis We present the crystal structures of two catalytically active domains of Of ChtII, Of ChtII-C1 and Of ChtII-C2, both in unliganded form and complexed with chitooligosaccharide substrates. We found that Of ChtII-C1 and Of ChtII-C2 both possess long, deep substrate-binding clefts with endochitinase activities. Of ChtII exhibited structural characteristics within the substrate-binding cleft similar to those in Of Chi-h and Of ChtI. However, Of ChtII lacked structural elements favoring substrate binding beyond the active sites, including an extra wall structure present in Of Chi-h. Nevertheless, the numerous domains in Of ChtII may compensate for this difference; a truncation containing one catalytic domain and three chitin-binding modules ( Of ChtII-B4C1) displayed activity toward insoluble polymeric substrates that was higher than those of Of Chi-h and Of ChtI. Our observations provide the last piece of the puzzle of chitin hydrolysis in insects. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

Science.gov (United States)

Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

2014-01-01

Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

Aromatic-Mediated Carbohydrate Recognition in Processive Serratia marcescens Chitinases.

Science.gov (United States)

Jana, Suvamay; Hamre, Anne Grethe; Wildberger, Patricia; Holen, Matilde Mengkrog; Eijsink, Vincent G H; Beckham, Gregg T; Sørlie, Morten; Payne, Christina M

2016-02-25

Microorganisms use a host of enzymes, including processive glycoside hydrolases, to deconstruct recalcitrant polysaccharides to sugars. Processive glycoside hydrolases closely associate with polymer chains and repeatedly cleave glycosidic linkages without dissociating from the crystalline surface after each hydrolytic step; they are typically the most abundant enzymes in both natural secretomes and industrial cocktails by virtue of their significant hydrolytic potential. The ubiquity of aromatic residues lining the enzyme catalytic tunnels and clefts is a notable feature of processive glycoside hydrolases. We hypothesized that these aromatic residues have uniquely defined roles, such as substrate chain acquisition and binding in the catalytic tunnel, that are defined by their local environment and position relative to the substrate and the catalytic center. Here, we investigated this hypothesis with variants of Serratia marcescens family 18 processive chitinases ChiA and ChiB. We applied molecular simulation and free energy calculations to assess active site dynamics and ligand binding free energies. Isothermal titration calorimetry provided further insight into enthalpic and entropic contributions to ligand binding free energy. Thus, the roles of six aromatic residues, Trp-167, Trp-275, and Phe-396 in ChiA, and Trp-97, Trp-220, and Phe-190 in ChiB, have been examined. We observed that point mutation of the tryptophan residues to alanine results in unfavorable changes in the free energy of binding relative to wild-type. The most drastic effects were observed for residues positioned at the "entrances" of the deep substrate-binding clefts and known to be important for processivity. Interestingly, phenylalanine mutations in ChiA and ChiB had little to no effect on chito-oligomer binding, in accordance with the limited effects of their removal on chitinase functionality.

Chitotriosidase is the primary active chitinase in the human lung and is modulated by genotype and smoking habit

NARCIS (Netherlands)

Seibold, Max A.; Donnelly, Samantha; Solon, Margaret; Innes, Anh; Woodruff, Prescott G.; Boot, Rolf G.; Burchard, Esteban González; Fahy, John V.

2008-01-01

Background: Chitinolytic enzymes play important roles in the pathophysiology of allergic airway responses in mouse models of asthma. Acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1) have chitinolytic activity, but relatively little is known about their expression in human asthma.

Positions of disulfide bonds in rye (Secale cereale) seed chitinase-a.

Science.gov (United States)

Yamagami, T; Funatsu, G; Ishiguro, M

2000-06-01

The positions of disulfide bonds of rye seed chitinase-a (RSC-a) were identified by the isolation of disulfide-containing peptides produced with enzymatic and/or chemical cleavages of RSC-a, followed by sequencing them. An unequivocal assignment of disulfide bonds in this enzyme was as follows: Cys3-Cysl8, Cys12-Cys24, Cys15-Cys42, Cys17-Cys31, and Cys35-Cys39 in the chitin-binding domain (CB domain), Cys82-Cys144, Cys156-Cys164, and Cys282-Cys295 in the catalytic domain (Cat domain), and Cys263 was a free form.

Kinetic characterization of Aspergillus niger chitinase CfcI using a HPAEC-PAD method for native chitin oligosaccharides

NARCIS (Netherlands)

van Munster, Jolanda M.; Sanders, Peter; ten Kate, Geralt A.; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.

2015-01-01

The abundant polymer chitin can be degraded by chitinases (EC 3.2.1.14) and beta-N-acetyl-hexosaminidases (EC 3.2.1.52) to oligosaccharides and N-acetyl-glucosamine (GlcNAc) monomers. Kinetic characterization of these enzymes requires product quantification by an assay method with a low detection

Involvement of the MAPK and PI3K pathways in chitinase 3-like 1-regulated hyperoxia-induced airway epithelial cell death

Energy Technology Data Exchange (ETDEWEB)

Kim, Mi Na; Lee, Kyung Eun; Hong, Jung Yeon; Heo, Won Il; Kim, Kyung Won; Kim, Kyu Earn [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of); Sohn, Myung Hyun, E-mail: mhsohn@yuhs.ac [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Hyperoxia induces apoptosis and chitinase 3-like 1 expression in human airway epithelial cells. Black-Right-Pointing-Pointer Presence of chitinase 3-like 1 affects airway epithelial cell death after hyperoxic exposure. Black-Right-Pointing-Pointer Silencing chitinase 3-like 1 manipulate the phosphorylation of ERK, p38 and Akt. -- Abstract: Background: Exposure to 100% oxygen causes hyperoxic acute lung injury characterized by cell death and injury of alveolar epithelial cells. Recently, the role of chitinase 3-like 1 (CHI3L1), a member of the glycosyl hydrolase 18 family that lacks chitinase activity, in oxidative stress was demonstrated in murine models. High levels of serum CHI3L1 have been associated with various diseases of the lung, such as asthma, chronic obstructive pulmonary disease, and cancer. However, the role of CHI3L1 in human airway epithelial cells undergoing oxidative stress remains unknown. In addition, the signaling pathways associated with CHI3L1 in this process are poorly understood. Purpose: In this study, we demonstrate the role of CHI3L1, along with the MAPK and PI3K signaling pathways, in hyperoxia-exposed airway epithelial cells. Method: The human airway epithelial cell line, BEAS-2B, was exposed to >95% oxygen (hyperoxia) for up to 72 h. Hyperoxia-induced cell death was determined by assessing cell viability, Annexin-V FITC staining, caspase-3 and -7 expression, and electron microscopy. CHI3L1 knockdown and overexpression studies were conducted in BEAS-2B cells to examine the role of CHI3L1 in hyperoxia-induced apoptosis. Activation of the MAPK and PI3K pathways was also investigated to determine the role of these signaling cascades in this process. Results: Hyperoxia exposure increased CHI3L1 expression and apoptosis in a time-dependent manner. CHI3L1 knockdown protected cells from hyperoxia-induced apoptosis. In contrast, CHI3L1 overexpression promoted cell death after hyperoxia exposure. Finally

Optimalisation of expression conditions for production of round-leaf sundew chitinase (Drosera rotundifolia L. in three E. coli expression strains

Directory of Open Access Journals (Sweden)

Miroslav Rajninec

2016-12-01

Full Text Available Round-leaf sundew (Drosera rotundifolia L., family Droseraceae, genus Drosera, is one of a few plant species with a strong antifungal potential. Chitinases of carnivorous plants play an important role in decomposition of chitin-containing cell structures of insect prey. The cell wall of many phytopathogenic fungi also contains chitin, which can be utilized by chitinases, thus round-leaf sundew represents an interesting gene source for plant biotechnology. The purpose of this study was to compare the suitability of 3 different E. coli expression strains (E. coli BL21- CodonPlus® (DE3-RIPL, E. coli ArcticExpress (DE3RIL and E. coli SHuffle® T7 for production and isolation of heterologous round-leaf sundew chitinase (DrChit. Results showed that the recombinant protein was successfully expressed in all three strains, but occurred in insoluble protein fraction. To get the DrChit protein into soluble protein fraction some modifications concerning to induction temperatures and concentration of the IPTG inductor were tested. In addition, composition of lysis buffer has been modified with supplementation of strong non-ionic detergents, Triton® X100 and Tween® 20, respectively. As these modifications didn’t increase the amount of the DrChit protein in soluble fraction, therefore, its isolation under denaturing conditions and subsequent refolding for activity assays is recommended.

Chitinase 3-like 1 Regulates Cellular and Tissue Responses via IL-13 Receptor α2

Directory of Open Access Journals (Sweden)

Chuan Hua He

2013-08-01

Full Text Available Members of the 18 glycosyl hydrolase (GH 18 gene family have been conserved over species and time and are dysregulated in inflammatory, infectious, remodeling, and neoplastic disorders. This is particularly striking for the prototypic chitinase-like protein chitinase 3-like 1 (Chi3l1, which plays a critical role in antipathogen responses where it augments bacterial killing while stimulating disease tolerance by controlling cell death, inflammation, and remodeling. However, receptors that mediate the effects of GH 18 moieties have not been defined. Here, we demonstrate that Chi3l1 binds to interleukin-13 receptor α2 (IL-13Rα2 and that Chi3l1, IL-13Rα2, and IL-13 are in a multimeric complex. We also demonstrate that Chi3l1 activates macrophage mitogen-activated protein kinase, protein kinase B/AKT, and Wnt/β-catenin signaling and regulates oxidant injury, apoptosis, pyroptosis, inflammasome activation, antibacterial responses, melanoma metastasis, and TGF-β1 production via IL-13Rα2-dependent mechanisms. Thus, IL-13Rα2 is a GH 18 receptor that plays a critical role in Chi3l1 effector responses.

Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

NARCIS (Netherlands)

Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

2004-01-01

The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, Evert; Rozeboom, Henriëtte J.; Sibbald, Mark; Dijkstra, Bauke W.; Beintema, Jaap J.

Hevamine is a chitinase from the rubber tree Hevea brasiliensis. Its active site contains Asp125, Glu127, and Tyr183, which interact with the -1 sugar residue of the substrate. To investigate their role in catalysis, we have successfully expressed wild-type enzyme and mutants of these residues as

Mutational analysis of amino acid residues involved in catalytic activity of a family 18 chitinase from tulip bulbs.

Science.gov (United States)

Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune

2003-02-01

We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.

The Drosophila chitinase-like protein IDGF3 is involved in protection against nematodes and woung healing

Czech Academy of Sciences Publication Activity Database

Kučerová, Lucie; Brož, Václav; Arefin, B.; Maaroufi, H. O.; Hurychová, J.; Strnad, Hynek; Žurovec, Michal; Theopold, U.

2016-01-01

Roč. 8, č. 2 (2016), s. 199-210 ISSN 1662-811X R&D Projects: GA ČR GA14-27816S Institutional support: RVO:60077344 ; RVO:68378050 Keywords : chitinase-like proteins * imaginal disc growth factor * hemolymph clot Subject RIV: CE - Biochemistry; EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 3.938, year: 2016 http://www.karger.com/Article/FullText/442351

Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

OpenAIRE

Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

2011-01-01

In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

Molecular Analysis of Atypical Family 18 Chitinase from Fujian Oyster Crassostrea angulata and Its Physiological Role in the Digestive System.

Science.gov (United States)

Yang, Bingye; Zhang, Mingming; Li, Lingling; Pu, Fei; You, Weiwei; Ke, Caihuan

2015-01-01

Chitinolytic enzymes have an important physiological significance in immune and digestive systems in plants and animals, but chitinase has not been identified as having a role in the digestive system in molluscan. In our study, a novel chitinase homologue, named Ca-Chit, has been cloned and characterized as the oyster Crassostrea angulate. The 3998bp full-length cDNA of Ca-Chit consisted of 23bp 5-UTR, 3288 ORF and 688bp 3-UTR. The deduced amino acids sequence shares homologue with the chitinase of family 18. The molecular weight of the protein was predicted to be 119.389 kDa, with a pI of 6.74. The Ca-Chit protein was a modular enzyme composed of a glycosyl hydrolase family 18 domain, threonine-rich region profile and a putative membrane anchor domain. Gene expression profiles monitored by quantitative RT-PCR in different adult tissues showed that the mRNA of Ca-Chit expressed markedly higher visceral mass than any other tissues. The results of the whole mount in-situ hybridization displayed that Ca-Chit starts to express the visceral mass of D-veliger larvae and then the digestive gland forms a crystalline structure during larval development. Furthermore, the adult oysters challenged by starvation indicated that the Ca-Chit expression would be regulated by feed. All the observations made suggest that Ca-Chit plays an important role in the digestive system of the oyster, Crassostrea angulate.

Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

International Nuclear Information System (INIS)

Ahmad, B.; Ambreen, S.; Khan, I.

2015-01-01

Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

STUDI PENDAHULUAN ENZIM KITINASE EXTRASELULER YANG DIHASILKAN OLEH ISOLAT BAKTERI ASAL MANADO 1 [Preliminary Study of Extracellular Chitinase Produced by Bacteria Isolated from Manado

Directory of Open Access Journals (Sweden)

E.Y. Purwani 1

2002-08-01

Full Text Available Chitinolytic bacteria were isolated from several exotic area in Manado Province. The most potential isolate, namely 13.26, was isolated from Tompaso. The isolate was cultured in the thermus medium containing colloidal chitin as a carbon source for 5 days at 55°C to produce chitinase. It was observed that chitinase was most active at 65��C and the optimum pH was 8 in boric acid-borax buffer. Ammonium sulfate (50% saturation precipitation of the protein increased the specific activity of the enzyme from 0.20 unit/mg protein (in culture supernatant to 0.28 unit/mg protein. The molecular weight as estimated by zymogram analysis was180 kDa

Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

International Nuclear Information System (INIS)

Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

2016-01-01

Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity.

Science.gov (United States)

Kidibule, Peter Elias; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M Carmen; Remacha, Miguel; Plou, Francisco José; Sanz-Aparicio, Julia; Fernández-Lobato, María

2018-03-22

Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of three N-acetyl-D-glucosamine (GlcNAc) units. Gene chit42 was previously characterized, and according to its sequence, the encoded protein included in the structural Glycoside Hydrolase family GH18. Chit42 was expressed in Pichia pastoris using fed-batch fermentation to about 3 g/L. Protein heterologously expressed showed similar biochemical properties to those expressed by the natural producer (42 kDa, optima pH 5.5-6.5 and 30-40 °C). In addition to hydrolyse colloidal chitin, this enzyme released reducing sugars from commercial chitosan of different sizes and acetylation degrees. Chit42 hydrolysed colloidal chitin at least 10-times more efficiently (defined by the k cat /K m ratio) than any of the assayed chitosan. Production of partially acetylated chitooligosaccharides was confirmed in reaction mixtures using HPAEC-PAD chromatography and mass spectrometry. Masses corresponding to (D-glucosamine) 1-8 -GlcNAc were identified from the hydrolysis of different substrates. Crystals from Chit42 were grown and the 3D structure determined at 1.8 Å resolution, showing the expected folding described for other GH18 chitinases, and a characteristic groove shaped substrate-binding site, able to accommodate at least six sugar units. Detailed structural analysis allows depicting the features of the Chit42 specificity, and explains the chemical nature of the partially acetylated molecules obtained from analysed substrates. Chitinase Chit42 was expressed in a heterologous system to levels never before achieved. The enzyme produced small partially acetylated

Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato.

Science.gov (United States)

Mamta; Reddy, K R K; Rajam, M V

2016-02-01

Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a devastating agricultural insect pest with broad spectrum of host range, causing million dollars crop loss annually. Limitations in the present conventional and transgenic approaches have made it crucial to develop sustainable and environmental friendly methods for crop improvement. In the present study, host-induced RNA interference (HI-RNAi) approach was used to develop H. armigera resistant tobacco and tomato plants. Chitinase (HaCHI) gene, critically required for insect molting and metamorphosis was selected as a potential target. Hair-pin RNAi construct was prepared from the conserved off-target free partial HaCHI gene sequence and was used to generate several HaCHI-RNAi tobacco and tomato plants. Northern hybridization confirmed the production of HaCHI gene-specific siRNAs in HaCHI-RNAi tobacco and tomato lines. Continuous feeding on leaves of RNAi lines drastically reduced the target gene transcripts and consequently, affected the overall growth and survival of H. armigera. Various developmental deformities were also manifested in H. armigera larvae after feeding on the leaves of RNAi lines. These results demonstrated the role of chitinase in insect development and potential of HI-RNAi for effective management of H. armigera.

Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

DEFF Research Database (Denmark)

Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.

1992-01-01

Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

Science.gov (United States)

Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

2013-10-01

Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

The Vibrio cholerae Extracellular Chitinase ChiA2 Is Important for Survival and Pathogenesis in the Host Intestine

Science.gov (United States)

Mondal, Moumita; Nag, Dhrubajyoti; Koley, Hemanta; Saha, Dhira Rani; Chatterjee, Nabendu Sekhar

2014-01-01

In aquatic environments, Vibrio cholerae colonizes mainly on the chitinous surface of copepods and utilizes chitin as the sole carbon and nitrogen source. Of the two extracellular chitinases essential for chitin utilization, the expression of chiA2 is maximally up-regulated in host intestine. Recent studies indicate that several bacterial chitinases may be involved in host pathogenesis. However, the role of V. cholerae chitinases in host infection is not yet known. In this study, we provide evidence to show that ChiA2 is important for V. cholerae survival in intestine as well as in pathogenesis. We demonstrate that ChiA2 de-glycosylates mucin and releases reducing sugars like GlcNAc and its oligomers. Deglycosylation of mucin corroborated with reduced uptake of alcian blue stain by ChiA2 treated mucin. Next, we show that V. cholerae could utilize mucin as a nutrient source. In comparison to the wild type strain, ΔchiA2 mutant was 60-fold less efficient in growth in mucin supplemented minimal media and was also ∼6-fold less competent to survive when grown in the presence of mucin-secreting human intestinal HT29 epithelial cells. Similar results were also obtained when the strains were infected in mice intestine. Infection with the ΔchiA2 mutant caused ∼50-fold less fluid accumulation in infant mice as well as in rabbit ileal loop compared to the wild type strain. To see if the difference in survival of the ΔchiA2 mutant and wild type V. cholerae was due to reduced adhesion of the mutant, we monitored binding of the strains on HT29 cells. The initial binding of the wild type and mutant strain was similar. Collectively these data suggest that ChiA2 secreted by V. cholerae in the intestine hydrolyzed intestinal mucin to release GlcNAc, and the released sugar is successfully utilized by V. cholerae for growth and survival in the host intestine. PMID:25244128

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifoliaL.) show induction of chitinase activity upon mimicking the presence of prey

NARCIS (Netherlands)

Matusikova, [No Value; Salaj, J; Moravcikova, J; Mlynarova, L; Nap, JP; Libantova, J

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

NARCIS (Netherlands)

Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

Floral nectar of the obligate outcrossing Canavalia gladiata (Jacq.) DC. (Fabaceae) contains only one predominant protein, a class III acidic chitinase.

Science.gov (United States)

Ma, X L; Milne, R I; Zhou, H X; Fang, J Y; Zha, H G

2017-09-01

Floral nectar can affect the fitness of insect-pollinated plants, through both attraction and manipulation of pollinators. Self-incompatible insect-pollinated plants receive more insect visits than their self-compatible relatives, and the nectar of such species might face increased risk of infestation by pathogens carried by pollinators than self-compatible plants. Proteins in nectar (nectarins) play an important role in protecting the nectar, but little is known regarding nectarins in self-incompatible species. The nectarins from a self-incompatible and insect-pollinated leguminous crop, Canavalia gladiata, were separated using two-dimensional electrophoresis and analysed using mass spectrometry. The predominant nectarin gene was cloned and the gene expression pattern investigated using quantitative real-time PCR. Chitinolytic activity in the nectar was tested with different substrates. The C. gladiata nectar proteome only has one predominant nectarin, an acidic class III chitinase (CaChi3). The full-length CaChi3 gene was cloned, coding for a protein of 298 amino acids with a predicted signal peptide. CaChi3 is very similar to members of the class III chitinase family, whose evolution is dominated by purifying selection. CaChi3 was expressed in both nectary and leaves. CaChi3 has thermostable chitinolytic activity according to glycol-chitin zymography or a fluorogenic substratem but has no lysozyme activity. Chitinase might be a critical protein component in nectar. The extremely simple nectar proteome in C. gladiata disproves the hypothesis that self-incompatible species always have more complex nectar proteomes. Accessibility of nectar might be a significant determinant of the evolutionary pressure to develop nectar defence mechanisms. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

20-hydroxyecdysone enhances the expression of the chitinase 5 via Broad-Complex Zinc-Finger 4 during metamorphosis in silkworm, Bombyx mori.

Science.gov (United States)

Zhang, X; Zheng, S

2017-04-01

Insect chitinases are hydrolytic enzymes required for the degradation of chitin. They are essential for insect moulting and metamorphosis. In this study, the regulation mechanism of a chitinase gene, Bombyx mori chitinase 5 (BmCHT5), was studied. Quantitative reverse transcription PCR (qRT-PCR) analysis showed that BmCHT5 was up-regulated during the larval-larval and larval-pupa transitions and notably induced by 20-hydroxyecdysone (20E). Analysis of the BmCHT5 promoter revealed the presence of one Bombyx mori Broad-Complex Zinc-Finger Isoform 4 (BR-C Z4), two BR-C Z2 and two ecdysone-induced protein 74A (E74A) cis-regulatory elements (CREs) that are related to 20E. qRT-PCR showed that the expression of both BmBR-C Z4 and BmBR-C Z2 during metamorphosis, and when induced by 20E, was anastomotic with the variations in BmCHT5 mRNA level. In contrast, BmE74A did not follow this trend. An electrophoretic mobility shift assay did not retrieve a binding partner for the two BR-C Z2 CREs in the BmN cell line nuclear extract, whereas BR-C Z4 CRE specifically bound to BmBR-C Z4. Besides, luciferase activity analysis confirmed that BmBR-C Z4 could enhance the activity of the BmCHT5 promoter with BR-C Z4 CRE and could not enhance the promoter activity by mutating BR-C Z4 CRE. Taken together, these data suggest that the transcription factor BmBR-C Z4 enhances the expression of BmCHT5 during metamorphosis. © 2016 The Royal Entomological Society.

Production in Pichia pastoris, antifungal activity and crystal structure of a class I chitinase from cowpea (Vigna unguiculata): Insights into sugar binding mode and hydrolytic action.

Science.gov (United States)

Landim, Patrícia G Castro; Correia, Tuana O; Silva, Fredy D A; Nepomuceno, Denise R; Costa, Helen P S; Pereira, Humberto M; Lobo, Marina D P; Moreno, Frederico B M B; Brandão-Neto, José; Medeiros, Suelen C; Vasconcelos, Ilka M; Oliveira, José T A; Sousa, Bruno L; Barroso-Neto, Ito L; Freire, Valder N; Carvalho, Cristina P S; Monteiro-Moreira, Ana C O; Grangeiro, Thalles B

2017-04-01

A cowpea class I chitinase (VuChiI) was expressed in the methylotrophic yeast P. pastoris. The recombinant protein was secreted into the culture medium and purified by affinity chromatography on a chitin matrix. The purified chitinase migrated on SDS-polyacrylamide gel electrophoresis as two closely-related bands with apparent molecular masses of 34 and 37 kDa. The identity of these bands as VuChiI was demonstrated by mass spectrometry analysis of tryptic peptides and N-terminal amino acid sequencing. The recombinant chitinase was able to hydrolyze colloidal chitin but did not exhibit enzymatic activity toward synthetic substrates. The highest hydrolytic activity of the cowpea chitinase toward colloidal chitin was observed at pH 5.0. Furthermore, most VuChiI activity (approximately 92%) was retained after heating to 50 °C for 30 min, whereas treatment with 5 mM Cu 2+ caused a reduction of 67% in the enzyme's chitinolytic activity. The recombinant protein had antifungal activity as revealed by its ability to inhibit the spore germination and mycelial growth of Penicillium herquei. The three-dimensional structure of VuChiI was resolved at a resolution of 1.55 Å by molecular replacement. The refined model had 245 amino acid residues and 381 water molecules, and the final R-factor and R free values were 14.78 and 17.22%, respectively. The catalytic domain of VuChiI adopts an α-helix-rich fold, stabilized by 3 disulfide bridges and possessing a wide catalytic cleft. Analysis of the crystallographic model and molecular docking calculations using chito-oligosaccharides provided evidences about the VuChiI residues involved in sugar binding and catalysis, and a possible mechanism of antifungal action is suggested. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Crystallization and preliminary X-ray diffraction studies of the catalytic domain of a novel chitinase, a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471

International Nuclear Information System (INIS)

Okazaki, Nobuo; Arimori, Takao; Nakazawa, Masami; Miyatake, Kazutaka; Ueda, Mitsuhiro; Tamada, Taro

2011-01-01

The catalytic domain of a novel chitinase, which is a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471 was crystallized and diffraction data were collected to 1.85 Å resolution. Chitinase from the moderately thermophilic bacterium Ralstonia sp. A-471 (Ra-ChiC) is divided into two domains: a chitin-binding domain (residues 36–80) and a catalytic domain (residues 103–252). Although the catalytic domain of Ra-ChiC has homology to goose-type lysozyme, Ra-ChiC does not show lysozyme activity but does show chitinase activity. The catalytic domain with part of an interdomain loop (Ra-ChiC 89–252 ) was crystallized under several different conditions using polyethylene glycol as a precipitant. The crystals diffracted to 1.85 Å resolution and belonged to space group P6 1 22 or P6 5 22, with unit-cell parameters a = b = 100, c = 243 Å. The calculated Matthews coefficient was approximately 3.2, 2.4 or 1.9 Å 3 Da −1 assuming the presence of three, four or five Ra-ChiC 89–252 molecules in the asymmetric unit, respectively

Recombinant Bacillus thuringiensis subsp. kurstaki HD73 strain that synthesizes Cry1Ac and chimeric ChiA74∆sp chitinase inclusions.

Science.gov (United States)

González-Ponce, Karen S; Casados-Vázquez, Luz E; Salcedo-Hernández, Rubén; Bideshi, Dennis K; Del Rincón-Castro, María C; Barboza-Corona, José E

2017-05-01

In this study, the endochitinase chiA74 gene lacking its secretion signal peptide sequence (chiA74∆sp) was fused in frame with the sequence coding for the C-terminal crystallization domain and transcription terminator of cry1Ac. The chimeric gene was expressed under the strong pcytA-p/STAB-SD promoter system in an acrystalliferous Cry - B strain of Bacillus thuringiensis and B. thuringiensis subsp. kurstaki HD73. We showed that the chimeric ChiA74∆sp produced amorphous inclusions in both Cry - B and HD73. In addition to the amorphous inclusions putatively composed of the chimera, bipyramidal Cry1Ac crystals, smaller than the wild-type crystal, were observed in recombinant HD73, and chitinase activity was remarkably higher (75-fold) in this strain when compared with parental HD73. Moreover, we observed that lyophilized samples of a mixture containing Cry1Ac, amorphous inclusions, and spores maintained chitinase activity. Amorphous inclusions could not be separated from Cry1Ac crystals by sucrose gradient centrifugation. Interestingly, the chitinase activity of purified Cry1Ac/amorphous inclusions was 51-fold higher compared to purified Cry1Ac inclusions of parental HD73, indicating that the increased enzymatic activity was due primarily to the presence of the atypical amorphous component. The possibility that the chimera is occluded with the Cry1Ac crystal, thereby contributing to the increased endochitinolytic activity, cannot be excluded. Finally, bioassays against larvae of Spodoptera frugiperda with spore/crystals of HD73 or spore-crystal ChiA74∆sp chimeric inclusions of recombinant HD73 strain showed LC 50 s of 396.86 and 290.25 ng/cm 2 , respectively. Our study suggests a possible practical application of the chimera in formulations of B. thuringiensis-based lepidopteran larvicides.

Functional and Promoter Analysis of ChiIV3, a Chitinase of Pepper Plant, in Response to Phytophthora capsici Infection.

Science.gov (United States)

Liu, Zhiqin; Shi, Lanping; Yang, Sheng; Lin, Youquan; Weng, Yahong; Li, Xia; Hussain, Ansar; Noman, Ali; He, Shuilin

2017-08-01

Despite the involvement of many members of the chitinase family in plant immunity, the precise functions of the majority of the members remain poorly understood. Herein, the gene ChiIV3 in Capsicum annuum encoding a chitinase protein containing a chitin binding domain and targeting to the plasma membrane was found to be induced by Phytophthora capsici inoculation (PCI) and applied chitin treatment. Besides its direct inhibitory effect on growth of Phytophthora capsici ( P. capsici ), ChiIV3 was also found by virus-induced gene silencing (VIGS) and transient overexpression (TOE) in pepper plants to act as a positive regulator of plant cell death and in triggering defense signaling and upregulation of PR (pathogenesis related) genes against PCI. A 5' deletion assay revealed that pChiIV3 -712 to -459 bp was found to be sufficient for ChiIV3' response to PCI. Furthermore, a mutation assay indicated that W-box -466 to -461 bp in pChiIV3 -712 to -459 bp was noted to be the PCI-responsible element. These results collectively suggest that ChiIV3 acts as a likely antifungal protein and as a receptor for unidentified chitin in planta to trigger cell death and defense signaling against PCI.

Acidic mammalian chitinase in dry eye conditions.

Science.gov (United States)

Musumeci, Maria; Aragona, Pasquale; Bellin, Milena; Maugeri, Francesco; Rania, Laura; Bucolo, Claudio; Musumeci, Salvatore

2009-07-01

An acidic mammalian chitinase (AMCase) seems to be implicated in allergic asthma and allergic ocular pathologies. The aim of this work was to investigate the role of AMCase during Sjögren's Syndrome (SS) and Meibomian Gland Dysfunction (MGD) dry eye diseases. Six patients with MGD dry eye (20-58 years, median 40) and six patients with dry eye associated to SS (32-60 years, median 47) were enrolled in this study. AMCase activity was measured in tears and AMCase mRNA expression was evaluated by real-time polymerase chain reaction from RNA extracted from epithelial cells of the conjunctiva. Six healthy adult subjects of the same age (34-44 years, median 39) were also studied as the control group. AMCase activity was significantly increased in patients affected by MGD dry eye (18.54 +/- 1.5 nmol/ml/h) and SS dry eye (8.94 +/- 1.0 nmol/ml/h) respectively, compared to healthy controls (1.6 +/- 0.2 nmol/ml/h). AMCase activity was higher in the tears of subjects with MGD dry eye (P < 0.001). AMCase mRNA was detected in conjunctival epithelial cells and the expression was significantly higher in MGD dry eye than SS dry eye. A significant correlation between AMCase activity in the tears and mRNA in conjunctival epithelial cells was found. AMCase may be an important marker in the pathogenesis of dry eye, suggesting the potential role of AMCase as a therapeutic target in these frequent pathologies.

Overexpression of a New Chitinase Gene EuCHIT2 Enhances Resistance to Erysiphe cichoracearum DC. in Tobacco Plants

Directory of Open Access Journals (Sweden)

Xuan Dong

2017-11-01

Full Text Available In this study, we cloned a new chitinase gene, EuCHIT2, from Eucommia ulmoides Oliver (E. ulmoides using rapid amplification of cDNA ends (RACE technology and constructed an overexpression vector, pSH-35S-EuCHIT2, to introduce it into tobacco (Nicotiana tabacum cv. Xanthi. Resistance to Erysiphe cichoracearum de Candolle (E.cichoracearum DC and molecular mechanisms in the transgenic tobacco were determined by drop inoculation, spore counting, determination of physicochemical indicators, and analysis of gene expression. The chitinase activity and resistance to E. cichoracearum DC were significantly higher in the transgenic tobacco than in wild-type tobacco (p < 0.05. The activities of peroxidase (POD and catalase (CAT, after inoculation with E. cichoracearum DC, were higher in the transgenic tobacco than in the wild-type. Conversely, the malondialdehyde (MDA content was significantly lower in the transgenic tobacco than the wild-type before and after inoculation. In addition, our study also indicated that the resistance to E. cichoracearum DC might involve the salicylic acid (SA and jasmonic acid (JA pathways, because the expression levels of pathogenesis-related gene 1 (PR-1a and coronatine-insensitive 1 (COI1 were significantly increased and decreased, respectively, after inoculation with E. cichoracearum DC. The present study supports the notion that PR-1a and POD participate in resistance to E. cichoracearum DC in the transgenic tobacco plants.

The chitinase-like protein YKL-40 increases mucin5AC production in human bronchial epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Chunyi; Li, Qi [Division of Respiratory Medicine, Second Affiliated Hospital, Chongqing Medical University, No. 74, Linjiang Road, Yuzhong District, Chongqing 400010 (China); Zhou, Xiangdong, E-mail: zxd999@263.net [Division of Respiratory Medicine, Second Affiliated Hospital, Chongqing Medical University, No. 74, Linjiang Road, Yuzhong District, Chongqing 400010 (China); Kolosov, Victor P.; Perelman, Juliy M. [Far Eastern Scientific Center of Physiology and Pathology of Respiration, Siberian Branch, Russian Academy of Medical Sciences, Blagoveshchensk (Russian Federation)

2013-11-01

Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases. However, the regulatory mechanisms that mediate excessive mucin production remain elusive. Recently, the level of YKL-40, a chitinase-like protein, has been found to be significantly increased in chronic inflammatory airway diseases and has been shown to be associated with the severity of these diseases. In this study, we sought to explore the effect of YKL-40 on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in this process. We found that elevated YKL-40 levels increased the mRNA and protein expression of MUC5AC in a dose- and time-dependent manner, in association with the phosphorylation of extracellular signal-regulated kinase (ERK) and nuclear factor κB (NF-κB), reflecting their activation. These responses were significantly suppressed by the knockdown of protease-activating receptor 2 (PAR2) with specific small interfering RNA or the inhibitors of ERK and NF-κB. YKL-40-induced MUC5AC overproduction was also effectively attenuated by the inhibitor of focal adhesion kinase (FAK). Taken together, these results imply that YKL-40 can stimulate excessive MUC5AC production through PAR2- and FAK-mediated mechanisms. - Highlights: • MUC5AC is the major secreted mucin in chronic inflammatory airway diseases. • YKL-40 is a prototype of the chitinase-like protein in mammals. • YKL-40 is an active player in chronic inflammatory airway diseases. • YKL-40 can increase MUC5AC production via PAR2-mediated pathway. • FAK is another candidate to mediate YKL-40-induced MUC5AC overexpression.

The chitinase-like protein YKL-40 increases mucin5AC production in human bronchial epithelial cells

International Nuclear Information System (INIS)

Liu, Chunyi; Li, Qi; Zhou, Xiangdong; Kolosov, Victor P.; Perelman, Juliy M.

2013-01-01

Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases. However, the regulatory mechanisms that mediate excessive mucin production remain elusive. Recently, the level of YKL-40, a chitinase-like protein, has been found to be significantly increased in chronic inflammatory airway diseases and has been shown to be associated with the severity of these diseases. In this study, we sought to explore the effect of YKL-40 on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in this process. We found that elevated YKL-40 levels increased the mRNA and protein expression of MUC5AC in a dose- and time-dependent manner, in association with the phosphorylation of extracellular signal-regulated kinase (ERK) and nuclear factor κB (NF-κB), reflecting their activation. These responses were significantly suppressed by the knockdown of protease-activating receptor 2 (PAR2) with specific small interfering RNA or the inhibitors of ERK and NF-κB. YKL-40-induced MUC5AC overproduction was also effectively attenuated by the inhibitor of focal adhesion kinase (FAK). Taken together, these results imply that YKL-40 can stimulate excessive MUC5AC production through PAR2- and FAK-mediated mechanisms. - Highlights: • MUC5AC is the major secreted mucin in chronic inflammatory airway diseases. • YKL-40 is a prototype of the chitinase-like protein in mammals. • YKL-40 is an active player in chronic inflammatory airway diseases. • YKL-40 can increase MUC5AC production via PAR2-mediated pathway. • FAK is another candidate to mediate YKL-40-induced MUC5AC overexpression

Mining of unexplored habitats for novel chitinases - chiA as a helper gene proxy in metagenomics

DEFF Research Database (Denmark)

Cretoiu, Mariana Silvia; Kielak, Anna Maria; Abu Al-Soud, Waleed

2012-01-01

encompassed (1) classical overall enzymatic assays, (2) chiA gene abundance measurement by qPCR, (3) chiA gene pyrosequencing, and (4) chiA gene-based PCR-DGGE was used. The chiA gene pyrosequencing is unprecedented, as it is the first massive parallel sequencing of this gene. The data obtained showed...... the existence across habitats of core bacterial communities responsible for chitin assimilation irrespective of ecosystem origin. Conversely, there were habitat-specific differences. In addition, a suite of sequences were obtained that are as yet unregistered in the chitinase database. In terms of chiA gene...

Extraction of Crude Chitinase from Higher Plants and their Chitin-Hydrolysis Activities; Kotosyokubutu yurai kichinaze no chusyutu to kichin bunkai kassei

Energy Technology Data Exchange (ETDEWEB)

Kondo, K.; Harada, K.; Shibata, M.; Maeda, R. [Doshisha Univ., Kyoto (Japan). Faculty of Engineering

1997-07-10

To prepare a purified chitinase from higher plants, firstly, crude enzymes were extracted from six higher plants, namely, radish seeds, sunflower seeds, watermelon seeds, bamboo leaves, orange skin, and persimmon skin. Using these crude enzymes, pH dependencies of hydrolysis reaction of colloidal chitin are investigated. For radish seeds and bamboo leaves, which have relatively high activities, the kinetics of enzymatic reaction are studies. It is clear that these reactions obey Michaelis-Menten kinetics. 7 refs., 3 figs., 2 tabs.

Circulating serum interleukin-6, serum chitinase-3-like protein-1, and plasma vascular endothelial growth factor are not predictive for remission and radiographic progression in patients with early rheumatoid arthritis

DEFF Research Database (Denmark)

Brahe, C H; Dehlendorff, C; Østergaard, M

2018-01-01

OBJECTIVE: To investigate serum interleukin-6 (IL-6), serum chitinase-3-like protein-1 (YKL-40), and plasma vascular endothelial growth factor (VEGF) as measures of disease activity and predictors of clinical remission and radiographic progression in two early rheumatoid arthritis (RA) randomized...

A chitinase with two catalytic domains is required for organization of the cuticular extracellular matrix of a beetle.

Directory of Open Access Journals (Sweden)

Mi Young Noh

2018-03-01

Full Text Available Insect cuticle or exoskeleton is an extracellular matrix formed primarily from two different structural biopolymers, chitin and protein. During each molt cycle, a new cuticle is deposited simultaneously with degradation of the inner part of the chitinous procuticle of the overlying old exoskeleton by molting fluid enzymes including epidermal chitinases. In this study we report a novel role for an epidermal endochitinase containing two catalytic domains, TcCHT7, from the red flour beetle, Tribolium castaneum, in organizing chitin in the newly forming cuticle rather than in degrading chitin present in the prior one. Recombinant TcCHT7 expressed in insect cells is membrane-bound and capable of hydrolyzing an extracellular chitin substrate, whereas in vivo, this enzyme is also released from the plasma membrane and co-localizes with chitin in the entire procuticle. RNAi of TcCHT7 reveals that this enzyme is nonessential for any type of molt or degradation of the chitinous matrix in the old cuticle. In contrast, TcCHT7 is required for maintaining the integrity of the cuticle as a compact structure of alternating electron-dense and electron-lucent laminae. There is a reduction in thickness of elytral and leg cuticles after RNAi for TcCHT7. TcCHT7 is also required for formation of properly oriented long chitin fibers inside pore canals that are vertically oriented columnar structures, which contribute to the mechanical strength of a light-weight, yet rigid, adult cuticle. The conservation of CHT7-like proteins harboring such a unique domain configuration among many insect and other arthropod species indicates a critical role for the group III class of chitinases in the higher ordered organization of chitin fibers for development of the structural integrity of many invertebrate exoskeletons.

A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

DEFF Research Database (Denmark)

Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

2011-01-01

role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

Hevamine, a chitinase from the rubber tree Hevea brasiliensis, cleaves peptidoglycan between the C-1 of N-acetylglucosamine and C-4 of N-acetylmuramic acid and therefore is not a lysozyme

NARCIS (Netherlands)

Bokma, E; vanKoningsveld, GA; JeronimusStratingh, M; Beintema, JJ

1997-01-01

Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. In this paper the cleavage specificity of hevamine for peptidoglycan was studied by HPLC and mass-spectrometry analysis of enzymatic digests. The results clearly showed that the enzyme

Chitinase, beta-1,3-glucanase, osmotin, and extensin are expressed in tobacco explants during flower formation

DEFF Research Database (Denmark)

Neale, A D; Wahleithner, J A; Lund, Marianne

1990-01-01

be considered a pathogenesis-related protein. These genes, which were highly expressed in explants during de novo flower formation but not in explants forming vegetative shoots [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35], were also regulated developmentally in day-neutral and photoresponsive tobacco......Sequence analysis of five gene families that were isolated from tobacco thin cell layer explants initiating floral development [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35] showed that two encode the pathogenesis-related proteins basic chitinase and basic beta-1,3-glucanase, while a third...... encodes the cell wall protein extensin, which also accumulates during pathogen attack. Another sequence family encodes the water stress-induced protein osmotin [Singh et al. (1989). Plant Physiol. 90, 1096-1101]. We found that osmotin was also induced by viral infection and wounding and, hence, could...

Enhanced resistance to blister blight in transgenic tea (Camellia sinensis [L.] O. Kuntze) by overexpression of class I chitinase gene from potato (Solanum tuberosum).

Science.gov (United States)

Singh, H Ranjit; Deka, Manab; Das, Sudripta

2015-07-01

Tea is the second most consumed beverage in the world. A crop loss of up to 43 % has been reported due to blister blight disease of tea caused by a fungus, Exobasidium vexans. Thus, it directly affects the tea industry qualitatively and quantitatively. Solanum tuberosum class I chitinase gene (AF153195) is a plant pathogenesis-related gene. It was introduced into tea genome via Agrobacterium-mediated transformation with hygromycin phosphotransferase (hpt) gene conferring hygromycin resistance as plant selectable marker. A total of 41 hygromycin resistant plantlets were obtained, and PCR analysis established 12 plantlets confirming about the stable integration of transgene in the plant genome. Real-time PCR detected transgene expression in four transgenic plantlets (T28, C57, C9, and T31). Resistance to biotrophic fungal pathogen, E. vexans, was tested by detached leaf infection assay of greenhouse acclimated plantlets. An inhibitory activity against the fungal pathogen was evident from the detached leaves from the transformants compared with the control. Fungal lesion formed on control plantlet whereas the transgenic plantlets showed resistance to inoculated fungal pathogen by the formation of hypersensitivity reaction area. This result suggests that constitutive expression of the potato class I chitinase gene can be exploited to improve resistance to fungal pathogen, E. vexans, in economical perennial plantation crop like tea.

Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

DEFF Research Database (Denmark)

Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

2008-01-01

Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

International Nuclear Information System (INIS)

Miyatake, Kazumasa; Tsuji, Kunikazu; Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer; Sekiya, Ichiro; Muneta, Takeshi

2013-01-01

Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis

Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

Energy Technology Data Exchange (ETDEWEB)

Miyatake, Kazumasa [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Tsuji, Kunikazu, E-mail: ktsuji.gcoe@tmd.ac.jp [International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan); Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Sekiya, Ichiro [Section of Cartilage Regeneration, Tokyo Medical and Dental University, Tokyo (Japan); Muneta, Takeshi [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan)

2013-02-01

Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis.

Characterization of Pseudomonas aeruginosa chitinase, a gradually secreted protein.

Science.gov (United States)

Folders, J; Algra, J; Roelofs, M S; van Loon, L C; Tommassen, J; Bitter, W

2001-12-01

The gram-negative bacterium Pseudomonas aeruginosa secretes many proteins into its extracellular environment via the type I, II, and III secretion systems. In this study, a gene, chiC, coding for an extracellular chitinolytic enzyme, was identified. The chiC gene encodes a polypeptide of 483 amino acid residues, without a typical N-terminal signal sequence. Nevertheless, an N-terminal segment of 11 residues was found to be cleaved off in the secreted protein. The protein shows sequence similarity to the secreted chitinases ChiC of Serratia marcescens, ChiA of Vibrio harveyi, and ChiD of Bacillus circulans and consists of an activity domain and a chitin-binding domain, which are separated by a fibronectin type III domain. ChiC was able to bind and degrade colloidal chitin and was active on the artificial substrates carboxymethyl-chitin-Remazol Brilliant Violet and p-nitrophenyl-beta-D-N,N',N"-triacetylchitotriose, but not on p-nitrophenyl-beta-D-N-acetylglucosamine, indicating that it is an endochitinase. Expression of the chiC gene appears to be regulated by the quorum-sensing system of P. aeruginosa, since this gene was not expressed in a lasIR vsmI mutant. After overnight growth, the majority of the ChiC produced was found intracellularly, whereas only small amounts were detected in the culture medium. However, after several days, the cellular pool of ChiC was largely depleted, and the protein was found in the culture medium. This release could not be ascribed to cell lysis. Since ChiC did not appear to be secreted via any of the known secretion systems, a novel secretion pathway seems to be involved.

The Correlation between Chitin and Acidic Mammalian Chitinase in Animal Models of Allergic Asthma

Directory of Open Access Journals (Sweden)

Chia-Rui Shen

2015-11-01

Full Text Available Asthma is the result of chronic inflammation of the airways which subsequently results in airway hyper-responsiveness and airflow obstruction. It has been shown that an elicited expression of acidic mammalian chitinase (AMCase may be involved in the pathogenesis of asthma. Our recent study has demonstrated that the specific suppression of elevated AMCase leads to reduced eosinophilia and Th2-mediated immune responses in an ovalbumin (OVA-sensitized mouse model of allergic asthma. In the current study, we show that the elicited expression of AMCase in the lung tissues of both ovalbumin- and Der P2-induced allergic asthma mouse models. The effects of allergic mediated molecules on AMCase expression were evaluated by utilizing promoter assay in the lung cells. In fact, the exposure of chitin, a polymerized sugar and the fundamental component of the major allergen mite and several of the inflammatory mediators, showed significant enhancement on AMCase expression. Such obtained results contribute to the basis of developing a promising therapeutic strategy for asthma by silencing AMCase expression.

Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

Directory of Open Access Journals (Sweden)

Mohammad S. Khan

2017-07-01

Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

CytR Is a Global Positive Regulator of Competence, Type VI Secretion, and Chitinases in Vibrio cholerae.

Directory of Open Access Journals (Sweden)

Samit S Watve

Full Text Available The facultative pathogen Vibrio cholerae transitions between its human host and aquatic reservoirs where it colonizes chitinous surfaces. Growth on chitin induces expression of chitin utilization genes, genes involved in DNA uptake by natural transformation, and a type VI secretion system that allows contact-dependent killing of neighboring bacteria. We have previously shown that the transcription factor CytR, thought to primarily regulate the pyrimidine nucleoside scavenging response, is required for natural competence in V. cholerae. Through high-throughput RNA sequencing (RNA-seq, we show that CytR positively regulates the majority of competence genes, the three type VI secretion operons, and the four known or predicted chitinases. We used transcriptional reporters and phenotypic analysis to determine the individual contributions of quorum sensing, which is controlled by the transcription factors HapR and QstR; chitin utilization that is mediated by TfoX; and pyrimidine starvation that is orchestrated by CytR, toward each of these processes. We find that in V. cholerae, CytR is a global regulator of multiple behaviors affecting fitness and adaptability in the environment.

Asexual sporulation signalling regulates autolysis of Aspergillus nidulans via modulating the chitinase ChiB production.

Science.gov (United States)

Pócsi, I; Leiter, E; Kwon, N-J; Shin, K-S; Kwon, G-S; Pusztahelyi, T; Emri, T; Abuknesha, R A; Price, R G; Yu, J-H

2009-08-01

Elucidation of the regulation of ChiB production in Aspergillus nidulans. Mutational inactivation of the A. nidulans chiB gene resulted in a nonautolytic phenotype. To better understand the mechanisms controlling both developmental progression and fungal autolysis, we examined a range of autolysis-associated parameters in A. nidulans developmental and/or autolytic mutants. Investigation of disorganization of mycelial pellets, loss of biomass, extra-/intracellular chitinase activities, ChiB production and chiB mRNA levels in various cultures revealed that, in submerged cultures, initialization of autolysis and stationary phase-induced ChiB production are intimately coupled, and that both processes are controlled by the FluG-BrlA asexual sporulation regulatory pathway. ChiB production does not affect the progression of apoptotic cell death in the aging A. nidulans cultures. The endochitinase ChiB plays an important role in autolysis of A. nidulans, and its production is initiated by FluG-BrlA signalling. Despite the fact that apoptosis is an inseparable part of fungal autolysis, its regulation is independent to FluG-initiated sporulation signalling. Deletion of chiB and fluG homologues in industrial filamentous fungal strains may stabilize the hyphal structures in the autolytic phase of growth and limit the release of autolytic hydrolases into the culture medium.

A chitinase is required for Xylella fastidiosa colonization of its insect and plant hosts.

Science.gov (United States)

Labroussaa, Fabien; Ionescu, Michael; Zeilinger, Adam R; Lindow, Steven E; Almeida, Rodrigo P P

2017-04-01

Xylella fastidiosa colonizes the xylem network of host plant species as well as the foregut of its required insect vectors to ensure efficient propagation. Disease management strategies remain inefficient due to a limited comprehension of the mechanisms governing both insect and plant colonization. It was previously shown that X. fastidiosa has a functional chitinase (ChiA), and that chitin likely serves as a carbon source for this bacterium. We expand on that research, showing that a chiA mutant strain is unable to grow on chitin as the sole carbon source. Quantitative PCR assays allowed us to detect bacterial cells in the foregut of vectors after pathogen acquisition; populations of the wild-type and complemented mutant strain were both significantly larger than the chiA mutant strain 10 days, but not 3 days, post acquisition. These results indicate that adhesion of the chiA mutant strain to vectors may not be impaired, but that cell multiplication is limited. The mutant was also affected in its transmission by vectors to plants. In addition, the chiA mutant strain was unable to colonize host plants, suggesting that the enzyme has other substrates associated with plant colonization. Lastly, ChiA requires other X. fastidiosa protein(s) for its in vitro chitinolytic activity. The observation that the chiA mutant strain is not able to colonize plants warrants future attention to be paid to the substrates for this enzyme.

Estudio de los genes allinasa y quitinasa en el ajo costarricense (Allium sativum L. Study of the genes alliinase and chitinase in materials of costarican garlic (Allium sativum L

Directory of Open Access Journals (Sweden)

Karina Barboza Rojas

2013-03-01

Full Text Available El cultivo del ajo en Costa Rica se ha visto afectado por la calidad y cantidad de semillas almacenadas. La producción de los bulbos también se ve deteriorada por las enfermedades. Sin embargo, este cultivo es apetecido por su sabor, considerado superior al del ajo importado de China. La pungencia del ajo está dada en parte por la acción de la enzima allinasa. Además, la resistencia a ciertos hongos patógenos está influenciada por la actividad de la enzima quitinasa. En el presente estudio se analizaron los genes que codifican para ambas enzimas, utilizando plántulas in vitro obtenidas a partir de materiales de las zonas de Llano Grande, Santa Ana, Miramar, San Ramón y de ajo importado de China. Se compararon y estudiaron las secuencias de ADN utilizando estos genes, con el fin de encontrar diferencias que permitieran la caracterización de distintos materiales. Los resultados obtenidos indicaron la presencia de distintas copias del gen allinasa. El gen de la quitinasa presentó una secuencia muy conservada en todos los materiales analizados. Se encontraron dos intrones altamente conservados en el germoplasma costarricense y el material de referencia asiático. Se concluyó que el ajo costarricense es muy similar al asiático. Y se presenta el primer informe de la existencia de intrones en la quitinasa del ajo.Garlic production in Costa Rica has been affected by the quality and quantity of the harvested seeds. Bulb production has also been deteriorated by diseases. However, this crop is preferred for its flavor, considered superior to the one imported from China. Pungency of garlic is partially due to the action of the alliinase enzyme. Furthermore, the resistance to certain pathogenic fungi is influenced by the chitinase enzyme activity. The encoding genes for both enzymes were analyzed in this study, by using in vitro plantlets obtained from local materials from Llano Grande, Santa Ana, Miramar and San Ramon zones and garlic imported

Improved fluorescent labeling of chitin oligomers: Chitinolytic properties of acidic mammalian chitinase under somatic tissue pH conditions.

Science.gov (United States)

Wakita, Satoshi; Kimura, Masahiro; Kato, Naoki; Kashimura, Akinori; Kobayashi, Shunsuke; Kanayama, Naoto; Ohno, Misa; Honda, Shotaro; Sakaguchi, Masayoshi; Sugahara, Yasusato; Bauer, Peter O; Oyama, Fumitaka

2017-05-15

Acidic mammalian chitinase (AMCase) has been implicated in various pathophysiological conditions including asthma, allergic inflammation and food processing. AMCase is most active at pH 2.0, and its activity gradually decreases to up to pH 8. Here we analyzed chitin degradation by AMCase in weak acidic to neutral conditions by fluorophore-assisted carbohydrate electrophoresis established originally for oligosaccharides analysis. We found that specific fragments with slower-than-expected mobility as defined by chitin oligosaccharide markers were generated at pH 5.0∼8.0 as by-products of the reaction. We established an improved method for chitin oligosaccharides suppressing this side reaction by pre-acidification of the fluorophore-labeling reaction mixture. Our improved method specifically detects chitin oligosaccharides and warrants quantification of up to 50nmol of the material. Using this strategy, we found that AMCase produced dimer of N-acetyl-d-glucosamine (GlcNAc) at strong acidic to neutral condition. Moreover, we found that AMCase generates (GlcNAc) 2 as well as (GlcNAc) 3 under physiological conditions. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Chitinase 3-like 1 protein levels are elevated in Schistosoma haematobium infected children.

Directory of Open Access Journals (Sweden)

Laura J Appleby

Full Text Available Currently there are few studies characterising the nature and aetiology of human schistosome-related inflammatory processes. The aim of this study was to determine the relationship between Chitinase 3-like 1 (CHI3L1, also known as YKL-40, a molecule associated with inflammatory processes, and schistosome infection, morbidity and systemic cytokine levels.Serological levels of CHI3L1 and a panel of cytokines (IFN-y, IL-4/5/6/9/10/13 and 17 were measured in two Zimbabwean populations resident in a high and low schistosome infection area. CHI3L1 levels were related to schistosome infection, haematuria status and cytokine levels after allowing for confounding variables. The effect of antihelminthic treatment with praziquantel on CHI3L1 levels was determined in 246 participants 6 weeks post-treatment.CHI3L1 levels increased with age in both areas but were significantly higher in the high infection areas compared to the low infection area. CHI3L1 levels were also higher in infected compared to uninfected individuals with this difference being significant in the youngest age group. Curative antihelminthic treatment resulted in a significant decrease in CHI3L1 levels. Of the cytokines, only IL-10 and IL-17 had a significant association with CHI3L1 levels, and this association was negative.Serum CHI3L1 levels differ between infected and uninfected people before and after antihelminthic treatment. The greatest difference occurs in the youngest age group, in keeping with the period when schistosome-related pathological processes are initiated. Following from previous studies in non-infectious diseases showing that CHI3L1 is a biomarker for the inflammatory process, this study suggests that the potential for CHI3L1 as a biomarker for schistosome-related pathology should be explored further.

Micorrização e indução de quitinases e β-1,3-glucanases e resistência à fusariose em porta-enxerto de videira Mycorrhizal inoculation and induction of chitinases and β-1,3-glucanases and fusarium resistance in grapevine rootstock

Directory of Open Access Journals (Sweden)

Murilo Dalla Costa

2010-04-01

Full Text Available O objetivo deste trabalho foi avaliar os níveis de expressão de β-1,3-glucanases e quitinases nos porta-enxertos de videira SO4 e R110, respectivamente suscetível e resistente a Fusarium oxysporum f. sp. herbemontis, bem como avaliar o efeito do fungo micorrízico arbuscular Glomus intraradices no crescimento, na expressão dessas enzimas e na supressão do patógeno no porta-enxerto suscetível. Foram quantificadas as atividades enzimáticas de β-1,3-glucanases e quitinases nas raízes dos porta-enxertos. Mudas do porta-enxerto SO4 receberam inóculos de G. intraradices e F. oxysporum, e foram avaliadas quanto ao crescimento, atividade das duas enzimas e sintomas de doença. As atividades das enzimas nas raízes do porta-enxerto resistente aumentaram entre 0 e 5 dias após a inoculação do patógeno. A atividade de quitinases nas raízes do porta-enxerto suscetível aumentou com a inoculação do fungo micorrízico e do patógeno. A atividade de β-1,3-glucanases foi maior somente com a presença do fungo micorrízico e do patógeno. Videiras com inoculação de G. intraradices apresentaram diminuição nos sintomas de infecção por Fusarium spp., o que indica que o fungo micorrízico promove a indução de quitinases e β-1,3-glucanases especificamente na supressão ou inibição do patógeno.The objective of this work was to evaluate the expression levels of β-1,3-glucanases and chitinases in SO4 and 110 grapevine rootstocks, respectively susceptible and resistant to Fusarium oxysporum f. sp. herbemontis, as well as to evaluate the effect of the arbuscular mycorrhizal fungus Glomus intraradices on plant growth, on enzyme expression and on pathogen suppression in the susceptible rootstock. The enzyme activities of β-1,3-glucanases and chitinases in the rootstocks roots were evaluated. Plant growth, enzyme activity, and disease symptoms were evaluated in SO4 plantlets inoculated with G. intraradices and F. oxysporum. Enzyme activities

A glycosynthase derived from an inverting GH19 chitinase from the moss Bryum coronatum.

Science.gov (United States)

Ohnuma, Takayuki; Fukuda, Tatsuya; Dozen, Satoshi; Honda, Yuji; Kitaoka, Motomitsu; Fukamizo, Tamo

2012-06-15

BcChi-A, a GH19 chitinase from the moss Bryum coronatum, is an endo-acting enzyme that hydrolyses the glycosidic bonds of chitin, (GlcNAc)(n) [a β-1,4-linked polysaccharide of GlcNAc (N-acetylglucosamine) with a polymerization degree of n], through an inverting mechanism. When the wild-type enzyme was incubated with α-(GlcNAc)2-F [α-(GlcNAc)(2) fluoride] in the absence or presence of (GlcNAc)(2), (GlcNAc)(2) and hydrogen fluoride were found to be produced through the Hehre resynthesis-hydrolysis mechanism. To convert BcChi-A into a glycosynthase, we employed the strategy reported by Honda et al. [(2006) J. Biol. Chem. 281, 1426-1431; (2008) Glycobiology 18, 325-330] of mutating Ser(102), which holds a nucleophilic water molecule, and Glu(70), which acts as a catalytic base, producing S102A, S102C, S102D, S102G, S102H, S102T, E70G and E70Q. In all of the mutated enzymes, except S102T, hydrolytic activity towards (GlcNAc)(6) was not detected under the conditions we used. Among the inactive BcChi-A mutants, S102A, S102C, S102G and E70G were found to successfully synthesize (GlcNAc)(4) as a major product from α-(GlcNAc)(2)-F in the presence of (GlcNAc)(2). The S102A mutant showed the greatest glycosynthase activity owing to its enhanced F(-) releasing activity and its suppressed hydrolytic activity. This is the first report on a glycosynthase that employs amino sugar fluoride as a donor substrate.

Effect of mouse antisera targeting the Phlebotomus papatasi midgut chitinase PpChit1 on sandfly physiology and fitness

Directory of Open Access Journals (Sweden)

Maricela Robles-Murguia

2014-12-01

Full Text Available In sandflies, the absence of the peritrophic matrix (PM affects the rate of blood digestion. Also, the kinetics of PM secretion varies according to species. We previously characterised PpChit1, a midgut-specific chitinase secreted in Phlebotomus papatasi (PPIS that is involved in the maturation of the PM and showed that antibodies against PpChit1 reduce the chitinolytic activity in the midgut of several sandfly species. Here, sandflies were fed on red blood cells reconstituted with naïve or anti-PpChit1 sera and assessed for fitness parameters that included blood digestion, oviposition onset, number of eggs laid, egg bouts, average number of eggs per bout and survival. In PPIS, anti-PpChit1 led to a one-day delay in the onset of egg laying, with flies surviving three days longer compared to the control group. Anti-PpChit1 also had a negative effect on overall ability of flies to lay eggs, as several gravid females from all three species were unable to lay any eggs despite having lived longer than control flies. Whereas the longer survival might be associated with improved haeme scavenging ability by the PM, the inability of females to lay eggs is possibly linked to changes in PM permeability affecting nutrient absorption.

Digestion and metabolism of carbohydrates in fish

OpenAIRE

Abro, Rani

2014-01-01

This thesis deals with the digestion and metabolism of carbohydrates in Arctic charr, Eurasian perch and tilapia. Two sources of carbohydrates, native starch (wheat) and chitin (zygomycete biomass), were evaluated. Gut tissue of Arctic charr displayed significant chitinase activity, of both endo- and exo-chitinase forms. Moreover, the distribution pattern along the gastrointestinal tract of Arctic charr differed between endo-chitinase and exo-chitinase. The endo-chitinase activity in sto...

Chitinase-3-like Protein 1: A Progranulin Downstream Molecule and Potential Biomarker for Gaucher Disease

Directory of Open Access Journals (Sweden)

Jinlong Jian

2018-02-01

Full Text Available We recently reported that progranulin (PGRN is a novel regulator of glucocerebrosidase and its deficiency associates with Gaucher Diseases (GD (Jian et al., 2016a; Jian et al., 2018. To isolate the relevant downstream molecules, we performed a whole genome microarray and mass spectrometry analysis, which led to the isolation of Chitinase-3-like-1 (CHI3L1 as one of the up-regulated genes in PGRN null mice. Elevated levels of CHI3L1 were confirmed by immunoblotting and immunohistochemistry. In contrast, treatment with recombinant Pcgin, a derivative of PGRN, as well as imigluerase, significantly reduced the expressions of CHI3L1 in both PGRN null GD model and the fibroblasts from GD patients. Serum levels of CHIT1, a clinical biomarker for GD, were significantly higher in GD patients than healthy controls (51.16 ± 2.824 ng/ml vs 35.07 ± 2.099 ng/ml, p < 0.001. Similar to CHIT1, serum CHI3L1 was also significantly increased in GD patients compared with healthy controls (1736 ± 152.1 pg/ml vs 684.7 ± 68.20 pg/ml, p < 0.001. Whereas the PGRN level is significantly reduced in GD patients as compared to the healthy control (91.56 ± 3.986 ng/ml vs 150.6 ± 4.501, p < 0.001. Collectively, these results indicate that CHI3L1 may be a previously unrecognized biomarker for diagnosing GD and for evaluating the therapeutic effects of new GD drug(s.

Purificação e caracterização da quitinase de uva (Vitis vinífera L. cv Red Globe para a produção de quitosana a partir de quitina de camarão

Directory of Open Access Journals (Sweden)

Laidson Paes Gomes

2010-01-01

Full Text Available Chitinase is produced by a wide variety of plants as a defense against peste attacks. In this study, grape chitinases were purified 16 times by fractionation in 80% ammonium sulfate followed by dialysis and filtration. Purified chitinases exhibited enzymatic activity toward chitin azure. The yield of purified chitinase was 229 mg/L with chitinase activity of 563 U/g. Chitinases had molecular masses of 24 and 30 kDa, as evaluated by SDS-PAGE 12.5%. Two pH optima were determined 3.0 and 6.0. The optimal temperature was 42 °C. Pre hydrolysis of crystalline shrimp chitin by chitinases caused in an increase in the deacetylation ratio triggered by chitin deacetylase producing chitooligosaccharides with DA (degree acetylation of 58.8%.

High Endogenous Expression of Chitinase 3-Like 1 and Excessive Epithelial Proliferation with Colonic Tumor Formation in MOLF/EiJ Mice.

Directory of Open Access Journals (Sweden)

Daren Low

Full Text Available Colorectal cancer (CRC development is mediated by uncontrolled survival and proliferation of tumor progenitor cells. Using animal models to identify and study host-derived factors that underlie this process can aid interventions in preventing tumor expansion and metastasis. In healthy steady states in humans and mice (e.g. C57BL/6 strain, colonic Chitinase 3-like 1 (CHI3L1 gene expression is undetectable. However, this expression can be induced during intestinal inflammation and tumorigenesis where CHI3L1 plays an important role in tissue restitution and cell proliferation. Here, we show that a wild-derived mouse strain MOLF/EiJ expresses high levels of colonic epithelial CHI3L1 at the steady state due to several nucleotide polymorphisms in the proximal promoter regions of the CHI3L1 gene. Interestingly, these mice spontaneously developed polypoid nodules in the colon with signs of immune cell infiltrations at steady state. The CHI3L1 positive colonic epithelial cells were highly proliferative and exhibited malignant transformation and expansion when exposed in vivo to azoxymethane, one of the well-known colonic carcinogens.

Introduction of a tryptophan side chain into subsite +1 enhances transglycosylation activity of a GH-18 chitinase from Arabidopsis thaliana, AtChiC

DEFF Research Database (Denmark)

Umemoto, Naoyuki; Ohnuma, Takayuki; Mizuhara, Mamiko

2013-01-01

A tryptophan side chain was introduced into subsite +1 of family GH-18 (class V) chitinases from Nicotiana tabacum and Arabidopsis thaliana (NtChiV and AtChiC, respectively) by the mutation of a glycine residue to tryptophan (G74W-NtChiV and G75W-AtChiC). The specific activity toward glycol chitin...... of the two mutant enzymes was 70-71% of that of the wild type. Using chitin oligosaccharides, (GlcNAc)(n) (n = 4, 5 and 6), as the substrates, we found the transglycosylation reaction to be significantly enhanced in G74W-NtChiV and G75W-AtChiC when compared with the corresponding wild-type enzymes....... The introduced tryptophan side chain might protect the oxazolinium ion intermediate from attack by a nucleophilic water molecule. The enhancement of transglycosylation activity was much more distinct in G75W-AtChiC than in G74W-NtChiV. Nuclear magnetic resonance titration experiments using the inactive double...

Molecular, Structural and Immunological Characterization of Der p 18, a Chitinase-Like House Dust Mite Allergen.

Directory of Open Access Journals (Sweden)

Yvonne Resch

Full Text Available The house dust mite (HDM allergen Der p 18 belongs to the glycoside hydrolase family 18 chitinases. The relevance of Der p 18 for house dust mite allergic patients has only been partly investigated.To perform a detailed characterization of Der p 18 on a molecular, structural and immunological level.Der p 18 was expressed in E. coli, purified to homogeneity, tested for chitin-binding activity and its secondary structure was analyzed by circular dichroism. Der p 18-specific IgG antibodies were produced in rabbits to localize the allergen in mites using immunogold electron microscopy and to search for cross-reactive allergens in other allergen sources (i.e. mites, crustacea, mollusca and insects. IgE reactivity of rDer p 18 was tested with sera from clinically well characterized HDM-allergic patients (n = 98 and its allergenic activity was analyzed in basophil activation experiments.Recombinant Der p 18 was expressed and purified as a folded, biologically active protein. It shows weak chitin-binding activity and partial cross-reactivity with Der f 18 from D. farinae but not with proteins from the other tested allergen sources. The allergen was mainly localized in the peritrophic matrix of the HDM gut and to a lower extent in fecal pellets. Der p 18 reacted with IgE from 10% of mite allergic patients from Austria and showed allergenic activity when tested for basophil activation in Der p 18-sensitized patients.Der p 18 is a rather genus-specific minor allergen with weak chitin-binding activity but exhibits allergenic activity and therefore should be included in diagnostic test panels for HDM allergy.

Plasma chitinase 3-like 1 is persistently elevated during first month after minimally invasive colorectal cancer resection

Institute of Scientific and Technical Information of China (English)

HMC Shantha Kumara; David Gaita; Hiromichi Miyagaki; Xiaohong Yan; Sonali AC Hearth; Linda Njoh; Vesna Cekic; Richard L Whelan

2016-01-01

AIM: To assess blood chitinase 3-like 1(CHi3L1) levels for 2 mo after minimally invasive colorectal resection(MICR) for colorectal cancer(CRC). METHODS: CRC patients in an Institutional Review Board approved data/plasma bank who underwent elective MICR for whom preoperative(PreO p), early postoperative(PostO p), and 1 or more late PostO p samples [postoperative day(POD) 7-27] available were included. Plasma CHi3L1 levels(ng/m L) were determined in duplicate by enzyme linked immunosorbent assay. RESULTS: PreOp and PostOp plasma sample were available for 80 MICR cancer patients for the study. The median PreOp CHi3L1 level was 56.8 CI: 41.9-78.6 ng/mL(n = 80). Significantly elevated(P < 0.001) median plasma levels(ng/mL) over PreOp levels were detected on POD1(667.7 CI: 495.7, 771.7; n = 79), POD 3(132.6 CI: 95.5, 173.7; n = 76), POD7-13(96.4 CI: 67.7, 136.9; n = 62), POD14-20(101.4 CI: 80.7, 287.4; n = 22), and POD 21-27(98.1 CI: 66.8, 137.4; n = 20, P = 0.001). No significant difference in plasma levels were noted on POD27-41. CONCLUSION: Plasma CHi3L1 levels were significantly elevated for one month after MICR. Persistently elevated plasma CHi3L1 may support the growth of residual tumor and metastasis.

Immunomodulation of Host Chitinase 3-Like 1 During a Mammary Pathogenic Escherichia coli Infection

Directory of Open Access Journals (Sweden)

Koen Breyne

2018-05-01

Full Text Available Chitin is a N-acetyl-d-glucosamine biopolymer that can be recognized by chitin-binding proteins. Although mammals lack chitin synthase, they induce proteins responsible for detecting chitin in response to bacterial infections. Our aim was to investigate whether chitinase 3-like 1 (CHI3L1 has a potential role in the innate immunity of the Escherichia coli (E. coli infected mammary gland. CHI3L1 protein was found to be secreted in whey of naturally coliform-affected quarters compared to whey samples isolated from healthy udders. In addition, gene expression of CHI3L1 was confirmed in udder tissue of cows experimentally infected with a mammary pathogenic E. coli (MPEC strain. Despite the known anatomical differences, the bovine udders’ innate immune response was mimicked by applying an experimental mouse model using MPEC or non-MPEC isolates. The effect of CHI3L1 expression in the murine mammary gland in response to coliform bacteria was investigated through the use of CHI3L1−/− mice as well as through treatment with either a pan-caspase inhibitor or chitin particles in wild-type mice. The local induction of CHI3L1 postinfection with different E. coli strains was demonstrated to be independent of both bacterial growth and mammary interleukin (IL-8 levels. Indeed, CHI3L1 emerged as a regulator impacting on the transcytosis of Ly6G-positive cells from the interstitial space into the alveolar lumen of the mammary tissue. Furthermore, CHI3L1 was found to be upstream regulated by caspase activity and had a major downstream effect on the local pro-inflammatory cytokine profile, including IL-1beta, IL-6, and RANTES/CCL5. In conclusion, CHI3L1 was demonstrated to play a key role in the cytokine and caspase signaling during E. coli triggered inflammation of the mammary gland.

Production, optimization, characterization and antifungal activity of ...

African Journals Online (AJOL)

Aspergillus terrus was found to be a good chitinase producer among the five fungi ... The high level of chitinase production was observed in the culture medium ... A. terrus chitinase was investigated against Apergillus niger, Aspergillus oryzae, ...

The Evidence of Non n-glycan Linked Mannose in Exochitinase 42kDa, from Trichoderma harzianum BIO10671 Glycosylation

Directory of Open Access Journals (Sweden)

Muskhazli, M.

2006-01-01

Full Text Available Chitinase 42 kDa produced by Trichoderma harzianum has been proven as a prime compound to be excreted onto the hyphae of the pathogen causing localised cell wall lysis at the point of interaction. Later it will initiate the process of the host cell becomes empty of cytoplasm, disintegrates and shows a rapid collapse. This study investigates the existence of N-glycan linked mannose in chitinase 42 kDa produced by the Malaysian T. harzianum strain BIO10671. The chitinase 42 kDa from T. harzianum BIO10671 was initially purified using anion exchange chromatography prior to a series of experiments such as immunoblotting against the chitinase 42 kDa antibody, lectin staining for detecting any terminal linked mannose, and galactofuranose detection to determine the presence of galatofuranase components in glycoproteins. The enzyme purification harvested about 12-fold of chitinase 42 kDa from T. harzianum BIO10671 with strong indication of the chitinase 42 kDa presence on SDS-Page. This was confirmed by immunoblotting with a strong response around 42 kDa after overnight incubation in chitinase 42 kDa antibody suggesting that the gene for chitinase 42 kDa was greatly expressed in this strain. There are no intervation of galatofuranose on any of the terminal mannose in chitinase 42 kDa as shown by negative results on samples treated with or without endoglycosidase-H and lectin staining. Therefore, it can be concludeed that glycosylation occurred in the chitinase 42 kDa from T. harzianum 42 kDa was not in the form of N-glycan linked mannose as expected.

Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

Science.gov (United States)

Ignacimuthu, S; Ceasar, S Antony

2012-03-01

Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

Breast Regression Protein-39/Chitinase 3-Like 1 Promotes Renal Fibrosis after Kidney Injury via Activation of Myofibroblasts.

Science.gov (United States)

Montgomery, Tinika A; Xu, Leyuan; Mason, Sherene; Chinnadurai, Amirtha; Lee, Chun Geun; Elias, Jack A; Cantley, Lloyd G

2017-11-01

The normal response to kidney injury includes a robust inflammatory infiltrate of PMNs and macrophages. We previously showed that the small secreted protein breast regression protein-39 (BRP-39), also known as chitinase 3-like 1 (CHI3L1) and encoded by the Chi3l1 gene, is expressed at high levels by macrophages during the early stages of kidney repair and promotes tubular cell survival via IL-13 receptor α 2 (IL13R α 2)-mediated signaling. Here, we investigated the role of BRP-39 in profibrotic responses after AKI. In wild-type mice, failure to resolve tubular injury after unilateral ischemia-reperfusion injury (U-IRI) led to sustained low-level Chi3l1 mRNA expression by renal cells and promoted macrophage persistence and severe interstitial fibrosis. Analysis of macrophages isolated from wild-type kidneys 14 days after U-IRI revealed high-level expression of the profibrotic BRP-39 receptor Ptgdr2 / Crth2 and expression of the profibrotic markers Lgals3 , Pdgfb , Egf , and Tgfb In comparison, injured kidneys from mice lacking BRP-39 had significantly fewer macrophages, reduced expression of profibrotic growth factors, and decreased accumulation of extracellular matrix. BRP-39 depletion did not affect myofibroblast accumulation but did attenuate myofibroblast expression of Col1a1 , Col3a1 , and Fn1 Together, these results identify BRP-39 as an important activator of macrophage-myofibroblast crosstalk and profibrotic signaling in the setting of maladaptive kidney repair. Copyright © 2017 by the American Society of Nephrology.

The impact of acute aerobic exercise on chitinase 3-like protein 1 and intelectin-1 expression in obesity.

Science.gov (United States)

Huang, Chun-Jung; Slusher, Aaron L; Whitehurst, Michael; Wells, Marie; Maharaj, Arun; Shibata, Yoshimi

2016-01-01

Chitinase 3-like 1 (CHI3L1) and intelectin 1 (ITLN-1) recognize microbial N-acetylglucosamine polymer and galactofuranosyl carbohydrates, respectively. Both lectins are highly abundant in plasma and seem to play pro- and anti-inflammatory roles, respectively, in obesity and inflammatory-related illnesses. The aim of this study was to examine whether plasma levels of these lectins in obese subjects are useful for monitoring inflammatory conditions immediately influenced by acute aerobic exercise. Plasma interleukin-6, a pro-inflammatory cytokine, was also examined. Twenty-two (11 obese and 11 normal-weight) healthy subjects, ages 18-30 years, were recruited to perform a 30 min bout of acute aerobic exercise at 75% VO2max. We confirmed higher baseline levels of plasma CHI3L1, but lower ITLN-1, in obese subjects than in normal-weight subjects. The baseline levels of CHI3L1 were negatively correlated with cardiorespiratory fitness (relative VO2max). However, when controlled for BMI, the relationship between baseline level of CHI3L1 and relative VO2max was no longer observed. While acute aerobic exercise elicited an elevation in these parameters, we found a lower ITLN-1 response in obese subjects compared to normal-weight subjects. Our study clearly indicates that acute aerobic exercise elicits a pro-inflammatory response (e.g. CHI3L1) with a lower anti-inflammatory effect (e.g. ITLN-1) in obese individuals. Furthermore, these lectins could be predictors of outcome of exercise interventions in obesity-associated inflammation. © 2015 by the Society for Experimental Biology and Medicine.

Isolation and characterization of a chitinase gene from entomopathogenic fungus Verticillium lecanii Isolamento e caracterização de um gene de quitinase do fungo entomopatogênico Verticillium lecanii

Directory of Open Access Journals (Sweden)

Yanping Zhu

2008-06-01

Full Text Available Entomopathogenic fungus Verticillium lecanii is a promising whitefly and aphid control agent. Chitinases secreted by this insect pathogen have considerable importance in the biological control of some insect pests. An endochitinase gene Vlchit1 from the fungus was cloned and overexpressed in Escherichia coli. The Vlchit1 gene not only contains an open reading frame (ORF which encodes a protein of 423 amino acids (aa, but also is interrupted by three short introns. A homology modelling of Vlchit1 protein showed that the chitinase Vlchit1 has a (α/β8 TIM barrel structure. Overexpression test and Enzymatic activity assay indicated that the Vlchit1 is a functional enzyme that can hydrolyze the chitin substrate, so the Vlchit1 gene can service as a useful gene source for genetic manipulation leading to strain improvement of entomopathogenic fungi or constructing new transgenic plants with resistance to various fungal and insects pests.O fungo entomopatogênico Verticillium lecanii é um agente promissor no controle da mosca-branca e do pulgão. As quitinases secretadas por esse patógeno de insetos têm uma grande importância no controle biológico de doenças causadas por insetos. Um gene de endoquitinase Vlchit1 desse fungo foi clonado e expresso em Escherichia coli. O gene Vlchit contém não apenas um ORF que codifica uma proteína de 423 aminoácidos, mas também é interrompido por três pequenos introns. A modelagem de homologia da proteína Vlchit1indicou que a quitinase Vlchit1 tem uma estrutura (α/β 8 TIM barrel. Testes de expressão e de atividade enzimática indicaram que Vlchit1 é uma enzima funcional que hidroliza quitina, portanto o gene Vlchit pode ser um gene útil para manipulação genética para melhoramento de cepas de fungos entomopatogênicos ou para a construção de novas plantas transgênicas com resistência a várias doenças causadas por fungos e insetos.

Production, optimization, characterization and antifungal activity of ...

African Journals Online (AJOL)

SAM

2014-04-02

Apr 2, 2014 ... the present study, the antifungal activity of crude A. terrus chitinase was investigated against Apergillus niger, Aspergillus oryzae .... Chitinase activity was determined spectrophotometrically by estimating the amount of ..... characterization of two. Bifunctional chitinases lysozyme extracellularly produced by.

Expression of the chitinase family glycoprotein YKL-40 in undifferentiated, differentiated and trans-differentiated mesenchymal stem cells.

Directory of Open Access Journals (Sweden)

Daniel J Hoover

Full Text Available The glycoprotein YKL-40 (CHI3L1 is a secreted chitinase family protein that induces angiogenesis, cell survival, and cell proliferation, and plays roles in tissue remodeling and immune regulation. It is expressed primarily in cells of mesenchymal origin, is overexpressed in numerous aggressive carcinomas and sarcomas, but is rarely expressed in normal ectodermal tissues. Bone marrow-derived mesenchymal stem cells (MSCs can be induced to differentiate into various mesenchymal tissues and trans-differentiate into some non-mesenchymal cell types. Since YKL-40 has been used as a mesenchymal marker, we followed YKL-40 expression as undifferentiated MSCs were induced to differentiate into bone, cartilage, and neural phenotypes. Undifferentiated MSCs contain significant levels of YKL-40 mRNA but do not synthesize detectable levels of YKL-40 protein. MSCs induced to differentiate into chondrocytes and osteocytes soon began to express and secrete YKL-40 protein, as do ex vivo cultured chondrocytes and primary osteocytes. In contrast, MSCs induced to trans-differentiate into neurons did not synthesize YKL-40 protein, consistent with the general absence of YKL-40 protein in normal CNS parenchyma. However, these trans-differentiated neurons retained significant levels of YKL-40 mRNA, suggesting the mechanisms which prevented YKL-40 translation in undifferentiated MSCs remained in place, and that these trans-differentiated neurons differ in at least this way from neurons derived from neuronal stem cells. Utilization of a differentiation protocol containing β-mercaptoethanol resulted in cells that expressed significant amounts of intracellular YKL-40 protein that was not secreted, which is not seen in normal cells. Thus the synthesis of YKL-40 protein is a marker for MSC differentiation into mature mesenchymal phenotypes, and the presence of untranslated YKL-40 mRNA in non-mesenchymal cells derived from MSCs reflects differences between differentiated and

Listeria monocytogenes has a functional chitinolytic system and an active lytic polysaccharide monooxygenase

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg

2015-01-01

Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and ChiB) and a ......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...... but different product profiles depending on the substrate. In LPMO-chitinase synergy experiments, CBP21 is able to boost the activity of both ChiA and ChiB more than LmLPMO10. Product analysis of the synergy assays revealed that the chitinases were unable to efficiently hydrolyse the LPMO products...... (chitooligosaccharide aldonic acids) with a degree of polymerization below four (ChiA and SmChiC) or three (ChiB). Gene transcription and protein expression analysis showed that LmLPMO10 is neither highly transcribed, nor abundantly secreted during the growth of L. monocytogenes in a chitin-containing medium...

Chitin Degradation Proteins Produced by the Marine Bacterium Vibrio harveyi Growing on Different Forms of Chitin.

Science.gov (United States)

Svitil, A L; Chadhain, S; Moore, J A; Kirchman, D L

1997-02-01

Relatively little is known about the number, diversity, and function of chitinases produced by bacteria, even though chitin is one of the most abundant polymers in nature. Because of the importance of chitin, especially in marine environments, we examined chitin-degrading proteins in the marine bacterium Vibrio harveyi. This bacterium had a higher growth rate and more chitinase activity when grown on (beta)-chitin (isolated from squid pen) than on (alpha)-chitin (isolated from snow crab), probably because of the more open structure of (beta)-chitin. When exposed to different types of chitin, V. harveyi excreted several chitin-degrading proteins into the culture media. Some chitinases were present with all of the tested chitins, while others were unique to a particular chitin. We cloned and identified six separate chitinase genes from V. harveyi. These chitinases appear to be unique based on DNA restriction patterns, immunological data, and enzyme activity. This marine bacterium and probably others appear to synthesize separate chitinases for efficient utilization of different forms of chitin and chitin by-products.

Chitin stimulates expression of acidic mammalian chitinase and eotaxin-3 by human sinonasal epithelial cells in vitro.

Science.gov (United States)

Lalaker, Ashley; Nkrumah, Louis; Lee, Won-Kyung; Ramanathan, Murugappan; Lane, Andrew P

2009-01-01

Sinonasal epithelial cells participate in host defense by initiating innate immune mechanisms against potential pathogens. Antimicrobial innate mechanisms have been shown to involve Th1-like inflammatory responses. Although epithelial cells can also be induced by Th2 cytokines to express proeosinophilic mediators, no environmental agents have been identified that promote this effect. Human sinonasal epithelial cells from patients with chronic rhinosinusitis with nasal polyps (CRSwNPs) and controls were harvested and grown in primary culture. Cell cultures were exposed to a range of concentrations of chitin for 24 hours, and mRNA for acidic mammalian chitinase (AMCase), eotaxin-3, and thymic stromal-derived lymphopoietin (TSLP) were assessed. Other cultures were exposed to interleukin 4 (IL- 4) alone and in combination with dust-mite antigen (DMA) for 36 hours. Extracted mRNA and cell culture supernatant were analyzed for expression of AMCase and eotaxin-3. Chitin induced a dose-dependent expression of AMCase and eotaxin-3 mRNA but not TSLP. Patients with recalcitrant CRSwNPs showed lower baseline expression of AMCase when compared with treatment-responsive CRSwNP and less induction of AMCase expression by chitin. DMA did not directly induce expression of AMCase or eotaxin-3. Expression of eotaxin-3 was stimulated by IL-4 and further enhanced with the addition of DMA. Levels of AMCase were not significantly affected by either IL-4 or DMA exposure. In some cases, the combination of IL-4 and DMA was able to induce AMCase expression in cell cultures not producing AMCase at baseline. The abundant biopolymer chitin appears to be recognized by a yet uncharacterized receptor on sinonasal epithelial cells. Chitin stimulates production of AMCase and eotaxin-3, two pro-Th2 effector proteins. This finding suggests the existence of a novel innate immune pathway for local defense against chitin-containing organisms in the sinonasal tract. Dysregulation of this function could

C-reactive protein and chitinase 3-like protein 1 as biomarkers of spatial redistribution of retinal blood vessels on digital retinal photography in patients with diabetic retinopathy.

Science.gov (United States)

Cekić, Sonja; Cvetković, Tatjana; Jovanović, Ivan; Jovanović, Predrag; Pesić, Milica; Stanković Babić, Gordana; Milenković, Svetislav; Risimić, Dijana

2014-08-20

The aim of the study was to investigate the correlation between the levels of C-reactive protein (CRP) and chitinase 3-like protein 1 (YKL-40) in blood samples with morpohometric parameters of retinal blood vessels in patients with diabetic retinopathy. Blood laboratory examination of 90 patients included the measurement of glycemia, HbA1C, total cholesterol, LDL-C, HDL-C, triglycerides and CRP. Levels of YKL-40 were detected and measured in serum by ELISA (Micro VueYKL-40 EIA Kit, Quidel Corporation, San Diego, USA). YKL-40 correlated positively with diameter and negatively with number of retinal blood vessels. The average number of the blood vessels per retinal zone was significantly higher in the group of patients with mild non-proliferative diabetic retinopathy than in the group with severe form in the optic disc and all five retinal zones. The average outer diameter of the evaluated retinal zones and optic disc vessels was significantly higher in the group with severe compared to the group with mild diabetic retinopathy. Morphological analysis of the retinal vessels on digital fundus photography and correlation with YKL-40 may be valuable for the follow-up of diabetic retinopathy.

Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice.

Science.gov (United States)

Kim, Hyun-Soo; Timmis, Kenneth N; Golyshin, Peter N

2007-07-01

The novel chitinolytic bacterium Serratia sp. KCK, which was isolated from kimchi juice, produced chitinase A. The gene coding for the chitinolytic enzyme was cloned on the basis of sequencing of internal peptides, homology search, and design of degenerated primers. The cloned open reading frame of chiA encodes for deduced polypeptide of 563 amino acid residues with a calculated molecular mass of 61 kDa and appears to correspond to a molecular mass of about 57 kDa, which excluded the signal sequence. The deduced amino acid sequence showed high similarity to those of bacterial chitinases classified as family 18 of glycosyl hydrolases. The chitinase A is an exochitinase and exhibits a greater pH range (5.0-10.0), thermostability with a temperature optimum of 40 degrees C, and substrate range other than Serratia chitinases thus far described. These results suggested that Serratia sp. KCK chitinase A can be used for biotechnological applications with good potential.

Glucanases and Chitinases as Causal Agents in the Protection of Acacia Extrafloral Nectar from Infestation by Phytopathogens1[W][OA

Science.gov (United States)

González-Teuber, Marcia; Pozo, María J.; Muck, Alexander; Svatos, Ales; Adame-Álvarez, Rosa M.; Heil, Martin

2010-01-01

Nectars are rich in primary metabolites and attract mutualistic animals, which serve as pollinators or as an indirect defense against herbivores. Their chemical composition makes nectars prone to microbial infestation. As protective strategy, floral nectar of ornamental tobacco (Nicotiana langsdorffii × Nicotiana sanderae) contains “nectarins,” proteins producing reactive oxygen species such as hydrogen peroxide. By contrast, pathogenesis-related (PR) proteins were detected in Acacia extrafloral nectar (EFN), which is secreted in the context of defensive ant-plant mutualisms. We investigated whether these PR proteins protect EFN from phytopathogens. Five sympatric species (Acacia cornigera, A. hindsii, A. collinsii, A. farnesiana, and Prosopis juliflora) were compared that differ in their ant-plant mutualism. EFN of myrmecophytes, which are obligate ant-plants that secrete EFN constitutively to nourish specialized ant inhabitants, significantly inhibited the growth of four out of six tested phytopathogenic microorganisms. By contrast, EFN of nonmyrmecophytes, which is secreted only transiently in response to herbivory, did not exhibit a detectable inhibitory activity. Combining two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis with nanoflow liquid chromatography-tandem mass spectrometry analysis confirmed that PR proteins represented over 90% of all proteins in myrmecophyte EFN. The inhibition of microbial growth was exerted by the protein fraction, but not the small metabolites of this EFN, and disappeared when nectar was heated. In-gel assays demonstrated the activity of acidic and basic chitinases in all EFNs, whereas glucanases were detected only in EFN of myrmecophytes. Our results demonstrate that PR proteins causally underlie the protection of Acacia EFN from microorganisms and that acidic and basic glucanases likely represent the most important prerequisite in this defensive function. PMID:20023149

Structural and functional characterisation of a class I endochitinase of the carnivorous sundew (Drosera rotundifolia L.).

Science.gov (United States)

Jopcik, Martin; Moravcikova, Jana; Matusikova, Ildiko; Bauer, Miroslav; Rajninec, Miroslav; Libantova, Jana

2017-02-01

Chitinase gene from the carnivorous plant, Drosera rotundifolia , was cloned and functionally characterised. Plant chitinases are believed to play an important role in the developmental and physiological processes and in responses to biotic and abiotic stress. In addition, there is growing evidence that carnivorous plants can use them to digest insect prey. In this study, a full-length genomic clone consisting of the 1665-bp chitinase gene (gDrChit) and adjacent promoter region of the 698 bp in length were isolated from Drosera rotundifolia L. using degenerate PCR and a genome-walking approach. The corresponding coding sequence of chitinase gene (DrChit) was obtained following RNA isolation from the leaves of aseptically grown in vitro plants, cDNA synthesis with a gene-specific primer and PCR amplification. The open reading frame of cDNA clone consisted of 978 nucleotides and encoded 325 amino acid residues. Sequence analysis indicated that DrChit belongs to the class I group of plant chitinases. Phylogenetic analysis within the Caryophyllales class I chitinases demonstrated a significant evolutionary relatedness of DrChit with clade Ib, which contains the extracellular orthologues that play a role in carnivory. Comparative expression analysis revealed that the DrChit is expressed predominantly in tentacles and is up-regulated by treatment with inducers that mimick insect prey. Enzymatic activity of rDrChit protein expressed in Escherichia coli was confirmed and purified protein exhibited a long oligomer-specific endochitinase activity on glycol-chitin and FITC-chitin. The isolation and expression profile of a chitinase gene from D. rotundifolia has not been reported so far. The obtained results support the role of specific chitinases in digestive processes in carnivorous plant species.

A Phenotyping Method of Giant Cells from Root-Knot Nematode Feeding Sites by Confocal Microscopy Highlights a Role for CHITINASE-LIKE 1 in Arabidopsis

Science.gov (United States)

Cabrera, Javier; Olmo, Rocio; Ruiz-Ferrer, Virginia; Hermans, Christian; Martinez-Argudo, Isabel; Escobar, Carolina

2018-01-01

Most effective nematicides for the control of root-knot nematodes are banned, which demands a better understanding of the plant-nematode interaction. Understanding how gene expression in the nematode-feeding sites relates to morphological features may assist a better characterization of the interaction. However, nematode-induced galls resulting from cell-proliferation and hypertrophy hinders such observation, which would require tissue sectioning or clearing. We demonstrate that a method based on the green auto-fluorescence produced by glutaraldehyde and the tissue-clearing properties of benzyl-alcohol/benzyl-benzoate preserves the structure of the nematode-feeding sites and the plant-nematode interface with unprecedented resolution quality. This allowed us to obtain detailed measurements of the giant cells’ area in an Arabidopsis line overexpressing CHITINASE-LIKE-1 (CTL1) from optical sections by confocal microscopy, assigning a role for CTL1 and adding essential data to the scarce information of the role of gene repression in giant cells. Furthermore, subcellular structures and features of the nematodes body and tissues from thick organs formed after different biotic interactions, i.e., galls, syncytia, and nodules, were clearly distinguished without embedding or sectioning in different plant species (Arabidopsis, cucumber or Medicago). The combination of this method with molecular studies will be valuable for a better understanding of the plant-biotic interactions. PMID:29389847

β-1,3 Glucanases e quitinases: aplicação na lise de leveduras e inibição de fungos β-1,3 glucanases and chitinases: application in the yeast cell lysis and fungi inhibition

Directory of Open Access Journals (Sweden)

Luciana Francisco Fleuri

2008-08-01

Full Text Available Objetivou-se, no presente trabalho, a aplicação de β-1,3 glucanases e quitinases da linhagem Cellulosimicrobium cellulans 191 na lise de leveduras e inibição de fungos, respectivamente. O delineamento experimental mostrou que as melhores condições para a lise de Saccharomyces cerevisiae KL-88 pela β-1,3 glucanase foi pH 6,5 e 35ºC. As células de leveduras incubadas por 10 h em frascos sem agitação mostraram-se mais susceptíveis à lise pela ação da enzima. Foi obtido maior lise da levedura quando a suspensão de células foi submetida ao tratamento com β-1,3 glucanase e cisteína 1mM. A enzima invertase intracelular ou ligada à célula de S. cerevisiae KL-88 e K. marxianus NCYC 587 foi extraída após tratamento da suspensão celular com β-1,3 glucanase, sendo que o tratamento prévio das leveduras com a enzima aumentou a susceptibilidade das células à lise com ultra-som. A preparação de quitinase foi capaz de formar halos de inibição de alguns fungos.The aim of this work was the application of β-1,3 glucanases and chitinases by Cellulosimicrobium cellulans 191 strain on yeast cell lysis and fungi inhibition, respectively. The experimental design study showed that the best conditions to Saccharomyces cerevisiae KL-88 lysis by β-1,3 glucanase extract were pH 6,5 and 35ºC. This study also demonstrated that the yeast cells were more susceptible to lysis after 10 h of cultivation in flasks without agitation. Lysis activity was increased when S. cerevisiae KL-88 cell suspension was treated with β-1,3 glucanase and cystein 1mM. The enzyme invertase of S. cerevisiae KL-88 and Kluyveromyces marxianus NCYC 587 was extracted after treatment of cell suspension with β-1,3 glucanase and the previous treatment of yeasts with the enzyme, increased the susceptibility to lysis when ultrasonic treatment was used. The chitinase presented growth inhibition halos for some of the fungi.

Penapisan dan Identifikasi Bakteri Kitinolitik Penghambat Pertumbuhan Ganoderma boninense in Vitro

Directory of Open Access Journals (Sweden)

Risky Hadi Wibowo

2017-09-01

Full Text Available Chitinolytic bacteria have been reported as biocontrol agents and have the ability to produce chitinase enzymes. The objective of the research was to obtain chitinase producing bacteria that had antagonistic activity to Ganoderma boninense, a causal agent of basal stem rot on oil palm. A total of 63 isolates of chitinase producing bacteria were isolated from soil of Bukit Dua Belas National Park and oil palm plantation in Jambi Province; all was screened for their potency in inhibiting G. boninense in vitro. Three isolates designated TB04-05, SW01-11, and SW02-08 were potentially suppressed and inhibited the mycelium growth of G. boninense in vitro. Based on their specific chitinase activity, these three isolates produced the highest level of chitinase enzyme of 6.3072 U mg-1 protein, 6.0385 U mg-1 protein and 6.1279 U mg-1 protein, respectively after 24 hr incubation. Based on 16S RNA identification, strain TB04-05 had similarity with Bacillus cereus, whereas strains SW01 and SW02-08 had similarity with Bacillus thuringiensis.

Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.

Science.gov (United States)

Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

2015-11-27

Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Enhancement of Exochitinase Production by Bacillus licheniformis AT6 Strain and Improvement of N-Acetylglucosamine Production.

Science.gov (United States)

Aounallah, Mohamed Amine; Slimene-Debez, Imen Ben; Djebali, Kais; Gharbi, Dorra; Hammami, Majdi; Azaiez, Sana; Limam, Ferid; Tabbene, Olfa

2017-02-01

A strain producing chitinase, isolated from potato stem tissue, was identified as Bacillus licheniformis by biochemical properties and 16S RNA sequence analysis. Statistical experimental designs were used to optimize nine independent variables for chitinase production by B. licheniformis AT6 strain in submerged fermentation. Using Plackett-Burman design, (NH 4 ) 2 SO 4 , MgSO 4 .7H 2 O, colloidal chitin, MnCl 2 2H 2 O, and temperature were found to influence chitinase production significantly. According to Box-Behnken response surface methodology, the optimal fermentation conditions allowing maximum chitinase production were (in gram per liter): (NH 4 ) 2 SO 4 , 7; K 2 HPO 4 , 1; NaCl, 1; MgSO 4 .7H 2 O, 0.1; yeast extract, 0.5; colloidal chitin, 7.5; MnCl 2 .2H 2 O, 0.2; temperature 35 °C; pH medium 7. The optimization strategy led to a 10-fold increase in chitinase activity (505.26 ± 22.223 mU/mL versus 50.35 ± 19.62 mU/mL for control basal medium). A major protein band with a molecular weight of 61.9 kDa corresponding to chitinase activity was clearly detected under optimized conditions. Chitinase activity produced in optimized medium mainly releases N-acetyl glucosamine (GlcNAc) monomer from colloidal chitin. This enzyme also acts as an exochitinase with β-N-acetylglucosaminidase. These results suggest that B. licheniformis AT6 secreting exochitinase is highly efficient in GlcNAc production which could in turn be envisaged as a therapeutic agent or as a conservator against the alteration of several ailments.

Increased Obesity-Associated Circulating Levels of the Extracellular Matrix Proteins Osteopontin, Chitinase-3 Like-1 and Tenascin C Are Associated with Colon Cancer.

Directory of Open Access Journals (Sweden)

Victoria Catalán

Full Text Available Excess adipose tissue represents a major risk factor for the development of colon cancer with inflammation and extracellular matrix (ECM remodeling being proposed as plausible mechanisms. The aim of this study was to investigate whether obesity can influence circulating levels of inflammation-related extracellular matrix proteins in patients with colon cancer (CC, promoting a microenvironment favorable for tumor growth.Serum samples obtained from 79 subjects [26 lean (LN and 53 obese (OB] were used in the study. Enrolled subjects were further subclassified according to the established diagnostic protocol for CC (44 without CC and 35 with CC. Anthropometric measurements as well as circulating metabolites and hormones were determined. Circulating concentrations of the ECM proteins osteopontin (OPN, chitinase-3-like protein 1 (YKL-40, tenascin C (TNC and lipocalin-2 (LCN-2 were determined by ELISA.Significant differences in circulating OPN, YKL-40 and TNC concentrations between the experimental groups were observed, being significantly increased due to obesity (P<0.01 and colon cancer (P<0.05. LCN-2 levels were affected by obesity (P<0.05, but no differences were detected regarding the presence or not of CC. A positive association (P<0.05 with different inflammatory markers was also detected.To our knowledge, we herein show for the first time that obese patients with CC exhibit increased circulating levels of OPN, YKL-40 and TNC providing further evidence for the influence of obesity on CC development via ECM proteins, representing promising diagnostic biomarkers or target molecules for therapeutics.

PROTEIN ANTIMIKROB DARI TANAMAN TRICHOSANTHES

Directory of Open Access Journals (Sweden)

Sukma D

2008-08-01

Full Text Available The research was aimed to study morphology, growth, development, pest and disease of 3 Trichosanthes species, initiate shoots, callus and hairy root culture in vitro, analyze chitinase and peroxidase activities and the effect of salicylic acid (SA and etefon (ETF on the chitinase and peroxidase activities of crude protein extract from Trichosanthes, and evaluate in vitro antifungal activity of crude protein extract of Trichosanthes. The results of the research showed the differences of morphological characters, growth habit of T. cucumerina var. anguina, T.tricuspidata and the differences of pest and diseases problem of T. quinquangulata. T. cucumerina var. anguina and T. quinquangulata. T. tricuspidata had the highest chitinase activity in crude protein extract of in vitro shoots, calli and plant roots and peroxidase activity in plant roots grown in field. T. cucumerina var. anguina showed the highest chitinase and peroxidase activities in crude protein extract of plant roots grown in field and calli. Chitinase and peroxidase activities of calli crude protein extract of T. tricuspidata could be increased by SA and ETF. Adversely, ETF decreased the peroxidase activity of calli crude protein exract ofT. tricuspidata. In T. cucumerina var. anguina, SA could not increase the chitinase activity but increase the peroxidase activity. The crude protein from in vitro shoots of T. tricuspidata could inhibited the spore germination of Fusarium sp. from T. cucumerina var. anguina, Fusarium oxysporum from shallot, Puccinia arachidis from peanut and Pseudoperonospora cubensis from cucumber. The protein could not inhibit spore germination of Curvularia eragrostidis from Dendrobium orchids

The role of exochitinase type A1 in the fungistatic activity of the rhizosphere bacterium Paenibacillus sp. M4

Directory of Open Access Journals (Sweden)

Jankiewicz Urszula

2016-01-01

Full Text Available The aim of the study was to detect the activity and characterize potentially fungistatic chitinases synthesized by rhizosphere bacteria identified as Paenibacillus sp. M4. Maximum chitinolytic activity was achieved on the fifth day of culturing bacteria in a growth medium with 1% colloidal chitin. Analysis of a zymogram uncovered the presence of four activity bands in the crude bacterial extract. The used three-stage protein purification procedure resulted in a single band of chitinase activity on the zymogram. The purified enzyme exhibited maximum activity at pH 6.5 and temperature 45oC, and thermal stability at 40oC for 4 h. In terms of substrate specificity, it is an exochitinase (chitobiose. The amino acid sequence obtained after mass spectrometry showed similarity to chitinase A1 synthesized by Bacillus circulans. The M4 isolate demonstrated the highest growth inhibiting activity against plant pathogens belonging to the genera Fusarium, Rhizoctonia and Alternaria. Fungistatic activity, although to a somewhat lesser degree, was also demonstrated by purified chitinase. The obtained results confirm the participation of the studied exochitinase in antagonism towards pathogenic molds. However, the lower fungistatic effectiveness of the chitinases points to the synergistic action of different metabolites in biocontrol by these bacteria.

The endochitinase VDECH from Verticillium dahliae inhibits spore germination and activates plant defense responses

Science.gov (United States)

Chitinases function in the digestion of chitin molecules, which are present principally in insects and fungi. In plants, chitinase genes play important roles in defense, and their expression can be triggered in response to both biotic and abiotic stresses. In this study, we cloned and characterized ...

Analysis of variation in virulence of Beauveria bassiana against insect pests of pigeonpea using qPCR.

Science.gov (United States)

Senthilraja, Govindasamy; Anand, Theerthagiri; Mohankumar, Subbarayalu; Raguchander, Thiruvengadam; Samiyappan, Ramasamy

2018-03-01

Beauveria bassiana is a broad spectrum microbial bioagent used for the control of agriculturally important insect pests. However, in our experiments, two virulent isolates of B. bassiana (B2 and B10) showed specific preference toward Maruca vitrata and Helicoverpa armigera of pigeonpea. To better understand this feature, we developed a qPCR assay to quantify the chitinase (virulence factor) of B. bassiana during the infection process. Isolates of B. bassiana were grown on insect cuticle amended medium and minimal medium (without insect cuticle) to assess the induction of chitinase. Our results revealed a positive correlation between expression of chitinase by B. bassiana and the substrates (with or without cuticles of M. vitrata and H. armigera) used. This study showcases the methodology to quantify the chitinase and analysis of variation in virulence of B. bassiana (B2 and B10) against M. vitrata and H. armigera. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regulation of the chitin degradation and utilization system by the ChiX small RNA in Serratia marcescens 2170.

Science.gov (United States)

Suzuki, Kazushi; Shimizu, Mari; Sasaki, Naomi; Ogawa, Chisana; Minami, Haruka; Sugimoto, Hayuki; Watanabe, Takeshi

2016-01-01

Serratia marcescens 2170 produces three different types of chitinases and chitin-binding protein CBP21. We found that transposon insertion into the 5' untranslated region (5' UTR) of chiPQ-ctb led to defective chitinase and CBP21 production. ChiX small RNA possessed the complementary sequence of the 5' UTRs of the chiPQ-ctb and chiR and repressed the expression of chiP and chiR. ChiX was detected in a medium containing glucose, glycerol, GlcNAc, and (GlcNAc)2, but the expression of both chiP and chiR was only observed in a medium containing (GlcNAc)2. ∆chiX mutant produced chitinases, CBP21, and chitobiase without induction. chiP transcripts were more abundant than those of chiR or chiX in a medium containing (GlcNAc)2. These results suggest that the constitutively expressed ChiX binds to the highly abundant chiP 5' UTR, thereby leading to the induction of chiR mRNA translation and the subsequent expression of chitinases and CBP21.

Sequence/structural analysis of xylem proteome emphasizes pathogenesis-related proteins, chitinases and β-1, 3-glucanases as key players in grapevine defense against Xylella fastidiosa

Directory of Open Access Journals (Sweden)

Sandeep Chakraborty

2016-05-01

Full Text Available Background. Xylella fastidiosa, the causative agent of various plant diseases including Pierce’s disease in the US, and Citrus Variegated Chlorosis in Brazil, remains a continual source of concern and economic losses, especially since almost all commercial varieties are sensitive to this Gammaproteobacteria. Differential expression of proteins in infected tissue is an established methodology to identify key elements involved in plant defense pathways. Methods. In the current work, we developed a methodology named CHURNER that emphasizes relevant protein functions from proteomic data, based on identification of proteins with similar structures that do not necessarily have sequence homology. Such clustering emphasizes protein functions which have multiple copies that are up/down-regulated, and highlights similar proteins which are differentially regulated. As a working example we present proteomic data enumerating differentially expressed proteins in xylem sap from grapevines that were infected with X. fastidiosa. Results. Analysis of this data by CHURNER highlighted pathogenesis related PR-1 proteins, reinforcing this as the foremost protein function in xylem sap involved in the grapevine defense response to X. fastidiosa. β-1, 3-glucanase, which has both anti-microbial and anti-fungal activities, is also up-regulated. Simultaneously, chitinases are found to be both up and down-regulated by CHURNER, and thus the net gain of this protein function loses its significance in the defense response. Discussion. We demonstrate how structural data can be incorporated in the pipeline of proteomic data analysis prior to making inferences on the importance of individual proteins to plant defense mechanisms. We expect CHURNER to be applicable to any proteomic data set.

The Capsicum annuum class IV chitinase ChitIV interacts with receptor-like cytoplasmic protein kinase PIK1 to accelerate PIK1-triggered cell death and defence responses

Science.gov (United States)

Kim, Dae Sung; Kim, Nak Hyun; Hwang, Byung Kook

2015-01-01

The pepper receptor-like cytoplasmic protein kinase, CaPIK1, which mediates signalling of plant cell death and defence responses was previously identified. Here, the identification of a class IV chitinase, CaChitIV, from pepper plants (Capsicum annuum), which interacts with CaPIK1 and promotes CaPIK1-triggered cell death and defence responses, is reported. CaChitIV contains a signal peptide, chitin-binding domain, and glycol hydrolase domain. CaChitIV expression was up-regulated by Xanthomonas campestris pv. vesicatoria (Xcv) infection. Notably, avirulent Xcv infection rapidly induced CaChitIV expression in pepper leaves. Bimolecular fluorescence complementation and co-immunoprecipitation revealed that CaPIK1 interacts with CaChitIV in planta, and that the CaPIK1–CaChitIV complex is localized mainly in the cytoplasm and plasma membrane. CaChitIV is also localized in the endoplasmic reticulum. Transient co-expression of CaChitIV with CaPIK1 enhanced CaPIK1-triggered cell death response and reactive oxygen species (ROS) and nitric oxide (NO) bursts. Co-silencing of both CaChitIV and CaPIK1 in pepper plants conferred enhanced susceptibility to Xcv infection, which was accompanied by a reduced induction of cell death response, ROS and NO bursts, and defence response genes. Ectopic expression of CaPIK1 in Arabidopsis enhanced basal resistance to Hyaloperonospora arabidopsidis infection. Together, the results suggest that CaChitIV positively regulates CaPIK1-triggered cell death and defence responses through its interaction with CaPIK1. PMID:25694549

Overexpression of the mulberry latex gene MaMLX-Q1 enhances defense against Plutella xylostella in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Liu Yan

2017-01-01

Full Text Available Purified mulberry latex chitinase (MLX has a role in defense against some lepidopteran insects. In this study, a full length chitinase gene, MaMLX-Q1, of 1405 bp with a 1140 bp open reading frame, was obtained from mulberry leaves by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR procedure. The gene encoded a mature protein with the predicted molecular mass of 39.38 kDa and an isoelectric point (pI of 6.43; it contained two chitin-binding domains and a hydrolase family 19 chitinase domain. Sequence alignment and phylogenetic analysis grouped it in the class I chitinase protein group. Heterogeneous expression of this MaMLX-Q1 in Arabidopsis showed non-visible alterations in growth phenotype, except for the higher transcriptional expression of MaMLX-Q1 when compared to that of wild-type Arabidopsis. This ectopic MaMLX-Q1 exhibited toxicity to the growth and development of Plutella xylostella larvae, causing significantly lower weight gain and higher mortality. These results indicate an application of MaMLX-Q1 as an insecticide for plant protection.

Bortezomib modulates CHIT1 and YKL40 in monocyte-derived osteoclast and in myeloma cells

Directory of Open Access Journals (Sweden)

Tibullo eDaniele

2015-10-01

Full Text Available Osteolytic bone disease is a common manifestation of multiple myeloma (MM that leads to progressive skeleton destruction and is the most severe cause of morbidity in MM patients.It results from increased osteolytic activity and decrease osteoblastic function. Activation of mammalian chitinases CHIT1 and YKL40 is associated with osteoclast (OCs differentiation and bone digestion. In the current study, we investigated the effect of two Bortezomib’s concentration (BO (2.5 nM and 5nM on osteoclastogenesis by analyzing regulation of chitinase expression. OCs exposition to BO was able to inhibit the expression of different OCs markers such as RANK, CTSK, TRAP and MMP9. In addition BO-treatment reduced CHIT1 enzymatic activity and both CHIT1 and YKL40 mRNA expression levels and cytoplasmatic and secreted protein. Moreover, immunofluorescence evaluation of mature OCs showed that BO was able to translocate YKL40 into the nucleus, while CHIT1 remained into the cytoplasm. Since MM cell lines such as U266, SKM-M1 and MM1 showed high levels of CHIT1 activity, we analyzed bone resorption ability of U266 using dentin disc assay resorption pits. Silencing chitinase proteins in U266 cell line with specific siRNAs, resulted in pits number reduction on dentine discs. In conclusion, we showed that BO decreases osteoclastogenesis and reduces bone resorption in OCs and U266 cell line by modulating the chitinases CHIT1 and YKL40. These results indicate that chitinases may be a therapeutic target for bone disease in MM patients.

Bortezomib modulates CHIT1 and YKL40 in monocyte-derived osteoclast and in myeloma cells.

Science.gov (United States)

Tibullo, Daniele; Di Rosa, Michelino; Giallongo, Cesarina; La Cava, Piera; Parrinello, Nunziatina L; Romano, Alessandra; Conticello, Concetta; Brundo, Maria V; Saccone, Salvatore; Malaguarnera, Lucia; Di Raimondo, Francesco

2015-01-01

Osteolytic bone disease is a common manifestation of multiple myeloma (MM) that leads to progressive skeleton destruction and is the most severe cause of morbidity in MM patients. It results from increased osteolytic activity and decrease osteoblastic function. Activation of mammalian chitinases chitotriosidase (CHIT1) and YKL40 is associated with osteoclast (OCs) differentiation and bone digestion. In the current study, we investigated the effect of two Bortezomib's concentration (2.5 and 5 nM) on osteoclastogenesis by analyzing regulation of chitinase expression. OCs exposition to bortezomib (BO) was able to inhibit the expression of different OCs markers such as RANK, CTSK, TRAP, and MMP9. In addition BO-treatment reduced CHIT1 enzymatic activity and both CHIT1 and YKL40 mRNA expression levels and cytoplasmatic and secreted protein. Moreover, immunofluorescence evaluation of mature OCs showed that BO was able to translocate YKL40 into the nucleus, while CHIT1 remained into the cytoplasm. Since MM cell lines such as U266, SKM-M1 and MM1 showed high levels of CHIT1 activity, we analyzed bone resorption ability of U266 using dentin disk assay resorption pits. Silencing chitinase proteins in U266 cell line with specific small interfering RNA, resulted in pits number reduction on dentine disks. In conclusion, we showed that BO decreases osteoclastogenesis and reduces bone resorption in OCs and U266 cell line by modulating the chitinases CHIT1 and YKL40. These results indicate that chitinases may be a therapeutic target for bone disease in MM patients.

Atividades de quitinase e beta-1,3-glucanase após eliciação das defesas do tomateiro contra a mancha-bacteriana Chitinase and beta-1,3-glucanase activities after the elicitation of tomato defenses against bacterial spot

Directory of Open Access Journals (Sweden)

Fábio Rossi Cavalcanti

2006-12-01

Full Text Available O objetivo deste trabalho foi avaliar a influência de eliciadores biológicos e químicos sobre as atividades de duas proteínas relacionadas à patogênese (PR, quitinase e beta-1,3-glucanase, em folhas de tomateiro, e avaliar o potencial desses eliciadores na redução do progresso da mancha-foliar causada por Xanthomonas campestris pv. vesicatoria. Plantas de tomateiro da cultivar Santa Cruz Kada foram pulverizadas com: acibenzolar-S-metil (ASM; 0,2 g L-1; formulação biológica proveniente de biomassa cítrica, denominada Ecolife (5 mL L-1; suspensão de quitosana (MCp; 200 g L-1, proveniente de micélio de Crinipellis perniciosa; extrato aquoso de ramos de lobeira (Solanum lycocarpum infectados por C. perniciosa (VLA; 300 g L-1. As plantas foram desafiadas com um isolado virulento da bactéria, quatro dias depois das pulverizações. Plantas pulverizadas com extratos biológicos mostraram redução da mancha-bacteriana. ASM proporcionou 49,3% de proteção, e foi igual à MCp e Ecolife e superior ao VLA. Este último não diferiu significativamente de MCp e Ecolife. Observou-se maior atividade das duas enzimas nas plantas tratadas, principalmente nas primeiras horas após as pulverizações.The objective of this work was to assess the influence of foliar application of resistance inducers and the activation of plant pathogenesis-related (PR proteins, chitinases and beta-1,3-glucanases, against Xanthomonas campestris pv. vesicatoria, and evaluate the potential of these elicitors on the reduction of bacterial leaf spot. Tomato plants of the cultivar Santa Cruz Kada were sprayed with: acibenzolar-S-methyl (0.2 g L-1 ASM; Ecolife, a biological formulation based on citric biomass (5 mL L-1; chitosan suspension from Crinipellis perniciosa mycelium (MCp; 200 g L-1; an aqueous extract from branches of lobeira (Solanum lycocarpum infected with C. perniciosa (VLA; 300 g L-1. Plants were challenged with a virulent bacterial strain four days after

Streptomyces plicatus as a model biocontrol agent.

Science.gov (United States)

Abd-Allah, E F

2001-01-01

Three hundred and seventy two isolates belonging to the genus Streptomyces were isolated and screened for chitinase production. Streptomyces plicatus was found to be the best producer. The highest chitinase production were incubated for 3 d at 30 degrees C on buffered culture medium (pH 8.0) containing chitin plus sucrose and calcium nitrate as carbon and nitrogen sources. S. plicatus chitinase had a highly significant inhibitory effect on spore germination, germ tube elongation and radial growth of Fusarium oxysporum f.sp. lycopersici, Altrernaria alternata and Verticillium albo-atrum, the causal organisms of Fusarium wilt, stem canker and Verticillium wilt diseases of tomato. Application of S. plicatus to the root system of tomato plants before transplantation markedly protected tomato plants against the tested phytopathogenic fungi in vivo.

Effect of Chitosan on Rhizome Rot Disease of Turmeric Caused by Pythium aphanidermatum

OpenAIRE

Anusuya, Sathiyanarayanan; Sathiyabama, Muthukrishnan

2014-01-01

Chitosan was evaluated for its potential to induce antifungal hydrolases in susceptible turmeric plant (Curcuma longa L.). Under field conditions, the application of chitosan (crab shell) to turmeric plants by foliar spray method induces defense enzymes such as chitinases and chitosanases. Such an increase in enzyme activity was enhanced by spraying chitosan (0.1% w/v) on leaves of turmeric plants at regular intervals. Gel electrophoresis revealed new chitinase and chitosanase isoforms in lea...

Genetic ontogeny of pancreatic enzymes in Labrus bergylta larvae and the effect of feed type on enzyme activities and gene expression.

Science.gov (United States)

Hansen, Truls Wergeland; Folkvord, Arild; Grøtan, Espen; Sæle, Øystein

2013-03-01

A newly cultivated wrasse species, Labrus bergylta, have shown great potential for use in Atlantic salmon (Salmo salar) farms in the battle against sea lice (Lepeoptheirus salmonis) infections. Hatchery reared L. bergylta were studied from 2 to 55 DPH to examine the molecular basis of digestive ontogeny related to the pancreas. An isolated feeding trial was performed on 27-34 DPH larvae to compare the effect of diet on enzyme activity and the possible exogenous contribution by live feed. The following genes coding for key pancreatic enzymes were analyzed by qPCR: trypsin, Cyp7 A1, BAL, sPLA(2) 1B, amylase and pancreatic chitinase. Enzyme activity was measured on trypsin, neutral lipase, sPLA(2), amylase and chitinase in fed and unfed larvae. We did not observe any effects of the formulated diet v.s. rotifers on enzyme activities of neutral lipase, chitinase and sPLA(2). However, a probable feed-dependency was observed at a transcriptional level, where rotifers seem to stimulate upregulation. The regulation of BAL was the only exception, where an upregulation was observed after weaning both in the ontogeny series and the experimental part. Our data on pancreatic chitinase and amylase mRNA levels suggest the importance of carbohydrates in the diet of early larval and juvenile L. bergylta. Copyright © 2012 Elsevier Inc. All rights reserved.

Thermodynamic analysis of allosamidin binding to the human chitotriosidase

Energy Technology Data Exchange (ETDEWEB)

Eide, Kristine Bistrup; Lundmark, Silje Thoresen [Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, P.O. Box 5003, N-1432 Ås (Norway); Sakuda, Shohei [Department of Applied Biological Chemistry, University of Tokyo, Bunkyo-Ku, Tokyo 113 (Japan); Sørlie, Morten, E-mail: morten.sorlie@umb.no [Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences, P.O. Box 5003, N-1432 Ås (Norway)

2013-08-10

Highlights: • Large differences in thermodynamic signatures for family 18 chitinase inhibition. • Allosamidin binds tight to HCHT. • Binding driven by enthalpy change and desolvation. - Abstract: Human chitotriosidase (HCHT) is one of two active family 18 chitinases produced by humans, the other being acidic mammalian chitinase (AMCase). The enzyme is thought to be part of the innate human defense mechanism against fungal parasites. Recently, it has been shown that levels of HCHT bioactivity and protein are significantly increased in the circulation and lungs of systemic sclerosis patients and for this reason is a suggested therapeutic target. For this reason, we have undertaken a detailed thermodynamic investigation using isothermal titration calorimetry of the binding interaction of HCHT with the well-known family 18 chitinase inhibitor allosamidin. The binding is shown to be strong (K{sub d} = 0.20 ± 0.03 μM and ΔG{sub r}° = −38.9 ± 0.4 kJ/mol) and driven by favorable changes in enthalpy (ΔH{sub r}° = −50.2 ± 1.2 kJ/mol) and solvation entropy (−TΔS{sub solv}° = −41.8 ± 4.4 kJ/mol). It is accompanied with a large penalty in conformational entropy change (−TΔS{sub conf}° = 43.1 ± 4.2 kJ/mol)

Metabolites change in Jatropha plants due to seed treatment with rhizobacteria and Rhizoctonia bataticola

Directory of Open Access Journals (Sweden)

Surender Kumar

2013-12-01

Full Text Available An experiment on the metabolite [salicylic acid (SA, jasmonic acid (JA, hydrocyanic acid (HCN and chitinase activity] changes owing to seed treatn1ent with pathogen, plant growth pron1oting rhizobacteria (PGPRs - (P. maltophilia, P. fluorescens and Bacillus subtilis alone and in combination was conducted at Chaudhary Charan Singh, Haryana Agricultural University, Regional Research Station, Bawal. Jatropha curcas plants raised from root rot pathogen (Rhizoctonia bataticola treated seeds showed an initial increase in SA and hydrocyanic acid HCN content and an opposite trend was observed for JA level and chitinase activity. Though, PGPRs inoculation resulted in higher increase in SA level, JA level and chitinase activity in both the cases alone as well as in integration with pathogen, however, maximun1 increase in JA content was explicited in plants raised after seed treatment with P. fluorescens, the most effective rhizobacteria amongst PGPRs studied. Highest increase in HCN content (45 micrograms g-1 over control (24 micrograms g-1 was noticed for P. fluorescens followed by co-seed inoculation with P. fluorescens + pathogen (43 micrograms g-1 at 10 DPL. The co-seed inoculation elicited 68 units at 10 DPI, whereas the pathogen challenged plants showed lower chitinase activity with 42 units. All the metabolites declined slightly or sharply with age of the plant irrespective of inoculations.

Comparison of plasma pigment epithelium-derived factor (PEDF), retinol binding protein 4 (RBP-4), chitinase-3-like protein 1 (YKL-40) and brain-derived neurotrophic factor (BDNF) for the identification of insulin resistance.

Science.gov (United States)

Toloza, F J K; Pérez-Matos, M C; Ricardo-Silgado, M L; Morales-Álvarez, M C; Mantilla-Rivas, J O; Pinzón-Cortés, J A; Pérez-Mayorga, M; Arévalo-García, M L; Tolosa-González, G; Mendivil, C O

2017-09-01

To evaluate and compare the association of four potential insulin resistance (IR) biomarkers (pigment-epithelium-derived factor [PEDF], retinol-binding-protein-4 [RBP-4], chitinase-3-like protein 1 [YKL-40] and brain-derived neurotrophic factor [BDNF]) with objective measures of IR. We studied 81 subjects with different metabolic profiles. All participants underwent a 5-point OGTT with calculation of multiple IR indexes. A subgroup of 21 participants additionally underwent a hyperinsulinemic-euglycemic clamp. IR was defined as belonging to the highest quartile of incremental area under the insulin curve (iAUCins), or to the lowest quartile of the insulin sensitivity index (ISI). PEDF was associated with adiposity variables. PEDF and RBP4 increased linearly across quartiles of iAUCins (for PEDF p-trend=0.029; for RBP-4 p-trend=0.053). YKL-40 and BDNF were not associated with any adiposity or IR variable. PEDF and RBP-4 levels identified individuals with IR by the iAUCins definition: A PEDF cutoff of 11.9ng/mL had 60% sensitivity and 68% specificity, while a RBP-4 cutoff of 71.6ng/mL had 70% sensitivity and 57% specificity. In multiple regression analyses simultaneously including clinical variables and the studied biomarkers, only BMI, PEDF and RBP-4 remained significant predictors of IR. Plasma PEDF and RBP4 identified IR in subjects with no prior diagnosis of diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.

The chitinolytic activity of Listeria monocytogenes EGD is regulated by carbohydrates but also by the virulence regulator PrfA

DEFF Research Database (Denmark)

Larsen, Marianne Halberg; Leisner, Jørgen; Ingmer, Hanne

2010-01-01

Chitin, an insoluble polymer of N-acetyl-D-glucosamine (GlcNAc), is one of the most abundant carbohydrate polymers in marine and terrestrial environments. Chitin hydrolysis by Listeria monocytogenes depends on two chitinase-encoding genes, chiA and chiB, and the aim of this study was to investigate...... their regulation. Chitin induces the expression of both chitinases in late exponential growth phase, and chiA but not chiB is furthermore induced by the monomer GlcNAc. Furthermore, their expression is subjected to catabolite control. Chitinases expressed by bacterial pathogens have proven to be important not only...... in wild-type cells. In agreement with this, Northern blot analysis showed that the amounts of chiA and chiB transcripts upon induction by chitin were significantly lower in the prfA mutant than in the wild type. The chitinolytic activity and chiA and chiB expression were reduced in the absence of the sig...

Competitive performance of transgenic wheat resistant to powdery mildew.

Directory of Open Access Journals (Sweden)

Olena Kalinina

Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

Terpene Profile, Leaf Anatomy, and Enzyme Activity of Resistant and Susceptible Cocoa Clonesto Vascular Streak Dieback Disease

Directory of Open Access Journals (Sweden)

Adi Prawoto

2014-10-01

Full Text Available Vascular-streak dieback (VSD, Oncobasidium theobromae is the most prevalent disease of Theobroma cacao L. in Indonesia. This study aims to analyze resistance mechanism to VSD based on terpene profile, leaf anatomy, chitinase, and peroxidase study. Resistant clones of Sulawesi 1 and Sca 6 and susceptible clones of ICS 60 and TSH 858 were used for terpene profile, leaf anatomy analysis, chitinase, peroxides, polyphenol, lignin, and cellulose analysis. Those clones and KEE 2, KKM 22 and ICS 13 were used for peroxides analysis. For trichome study, the resistant clones of Sulawesi 1, Sca 6, KEE 2, and KKM 22, and susceptible clones of ICS 60 and TSH 858 were used. GCMS analysis showed that chromatogram pattern of resistant and susceptible groups were quite similar, but resistant clones contained 22% more components than the susceptible ones. Resistant clones contained groups of pinene, decane, myrcene, and octadecanoic acid, while those substances on usceptible clones were absent. Trichome was thicker on younger leaf, and its density on the basal was higher than that on the middle and tip leaf parts. Trichome density of resistant clone was not always thicker than that of susceptible ones. On resistant clones, stomatal density was lower and width of stomate pits was narrower, while thickness of epidermis layer and pallisade parenchym were higher. Polyphenol content of resistant clones were higher but lignin and cellulose of both groups were similar. Chitinase activity which has a role in hydrolysis of mycelia cell wall was higher on the resistant clones, but peroxides which has a role in polymeration of lignin biosynthesis was similar between both groups. It is concluded that groups of terpene pinene, decane, myrcene, and octadecanoic acid, thickness of leaf epidermis, density and width of stomata pit, and chitinase activity plays important role in cocoa resistance to VSD. Key words: Theobroma cacaoL., clone, vascular-streak dieback, resistance, leaf

Proteomic Analysis of Sauvignon Blanc Grape Skin, Pulp and Seed and Relative Quantification of Pathogenesis-Related Proteins.

Directory of Open Access Journals (Sweden)

Bin Tian

Full Text Available Thaumatin-like proteins (TLPs and chitinases are the main constituents of so-called protein hazes which can form in finished white wine and which is a great concern of winemakers. These soluble pathogenesis-related (PR proteins are extracted from grape berries. However, their distribution in different grape tissues is not well documented. In this study, proteins were first separately extracted from the skin, pulp and seed of Sauvignon Blanc grapes, followed by trypsin digestion and analysis by liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS. Proteins identified included 75 proteins from Sauvignon Blanc grape skin, 63 from grape pulp and 35 from grape seed, mostly functionally classified as associated with metabolism and energy. Some were present exclusively in specific grape tissues; for example, proteins involved in photosynthesis were only detected in grape skin and proteins found in alcoholic fermentation were only detected in grape pulp. Moreover, proteins identified in grape seed were less diverse than those identified in grape skin and pulp. TLPs and chitinases were identified in both Sauvignon Blanc grape skin and pulp, but not in the seed. To relatively quantify the PR proteins, the protein extracts of grape tissues were seperated by HPLC first and then analysed by SDS-PAGE. The results showed that the protein fractions eluted at 9.3 min and 19.2 min under the chromatographic conditions of this study confirmed that these corresponded to TLPs and chitinases seperately. Thus, the relative quantification of TLPs and chitinases in protein extracts was carried out by comparing the area of corresponding peaks against the area of a thamautin standard. The results presented in this study clearly demonstrated the distribution of haze-forming PR proteins in grape berries, and the relative quantification of TLPs and chitinases could be applied in fast tracking of changes in PR proteins during grape growth and

The dual exo/endo-type mode and the effect of ionic strength on the mode of catalysis of chitinase 60 (CHI60) from Serratia sp. TU09 and its mutants.

Science.gov (United States)

Kuttiyawong, K; Nakapong, S; Pichyangkura, R

2008-11-03

Mutations of the tryptophan residues in the tryptophan-track of the N-terminal domain (W33F/Y and W69F/Y) and in the catalytic domain (W245F/Y) of Serratia sp. TU09 Chitinase 60 (CHI60) were constructed, as single and double point substitutions to either phenylalanine or tyrosine. The enzyme-substrate interaction and mode of catalysis, exo/endo-type, of wild type CHI60 and mutant enzymes on soluble (partially N-acetylated chitin), amorphous (colloidal chitin), and crystalline (β-chitin) substrates were studied. All CHI60 mutants exhibited a reduced substrate binding activity on colloidal chitin. CHI60 possesses a dual mode of catalysis with both exo- and endo-type activities allowing the enzyme to work efficiently on various substrate types. CHI60 preferentially uses the endo-type mode on soluble and amorphous substrates and the exo-type mode on crystalline substrate. However, the prevalent mode of hydrolysis mediated by CHI60 is regulated by ionic strength. Slightly elevated ionic strength, 0.1-0.2M NaCl, which promotes enzyme-substrate interactions, enhances CHI60 hydrolytic activity on amorphous substrate and, interestingly, on partially N-acetylated chitin. High ionic strength, 0.5-2.0M NaCl, prevents the enzyme from dissociating from amorphous substrate, occupying the enzyme in an enzyme-substrate non-productive complex. However, on crystalline substrates, the activity of CHI60 was only inhibited approximately 50% at high ionic strength, suggesting that the enzyme hydrolyzes crystalline substrates with an exo-type mode processively while remaining tightly bound to the substrate. Moreover, substitution of Trp-33 to either phenylalanine or tyrosine reduced the activity of the enzyme at high ionic strength, suggesting an important role of Trp-33 on enzyme processivity.

Chitinolytic Streptomyces vinaceusdrappus S5MW2 isolated from Chilika lake, India enhances plant growth and biocontrol efficacy through chitin supplementation against Rhizoctonia solani.

Science.gov (United States)

Yandigeri, Mahesh S; Malviya, Nityanand; Solanki, Manoj Kumar; Shrivastava, Pooja; Sivakumar, G

2015-08-01

A chitinolytic actinomycete Streptomyces vinaceusdrappus S5MW2 was isolated from water sample of Chilika lake, India and identified using 16S rRNA gene sequencing. It showed in vitro antifungal activity against the sclerotia producing pathogen Rhizoctonia solani in a dual culture assay and by chitinase enzyme production in a chitin supplemented minimal broth. Moreover, isolate S5MW2 was further characterized for biocontrol (BC) and plant growth promoting features in a greenhouse experiment with or without colloidal chitin (CC). Results of greenhouse experiment showed that CC supplementation with S5MW2 showed a significant growth of tomato plants and superior disease reduction as compared to untreated control and without CC treated plants. Moreover, higher accumulation of chitinase also recovered in the CC supplemented plants. Significant effect of CC also concurred with the Analysis of Variance of greenhouse parameters. These results show that the a marine antagonist S5MW2 has BC efficiency against R. solani and chitinase enzyme played important role in plant resistance.

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

Energy Technology Data Exchange (ETDEWEB)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium); Azarkan, Mohamed [Laboratoire de Chimie Générale (CP 609), Faculté de Médecine, Université Libre de Bruxelles (ULB), Campus Erasme, 808 Route de Lennik, B-1070 Bruxelles (Belgium); Looze, Yvan [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium); Villeret, Vincent [CNRS-UMR 8161, Institut de Biologie de Lille, Université de Lille 1-Université de Lille 2-Institut Pasteur de Lille, IFR142, 1 Rue du Professeur Calmette, F-59021 Lille (France); Wintjens, René, E-mail: jhuet@ulb.ac.be [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium)

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resulting from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.

Expression of pathogenesis-related (PR) genes in avocados fumigated with thyme oil vapours and control of anthracnose.

Science.gov (United States)

Bill, Malick; Sivakumar, Dharini; Beukes, Mervyn; Korsten, Lise

2016-03-01

Thyme oil (TO) fumigation (96μll(-1)) to cv. Hass and Ryan avocados significantly reduced anthracnose incidence compared to prochloraz and the untreated control. Also, enhanced activities of β-1,3-glucanase, chitinase were noted in both cultivars. TO fumigation induced the expression of both β-1,3-glucanase and chitinase genes in naturally infected fruit of both cultivars, during storage at 7 or 7.5°C for up to 21d and during subsequent simulated market shelf conditions at 20°C for 5d. However, the impact of TO fumigation on the β-1,3-glucanase gene expression was higher in both cultivars. Higher gene regulation and β-1,3-glucanase, chitinase activities were observed in cv. Ryan compared to Hass. Although TO fumigation significantly reduced anthracnose incidence in both naturally infected cultivars, the inhibitory effect was slightly higher in cv. Ryan than Hass. Thus, postharvest TO fumigation had positive effects on enhancing anthracnose disease resistance during storage and also gave a residual effect during the simulated shelf life. Copyright © 2015 Elsevier Ltd. All rights reserved.

Halo(natronoarchaea isolated from hypersaline lakes utilize cellulose and chitin as growth substrates

Directory of Open Access Journals (Sweden)

Dimitry Y Sorokin

2015-09-01

Full Text Available Until recently, extremely halophilic euryarchaeota were considered mostly as aerobic heterotrophs utilizing simple organic compounds as growth substrates. Almost nothing is known on the ability of these prokaryotes to utilize complex polysaccharides as cellulose, xylan and chitin. Although few haloarchaeal cellulases and chitinases were recently characterized, the analysis of currently available haloarchaeal genomes deciphered numerous genes encoding glycosidases (GHs of various families including endoglucanases and chitinases. However, all these haloarchaea were isolated and cultivated on simple substrates and their ability to grow on polysaccharides in situ or in vitro is unknown. This study examines several halo(natronoarchaeal strains from geographically distant hypersaline lakes for the ability to grow on insoluble polymers as a sole growth substrate in salt-saturated mineral media. Some of them belonged to known taxa, while other represented novel phylogenetic lineages within the class Halobacteria. All isolates produced extracellular extremely salt tolerant cellulases or chitinases, either cell-free or cell-bound. Obtained results demonstrate a presence of diverse population of haloarchaeal cellulo/chitinotrophs in hypersaline habitats indicating that euryarchaea participate in aerobic mineralization of recalcitrant organic polymers in salt-saturated environments.

Chitins and Chitosans as Immunoadjuvants and Non-Allergenic Drug Carriers

Directory of Open Access Journals (Sweden)

Riccardo A. A. Muzzarelli

2010-02-01

Full Text Available Due to the fact that some individuals are allergic to crustaceans, the presumed relationship between allergy and the presence of chitin in crustaceans has been investigated. In vivo, chitin is part of complex structures with other organic and inorganic compounds: in arthropods chitin is covalently linked to proteins and tanned by quinones, in fungi it is covalently linked to glucans, while in bacteria chitin is diversely combined according to Gram(+/- classification. On the other hand, isolated, purified chitin is a plain polysaccharide that, at the nano level, presents itself as a highly associated structure, recently refined in terms of regularity, nature of bonds, crystallinity degree and unusual colloidal behavior. Chitins and modified chitins exert a number of beneficial actions, i.e., (i they stimulate macrophages by interacting with receptors on the macrophage surface that mediate the internalization of chitin particles to be degraded by lysozyme and N-acetyl-β-glucosaminidase (such as Nod-like, Toll-like, lectin, Dectin-1, leukotriene 134 and mannose receptors; (ii the macrophages produce cytokines and other compounds that confer non-specific host resistance against bacterial and viral infections, and anti-tumor activity; (iii chitin is a strong Th1 adjuvant that up-regulates Th1 immunity induced by heat-killed Mycobacterium bovis, while down- regulating Th2 immunity induced by mycobacterial protein; (iv direct intranasal application of chitin microparticles into the lung was also able to significantly down-regulate allergic response to Dermatophagoids pteronyssinus and Aspergillus fumigatus in a murine model of allergy; (v chitin microparticles had a beneficial effect in preventing and treating histopathologic changes in the airways of asthmatic mice; (vi authors support the fact that chitin depresses the development of adaptive type 2 allergic responses. Since the expression of chitinases, chitrotriosidase and chitinase-like proteins

Chitins and chitosans as immunoadjuvants and non-allergenic drug carriers.

Science.gov (United States)

Muzzarelli, Riccardo A A

2010-02-21

Due to the fact that some individuals are allergic to crustaceans, the presumed relationship between allergy and the presence of chitin in crustaceans has been investigated. In vivo, chitin is part of complex structures with other organic and inorganic compounds: in arthropods chitin is covalently linked to proteins and tanned by quinones, in fungi it is covalently linked to glucans, while in bacteria chitin is diversely combined according to Gram(+/-) classification. On the other hand, isolated, purified chitin is a plain polysaccharide that, at the nano level, presents itself as a highly associated structure, recently refined in terms of regularity, nature of bonds, crystallinity degree and unusual colloidal behavior. Chitins and modified chitins exert a number of beneficial actions, i.e., (i) they stimulate macrophages by interacting with receptors on the macrophage surface that mediate the internalization of chitin particles to be degraded by lysozyme and N-acetyl-beta-glucosaminidase (such as Nod-like, Toll-like, lectin, Dectin-1, leukotriene 134 and mannose receptors); (ii) the macrophages produce cytokines and other compounds that confer non-specific host resistance against bacterial and viral infections, and anti-tumor activity; (iii) chitin is a strong Th1 adjuvant that up-regulates Th1 immunity induced by heat-killed Mycobacterium bovis, while down- regulating Th2 immunity induced by mycobacterial protein; (iv) direct intranasal application of chitin microparticles into the lung was also able to significantly down-regulate allergic response to Dermatophagoids pteronyssinus and Aspergillus fumigatus in a murine model of allergy; (v) chitin microparticles had a beneficial effect in preventing and treating histopathologic changes in the airways of asthmatic mice; (vi) authors support the fact that chitin depresses the development of adaptive type 2 allergic responses. Since the expression of chitinases, chitrotriosidase and chitinase-like proteins is greatly

Metabolites change in Jatropha plants due to seed treatment with rhizobacteria and Rhizoctonia bataticola

Directory of Open Access Journals (Sweden)

Surender Kumar

2013-11-01

Full Text Available An experiment on the metabolite [salicylic acid (SA, jasmonicacid (JA, hydrocyanic acid (HCN and chitinase activity] changes owing to seed treatment with pathogen, plant growth promoting rhizobacteria (PGPRs - (P. maltophilia, P. fluorescens and Bacillus subtilis alone and in combination was conducted at Chaudhary Charan Singh, Haryana Agricultural University, Regional Research Station, Bawal. Jatropha curcas plants raised from root rot pathogen (Rhizoctonia bataticola treated seeds showed an initial increase in SA and hydrocyanic acid HCN content and an opposite trend was observed for JA level and chitinase activity. Though, PGPRs inoculation resulted in higher increase in SA level, JA level and chitinaseactivity in both the cases alone as well as in integration with pathogen, however, maximum increase in JA content was explicited in plants raised after seed treatment with P. fluorescens, the most effective rhizobacteria amongst PGPRs studied. Highest increase in HCN content (45 μg g-1 over control (24 μg g-1 was noticed for P. fluorescens followed by co-seed inoculation with P. fluorescens + pathogen (43 μg g-1 at 10 DPI. The co-seed inoculation elicited 68 units at 10 DPI whereas the pathogen challenged plants showed lower chitinase activity with 42 units. All the metabolites declinedslightly or sharply with age of the plant irrespective of inoculations.

mRNA expression of EgCHI1, EgCHI2, and EgCHI3 in oil palm leaves (Elaeis guineesis Jacq.) after treatment with Ganoderma boninense pat. and Trichoderma harzianum Rifai.

Science.gov (United States)

Naher, Laila; Tan, Soon Guan; Ho, Chai Ling; Yusuf, Umi Kalsom; Ahmad, Siti Hazar; Abdullah, Faridah

2012-01-01

Basal stem rot (BSR) disease caused by the fungus Ganoderma boninense is the most serious disease affecting the oil palm; this is because the disease escapes the early disease detection. The biocontrol agent Trichoderma harzianum can protect the disease only at the early stage of the disease. In the present study, the expression levels of three oil palm (Elaeis guineensis Jacq.) chitinases encoding EgCHI1, EgCHI2, and EgCHI3 at 2, 5, and 8 weeks inoculation were measured in oil palm leaves from plants treated with G. boninense or T. harzianum alone or both. The five-month-old oil palm seedlings were treated with Gano-wood blocks inoculum and trichomulch. Expression of EgCHI1, EgCHI2, and EgCHI3 in treated leaves tissue was determined by real-time PCR. Oil palm chitinases were not strongly expressed in oil palm leaves of plants treated with G. boninense alone compared to other treatments. Throughout the 8-week experiment, expression of EgCHI1 increased more than 3-fold in leaves of plants treated with T. harzianum and G. boninense when compared to those of control and other treated plants. The data illustrated that chitinase cDNA expression varied depending on tissue and the type of treatment.

mRNA Expression of EgCHI1, EgCHI2, and EgCHI3 in Oil Palm Leaves (Elaeis guineesis Jacq. after Treatment with Ganoderma boninense Pat. and Trichoderma harzianum Rifai

Directory of Open Access Journals (Sweden)

Laila Naher

2012-01-01

Full Text Available Background. Basal stem rot (BSR disease caused by the fungus Ganoderma boninense is the most serious disease affecting the oil palm; this is because the disease escapes the early disease detection. The biocontrol agent Trichoderma harzianum can protect the disease only at the early stage of the disease. In the present study, the expression levels of three oil palm (Elaeis guineensis Jacq. chitinases encoding EgCHI1, EgCHI2, and EgCHI3 at 2, 5, and 8 weeks inoculation were measured in oil palm leaves from plants treated with G. boninense or T. harzianum alone or both. Methods. The five-month-old oil palm seedlings were treated with Gano-wood blocks inoculum and trichomulch. Expression of EgCHI1, EgCHI2, and EgCHI3 in treated leaves tissue was determined by real-time PCR. Results. Oil palm chitinases were not strongly expressed in oil palm leaves of plants treated with G. boninense alone compared to other treatments. Throughout the 8-week experiment, expression of EgCHI1 increased more than 3-fold in leaves of plants treated with T. harzianum and G. boninense when compared to those of control and other treated plants. Conclusion. The data illustrated that chitinase cDNA expression varied depending on tissue and the type of treatment.

mRNA Expression of EgCHI1, EgCHI2, and EgCHI3 in Oil Palm Leaves (Elaeis guineesis Jacq.) after Treatment with Ganoderma boninense Pat. and Trichoderma harzianum Rifai

Science.gov (United States)

Naher, Laila; Tan, Soon Guan; Ho, Chai Ling; Yusuf, Umi Kalsom; Ahmad, Siti Hazar; Abdullah, Faridah

2012-01-01

Background. Basal stem rot (BSR) disease caused by the fungus Ganoderma boninense is the most serious disease affecting the oil palm; this is because the disease escapes the early disease detection. The biocontrol agent Trichoderma harzianum can protect the disease only at the early stage of the disease. In the present study, the expression levels of three oil palm (Elaeis guineensis Jacq.) chitinases encoding EgCHI1, EgCHI2, and EgCHI3 at 2, 5, and 8 weeks inoculation were measured in oil palm leaves from plants treated with G. boninense or T. harzianum alone or both. Methods. The five-month-old oil palm seedlings were treated with Gano-wood blocks inoculum and trichomulch. Expression of EgCHI1, EgCHI2, and EgCHI3 in treated leaves tissue was determined by real-time PCR. Results. Oil palm chitinases were not strongly expressed in oil palm leaves of plants treated with G. boninense alone compared to other treatments. Throughout the 8-week experiment, expression of EgCHI1 increased more than 3-fold in leaves of plants treated with T. harzianum and G. boninense when compared to those of control and other treated plants. Conclusion. The data illustrated that chitinase cDNA expression varied depending on tissue and the type of treatment. PMID:22919345

Potencial de los quito-oligosacáridos generados de quitina y quitosana Potencial de los quito-oligosacáridos generados de quitina y quitosana

Directory of Open Access Journals (Sweden)

José Eleazar Barboza Corona

2012-01-01

Full Text Available Las quitinasas sintetizadas por plantas, hongos, insectos y bacterias tienen un gran poten­cial debido a su amplio espectro de aplicaciones. En este trabajo revisamos generalidades sobre las quitinasas y quitosanasas bacterianas y su uso en la producción de quito-oligo­sacáridos. Este tipo de biomoléculas han creado un mercado biotecnológico diversificado e ilimitado que incluye aplicaciones en alimentos como aditivos y bioconservadores, asi­mismo en múltiples aplicaciones biomédicas enfocadas a la actividad anti-tumoral, a la capacidad como agentes antioxidantes y como antidiabéticos. Además, en la agricultura se han aplicado como factores de nodulación, como agentes osmoprotectores y antioxidan­tes para beneficiar el crecimiento de cultivos. Es importante destacar el potencial de las quitinasas sintetizadas por Bacillus thuringiensis, el bioinsecticida mas importante mun­dialmente. Las quitinasas de B. thuringiensis se han empleado recientemente para generar quito-oligosacáridos que tienen actividad antimicrobiana, particularmente contra diversas bacterias patógenas de importancia en salud pública transmitidas por alimentos.Chitinases synthesized by plants, fungi, insects and bacteria have a huge potential owing to its wide range of applications. In this work we review generalities about chitin, chitosane, chitinases and chitosanases from bacteria and their use in the production of chitin-oligosaccharides. This kind of biomolecules has created a diversified biotechnology market, including unlimited applications such as food additives and biopreservative, in biomedical applications focused mainly on anti-tumor activities, as antioxidants and anti-diabetics. In agriculture chitin-oligosaccharides has been applied as nodulation factors, osmoprotectors agents and antioxidants to benefit crop growth. It is important to note the potential use of chitinases biosynthesized by Bacillus thuringiensis, the most important biopesticide

Yeast cell wall chitin reduces wine haze formation.

Science.gov (United States)

Ndlovu, Thulile; Divol, Benoit; Bauer, Florian F

2018-04-27

Protein haze formation in bottled wines is a significant concern for the global wine industry and wine clarification before bottling is therefore a common but expensive practice. Previous studies have shown that wine yeast strains can reduce haze formation through the secretion of certain mannoproteins, but it has been suggested that other yeast-dependent haze protective mechanisms exist. On the other hand, addition of chitin has been shown to reduce haze formation, likely because grape chitinases have been shown to be the major contributors to haze. In this study, Chardonnay grape must fermented by various yeast strains resulted in wines with different protein haze levels indicating differences in haze protective capacities of the strains. The cell wall chitin levels of these strains were determined, and a strong correlation between cell wall chitin levels and haze protection capability was observed. To further evaluate the mechanism of haze protection, Escherichia coli -produced GFP-tagged grape chitinase was shown to bind efficiently to yeast cell walls in a cell wall chitin concentration-dependent manner, while commercial chitinase was removed from synthetic wine in quantities also correlated with the cell wall chitin levels of the strains. Our findings suggest a new mechanism of reducing wine haze, and propose a strategy for optimizing wine yeast strains to improve wine clarification. Importance In this study, we establish a new mechanism by which wine yeast strains can impact on the protein haze formation of wines, and demonstrate that yeast cell wall chitin binds grape chitinase in a chitin-concentration dependent manner. We also show that yeast can remove this haze-forming protein from wine. Chitin has in the past been shown to efficiently reduce wine haze formation when added to the wine in high concentration as a clarifying agent. Our data suggest that the selection of yeast strains with high levels of cell wall chitin can reduce protein haze. We also

isolated from Trichoderma harzianum

African Journals Online (AJOL)

SAM

2014-05-21

May 21, 2014 ... Chitinase gene from Trichoderma harzianum was cloned and hetrologously over expressed in ... used by Trichoderma to inhibit the growth of other fungi. ..... actinomycete isolates from niche habitats in Manipur for antibiotic.

Digestive enzymes in Rhinolophus euryale (Rhinolophidae, Chiroptera) are active also during hibernation

Czech Academy of Sciences Publication Activity Database

Maxinová, E.; Šustr, Vladimír; Uhrin, M.

2017-01-01

Roč. 3, č. 1 (2017), s. 91-96 E-ISSN 1339-8474 Institutional support: RVO:60077344 Keywords : bats * winter season * faecal matter * diet analysis * amylase * chitinases Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology

Degradation of barnacle nauplii: Implications to chitin regulation in the marine environment

Digital Repository Service at National Institute of Oceanography (India)

Khandeparker, L.; Gaonkar, C.C.; Desai, D.V.

in the treatment time. Bacterial abundance of the chitinase treated nauplii increased with the increase in enzyme concentration. Pathogenic bacteria such as Vibrio cholerae, V. alginolyticus, V. parahaemolyticus which were initially associated with the exoskeleton...

Browse Title Index

African Journals Online (AJOL)

Items 5051 - 5100 of 11090 ... ... transformation of rice chitinase gene in Solanum tuberosum L. Abstract PDF ... performance of dairy cow in Algeria: Effects of clinical mastitis ... Fattening performance, blood parameters and slaughter traits of ...

Development of transgenic finger millet (Eleusine coracana (L ...

Indian Academy of Sciences (India)

2012-01-18

Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

Endochitinase from wheat germ

International Nuclear Information System (INIS)

Cabib, E.

1988-01-01

This paper discusses the chitinase that can be assayed by the liberation of tritiated oligosaccharides from [acetyl- 3 H]chitin, 3 with phosphate buffer at pH 6, final concentration in the reaction mixture, 0.05 M

Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

Science.gov (United States)

Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

Bakteri Endofit Asal Berbagai Akar Tanaman sebagai Agens Pengendali Nematoda Puru Akar Meloidogyne incognita pada Tomat

Directory of Open Access Journals (Sweden)

Pradana Pandu Ankardiansyah

2016-08-01

Full Text Available Infection caused by root knot nematode (RKN Meloidogyne incognita may cause yield losses. Little is known regarding the effectiveness of endophytic bacterial group as biocontrol agents of RKN. This research was aimed to obtain endophytic bacteria group from 16 species of plants, which effectively controlled the RKN. Isolation of endophytic bacteria group was conducted using NA 20%, NA 50%, TSA 20%, TSA 50%, and King’s B medium. All of the bacteria groups giving negative result in hypersensitive and haemolytic tests, was further examined for their ability to produce protease, chitinase, and cyanide acid. The same endophytic bacteria groups were also tested for their potential to control juvenile 2 of M. incognita on tomatoes by seed treatment and soil drenching. Agronomical and pathological traits were observed 40 days after nematodes infestation. Eighty endophytic bacteria groups were successfully isolated and 17 of them were considered potential. Physiological test showed that 16 groups of endophytic bacteria can produce protease enzyme, 12 groups can produce chitinase enzyme, and 5 groups can produce cyanide acid. Specific endophytic bacteria group, i.e. TmtN5 from roots of tomato plant, is the most effective isolate for suppressing root damage and population of RKN. This group was effective as biocontrol agents of RKN because it produceds chitinase, protease, and cyanide acid. This research provided a new information regarding the potential use of endophytic bacteria group as a biocontrol agent of RKN.

The components of rice and watermelon root exudates and their effects on pathogenic fungus and watermelon defense.

Science.gov (United States)

Ren, Lixuan; Huo, Hongwei; Zhang, Fang; Hao, Wenya; Xiao, Liang; Dong, Caixia; Xu, Guohua

2016-06-02

Watermelon (Citrullus lanatus) is susceptible to wilt disease caused by the fungus Fusarium oxysporum f. sp niveum (FON). Intercropping management of watermelon/aerobic rice (Oryza sativa) alleviates watermelon wilt disease, because some unidentified component(s) in rice root exudates suppress FON sporulation and spore germination. Here, we show that the phenolic acid p-coumaric acid is present in rice root exudates only, and it inhibits FON spore germination and sporulation. We found that exogenously applied p-coumaric acid up-regulated the expression of ClPR3 in roots, as well as increased chitinase activity in leaves. Furthermore, exogenously applied p-coumaric acid increased β-1,3-glucanase activity in watermelon roots. By contrast, we found that ferulic acid was secreted by watermelon roots, but not by rice roots, and that it stimulated spore germination and sporulation of FON. Exogenous application of ferulic acid down-regulated ClPR3 expression and inhibited chitinase activity in watermelon leaves. Salicylic acid was detected in both watermelon and rice root exudates, which stimulated FON spore germination at low concentrations and suppressed spore germination at high concentrations. Exogenously applied salicylic acid did not alter ClPR3 expression, but did increase chitinase and β-1,3-glucanase activities in watermelon leaves. Together, our results show that the root exudates of phenolic acids were different between rice and watermelon, which lead to their special ecological roles on pathogenic fungus and watermelon defense.

Chitin Degradation In Marine Bacteria

DEFF Research Database (Denmark)

Paulsen, Sara; Machado, Henrique; Gram, Lone

2015-01-01

Introduction: Chitin is the most abundant polymer in the marine environment and the second most abundant in nature. Chitin does not accumulate on the ocean floor, because of microbial breakdown. Chitin degrading bacteria could have potential in the utilization of chitin as a renewable carbon...... and nitrogen source in the fermentation industry.Methods: Here, whole genome sequenced marine bacteria were screened for chitin degradation using phenotypic and in silico analyses.Results: The in silico analyses revealed the presence of three to nine chitinases in each strain, however the number of chitinases...... chitin regulatory system.Conclusions: This study has provided insight into the ecology of chitin degradation in marine bacteria. It also served as a basis for choosing a more efficient chitin degrading production strain e.g. for the use of chitin waste for large-scale fermentations....

Enhanced biocontrol activity of Rhodotorula mucilaginosa cultured in media containing chitosan against postharvest diseases in strawberries: possible mechanisms underlying the effect.

Science.gov (United States)

Zhang, Hongyin; Ge, Lingling; Chen, Keping; Zhao, Lina; Zhang, Xiaoyun

2014-05-07

The effect of Rhodotorula mucilaginosa cultured in media containing chitosan on its antogonistic activity against postharvest diseases of strawberries and the possible mechanisms involved are discussed. Two-dimensional gel electrophoresis were applied in the analysis of the proteins of R. mucilaginosa in response to chitosan. Compared with the application of R. mucilaginosa alone, the biocontrol efficacy of the yeast combined with 0.5% chitosan was enhanced greatly, with significant increase in chitinase activity of antagonistic yeast, polyphenoloxidase, peroxidase, phenylalanine ammonia lyase, chitinase and β-1,3-glucanase activity, and with an inhibition of lipid peroxidation of strawberries. The population of R. mucilaginosa harvested from NYDB amended with chitosan at 0.5% increased rapidly in strawberry wounds compared with those harvested from NYDB without chitosan. In the cellular proteome, several differentially expressed proteins were identified, most of which were related to basic metabolism.

African Crop Science Journal - Vol 11, No 2 (2003)

African Journals Online (AJOL)

Variation of β-1,3-Glucanase, Chitinase and Polyphenoloxidase Activities in Cacao Pods upon Phytophthora megakarya Inoculation. N.D. Omokolo,, D.J. Nankeu, N. Niemenak, T. Boudjeko. http://dx.doi.org/10.4314/acsj.v11i2.27522 ...

Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit

Science.gov (United States)

Effects of cyclic lipopeptides obtained from B. subtilis ABS-S14 on eliciting defense-related gene transcription and activity of defense-related enzymes glucanase (GLU), chitinase (CHI), peroxidase (POX) and lipoxygenase (LOX) in Citrus sinensis cv. Valencia fruit were determined. The maximum level ...

Increased YKL-40 and Chitotriosidase in Asthma and Chronic Obstructive Pulmonary Disease

NARCIS (Netherlands)

James, Anna J.; Reinius, Lovisa E.; Verhoek, Marri; Gomes, Anna; Kupczyk, Maciej; Hammar, Ulf; Ono, Junya; Ohta, Shoichiro; Izuhara, Kenji; Bel, Elisabeth; Kere, Juha; Söderhäll, Cilla; Dahlén, Barbro; Boot, Rolf G.; Dahlén, Sven-Erik; Gaga, Mina; Siafakas, Nikos M.; Papi, Alberto; Fabbri, Leonardo M.; Joos, Guy; Brusselle, Guy; Rabe, Klaus F.; Kanniess, Frank; Hiemstra, Pieter; Johnston, Sebastian L.; Chanez, Pascal; Vachier, Isabelle; Gjomarkaj, Mark; Sterk, Peter J.; Howarth, Peter H.; Nizankowska-Mogilnicka, Ewa; Middelveld, Roelinde; Holgate, Stephen T.; Wilson, Susan

2016-01-01

Serum chitinases may be novel biomarkers of airway inflammation and remodeling, but less is known about factors regulating their levels. To examine serum chitotriosidase activity and YKL-40 levels in patients with asthma and chronic obstructive pulmonary disease (COPD) and evaluate clinically

Increased YKL-40 and Chitotriosidase in Asthma and Chronic Obstructive Pulmonary Disease

NARCIS (Netherlands)

James, Anna J.; Reinius, Lovisa E.; Verhoek, Marri; Gomes, Anna; Kupczyk, Maciej; Hammar, Ulf; Ono, Junya; Ohta, Shoichiro; Izuhara, Kenji; Bel, Elisabeth; Kere, Juha; Soderhall, Cilia; Dahlen, Barbro; Boot, Rolf G.; Dahlen, Sven-Erik

2016-01-01

Rationale: Serum chitinases may be novel biomarkers of airway inflammation and remodeling, but less is known about factors regulating their levels. Objectives: To examine serum chitotriosidase activity and YKL-40 levels in patients with asthma and chronic obstructive pulmonary disease (COPD) and

Acibenzolar-S-methyl induces lettuce resistance against ...

African Journals Online (AJOL)

... contributing to the enhancement of plant resistance. The effect was comparable with copper treatment. As a marker of resistance, PR protein activity chitinase showed remarkable increase, depending on decreasing bacterial growth in planta. Key words: Acibenzolar-S-methyl, induced resistance, Xanthomonas campestris ...

YKL-40: a novel marker shared by chronic inflammation and oncogenic transformation

DEFF Research Database (Denmark)

Roslind, Anne; Johansen, Julia S

2009-01-01

YKL-40, a member of 'mammalian chitinase-like proteins', is secreted by macrophages, neutrophils, chondrocytes, endothelial-, vascular smooth muscle-, and cancer cells. High serum YKL-40 is a biomarker of poor prognosis in patients with cancer, inflammation and increased tissue remodelling. High...

Regulation of YKL-40 expression during genotoxic or microenvironmental stress in human glioblastoma cells

DEFF Research Database (Denmark)

Junker, Nanna; Johansen, Julia S; Hansen, Lasse T

2005-01-01

YKL-40 is a 40 kDa secreted glycoprotein belonging to the family of 'mammalian chitinase-like proteins', but without chitinase activity. YKL-40 has a proliferative effect on fibroblasts, chondrocytes and synoviocytes, and chemotactic effect on endothelium and vascular smooth muscle cells. Elevated...... material from glioblastomas patients. We investigated the expression of YKL-40 in three human malignant glioma cell lines exposed to different types of stress. Whereas a polymerase chain reaction transcript was detectable in all three cell lines, only U87 produced measurable amounts of YKL-40 protein. In U...... is attenuated by p53. In contrast, both basic fibroblast growth factor and tumor necrosing factor-alpha repressed YKL-40. These are the first data on regulation of YKL-40 in cancer cells. Diverse types of stress resulted in YKL-40 elevation, which strongly supports an involvement of YKL-40 in the malignant...

26kDa endochitinase from barley seeds: real-time monitoring of the enzymatic reaction and substrate binding experiments using electrospray ionization mass spectrometry

DEFF Research Database (Denmark)

Dennhart, Nicole; Weigang, Linda M M; Fujiwara, Maho

2009-01-01

A 26 kDa endochitinase from barley seeds was enzymatically characterized exclusively by electrospray ionization mass spectrometry (ESI-MS). At first, oligosaccharide hydrolysis catalyzed by the barley chitinase was monitored in real-time by ESI-MS. The reaction time-course obtained by ESI......-MS monitoring was found to be consistent with the data obtained earlier by HPLC, and the quantitative profile was successfully simulated by kinetic modeling of the enzymatic hydrolysis. It is obvious that the real-time monitoring method by ESI-MS allows a faster and cheaper determination of the chitinase...... of the enzymatic activity in E67Q is definitely caused by a point mutation of Glu67 but not due to partial unfolding of the mutated enzyme. Finally, association constants of enzyme-oligosaccharide complexes were calculated from Scatchard plots obtained by mass spectra. The binding free energy values obtained for E...

Encouragement of Enzyme Reaction Utilizing Heat Generation from Ferromagnetic Particles Subjected to an AC Magnetic Field.

Science.gov (United States)

Suzuki, Masashi; Aki, Atsushi; Mizuki, Toru; Maekawa, Toru; Usami, Ron; Morimoto, Hisao

2015-01-01

We propose a method of activating an enzyme utilizing heat generation from ferromagnetic particles under an ac magnetic field. We immobilize α-amylase on the surface of ferromagnetic particles and analyze its activity. We find that when α-amylase/ferromagnetic particle hybrids, that is, ferromagnetic particles, on which α-amylase molecules are immobilized, are subjected to an ac magnetic field, the particles generate heat and as a result, α-amylase on the particles is heated up and activated. We next prepare a solution, in which α-amylase/ferromagnetic particle hybrids and free, nonimmobilized chitinase are dispersed, and analyze their activities. We find that when the solution is subjected to an ac magnetic field, the activity of α-amylase immobilized on the particles increases, whereas that of free chitinase hardly changes; in other words, only α-amylase immobilized on the particles is selectively activated due to heat generation from the particles.

Mycolytic enzymes produced by Streptomyces violaceusniger and their role in antagonism towards wood-rotting fungi.

Science.gov (United States)

Nagpure, Anand; Choudhary, Bharti; Gupta, Rajinder K

2014-05-01

Extracellular mycolytic enzymes produced under submerged fermentation by the fungal antagonist Streptomyces violaceusniger MTCC 3959 were characterized. This streptomycete produced higher amounts of extracellular chitinase and protease during late exponential phase, whereas β-1,3-glucanase production was at peak in mid-stationary phase. Cell-free culture filtrate (CCF) exhibited a broad range of antifungal activity against both white rot and brown rot fungi. The inhibitory activity was completely lost after treatment with proteinase K and heat, indicating that extracellular antifungal metabolites are heat labile and proteinaceous in nature. Optimum pH and temperature for enzyme activity were: 9.0 and 60 °C for chitinase; 6.0 and 60 °C for β-1,3-glucanase; and 9.0 and 70 °C for protease. Mycolytic enzymes were moderately thermostable, and had a wide pH stability range extending from pH 5.0 to 10.0. The zymogram analysis of CCF revealed five chitinase isoenzymes with an apparent molecular weight of 20.8, 33.3, 45.6, 67.4, and 114.8 kDa, one β-1,3-glucanase appeared as a single band of ∼131.8 kDa and four protease isoenzymes with approximate molecular weights of 22.8, 62.52, 74.64, and 120.5 kDa. S. violaceusniger MTCC 3959 produced mycolytic enzymes that can be effectively used for suppression of phytopathogenic basidiomycetes. It has the potential to be an effective biofungicide. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Survival of Bemisia tabaci and activity of plant defense-related enzymes in genotypes of Capsicum annuum L.

Directory of Open Access Journals (Sweden)

Luis Latournerie-Moreno

2015-03-01

Full Text Available The whitefly Bemisia tabaci (Gennadius, 1889 is a major plant pest of horticultural crops from the families Solanaceae, Fabaceae and Cucurbitaceae in Neotropical areas. The exploration of host plant resistance and their biochemical mechanisms offers an excellent alternative to better understand factors affecting the interaction between phytophagous insect and host plant. We evaluated the survival of B. tabaci in landrace genotypes of Capsicum annuum L., and the activity of plant defense-related enzymes (chitinase, polyphenoloxidase, and peroxidase. The landrace genotypes Amaxito, Tabaquero, and Simojovel showed resistance to B. tabaci, as we observed more than 50% nymphal mortality, while in the commercial susceptible genotype Jalapeño mortality of B. tabaci nymphs was not higher than 20%. The activities of plant defense-related enzymes were significantly different among pepper genotypes (P < 0.05. Basal activities of chitinase, polyphenoloxidase and peroxidase were significantly lower or equal in landrace genotypes than that of the commercial genotype Jalapeño. The activity of plant enzymes was differential among pepper genotypes (P < 0.05. For example, the activity of chitinase enzyme generally was higher in non-infested plants with B. tabaci than those infested. Instead polyphenoloxidase ('Amaxito' and 'Simojovel' and peroxidase enzymes activities ('Tabaquero' increased in infested plants (P < 0.05. We conclude that basal activities of plant defense-related enzymes could be act through other mechanism plant induction, since plant defense-related enzymes showed a different induction response to B. tabaci. We underlined the role of polyphenoloxidase as plant defense in the pepper genotype Simojovel related to B. tabaci.

Molecular characterization of intergeneric hybrid between Aspergillus oryzae and Trichoderma harzianum by protoplast fusion.

Science.gov (United States)

Patil, N S; Patil, S M; Govindwar, S P; Jadhav, J P

2015-02-01

Protoplast fusion between Aspergillus oryzae and Trichoderma harzianum and application of fusant in degradation of shellfish waste. The filamentous chitinolytic fungal strains A. oryzae NCIM 1272 and T. harzianum NCIM 1185 were selected as parents for protoplast fusion. Viable protoplasts were released from fungal mycelium using enzyme cocktail containing 5 mg ml(-1) lysing enzymes from T. harzianum, 0.06 mg ml(-1) β-glucuronidase from Helix pomatia and 1 mg ml(-1) purified Penicillium ochrochloron chitinase in 0.8 mol l(-1) sorbitol as an osmotic stabilizer. Intergeneric protoplast fusion was carried out using 60% polyethylene glycol as a fusogen. At optimum conditions, the regeneration frequency of the fused protoplasts on colloidal chitin medium and fusion frequency were calculated. Fusant showed higher rate of growth pattern, chitinase activity and protein content than parents. Fusant formation was confirmed by morphological markers, viz. colony morphology and spore size and denaturation gradient gel electrophoresis (DGGE). This study revealed protoplast fusion between A. oryzae and T. harzianum significantly enhanced chitinase activity which ultimately provides potential strain for degradation of shellfish waste. Consistency in the molecular characterization results using DGGE is the major outcome of this study which can be emerged as a fundamental step in fusant identification. Now it is need to provide attention over effective chitin degradation to manage shrimp processing issues. In this aspect, ability of fusant to degrade shellfish waste efficiently in short incubation time revealed discovery of potential strain in the reclamation of seafood processing crustacean bio-waste. © 2014 The Society for Applied Microbiology.

Chitin degrading potential of three aquatic actinomycetes and its ...

African Journals Online (AJOL)

PRECIOUS

2009-12-01

Dec 1, 2009 ... chitinase production by all tested actinomycetes was at pH 8. S. canus and M. ... Chitin is the most abundant biopolymer next to cellulose. It is the β –1, ... Microorganisms, lower animals, birds, fungi and plants are known to ...

Selected soil enzymes: Examples of their potential roles in the ...

African Journals Online (AJOL)

Soil enzymes regulate ecosystem functioning and in particular play a key role in nutrient cycling. In this review we briefly summarise potential roles of selected enzymes such as amylase, arylsulphatases, -glucosidase, cellulose, chitinase, dehydrogenase, phosphatase, protease and urease in the ecosystem. We also ...

An exoproteome approach to monitor safety of a cheese-isolated Lactococcus lactis

DEFF Research Database (Denmark)

Genovese, Federica; Coïsson, Jean Daniel; Majumder, Avishek

2013-01-01

. A DIGE comparative exoproteomic analysis was performed on the L. lactis 11D strain grown on glucose and the disaccharide trehalose, examined here due to its common use as lyophilization stabilizer, respectively. The experiment showed that chitinase biosynthesis was enhanced in presence of trehalose...

Appa Rao Podile | Speakers | Indian Academy of Sciences

Indian Academy of Sciences (India)

In the past decade, domain shuf- fling/swapping of recombinant bacterial chitinases, bioprocess development for production of chitooligosaccharides by enzymatic methods, mechanism of elicitor (harpin) induced cell death, nanotechnology for crop protection, and non-host resistance have been his major areas of research ...

Induction and characterization of pathogenesis-related proteins in ...

African Journals Online (AJOL)

Furthermore, induced proteins were extracted from roots of inoculated and control tolerant (RO1054 and RO3015) and susceptible (RO2063) accessions at 8 dpi, and characterized by isoelectric focusing (IEF), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analyses. Chitinase ...

Characterization of LysM-receptors and their ligands involved in development and regulation of legume-rhizobium symbiosis

DEFF Research Database (Denmark)

Broghammer, Angelique; Krusell, Lene; Blaise, Mickael

LysM domains are conserved protein domains found in proteins of multiple organisms. This includes bacterial peptidoglycan-binding proteins, chitinases from yeast and algae and membrane-bound receptor-like kinases in plants. Several LysM encoding genes have also been identified in humans, where th...

Control of Dermatomycoses by Physical, Chemical and Biological Agents.

Science.gov (United States)

1981-02-28

canase isolated from an unidentified species of fungi imperfecti and chitinase isolated from Aspergillus oryzae , showed similar lytic effects on the...cerevisiae and Aspergillus niger were not. A partial characterization of the in- hibitory substance(s) indicated that it was absorbed to activated charcoal

Modification of chitin as substrates for chitinase

African Journals Online (AJOL)

sunny t

2015-05-06

May 6, 2015 ... Enzymes are able to bind to their substrates specifically at the active site. The proximity and ... the presence of chitin as a carbon source (Chernin et al.,. 1998). ... Possible rearrangement of chitin structure ... and form larger granules. .... Medium for Enumeration of Actinomycetes in Water and Soil. Appl.

Combined overexpression of chitinase and defensin genesin ...

African Journals Online (AJOL)

STORAGESEVER

2009-10-19

Oct 19, 2009 ... independent lines with high disease resistance, low variability and stable expression of transgenes could be ... exerts broad-spectrum poisoning effects on many bac- ... tant tomato pathogens and showed typical symptoms.

Defense Response in Slash Pine: Chitosan Treatment Alters the Abundance of Specific mRNAs

Science.gov (United States)

Mary E. Mason; John M. Davis

1997-01-01

We used differential display to identify chitosan responsive cDNAs in slashpine cell cultures. Two clones that showed increased mRNA abundance had sequence similarity to genes with roles in major plant defense responses, clone 18 to cinnamic acid 4-hydroxylase, and clone 30 to chitinase.

Anti-fungal properties of chitinolytic dune soil bacteria

NARCIS (Netherlands)

De Boer, W.; Klein Gunnewiek, P.J.A.; Lafeber, P.; Janse, J.H.; Spit, B.E.; Woldendorp, J.W.

1998-01-01

Anti-fungal properties of chitinolytic soil bacteria may enable them to compete successfully for chitin with fungi. Additionally, the production of chitinase may be part of a lytic system that enables the bacteria to use living hyphae rather than chitin as the actual growth substrate, since chitin

Effects of carbon and nitrogen sources on the induction and ...

African Journals Online (AJOL)

Effects of carbon and nitrogen sources on the induction and repression of chitinase enzyme from Beauveria bassiana isolates. Priyanka Dhar, Gurvinder Kaur. Abstract. Beauveria bassiana a natural soil borne insect pathogen is being used effectively these days in integrated pest management system. Foliar application of ...

Biochemical responses during the pathogenesis of Sclerotium rolfsii ...

African Journals Online (AJOL)

Subhadfip Nandi

a variety of novel proteins and secondary metabolites. This study aimed to examine the induction of different stress related enzymes like phenyl alanineammonia lyase (PAL), chitinase, β-1,3 glucanase, oxidative enzymes like peroxidases (POD), poly phenol oxidases (PPO) and phenolics after inoculation of Sclerotium ...

Genetic transformation of garlic ( Allium sativum L.) with tobacco ...

African Journals Online (AJOL)

Garlic yield and quality have decreased due to white rot disease caused by Sclerotium cepivorum Berk. A transformation protocol to introduce tobacco chitinase and glucanase genes into garlic embryogenic calli using Agrobacterium tumefaciens has been established. LBA4404 strain having pC2301CHGLU plasmid with ...

Increased Levels of Antinutritional and/or Defense Proteins Reduced the Protein Quality of a Disease-Resistant Soybean Cultivar.

Science.gov (United States)

Sousa, Daniele O B; Carvalho, Ana F U; Oliveira, José Tadeu A; Farias, Davi F; Castelar, Ivan; Oliveira, Henrique P; Vasconcelos, Ilka M

2015-07-22

The biochemical and nutritional attributes of two soybean (Glycine max (L.) Merr.) cultivars, one susceptible (Seridó) and the other resistant (Seridó-RCH) to stem canker, were examined to assess whether the resistance to pathogens was related to levels of antinutritional and/or defense proteins in the plant and subsequently affected the nutritional quality. Lectin, urease, trypsin inhibitor, peroxidase and chitinase activities were higher in the resistant cultivar. Growing rats were fed with isocaloric and isoproteic diets prepared with defatted raw soybean meals. Those on the Seridó-RCH diet showed the worst performance in terms of protein quality indicators. Based on regression analysis, lectin, trypsin inhibitor, peroxidase and chitinase appear to be involved in the resistance trait but also in the poorer nutritional quality of Seridó-RCH. Thus, the development of cultivars for disease resistance may lead to higher concentrations of antinutritional compounds, affecting the quality of soybean seeds. Further research that includes the assessment of more cultivars/genotypes is needed.

Agrobacterium tumefaciens-mediated genetic transformation of embryogenesis cell suspensions of banana cultivar Grande naine (AAA

Directory of Open Access Journals (Sweden)

Idalmis Bermúdez-Caraballoso

2004-01-01

Full Text Available The black Sigatoka (Mycosphaerella fijiensis Morelet has become in the last years, the most destructive disease that affects the production of banana and plantains world-wide. The present work was made with the objective to obtain transgenic plants of banana cultivar Grand naine (AAA resistant to this disease with the use of genetic transformation. Embryogenenic cell suspensions obtained from somatic embryos formed from immature male flowers, were used for the transformation by Agrobacterium tumefaciens. The bacterial strain EHA-105 was used with the binary plasmids pHCA-58, pHCG-59 and pHGA-91, which contain different combinations of genes that encode for the antifungal chitinase, glucanase enzymes and the AP-24 osmotin. The commercial herbicide BASTA® was used as selective agent. One hundred ten putative transformed lines of the three constructions were obtained, after three selection months in the culture medium. The transgenic events were verified by means of Polymerase Chain Reaction analysis. Key words: AP-24, chitinase, glucanase, Musa, Mycosphaerella fijiensis

The platelet-activating factor acetylhydrolase gene derived from Trichoderma harzianum induces maize resistance to Curvularia lunata through the jasmonic acid signaling pathway.

Science.gov (United States)

Yu, Chuanjin; Fan, Lili; Gao, Jinxin; Wang, Meng; Wu, Qiong; Tang, Jun; Li, Yaqian; Chen, Jie

2015-01-01

Platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum was upregulated by the interaction of T. harzianum with maize roots or the foliar pathogen Curvularia lunata. PAF-AH was associated with chitinase and cellulase expressions, but especially with chitinase, because its activity in the KO40 transformant (PAF-AH disruption transformant) was lower, compared with the wild-type strain T28. The result demonstrated that the colonization of maize roots by T. harzianum induced systemic protection of leaves inoculated with C. lunata. Such protection was associated with the expression of inducible jasmonic acid pathway-related genes. Moreover, the data from liquid chromatography-mass spectrometry confirmed that the concentration of jasmonic acid in maize leaves was associated with the expression level of defense-related genes, suggesting that PAF-AH induced resistance to the foliar pathogen. Our findings showed that PAF-AH had an important function in inducing systemic resistance to maize leaf spot pathogen.

Expression Study of Banana Pathogenic Resistance Genes

Directory of Open Access Journals (Sweden)

Fenny M. Dwivany

2016-10-01

Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

Application of Osthol Induces a Resistance Response Against Powdery Mildew in Pumpkin Leave

Directory of Open Access Journals (Sweden)

Yong Jian Fan

2007-09-01

Full Text Available Plants can defend themselves against fungal infection by natural means inducedby biotic and abiotic elicitors. Osthol is a natural compound extracted from dried fruits ofCnidii Monnieri Fructus. In this study, it has been shown to not only be a fungicide withacceptable curative properties (control efficacy of 68.72, but it also showed a significantprophylactic effect (with control efficacy of 77.36 against pumpkin powdery mildew at aconcentration of 100 μg·mL-1. In pumpkin leaves with/or without inoculation ofSphaerotheca fuliginea, osthol treatment induced the accumulation of chitinase andperoxidase and enhanced the transcription of chitinase gene in non-inoculated leaves. Thepotentiation of phenylalanine amonia-lyase activity in leaves by osthol application andfollowing inoculation was absent in that with inoculation or osthol treatment, indicatingthat induced PAL in osthol-pretreated plants was inoculation-mediated. In conclusion, thisnatural compound could induce resistance response in the plant against powdery mildew.

Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

Directory of Open Access Journals (Sweden)

Caroline da Silva Moraes

2014-08-01

Full Text Available The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females or blood feeders (females only, and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18 and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes.

Isolation and Identification of the Chitinolytic Bacteria from Rumen Ecosystem

Directory of Open Access Journals (Sweden)

Sri Rahayu

2003-05-01

Full Text Available Rumen is an interesting ecosystem for microbial exploration and their products. Isolation of the chitinolytic bacteria from the rumen ecosystem found 109 colonies that produced clear zone, 84 colonies (86% anaerobic and 17 colonies (14% aerobic. Clear zone appeared in the third and fourth days incubation. Four potential isolates were chosen for identification purposes. Results showed that the bacteria were sticky, gram-positive, motile, endospore-forming, mesophilic and aerobic. It was supposed to Bacillus spp. the optimal pH and temperature to produce chitinase from isolate 18 are pH 6.0 and temperature of 35-40ºC. Divalent cations Mg, Ca, Zn, and Mn increase chitinase activity, while Cu and Co inhibit enzyme activity. When isolate 18 was grown on shrimp waste meal, it showed aptimal activity on the fifth days incubation. (Animal Production 5(2: 73-78 (2003   Key Words : Isolation, Identification, Chitinolytic Bacteria, Rumen

Encouragement of Enzyme Reaction Utilizing Heat Generation from Ferromagnetic Particles Subjected to an AC Magnetic Field.

Directory of Open Access Journals (Sweden)

Masashi Suzuki

Full Text Available We propose a method of activating an enzyme utilizing heat generation from ferromagnetic particles under an ac magnetic field. We immobilize α-amylase on the surface of ferromagnetic particles and analyze its activity. We find that when α-amylase/ferromagnetic particle hybrids, that is, ferromagnetic particles, on which α-amylase molecules are immobilized, are subjected to an ac magnetic field, the particles generate heat and as a result, α-amylase on the particles is heated up and activated. We next prepare a solution, in which α-amylase/ferromagnetic particle hybrids and free, nonimmobilized chitinase are dispersed, and analyze their activities. We find that when the solution is subjected to an ac magnetic field, the activity of α-amylase immobilized on the particles increases, whereas that of free chitinase hardly changes; in other words, only α-amylase immobilized on the particles is selectively activated due to heat generation from the particles.

Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

Science.gov (United States)

Moraes, Caroline da Silva; Diaz-Albiter, Hector M.; Faria, Maiara do Valle; Sant'Anna, Maurício R. V.; Dillon, Rod J.; Genta, Fernando A.

2014-01-01

The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females) or blood feeders (females only), and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases, and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18, and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes. PMID:25140153

Soil zymography - A novel technique for mapping enzyme activity in the rhizosphere

Science.gov (United States)

Spohn, Marie

2014-05-01

The effect plant roots on microbial activity in soil at the millimeter scale is poorly understood. One reason for this is that spatially explicit methods for the study of microbial activity in soil are limited. Here we present a quantitative in situ technique for mapping the distribution of exoenzymes in soil along with some results about the effects of roots on exoenzyme activity in soil. In the first study we showed that both acid and alkaline phosphatase activity were up to 5.4-times larger in the rhizosphere of Lupinus albus than in the bulk soil. While acid phosphatase activity (produced by roots and microorganisms) was closely associated with roots, alkaline phosphatase activity (produced only by microorganisms) was more widely distributed, leading to a 2.5-times larger area of activity of alkaline than of acid phosphatase. These results indicate a spatial differentiation of different ecophysiological groups of organic phosphorus mineralizing organisms in the rhizosphere which might alleviate a potential competition for phosphorus between them. In a second study cellulase, chitinase and phosphatase activities were analyzed in the presence of living Lupinus polyphyllus roots and dead/dying roots (in the same soils 10, 20 and 30 days after cutting the L. polyphyllus shoots). The activity of all three enzymes was 9.0 to 13.9-times higher at the living roots compared to the bulk soil. Microhotspots of cellulase, chitinase and phosphatase activity in the soil were found up to 60 mm away from the living roots. 10 days after shoot cutting, the areas of high activities of cellulase and phosphatase activity were extend up to 55 mm away from the next root, while the extension of the area of chitinase activity did not change significantly. At the root, cellulase and chitinase activity increased first at the root tips after shoot cutting and showed maximal activity 20 days after shoot cutting. The number and activity of microhotspots of chitinase activity was maximal 10

Factor affecting Agrobacterium -mediated transformation of rice ...

African Journals Online (AJOL)

Potato is a very important food crop and is adversely affected by fungus. Agrobacterium-mediated transformation can play an important role in the improvement of potato. The present study was conducted to optimize the different factors affecting Agrobacterium-mediated transformation of chitinase gene. Nodes were used as ...

Characterization of two novel bacterial type A exo-chitobiose hydrolases having C-terminal 5/12-type carbohydrate-binding modules

DEFF Research Database (Denmark)

Binti Jamek, Shariza; Nyffenegger, Christian; Muschiol, Jan

2017-01-01

"exo-chitobiose hydrolases." In this study, the chitinase type A from Serratia marcescens (SmaChiA) was used as a template for identifying two novel exo-chitobiose hydrolase type A enzymes, FbalChi18A and MvarChi18A, originating from the marine organisms Ferrimonas balearica and Microbulbifer...

Enzymic and structural studies on processed proteins from the vacuolar (lutoid-body) fraction of latex of Hevea brasiliensis

NARCIS (Netherlands)

Subroto, T; de Vries, H; Schuringa, JJ; Soedjanaatmadja, UMS; Hofsteenge, J; Jekel, PA; Beintema, JJ

2001-01-01

The lutoid-body (bottom) fraction of latex from the rubber tree (Hevea brasiliensis) contains a limited number of major proteins. These are the chitin-binding protein hevein, its precursor and C-terminal fragment of the precursor, a basic chitinase/lysozyme, and a beta-1,3-glucanase. The content and

Identification of an Endophytic Antifungal Bacterial Strain Isolated from the Rubber Tree and Its Application in the Biological Control of Banana Fusarium Wilt.

Directory of Open Access Journals (Sweden)

Deguan Tan

Full Text Available Banana Fusarium wilt (also known as Panama disease is one of the most disastrous plant diseases. Effective control methods are still under exploring. The endophytic bacterial strain ITBB B5-1 was isolated from the rubber tree, and identified as Serratia marcescens by morphological, biochemical, and phylogenetic analyses. This strain exhibited a high potential for biological control against the banana Fusarium disease. Visual agar plate assay showed that ITBB B5-1 restricted the mycelial growth of the pathogenic fungus Fusarium oxysporum f. sp. cubense race 4 (FOC4. Microscopic observation revealed that the cell wall of the FOC4 mycelium close to the co-cultured bacterium was partially decomposed, and the conidial formation was prohibited. The inhibition ratio of the culture fluid of ITBB B5-1 against the pathogenic fungus was 95.4% as estimated by tip culture assay. Chitinase and glucanase activity was detected in the culture fluid, and the highest activity was obtained at Day 2 and Day 3 of incubation for chitinase and glucanase, respectively. The filtrated cell-free culture fluid degraded the cell wall of FOC4 mycelium. These results indicated that chitinase and glucanase were involved in the antifungal mechanism of ITBB B5-1. The potted banana plants that were inoculated with ITBB B5-1 before infection with FOC4 showed 78.7% reduction in the disease severity index in the green house experiments. In the field trials, ITBB B5-1 showed a control effect of approximately 70.0% against the disease. Therefore, the endophytic bacterial strain ITBB B5-1 could be applied in the biological control of banana Fusarium wilt.

Excretome of the chitinolytic bacterium Clostridium paraputrificum J4

Czech Academy of Sciences Publication Activity Database

Šimůnek, Jiří; Koppová, Ingrid; Tiščenko, Galina; Dohnálek, Jan; Dušková, Jarmila

2012-01-01

Roč. 57, č. 4 (2012), s. 335-339 ISSN 0015-5632 R&D Projects: GA ČR GA310/09/1407 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z40500505 Keywords : chitinase * purification * enzymes Subject RIV: EE - Microbiology, Virology Impact factor: 0.791, year: 2012

Substituted 4-hydroxy-1,2,3-triazoles

DEFF Research Database (Denmark)

Pippione, Agnese C.; Dosio, Franco; Ducime, Alex

2015-01-01

the distal (S)-glutamic acid carboxyl group using the 4-hydroxy-1,2,3-triazole moiety is applied, to obtain two promising glutamate analogs. In the second example, a scaffold hopping approach is applied, replacing the phenolic moiety present in MDG-1-33A, a potent inhibitor of Onchocerca volvulus chitinase...

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Estimation of in situ mating systems in wild sorghum (Sorghum bicolor (L.) Moench) in .... is one of the novel chromosome regions influencing dough-mixing strength. ... Validation of PPP1R12B as a candidate gene for childhood asthma in Russians ... Genomewide analysis of the chitinase gene family in Populus trichocarpa.

Metagenomic insights into the uncultured diversity and physiology of microbes in four hypersaline soda lake brines.

Czech Academy of Sciences Publication Activity Database

Vavourakis, C. D.; Ghai, Rohit; Rodriguez-Valera, F.; Sorokin, D. Y.; Tringe, S. G.; Hugenholtz, P.; Muyzer, G.

2016-01-01

Roč. 7, February (2016), č. článku 211. ISSN 1664-302X R&D Projects: GA ČR(CZ) GA13-00243S Institutional support: RVO:60077344 Keywords : soda lake brines * Nanohaloarchaea * Halobacteria * Bacteroidetes * hydrolytics * cellulase * chitinase * rhodopsin Subject RIV: EE - Microbiology, Virology Impact factor: 4.076, year: 2016

Influence of protoplast fusion between two Trichoderma spp. on extracellular enzymes production and antagonistic activity.

Science.gov (United States)

Hassan, Mohamed M

2014-11-02

Biological control plays a crucial role in grapevine pathogens disease management. The cell-wall degrading enzymes chitinase, cellulase and β-glucanase have been suggested to be essential for the mycoparasitism activity of Trichoderma species against grapevine fungal pathogens. In order to develop a useful strain as a single source of these vital enzymes, it was intended to incorporate the characteristics of two parental fungicides tolerant mutants of Trichoderma belonging to the high chitinase producing species T. harzianum and the high cellulase producing species T. viride , by fusing their protoplasts. The phylogeny of the parental strains was carried out using a sequence of the 5.8S-ITS region. The BLAST of the obtained sequence identified these isolates as T. harzianum and T. viride . Protoplasts were isolated using lysing enzymes and were fused using polyethylene glycol. The fused protoplasts have been regenerated on protoplast regeneration minimal medium supplemented with two selective fungicides. Among the 40 fast growing fusants, 17 fusants were selected based on their enhanced growth on selective media for further studies. The fusant strains were growing 60%-70% faster than the parents up to third generation. All the 17 selected fusants exhibited morphological variations. Some fusant strains displayed threefold increased chitinase enzyme activity and twofold increase in β-glucanase enzyme activity compared to the parent strains. Most fusants showed powerful antagonistic activity against Macrophomin aphaseolina , Pythium ultimum and Sclerotium rolfsii pathogens. Fusant number 15 showed the highest inhibition percentage (92.8%) against M. phaseolina and P. ultimum, while fusant number 9 showed the highest inhibition percentage (98.2%) against the growth of S. rolfsii. A hyphal intertwining and degradation phenomenon was observed by scanning electron microscope. The Trichoderma antagonistic effect against pathogenic fungal mycelia was due to the

Feeding of Whitefly on Tobacco Decreases Aphid Performance via Increased Salicylate Signaling.

Directory of Open Access Journals (Sweden)

Haipeng Zhao

Full Text Available The feeding of Bemisia tabaci nymphs trigger the SA pathway in some plant species. A previous study showed that B. tabaci nymphs induced defense against aphids (Myzus persicae in tobacco. However, the mechanism underlying this defense response is not well understood.Here, the effect of activating the SA signaling pathway in tobacco plants through B. tabaci nymph infestation on subsequent M. persicae colonization is investigated. Performance assays showed that B. tabaci nymphs pre-infestation significantly reduced M. persicae survival and fecundity systemically in wild-type (WT but not salicylate-deficient (NahG plants compared with respective control. However, pre-infestation had no obvious local effects on subsequent M. persicae in either WT or NahG tobacco. SA quantification results indicated that the highest accumulation of SA was induced by B. tabaci nymphs in WT plants after 15 days of infestation. These levels were 8.45- and 6.14-fold higher in the local and systemic leaves, respectively, than in controls. Meanwhile, no significant changes of SA levels were detected in NahG plants. Further, biochemical analysis of defense enzymes polyphenol oxidase (PPO, peroxidase (POD, β-1,3-glucanase, and chitinase demonstrated that B. tabaci nymph infestation increased these enzymes' activity locally and systemically in WT plants, and there was more chitinase and β-1, 3-glucanase activity systemically than locally, which was opposite to the changing trends of PPO. However, B. tabaci nymph infestation caused no obvious increase in enzyme activity in any NahG plants except POD.In conclusion, these results underscore the important role that induction of the SA signaling pathway by B. tabaci nymphs plays in defeating aphids. It also indicates that the activity of β-1, 3-glucanase and chitinase may be positively correlated with resistance to aphids.

Isolation of microorganisms with chinitase, protease and keratinase activities from petroleum contaminated soils

International Nuclear Information System (INIS)

Cervantes-Gonzalez, E.; Rojas-Avelizapa, L.; Cruz-Camarillo, R.; Rojas-Avelizapa, N.G.

2005-01-01

The most important part in one process of bio-remediation are the microorganisms with the capacities to degrade target compounds, this research is based to find microorganisms hydrocarbon-clastic with enzyme activities to degrade chicken feather (keratinolytic activity) which is also a contaminant and has been used such as sorbent of petroleum and can be composted after the oil spill cleanup is complete, the isolation was also to degrade shrimp waste (chitinolitic and proteolitic activity) which is waste material that can be used in compost or such as sorbent of petroleum too. We isolated mesofilic aerobic microorganisms from mexican soils located in Tabasco, Mexico. We achieved to isolate 105 bacteria from 10 soils, 90% was Bacillus Gram (-) which are common in soils and all were hydrocarbon-clastic, only 7 different bacteria had protease and chitinase activity and 12 bacteria had keratinase activity. So we found three fungi and one actinomycete with capacity to degrade hydrocarbons and presence of chitinase activity. The results of growth and enzyme activities in liquid culture showed that the protease activity was produced between 18 and 48 h in almost all bacteria, the chitinase activity started at 12 h but was slight , only 0.5 U/ml, and the keratinase activity was produced after 6 h of incubation and there were correlation between logarithmic phase of growth and enzymes production. With this study we showed the existence of some enzyme activities from microorganisms that live in hostile habitats. This, can be useful in bio-treatment soils by the possible use of this type of residues that can be bio-degraded at the same time that the hydrocarbons increasing the speed or the quality of cleanup in soils. (authors)

Changes of exoskeleton surface roughness and expression of crucial participation genes for chitin formation and digestion in the mud crab (Macrophthalmus japonicus) following the antifouling biocide irgarol.

Science.gov (United States)

Park, Kiyun; Nikapitiya, Chamilani; Kim, Won-Seok; Kwak, Tae-Soo; Kwak, Ihn-Sil

2016-10-01

Irgarol is a common antifoulant present in coastal sediment. The mud crab Macrophthalmus japonicus is one of the most abundant of the macrobenthos in the costal environment, and its exoskeleton has a protective function against various environmental threats. We evaluated the effects of irgarol toxicity on the exoskeleton of M. japonicus, which is the outer layer facing the environment. We analyzed transcriptional expression of exoskeleton, molting, and proteolysis-related genes in the gill and hepatopancreas of these exposed M. japonicus. In addition, changes in survival and exoskeleton surface characteristics were investigated. In the hepatopancreas, mRNA expression of chitinase 1 (Mj-chi1), chitinase 4 (Mj-chi4), and chitinase 5 (Mj-chi5) increased in M. japonicus exposed to all concentrations of irgarol. Mj-chi1 and Mj-chi4 expressions from 1 to 10μgL(-1) were dose- and time-dependent. Ecdysteroid receptor (Mj-EcR), trypsin (Mj-Tryp), and serine proteinase (Mj-SP) in the hepatopancreas were upregulated in response to different exposure levels of irgarol at day 1, 4, or 7. In contrast, gill Mj-chi5, Mj-Tryp, and Mj-SP exhibited late upregulated responses to 10μgL(-1) irgarol compared to the control at day 7. Mj-chi1 showed early upregulation upon exposure to 10μgL(-1) irgarol and Mj-chi4 showed no changes in transcription in the gill. Gill Mj-EcR presented generally downregulated expression patterns. In addition, decreased survival and change of exoskeleton surface roughness were observed in M. japonicus exposed to the three concentrations of irgarol. These results suggest that exposure to irgarol induces changes in the exoskeleton, molting, and proteolysis metabolism of M. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Extraction of Pathogenesis-Related Proteins and Phenolics in Sauvignon Blanc as Affected by Grape Harvesting and Processing Conditions

Directory of Open Access Journals (Sweden)

Bin Tian

2017-07-01

Full Text Available Thaumatin-like proteins (TLPs and chitinases are the two main groups of pathogenesis-related (PR proteins found in wine that cause protein haze formation. Previous studies have found that phenolics are also involved in protein haze formation. In this study, Sauvignon Blanc grapes were harvested and processed in two vintages (2011 and 2012 by three different treatments: (1 hand harvesting with whole bunch press (H-WB; (2 hand harvesting with destem/crush and 3 h skin contact (H-DC-3; and (3 machine harvesting with destem/crush and 3 h skin contact (M-DC-3. The juices were collected at three pressure levels (0.4 MPa, 0.8 MPa and 1.6 MPa, some juices were fermented in 750 mL of wine bottles to determine the bentonite requirement for the resulting wines. Results showed juices of M-DC-3 had significantly lower concentration of proteins, including PR proteins, compared to those of H-DC-3, likely due to the greater juice yield of M-DC-3 and interactions between proteins and phenolics. Juices from the 0.8–1.6 MPa pressure and resultant wines had the highest concentration of phenolics but the lowest concentration of TLPs. This supported the view that TLPs are released at low pressure as they are mainly present in grape pulp but additional extraction of phenolics largely present in skin occurs at higher pressing pressure. Wine protein stability tests showed a positive linear correlation between bentonite requirement and the concentration of chitinases, indicating the possibility of predicting bentonite requirement by quantification of chitinases. This study contributes to an improved understanding of extraction of haze-forming PR proteins and phenolics that can influence bentonite requirement for protein stabilization.

Deletion of v-chiA from a baculovirus reduces horizontal transmission in the field

Science.gov (United States)

Vincent D' Amico; James Slavicek; John D. Podgwaite; Ralph Webb; Roger Fuester; Randall A. Peiffer

2013-01-01

Nucleopolyhedroviruses (NPVs) can initiate devastating disease outbreaks in populations of defoliating Lepidoptera, a fact that has been exploited for the purposes of biological control of some pest insects. A key part of the horizontal transmission process of NPVs is the degradation of the larval integument by virus-coded proteins called chitinases, such as V-CHIA...

Engineered N-acetylhexosamine-active enzymes in glycoscience

Czech Academy of Sciences Publication Activity Database

Slámová, Kristýna; Bojarová, Pavla

2017-01-01

Roč. 1861, č. 8 (2017), s. 2070-2087 ISSN 0304-4165 R&D Projects: GA ČR GP13-06818P; GA MŠk(CZ) LD15085 Institutional support: RVO:61388971 Keywords : beta-N-acetylhexosaminidase * Chitinase * Glycosynthase Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016

Prescribed burning effects on soil enzyme activity in a southern Ohio hardwood forest: A landscape-scale analysis

Science.gov (United States)

Ralph E. J. Boerner; Kelly L. M. Decker; Elaine K. Sutherland

2000-01-01

We assessed the effect of a single, dormant season prescribed fire on soil enzyme activity in oak-hickory (Quercus-Carya) forests in southern Ohio, USA. Four enzymes specific for different C sources were chosen for monitoring: acid phosphatase, beta-glucosidase, chitinase and phenol oxidase. Postfire acid phosphatase activity was generally reduced by burning and...

Synthesis of enzymes connected with mycoparasitism by ectomycorrhizal fungi.

Science.gov (United States)

Mucha, Joanna; Dahm, Hanna; Strzelczyk, Edmund; Werner, Antoni

2006-03-01

The production of enzymes involved in mycoparasitism by several strains of ectomycorrhizal fungi: Amanita muscaria (16-3), Laccaria laccata (9-12), L. laccata (9-1), Suillus bovinus (15-4), S. bovinus (15-3), S. luteus (14-7) on different substrates such as colloidal chitin, mycelia of Trichoderma harzianum, T. virens and Mucor hiemalis was examined. Chitinases and beta-1,3-glucanases were assayed spectrophotometrically by measuring the amount of reducing sugars releasing from suitable substrate by means of Miller's method. Beta-glucosidases were determined by measuring the amount of p-nitrophenol released from p-nitrophenyl-beta-D-glucopyranoside. It was observed that A. muscaria (16-3) and L. laccata (9-12) biosynthesized the highest activity of enzymes in contrast to the strains of S. bovinus and S. luteus. The mycelium of T. harzianum turned out to be the best substrate for the induction of beta-1,3-glucanases and beta-glucosidases for both strains of L. laccata, although the difference in the induction of chitinases in the presence of mycelia of different species of Trichoderma was not indicated.

A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola.

Science.gov (United States)

Sanz-Martín, José M; Pacheco-Arjona, José Ramón; Bello-Rico, Víctor; Vargas, Walter A; Monod, Michel; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A

2016-09-01

Colletotrichum graminicola causes maize anthracnose, an agronomically important disease with a worldwide distribution. We have identified a fungalysin metalloprotease (Cgfl) with a role in virulence. Transcriptional profiling experiments and live cell imaging show that Cgfl is specifically expressed during the biotrophic stage of infection. To determine whether Cgfl has a role in virulence, we obtained null mutants lacking Cgfl and performed pathogenicity and live microscopy assays. The appressorium morphology of the null mutants is normal, but they exhibit delayed development during the infection process on maize leaves and roots, showing that Cgfl has a role in virulence. In vitro chitinase activity assays of leaves infected with wild-type and null mutant strains show that, in the absence of Cgfl, maize leaves exhibit increased chitinase activity. Phylogenetic analyses show that Cgfl is highly conserved in fungi. Similarity searches, phylogenetic analysis and transcriptional profiling show that C. graminicola encodes two LysM domain-containing homologues of Ecp6, suggesting that this fungus employs both Cgfl-mediated and LysM protein-mediated strategies to control chitin signalling. © 2015 BSPP and John Wiley & Sons Ltd.

Infections with the Sexually Transmitted Pathogen Nosema apis Trigger an Immune Response in the Seminal Fluid of Honey Bees (Apis mellifera).

Science.gov (United States)

Grassl, Julia; Peng, Yan; Baer-Imhoof, Barbara; Welch, Mat; Millar, A Harvey; Baer, Boris

2017-01-06

Honey bee (Apis mellifera) males are highly susceptible to infections with the sexually transmitted fungal pathogen Nosema apis. However, they are able to suppress this parasite in the ejaculate using immune molecules in the seminal fluid. We predicted that males respond to infections by altering the seminal fluid proteome to minimize the risk to sexually transmit the parasite to the queen and her colony. We used iTRAQ isotopic labeling to compare seminal fluid proteins from infected and noninfected males and found that N. apis infections resulted in significant abundance changes in 111 of the 260 seminal fluid proteins quantitated. The largest group of proteins with significantly changed abundances consisted of 15 proteins with well-known immune-related functions, which included two significantly more abundant chitinases in the seminal fluid of infected males. Chitinases were previously hypothesized to be involved in honey bee antifungal activity against N. apis. Here we show that infection with N. apis triggers a highly specific immune response in the seminal fluid of honey bee males.

Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

Science.gov (United States)

Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

2015-06-01

Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

Isolation and selection of plant growth-promoting bacteria associated with sugarcane

Directory of Open Access Journals (Sweden)

Ariana Alves Rodrigues

2016-06-01

Full Text Available Microorganisms play a vital role in maintaining soil fertility and plant health. They can act as biofertilizers and increase the resistance to biotic and abiotic stress. This study aimed at isolating and characterizing plant growth-promoting bacteria associated with sugarcane, as well as assessing their ability to promote plant growth. Endophytic bacteria from leaf, stem, root and rhizosphere were isolated from the RB 867515 commercial sugarcane variety and screened for indole acetic acid (IAA production, ability to solubilize phosphate, fix nitrogen and produce hydrogen cyanide (HCN, ammonia and the enzymes pectinase, cellulase and chitinase. A total of 136 bacteria were isolated, with 83 of them presenting some plant growth mechanism: 47 % phosphate solubilizers, 26 % nitrogen fixers and 57 % producing IAA, 0.7 % HCN and chitinase, 45 % ammonia, 30 % cellulose and 8 % pectinase. The seven best isolates were tested for their ability to promote plant growth in maize. The isolates tested for plant growth promotion belong to the Enterobacteriaceae family and the Klebsiella, Enterobacter and Pantoea genera. Five isolates promoted plant growth in greenhouse experiments, showing potential as biofertilizers.

Visualization of enzyme activities inside earthworm pores

Science.gov (United States)

Hoang, Duyen; Razavi, Bahar S.

2015-04-01

In extremely dynamic microhabitats as bio-pores made by earthworm, the in situ enzyme activities are assumed as a footprint of complex biotic interactions. Our study focused on the effect of earthworm on the enzyme activities inside bio-pores and visualizing the differences between bio-pores and earthworm-free soil by zymography technique (Spohn and Kuzyakov, 2013). For the first time, we aimed at quantitative imaging of enzyme activities in bio-pores. Lumbricus terrestris L. was placed into transparent box (15×20×15cm). After two weeks when bio-pore systems were formed by earthworms, we visualized in situ enzyme activities of five hydrolytic enzymes (β-glucosidase, cellobiohydrolase, chitinase, xylanase, leucine-aminopeptidase, and phosphatase. Zymography showed higher activity of β-glucosidase, chitinase, xylanase and phosphatase in biopores comparing to bulk soil. However, the differences in activity of cellobiohydrolase and leucine aminopeptidase between bio-pore and bulk soil were less pronounced. This demonstrated an applicability of zymography approach to monitor and to distinguish the in situ activity of hydrolytic enzymes in soil biopores.

Antifungical Activity of Autochthonous Bacillus subtilis Isolated from Prosopis juliflora against Phytopathogenic Fungi.

Science.gov (United States)

Abdelmoteleb, Ali; Troncoso-Rojas, Rosalba; Gonzalez-Soto, Tania; González-Mendoza, Daniel

2017-12-01

The ability of Bacillus subtilis , strain ALICA to produce three mycolytic enzymes (chitinase, β-1,3-glucanase, and protease), was carried out by the chemical standard methods. Bacillus subtilis ALICA was screened based on their antifungal activity in dual plate assay and cell-free culture filtrate (25%) against five different phytopathogenic fungi Alternaria alternata , Macrophomina sp., Colletotrichum gloeosporioides , Botrytis cinerea , and Sclerotium rolfesii . The B. subtilis ALICA detected positive for chitinase, β-1,3-glucanase and protease enzymes. Fungal growth inhibition by both strain ALICA and its cell-free culture filtrate ranged from 51.36% to 86.3% and 38.43% to 68.6%, respectively. Moreover, hyphal morphological changes like damage, broken, swelling, distortions abnormal morphology were observed. Genes expression of protease, β-1,3-glucanase, and lipopeptides (subtilosin and subtilisin) were confirmed their presence in the supernatant of strain ALICA. Our findings indicated that strain ALICA provided a broad spectrum of antifungal activities against various phytopathogenic fungi and may be a potential effective alternative to chemical fungicides.

Enzymatic production of N-acetyl-d-glucosamine from crayfish shell wastes pretreated via high pressure homogenization.

Science.gov (United States)

Wei, Guoguang; Zhang, Alei; Chen, Kequan; Ouyang, Pingkai

2017-09-01

This study presents an efficient pretreatment of crayfish shell using high pressure homogenization that enables N-acetyl-d-glucosamine (GlcNAc) production by chitinase. Firstly, the chitinase from Serratia proteamaculans NJ303 was screened for its ability to degrade crayfish shell and produce GlcNAc as the sole product. Secondly, high pressure homogenization, which caused the crayfish shell to adopt a fluffy netted structure that was characterized by Scanning electron microscope (SEM), Fourier transform infrared spectrometer (FT-IR), X-ray diffraction (XRD), was evaluated as the best pretreatment method. In addition, the optimal conditions of high pressure homogenization of crayfish shell were determined to be five cycles at a pressure of 400bar, which achieved a yield of 3.9g/L of GlcNAc from 25g/L of crayfish shell in a batch enzymatic reaction over 1.5h. The results showed high pressure homogenization might be an efficient method for direct utilization of crayfish shell for enzymatic production of GlcNAc. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sample preparation in separation of the extracellular chitinolytic enzymes of the human intestinal bacterium Clostridium paraputrificum J4 from the culture fluids

Czech Academy of Sciences Publication Activity Database

Tishchenko, Galina; Šimůnek, Jiří; Bartoňová, Hana; Dušková, Jarmila; Dohnálek, Jan; Ponomareva, Evgenia; Tennikova, T.

2011-01-01

Roč. 879, č. 22 (2011), s. 2175-2178 ISSN 1570-0232 R&D Projects: GA ČR GA310/09/1407; GA ČR GA525/05/2584 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z50450515 Keywords : sample preparation * culture fluids C. paraputrificum J4 * chitinases Subject RIV: EE - Microbiology, Virology Impact factor: 2.888, year: 2011

Effective stimulation of the biotechnological potential of the medicinal white rot fungus: Phellinus pini by menadione-mediated oxidative stress.

Science.gov (United States)

Jaszek, Magdalena; Kos, Katarzyna; Matuszewska, Anna; Grąz, Marcin; Stefaniuk, Dawid; Osińska-Jaroszuk, Monika; Prendecka, Monika; Jóźwik, Ewa; Grzywnowicz, Krzysztof

2014-09-01

The effect of menadione (MQ; 2-methyl-1,4-naphtoquinone), a superoxide-generating agent, on the natural biodegradation system in the medicinal white rot fungus Phellinus pini was determined. While measuring the activities of extracellular manganese-dependent peroxidase (MnP) and intracellular chitinase, it was found that the application of MQ (0.75 mM) distinctly stimulated the activities of these enzymes in comparison to the control values (without MQ). Using the capillary electrophoresis (CE) method, an increase in the extracellular oxalic acid (OXA) concentration was detected during the first days after the addition of MQ. It was observed that the rate of intracellular proteolysis at pH 3.5 evidently decreased under oxidative stress conditions. Contrary to these results, the activities of serine proteases at pH 9.5 measured against fluorogenic peptide substrates distinctly increased in stressed cultures. The MQ treatment also caused an evident increase in the catalase (CAT) activity, as well as the levels of superoxide anion radicals (SORs), formaldehyde (FA), and phenolic compounds (PHC) in the experimental cultures. The results obtained confirm that prooxidants may find application as an effective way to stimulate biotechnological production of MnP and chitinase by white rot fungi.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Glucose-mediated repression of autolysis and conidiogenesis in Emericella nidulans.

Science.gov (United States)

Emri, Tamás; Molnár, Zsolt; Veres, Tünde; Pusztahelyi, Tünde; Dudás, Gábor; Pócsi, István

2006-10-01

Glucose-mediated repression of autolysis and sporulation was studied in submerged Emericellanidulans (anam. Aspergillus nidulans) cultures. Null mutation of the creA gene, which encodes the major carbon catabolite repressor CreA in E. nidulans, resulted in a hyperautolytic phenotype characterized by increased extracellular hydrolase production and dry cell mass declination. Interestingly, glucose, as well as the glucose antimetabolite 2-deoxy-d-glucose, repressed autolysis and sporulation in both the control and the creA null mutant strains suggesting that these processes were also subjected to CreA-independent carbon regulation. For example, the glucose-mediated, but CreA-independent, repression of the sporulation transcription factor BrlA was likely to contribute to the negative regulation of conidiogenesis by glucose. Although CreA played a prominent role in the regulation of autolysis via the repression of genes encoding important autolytic hydrolases like ChiB chitinase and PrtA protease the age-related production of the chitinase activity was also negatively affected by the down-regulation of brlA expression. However, neither CreA-dependent nor CreA-independent elements of carbon regulation affected the initiation and regulation of cell death in E. nidulans under carbon starvation.

Isolation and characterization of novel chitinolytic bacteria

Science.gov (United States)

Gürkök, Sümeyra; Görmez, Arzu

2016-04-01

Chitin, a linear polymer of β-1,4-N-acetylglucosamine units, is one of the most abundant biopolymers widely distributed in the marine and terrestrial environments. It is found as a structural component of insects, crustaceans and the cell walls of fungi. Chitinases, the enzymes degrading chitin by cleaving the β-(1-4) bond, have gained increased attention due to their wide range of biotechnological applications, especially for biocontrol of harmful insects and phytopathogenic fungi in agriculture. In the present study, 200 bacterial isolates from Western Anatolia Region of Turkey were screened for chitinolytic activity on agar media amended with colloidal chitin. Based on the chitin hydrolysis zone, 13 isolates were selected for further study. Bacterial isolates with the highest chitinase activity were identified as Acinetobacter calcoaceticus, Arthrobacter oxydans, Bacillus cereus, Bacillus megaterium, Brevibacillus reuszeri, Kocuria erythromyxa, Kocuria rosea, Novosphingobium capsulatum, Rhodococcus bratislaviensis, Rhodococcus fascians and Staphylococcus cohnii by MIS and BIOLOG systems. The next aims of the study are to compare the productivity of these bacteria quantitatively, to purify the enzyme from the most potent producer and to apply the pure enzyme for the fight against the phytopathogenic fungi and harmful insects.

Effets d'application sur le long terme de fertilisants organiques et ...

African Journals Online (AJOL)

Les teneurs en C, N et P, les agrégats formés, le potentiel de respiration du sol, les activités de la chitinase et la longueur des hyphes fongiques ont été déterminés. ... English Title: Long-term effect of organic residues and mineral fertilizers on soil aggregation and microbial activities in a tropical sandy soil in Burkina Faso.

Microbial dynamics and enzyme activities in tropical Andosols depending on land use and nutrient inputs

Science.gov (United States)

Mganga, Kevin; Razavi, Bahar; Kuzyakov, Yakov

2015-04-01

Microbial decomposition of soil organic matter is mediated by enzymes and is a key source of terrestrial CO2 emissions. Microbial and enzyme activities are necessary to understand soil biochemical functioning and identify changes in soil quality. However, little is known about land use and nutrients availability effects on enzyme activities and microbial processes, especially in tropical soils of Africa. This study was conducted to examine how microbial and enzyme activities differ between different land uses and nutrient availability. As Andosols of Mt. Kilimanjaro are limited by nutrient concentrations, we hypothesize that N and P additions will stimulate enzyme activity. N and P were added to soil samples (0-20 cm) representing common land use types in East Africa: (1) savannah, (2) maize fields, (3) lower montane forest, (4) coffee plantation, (5) grasslands and (6) traditional Chagga homegardens. Total CO2 efflux from soil, microbial biomass and activities of β-glucosidase, cellobiohydrolase, chitinase and phosphatase involved in C, N and P cycling, respectively was monitored for 60 days. Total CO2 production, microbial biomass and enzyme activities varied in the order forest soils > grassland soils > arable soils. Increased β-glucosidase and cellobiohydrolase activities after N addition of grassland soils suggest that microorganisms increased N uptake and utilization to produce C-acquiring enzymes. Low N concentration in all soils inhibited chitinase activity. Depending on land use, N and P addition had an inhibitory or neutral effect on phosphatase activity. We attribute this to the high P retention of Andosols and low impact of N and P on the labile P fractions. Enhanced CO2 production after P addition suggests that increased P availability could stimulate soil organic matter biodegradation in Andosols. In conclusion, land use and nutrients influenced soil enzyme activities and microbial dynamics and demonstrated the decline in soil quality after landuse

Gene flow in genetically modified wheat.

Directory of Open Access Journals (Sweden)

Silvan Rieben

Full Text Available Understanding gene flow in genetically modified (GM crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer

Gene flow in genetically modified wheat.

Science.gov (United States)

Rieben, Silvan; Kalinina, Olena; Schmid, Bernhard; Zeller, Simon L

2011-01-01

Understanding gene flow in genetically modified (GM) crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer approach and that gene

Visualization of enzyme activities inside earthworm biopores by in situ soil zymography

Science.gov (United States)

Thu Duyen Hoang, Thi; Razavi, Bahar. S.; Blagodatskaya, Evgenia; Kuzyakov, Yakov

2015-04-01

Earthworms can strongly activate microorganisms, increase microbial and enzyme activities and consequently the turnover of native soil organic matter. In extremely dynamic microhabitats and hotspots as biopores made by earthworms, the in situ enzyme activities are a footprint of complex biotic interactions. The effect of earthworms on the alteration of enzyme activities inside biopores and the difference between bio-pores and earthworm-free soil was visualized by in situ soil zymography (Spohn and Kuzyakov, 2014). For the first time, we prepared quantitative imaging of enzyme activities in biopores. Furthermore, we developed the zymography technique by direct application of a substrate saturated membrane to the soil to obtain better spatial resolution. Lumbricus terrestris L. was placed into transparent box (15×20×15cm). Simultaneously, maize seed was sown in the soil. Control soil box with maize and without earthworm was prepared in the same way. After two weeks when bio-pore systems were formed by earthworm, we visualized in situ enzyme activities of five hydrolytic enzymes (β-glucosidase, cellobiohydrolase, chitinase, xylanase, leucine aminopeptidase) and phosphatase. Followed by non-destructive zymography, biopore samples and control soil were destructively collected to assay enzyme kinetics by fluorogenically labeled substrates method. Zymography showed higher activity of β-glucosidase, chitinase, xylanase and phosphatase in biopores comparing to bulk soil. These differences were further confirmed by fluorimetric microplate enzyme assay detected significant difference of Vmax in four above mentioned enzymes. Vmax of β-glucosidase, chitinase, xylanase and phosphatase in biopores is 68%, 108%, 50% and 49% higher than that of control soil. However, no difference in cellobiohydrolase and leucine aminopeptidase kinetics between biopores and control soil were detected. This indicated little effect of earthworms on protein and cellulose transformation in soil

Variation of β-1,3-Glucanase, Chitinase and Polyphenoloxidase

African Journals Online (AJOL)

Cacao (Theobroma cacao L.) clones that differ in susceptibility to black pod disease were analysed for response to stress induced by pod inoculation with the fungus Phytophthora megakarya Braz. Et Griff. Fungal inoculation significantly stimulated β-1,3-glucanase activity in both soluble and ionically-bound fractions of the ...

Characterization of Pseudomonas aeruginosa Chitinase, a Gradually Secreted Protein

NARCIS (Netherlands)

Folders, J. (Jindra); Algra, J. (Jon); Roelofs, M.S. (Marc); Loon, L.C. van; Tommassen, J.P.M.; Bitter, Wilbert

2001-01-01

The gram-negative bacterium Pseudomonas aeruginosa secretes many proteins into its extracellular environment via the type I, II, and III secretion systems. In this study, a gene, chiC, coding for an extracellular chitinolytic enzyme, was identified. The chiC gene encodes a polypeptide of 483 amino

Optimization of cultural conditions for production of chitinase by ...

African Journals Online (AJOL)

STORAGESEVER

2008-08-04

Aug 4, 2008 ... Sticklen, 1994; Ancillo et al., 1999; Takakura et al., 2000;. Troedsson et al., 2005; ... Chemicals Company, USA) by the method of Mathivanan (1995). The chitin flakes were ground ..... chitin-containing compost. Appl. Environ.

Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

OpenAIRE

Pranee Pattanapipitpaisal; Rillapat Kamlandharn

2012-01-01

Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar). All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar) assayprocedure and the r...

High prevalence of chitotriosidase deficiency in Peruvian Amerindians exposed to chitin-bearing food and enteroparasites.

Science.gov (United States)

Manno, N; Sherratt, S; Boaretto, F; Coico, F Mejìa; Camus, C Espinoza; Campos, C Jara; Musumeci, S; Battisti, A; Quinnell, R J; León, J Mostacero; Vazza, G; Mostacciuolo, M L; Paoletti, M G; Falcone, F H

2014-11-26

The human genome encodes a gene for an enzymatically active chitinase (CHIT1) located in a single copy on Chromosome 1, which is highly expressed by activated macrophages and in other cells of the innate immune response. Several dysfunctional mutations are known in CHIT1, including a 24-bp duplication in Exon 10 causing catalytic deficiency. This duplication is a common variant conserved in many human populations, except in West and South Africans. Thus it has been proposed that human migration out of Africa and the consequent reduction of exposure to chitin from environmental factors may have enabled the conservation of dysfunctional mutations in human chitinases. Our data obtained from 85 indigenous Amerindians from Peru, representative of populations characterized by high prevalence of chitin-bearing enteroparasites and intense entomophagy, reveal a very high frequency of the 24-bp duplication (47.06%), and of other single nucleotide polymorphisms which are known to partially affect enzymatic activity (G102S: 42.7% and A442G/V: 25.5%). Our finding is in line with a founder effect, but appears to confute our previous hypothesis of a protective role against parasite infection and sustains the discussion on the redundancy of chitinolytic function. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Characterization of O-mannosyltransferase family in Schizosaccharomyces pombe.

Science.gov (United States)

Tanaka, Naotaka; Fujita, Yasuko; Suzuki, Shotaro; Morishita, Masayo; Giga-Hama, Yuko; Shimoda, Chikashi; Takegawa, Kaoru

2005-05-13

Protein O-glycosylation is an essential protein modification in eukaryotic cells. In Saccharomyces cerevisiae, O-mannosylation is initiated in the lumen of the endoplasmic reticulum by O-mannosyltransferase gene products (Pmt1p-7p). A search of the Schizosaccharomyces pombe genome database revealed a total of three O-glycoside mannosyltransferase homologs (ogm1+, ogm2+, and ogm4+), closely related to Saccharomyces cerevisiae PMT1, PMT2, and PMT4. Although individual ogm genes were not found to be essential, ogm1Delta and ogm4Delta mutants exhibited aberrant morphology and failed to agglutinate during mating. The phenotypes of the ogm4Delta mutant were not complemented by overexpression of ogm1+ or ogm2+, suggesting that each of the Ogm proteins does not have overlapping functions. Heterologous expression of a chitinase from S. cerevisiae in the ogm mutants revealed that O-glycosylation of chitinase had decreased in ogm1Delta cells. A GFP-tagged Fus1p from S. cerevisiae was specifically not glycosylated and accumulated in the Golgi in ogm4Delta cells. These results indicate that O-glycosylation initiated by Ogm proteins plays crucial physiological roles and can serve as a sorting determinant for protein transport of membrane glycoproteins in S. pombe.

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

Science.gov (United States)

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Endochitinase 1 (Tv-ECH1) from Trichoderma virens has high subsite specificities for acetylated units when acting on chitosans.

Science.gov (United States)

Bußwinkel, Franziska; Goñi, Oscar; Cord-Landwehr, Stefan; O'Connell, Shane; Moerschbacher, Bruno M

2018-03-15

Chitosans with defined characteristics have been shown to possess reproducible bioactivities for numerous applications. A promising approach for producing chitosans with defined degrees of polymerization (DP), degrees of acetylation (DA), and patterns of acetylation (PA) involves using chitin-modifying enzymes. One such enzyme, the chitinase Tv-ECH1 belonging to the glycoside hydrolase (GH) family 18, seems to have an important role in the biocontrol properties of the fungus Trichoderma virens, suggesting its potential in generating novel chitosans for plant health applications. In this study, the Tv-ECH1 enzyme was overexpressed in the methylotrophic yeast Pichia pastoris, yielding large amounts (up to 2mgmL -1 ) of purified recombinant enzyme of high activity, high purity, and high stability, making the system promising for industrial production of Tv-ECH1. The purified Tv-ECH1 chitinase displayed a wide optimal pH range from 4.5 to 6 and an optimal temperature of 37°C. Detailed subsite specificity analyses revealed high preference for acetylated residues at all four subsites analyzed (-2, -1, +1, +2), making Tv-ECH1 a promising candidate for the biotechnological production of specific chitosan oligomers and for the characterization of chitosan polymers via enzymatic fingerprinting. Copyright © 2018 Elsevier B.V. All rights reserved.

Chitin-induced T6SS in Vibrio cholerae is dependent on ChiS activation.

Science.gov (United States)

Chourashi, Rhishita; Das, Suman; Dhar, Debarpan; Okamoto, Keinosuke; Mukhopadhyay, Asish K; Chatterjee, Nabendu Sekhar

2018-05-01

Vibrio cholerae regularly colonizes the chitinous exoskeleton of crustacean shells in the aquatic region. The type 6 secretion system (T6SS) in V. cholerae is an interbacterial killing device. This system is thought to provide a competitive advantage to V. cholerae in a polymicrobial community of the aquatic region under nutrient-poor conditions. V. cholerae chitin sensing is known to be initiated by the activation of a two-component sensor histidine kinase ChiS in the presence of GlcNAc2 (N,N'-diacetylchitobiose) residues generated by the action of chitinases on chitin. It is known that T6SS in V. cholerae is generally induced by chitin. However, the effect of ChiS activation on T6SS is unknown. Here, we found that ChiS inactivation resulted in impaired bacterial killing and reduced expression of T6SS genes. Active ChiS positively affected T6SS-mediated natural transformation in V. cholerae. ChiS depletion or inactivation also resulted in reduced colonization on insoluble chitin surfaces. Therefore, we have shown that V. cholerae colonization on chitinous surfaces activates ChiS, which promotes T6SS-dependent bacterial killing and horizontal gene transfer. We also highlight the importance of chitinases in T6SS upregulation.

Bacterial quorum sensing and nitrogen cycling in rhizosphere soil

Energy Technology Data Exchange (ETDEWEB)

DeAngelis, K.M.; Lindow, S.E.; Firestone, M.K.

2008-10-01

Plant photosynthate fuels carbon-limited microbial growth and activity, resulting in increased rhizosphere nitrogen (N)-mineralization. Most soil organic N is macromolecular (chitin, protein, nucleotides); enzymatic depolymerization is likely rate-limiting for plant N accumulation. Analyzing Avena (wild oat) planted in microcosms containing sieved field soil, we observed increased rhizosphere chitinase and protease specific activities, bacterial cell densities, and dissolved organic nitrogen (DON) compared to bulk soil. Low-molecular weight DON (<3000 Da) was undetectable in bulk soil but comprised 15% of rhizosphere DON. Extracellular enzyme production in many bacteria requires quorum sensing (QS), cell-density dependent group behavior. Because proteobacteria are considered major rhizosphere colonizers, we assayed the proteobacterial QS signals acyl-homoserine lactones (AHLs), which were significantly increased in the rhizosphere. To investigate the linkage between soil signaling and N cycling, we characterized 533 bacterial isolates from Avena rhizosphere: 24% had chitinase or protease activity and AHL production; disruption of QS in 7 of 8 eight isolates disrupted enzyme activity. Many {alpha}-Proteobacteria were newly found with QS-controlled extracellular enzyme activity. Enhanced specific activities of N-cycling enzymes accompanied by bacterial density-dependent behaviors in rhizosphere soil gives rise to the hypothesis that QS could be a control point in the complex process of rhizosphere N-mineralization.

Identification of predictor parameters to determine agro-industrial compost suppressiveness against Fusarium oxysporum and Phytophthora capsici diseases in muskmelon and pepper seedlings.

Science.gov (United States)

Blaya, Josefa; Lloret, Eva; Ros, Margarita; Pascual, Jose Antonio

2015-05-01

The lack of reliable prediction tools for evaluation of the level and specificity of compost suppressiveness limits its application. In our study, different chemical, biological and microbiological parameters were used to evaluate their potential use as a predictor parameter for the suppressive effect of composts against Fusarium oxysporum f. sp. melonis (FOM) and Phytophthora capsici (P. capsici) in muskmelon and pepper seedlings respectively. Composts were obtained from artichoke sludge, chopped vineyard pruning waste and various agro-industrial wastes (C1: blanched artichokes; C2: garlic waste; C3: dry olive cake). Compost C3 proved to offer the highest level of resistance against FOM, and compost C2 the highest level of resistance against P. capsici. Analysis of phospholipid fatty acids isolated from compost revealed that the three composts showed different microbial community structures. Protease, NAGase and chitinase activities were significantly higher in compost C3, as was dehydrogenase activity in compost C2. The use of specific parameters such as general (dehydrogenase activity) and specific enzymatic activities (protease, NAGase and chitinase activities) may be useful to predict compost suppressiveness against both pathogens. The selection of raw materials for agro-industrial composts is important in controlling Fusarium wilt and Phytophthora root rot. © 2014 Society of Chemical Industry.

The Role of Pathogenesis-Related Proteins in the Tomato-Rhizoctonia solani Interaction

Directory of Open Access Journals (Sweden)

Parissa Taheri

2012-01-01

Full Text Available Rhizoctonia solani is one of the most destructive pathogens causing foot rot disease on tomato. In this study, the molecular and cellular changes of a partially resistant (Sunny 6066 and a susceptible (Rio Grande tomato cultivar after infection with necrotrophic soil-borne fungus R. solani were compared. The expression of defense-related genes such as chitinase (LOC544149 and peroxidase (CEVI-1 in infected tomato cultivars was investigated using semiquantitative reverse transcription-polymerase chain reaction (RT-PCR. This method revealed elevated levels of expression for both genes in the partially resistant cultivar compared to the susceptible cultivar. One of the most prominent facets of basal plant defense responses is the formation of physical barriers at sites of attempted fungal penetration. These structures are produced around the sites of potential pathogen ingress to prevent pathogen progress in plant tissues. We investigated formation of lignin, as one of the most important structural barriers affecting plant resistance, using thioglycolic acid assay. A correlation was found between lignification and higher level of resistance in Sunny 6066 compared to Rio Grande cultivar. These findings suggest the involvement of chitinase, peroxidase, and lignin formation in defense responses of tomato plants against R. solani as a destructive pathogen.

In silico assessment of the potential allergenicity of transgenes used for the development of GM food crops.

Science.gov (United States)

Mishra, Ankita; Gaur, S N; Singh, B P; Arora, Naveen

2012-05-01

Genetically modified (GM) crops require allergenicity and toxicity assessment of the novel protein(s) to ensure complete safety to the consumers. These assessments are performed in accordance with the guidelines proposed by Codex (2003) and ICMR (2008). The guidelines recommend sequence homology analysis as a preliminary step towards allergenicity prediction, later in vitro experiments may be performed to confirm allergenicity. In the present study, an in silico approach is employed to evaluate the allergenic potential of six transgenes routinely used for the development of GM food crops. Among the genes studied, manganese superoxide dismutase (MnSOD) and osmotin shares greater than 90% identity with Hev b 10 and Cap a 1w, respectively. Chitinase shares greater than 70% identity with allergens namely Pers a 1 and Hev b 11, and fungal chitinase showed significant IgE binding with 7 of 75 patients' sera positive to different food extracts. Glucanases (alfalfa, wheat) and glycine betaine aldehyde dehydrogenase gene share 50% homology with allergens like - Ole e 9, Cla h 10 and Alt a 10. The results demonstrate the allergenic potential of six genes and can serve as a guide for selection of transgenes to develop GM crops. Copyright © 2012 Elsevier Ltd. All rights reserved.

MICROBIAL FERMENTATION OF ABUNDANT BIOPOLYMERS: CELLULOSE AND CHITIN

Energy Technology Data Exchange (ETDEWEB)

Leschine, Susan

2009-10-31

Our research has dealt with seven major areas of investigation: i) characterization of cellulolytic members of microbial consortia, with special attention recently given to Clostridium phytofermentans, a bacterium that decomposes cellulose and produces uncommonly large amounts of ethanol, ii) investigations of the chitinase system of Cellulomonas uda; including the purification and characterization of ChiA, the major component of this enzyme system, iii) molecular cloning, sequence and structural analysis of the gene that encodes ChiA in C. uda, iv) biofilm formation by C. uda on nutritive surfaces, v) investigations of the effects of humic substances on cellulose degradation by anaerobic cellulolytic microbes, vi) studies of nitrogen metabolism in cellulolytic anaerobes, and vii) understanding the molecular architecture of the multicomplex cellulase-xylanase system of Clostridium papyrosolvens. Also, progress toward completing the research of more recent projects is briefly summarized. Major accomplishments include: 1. Characterization of Clostridium phytofermentans, a cellulose-fermenting, ethanol-producing bacterium from forest soil. The characterization of a new cellulolytic species isolated from a cellulose-decomposing microbial consortium from forest soil was completed. This bacterium is remarkable for the high concentrations of ethanol produced during cellulose fermentation, typically more than twice the concentration produced by other species of cellulolytic clostridia. 2. Examination of the use of chitin as a source of carbon and nitrogen by cellulolytic microbes. We discovered that many cellulolytic anaerobes and facultative aerobes are able to use chitin as a source of both carbon and nitrogen. This major discovery expands our understanding of the biology of cellulose-fermenting bacteria and may lead to new applications for these microbes. 3. Comparative studies of the cellulase and chitinase systems of Cellulomonas uda. Results of these studies indicate

In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

Science.gov (United States)

Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap

2015-01-01

Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

Profiling of a few immune responsive genes expressed in postlarvae of Fenneropenaeus indicus challenged with Vibrio harveyi D3

Digital Repository Service at National Institute of Oceanography (India)

Nayak, S.; Ajay, K.M.; Ramaiah, N.; Meena, R.M.; Sreepada, R.A.

controlled tumor protein (TCTP), hemocyanin, serine carboxy peptidase, and chitinase accounted for 10% of the identified ESTs. Interestingly, there was also a higher incidence of genes related to cell cycle progression and protein modification such as S...). It was earlier reported to be upregulated following challenge with WSSV (Pan et al., 2005). Binding of free iron is considered bacteriostatic, as bacterial cell growth, in particular of Vibrionaceae, is inhibited if iron is not available for synthesis...

High-resolution proteomic profiling of spider venom: expanding the toxin diversity of Phoneutria nigriventer venom.

Science.gov (United States)

Liberato, Tarcísio; Troncone, Lanfranco Ranieri Paolo; Yamashiro, Edson T; Serrano, Solange M T; Zelanis, André

2016-03-01

Here we present a proteomic characterization of Phoneutria nigriventer venom. A shotgun proteomic approach allowed the identification, for the first time, of O-glycosyl hydrolases (chitinases) in P. nigriventer venom. The electrophoretic profiles under nonreducing and reducing conditions, and protein identification by mass spectrometry, indicated the presence of oligomeric toxin structures in the venom. Complementary proteomic approaches allowed for a qualitative and semi-quantitative profiling of P. nigriventer venom complexity, expanding its known venom proteome diversity.

Overexpression of chitinase like protein YKL-40 in leukemia patients

Directory of Open Access Journals (Sweden)

Anil K. Hurmale

2013-01-01

Full Text Available YKL-40 is a member of mammalian chitanase (CHI3L1, expressed and secreted by several types of solid tumor cells, inflammatory cells and stem cells. The precise physiological role of YKL-40 in cancer is still not clear and it is suggested that it play a role in cancer cell proliferation, differentiation, metastatic potential, cell attachment and migration, reorganization and tissue remodeling.The aim of the study was to check the appearance of YKL-40 in leukemic cells and over-expression of YKL-40 in the plasma of leukemia patients in comparison to healthy controls, and find whether YKL-40 could serve as a peripheral biomarker for leukemia. The study was conducted between July 2012 and March 2013 and included 67 volunteers, 55 having leukemia at the stage of diagnosis ofthe disease and 12 normal healthy volunteers. YKL-40 levels were determined in all plasma samples using the YKL-40 enzyme-linked immunosorbent assay (ELISA kit and expression of YKL-40 was observed by using immunocytochemical (ICC analysis. YKL-40 plasma levels differed significantly between patients with leukemia and the normal healthy volunteers (P=<0.001 and YKL-40 was positively expressed in all four types of leukemia (AML, ALL, CLL and CML specimens.

Biocontrol ability of Lysobacter antibioticus HS124 against Phytophthora blight is mediated by the production of 4-hydroxyphenylacetic acid and several lytic enzymes.

Science.gov (United States)

Ko, Hyun-Sun; Jin, Rong-De; Krishnan, Hari B; Lee, Sang-Bog; Kim, Kil-Yong

2009-12-01

Several rhizobacteria play a vital role in plant protection, plant growth promotion and the improvement of soil health. In this study, we have isolated a strain of Lysobacter antibioticus HS124 from rhizosphere and demonstrate its antifungal activity against various pathogens including Phytophthora capsici, a destructive pathogen of pepper plants. L. antibioticus HS124 produced lytic enzymes such as chitinase, beta-1,3-glucanase, lipase, protease, and an antibiotic compound. This antibiotic compound was purified by diaion HP-20, silica gel, sephadex LH-20 column chromatography and high performance liquid chromatography. The purified compound was identified as 4-hydroxyphenylacetic acid by gas chromatography-electron ionization (GC-EI) and gas chromatography-chemical ionization (GC-CI) mass spectrometry. This antibiotic exhibited destructive activity toward P. capsici hyphae. In vivo experiments utilizing green house grown pepper plants demonstrated the protective effect of L. antibioticus HS124 against P. capsici. The growth of pepper plants treated with L. antibioticus culture was enhanced, resulting in greater protection from fungal disease. Optimum growth and protection was found when cultures were grown in presence of Fe(III). Additionally, the activities of pathogenesis-related proteins such as chitinase and beta-1,3-glucanase decreased in roots, but increased in leaves with time after treatment compared to controls. Our results demonstrate L. antibioticus HS124 as a promising candidate for biocontrol of P. capsici in pepper plants.

Selection and differentiation of Bacillus spp. Antagonistic to Fusarium oxysporum f.sp. lycopersici and Alternaria solani infecting Tomato.

Science.gov (United States)

Shanmugam, Veerubommu; Atri, Kamini; Gupta, Samriti; Kanoujia, Nandina; Naruka, Digvijay Singh

2011-03-01

Antagonistic Bacillus spp. displaying in vitro production of siderophore, chitinase, and β-1,3-glucanase were identified from dual culture assays. In independent greenhouse studies, seed bacterization and soil application of Bacillus atrophaeus S2BC-2 challenge inoculated with Fusarium oxysporum f.sp. lycopersici (FOL) and Alternaria solani (AS) recorded low percent disease index of 25.3 and 28.7, respectively, over nonbacterised pathogen control (44.3 and 56.4). The low disease incidence corroborated with tomato growth promotion with high vigor index (8,041.2) and fresh plant weight (82.5 g) on challenge inoculation with FOL. Analysis of root and leaf samples in rhizobacterial treatment challenged with FOL and AS revealed maximum induction of chitinase (1.9 and 1.7 U/mg of protein, respectively) and β-1,3-glucanase (23.5 and 19.2 U/mg of protein, respectively). In native gel activity assays, the rhizobacterial treatment on challenge inoculation strongly expressed three high intensity PO isoforms along with one low intensity isoform. In studies on genetic diversity of the Bacillus strains by repetitive extragenomic palindromic-polymerase chain reaction (REP-PCR) and amplified rDNA restriction analysis (ARDRA) patterns, ARDRA was more highly discriminant than REP-PCR and allowed grouping of the strains and differentiation of the antagonistic strains from other isolates.

Morphology and physiology of the marine straminipilan fungi, the aplanochytrids isolated from the equatorial Indian Ocean

Digital Repository Service at National Institute of Oceanography (India)

Damare, V.; Raghukumar, S.

cysteine and the aromatic amino acids did not induce any growth. Enzymatic studies−Ten isolates showed degrada-tion of milk protein indicating production of protease enzyme but none of the isolates produced lipase, amylase or chitinase enzymes (Table 4... represents 5 µm. Table 4Protease activity of 14 isolates of aplanochytrids isolated from equatorial Indian Ocean, as observed by the zone of clearance of milk protein. Isolate no. Zone of clearance of milk protein (mm) S1961 16.5 S1962 nil S1963 18...

Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

Directory of Open Access Journals (Sweden)

Pranee Pattanapipitpaisal

2012-09-01

Full Text Available Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar. All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar assayprocedure and the result showed that thirteen isolates have remarkable inhibiting the growth of the fungus and the top fiveantagonistic actinomycetes were PACCH 277, PACCH129, PACCH225, PACCH24 and PACCH246, respectively. The resultindicated that these actinomycetes produce chitinase which catalyze the degradation of chitin, resulting in inhibition of S.rolfsii growth. Their abilities to control the disease development were tested for in vivo biocontrol assay on chilli seedlings.Two out of thirteen candidate, PACCH24 and PACCH225, antagonists reduced the disease development at 90%. It wassuggested that the ability to inhibit the growth of pathogen in vitro was not related to the disease reduction in vivo. Thestrain PACCH24 was further identified as Streptomyces hygroscopicus according to morphological characteristic, cell walland cellular sugar analysis and 16S rDNA sequencing. The study implies a novel chitinolytic actinomycete which could bedeveloped to be a biological agent which would be included as a complement with organic fertilizers in order to control stemrot disease and promote growth of chilli.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

Science.gov (United States)

Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

The hard parts (trophi) of the rotifer mastax do contain chitin: evidence from studies on Brachionus plicatilis.

Science.gov (United States)

Klusemann, J; Kleinow, W; Peters, W

1990-01-01

The jaws (trophi) of the rotifer Brachionus plicatilis are soluble in strong acids but are resistant to long treatments by strong alkali. They show the same buoyant density as chitin and also as the chitin-containing layers of rotifer egg-shells. The presence of chitin in these structures was confirmed using the following techniques: chitosan-tests, thin-layer chromatography of trophi-hydrolysates which revealed glucosamine, by dissolving trophi with chitinase and electron microscopic WGA/gold-labelling. The content of chitin in the trophi was estimated by two different methods to be approx. 64% (50-75%).

Insights on the evolution of mycoparasitism from the genome of Clonostachys rosea

DEFF Research Database (Denmark)

Karlsson, Magnus; Durling, Mikael Brandström; Choi, Jaeyoung

2015-01-01

lifestyle. The genome of C. rosea is estimated to 58.3 Mbp, and contains 14268 predicted genes. A phylogenomic analysis shows that C. rosea clusters as sister taxon to plant pathogenic Fusarium species, with mycoparasitic/saprotrophic Trichoderma species in an ancestral position. A comparative analysis...... (multidrug resistance-associated proteins) is evident in T. virens. In contrast with mycoparasitic Trichoderma species, C. rosea contains very few chitinases. Expression of six group B and group G ABC transporter genes were induced in C. rosea during exposure to the Fusarium mycotoxin zearalenone...

Chitinolytic enzymes from Clostridium paraputrificum for biomedical applications

Czech Academy of Sciences Publication Activity Database

Kolenko, Petr; Dušková, Jarmila; Tiščenko, Galina; Koval, Tomáš; Fejfarová, Karla; Šimůnek, Jiří; Hašek, Jindřich; Dohnálek, Jan

2014-01-01

Roč. 281, Supplement s1 (2014), s. 653 ISSN 1742-464X. [FEBS EMBO 2014 Conference. 30.08.2014-04.09.2014, Paris] R&D Projects: GA MŠk(CZ) EE2.3.30.0029; GA MŠk LG14009; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61389013 ; RVO:86652036 ; RVO:67985904 Keywords : chitin * chitinase * clostridium Subject RIV: CE - Biochemistry; EB - Genetics ; Molecular Biology (BTO-N); EE - Microbiology, Virology (UZFG-Y) http://onlinelibrary.wiley.com/doi/10.1111/febs.12919/abstract

Structure features of TBN1, a P1/S1-like nuclease

Czech Academy of Sciences Publication Activity Database

Koval, Tomáš; Stránský, Jan; Lipovová, P.; Podzimek, Tomáš; Matoušek, Jaroslav; Dušková, Jarmila; Skálová, Tereza; Hašek, Jindřich; Fejfarová, Karla; Kolenko, Petr; Dohnálek, Jan

2014-01-01

Roč. 281, Supplement s1 (2014), s. 601 ISSN 1742-464X. [FEBS EMBO 2014 Conference. 30.08.2014-04.09.2014, Paris] R&D Projects: GA MŠk(CZ) EE2.3.30.0029; GA MŠk LG14009; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61389013 ; RVO:86652036 ; RVO:60077344 Keywords : chitin * chitinase * clostridium Subject RIV: CE - Biochemistry; EI - Biotechnology ; Bionics (BTO-N); EB - Genetics ; Molecular Biology (BC-A) http://onlinelibrary.wiley.com/doi/10.1111/febs.12919/abstract

Agricultural research department. Annual report 1989

International Nuclear Information System (INIS)

1990-01-01

The annual report gives a general review of the research work of the department. The activities of the year are described in short project reports followed by a list of publications, posters and lectures. Further, the report gives three review articles on selected subjects related to the work: ''Chitinase in barley and rape seed'', ''Symbiotic nitrogen fixation'' and ''Biological control of powdery mildews''. Included in the report are also a list of the staff members, guest scientists and students, lectures given at the department, and a list of travel - and other acitivities. (author) 10 refs

The biology of the Gaucher cell: the cradle of human chitinases

NARCIS (Netherlands)

Bussink, Anton P.; van Eijk, Marco; Renkema, G. Herma; Aerts, Johannes M.; Boot, Rolf G.

2006-01-01

Gaucher disease (GD) is the most common lysosomal storage disorder and is caused by inherited deficiencies of glucocerebrosidase, the enzyme responsible for the lysosomal breakdown of the lipid glucosylceramide. GD is characterized by the accumulation of pathological, lipid laden macrophages,

Evaluación de microorganismos con potencial de promoción de crecimiento vegetal y biocontrol de Spongospora subterranea

Directory of Open Access Journals (Sweden)

Juliana Soler Arango

2012-01-01

subterranea which reduces the quality and yield of tubers and facilitates the establishment of other pathogens. This disease affects main potato production zones in the world, because there is not a completely effective and available control method against the disease, and due to the trading of infested seed tubers. Some research suggests that biological control agents could reduce the activity of S. subterranea through effects on the viability of their cystosoris or zoospores or by stimulating plant growth. In this research, bacteria previously isolated, from inside the roots, the rhizosphere and tuber peel of potato plants (Solanum tuberosum var. Diacol Capiro, were used, and then selected according to their capacity for producing total indoles and chitinases. Here was tested in parallel studies the capacity of nine bacterial isolates differing in total indole and chitinase production, for its capacity at increasing tuber sprout length and in promoting plant growth and biocontrol of S. subterranea. Inoculated in excised minitubers in laboratory most indole producing isolates tested resulted in increased tuber sprout length. In the greenhouse assay, in non-sterile soil and under a high pathogen pressure, two of the ten isolates selected because for their ability to produce total indoles and chitinases, showed plant growth promotion and possible biocontrol of the pathogen. These results suggest a great potential for the selection of biocontrol microorganisms and the development of new bioproducts from local microbial resources. Key words: powdery scab of potato; total indole; chitinases; biological control; PGPR.

Mechanisms of Bacterial (Serratia marcescens) Attachment to, Migration along, and Killing of Fungal Hyphae.

Science.gov (United States)

Hover, Tal; Maya, Tal; Ron, Sapir; Sandovsky, Hani; Shadkchan, Yana; Kijner, Nitzan; Mitiagin, Yulia; Fichtman, Boris; Harel, Amnon; Shanks, Robert M Q; Bruna, Roberto E; García-Véscovi, Eleonora; Osherov, Nir

2016-05-01

We have found a remarkable capacity for the ubiquitous Gram-negative rod bacterium Serratia marcescens to migrate along and kill the mycelia of zygomycete molds. This migration was restricted to zygomycete molds and several basidiomycete species. No migration was seen on any molds of the phylum Ascomycota. S. marcescens migration did not require fungal viability or surrounding growth medium, as bacteria migrated along aerial hyphae as well.S. marcescens did not exhibit growth tropism toward zygomycete mycelium. Bacterial migration along hyphae proceeded only when the hyphae grew into the bacterial colony. S. marcescens cells initially migrated along the hyphae, forming attached microcolonies that grew and coalesced to generate a biofilm that covered and killed the mycelium. Flagellum-defective strains of S. marcescens were able to migrate along zygomycete hyphae, although they were significantly slower than the wild-type strain and were delayed in fungal killing. Bacterial attachment to the mycelium does not necessitate type 1 fimbrial adhesion, since mutants defective in this adhesin migrated equally well as or faster than the wild-type strain. Killing does not depend on the secretion of S. marcescens chitinases, as mutants in which all three chitinase genes were deleted retained wild-type killing abilities. A better understanding of the mechanisms by which S. marcescens binds to, spreads on, and kills fungal hyphae might serve as an excellent model system for such interactions in general; fungal killing could be employed in agricultural fungal biocontrol. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Enzymatic comparison and mortality of Beauveria bassiana against cabbage caterpillar Pieris brassicae LINN.

Science.gov (United States)

Dhawan, Manish; Joshi, Neelam

Beauveria bassiana, an entomopathogenic fungus, is the alternative biocontrol agent exploited against major economic crop pests. Pieris brassicae L. is an emerging pest of the Brassicaceae family. Therefore, in the present study, fungal isolates of Beauveria bassiana, viz. MTCC 2028, MTCC 4495, MTCC 6291, and NBAII-11, were evaluated for their virulence against third instar larvae of P. brassicae. Among all these fungal isolates, maximum mortality (86.66%) was recorded in B. bassiana MTCC 4495 at higher concentration of spores (10 9 conidia/ml), and the minimum mortality (30.00%) was recorded in B. bassiana MTCC 6291 at a lower concentration (10 7 conidia/ml) after ten days of treatment. The extracellular cuticle-degrading enzyme activities of fungal isolates were measured. Variability was observed both in the pattern of enzyme secretion and the level of enzyme activities among various fungal isolates. B. bassiana MTCC 4495 recorded the maximum mean chitinase (0.51U/ml), protease (1.12U/ml), and lipase activities (1.36U/ml). The minimum mean chitinase and protease activities (0.37 and 0.91U/ml, respectively) were recorded in B. bassiana MTCC 6291. The minimum mean lipase activity (1.04U/ml) was recorded in B. bassiana NBAII-11. Our studies revealed B. bassiana MTCC 4495 as the most pathogenic isolate against P. brassicae, which also recorded maximum extracellular enzyme activities, suggesting the possible roles of extracellular enzymes in the pathogenicity of B. bassiana against P. brassicae. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Infestation of transgenic powdery mildew-resistant wheat by naturally occurring insect herbivores under different environmental conditions.

Directory of Open Access Journals (Sweden)

Fernando Álvarez-Alfageme

Full Text Available A concern associated with the growing of genetically modified (GM crops is that they could adversely affect non-target organisms. We assessed the impact of several transgenic powdery mildew-resistant spring wheat lines on insect herbivores. The GM lines carried either the Pm3b gene from hexaploid wheat, which confers race-specific resistance to powdery mildew, or the less specific anti-fungal barley seed chitinase and β-1,3-glucanase. In addition to the non-transformed control lines, several conventional spring wheat varieties and barley and triticale were included for comparison. During two consecutive growing seasons, powdery mildew infection and the abundance of and damage by naturally occurring herbivores were estimated under semi-field conditions in a convertible glasshouse and in the field. Mildew was reduced on the Pm3b-transgenic lines but not on the chitinase/glucanase-expressing lines. Abundance of aphids was negatively correlated with powdery mildew in the convertible glasshouse, with Pm3b wheat plants hosting significantly more aphids than their mildew-susceptible controls. In contrast, aphid densities did not differ between GM plants and their non-transformed controls in the field, probably because of low mildew and aphid pressure at this location. Likewise, the GM wheat lines did not affect the abundance of or damage by the herbivores Oulema melanopus (L. and Chlorops pumilionis Bjerk. Although a previous study has revealed that some of the GM wheat lines show pleiotropic effects under field conditions, their effect on herbivorous insects appears to be low.

Dead Pericarps of Dry Fruits Function as Long-Term Storage for Active Hydrolytic Enzymes and Other Substances That Affect Germination and Microbial Growth

Directory of Open Access Journals (Sweden)

James Godwin

2017-12-01

Full Text Available It is commonly assumed that dead pericarps of dry indehiscent fruits have evolved to provide an additional physical layer for embryo protection and as a means for long distance dispersal. The pericarps of dry fruits undergo programmed cell death (PCD during maturation whereby most macromolecules such DNA, RNA, and proteins are thought to be degraded and their constituents remobilized to filial tissues such as embryo and endosperm. We wanted to test the hypothesis that the dead pericarp represents an elaborated layer that is capable of storing active proteins and other substances for increasing survival rate of germinating seeds. Using in gel assays we found that dead pericarps of both dehiscent and indehiscent dry fruits of various plant species including Arabidopsis thaliana and Sinapis alba release upon hydration multiple active hydrolytic enzymes that can persist in an active form for decades, including nucleases, proteases, and chitinases. Proteomic analysis of indehiscent pericarp of S. alba revealed multiple proteins released upon hydration, among them proteases and chitinases, as well as proteins involved in reactive oxygen species (ROS detoxification and cell wall modification. Pericarps appear to function also as a nutritional element-rich storage for nitrate, potassium, phosphorus, sulfur, and others. Sinapis alba dehiscent and indehiscent pericarps possess germination inhibitory substances as well as substances that promote microbial growth. Collectively, our study explored previously unknown features of the dead pericarp acting also as a reservoir of biological active proteins, and other substances capable of “engineering” the microenvironment for the benefit of the embryo.

Application of Doehlert experimental design in the optimization of experimental variables for the Pseudozyma sp. (CCMB 306 and Pseudozyma sp. (CCMB 300 cell lysis

Directory of Open Access Journals (Sweden)

Amanda Reges de Sena

2012-12-01

Full Text Available This study aimed to verify the influence of pH and temperature on the lysis of yeast using experimental design. In this study, the enzymatic extract containing β-1,3-glucanase and chitinase, obtained from the micro-organism Moniliophthora perniciosa, was used. The experiment showed that the best conditions for lysis of Pseudozyma sp. (CCMB 306 and Pseudozyma sp. (CCMB 300 by lytic enzyme were pH 4.9 at 37 ºC and pH 3.9 at 26.7 ºC, respectively. The lytic enzyme may be used for obtaining various biotechnology products from yeast.

Characterization and role of a metalloprotease induced by chitin in Serratia sp. KCK.

Science.gov (United States)

Kim, Hyun-Soo; Golyshin, Peter N; Timmis, Kenneth N

2007-11-01

A metalloprotease induced by chitin in a new chitinolytic bacterium Serratia sp. Strain KCK was purified and characterized. Compared with other Serratia enzymes, it exhibited a rather broad pH activity range (pH 5.0-8.0), and thermostability. The cognate ORF, mpr, was cloned and expressed. Its deduced amino acid sequence showed high similarity to those of bacterial zinc-binding metalloproteases and a well-conserved serralysin family motif. Pretreatment of chitin with the Mpr protein promoted chitin degradation by chitinase A, which suggests that Mpr participates in, and facilitates, chitin degradation by this microorganism.

Serum YKL-40 and colorectal cancer

DEFF Research Database (Denmark)

Cintin, C; Johansen, J S; Christensen, Ib Jarle

1999-01-01

related to short survival. In the present study we analysed YKL-40 in preoperative sera from patients with colorectal cancer and evaluated its relation to survival. Serum YKL-40 was determined by RIA in 603 patients. Survival after operation was registered, and median follow-up time was 61 months. Three......YKL-40 is a mammalian member of the chitinase protein family. Although the function of YKL-40 is unknown, the pattern of its expression suggests a function in remodelling or degradation of extracellular matrix. High serum YKL-40 has been found in patients with recurrent breast cancer and has been...

POTENSI BAKTERI ENDOFIT AKAR UBI JALAR (IPOMOEA BATATAS L. ASAL KABUPATEN SORONG PAPUA BARAT SEBAGAI AGENSIA BIOKONTROL MELOIDOGYNE SPP.

Directory of Open Access Journals (Sweden)

Tuminem .

2016-03-01

Full Text Available Potency of sweetpotato (Ipomoea batatas L. root endophytic bacteria from Sorong District West Papua as biocontrol agent of Meloidogyne spp. Root knot nematodes/RKN, Meloidogyne spp. is one of the important pathogens in sweet potato plant. The disease incidence rate by the RKN on sweetpotato crop in Sorong District reached 88.77%. This study aims to get the sweet potato root endophytic bacteria that have potential as biocontrol agents against Meloidogyne spp. Endophytic bacteria was isolated from the roots of healthy sweet potato sampled from Sorong District, West Papua Province. Isolation and selection of bacteria using TSA media. Selected bacterial isolates, which were non-pathogenic to plants and humans then were identified with PCR technique using universal primer 63-F / 1387-R. The ability of bacteria to produce the lipase enzyme was selected using the media NB agar and rhodamine B. The protease enzyme-producing bacteria were selected using skim milk media. The chitinase enzyme-producing bacteria were selected using the colloidal chitin media. Production of cyanide was detected using filter paper soaked in a solution of CDS. The effectiveness of culture filtrate of bacteria as biocontrol agents was measured based on the percentage of 2nd juvenile mortality and egg hatching of Meloidogyne spp. Four isolates of endophytic bacteria, that were Enterobacter sp EAS (1a, Enterobacter sp. EAS (3a Enterobacter ludwigii EAS (4, and Burkholderia cepacia EAS (6 produced lipase and protease. In addition, B. cepacia EAS (6 also produced chitinase. Those isolates caused mortality of the 2nd juvenile 81.4 to 95.2% and inhibited the egg hatching of Meloidogyne spp. 53.13 to 81.92%.

Slow food: insect prey and chitin induce phytohormone accumulation and gene expression in carnivorous Nepenthes plants.

Science.gov (United States)

Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel

2016-08-01

Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

Science.gov (United States)

Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

2017-04-01

The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

Distribución Diferencial de Bacterias con Potencial Biocontrolador de Spongospora subterranea en Plantas de Papa (Solanum tuberosum cv. Diacol Capiro Differential Distrubution of Candidadate Biocontrol Bacteria against Spongospora subterranea in Potato Plants (Solanum tuberosum cv. Diacol Capiro

Directory of Open Access Journals (Sweden)

Juliana Soler Arango

2012-06-01

farmers field, in this research we obtained bacteria from inside roots, rhizosphere, tubers peel or bulk soil, and determined in them the production of indol and chitinases. In general, bacteria isolated form inside the roots showed the highest production of total indols and chitinases. Simultaneous high production of both compounds was not detected in these isolates, and the frecuency of bacteria producing both, indol and chitinases was higher in roots and rhizosphere, compared to tubers peel and bulk soil samples. These results suggest that in soil, the distribution of microorganisms and functions linked to biocontrol are not randomly distributed. These findings might be usefull to guide the search for biocontrol agents, optimize resource use and speed up the development of new bioproducts.

Indução de resistência sistêmica à antracnose em feijoeiro-comum pela raça delta avirulenta de Colletotrichum lindemuthianum Induction of systemic resistance to anthracnose in common bean by the avirulent delta race of Colletotrichum lindemuthianum

Directory of Open Access Journals (Sweden)

Ângela Diniz Campos

2009-01-01

Full Text Available O objetivo deste trabalho foi avaliar o potencial da raça delta avirulenta do fungo Colletotrichum lindemuthianum, como protetora contra raças virulentas deste fungo e quanto à capacidade de induzir resistência sistêmica em feijoeiro-comum (Phaseolus vulgaris. Quatro cultivares de feijoeiro foram avaliadas quanto às alterações nas atividades de beta 1,3 glucanase e quitinase, em dois estádios de desenvolvimento (V2 e R6, três dias após a aplicação de suspensão de esporos de C. lindemuthianum raça delta avirulenta, em comparação com aplicações de água e ácido salicílico. As plantas foram, então, infectadas com o patótipo virulento 33/95 de C. lindemuthianum em suspensão e, depois de cinco dias, foram reavaliadas quanto à atividade das enzimas. Observaram-se acréscimos significativos nas atividades da beta 1,3 glucanase e quitinase, após inoculação do fungo indutivo, nas duas avaliações, nos dois estádios de desenvolvimento. As atividades da beta 1,3 glucanase e da quitinase variaram entre as cultivares e entre os estádios de desenvolvimento das plantas. A correlação entre o índice de severidade da doen��a e a atividade das enzimas foi altamente significativa. O uso de C. lindemuthianum raça delta avirulenta diminuiu a severidade da doença e pode ter potencial para controlar a antracnose do feijoeiro.The objectives of this work were to evaluate the potential of the avirulent delta race of Colletotrichum lindemuthianum as a protector against virulent races of this fungus and induce systemic resistance to anthracnose in common bean (Phaseolus vulgaris. Four common bean cultivars were evaluated for changes in the activities of beta-1,3-glucanase and chitinase at two common bean developmental stages, V2 and R6, three days after the infection with delta race of C. lindemuthianum, in comparison with control applications of water and salicylic acid. The plants were then infected with a spore suspension of 33

Characterization of putative virulence factors of Serratia marcescens strain SEN for pathogenesis in Spodoptera litura.

Science.gov (United States)

Aggarwal, Chetana; Paul, Sangeeta; Tripathi, Vishwas; Paul, Bishwajeet; Khan, Md Aslam

2017-02-01

Two Serratia marcescens strains, SEN and ICC-4, isolated from diseased insect cadavers were observed to differ considerably in their virulence towards Spodoptera litura. The present study was aimed to characterize the possible virulence factors present in the virulent Serratia marcescens strain SEN. Both the S. marcescens strains were evaluated for the presence of various lytic enzymes such as chitinase, lipase, protease and phospholipase. The virulent S. marcescens strain SEN was observed to possess considerably higher activity of chitinase and protease enzymes; activity of phospholipase enzyme was also higher. Although, all the three toxin genes shlA, phlA and swr could be detected in both the S. marcescens strains, there was a higher expression of these genes in the virulent strain SEN. S. marcescens strain ICC-4 showed greater reduction in overall growth yield in the post-exponential phase in the presence of midgut juice and hemolymph of S. litura larvae, as compared to S. marcescens strain SEN. Proliferation of the S. marcescens strain SEN was also considerably higher in foregut, midgut and hemolymph of S. litura larvae, as compared to strain ICC-4. Peritrophic membrane treated with broth culture of the S. marcescens strain SEN showed higher damage as compared to strain ICC-4. The peritrophic membrane of larvae fed on diet treated with the virulent strain showed considerable damage while the peritrophic membrane of larvae fed on diet treated with the non-virulent strain showed no damage. This is the first report documenting the fate of ingested S. marcescens in S. litura gut and the relative expression of toxin genes from two S. marcescens strains differing in their virulence towards S. litura. Copyright © 2016 Elsevier Inc. All rights reserved.

Potential extinction of Antarctic endemic fungal species as a consequence of global warming

International Nuclear Information System (INIS)

Selbmann, Laura; Isola, Daniela; Fenice, Massimiliano; Zucconi, Laura; Sterflinger, Katja; Onofri, Silvano

2012-01-01

Cryomyces spp. are fungi adapted to the harsh conditions of the McMurdo Dry Valleys in the Antarctic. The structure of their cell wall is one of the main factors for their uncommon ability to survive external stressors. The cells are, in fact, embedded in a thick and strongly melanised cell wall encrusted with black rigid plaques giving a supplementary protection and making them practically impregnable and refractory even to commercial enzymes including chitinases and glucanases. The Antarctic fungus Lecanicillium muscarium CCFEE 5003, able to produce an arsenal of lytic enzymes, including chitinases and glucanases, is known for its ability to degrade the cell walls of different food spoiling and opportunistic fungi as well as plant pathogenic Oomycota. Active cells of Cryomyces spp. were cultivated in dual culture with the mycoparasitic fungus both in liquid and solid media. Light microscope observations revealed that the cell walls of Cryomyces were heavily decayed. This resulted in the release of protoplasts. Hyphae penetration was evident with both scanning and transmission electron microscope observations. Due to its ecological amplitude (i.e. temperature growth range 0–28 °C), the parasitic fungus could easily expand its area of distribution as a consequence of global warming by invading new areas towards the interior of the continent. The establishment of interactions with organisms living at present in border ecosystems may lead to extinction of extremely specialized and poorly competitive entities. -- Highlights: ► We studied interactions among Antarctic fungi to evaluate the effects of global warming. ► Cryomyces spp. was parasitized and killed by Lecanicillum muscarium in co-cultures. ► L. muscarium lythic activities may have intriguing and new applications. ► L. muscarium may expand its area of distribution as a consequence of global warming. ► Extinction of threatened species previously living in confined niches may occur.

Secretome analysis of the fungus Trichoderma harzianum grown on cellulose.

Science.gov (United States)

Do Vale, Luis H F; Gómez-Mendoza, Diana P; Kim, Min-Sik; Pandey, Akhilesh; Ricart, Carlos A O; Ximenes F Filho, Edivaldo; Sousa, Marcelo V

2012-08-01

Trichoderma harzianum is a mycoparasitic filamentous fungus that produces and secretes a wide range of extracellular hydrolytic enzymes used in cell wall degradation. Due to its potential in biomass conversion, T. harzianum draws great attention from biofuel and biocontrol industries and research. Here, we report an extensive secretome analysis of T. harzianum. The fungus was grown on cellulose medium, and its secretome was analyzed by a combination of enzymology, 2DE, MALDI-MS and -MS/MS (Autoflex II), and LC-MS/MS (LTQ-Orbitrap XL). A total of 56 proteins were identified using high-resolution MS. Interestingly, although cellulases were found, the major hydrolytic enzymes secreted in the cellulose medium were chitinases and endochitinases, which may reflect the biocontrol feature of T. harzianum. The glycoside hydrolase family, including chitinases (EC 3.2.1.14), endo-N-acetylglucosaminidases (EC 3.2.1.96), hexosaminidases (EC 3.2.1.52), galactosidases (EC 3.2.1.23), xylanases (EC 3.2.1.8), exo-1,3-glucanases (EC 3.2.1.58), endoglucanases (EC 3.2.1.4), xylosidases (EC 3.2.1.37), α-L-arabinofuranosidase (EC 3.2.1.55), N-acetylhexosaminidases (EC 3.2.1.52), and other enzymes represented 51.36% of the total secretome. Few representatives were classified in the protease family (8.90%). Others (17.60%) are mostly intracellular proteins. A considerable part of the secretome was composed of hypothetical proteins (22.14%), probably because of the absence of an annotated T. harzianum genome. The T. harzianum secretome composition highlights the importance of this fungus as a rich source of hydrolytic enzymes for bioconversion and biocontrol applications. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Phenotypic and Proteomic Analysis of the Aspergillus fumigatus ΔPrtT, ΔXprG and ΔXprG/ΔPrtT Protease-Deficient Mutants

Directory of Open Access Journals (Sweden)

Einav Shemesh

2017-12-01

Full Text Available Aspergillus fumigatus is the most common mold species to cause disease in immunocompromised patients. Infection usually begins when its spores (conidia are inhaled into the airways, where they germinate, forming hyphae that penetrate and destroy the lungs and disseminate to other organs, leading to high mortality. The ability of hyphae to penetrate the pulmonary epithelium is a key step in the infectious process. A. fumigatus produces extracellular proteases that are thought to enhance penetration by degrading host structural barriers. This study explores the role of the A. fumigatus transcription factor XprG in controlling secreted proteolytic activity and fungal virulence. We deleted xprG, alone and in combination with prtT, a transcription factor previously shown to regulate extracellular proteolysis. xprG deletion resulted in abnormal conidiogenesis and formation of lighter colored, more fragile conidia and a moderate reduction in the ability of culture filtrates (CFs to degrade substrate proteins. Deletion of both xprG and prtT resulted in an additive reduction, generating a mutant strain producing CF with almost no ability to degrade substrate proteins. Detailed proteomic analysis identified numerous secreted proteases regulated by XprG and PrtT, alone and in combination. Interestingly, proteomics also identified reduced levels of secreted cell wall modifying enzymes (glucanases, chitinases and allergens following deletion of these genes, suggesting they target additional cellular processes. Surprisingly, despite the major alteration in the secretome of the xprG/prtT null mutant, including two to fivefold reductions in the level of 24 proteases, 18 glucanases, 6 chitinases, and 19 allergens, it retained wild-type virulence in murine systemic and pulmonary models of infection. This study highlights the extreme adaptability of A. fumigatus during infection based on extensive gene redundancy.

Three-dimensional chitin rings from body segments of a pet diplopod species: Characterization and protein interaction studies

Energy Technology Data Exchange (ETDEWEB)

Kaya, Murat, E-mail: muratkaya3806@yahoo.com [Department of Biotechnology and Molecular Biology, Faculty of Science and Letters, Aksaray University, 68100 Aksaray (Turkey); Mulerčikas, Povilas [Department of Biology and Plant Protection, Lithuanian University of Agriculture, LT-53361 (Lithuania); Sargin, Idris [Department of Chemistry, Faculty of Science, Selcuk University, 42075 Konya (Turkey); Kazlauskaitė, Sonata [Department of Biology and Plant Protection, Lithuanian University of Agriculture, LT-53361 (Lithuania); Baublys, Vykintas [Department of Biology, Vytautas Magnus University, LT-44404 Kaunas (Lithuania); Akyuz, Bahar; Bulut, Esra [Department of Biotechnology and Molecular Biology, Faculty of Science and Letters, Aksaray University, 68100 Aksaray (Turkey); Tubelytė, Vaida [Department of Biology, Vytautas Magnus University, LT-44404 Kaunas (Lithuania)

2016-11-01

Physicochemical characterization of new chitin isolates can provide valuable insights into designing of biomimetic materials. Chitin isolates with a definite three-dimensional (3D) structure can exhibit characteristics that distinguish them from other chitin specimens that are in form of powder or flakes without a definite and uniform shape. Herein, 3D chitin rings were produced from body segments of a diplopod (Archispirostreptus gigas) inhabiting tropical regions. This organism is cultured easily and can reach 38 cm in length, which makes it a suitable source for isolation of chitin. The chitin rings were characterized via TGA, FT-IR, SEM and XRD analyses. Enzymatic digestion test with chitinase demonstrated that chitin isolates had high purity (digestion rate: 97.4%). The source organism had high chitin content; 21.02 ± 2.23% on dry weight. Interactions of the chitin rings with bovine serum albumin (BSA) protein were studied under different conditions (pH: 4.0–8.0, chitin amount: 6–14 mg, contact time: 30–360 min, protein concentration: 0.2–1 mg/mL). The highest BSA adsorption was observed at pH 5.0 at 20 °C. The adsorption equilibrium data exhibited a better fit to Langmuir adsorption and the pseudo-first order kinetic models. The findings presented here can be useful for further studies aiming to develop biocompatible and nontoxic biomaterials. - Highlights: • Three-dimensional ring shaped chitin was produced from a pet diplopod species. • Archispirostreptus gigas has high chitin content; 21.02 ± 2.23% on dry weight. • Chitinase enzyme showed activity on the chitin rings with digestion rate of 97.4%. • The highest bovine serum albumin (BSA) adsorption was observed at pH 5.0 at 20 °C.

YKL-40 tissue expression and plasma levels in patients with ovarian cancer

International Nuclear Information System (INIS)

Høgdall, Estrid VS; Christensen, Lise H; Ringsholt, Merete; Høgdall, Claus K; Christensen, Ib Jarle; Johansen, Julia S; Kjaer, Susanne K; Blaakaer, Jan; Ostenfeld-Møller, Lene; Price, Paul A

2009-01-01

YKL-40 (chitinase-3-like-1) is a member of 'mammalian chitinase-like proteins'. The protein is expressed in many types of cancer cells and the highest plasma YKL-40 levels have been found in patients with metastatic disease, short recurrence/progression-free intervals, and short overall survival. The aim of the study was to determine the expression of YKL-40 in tumor tissue and plasma in patients with borderline ovarian tumor or epithelial ovarian cancer (OC), and investigate prognostic value of this marker. YKL-40 protein expression was determined by immunohistochemistry in tissue arrays from 181 borderline tumors and 473 OC. Plasma YKL-40 was determined by ELISA in preoperative samples from 19 patients with borderline tumor and 76 OC patients. YKL-40 protein expression was found in cancer cells, tumor associated macrophages, neutrophils and mast cells. The tumor cell expression was higher in OC than in borderline tumors (p = 0.001), and associated with FIGO stage (p < 0.0001) and histological subtype (p = 0.0009). Positive YKL-40 expression (≥ 5% staining) was not associated with reduced survival. Plasma YKL-40 was also higher in patients with OC than in patients with borderline tumors (p < 0.0001), and it was positively correlated to serum CA-125 (p < 0.0001) and FIGO stage (p = 0.0001). Univariate Cox analysis of plasma YKL-40 showed association with overall survival (p < 0.0001). Multivariate Cox analysis, including plasma YKL-40, serum CA125, FIGO stage, age and radicality after primary surgery as variables, showed that elevated plasma YKL-40 was associated with a shorter survival (HR = 2.13, 95% CI: 1.40–3.25, p = 0.0004). YKL-40 in OC tissue and plasma are related to stage and histology, but only plasma YKL-40 is a prognostic biomarker in patients with OC

Cloning of a cDNA encoding chitotriosidase, a human chitinase produced by macrophages

NARCIS (Netherlands)

Boot, R. G.; Renkema, G. H.; Strijland, A.; van Zonneveld, A. J.; Aerts, J. M.

1995-01-01

We have recently observed that chitotriosidase, a chitinolytic enzyme, is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients (Hollak, C. E. M., van Weely, S., van Oers, M. H. J., and Aerts, J. M. F. G. (1994) J. Clin. Invest. 93, 1288-1292). Here,

Mycoparasitism studies of Trichoderma species against three phytopathogenic fungi: evaluation of antagonism and hydrolytic enzyme production.

Science.gov (United States)

Qualhato, Thiago Fernandes; Lopes, Fabyano Alvares Cardoso; Steindorff, Andrei Stecca; Brandão, Renata Silva; Jesuino, Rosália Santos Amorim; Ulhoa, Cirano José

2013-09-01

Trichoderma spp. are used for biocontrol of several plant pathogens. However, their efficient interaction with the host needs to be accompanied by production of secondary metabolites and cell wall-degrading enzymes. Three parameters were evaluated after interaction between four Trichoderma species and plant-pathogenic fungi: Fusarium solani, Rhizoctonia solani and Sclerotinia sclerotiorum. Trichoderma harzianum and T. asperellum were the most effective antagonists against the pathogens. Most of the Trichoderma species produced toxic volatile metabolites, having significant effects on growth and development of the plant pathogens. When these species were grown in liquid cultures with cell walls from these plant pathogens, they produced and secreted β-1,3-glucanase, NAGAse, chitinase, acid phosphatase, acid proteases and alginate lyase.

Biochemical characterization of a sphingomonad isolate from the ascocarp of white truffle (Tuber magnatum Pico

Directory of Open Access Journals (Sweden)

Pavić A.

2011-01-01

Full Text Available Available information on bacteria that influence the economically important white truffle (Tuber magnatum Pico life cycle is scarce. From the ascocarp of white truffle we isolated a strain TMG 022C, capable for growth in nitrogendepleted conditions and assimilation of mannitol and trehalose. According to 16S rDNA sequence phylogeny, the strain was closely related to Sphingobium amiense. The strain had the ability to perform ammonification, reduce nitrate and solubilize Ca3(PO42, produce chitinase, lipase, phospholipase and β-glucanase, but not cellulase, pectinase, protease and siderophores. The results suggest that Sphingobium sp. TMG 022C could have an influence on the Tuber magnatum life cycle through improved mycelium nutrition and ascocarp decomposition.

Production of hydrolytic enzymes by Trichoderma isolates with antagonistic activity against Crinipellis perniciosa, the causal agent of witches' broom of cocoa

Directory of Open Access Journals (Sweden)

Marco Janice Lisboa De

2003-01-01

Full Text Available Two isolates of Trichoderma, which reduce the incidence of witches'broom disease caused in cocoa by Crinipellis perniciosa, were evaluated for their potential to produce hydrolases in liquid medium. Very low or no hydrolytic activity was produced in the absence of any substrate. The activities of chitinase, N-acetylglucosaminidase, beta-1,3-glucanase, total cellulase, endoglucanase, aryl- beta-glucosidase, beta-glucosidase, protease and amylase increased dramatically within 72-120 h of growth in the presence of specific substrates. Except for N-acetylglucosaminidase and beta-glucosidase Trichoderma harzianum isolate 1051 produced the largest amounts of hydrolases. The possible involvement of these enzymes in the antagonistic interaction between Trichoderma and C. perniciosa is discussed.

Control of anthracnose disease via increased activity of defence related enzymes in 'Hass' avocado fruit treated with methyl jasmonate and methyl salicylate.

Science.gov (United States)

Glowacz, Marcin; Roets, Nico; Sivakumar, Dharini

2017-11-01

Development of anthracnose disease caused by Colletotrichum gloeosporioides Penz. is one of the major issues within the avocado supply chain. Exposure to methyl jasmonate (MeJA) and methyl salicylate (MeSA) vapours at 10 and 100µmoll -1 was investigated as an alternative solution to commercial fungicide - prochloraz® that is currently being used by the industry. The incidence of anthracnose disease was found to be significantly reduced in 'Hass' avocado fruit treated with MeJA or MeSA vapours, especially at 100μmoll -1 . The mechanism involved enhanced activity of defence related enzymes, i.e. chitinase, β-1,3-glucanase and PAL, and higher content of epicatechin. Copyright © 2017. Published by Elsevier Ltd.

Produção, purificação, clonagem e aplicação de enzimas líticas Production, purification, cloning and application of lytic enzymes

Directory of Open Access Journals (Sweden)

Luciana Francisco Fleuri

2005-10-01

Full Text Available Lytic enzymes such as beta-1,3 glucanases, proteases and chitinases are able to hydrolyse, respectively, beta-1,3 glucans, mannoproteins and chitin, as well as the cell walls of many yeast species. Lytic enzymes are useful in a great variety of applications including the preparation of protoplasts; the extraction of proteins, enzymes, pigments and functional carbohydrates; pre-treatment for the mechanical rupture of cells; degradation of residual yeast cell mass for the preparation of animal feed; analysis of the yeast cell wall structure and composition; study of the yeast cell wall synthesis and the control of pathogenic fungi. This review presents the most important aspects with respect to lytic enzymes, especially their production, purification, cloning and application.

Differentiation of Vitis vinifera varieties by MALDI-MS analysis of the grape seed proteins.

Science.gov (United States)

Pesavento, Ivana Chiara; Bertazzo, Antonella; Flamini, Riccardo; Vedova, Antonio Dalla; De Rosso, Mirko; Seraglia, Roberta; Traldi, Pietro

2008-02-01

Until now the study of pathogenic related proteins in grape juice and wine, performed by ESI-MS, LC/ESI-MS, and MALDI/MS, has been proposed for differentiation of varieties. In fact, chitinases and thaumatin-like proteins persist through the vinification process and cause hazes and sediments in bottled wines. An additional instrument, potentially suitable for the grape varieties differentiation, has been developed by MALDI/MS for the grape seed protein analysis. The hydrosoluble protein profiles of seeds extract from three different Vitis vinifera grape (red and white) varieties were analyzed and compared. In order to evaluate the environmental conditions and harvest effects, the seed protein profiles of one grape variety from different locations and harvests were studied. (c) 2008 John Wiley & Sons, Ltd.

The pathogenesis-related protein PR-4b from Theobroma cacao presents RNase activity, Ca(2+) and Mg(2+) dependent-DNase activity and antifungal action on Moniliophthora perniciosa.

Science.gov (United States)

Pereira Menezes, Sara; de Andrade Silva, Edson Mario; Matos Lima, Eline; Oliveira de Sousa, Aurizângela; Silva Andrade, Bruno; Santos Lima Lemos, Livia; Peres Gramacho, Karina; da Silva Gesteira, Abelmon; Pirovani, Carlos Priminho; Micheli, Fabienne

2014-06-11

The production and accumulation of pathogenesis-related proteins (PR proteins) in plants in response to biotic or abiotic stresses is well known and is considered as a crucial mechanism for plant defense. A pathogenesis-related protein 4 cDNA was identified from a cacao-Moniliophthora perniciosa interaction cDNA library and named TcPR-4b. TcPR-4b presents a Barwin domain with six conserved cysteine residues, but lacks the chitin-binding site. Molecular modeling of TcPR-4b confirmed the importance of the cysteine residues to maintain the protein structure, and of several conserved amino acids for the catalytic activity. In the cacao genome, TcPR-4b belonged to a small multigene family organized mainly on chromosome 5. TcPR-4b RT-qPCR analysis in resistant and susceptible cacao plants infected by M. perniciosa showed an increase of expression at 48 hours after infection (hai) in both cacao genotypes. After the initial stage (24-72 hai), the TcPR-4b expression was observed at all times in the resistant genotypes, while in the susceptible one the expression was concentrated at the final stages of infection (45-90 days after infection). The recombinant TcPR-4b protein showed RNase, and bivalent ions dependent-DNase activity, but no chitinase activity. Moreover, TcPR-4b presented antifungal action against M. perniciosa, and the reduction of M. perniciosa survival was related to ROS production in fungal hyphae. To our knowledge, this is the first report of a PR-4 showing simultaneously RNase, DNase and antifungal properties, but no chitinase activity. Moreover, we showed that the antifungal activity of TcPR-4b is directly related to RNase function. In cacao, TcPR-4b nuclease activities may be related to the establishment and maintenance of resistance, and to the PCD mechanism, in resistant and susceptible cacao genotypes, respectively.

The pathogenesis-related protein PR-4b from Theobroma cacao presents RNase activity, Ca2+ and Mg2+ dependent-DNase activity and antifungal action on Moniliophthora perniciosa

Science.gov (United States)

2014-01-01

Background The production and accumulation of pathogenesis-related proteins (PR proteins) in plants in response to biotic or abiotic stresses is well known and is considered as a crucial mechanism for plant defense. A pathogenesis-related protein 4 cDNA was identified from a cacao-Moniliophthora perniciosa interaction cDNA library and named TcPR-4b. Results TcPR-4b presents a Barwin domain with six conserved cysteine residues, but lacks the chitin-binding site. Molecular modeling of TcPR-4b confirmed the importance of the cysteine residues to maintain the protein structure, and of several conserved amino acids for the catalytic activity. In the cacao genome, TcPR-4b belonged to a small multigene family organized mainly on chromosome 5. TcPR-4b RT-qPCR analysis in resistant and susceptible cacao plants infected by M. perniciosa showed an increase of expression at 48 hours after infection (hai) in both cacao genotypes. After the initial stage (24-72 hai), the TcPR-4b expression was observed at all times in the resistant genotypes, while in the susceptible one the expression was concentrated at the final stages of infection (45-90 days after infection). The recombinant TcPR-4b protein showed RNase, and bivalent ions dependent-DNase activity, but no chitinase activity. Moreover, TcPR-4b presented antifungal action against M. perniciosa, and the reduction of M. perniciosa survival was related to ROS production in fungal hyphae. Conclusion To our knowledge, this is the first report of a PR-4 showing simultaneously RNase, DNase and antifungal properties, but no chitinase activity. Moreover, we showed that the antifungal activity of TcPR-4b is directly related to RNase function. In cacao, TcPR-4b nuclease activities may be related to the establishment and maintenance of resistance, and to the PCD mechanism, in resistant and susceptible cacao genotypes, respectively. PMID:24920373

The dead, hardened floral bracts of dispersal units of wild wheat function as storage for active hydrolases and in enhancing seedling vigor.

Directory of Open Access Journals (Sweden)

Buzi Raviv

Full Text Available It is commonly assumed that the dead, hardened floral bracts of the dispersal unit of grasses have been evolved to protect seeds from predation and / or assist in fruit/caryopsis dispersal. While these structures have important agronomical and economical implications, their adaptive value has not been fully explored. We investigated the hypothesis that the maternally derived hardened floral bracts have been evolved not just as a means for caryopsis protection and dispersal, but also as storage for substances that might affect seed germination and seedling vigor. Dead glumes as well as lemmas and paleas of wild emmer wheat (Triticum turgidum var dicoccoides were found to store and release upon hydration active hydrolases including nucleases and chitinases. High nuclease activity was released upon hydration from glumes derived from wild strains of wheat including Triticum urartu and wild emmer wheat, while very low nuclease activity was detected in glumes derived from domesticated, free-threshing wheat cultivars (e.g., durum wheat. Germination from the intact dispersal unit of wild emmer wheat was delayed, but post germination growth was better than those of separated caryopses. Most notable was a significant increase in lateral root production on seedlings germinated from the intact dispersal unit. Proteome analysis of wild emmer wheat glumes revealed many proteins stored and released upon hydration including S1-type nucleases, peptidases, antifungal hydrolases such as chitinases and β-1,3-glucanase as well as pectin acetylesterase, a protein involved in cell wall degradation and remodeling. Also, reactive oxygen species (ROS-detoxifying enzymes such as superoxide dismutase and ascorbate peroxidase were overrepresented in dead glumes of wild emmer wheat. Thus our study highlighted previously unknown features of the dispersal unit in wild wheat in which the dead, hardened floral bracts enclosing the caryopsis store active hydrolases and

Potential extinction of Antarctic endemic fungal species as a consequence of global warming

Energy Technology Data Exchange (ETDEWEB)

Selbmann, Laura, E-mail: selbmann@unitus.it [Department of Ecological and Biological Sciences (DEB), Universita degli Studi della Tuscia, Largo dell' Universita, 01100 Viterbo (Italy); Isola, Daniela; Fenice, Massimiliano; Zucconi, Laura [Department of Ecological and Biological Sciences (DEB), Universita degli Studi della Tuscia, Largo dell' Universita, 01100 Viterbo (Italy); Sterflinger, Katja [Department of Biotechnology, Austrian Center of Biological Resources and Applied Mycology (ACBR), University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Wien (Austria); Onofri, Silvano [Department of Ecological and Biological Sciences (DEB), Universita degli Studi della Tuscia, Largo dell' Universita, 01100 Viterbo (Italy)

2012-11-01

Cryomyces spp. are fungi adapted to the harsh conditions of the McMurdo Dry Valleys in the Antarctic. The structure of their cell wall is one of the main factors for their uncommon ability to survive external stressors. The cells are, in fact, embedded in a thick and strongly melanised cell wall encrusted with black rigid plaques giving a supplementary protection and making them practically impregnable and refractory even to commercial enzymes including chitinases and glucanases. The Antarctic fungus Lecanicillium muscarium CCFEE 5003, able to produce an arsenal of lytic enzymes, including chitinases and glucanases, is known for its ability to degrade the cell walls of different food spoiling and opportunistic fungi as well as plant pathogenic Oomycota. Active cells of Cryomyces spp. were cultivated in dual culture with the mycoparasitic fungus both in liquid and solid media. Light microscope observations revealed that the cell walls of Cryomyces were heavily decayed. This resulted in the release of protoplasts. Hyphae penetration was evident with both scanning and transmission electron microscope observations. Due to its ecological amplitude (i.e. temperature growth range 0-28 Degree-Sign C), the parasitic fungus could easily expand its area of distribution as a consequence of global warming by invading new areas towards the interior of the continent. The establishment of interactions with organisms living at present in border ecosystems may lead to extinction of extremely specialized and poorly competitive entities. -- Highlights: Black-Right-Pointing-Pointer We studied interactions among Antarctic fungi to evaluate the effects of global warming. Black-Right-Pointing-Pointer Cryomyces spp. was parasitized and killed by Lecanicillum muscarium in co-cultures. Black-Right-Pointing-Pointer L. muscarium lythic activities may have intriguing and new applications. Black-Right-Pointing-Pointer L. muscarium may expand its area of distribution as a consequence of global

Effect of Culture Conditions and Gamma Rays on Chitosan Production from Shrimp Shells by Certain Isolated Fungi

International Nuclear Information System (INIS)

Abd EI-Aziz, A.B.; Swialam, H.M.; Abd EI -Aziz, A.H.

2009-01-01

The obtained chitosan from shrimp shells waste used in the present work is compared with a standard chitosan. Six strains of the isolated fungi had the ability to attack the chitin namely: Candida tropicalis, Zygosaccharomyces rouxii, Candida guilliermondii, Trichoderma viride, Penicillium chrysogenum and Aspergillus niger. Z. rouxii and A. niger were the most active strains for decomposing chitin. The best culture conditions for chitosan production by the selected strains differed from one to another. Highest yield of chitosan was obtained after 96 h of incubation by A. niger (40.00 mg/g) in the basal medium followed by P. chrysogenum (38.20 mg/g). Optimum ph for chitosan production by C. tropicalis, Z. rouxii and T. viride was found to be 5.5, while ph 6.0 was the best for A. niger and C. guilliermondii. Meanwhile ph 5.0 was preferable for P. chrysogenllm. Regarding the carbon source, fructose as a sole carbon source in the medium was the best one for A. niger (92.58 mg/g) and T. viride (85.78 mg/g). C. tropicalis and Z. rouxii showed the highest chitosan production in the presence of sucrose (66.00 and 60.00 mg/g), whereas xylose was the best carbon for P. chrysogenum (62.50 mg/g). The selected strains were also differing in their nitrogen source requiring for production of chitosan. The present work confirmed that chitosan production by microorganisms is strongly dependent on the ph of the culture medium. The present data show that exposing the selected fungal strains to very low dose levels of gamma ray enhanced their productivity of chitosan and dry weight. The best environmental conditions of temperature degree, ph value and colloidal chitin concentration on chitinase activity produced by Z. rouxii were 30 degree C, 5.5 and 2% respectively, while they were 30 degree C, 6.0 and 1.5% for chitinase produced by A. niger in the same manner respectively

Combined Transcriptomic and Proteomic Analysis of the Posterior Salivary Gland from the Southern Blue-Ringed Octopus and the Southern Sand Octopus.

Science.gov (United States)

Whitelaw, Brooke L; Strugnell, Jan M; Faou, Pierre; da Fonseca, Rute R; Hall, Nathan E; Norman, Mark; Finn, Julian; Cooke, Ira R

2016-09-02

This study provides comprehensive proteomic profiles from the venom producing posterior salivary glands of octopus (superorder Octopodiformes) species. A combined transcriptomic and proteomic approach was used to identify 1703 proteins from the posterior salivary gland of the southern blue-ringed octopus, Hapalochlaena maculosa and 1300 proteins from the posterior salivary gland of the southern sand octopus, Octopus kaurna. The two proteomes were broadly similar; clustering of proteins into orthogroups revealed 937 that were shared between species. Serine proteases were particularly diverse and abundant in both species. Other abundant proteins included a large number of secreted proteins, many of which had no known conserved domains, or homology to proteins with known function. On the basis of homology to known venom proteins, 23 putative toxins were identified in H. maculosa and 24 in O. kaurna. These toxins span nine protein families: CAP (cysteine rich secretory proteins, antigen 5, parthenogenesis related), chitinase, carboxylesterase, DNase, hyaluronidase, metalloprotease, phospholipase, serine protease and tachykinin. Serine proteases were responsible for 70.9% and 86.3% of putative toxin expression in H. maculosa and O. kaurna, respectively, as determined using intensity based absolute quantification (iBAQ) measurements. Phylogenetic analysis of the putative toxin serine proteases revealed a similar suite of diverse proteins present in both species. Posterior salivary gland composition of H. maculosa and O. kaurna differ in several key aspects. While O. kaurna expressed the proteinaceous neurotoxin, tachykinin, this was absent from H. maculosa, perhaps reflecting the acquisition of a potent nonproteinaceous neurotoxin, tetrodotoxin (TTX) produced by bacteria in the salivary glands of that species. The dispersal factor, hyaluronidase was particularly abundant in H. maculosa. Chitinase was abundant in both species and is believed to facilitate

Genome analysis of Pseudoalteromonas flavipulchra JG1 reveals various survival advantages in marine environment.

Science.gov (United States)

Yu, Min; Tang, Kaihao; Liu, Jiwen; Shi, Xiaochong; Gulder, Tobias A M; Zhang, Xiao-Hua

2013-10-16

Competition between bacteria for habitat and resources is very common in the natural environment and is considered to be a selective force for survival. Many strains of the genus Pseudoalteromonas were confirmed to produce bioactive compounds that provide those advantages over their competitors. In our previous study, P. flavipulchra JG1 was found to synthesize a Pseudoalteromonas flavipulchra antibacterial Protein (PfaP) with L-amino acid oxidase activity and five small chemical compounds, which were the main competitive agents of the strain. In addition, the genome of this bacterium has been previously sequenced as Whole Genome Shotgun project (PMID: 22740664). In this study, more extensive genomic analysis was performed to identify specific genes or gene clusters which related to its competitive feature, and further experiments were carried out to confirm the physiological roles of these genes when competing with other microorganisms in marine environment. The antibacterial protein PfaP may also participate in the biosynthesis of 6-bromoindolyl-3-acetic acid, indicating a synergistic effect between the antibacterial macromolecule and small molecules. Chitinases and quorum quenching enzymes present in P. flavipulchra, which coincide with great chitinase and acyl homoserine lactones degrading activities of strain JG1, suggest other potential mechanisms contribute to antibacterial/antifungal activities. Moreover, movability and rapid response mechanisms to phosphorus starvation and other stresses, such as antibiotic, oxidative and heavy metal stress, enable JG1 to adapt to deleterious, fluctuating and oligotrophic marine environments. The genome of P. flavipulchra JG1 exhibits significant genetic advantages against other microorganisms, encoding antimicrobial agents as well as abilities to adapt to various adverse environments. Genes involved in synthesis of various antimicrobial substances enriches the antagonistic mechanisms of P. flavipulchra JG1 and affords

Serum YKL-40 is increased in patients with hepatic fibrosis

DEFF Research Database (Denmark)

Johansen, J S; Christoffersen, P; Møller, S

2000-01-01

BACKGROUND/AIMS: YKL-40, a mammalian member of the chitinase family, is a lectin that binds heparin and chitin. The function of YKL-40 is unknown, but it may function in tissue remodelling. The aims of this study were to assess the level of circulating YKL-40 in patients with various kinds...... with the blood sample. RESULTS: The median serum YKL-40 was highest in patients with alcoholic cirrhosis (532 microg/l), in particular in patients with additional alcoholic hepatitis (740 microg/l). Patients with alcoholic cirrhosis, post-hepatitic cirrhosis (425 microg/l) and non-cirrhotic fibrosis (330 microg/l......) had significantly higher serum YKL-40 than normal subjects (102 microg/l), patients with fatty liver (195 microg/l) or patients with viral hepatitis without fibrosis (174 microg/l). Serum YKL-40 was significantly (p

Peptidoglycan from Fermentation By-Product Triggers Defense Responses in Grapevine

Science.gov (United States)

Chen, Yang; Takeda, Taito; Aoki, Yoshinao; Fujita, Keiko; Suzuki, Shunji; Igarashi, Daisuke

2014-01-01

Plants are constantly under attack from a variety of microorganisms, and rely on a series of complex detection and response systems to protect themselves from infection. Here, we found that a by-product of glutamate fermentation triggered defense responses in grapevine, increasing the expression of defense response genes in cultured cells, foliar chitinase activity, and resistance to infection by downy mildew in leaf explants. To identify the molecule that triggered this innate immunity, we fractionated and purified candidates extracted from Corynebacterium glutamicum, a bacterium used in the production of amino acids by fermentation. Using hydrolysis by lysozyme, a silkworm larva plasma detection system, and gel filtration analysis, we identified peptidoglycan as inducing the defense responses. Peptidoglycans of Escherichia coli, Bacillus subtilis, and Staphylococcus aureus also generated similar defensive responses. PMID:25427192

RNA-Seq reveals the molecular mechanism of trapping and killing of root-knot nematodes by nematode-trapping fungi.

Science.gov (United States)

Pandit, Ramesh; Patel, Reena; Patel, Namrata; Bhatt, Vaibhav; Joshi, Chaitanya; Singh, Pawan Kumar; Kunjadia, Anju

2017-04-01

Nematode-trapping fungi are well known for their inherent potential to trap and kill nematodes using specialized trapping devices. However, the molecular mechanisms underlying the trapping and subsequent processes are still unclear. Therefore, in this study, we examined differential genes expression in two nematode-trapping fungi after baiting with nematode extracts. In Arthrobotrys conoides, 809 transcripts associated with diverse functions such as signal transduction, morphogenesis, stress response and peroxisomal proteins, proteases, chitinases and genes involved in the host-pathogen interaction showed differential expression with fold change (>±1.5 fold) in the presence of nematode extract with FDR (p-value nematode-trapping fungi for its host. The findings illustrate the molecular mechanism of fungal parasitism in A. conoides which may be helpful in developing a potential biocontrol agent against parasitic nematodes.

The expression of extracellular fungal cell wall hydrolytic enzymes in different Trichoderma harzianum isolates correlates with their ability to control Pyrenochaeta lycopersici

Directory of Open Access Journals (Sweden)

LUZ MARÍA PÉREZ

2002-01-01

Full Text Available Four isolates of Trichoderma harzianum (ThN3, Th11, Th12 and Th16 were selected for their ability to control the in vitro development of the tomato root pathogen Pyrenochaeta lycopersici. Analysis of the mechanisms involved in biocontrol showed that the formation of non-volatile metabolites appears to be one of those involved in biocontrol of P. lycopersici by all T. harzianum isolates tested. Nevertheless, the higher secretion of chitinases, both in number of isoenzymes and activity by the Th11 strain, correlated well with its higher ability to control this agent in laboratory and greenhouse experiments as compared to the other T. harzianum isolates tested. The secretion of ß -1,3-endoglucanases and/or proteases appeared to have less significance than endochitinases in the biological control of P. lycopersici

Ultrastructural differences between wall apices of growing and non-growing hyphae of Schizophyllum commune

International Nuclear Information System (INIS)

Vermeulen, C.A.; Wessels, J.G.H.

1984-01-01

Newly synthesized chitin at the hyphal apex of Schizophyllum commune was shown to be highly susceptible to chitinase degradiation and solubilization by dilute mineral acid. With time this chitin became gradually more resistant to these treatments. With a combination of the shadow-cast technique and electron microscopic autoradiography it could be shown that this process occurred as the newly synthesized chitin moved into subapical parts of growing hyphae but also in non-growing apices which had ceased growth after incorporation of the N-acetyl[6- 3 H]glucosamine. These results are in agreement with a model which explains apical morphogenesis by assuming that the newly synthesized wall material at the apex is plastic due to the presence of individual polymer chains but becomes rigidified because of subsequent physical and chemical changes involving these polymers. (Author)

Effect of Bacillus pumilus CCIBP-C5 on Musa-Pseudocercospora fijiensis interaction.

Science.gov (United States)

Cruz-Martín, Mileidy; Acosta-Suárez, Mayra; Mena, Eilyn; Roque, Berkis; Pichardo, Tatiana; Alvarado-Capó, Yelenys

2018-02-01

The effect of antifungal activity of culture filtrate (CF) of Bacillus pumilus strain CCIBP-C5, an isolate from a phyllosphere of banana ( Musa ) leaves, was determined on Pseudocercospora fijiensis challenged banana plants. The CF was shown to decrease the fungal biomass and induce changes in banana plant. In this sense, at 70 days post inoculation (dpi), a lower infection index as well as a decrease in fungal biomass after 6 dpi was obtained in treated plants with respect to control ones. At the same time, changes in the activities of several enzymes related to plant defense responses, such as phenylalanine ammonia lyase, chitinases, β-1,3-glucanases and peroxidases were observed. These results indicate that B. pumilus CCIBP-C5 has a potential role for biological control of P. fijiensis possibly due to the production of antifungal metabolites.

Solidago canadensis L. Essential Oil Vapor Effectively Inhibits Botrytis cinerea Growth and Preserves Postharvest Quality of Strawberry as a Food Model System.

Science.gov (United States)

Liu, Shumin; Shao, Xingfeng; Wei, Yanzhen; Li, Yonghua; Xu, Feng; Wang, Hongfei

2016-01-01

This study investigated the anti-fungal properties of Solidago canadensis L. essential oil (SCLEO) against Botrytis cinerea in vitro, and its ability to control gray mold and maintain quality in strawberry fruits. SCLEO exhibited dose-dependent antifungal activity against B. cinerea and profoundly altered mycelial morphology, cellular ultrastructure, and membrane permeability as evaluated by scanning electron microscopy, transmission electron microscopy, and fluorescence microscopy. SCLEO vapor at 0.1 mL/L maintained higher sensory acceptance and reduced decay of fresh strawberry fruit, and also reduced gray mold in artificially inoculated fruit. SCLEO treatment did not, however, stimulate phenylalanin ammonia-lyase, polyphenol oxidase, or chitinase, enzymes related to disease resistance. This suggests that SCLEO reduces gray mold by direct inhibition of pathogen growth. SCLEO vapor may provide a new and effective strategy for controlling postharvest disease and maintaining quality in strawberries.

The fluG-BrlA pathway contributes to the initialisation of autolysis in submerged Aspergillus nidulans cultures.

Science.gov (United States)

Emri, Tamás; Molnár, Zsolt; Pusztahelyi, Tünde; Varecza, Zoltán; Pócsi, István

2005-07-01

The fluG gene proved to be essential in the initialisation of autolysis in Aspergillus nidulans (teleomorph Emericella nidulans) cultures, while a loss-of-function mutation in only one out of the flbB-E genes had only minor effects on autolysis. In contrast to its important role in sporulation, brlA regulated only some, but not all, elements of the autolytic process. The tightly coupled autolytic events (chitinase and proteinase production, hyphal fragmentation, disorganisation of pellets, autolytic loss of biomass) observable in ageing cultures of A. nidulans were disconnected by loss-of-function mutations in some genes of the FluG-BrlA regulatory network. The tight correlation between pellet morphology and size and hydrolase production was also erased by these mutations. On the other hand, the mutations studied did not affect the glutathione metabolism of the fungus.

Analysis of methylated patterns and quality-related genes in tobacco (Nicotiana tabacum) cultivars.

Science.gov (United States)

Jiao, Junna; Jia, Yanlong; Lv, Zhuangwei; Sun, Chuanfei; Gao, Lijie; Yan, Xiaoxiao; Cui, Liusu; Tang, Zongxiang; Yan, Benju

2014-08-01

Methylation-sensitive amplified polymorphism was used in this study to investigate epigenetic information of four tobacco cultivars: Yunyan 85, NC89, K326, and Yunyan 87. The DNA fragments with methylated information were cloned by reamplified PCR and sequenced. The results of Blast alignments showed that the genes with methylation information included chitinase, nitrate reductase, chloroplast DNA, mitochondrial DNA, ornithine decarboxylase, ribulose carboxylase, and promoter sequences. Homologous comparison in three cloned gene sequences (nitrate reductase, ornithine decarboxylase, and ribulose decarboxylase) indicated that geographic factors had significant influence on the whole genome methylation. Introns also contained different information in different tobacco cultivars. These findings suggest that synthetic mechanisms for tobacco aromatic components could be affected by different environmental factors leading to variation of noncoding regions in the genome, which finally results in different fragrance and taste in different tobacco cultivars.

Biological control of Mycosphaerella fragariae in strawberry culture

Directory of Open Access Journals (Sweden)

Anderson Luis Heling

2015-12-01

Full Text Available The Mycosphaerella spot is one of the main foliar diseases of strawberry, degrating great leaf regions and reducing the photosynthetic area. Its control is mainly by the use of chemical fungicides, but, due the increasing demand for food free of pesticide, alternative control methods have been researched, such as biological control. This work aimed to evaluate the effect on strawberry plants, treated with the biological control agents Bacillus cereus, Saccharomyces boulardii and Saccharomyces cerevisiae, in the severity of Mycosphaerella fragariae, productivity and in the activity of β-1.3 glucanases, peroxidases and chitinases enzymes. It was verified that S. cerevisiae and B. cereus treatments were similar to fungicide for disease control. However, even reducing the severity of the disease, there was no increase in productivity, and the different control agents do not cause changes in the evaluated defense mechanisms.

The Effect of Long Term Mercury Pollution on the Soil Microbial Community

DEFF Research Database (Denmark)

Müller, A.K.; Westergaard, K.; Christensen, Søren

2001-01-01

The effect of long-term exposure to mercury on the soil microbial community was investigated in soil from three different sites along a pollution gradient. The amount of total and bioavailable mercury was negatively correlated to the distance from the center of contamination. The size...... of the bacterial and protozoan populations was reduced in the most contaminated soil, whereas there was no significant difference in fungal biomass measured as chitinase activity. Based on the number of colony morphotypes, moreover, the culturable bacterial population was structurally less diverse and contained...... of the number and abundance of bands. The functional potential of the microbial population measured as sole carbon source utilization by Ecoplates® differed between the soils, but there was no change in the number of substrates utilized. The observed changes in the different soil microbial populations...

Enzymes and bioproducts produced by the ascomycete fungus Paecilomyces variotii.

Science.gov (United States)

Herrera Bravo de Laguna, I; Toledo Marante, F J; Mioso, R

2015-12-01

Due its innate ability to produce extracellular enzymes which can provide eco-friendly solutions for a variety of biotechnological applications, Paecilomyces variotii is a potential source of industrial bioproducts. In this review, we report biotechnological records on the biochemistry of different enzymes produced by the fermentation of the P. variotii fungus, including tannases, phytases, cellulases, xylanases, chitinases, amylases and pectinases. Additionally, the main physicochemical properties which can affect the enzymatic reactions of the enzymes involved in the conversion of a huge number of substrates to high-value bioproducts are described. Despite all the background information compiled in this review, more research is required to consolidate the catalytic efficiency of P. variotii, which must be optimized so that it is more accurate and reproducible on a large scale. © 2015 The Society for Applied Microbiology.

Improving the yield and quality of DNA isolated from white-rot fungi.

Science.gov (United States)

Kuhad, R C; Kapoor, R K; Lal, R

2004-01-01

A new simple method used to eliminate polysaccharides that cause problems during DNA isolation was established for 6 different white-rot fungi using 1% hexadecyltrimethylammonium bromide (CTAB) as wash buffer and followed by centrifugation. Variation in the DNA yield and quality was ascertained using precipitating agents, detergents and cell-wall-hydrolyzing chitinase. Considerable amount of exopolysaccharides from fungal biomass was removed with the use of 1% CTAB wash buffer followed by centrifugation. The DNA varied in terms of yield and quality. For the DNA extraction use of 2% SDS in extraction buffer worked best for Pycnoporus cinnabarinus, Cyathus bulleri, Cyathus striatus and Cyathus stercoreus, while 2% CTAB worked best for Phanerochaete chrysosporium and Pleurotus ostreatus. Elimination of phenol and use of absolute ethanol for precipitating DNA resulted in good yield and quality of DNA. This DNA was amenable to restriction endonuclease digestion.

A recombinant Anticarsia gemmatalis MNPV harboring chiA and v-cath genes from Choristoneura fumiferana defective NPV induce host liquefaction and increased insecticidal activity.

Directory of Open Access Journals (Sweden)

Anabele Azevedo Lima

Full Text Available One of the interesting features of Anticarsia gemmatalis multiple nucleopolyhedrovirus isolate 2D (AgMNPV-2D genome is the absence of chitinase (chiA and cathepsin (v-cath genes. This characteristic may be responsible for the lack of liquefaction and melanization in A. gemmatalis larvae killed by AgMNPV-2D infection. This study aimed to test the hypothesis that CHIA and V-CATH proteins from Choristonera fumiferana DEF multiple nucleopolyhedrovirus (CfDEFNPV are able to liquefy and melanize the cuticle of A. gemmatalis larvae infected by a recombinant AgMNPV containing chiA and v-cath genes inserted in its genome. A fragment from the CfDefNPV genome containing chiA and v-cath genes was inserted into the genome of AgMNPV-2D. The recombinant virus (vAgp2100Cf.chiA/v-cath was purified and used to infect insect cells and larvae. Transcripts of v-cath and chiA genes were detected along the infection of insect cells by qRT-PCR, from early to late phases of infection. The analysis of A. gemmatalis larvae killed by vAgp2100Cf.chiA/v-cath infection confirmed the hypothesis proposed. The vAgp2100Cf.chiA/v-cath showed higher insecticidal activity against third instar A. gemmatalis larvae when compared to AgMNPV-2D. The mean time to death was also lower for the vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D at 10 days post infection. Occlusion body production was higher in A. gemmatalis larvae infected with vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D. Enzyme assays showed higher chitinase and cysteine protease activities in insect cells and insects infected with vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D. The introduction of chiA and v-cath genes into the genome of AgMNPV improves its insecticidal activity against A. gemmatalis larvae and this recombinant virus could be used as an alternative to the wild type virus to control this important insect pest.

Genetic and epigenetic regulation of YKL-40 in childhood.

Science.gov (United States)

Guerra, Stefano; Melén, Erik; Sunyer, Jordi; Xu, Cheng-Jian; Lavi, Iris; Benet, Marta; Bustamante, Mariona; Carsin, Anne-Elie; Dobaño, Carlota; Guxens, Mònica; Tischer, Christina; Vrijheid, Martine; Kull, Inger; Bergström, Anna; Kumar, Ashish; Söderhäll, Cilla; Gehring, Ulrike; Dijkstra, Dorieke J; van der Vlies, Pieter; Wickman, Magnus; Bousquet, Jean; Postma, Dirkje S; Anto, Josep M; Koppelman, Gerard H

2018-03-01

Circulating levels of the chitinase-like protein YKL-40 are influenced by genetic variation in its encoding gene (chitinase 3-like 1 [CHI3L1]) and are increased in patients with several diseases, including asthma. Epigenetic regulation of circulating YKL-40 early in life is unknown. We sought to determine (1) whether methylation levels at CHI3L1 CpG sites mediate the association of CHI3L1 single nucleotide polymorphisms (SNPs) with YKL-40 levels in the blood and (2) whether these biomarkers (CHI3L1 SNPs, methylation profiles, and YKL-40 levels) are associated with asthma in early childhood. We used data from up to 2405 participants from the Spanish Infancia y Medio Ambiente; the Swedish Barn/Children, Allergy, Milieu, Stockholm, Epidemiological survey; and the Dutch Prevention and Incidence of Asthma and Mite Allergy birth cohorts. Associations between 68 CHI3L1 SNPs, methylation levels at 14 CHI3L1 CpG sites in whole-blood DNA, and circulating YKL-40 levels at 4 years of age were tested by using correlation analysis, multivariable regression, and mediation analysis. Each of these biomarkers was also tested for association with asthma at 4 years of age by using multivariable logistic regression. YKL-40 levels were significantly associated with 7 SNPs and with methylation at 5 CpG sites. Consistent associations between these 7 SNPs (particularly rs10399931 and rs4950928) and 5 CpG sites were observed. Alleles linked to lower YKL-40 levels were associated with higher methylation levels. Participants with high YKL-40 levels (defined as the highest YKL-40 tertile) had increased odds for asthma compared with subjects with low YKL-40 levels (meta-analyzed adjusted odds ratio, 1.90 [95% CI, 1.08-3.36]). In contrast, neither SNPs nor methylation levels at CpG sites in CHI3L1 were associated with asthma. The effects of CHI3L1 genetic variation on circulating YKL-40 levels are partly mediated by methylation profiles. In our study YKL-40 levels, but not CHI3L1 SNPs or

Genome Analysis of Fimbriiglobus ruber SP5T, a Planctomycete with Confirmed Chitinolytic Capability.

Science.gov (United States)

Ravin, Nikolai V; Rakitin, Andrey L; Ivanova, Anastasia A; Beletsky, Alexey V; Kulichevskaya, Irina S; Mardanov, Andrey V; Dedysh, Svetlana N

2018-04-01

Members of the bacterial order Planctomycetales have often been observed in associations with Crustacea. The ability to degrade chitin, however, has never been reported for any of the cultured planctomycetes although utilization of N -acetylglucosamine (GlcNAc) as a sole carbon and nitrogen source is well recognized for these bacteria. Here, we demonstrate the chitinolytic capability of a member of the family Gemmataceae , Fimbriiglobus ruber SP5 T , which was isolated from a peat bog. As revealed by metatranscriptomic analysis of chitin-amended peat, the pool of 16S rRNA reads from F. ruber increased in response to chitin availability. Strain SP5 T displayed only weak growth on amorphous chitin as a sole source of carbon but grew well with chitin as a source of nitrogen. The genome of F. ruber SP5 T is 12.364 Mb in size and is the largest among all currently determined planctomycete genomes. It encodes several enzymes putatively involved in chitin degradation, including two chitinases affiliated with the glycoside hydrolase (GH) family GH18, GH20 family β- N -acetylglucosaminidase, and the complete set of enzymes required for utilization of GlcNAc. The gene encoding one of the predicted chitinases was expressed in Escherichia coli , and the endochitinase activity of the recombinant enzyme was confirmed. The genome also contains genes required for the assembly of type IV pili, which may be used to adhere to chitin and possibly other biopolymers. The ability to use chitin as a source of nitrogen is of special importance for planctomycetes that inhabit N-depleted ombrotrophic wetlands. IMPORTANCE Planctomycetes represent an important part of the microbial community in Sphagnum -dominated peatlands, but their potential functions in these ecosystems remain poorly understood. This study reports the presence of chitinolytic potential in one of the recently described peat-inhabiting members of the family Gemmataceae , Fimbriiglobus ruber SP5 T This planctomycete uses

Differential expression and function of breast regression protein 39 (BRP-39 in murine models of subacute cigarette smoke exposure and allergic airway inflammation

Directory of Open Access Journals (Sweden)

Coyle Anthony J

2011-04-01

Full Text Available Abstract Background While the presence of the chitinase-like molecule YKL40 has been reported in COPD and asthma, its relevance to inflammatory processes elicited by cigarette smoke and common environmental allergens, such as house dust mite (HDM, is not well understood. The objective of the current study was to assess expression and function of BRP-39, the murine equivalent of YKL40 in a murine model of cigarette smoke-induced inflammation and contrast expression and function to a model of HDM-induced allergic airway inflammation. Methods CD1, C57BL/6, and BALB/c mice were room air- or cigarette smoke-exposed for 4 days in a whole-body exposure system. In separate experiments, BALB/c mice were challenged with HDM extract once a day for 10 days. BRP-39 was assessed by ELISA and immunohistochemistry. IL-13, IL-1R1, IL-18, and BRP-39 knock out (KO mice were utilized to assess the mechanism and relevance of BRP-39 in cigarette smoke- and HDM-induced airway inflammation. Results Cigarette smoke exposure elicited a robust induction of BRP-39 but not the catalytically active chitinase, AMCase, in lung epithelial cells and alveolar macrophages of all mouse strains tested. Both BRP-39 and AMCase were increased in lung tissue after HDM exposure. Examining smoke-exposed IL-1R1, IL-18, and IL-13 deficient mice, BRP-39 induction was found to be IL-1 and not IL-18 or IL-13 dependent, while induction of BRP-39 by HDM was independent of IL-1 and IL-13. Despite the importance of BRP-39 in cellular inflammation in HDM-induced airway inflammation, BRP-39 was found to be redundant for cigarette smoke-induced airway inflammation and the adjuvant properties of cigarette smoke. Conclusions These data highlight the contrast between the importance of BRP-39 in HDM- and cigarette smoke-induced inflammation. While functionally important in HDM-induced inflammation, BRP-39 is a biomarker of cigarette smoke induced inflammation which is the byproduct of an IL-1

Biomarkers of Host Response Predict Primary End-Point Radiological Pneumonia in Tanzanian Children with Clinical Pneumonia: A Prospective Cohort Study.

Directory of Open Access Journals (Sweden)

Laura K Erdman

Full Text Available Diagnosing pediatric pneumonia is challenging in low-resource settings. The World Health Organization (WHO has defined primary end-point radiological pneumonia for use in epidemiological and vaccine studies. However, radiography requires expertise and is often inaccessible. We hypothesized that plasma biomarkers of inflammation and endothelial activation may be useful surrogates for end-point pneumonia, and may provide insight into its biological significance.We studied children with WHO-defined clinical pneumonia (n = 155 within a prospective cohort of 1,005 consecutive febrile children presenting to Tanzanian outpatient clinics. Based on x-ray findings, participants were categorized as primary end-point pneumonia (n = 30, other infiltrates (n = 31, or normal chest x-ray (n = 94. Plasma levels of 7 host response biomarkers at presentation were measured by ELISA. Associations between biomarker levels and radiological findings were assessed by Kruskal-Wallis test and multivariable logistic regression. Biomarker ability to predict radiological findings was evaluated using receiver operating characteristic curve analysis and Classification and Regression Tree analysis.Compared to children with normal x-ray, children with end-point pneumonia had significantly higher C-reactive protein, procalcitonin and Chitinase 3-like-1, while those with other infiltrates had elevated procalcitonin and von Willebrand Factor and decreased soluble Tie-2 and endoglin. Clinical variables were not predictive of radiological findings. Classification and Regression Tree analysis generated multi-marker models with improved performance over single markers for discriminating between groups. A model based on C-reactive protein and Chitinase 3-like-1 discriminated between end-point pneumonia and non-end-point pneumonia with 93.3% sensitivity (95% confidence interval 76.5-98.8, 80.8% specificity (72.6-87.1, positive likelihood ratio 4.9 (3.4-7.1, negative likelihood ratio 0

Biomarkers of Host Response Predict Primary End-Point Radiological Pneumonia in Tanzanian Children with Clinical Pneumonia: A Prospective Cohort Study

Science.gov (United States)

Erdman, Laura K.; D’Acremont, Valérie; Hayford, Kyla; Kilowoko, Mary; Kyungu, Esther; Hongoa, Philipina; Alamo, Leonor; Streiner, David L.; Genton, Blaise; Kain, Kevin C.

2015-01-01

Background Diagnosing pediatric pneumonia is challenging in low-resource settings. The World Health Organization (WHO) has defined primary end-point radiological pneumonia for use in epidemiological and vaccine studies. However, radiography requires expertise and is often inaccessible. We hypothesized that plasma biomarkers of inflammation and endothelial activation may be useful surrogates for end-point pneumonia, and may provide insight into its biological significance. Methods We studied children with WHO-defined clinical pneumonia (n = 155) within a prospective cohort of 1,005 consecutive febrile children presenting to Tanzanian outpatient clinics. Based on x-ray findings, participants were categorized as primary end-point pneumonia (n = 30), other infiltrates (n = 31), or normal chest x-ray (n = 94). Plasma levels of 7 host response biomarkers at presentation were measured by ELISA. Associations between biomarker levels and radiological findings were assessed by Kruskal-Wallis test and multivariable logistic regression. Biomarker ability to predict radiological findings was evaluated using receiver operating characteristic curve analysis and Classification and Regression Tree analysis. Results Compared to children with normal x-ray, children with end-point pneumonia had significantly higher C-reactive protein, procalcitonin and Chitinase 3-like-1, while those with other infiltrates had elevated procalcitonin and von Willebrand Factor and decreased soluble Tie-2 and endoglin. Clinical variables were not predictive of radiological findings. Classification and Regression Tree analysis generated multi-marker models with improved performance over single markers for discriminating between groups. A model based on C-reactive protein and Chitinase 3-like-1 discriminated between end-point pneumonia and non-end-point pneumonia with 93.3% sensitivity (95% confidence interval 76.5–98.8), 80.8% specificity (72.6–87.1), positive likelihood ratio 4.9 (3.4–7

Mining of unexplored habitats for novel chitinases-chiA as a helper gene proxy in metagenomics

NARCIS (Netherlands)

Cretoiu, Mariana Silvia; Kielak, Anna Maria; Abu Al-Soud, Waleed; Sorensen, Soren J.; van Elsas, Jan Dirk; Sørensen, S.J.

The main objective of this study was to assess the abundance and diversity of chitin-degrading microbial communities in ten terrestrial and aquatic habitats in order to provide guidance to the subsequent exploration of such environments for novel chitinolytic enzymes. A combined protocol which

Molecular, Structural and Immunological Characterization of Der p 18, a Chitinase-Like House Dust Mite Allergen

Czech Academy of Sciences Publication Activity Database

Resch, A.; Blatt, K.; Malkus, U.; Fercher, CH.; Swoboda, I.; Focke-Tejkl, M.; Chen, K. W.; Seiberler, S.; Mittermann, I.; Lupinek, CH.; Rodriguez-Dominguez, A.; Zieglmayer, P.; Zieglmayer, R.; Keller, W.; Krzyžánek, Vladislav; Valent, P.; Valenta, R.; Vrtala, S.

2016-01-01

Roč. 11, č. 8 (2016), e0160641:1-19 E-ISSN 1932-6203 Institutional support: RVO:68081731 Keywords : dermatophagoides-pteronyssinus * peritrophic matrix * igebinding * protein Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 2.806, year: 2016 http://journals.plos.org/plosone/article/asset?id=10.1371/journal.pone.0160641.PDF

Genetic relatedness of Trichoderma isolates antagonistic against Fusarium oxysporum f.sp. dianthi inflicting carnation wilt.

Science.gov (United States)

Shanmugam, V; Sharma, Vivek; Ananthapadmanaban

2008-01-01

Twenty-eight isolates of Trichoderma belonging to four different species were screened in vitro for their antagonistic ability against Fusarium oxysporum f.sp. dianthi causing carnation wilt. Three different levels of antagonism observed in dual plate assay were further confirmed by cell-free culture filtrate experiments. Isolates showing class I level of antagonism produced maximum lytic enzymes, chitinases and beta-1,3-glucanases. Genetic variability of 25 selected isolates was assessed by random amplified polymorphic DNA technique and the amplified products were correlated for their level of antagonism. Unweighed pair-group method with arithmetical averages cluster analysis revealed prominent inter-and intraspecific genetic variation among the isolates. Based on their genetic relationship, the isolates were mainly distributed into 3 major groups representing T. atroviride, T. pseudokoningii and T. harzianum, with 20-35% interspecific dissimilarity. However, the polymorphism shown by the isolates did not correlate to their level of antagonism.

Autolysis of Blakeslea trispora during carotene production from cheese whey in an airlift reactor.

Science.gov (United States)

Varzakakou, Maria; Roukas, Triantafyllos; Papaioannou, Emmanuel; Kotzekidou, Parthena; Liakopoulou-Kyriakides, Maria

2011-01-01

The phenomenon of autolysis in Blakeslea trispora during carotene production from deproteinized hydrolyzed whey in an airlift reactor was investigated. The process of cellular autolysis was studied by measuring the changes in carotene concentration, dry biomass, residual sugars, pH, intracellular protein, specific activity of the hydrolytic enzymes (proteases, chitinase), and micromorphology of the fungus using a computerized image analysis system. All these parameters were useful indicators of autolysis, but image analysis was found to be the most useful indicator of the onset and progress of autolysis in the culture. Autolysis of B. trispora began early in the growth phase, continued during the stationary phase, and increased significantly in the decline phase. The morphological differentiation of the fungus was a result of the degradation of the cell membrane by hydrolytic enzymes. The biosynthesis of carotenes was carried out in the exponential phase, where the phenomenon of autolysis was not intense.

Solidago canadensis L essential oil vapor effectively inhibits Botrytis cinerea growth and preserves postharvest quality of strawberry as a food model system

Directory of Open Access Journals (Sweden)

Shumin Liu

2016-08-01

Full Text Available This study investigated the anti-fungal properties of Solidago canadensis L essential oil (SCLEO against Botrytis cinerea in vitro, and its ability to control gray mold and maintain quality in strawberry fruits. SCLEO exhibited dose-dependent antifungal activity against B. cinerea and profoundly altered mycelial morphology, cellular ultrastructure, and membrane permeability as evaluated by scanning electron microscopy, transmission electron microscopy, and fluorescence microscopy. SCLEO vapor at 0.1 mL/L maintained higher sensory acceptance and reduced decay of fresh strawberry fruit, and also reduced gray mold in artificially inoculated fruit. SCLEO treatment did not however, stimulate phenylalanin ammonia-lyase (PAL, polyphenol oxidase (POD, or chitinase (CHI, enzymes related to disease resistance. This suggests that SCLEO reduces gray mold by direct inhibition of pathogen growth. SCLEO vapor may provide a new and effective strategy for controlling postharvest disease and maintaining quality in strawberries.

Expressed sequence tag (EST) analysis of two subspecies of Metarhizium anisopliae reveals a plethora of secreted proteins with potential activity in insect hosts.

Science.gov (United States)

Freimoser, Florian M; Screen, Steven; Bagga, Savita; Hu, Gang; St Leger, Raymond J

2003-01-01

Expressed sequence tag (EST) libraries for Metarhizium anisopliae, the causative agent of green muscardine disease, were developed from the broad host-range pathogen Metarhizium anisopliae sf. anisopliae and the specific grasshopper pathogen, M. anisopliae sf. acridum. Approximately 1,700 5' end sequences from each subspecies were generated from cDNA libraries representing fungi grown under conditions that maximize secretion of cuticle-degrading enzymes. Both subspecies had ESTs for virtually all pathogenicity-related genes cloned to date from M. anisopliae, but many novel genes encoding potential virulence factors were also tagged. Enzymes with potential targets in the insect host included proteases, chitinases, phospholipases, lipases, esterases, phosphatases and enzymes producing toxic secondary metabolites. A diverse array of proteases composed 36 % of all M. anisopliae sf. anisopliae ESTs. Eighty percent of the ESTs that could be clustered into functional groups had significant matches (Ehistory of this clade.

Vitamin D-rich marine Inuit diet and markers of inflammation - a population-based survey in Greenland

DEFF Research Database (Denmark)

Schæbel, Louise Kærholm; Bonefeld-Jørgensen, Eva Cecilie; Laurberg, Peter

2015-01-01

The traditional Inuit diet in Greenland consists mainly of fish and marine mammals, rich in vitamin D. Vitamin D has anti-inflammatory capacity but markers of inflammation have been found to be high in Inuit living on a marine diet. Yet, the effect of vitamin D on inflammation in Inuit remains...... unsettled. This led us to investigate the association between vitamin D and markers of inflammation in a population with a high intake of a marine diet. We studied 535 Inuit and non-Inuit living in West and East Greenland. Information concerning dietary habits was obtained by interview-based FFQ. Blood...... samples were drawn for analysis of 25-hydroxyvitamin D, high-sensitivity C-reactive protein (hsCRP) and chitinase-3-like protein 1(YKL-40). Participants were divided into three groups based on degree of intake of the traditional Inuit diet. The diet groups (Inuit diet/mixed diet/imported foods) were...

Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco

DEFF Research Database (Denmark)

Jach, G; Görnhardt, B; Mundy, J

1995-01-01

cDNAs encoding three proteins from barley (Hordeum vulgare), a class-II chitinase (CHI), a class-II beta-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes...... was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original...... cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani, which infects a range of plant species including tobacco...

In-silico analysis of cis-acting regulatory elements of pathogenesis-related proteins of Arabidopsis thaliana and Oryza sativa.

Science.gov (United States)

Kaur, Amritpreet; Pati, Pratap Kumar; Pati, Aparna Maitra; Nagpal, Avinash Kaur

2017-01-01

Pathogenesis related (PR) proteins are low molecular weight family of proteins induced in plants under various biotic and abiotic stresses. They play an important role in plant-defense mechanism. PRs have wide range of functions, acting as hydrolases, peroxidases, chitinases, anti-fungal, protease inhibitors etc. In the present study, an attempt has been made to analyze promoter regions of PR1, PR2, PR5, PR9, PR10 and PR12 of Arabidopsis thaliana and Oryza sativa. Analysis of cis-element distribution revealed the functional multiplicity of PRs and provides insight into the gene regulation. CpG islands are observed only in rice PRs, which indicates that monocot genome contains more GC rich motifs than dicots. Tandem repeats were also observed in 5' UTR of PR genes. Thus, the present study provides an understanding of regulation of PR genes and their versatile roles in plants.

Effect of physical exercise on markers of neuronal dysfunction in cerebrospinal fluid in patients with Alzheimer's disease

DEFF Research Database (Denmark)

Jensen, Camilla Steen; Portelius, Erik; Høgh, Peter

2017-01-01

Introduction Physical exercise has gained increasing focus as a potential mean to maintain cognitive function in patients with Alzheimer's disease (AD). Alongside the markers of specific AD pathology (amyloid β and tau), other pathologies such as neuronal damage and synaptic loss have been proposed...... in Alzheimer's Disease: The Effect of Physical Exercise (ADEX) was analyzed for the concentration of neurofilament light (NFL), neurogranin (Ng), visinin-like protein-1 (VILIP-1), and chitinase-3–like protein 1 (YKL-40). Participants were subjected to either 16 weeks of moderate- to high-intensity exercise (n...... = 25) or treatment as usual (control group, n = 26), and CSF was collected before and after intervention. Results No significant differences in CSF concentrations of VILIP-1, YKL-40, NFL, and Ng were observed when comparing mean change from baseline between the exercise and control groups. Similarly...

Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

Science.gov (United States)

Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

2011-01-01

Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

Water extracts from winery by-products as tobacco defense inducers.

Science.gov (United States)

Benouaret, Razik; Goujon, Eric; Trivella, Aurélien; Richard, Claire; Ledoigt, Gérard; Joubert, Jean-Marie; Mery-Bernardon, Aude; Goupil, Pascale

2014-10-01

Water extracts from winery by-products exhibited significant plant defense inducer properties. Experiments were conducted on three marc extracts containing various amounts of polyphenols and anthocyanins. Infiltration of red, white and seed grape marc extracts into tobacco leaves induced hypersensitive reaction-like lesions with cell death evidenced by Evans Blue staining. The infiltration zones and the surrounding areas revealed accumulation of autofluorescent compounds under UV light. Leaf infiltration of the three winery by-product extracts induced defense gene expression. The antimicrobial PR1, β-1,3-glucanase PR2, and chitinase PR3 target genes were upregulated locally in tobacco plants following grape marc extract treatments. The osmotin PR5 transcripts accumulated as well in red marc extract treated-tobacco leaves. Overall, the winery by-product extracts elicited an array of plant defense responses making the grape residues a potential use of high value compounds.

A novel expansin protein from the white-rot fungus Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Omar Eduardo Tovar-Herrera

Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

Science.gov (United States)

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Immobilization of indigenous holocellulase on iron oxide (Fe2O3) nanoparticles enhanced hydrolysis of alkali pretreated paddy straw.

Science.gov (United States)

Kumar, Ajay; Singh, Surender; Tiwari, Rameshwar; Goel, Renu; Nain, Lata

2017-03-01

The holocellulase from Aspergillus niger SH3 was characterized and found to contain 125 proteins including cellulases (26), hemicellulases (21), chitinases (10), esterases (6), amylases (4) and hypothetical protein (32). The crude enzyme was immobilized on five different nanoparticles (NPs) via physical adsorption and covalent coupling methods. The enzyme-nanoparticle complexes (ENC) were screened for protein binding, enzymatic activities and immobilization efficiency. Magnetic enzyme-nanoparticle complexes (MENC) showed higher immobilization efficiency (60-80%) for most of the enzymes. MENC also showed better catalytic efficiencies in term of higher V max and lower K m than free enzyme. Saccharification yields from alkali treated paddy straw were higher (375.39mg/gds) for covalently immobilized MENC than free enzyme (339.99mg/gds). The immobilized enzyme was used for two cycles of saccharification with 55% enzyme recovery. Hence, this study for the first time demonstrated the immobilization of indigenous enzyme and its utilization for saccharification of paddy straw. Copyright © 2016 Elsevier B.V. All rights reserved.

Thermo-tolerant phosphate-solubilizing microbes for multi-functional biofertilizer preparation.

Science.gov (United States)

Chang, Cheng-Hsiung; Yang, Shang-Shyng

2009-02-01

In order to prepare the multi-functional biofertilizer, thermo-tolerant phosphate-solubilizing microbes including bacteria, actinomycetes, and fungi were isolated from different compost plants and biofertilizers. Except Streptomycesthermophilus J57 which lacked pectinase, all isolates possessed amylase, CMCase, chitinase, pectinase, protease, lipase, and nitrogenase activities. All isolates could solubilize calcium phosphate and Israel rock phosphate; various isolates could solubilize aluminum phosphate, iron phosphate, and hydroxyapatite. During composting, biofertilizers inoculated with the tested microbes had a significantly higher temperature, ash content, pH, total nitrogen, soluble phosphorus content, and germination rate than non-inoculated biofertilizer; total organic carbon and carbon-to-nitrogen ratio showed the opposite pattern. Adding these microbes can shorten the period of maturity, improve the quality, increase the soluble phosphorus content, and enhance the populations of phosphate-solubilizing and proteolytic microbes in biofertilizers. Therefore, inoculating thermo-tolerant phosphate-solubilizing microbes into agricultural and animal wastes represents a practical strategy for preparing multi-functional biofertilizer.

The toxicogenomic multiverse: convergent recruitment of proteins into animal venoms.

Science.gov (United States)

Fry, Bryan G; Roelants, Kim; Champagne, Donald E; Scheib, Holger; Tyndall, Joel D A; King, Glenn F; Nevalainen, Timo J; Norman, Janette A; Lewis, Richard J; Norton, Raymond S; Renjifo, Camila; de la Vega, Ricardo C Rodríguez

2009-01-01

Throughout evolution, numerous proteins have been convergently recruited into the venoms of various animals, including centipedes, cephalopods, cone snails, fish, insects (several independent venom systems), platypus, scorpions, shrews, spiders, toxicoferan reptiles (lizards and snakes), and sea anemones. The protein scaffolds utilized convergently have included AVIT/colipase/prokineticin, CAP, chitinase, cystatin, defensins, hyaluronidase, Kunitz, lectin, lipocalin, natriuretic peptide, peptidase S1, phospholipase A(2), sphingomyelinase D, and SPRY. Many of these same venom protein types have also been convergently recruited for use in the hematophagous gland secretions of invertebrates (e.g., fleas, leeches, kissing bugs, mosquitoes, and ticks) and vertebrates (e.g., vampire bats). Here, we discuss a number of overarching structural, functional, and evolutionary generalities of the protein families from which these toxins have been frequently recruited and propose a revised and expanded working definition for venom. Given the large number of striking similarities between the protein compositions of conventional venoms and hematophagous secretions, we argue that the latter should also fall under the same definition.

Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: an alternative to Bt-toxin technology.

Science.gov (United States)

Agrawal, Aditi; Rajamani, Vijayalakshmi; Reddy, Vanga Siva; Mukherjee, Sunil Kumar; Bhatnagar, Raj K

2015-10-01

The success of Bt transgenics in controlling predation of crops has been tempered by sporadic emergence of resistance in targeted insect larvae. Such emerging threats have prompted the search for novel insecticidal molecules that are specific and could be expressed through plants. We have resorted to small RNA-based technology for an investigative search and focused our attention to an insect-specific miRNA that interferes with the insect molting process resulting in the death of the larvae. In this study, we report the designing of a vector that produces artificial microRNA (amiR), namely amiR-24, which targets the chitinase gene of Helicoverpa armigera. This vector was used as transgene in tobacco. Northern blot and real-time analysis revealed the high level expression of amiR-24 in transgenic tobacco plants. Larvae feeding on the transgenic plants ceased to molt further and eventually died. Our results demonstrate that transgenic tobacco plants can express amiR-24 insectice specific to H. armigera.

Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

Directory of Open Access Journals (Sweden)

Ricardo Harakava

2005-01-01

Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

Use of a chiA probe for detection of chitinase genes in bacteria from the Chesapeake Bay

Digital Repository Service at National Institute of Oceanography (India)

Ramaiah, N.; Hill, R.T.; Chun, J.; Ravel, J.; Matte, M.H.; Straube, W.L.; Colwell, R.R.

PCR primers specific for the chiA gene were designed by alignment and selection of highly conserved regions of chiA sequences from Serratia marcescens, Alteromonas sp., Bacillus circulans and Aeromonas caviae. These primers were used to amplify a...

Characterization of the yam tuber storage proteins from Dioscorea batatas exhibiting unique lectin activities.

Science.gov (United States)

Gaidamashvili, Mariam; Ohizumi, Yuki; Iijima, Shinichiro; Takayama, Tomo; Ogawa, Tomohisa; Muramoto, Koji

2004-06-18

Four major proteins designated DB1, DB2, DB3, and DB4 were isolated and characterized from the yam tuber Dioscorea batatas. The ratios of their yields were 20:50:20:10. DB1 was a mannose-binding lectin (20 kDa) consisting of 10-kDa subunits and was classified as the monocot mannose-binding lectin family. DB2, accounting for 50% of the total protein, was the storage protein, commonly called dioscorins consisting of a 31-kDa subunit. On the basis of amino acid sequence, DB2 was classified to be dioscorin A. DB3 was a maltose-binding lectin, having an apparent molecular mass of 120 kDa and composed of a 66-kDa subunit and two 31-kDa subunits (DB3S). The 66-kDa subunit was further composed of two 31-kDa subunits (DB3L) cross-linked by disulfide bonds. DB3L and DB3S (242 and 241 amino acid residues, respectively) were homologous with each other with 72% sequence identity. They showed a sequence homology to dioscorin B and dioscorin A from Dioscorea alata, with 90 and 93% identity, respectively, and to carbonic anhydrase from Arabidopsis thaliana with about 45% identity. DB3S had one intrachain disulfide bond located at Cys(28)-Cys(187), whereas DB3L had one interchain disulfide bond (Cys(40)-Cys(40)') in addition to the intrachain disulfide bond (Cys(28)-Cys(188)) to form a 66-kDa subunit. DB1 and DB3 agglutinated rabbit erythrocytes at 2.7 and 3.9 microg/ml, respectively. Despite the structural homology between DB2 and DB3, DB2 had no lectin activity. The 66-kDa subunit itself revealed the full hemagglutinating activity of DB3, indicating that DB3L but not DB3S was responsible for the activity. The hemagglutinating activity of DB3 required Ca(2+) ions and was exclusively inhibited by maltose and oligomaltoses (e.g. maltopentaose and maltohexaose) but not by d-glucose. DB3 could not be classified into any known plant lectin family. DB4 was a chitinase, homologous to an acidic chitinase from Dioscorea japonica. DB1, DB2, and DB3 did not show any activity of carbonic

Transcriptional responses in honey bee larvae infected with chalkbrood fungus.

Science.gov (United States)

Aronstein, Katherine A; Murray, Keith D; Saldivar, Eduardo

2010-06-21

Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. We used cDNA-AFLP Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples.We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-kappaB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to transcriptional regulation, apoptotic

Development of embryo-like structures in the suspension cultures of flax coincides with secretion of chitinase-like proteins

Czech Academy of Sciences Publication Activity Database

Petrovská, Beáta; Salaj, T.; Moravčíková, J.; Libantová, J.; Salaj, J.

2010-01-01

Roč. 32, č. 4 (2010), s. 651-656 ISSN 0137-5881 Institutional research plan: CEZ:AV0Z50380511 Keywords : Conditioned media * Embryo-like structures * Linum usitatissimum L Subject RIV: EF - Botanics Impact factor: 1.344, year: 2010

YKL-40-Induced Inhibition of miR-590-3p Promotes Interleukin-18 Expression and Angiogenesis of Endothelial Progenitor Cells

Directory of Open Access Journals (Sweden)

Te-Mao Li

2017-04-01

Full Text Available YKL-40, also known as human cartilage glycoprotein-39 or chitinase-3-like-1, is a pro-inflammatory protein that is highly expressed in rheumatoid arthritis (RA patients. Angiogenesis is a critical step in the pathogenesis of RA, promoting the infiltration of inflammatory cells into joints and providing oxygen and nutrients to RA pannus. In this study, we examined the effects of YKL-40 in the production of the pro-inflammatory cytokine interleukin-18 (IL-18, and the stimulation of angiogenesis and accumulation of osteoblasts. We observed that YKL-40 induces IL-18 production in osteoblasts and thereby stimulates angiogenesis of endothelial progenitor cells (EPCs. We found that this process occurs through the suppression of miR-590-3p via the focal adhesion kinase (FAK/PI3K/Akt signaling pathway. YKL-40 inhibition reduced angiogenesis in in vivo models of angiogenesis: the chick embryo chorioallantoic membrane (CAM and Matrigel plug models. We report that YKL-40 stimulates IL-18 expression in osteoblasts and facilitates EPC angiogenesis.

Relationship between two blood stasis syndromes and inflammatory factors in patients with acute coronary syndrome.

Science.gov (United States)

Ma, Cai-Yun; Liu, Jing-Hua; Liu, Jian-Xun; Shi, Da-Zhuo; Xu, Zhen-Ye; Wang, Shao-Ping; Jia, Min; Zhao, Fu-Hai; Jiang, Yue-Rong; Ma, Qin; Peng, Hong-Yu; Lu, Yuan; Zheng, Ze; Ren, Feng-Xue

2017-11-01

To investigate the relationship between inflammatory factors and two Chinese medicine (CM) syndrome types of qi stagnation and blood stasis (QSBS) and qi deficiency and blood stasis (QDBS) in patients with acute coronary syndrome (ACS). Sixty subjects with ACS, whose pathogenesis changes belongs to qi disturbance blood stasis syndrome, were divided into 2 groups: 30 in the QSBS group and 30 in the QDBS group. The comparative analysis on them was carried out through comparing general information, coronary angiography and inflammatory factors including intracellular adhesion molecule-1 (ICAM-1), chitinase-3-like protein 1 (YKL-40) and lipoprotein-associated phospholipase A2 (Lp-PLA2). Compared with the QSBS group, Lp-PLA2 and YKL-40 levels in the QDBS group showed no-significant difference (P>0.05); ICAM-1 was significantly higher in the QDBS group than in the QSBS group in the pathological processes of qi disturbance and blood stasis syndrome of ACS (Psyndrome typing of QSBS and QDBS, which provides a research direction for standardization research of CM syndrome types.

Digestive enzymes in Rhinolophus euryale (Rhinolophidae, Chiroptera are active also during hibernation

Directory of Open Access Journals (Sweden)

Maxinová Edita

2017-11-01

Full Text Available During the winter, bats use hibernation as a means of surviving the period of low prey offer. However, the Mediterranean horseshoe bat (Rhinolophus euryale arouses from torpor quite frequently. Based on the actual climatic conditions, it can profit from occasional foraging oportunities, when they occur. We analysed faeces collected on four nights during the period from November 2012 to February 2013 from the Domica-Baradla cave system (Slovakia and Hungary. In mid-November, the largest proportion of faecal contents were from Lepidoptera. Later on, the proportion of non-consumptive mass in the faeces increased and prey remnants disappeared. We analysed the activity of digestive enzymes (amylase, chitobiase, endochitinase and glukosaminidase in faeces. The activity of these enzymes was detected in fresh faeces throughout the whole winter. The faecal activity of the chitinases was relatively stable during the monitored period, whilst the activity of amylase was highest during late November and December. Some level of active digestive enzymes during the winter could be an adaptation to occasional winter foraging.

Extracellular DNA Release Acts as an Antifungal Resistance Mechanism in Mature Aspergillus fumigatus Biofilms

Science.gov (United States)

Rajendran, Ranjith; Williams, Craig; Lappin, David F.; Millington, Owain; Martins, Margarida

2013-01-01

Aspergillus fumigatus has been shown to form biofilms that are associated with adaptive antifungal resistance mechanisms. These include multidrug efflux pumps, heat shock proteins, and extracellular matrix (ECM). ECM is a key structural and protective component of microbial biofilms and in bacteria has been shown to contain extracellular DNA (eDNA). We therefore hypothesized that A. fumigatus biofilms also possess eDNA as part of the ECM, conferring a functional role. Fluorescence microscopy and quantitative PCR analyses demonstrated the presence of eDNA, which was released phase dependently (8 autolysis, were significantly upregulated as the biofilm matured and that inhibition of chitinases affected biofilm growth and stability, indicating mechanistically that autolysis was possibly involved. Finally, using checkerboard assays, it was shown that combinational treatment of biofilms with DNase plus amphotericin B and caspofungin significantly improved antifungal susceptibility. Collectively, these data show that eDNA is an important structural component of A. fumigatus ECM that is released through autolysis, which is important for protection from environmental stresses, including antifungal therapy. PMID:23314962

The Protein Composition of the Digestive Fluid from the Venus Flytrap Sheds Light on Prey Digestion Mechanisms*

Science.gov (United States)

Schulze, Waltraud X.; Sanggaard, Kristian W.; Kreuzer, Ines; Knudsen, Anders D.; Bemm, Felix; Thøgersen, Ida B.; Bräutigam, Andrea; Thomsen, Line R.; Schliesky, Simon; Dyrlund, Thomas F.; Escalante-Perez, Maria; Becker, Dirk; Schultz, Jörg; Karring, Henrik; Weber, Andreas; Højrup, Peter; Hedrich, Rainer; Enghild, Jan J.

2012-01-01

The Venus flytrap (Dionaea muscipula) is one of the most well-known carnivorous plants because of its unique ability to capture small animals, usually insects or spiders, through a unique snap-trapping mechanism. The animals are subsequently killed and digested so that the plants can assimilate nutrients, as they grow in mineral-deficient soils. We deep sequenced the cDNA from Dionaea traps to obtain transcript libraries, which were used in the mass spectrometry-based identification of the proteins secreted during digestion. The identified proteins consisted of peroxidases, nucleases, phosphatases, phospholipases, a glucanase, chitinases, and proteolytic enzymes, including four cysteine proteases, two aspartic proteases, and a serine carboxypeptidase. The majority of the most abundant proteins were categorized as pathogenesis-related proteins, suggesting that the plant's digestive system evolved from defense-related processes. This in-depth characterization of a highly specialized secreted fluid from a carnivorous plant provides new information about the plant's prey digestion mechanism and the evolutionary processes driving its defense pathways and nutrient acquisition. PMID:22891002

Fiscal 1999 achievement report on regional consortium research and development project. Regional consortium research and development in its 1st year (Development of plastic/metal compositing technology utilizing biogradable natural macromolecules); 1999 nendo seibunkaisei tennen kobunshi wo katsuyoshita plastic to kinzoku no fukugoka gijutsu no kaihatsu seika hokokusho. 1

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-03-01

Research and development is conducted to composite plastic and metal into an electromagnetic shield, for which the metal adsorbing function of chitin and chitosan which are biomass to be obtained from crab and lobster shells is utilized. In the research and development of a method for manufacturing chitosan with its molecular weight decreased, it is found that the molecular weight of the substance is effectively lowered by the use of amorphous chitin as the matrix, lysozyme, chitinase, and chitosanase. In the research on the application of biogradable materials to an electromagnetic shield, studies are conducted about the melting and dispersion of biogradable materials into the primer used for pre-coating treatment. In the evaluation of the physical properties and functions of a novel electromagnetic shield system, coatings prepared by use of various chitosan derivatives are tested, and then it is found that a 2,4-dihydroxybenzaldehyde derivative achieves excellent adhesion. Studies are conducted as to how to decompose such a shield system, when experiments are performed for a chitosan derivative film etc. (NEDO)

Study on the Biocontrol Activities of Trichoderma species in Greengram with Infected Fungal Pathogens

International Nuclear Information System (INIS)

May Waine Wityi Htun; Myat Thu; Saw Sandar Maw

2011-12-01

Seven species of Trichoderma were isolated from rhizospheric soil sources and studied by cultural morphology and microscopic examinations. In dual plate assay, antifungal effects of seven Trichoderma strains were screened against three plant pathogenic fungi (Fusarium oxysporum, Rhizoctonia solani and Pythium sp.) on PDA medium and T-5 isolate showed a wide percentage of inhibitory effects on target pathogens with PIRG value. All Trichoderma strains exhibited a clear zone formation on minimal synthetic medium supplemented with 1% colloidal chitin. T-2 and T-5 were the best chitinase producer strains. In vitro screening for protease activity, the highest protease producing activity of Trichoderma isolate (T-2) were observed in pH indicator medium after 7 days incubation. In pot trial experiment, only T-5 strain exhibited more fungal suppression efficiency on green gram plant than commercial fungicide, Trisan and the other strains. So, it can be said that the effective strain was T-5 strain only which have been more antifungal producing power on three fungal pathogens than Trisan and the resting strains.

The battle in the apoplast: further insights into the roles of proteases and their inhibitors in plant-pathogen interactions

Directory of Open Access Journals (Sweden)

Mansoor eKarimi Jashni

2015-08-01

Full Text Available Upon host penetration, fungal pathogens secrete a plethora of effectors to promote disease, including proteases that degrade plant antimicrobial proteins, and protease inhibitors (PIs that inhibit plant proteases with antimicrobial activity. Conversely, plants secrete proteases and PIs to protect themselves against pathogens or to mediate recognition of pathogen proteases and PIs, which leads to induction of defense responses. Many examples of proteases and PIs mediating effector-triggered immunity in host plants have been reported in the literature, but little is known about their role in compromising basal defense responses induced by microbe-associated molecular patterns. Recently, several reports appeared in literature on secreted fungal proteases that modify or degrade pathogenesis-related proteins, including plant chitinases or PIs that compromise their activities. This prompted us to review the recent advances on proteases and PIs involved in fungal virulence and plant defense. Proteases and PIs from plants and their fungal pathogens play an important role in the arms race between plants and pathogens, which has resulted in co-evolutionary diversification and adaptation shaping pathogen lifestyles.

Characterization and Extracellular Enzyme Activity of Predominant Marine Bacillus spp. Isolated From Sea Water of Orissa Coast, India

Directory of Open Access Journals (Sweden)

Bal, S.

2009-01-01

Full Text Available Bacillus species are ubiquitous and diverse both in the terrestrial and marine ecosystems. In this investigation, predominant Bacillus species from sea water of three different sites of Orissa Coast were isolated and identified. In total, 16 Bacillus species were identified using morpho-physiological and biochemical characterisation. These identified bacterial strains include B. fastidiosus (CMB1, B. alvei (CMB2, B. coagulans (CMB3, B. marinus (CMB5, B. mycoides (CMB8, B. coagulans (PMB1, B. circulans (PMB2, B. cereus (PMB3, B. subtilis (PMB4, B. alcalophilus (GMB1, B. licheniformics (GMB2, B. polymyxa (GMB3 and B. pumilus (GMB4. The isolates CMB4, CMB6 and CMB7 were identified only up to genus level. These isolates were further screened for their salt tolerance and growth under varied temperature and pH conditions. Ability of these strains to produce extracellular enzymes such as protease, amylase, lipase, gelatinase, casein hydrolase, lecithinase, chitinase and pectinase were also screened and found that most of the Bacillus spp. possess extracellular enzymes.

A protein secretion system linked to bacteroidete gliding motility and pathogenesis

Science.gov (United States)

Sato, Keiko; Naito, Mariko; Yukitake, Hideharu; Hirakawa, Hideki; Shoji, Mikio; McBride, Mark J.; Rhodes, Ryan G.; Nakayama, Koji

2009-01-01

Porphyromonas gingivalis secretes strong proteases called gingipains that are implicated in periodontal pathogenesis. Protein secretion systems common to other Gram-negative bacteria are lacking in P. gingivalis, but several proteins, including PorT, have been linked to gingipain secretion. Comparative genome analysis and genetic experiments revealed 11 additional proteins involved in gingipain secretion. Six of these (PorK, PorL, PorM, PorN, PorW, and Sov) were similar in sequence to Flavobacterium johnsoniae gliding motility proteins, and two others (PorX and PorY) were putative two-component system regulatory proteins. Real-time RT-PCR analysis revealed that porK, porL, porM, porN, porP, porT, and sov were down-regulated in P. gingivalis porX and porY mutants. Disruption of the F. johnsoniae porT ortholog resulted in defects in motility, chitinase secretion, and translocation of a gliding motility protein, SprB adhesin, to the cell surface, providing a link between a unique protein translocation system and a motility apparatus in members of the Bacteroidetes phylum. PMID:19966289

Alterations in carbon and nitrogen metabolism induced by water deficit in the stems and leaves of Lupinus albus L.

Science.gov (United States)

Pinheiro, C; Chaves, M M; Ricardo, C P

2001-05-01

Water deficit (WD) in Lupinus albus L. brings about tissue-specific responses that are dependent on stress intensity. Carbohydrate metabolism is very sensitive to changes in plant water status. Six days from withholding water (DAW), sucrose, glucose and fructose levels of the leaf blade had already increased over 5-fold, and the activities of SS and INV(A) had increased c. 1.5-2 times. From 9 DAW on, when stress intensity was more pronounced, these effects were reversed with fructose and glucose concentrations as well as INV(A) activity dropping in parallel. The stem (specifically the stele) responded to the stress intensification with striking increases in the concentration of sugars, N and S, and in the induction of thaumatin-like-protein and an increase in chitinase and peroxidase. At 13 DAW, the plants lost most of the leaves but on rewatering they fully recovered. Thus, the observed changes appear to contribute to a general mechanism of survival under drought, the stem playing a key role in that process.

ISOLATION AND CHARACTERIZATION OF A NOVEL BENZOATE- UTILIZING Serratia marcescens

Directory of Open Access Journals (Sweden)

ANTONIUS SUWANTO

2003-01-01

Full Text Available A new benzoate-utilizing strain, Serratia marcescens DS-8, isolated from the environment was characterized. The strain was enterobacilli, Gram negative, mesophilic, non ha lophilic, and aerobic bacterium that showed motile ovale-rod shaped cells. The isolate produced extracellular chitinase, protease, and prodigiosin (a red pigment pr oduced by several Serratia strains yielding bright red or pink colonies. A physiological assay using Microbact* test showed that the strain was closely related to Klebsiella ozaenae (49.85% and Serratia liquefaciens (24.42%, respectively. However, 16S rRNA sequence analysis indicated that the strain was closely related to S. marcescens DSM 30121 with similarity level of 98%. DS-8 strain was able to synthesize its own vitamins. Optimum growth in benzoate was obtained at pH between 7-8.5 and NaCl concentration of 1- 1.5% (w/v. The isolate could grow in benzoate-containing medium up to 10 mM. Other carbon sources that could support the growth of DS-8 were casamino acid, glutamate, glucose, acetate, potato star ch, and ethanol.

Carnivorous Nutrition in Pitcher Plants (Nepenthes spp.) via an Unusual Complement of Endogenous Enzymes.

Science.gov (United States)

Lee, Linda; Zhang, Ye; Ozar, Brittany; Sensen, Christoph W; Schriemer, David C

2016-09-02

Plants belonging to the genus Nepenthes are carnivorous, using specialized pitfall traps called "pitchers" that attract, capture, and digest insects as a primary source of nutrients. We have used RNA sequencing to generate a cDNA library from the Nepenthes pitchers and applied it to mass spectrometry-based identification of the enzymes secreted into the pitcher fluid using a nonspecific digestion strategy superior to trypsin in this application. This first complete catalog of the pitcher fluid subproteome includes enzymes across a variety of functional classes. The most abundant proteins present in the secreted fluid are proteases, nucleases, peroxidases, chitinases, a phosphatase, and a glucanase. Nitrogen recovery involves a particularly rich complement of proteases. In addition to the two expected aspartic proteases, we discovered three novel nepenthensins, two prolyl endopeptidases that we name neprosins, and a putative serine carboxypeptidase. Additional proteins identified are relevant to pathogen-defense and secretion mechanisms. The full complement of acid-stable enzymes discovered in this study suggests that carnivory in the genus Nepenthes can be sustained by plant-based mechanisms alone and does not absolutely require bacterial symbiosis.

Efficient 1H-NMR Quantitation and Investigation of N-Acetyl-D-glucosamine (GlcNAc and N,N'-Diacetylchitobiose (GlcNAc2 from Chitin

Directory of Open Access Journals (Sweden)

Huey-Lang Yang

2011-09-01

Full Text Available A quantitative determination method of N-acetyl-D-glucosamine (GlcNAc and N,N'-diacetylchitobiose (GlcNAc2 is proposed using a proton nuclear magnetic resonance experiment. N-acetyl groups of GlcNAc and (GlcNAc2 are chosen as target signals, and the deconvolution technique is used to determine the concentration of the corresponding compound. Compared to the HPLC method, 1H-NMR spectroscopy is simple and fast. The method can be used for the analysis of chitin hydrolyzed products with real-time analysis, and for quantifying the content of products using internal standards without calibration curves. This method can be used to quickly evaluate chitinase activity. The temperature dependence of 1H-NMR spectra (VT-NMR is studied to monitor the chemical shift variation of acetyl peak. The acetyl groups of products are involved in intramolecular H-bonding with the OH group on anomeric sites. The rotation of the acetyl group is closely related to the intramolecular hydrogen bonding pattern, as suggested by the theoretical data (molecular modeling.

Intercellular production of tamavidin 1, a biotin-binding protein from Tamogitake mushroom, confers resistance to the blast fungus Magnaporthe oryzae in transgenic rice.

Science.gov (United States)

Takakura, Yoshimitsu; Oka, Naomi; Suzuki, Junko; Tsukamoto, Hiroshi; Ishida, Yuji

2012-05-01

The blast fungus Magnaporthe oryzae, one of the most devastating rice pathogens in the world, shows biotin-dependent growth. We have developed a strategy for creating disease resistance to M. oryzae whereby intercellular production of tamavidin 1, a biotin-binding protein from Pleurotus cornucopiae occurs in transgenic rice plants. The gene that encodes tamavidin 1, fused to the sequence for a secretion signal peptide derived from rice chitinase gene, was connected to the Cauliflower mosaic virus 35S promoter, and the resultant construct was introduced into rice. The tamavidin 1 was accumulated at levels of 0.1-0.2% of total soluble leaf proteins in the transgenic rice and it was localized in the intercellular space of rice leaves. The tamavidin 1 purified from the transgenic rice was active, it bound to biotin and inhibited in vitro growth of M. oryzae by causing biotin deficiency. The transgenic rice plants showed a significant resistance to M. oryzae. This study shows the possibility of a new strategy to engineer disease resistance in higher plants by taking advantage of a pathogen's auxotrophy.

Genetic and functional characterization of culturable plant-beneficial actinobacteria associated with yam rhizosphere.

Science.gov (United States)

Arunachalam Palaniyandi, Sasikumar; Yang, Seung Hwan; Damodharan, Karthiyaini; Suh, Joo-Won

2013-12-01

Actinobacteria were isolated from the rhizosphere of yam plants from agricultural fields from Yeoju, South Korea and analyzed for their genetic and plant-beneficial functional diversity. A total of 29 highly occurring actinobacterial isolates from the yam rhizosphere were screened for various plant-beneficial traits such as antimicrobial activity on fungi and bacteria; biocontrol traits such as production of siderophore, protease, chitinase, endo-cellulase, and β-glucanase. The isolates were also screened for plant growth-promoting (PGP) traits such as auxin production, phosphate solubilization, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, and in vitro Arabidopsis growth promotion. 16S rDNA sequence-based phylogenetic analysis was carried out on the actinobacterial isolates to determine their genetic relatedness to known actinobacteria. BOX-PCR analysis revealed high genetic diversity among the isolates. Several isolates were identified to belong to the genus Streptomyces and a few to Kitasatospora. The actinobacterial strains exhibited high diversity in their functionality and were identified as novel and promising candidates for future development into biocontrol and PGP agents. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synergistic Effects of l-Arginine and Methyl Salicylate on Alleviating Postharvest Disease Caused by Botrysis cinerea in Tomato Fruit.

Science.gov (United States)

Zhang, Xinhua; Min, Dedong; Li, Fujun; Ji, Nana; Meng, Demei; Li, Ling

2017-06-21

The effects of l-arginine (Arg, 1 mM) and/or methyl salicylate (MeSA, 0.05 mM) treatment on gray mold caused by Botrytis cinerea in tomato fruit were studied. Results indicated that Arg or MeSA alleviated the incidence and severity of fruit disease caused by B. cinerea, and that both Arg and MeSA (Arg + MeSA) further inhibited the development of fruit decay. Treatment with Arg + MeSA not only enhanced the activities of superoxide dismutase, catalase, and peroxidase but also promoted the expression levels of pathogenesis-related protein 1 gene and the activities of defense-related enzymes of phenylalanine ammonia-lyase, polyphenol oxidase, β-1,3-glucanase, and chitinase during most of the storage periods, which were associated with lower disease incidence and disease index. In addition, the combined treatment elevated the levels of total phenolics, polyamines, especially putrescine, and nitric oxide. These observations suggest that treatment of fruit with Arg + MeSA is an effective and promising way to alleviate postharvest decays on a commercial scale.

Analysis of chitin-binding proteins from Manduca sexta provides new insights into evolution of peritrophin A-type chitin-binding domains in insects.

Science.gov (United States)

Tetreau, Guillaume; Dittmer, Neal T; Cao, Xiaolong; Agrawal, Sinu; Chen, Yun-Ru; Muthukrishnan, Subbaratnam; Haobo, Jiang; Blissard, Gary W; Kanost, Michael R; Wang, Ping

2015-07-01

In insects, chitin is a major structural component of the cuticle and the peritrophic membrane (PM). In nature, chitin is always associated with proteins among which chitin-binding proteins (CBPs) are the most important for forming, maintaining and regulating the functions of these extracellular structures. In this study, a genome-wide search for genes encoding proteins with ChtBD2-type (peritrophin A-type) chitin-binding domains (CBDs) was conducted. A total of 53 genes encoding 56 CBPs were identified, including 15 CPAP1s (cuticular proteins analogous to peritrophins with 1 CBD), 11 CPAP3s (CPAPs with 3 CBDs) and 17 PMPs (PM proteins) with a variable number of CBDs, which are structural components of cuticle or of the PM. CBDs were also identified in enzymes of chitin metabolism including 6 chitinases and 7 chitin deacetylases encoded by 6 and 5 genes, respectively. RNA-seq analysis confirmed that PMP and CPAP genes have differential spatial expression patterns. The expression of PMP genes is midgut-specific, while CPAP genes are widely expressed in different cuticle forming tissues. Phylogenetic analysis of CBDs of proteins in insects belonging to different orders revealed that CPAP1s from different species constitute a separate family with 16 different groups, including 6 new groups identified in this study. The CPAP3s are clustered into a separate family of 7 groups present in all insect orders. Altogether, they reveal that duplication events of CBDs in CPAP1s and CPAP3s occurred prior to the evolutionary radiation of insect species. In contrast to the CPAPs, all CBDs from individual PMPs are generally clustered and distinct from other PMPs in the same species in phylogenetic analyses, indicating that the duplication of CBDs in each of these PMPs occurred after divergence of insect species. Phylogenetic analysis of these three CBP families showed that the CBDs in CPAP1s form a clearly separate family, while those found in PMPs and CPAP3s were clustered

From reverse transcription to human brain tumors

Directory of Open Access Journals (Sweden)

Dmitrenko V. V.

2013-05-01

Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

YKL-40, a mammalian member of the chitinase family, is a matrix protein of specific granules in human neutrophils

DEFF Research Database (Denmark)

Volck, B; Price, P A; Johansen, J S

1998-01-01

YKL-40, also called human cartilage glycoprotein-39 (HC gp-39), is a member of family 18 glycosyl hydrolases. YKL-40 is secreted by chondrocytes, synovial cells, and macrophages, and recently it has been reported that YKL-40 has a role as an autoantigen in rheumatoid arthritis (RA). The function...... of patients with RA, and the cells are assumed to play a role in joint destruction in that disorder. Therefore, we examined whether neutrophils are a source of YKL-40. YKL-40 was found to colocalize and comobilize with lactoferrin (the most abundant protein of specific granules) but not with gelatinase...... YKL-40 at the myelocyte-metamyelocyte stage, the stage of maturation at which other specific granule proteins are formed. Assuming that YKL-40 has a role as an autoantigen in RA by inducing T cell-mediated autoimmune response, YKL-40 released from neutrophils in the inflamed joint could be essential...

Evaluation of Antagonistic of the some Fungal isolates on Golden Potato Cyst Nematode (Globoderarostochiensis in vitro and Greenhouse Conditions in Hamedan Province

Directory of Open Access Journals (Sweden)

Kh. Abbasi

2017-12-01

Full Text Available Introduction:Potato (Solanumtuberosum is one of the most important crops used as a source of human food. Iran is the third-largest producer of potato in Asia, where the production rate in 2015 was estimated to be about 5 million tonnes. Potato producers inHamedan province produce 21.3% oftotal potato harvestedinIran. Golden potato cyst nematode, Globoderarostochiensis is the most destructive potato pathogen. As the chitin is a dominant composition in middle layer of the eggshell, using the chitinases produced as chitin-degrading enzymes in a wide range of fungiis a good strategy for biological control of the golden potato cyst nematode. We assessedthe ability of various antagonistic fungi to control Globoderarostochiensisunder in vitro and greenhouse conditions. Materials and Methods: Thirty four fungal isolates obtained from infected eggs of the potato cyst nematode, Globoderarostochiensisin potato fieldsofHamedan were evaluated in two chitin-agar and water-agar mediums under in vitro and greenhouse conditions.The ability of thechitinase enzyme production was assessedin chitin-agar medium with colloidal chitin as substrate, so the chitin was used as exclusive source of carbon.Colloidal chitin was prepared based onthe procedure of Seyedasliet al. (2004 with 10 g of powder chitin from practical-grade crab shell chitin (Sigma in 100 ml of 85% H3PO4. Water was added to the above mixtureand was filtered with cheese cloth. To completely remove acid, water addition and filtrationrepeated for several times. The produced unguent materialwas dried and powdered and then used as carbon source in the medium. 0.5 percent of colloidal chitin was added to the medium. Afterwards, a 5 mm disk from the edges of 5days old was placed in the center of Petridish and all of them were kept for 5 days at 25º C. Chitinase detection medium (chitin-agar was directly supplemented with colloidal chitin (5 g/l and bromocresol purple (0.15 g/l. The ability of antagonistic

Identification of a novel fungus, Trichoderma asperellum GDFS1009, and comprehensive evaluation of its biocontrol efficacy.

Science.gov (United States)

Wu, Qiong; Sun, Ruiyan; Ni, Mi; Yu, Jia; Li, Yaqian; Yu, Chuanjin; Dou, Kai; Ren, Jianhong; Chen, Jie

2017-01-01

Due to its efficient broad-spectrum antimicrobial activity, Trichoderma has been established as an internationally recognized biocontrol fungus. In this study, we found and identified a novel strain of Trichoderma asperellum, named GDFS1009. The mycelium of T. asperellum GDFS1009 exhibits a high growth rate, high sporulation capacity, and strong inhibitory effects against pathogens that cause cucumber fusarium wilt and corn stalk rot. T. asperellum GDFS1009 secretes chitinase, glucanase, and protease, which can degrade the cell walls of fungi and contribute to mycoparasitism. The secreted xylanases are good candidates for inducing plant resistance and enhancing plant immunity against pathogens. RNA sequencing (RNA-seq) and gas chromatography-mass spectrometry (GC-MS) showed that T. asperellum GDFS1009 produces primary metabolites that are precursors of antimicrobial compounds; it also produces a variety of antimicrobial secondary metabolites, including polyketides and alkanes. In addition, this study speculated the presence of six antimicrobial peptides via ultra-performance liquid chromatography quadrupole time of flight mass spectrometry (UPLC-QTOF-MS/MS). Future studies should focus on these antimicrobial metabolites for facilitating widespread application in the field of agricultural bio-control.

Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum.

Science.gov (United States)

Zhao, Yueju; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhou, Lu; Wang, Yan; Song, Huimin; Tan, Xinxin; Sun, Lichao; Sangare, Lancine; Folly, Yawa Minnie Elodie; Liu, Yang

2014-01-01

Fusarium graminearum causes Fusarium head blight (FHB), a devastating disease that leads to extensive yield and quality loss of wheat and barley. Bacteria isolated from wheat kernels and plant anthers were screened for antagonistic activity against F. graminearum. Based on its in vitro effectiveness, strain SG6 was selected for characterization and identified as Bacillus subtilis. B. subtilis SG6 exhibited a high antifungal effect on the mycelium growth, sporulation and DON production of F. graminearum with the inhibition rate of 87.9%, 95.6% and 100%, respectively. In order to gain insight into biological control effect in situ, we applied B. subtilis SG6 at anthesis through the soft dough stage of kernel development in field test. It was revealed that B. subtilis SG6 significantly reduced disease incidence (DI), FHB index and DON (P ≤ 0.05). Further, ultrastructural examination shows that B. subtilis SG6 strain induced stripping of F. graminearum hyphal surface by destroying the cellular structure. When hypha cell wall was damaged, the organelles and cytoplasm inside cell would exude, leading to cell death. The antifungal activity of SG6 could be associated with the coproduction of chitinase, fengycins and surfactins.

Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum.

Directory of Open Access Journals (Sweden)

Yueju Zhao

Full Text Available Fusarium graminearum causes Fusarium head blight (FHB, a devastating disease that leads to extensive yield and quality loss of wheat and barley. Bacteria isolated from wheat kernels and plant anthers were screened for antagonistic activity against F. graminearum. Based on its in vitro effectiveness, strain SG6 was selected for characterization and identified as Bacillus subtilis. B. subtilis SG6 exhibited a high antifungal effect on the mycelium growth, sporulation and DON production of F. graminearum with the inhibition rate of 87.9%, 95.6% and 100%, respectively. In order to gain insight into biological control effect in situ, we applied B. subtilis SG6 at anthesis through the soft dough stage of kernel development in field test. It was revealed that B. subtilis SG6 significantly reduced disease incidence (DI, FHB index and DON (P ≤ 0.05. Further, ultrastructural examination shows that B. subtilis SG6 strain induced stripping of F. graminearum hyphal surface by destroying the cellular structure. When hypha cell wall was damaged, the organelles and cytoplasm inside cell would exude, leading to cell death. The antifungal activity of SG6 could be associated with the coproduction of chitinase, fengycins and surfactins.

Achievement report for fiscal 1997 on the development of technologies for utilizing biological resources such as complex biosystems. Development of complex biosystem analyzing technology; 1997 nendo fukugo seibutsukei nado seibutsu shigen riyo gijutsu kaihatsu seika hokokusho. Fukugo seibutsukei kaiseki gijutsu no kaihatsu

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-03-01

The aim is to utilize the sophisticated functions of complex biosystems. In the research and development of technologies for effectively utilizing unexploited resources and substances such as seeweeds and algae, seaweeds are added to seawater to turn into a microbial suspension after the passage of two weeks, the suspension is next scattered on a carageenan culture medium, and then carageenan decomposing microbes are obtained. In the research and development of technologies for utilizing microbe/fauna-flora complex systems, technologies for exploring and analyzing microbes are studied. For this purpose, 48 kinds of sponges and 300 kinds of bacteria symbiotic with the sponges are sampled in Malaysia. Out of them, 15 exhibit enzyme inhibition and Artemia salina lethality activities. In the development of technologies for analyzing the functions of microbes engaged in the production of useful resources and substances for animals and plants, 150 kinds of micro-algae are subjected to screening using protease and chitinase inhibiting activities as the indexes, and it is found that an extract of Isochrysis galbana displays an intense inhibitory activity. The alga is cultured in quantities, the active component is isolated from 20g of dried alga, and its constitution is determined. (NEDO)

Inducers of resistance and silicon on the activity of defense enzymes in the soybean-Phakopsora pachyrhizi interaction

Directory of Open Access Journals (Sweden)

Maria Fernanda Antunes da Cruz

2013-06-01

Full Text Available This study aimed to determine the effect of jasmonic acid (JA, Acibenzolar-S-Methyl (ASM and calcium silicate (a source of soluble silicon, Si, on the potentiation of soybean resistance to Asian soybean rust (ASR. The ASR severity was significantly reduced on plants sprayed with ASM or supplied with Si in comparison to plants sprayed with JA or deionized water. For chitinases (CHI, significant differences in activity between non-inoculated and inoculated plants sprayed with deionized water or with ASM occurred at 72 hours after inoculation (hai, at 24 and 72 hai when sprayed with JA and at 141 hai when supplied with Si. For β-1,3-glucanases (GLU, significant differences in activity between non-inoculated and inoculated plants sprayed with deionized water occurred at 24, 48 and 141 hai, but not until 72 for plants sprayed with ASM. For phenylalanine ammonia-lyases (PAL, significant differences in activity between non-inoculated and inoculated plants occurred only for plants sprayed with ASM at 72 and 141 hai. In conclusion, the ASR symptoms can be mild on plants sprayed with ASM or supplied with Si and that this amelioration likely involved the defense enzymes.

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

Directory of Open Access Journals (Sweden)

Yuanman Tang

2017-11-01

Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Characterisation of bacteria from Pinus sylvestris-Suillus luteus mycorrhizas and their effects on root-fungus interactions and plant growth.

Science.gov (United States)

Bending, Gary D; Poole, Elizabeth J; Whipps, John M; Read, David J

2002-03-01

Bacteria from Pinus sylvestris-Suillus luteus mycorrhizas were isolated, characterised, and their effects on P. sylvestris-S. luteus interactions and plant growth investigated in vitro. The isolates formed five distinct phenotypic and physiological groups. Two of the groups, accounting for 34 of the 55 isolates, consisted of Bacillus spp., with three subgroups represented. The other groups contained Burkholderia spp., Serratia spp. and Pseudomonas spp. Representatives from each bacterial group were used in microcosm experiments to investigate bacterial effects on P. sylvestris-S. luteus interactions. Most Bacillus isolates stimulated growth of S. luteus along the P. sylvestris root, while isolates of Pseudomonas and Serratia inhibited root colonisation by the fungus. Burkholderia and Serratia isolates inhibited ectomycorrhiza formation by 97 and 41% respectively, while a single Bacillus isolate doubled the formation of first order ectomycorrhizal roots. There were no clear relationships between effects of the bacteria on root colonisation by the fungus after 4 weeks, and chitinase production or subsequent ectomycorrhiza formation. However, isolates that inhibited ectomycorrhiza formation appeared to associate preferentially with ectomycorrhizal roots. Several isolates enhanced plant growth substantially, although these effects were unrelated to either root colonisation by the fungus or ectomycorrhiza formation.

The demosponge Pseudoceratina purpurea as a new source of fibrous chitin.

Science.gov (United States)

Żółtowska-Aksamitowska, Sonia; Tsurkan, Mikhail V; Lim, Swee-Cheng; Meissner, Heike; Tabachnick, Konstantin; Shaala, Lamiaa A; Youssef, Diaa T A; Ivanenko, Viatcheslav N; Petrenko, Iaroslav; Wysokowski, Marcin; Bechmann, Nicole; Joseph, Yvonne; Jesionowski, Teofil; Ehrlich, Hermann

2018-06-01

Among marine demosponges (Porifera: Demospongiae), only representatives of the order Verongiida have been recognized to synthetize both biologically active substances as well as scaffolds-like fibrous skeletons made of structural aminopolysaccharide chitin. The unique 3D architecture of such scaffolds open perspectives for their applications in waste treatment, biomimetics and tissue engineering. Here, we focus special attention to the demosponge Pseudoceratina purpurea collected in the coastal waters of Singapore. For the first time the detailed description of the isolation of chitin from the skeleton of this sponge and its identification using diverse bioanalytical tools were carried out. Calcofluor white staining, FTIR analysis, electrospray ionization mass spectrometry (ESI-MS), SEM, and fluorescence microscopy as well as a chitinase digestion assay were applied in order to confirm with strong evidence the finding of alpha-chitin in the skeleton of P. purpurea. We suggest that the discovery of chitin within representatives of Pseudoceratinidae family is a perspective step in evaluation of these verongiid sponges as novel renewable sources for both chitin and biologically active metabolites, which are of prospective use for marine oriented biomedicine and pharmacology, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

In vitro antagonism of Thielaviopsis paradoxa by Trichoderma longibrachiatum.

Science.gov (United States)

Sánchez, Vladimir; Rebolledo, Oscar; Picaso, Rosa M; Cárdenas, Elizabeth; Córdova, Jesús; González, Orfil; Samuels, Gary J

2007-01-01

Seventy-nine Trichoderma strains were isolated from soil taken from 28 commercial plantations of Agave tequilana cv. 'Azul' in the State of Jalisco, Mexico. Nine of these isolates produced nonvolatile metabolites that completely inhibited the growth of Thielaviopsis paradoxa on potato dextrose agar plates. These isolates were identified as Trichoderma longibrachiatum on the basis of their morphology and DNA sequence analysis of two genes (ITS rDNA and translation elongation factor EF-1alpha). Mycoparasitism of Th. paradoxa by T. longibrachiatum strains in dual cultures was examined by scanning electron microscopy. The Trichoderma hyphae grew alongside the Th. paradoxa hyphae, but penetration of Thielaviopsis hyphae by Trichoderma was no apparent. Aleurioconidia of Th. paradoxa were parasitized by Trichoderma. Both hyphae and aleurioconidia of Th. paradoxa lost turgor pressure, wrinkled, collapsed and finally disintegrated. In liquid cultures, all nine Trichoderma isolates produced proteases, beta-1,3-glucanases and chitinases that would be responsible for the degradation of Thielaviopsis hyphae. These results demonstrate that the modes of action of T. longibrachiatum involved against Th. paradoxa in vitro experiments are mycoparasitism and the production of nonvolatile toxic metabolites.

DL-β-aminobutyric acid-induced resistance in soybean against Aphis glycines Matsumura (Hemiptera: Aphididae.

Directory of Open Access Journals (Sweden)

Yunpeng Zhong

Full Text Available Priming can improve plant innate capability to deal with the stresses caused by both biotic and abiotic factors. In this study, the effect of DL-β-amino-n-butyric acid (BABA against Aphis glycines Matsumura, the soybean aphid (SA was evaluated. We found that 25 mM BABA as a root drench had minimal adverse impact on plant growth and also efficiently protected soybean from SA infestation. In both choice and non-choice tests, SA number was significantly decreased to a low level in soybean seedlings drenched with 25 mM BABA compared to the control counterparts. BABA treatment resulted in a significant increase in the activities of several defense enzymes, such as phenylalanine ammonia-lyase (PAL, peroxidase (POX, polyphenol oxidase (PPO, chitinase (CHI, and β-1, 3-glucanase (GLU in soybean seedlings attacked by aphid. Meanwhile, the induction of 15 defense-related genes by aphid, such as AOS, CHS, MMP2, NPR1-1, NPR1-2, and PR genes, were significantly augmented in BABA-treated soybean seedlings. Our study suggest that BABA application is a promising way to enhance soybean resistance against SA.

Potensi Bakteri Endofit Pengendali Nematoda Peluka Akar (Pratylenchus brachyurus pada Nilam

Directory of Open Access Journals (Sweden)

RITA HARNI

2007-03-01

Full Text Available Root lesion nematode (Pratylenchus brachyurus is one of the most important pathogens of patchouli that caused significant losses. Studies on the potential of endophytic bacterial to control P. brachyurus on patchouli had been conducted. To evaluate the effectiveness of endophytic bacterial against to P. brachyurus on patchouli, nine isolates of bacteria (NJ2, NJ25, NJ41, NJ46, NJ57, NA22, ERB21, ES32, and E26 were applied by deeping root seedling into bacterial suspension. A study of the physiological characteristics of nine isolates was conducted by using specific medium. The results showed that endophytic bacterial was significantly reduced the population of P. brachyurus and all isolates bacterial promoted growth of patchouli (shoot weight, root weight, and root length. Four isolates, i.e. Bacillus NJ46, Bacillus Na22, Bacillus NJ2, and Bacillus NJ57 were among the potential control agents that reduced nematode populations as much as 68.1–73.9%. Almost all of the isolated bacteria from patchouli roots were able to solubilizing phosphate, while some of them had the ability to produce chitinase, cellulase, protease, HCN, and fluorescency.

Potential of Endophytic Bacterial to Control Lesion Nematode (Pratylenchus brachyurus on Patchouli

Directory of Open Access Journals (Sweden)

RITA HARNI

2007-03-01

Full Text Available Root lesion nematode (Pratylenchus brachyurus is one of the most important pathogens of patchouli that caused significant losses. Studies on the potential of endophytic bacterial to control P. brachyurus on patchouli had been conducted. To evaluate the effectiveness of endophytic bacterial against to P. brachyurus on patchouli, nine isolates of bacteria ( NJ2, NJ25, NJ41, NJ46, NJ57, NA22, ERB21, ES32, and E26 were applied by deeping root seedling into bacterial suspension. A study of the physiological characteristics of nine isolates was conducted by using specific medium. The results showed that endophytic bacterial was significantly reduced the population of P. brachyurus and all isolates bacterial promoted growth of patchouli (shoot weight, root weight, and root length. Four isolates, i.e. Bacillus NJ46, Bacillus Na22, Bacillus NJ2, and Bacillus NJ57 were among the potential control agents that reduced nematode populations as much as 68.1-73.9%. Almost all of the isolated bacteria from patchouli roots were able to solubilizing phosphate, while some of them had the ability to produce chitinase, cellulase, protease, HCN, and fluorescency.

Phyllosticta musarum Infection-Induced Defences Suppress Anthracnose Disease Caused by Colletotrichum musae in Banana Fruits cv 'Embul'.

Science.gov (United States)

Abayasekara, C L; Adikaram, N K B; Wanigasekara, U W N P; Bandara, B M R

2013-03-01

Anthracnose development by Colletotrichum musae was observed to be significantly less in the fruits of the banana cultivar 'Embul' (Mysore, AAB) infected with Phyllosticta musarum than in fruits without such infections. Anthracnose disease originates from quiescent C. musae infections in the immature fruit. P. musarum incites minute, scattered spots, referred to as freckles, in the superficial tissues of immature banana peel which do not expand during maturation or ripening. P. musarum does not appear to have a direct suppressive effect on C. musae as conidia of C. musae germinate on both freckled and non-freckled fruit forming quiescent infections. Our investigations have shown that P. musarum infection induced several defence responses in fruit including the accumulation of five phytoalexins, upregulation of chitinase and β-1,3-glucanase, phenylalanine ammonia lyase (PAL) activity and cell wall lignification. (1)H and (13)C NMR spectral data of one purified phytoalexin compared closely with 4'-hydroxyanigorufone. Some of the P. musarum-induced defences that retained during ripening, restrict C. musae development at the ripe stage. This paper examines the potential of P. musarum-induced defences, in the control of anthracnose, the most destructive postharvest disease in banana.

Phyllosticta musarum Infection-Induced Defences Suppress Anthracnose Disease Caused by Colletotrichum musae in Banana Fruits cv ‘Embul’

Science.gov (United States)

Abayasekara, C. L.; Adikaram, N. K. B.; Wanigasekara, U. W. N. P.; Bandara, B. M. R.

2013-01-01

Anthracnose development by Colletotrichum musae was observed to be significantly less in the fruits of the banana cultivar ‘Embul’ (Mysore, AAB) infected with Phyllosticta musarum than in fruits without such infections. Anthracnose disease originates from quiescent C. musae infections in the immature fruit. P. musarum incites minute, scattered spots, referred to as freckles, in the superficial tissues of immature banana peel which do not expand during maturation or ripening. P. musarum does not appear to have a direct suppressive effect on C. musae as conidia of C. musae germinate on both freckled and non-freckled fruit forming quiescent infections. Our investigations have shown that P. musarum infection induced several defence responses in fruit including the accumulation of five phytoalexins, upregulation of chitinase and β-1,3-glucanase, phenylalanine ammonia lyase (PAL) activity and cell wall lignification. 1H and 13C NMR spectral data of one purified phytoalexin compared closely with 4′-hydroxyanigorufone. Some of the P. musarum-induced defences that retained during ripening, restrict C. musae development at the ripe stage. This paper examines the potential of P. musarum-induced defences, in the control of anthracnose, the most destructive postharvest disease in banana. PMID:25288931

Antimicrobial and Anti-Proliferative Effects of Skin Mucus Derived from Dasyatis pastinaca (Linnaeus, 1758

Directory of Open Access Journals (Sweden)

Virginia Fuochi

2017-11-01

Full Text Available Resistance to chemotherapy occurs in various diseases (i.e., cancer and infection, and for this reason, both are very difficult to treat. Therefore, novel antimicrobial and chemotherapic drugs are needed for effective antibiotic therapy. The aim of the present study was to assess the antimicrobial and anti-proliferative effects of skin mucus derived from Dasyatis pastinaca (Linnaeus, 1758. Our results showed that skin mucus exhibited a significant and specific antibacterial activity against Gram-negative bacteria but not against Gram-positive bacteria. Furthermore, we also observed a significant antifungal activity against some strains of Candida spp. Concerning anti-proliferative activity, we showed that fish mucus was specifically toxic for acute leukemia cells (HL60 with an inhibition of proliferation in a dose dependent manner (about 52% at 1000 μg/mL of fish skin mucous, FSM. Moreover, we did not observe effects in healthy cells, in neuroblastoma cells (SH-SY5Y, and multiple myeloma cell lines (MM1, U266. Finally, it exhibited strong expression and activity of chitinase which may be responsible, at least in part, for the aforementioned results.

Bioproduction of Chitooligosaccharides: Present and Perspectives

Directory of Open Access Journals (Sweden)

Woo-Jin Jung

2014-10-01

Full Text Available Chitin and chitosan oligosaccharides (COS have been traditionally obtained by chemical digestion with strong acids. In light of the difficulties associated with these traditional production processes, environmentally compatible and reproducible production alternatives are desirable. Unlike chemical digestion, biodegradation of chitin and chitosan by enzymes or microorganisms does not require the use of toxic chemicals or excessive amounts of wastewater. Enzyme preparations with chitinase, chitosanase, and lysozymeare primarily used to hydrolyze chitin and chitosan. Commercial preparations of cellulase, protease, lipase, and pepsin provide another opportunity for oligosaccharide production. In addition to their hydrolytic activities, the transglycosylation activity of chitinolytic enzymes might be exploited for the synthesis of desired chitin oligomers and their derivatives. Chitin deacetylase is also potentially useful for the preparation of oligosaccharides. Recently, direct production of oligosaccharides from chitin and crab shells by a combination of mechanochemical grinding and enzymatic hydrolysis has been reported. Together with these, other emerging technologies such as direct degradation of chitin from crustacean shells and microbial cell walls, enzymatic synthesis of COS from small building blocks, and protein engineering technology for chitin-related enzymes have been discussed as the most significant challenge for industrial application.

Effectiveness of Postharvest Treatment with Chitosan to Control Citrus Green Mold

Directory of Open Access Journals (Sweden)

Mohamed El Guilli

2016-03-01

Full Text Available Control of green mold, caused by Penicillium digitatum, by fungicides raises several problems, such as emergence of resistant pathogens, as well as concerns about the environment and consumers’ health. As potential alternatives, the effects of chitosan on green mold disease and the quality attributes of citrus fruits were investigated. Fruits were wounded then treated with different concentrations of chitosan 24 h before their inoculation with P. digitatum. The results of in vitro experiment demonstrated that the antifungal activity against P. digitatum was improved in concert to the increase of chitosan concentration. In an in vivo study, green mold was significantly reduced by chitosan treatments. In parallel, chitinase and glucanase activities were enhanced in coated fruits. Evidence suggested that effects of chitosan coating on green mold of mandarin fruits might be related to its fungitoxic properties against the pathogen and/or the elicitation of biochemical defense responses in coated fruits. Further, quality attributes including fruit firmness, surface color, juice content, and total soluble solids, were not affected by chitosan during storage. Moreover, the loss of weight was even less pronounced in chitosan-coated fruit.

Interaction of Ulocladium atrum, a Potential Biological Control Agent, with Botrytis cinerea and Grapevine Plantlets

Directory of Open Access Journals (Sweden)

Sébastien Ronseaux

2013-09-01

Full Text Available The effectiveness of biological control agent, Ulocladium atrum (isolates U13 and U16 in protecting Vitis vinifera L. cv. Chardonnay against gray mold disease caused by Botrytis cinerea, and simulation of the foliar defense responses was investigated. A degraded mycelium structure during cultural assay on potato dextrose agar revealed that U. atrum isolates U13 and U16 were both antagonistic to B. cinerea, mainly when isolates were inoculated two days before Botrytis. Under in vitro conditions, foliar application of U. atrum protected grapevine leaves against gray mold disease. An increase in chitinase activity was induced by the presence of U. atrum isolates indicating that the biological control agents triggered plant defense mechanisms. Moreover, U13 has the potential to colonize the grapevine plantlets and to improve their growth. The ability of U. atrum isolates to exhibit an antagonistic effect against B. cinerea in addition to their aptitude to induce plant resistance and to promote grapevine growth may explain a part of their biological activity. Hence, this study suggests that U. atrum provides a suitable biocontrol agent against gray mold in grapevines.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Science.gov (United States)

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Screening and identification of putative allergens in berry fruits of the Rosaceae family: technical challenges.

Science.gov (United States)

Marzban, Gorji; Maghuly, Fatemeh; Herndl, Anita; Katinger, Hermann; Laimer, Margit

2008-01-01

Cross-reactive proteins in small fruits of the Rosaceae family like strawberry, raspberry and blackberry revealed an unexpected complex IgE-reactivity pattern. Several copies of PR-10 and PR-14 proteins were detected by Southern blots in strawberry, raspberry and blackberry. In raspberry, the highest similarity at the DNA level for PR-10 and PR-14 (Rub i 1 and Rub i 3) was detected to strawberry sequences of Fra a 1 and Fra a 3. At the protein level, Rub i 1 and Rub i 3 showed more than 70% identity with homologous proteins of rosaceous fruits. Furthermore, raspberries contained additional putative allergens, e.g. class III acidic chitinases and cyclophilins. Blackberries were shown to share at least two well-known major fruit allergens with other rosaceous fruits, namely PR-10s and PR-14s homologous proteins. However the IgE-reactive proteins of small fruits are still not extensively investigated. The main challenges in studying small fruit allergens are the complexity of the fruit matrix, the diversity of physico-chemical properties of fruit proteins, the lack of appropriate protein extraction procedures and the missing information about the influence of processing treatments on food components.

Adaptation of Candida albicans to environmental pH induces cell wall remodelling and enhances innate immune recognition

Science.gov (United States)

Sorsby, Eleanor; Mahtey, Nabeel; Brown, Ian

2017-01-01

Candida albicans is able to proliferate in environments that vary dramatically in ambient pH, a trait required for colonising niches such as the stomach, vaginal mucosal and the GI tract. Here we show that growth in acidic environments involves cell wall remodelling which results in enhanced chitin and β-glucan exposure at the cell wall periphery. Unmasking of the underlying immuno-stimulatory β-glucan in acidic environments enhanced innate immune recognition of C. albicans by macrophages and neutrophils, and induced a stronger proinflammatory cytokine response, driven through the C-type lectin-like receptor, Dectin-1. This enhanced inflammatory response resulted in significant recruitment of neutrophils in an intraperitoneal model of infection, a hallmark of symptomatic vaginal colonisation. Enhanced chitin exposure resulted from reduced expression of the cell wall chitinase Cht2, via a Bcr1-Rim101 dependent signalling cascade, while increased β-glucan exposure was regulated via a non-canonical signalling pathway. We propose that this “unmasking” of the cell wall may induce non-protective hyper activation of the immune system during growth in acidic niches, and may attribute to symptomatic vaginal infection. PMID:28542528

Characteristics of bacillus strains with antifungal activity against phytopathogens

Energy Technology Data Exchange (ETDEWEB)

Lee, Young Keun; Senthilkumar, M. [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

2009-12-15

Four bacterial isolates that showed antifungal activity against Alternaria alternata and other phytopathogens were isolates from bean rhizosphere. 16S rDNA analysis and phylogenetic relationship indicated that these isolates belong to Genus Bacillus. Isolate A1 clustered with Bacillus licheniformis while other isolates A2, A3 and A4 clustered together with B.pumilus. n-Butanol extract of these isolates strongly inhibited the growth of A. alternata while, chloroform extract of isolate A2 and ethyl acetate extract of A1,A3, and A4 inhibited the test fungus partially. All the isolates except A4 produced chitinase enzyme. None of the isolates solubilized mineral phosphate. Radiation sensitivity of isolates A1, A2, A3 and A4 were assessed and the LD{sub 99} values are determined as 0.50, 6.69, 11,60, 1.53 kGy, respectively. Mutant libraries of each isolate were prepared by exposing them to gamma radiation at their respective LD{sub 99} dose. Crude metabolite caused drastic changes on A. alternata hyphal morphology. Appearance of shrunken and collapsed hyphae could be due to the leak of cell wall or changes in membrane permeability.

Adaptation of Candida albicans to environmental pH induces cell wall remodelling and enhances innate immune recognition.

Directory of Open Access Journals (Sweden)

Sarah L Sherrington

2017-05-01

Full Text Available Candida albicans is able to proliferate in environments that vary dramatically in ambient pH, a trait required for colonising niches such as the stomach, vaginal mucosal and the GI tract. Here we show that growth in acidic environments involves cell wall remodelling which results in enhanced chitin and β-glucan exposure at the cell wall periphery. Unmasking of the underlying immuno-stimulatory β-glucan in acidic environments enhanced innate immune recognition of C. albicans by macrophages and neutrophils, and induced a stronger proinflammatory cytokine response, driven through the C-type lectin-like receptor, Dectin-1. This enhanced inflammatory response resulted in significant recruitment of neutrophils in an intraperitoneal model of infection, a hallmark of symptomatic vaginal colonisation. Enhanced chitin exposure resulted from reduced expression of the cell wall chitinase Cht2, via a Bcr1-Rim101 dependent signalling cascade, while increased β-glucan exposure was regulated via a non-canonical signalling pathway. We propose that this "unmasking" of the cell wall may induce non-protective hyper activation of the immune system during growth in acidic niches, and may attribute to symptomatic vaginal infection.

RNA interference of endochitinases in the sugarcane endophyte Trichoderma virens 223 reduces its fitness as a biocontrol agent of pineapple disease.

Directory of Open Access Journals (Sweden)

Aline S Romão-Dumaresq

Full Text Available The sugarcane root endophyte Trichoderma virens 223 holds enormous potential as a sustainable alternative to chemical pesticides in the control of sugarcane diseases. Its efficacy as a biocontrol agent is thought to be associated with its production of chitinase enzymes, including N-acetyl-ß-D-glucosaminidases, chitobiosidases and endochitinases. We used targeted gene deletion and RNA-dependent gene silencing strategies to disrupt N-acetyl-ß-D-glucosaminidase and endochitinase activities of the fungus, and to determine their roles in the biocontrol of soil-borne plant pathogens. The loss of N-acetyl-ß-D-glucosaminidase activities was dispensable for biocontrol of the plurivorous damping-off pathogens Rhizoctonia solani and Sclerotinia sclerotiorum, and of the sugarcane pathogen Ceratocystis paradoxa, the causal agent of pineapple disease. Similarly, suppression of endochitinase activities had no effect on R. solani and S. sclerotiorum disease control, but had a pronounced effect on the ability of T. virens 223 to control pineapple disease. Our work demonstrates a critical requirement for T. virens 223 endochitinase activity in the biocontrol of C. paradoxa sugarcane disease, but not for general antagonism of other soil pathogens. This may reflect its lifestyle as a sugarcane root endophyte.

Characteristics of bacillus strains with antifungal activity against phytopathogens

International Nuclear Information System (INIS)

Lee, Young Keun; Senthilkumar, M.

2009-01-01

Four bacterial isolates that showed antifungal activity against Alternaria alternata and other phytopathogens were isolates from bean rhizosphere. 16S rDNA analysis and phylogenetic relationship indicated that these isolates belong to Genus Bacillus. Isolate A1 clustered with Bacillus licheniformis while other isolates A2, A3 and A4 clustered together with B.pumilus. n-Butanol extract of these isolates strongly inhibited the growth of A. alternata while, chloroform extract of isolate A2 and ethyl acetate extract of A1,A3, and A4 inhibited the test fungus partially. All the isolates except A4 produced chitinase enzyme. None of the isolates solubilized mineral phosphate. Radiation sensitivity of isolates A1, A2, A3 and A4 were assessed and the LD 99 values are determined as 0.50, 6.69, 11,60, 1.53 kGy, respectively. Mutant libraries of each isolate were prepared by exposing them to gamma radiation at their respective LD 99 dose. Crude metabolite caused drastic changes on A. alternata hyphal morphology. Appearance of shrunken and collapsed hyphae could be due to the leak of cell wall or changes in membrane permeability

Application of Proteomics to the Study of Pollination Drops

Directory of Open Access Journals (Sweden)

Natalie Prior

2013-04-01

Full Text Available Premise of the study: Pollination drops are a formative component in gymnosperm pollen-ovule interactions. Proteomics offers a direct method for the discovery of proteins associated with this early stage of sexual reproduction. Methods: Pollination drops were sampled from eight gymnosperm species: Chamaecyparis lawsoniana (Port Orford cedar, Ephedra monosperma, Ginkgo biloba, Juniperus oxycedrus (prickly juniper, Larix ×marschlinsii, Pseudotsuga menziesii (Douglas-fir, Taxus ×media, and Welwitschia mirabilis. Drops were collected by micropipette using techniques focused on preventing sample contamination. Drop proteins were separated using both gel and gel-free methods. Tandem mass spectrometric methods were used including a triple quadrupole and an Orbitrap. Results: Proteins are present in all pollination drops. Consistency in the protein complement over time was shown in L. ×marschlinsii. Representative mass spectra from W. mirabilis chitinase peptide and E. monosperma serine carboxypeptidase peptide demonstrated high quality results. We provide a summary of gymnosperm pollination drop proteins that have been discovered to date via proteomics. Discussion: Using proteomic methods, a dozen classes of proteins have been identified to date. Proteomics presents a way forward in deepening our understanding of the biological function of pollination drops.

Rhizoxin analogs, orfamide A and chitinase production contribute to the toxicity of Pseudomonas protegens strain Pf-5 to Drosophila melanogaster

Science.gov (United States)

Pseudomonas protegens strain Pf-5 is a soil bacterium that was first described for its activity in biological control of plant diseases and has since been shown to be lethal to certain insects. Among these is the fruit fly Drosophila melanogaster, a well-established model organism for studies evalu...

Resistance to Fusarium oxysporum f. sp. gladioli in transgenic Gladiolus plants expressing either a bacterial chloroperoxidase or fungal chitinase genes

Science.gov (United States)

Three antifungal genes, a non-heme chloroperoxidase from Pseudomonas pyrrocinia, and an exochitinase and endochitinase from Fusarium venetanum under regulation by the CaMV 35S promoter, were used to transform Gladiolus for resistance to Fusarium oxysporum f. sp. gladioli. Gladiolus plants were conf...

Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight.

Science.gov (United States)

Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi

2016-01-01

Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

Chitinase 1 Is a Biomarker for and Therapeutic Target in Scleroderma-Associated Interstitial Lung Disease That Augments TGF-β1 Signaling

Science.gov (United States)

Lee, Chun Geun; Herzog, Erica L.; Ahangari, Farida; Zhou, Yang; Gulati, Mridu; Lee, Chang-Min; Peng, Xueyan; Feghali-Bostwick, Carol; Jimenez, Sergio A.; Varga, John; Elias, Jack A.

2014-01-01

Interstitial lung disease (ILD) with pulmonary fibrosis is an important manifestation in systemic sclerosis (SSc, scleroderma) where it portends a poor prognosis. However, biomarkers that predict the development and or severity of SSc-ILD have not been validated, and the pathogenetic mechanisms that engender this pulmonary response are poorly understood. In this study, we demonstrate in two different patient cohorts that the levels of chitotriosidase (Chit1) bioactivity and protein are significantly increased in the circulation and lungs of SSc patients compared with demographically matched controls. We also demonstrate that, compared with patients without lung involvement, patients with ILD show high levels of circulating Chit1 activity that correlate with disease severity. Murine modeling shows that in comparison with wild-type mice, bleomycin-induced pulmonary fibrosis was significantly reduced in Chit1−/− mice and significantly enhanced in lungs from Chit1 overexpressing transgenic animals. In vitro studies also demonstrated that Chit1 interacts with TGF-β1 to augment fibroblast TGF-β receptors 1 and 2 expression and TGF-β–induced Smad and MAPK/ERK activation. These studies indicate that Chit1 is potential biomarker for ILD in SSc and a therapeutic target in SSc-associated lung fibrosis and demonstrate that Chit1 augments TGF-β1 effects by increasing receptor expression and canonical and noncanonical TGF-β1 signaling. PMID:22826322

Biochemical markers assisted screening of Fusarium wilt resistant Musa paradisiaca (L.) cv. puttabale micropropagated clones.

Science.gov (United States)

Venkatesh; Krishna, V; Kumar, K Girish; Pradeepa, K; Kumar, S R Santosh; Kumar, R Shashi

2013-07-01

An efficient protocol was standardized for screening of panama wilt resistant Musa paradisiaca cv. Puttabale clones, an endemic cultivar of Karnataka, India. The synergistic effect of 6-benzyleaminopurine (2 to 6 mg/L) and thidiazuron (0.1 to 0.5 mg/L) on MS medium provoked multiple shoot induction from the excised meristem. An average of 30.10 +/- 5.95 shoots was produced per propagule at 4 mg/L 6-benzyleaminopurine and 0.3 mg/L thidiazuron concentrations. Elongation of shoots observed on 5 mg/L BAP augmented medium with a mean length of 8.38 +/- 0.30 shoots per propagule. For screening of disease resistant clones, multiple shoot buds were mutated with 0.4% ethyl-methane-sulfonate and cultured on MS medium supplemented with Fusarium oxysporum f. sp. cubense (FOC) culture filtrate (5-15%). Two month old co-cultivated secondary hardened plants were used for screening of disease resistance against FOC by the determination of biochemical markers such as total phenol, phenylalanine ammonia lyase, oxidative enzymes like peroxidase, polyphenol oxidase, catalase and PR-proteins like chitinase, beta-1-3 glucanase activities. The mutated clones of M. paradisiaca cv. Puttabale cultured on FOC culture filtrate showed significant increase in the levels of biochemical markers as an indicative of acquiring disease resistant characteristics to FOC wilt.

Determination of lytic enzyme activities of indigenous Trichoderma isolates from Pakistan.

Science.gov (United States)

Asad, Saeed Ahmad; Tabassum, Ayesha; Hameed, Abdul; Hassan, Fayyaz Ul; Afzal, Aftab; Khan, Sabaz Ali; Ahmed, Rafiq; Shahzad, Muhammad

2015-01-01

This study investigated lytic enzyme activities in three indigenous Trichoderma strains namely, Trichoderma asperellum, Trichoderma harzianum and Trichoderma sp. Native Trichoderma strains and a virulent strain of Rhizoctonia solani isolated from infected bean plants were also included in the study. Enzyme activities were determined by measuring sugar reduction by dinitrosalicylic acid (DNS) method using suitable substrates. The antagonists were cultured in minimal salt medium with the following modifications: medium A (1 g of glucose), medium B (0.5 g of glucose + 0.5 g of deactivated R. solani mycelia), medium C (1.0 g of deactivated respective antagonist mycelium) and medium D (1 g of deactivated R. solani mycelia). T asperellum showed presence of higher amounts of chitinases, β-1, 3-glucanases and xylanases in extracellular protein extracts from medium D as compared to medium A. While, the higher activities of glucosidases and endoglucanses were shown in medium D extracts by T. harzianum. β-glucosidase activities were lower compared with other enzymes; however, activities of the extracts of medium D were significantly different. T. asperellum exhibited maximum inhibition (97.7%). On the other hand, Trichoderma sp. did not show any effect on mycelia growth of R. solani on crude extract.

Antagonistic Potential of Native Trichoderma viride Strain against Potent Tea Fungal Pathogens in North East India.

Science.gov (United States)

Naglot, A; Goswami, S; Rahman, I; Shrimali, D D; Yadav, Kamlesh K; Gupta, Vikas K; Rabha, Aprana Jyoti; Gogoi, H K; Veer, Vijay

2015-09-01

Indigenous strains of Trichoderma species isolated from rhizosphere soils of Tea gardens of Assam, north eastern state of India were assessed for in vitro antagonism against two important tea fungal pathogens namely Pestalotia theae and Fusarium solani. A potent antagonist against both tea pathogenic fungi, designated as SDRLIN1, was selected and identified as Trichoderma viride. The strain also showed substantial antifungal activity against five standard phytopathogenic fungi. Culture filtrate collected from stationary growth phase of the antagonist demonstrated a significantly higher degree of inhibitory activity against all the test fungi, demonstrating the presence of an optimal blend of extracellular antifungal metabolites. Moreover, quantitative enzyme assay of exponential and stationary culture filtrates revealed that the activity of cellulase, β-1,3-glucanase, pectinase, and amylase was highest in the exponential phase, whereas the activity of proteases and chitinase was noted highest in the stationary phase. Morphological changes such as hyphal swelling and distortion were also observed in the fungal pathogen grown on potato dextrose agar containing stationary phase culture filtrate. Moreover, the antifungal activity of the filtrate was significantly reduced but not entirely after heat or proteinase K treatment, demonstrating substantial role of certain unknown thermostable antifungal compound(s) in the inhibitory activity.

Antagonistic Potential of Native Trichoderma viride Strain against Potent Tea Fungal Pathogens in North East India

Directory of Open Access Journals (Sweden)

A. Naglot

2015-09-01

Full Text Available Indigenous strains of Trichoderma species isolated from rhizosphere soils of Tea gardens of Assam, north eastern state of India were assessed for in vitro antagonism against two important tea fungal pathogens namely Pestalotia theae and Fusarium solani. A potent antagonist against both tea pathogenic fungi, designated as SDRLIN1, was selected and identified as Trichoderma viride. The strain also showed substantial antifungal activity against five standard phytopathogenic fungi. Culture filtrate collected from stationary growth phase of the antagonist demonstrated a significantly higher degree of inhibitory activity against all the test fungi, demonstrating the presence of an optimal blend of extracellular antifungal metabolites. Moreover, quantitative enzyme assay of exponential and stationary culture filtrates revealed that the activity of cellulase, β-1,3-glucanase, pectinase, and amylase was highest in the exponential phase, whereas the activity of proteases and chitinase was noted highest in the stationary phase. Morphological changes such as hyphal swelling and distortion were also observed in the fungal pathogen grown on potato dextrose agar containing stationary phase culture filtrate. Moreover, the antifungal activity of the filtrate was significantly reduced but not entirely after heat or proteinase K treatment, demonstrating substantial role of certain unknown thermostable antifungal compound(s in the inhibitory activity.

Microbiological studies of hot springs in India: a review.

Science.gov (United States)

Poddar, Abhijit; Das, Subrata K

2018-01-01

The earliest microbiological studies on hot springs in India date from 2003, a much later date compared to global attention in this striking field of study. As of today, 28 out of 400 geothermal springs have been explored following both culturable and non-culturable approaches. The temperatures and pH of the springs are 37-99 °C and 6.8-10, respectively. Several studies have been performed on the description of novel genera and species, characterization of different bio-resources, metagenomics of hot spring microbiome and whole genome analysis of few isolates. 17 strains representing novel species and many thermostable enzymes, including lipase, protease, chitinase, amylase, etc. with potential biotechnological applications have been reported by several authors. Influence of physico-chemical conditions, especially that of temperature, on shaping the hot spring microbiome has been established by metagenomic investigations. Bacteria are the predominant life forms in all the springs with an abundance of phyla Firmicutes, Proteobacteria, Actinobacteria, Thermi, Bacteroidetes, Deinococcus-Thermus and Chloroflexi. In this review, we have discussed the findings on all microbiological studies that have been carried out to date, on the 28 hot springs. Further, the possibilities of extrapolating these studies for practical applications and environmental impact assessment towards protection of natural ecosystem of hot springs have also been discussed.

Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Fangfang Chen

2018-01-01

Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

Differentiations of chitin content and surface morphologies of chitins extracted from male and female grasshopper species.

Directory of Open Access Journals (Sweden)

Murat Kaya

Full Text Available In this study, we used Fourier transform infrared spectroscopy (FT-IR, elemental analysis (EA, thermogravimetric analysis (TGA, X-ray diffractometry (XRD, and scanning electron microscopy (SEM to investigate chitin structure isolated from both sexes of four grasshopper species. FT-IR, EA, XRD, and TGA showed that the chitin was in the alpha form. With respect to gender, two main differences were observed. First, we observed that the quantity of chitin was greater in males than in females and the dry weight of chitin between species ranged from 4.71% to 11.84%. Second, using SEM, we observed that the male chitin surface structure contained 25-90 nm wide nanofibers and 90-250 nm nanopores, while no pores or nanofibers were observed in the chitin surface structure of the majority of females (nanofibers were observed only in M. desertus females. In contrast, the elemental analysis, thermal properties, and crystalline index values for chitin were similar in males and females. Also, we carried out enzymatic digestion of the isolated chitins using commercial chitinase from Streptomyces griseus. We observed that there were no big differences in digestion rate of the chitins from both sexes and commercial chitin. The digestion rates were for grasshoppers' chitins; 88.45-95.48% and for commercial chitin; 94.95%.

Differentiations of chitin content and surface morphologies of chitins extracted from male and female grasshopper species.

Science.gov (United States)

Kaya, Murat; Lelešius, Evaldas; Nagrockaitė, Radvilė; Sargin, Idris; Arslan, Gulsin; Mol, Abbas; Baran, Talat; Can, Esra; Bitim, Betul

2015-01-01

In this study, we used Fourier transform infrared spectroscopy (FT-IR), elemental analysis (EA), thermogravimetric analysis (TGA), X-ray diffractometry (XRD), and scanning electron microscopy (SEM) to investigate chitin structure isolated from both sexes of four grasshopper species. FT-IR, EA, XRD, and TGA showed that the chitin was in the alpha form. With respect to gender, two main differences were observed. First, we observed that the quantity of chitin was greater in males than in females and the dry weight of chitin between species ranged from 4.71% to 11.84%. Second, using SEM, we observed that the male chitin surface structure contained 25-90 nm wide nanofibers and 90-250 nm nanopores, while no pores or nanofibers were observed in the chitin surface structure of the majority of females (nanofibers were observed only in M. desertus females). In contrast, the elemental analysis, thermal properties, and crystalline index values for chitin were similar in males and females. Also, we carried out enzymatic digestion of the isolated chitins using commercial chitinase from Streptomyces griseus. We observed that there were no big differences in digestion rate of the chitins from both sexes and commercial chitin. The digestion rates were for grasshoppers' chitins; 88.45-95.48% and for commercial chitin; 94.95%.

Applying Unconventional Secretion in Ustilago maydis for the Export of Functional Nanobodies

Directory of Open Access Journals (Sweden)

Marius Terfrüchte

2017-04-01

Full Text Available Exploiting secretory pathways for production of heterologous proteins is highly advantageous with respect to efficient downstream processing. In eukaryotic systems the vast majority of heterologous proteins for biotechnological application is exported via the canonical endoplasmic reticulum–Golgi pathway. In the endomembrane system target proteins are often glycosylated and may thus be modified with foreign glycan patterns. This can be destructive for their activity or cause immune reactions against therapeutic proteins. Hence, using unconventional secretion for protein expression is an attractive alternative. In the fungal model Ustilago maydis, chitinase Cts1 is secreted via an unconventional pathway connected to cell separation which can be used to co-export heterologous proteins. Here, we apply this mechanism for the production of nanobodies. First, we achieved expression and unconventional secretion of a functional nanobody directed against green fluorescent protein (Gfp. Second, we found that Cts1 binds to chitin and that this feature can be applied to generate a Gfp-trap. Thus, we demonstrated the dual use of Cts1 serving both as export vehicle and as purification tag. Finally, we established and optimized the production of a nanobody against botulinum toxin A and hence describe the first pharmaceutically relevant target exported by Cts1-mediated unconventional secretion.

Antagonistic Activities of Bacillus spp. Strains Isolated from Tidal Flat Sediment Towards Anthracnose Pathogens Colletotrichum acutatum and C. gloeosporioides in South Korea.

Science.gov (United States)

Han, Joon-Hee; Shim, Hongsik; Shin, Jong-Hwan; Kim, Kyoung Su

2015-06-01

Anthracnose is a fungal disease caused by Colletotrichum species that is detrimental to numerous plant species. Anthracnose control with fungicides has both human health and environmental safety implications. Despite increasing public concerns, fungicide use will continue in the absence of viable alternatives. There have been relatively less efforts to search antagonistic bacteria from mudflats harboring microbial diversity. A total of 420 bacterial strains were isolated from mudflats near the western sea of South Korea. Five bacterial strains, LB01, LB14, HM03, HM17, and LB15, were characterized as having antifungal properties in the presence of C. acutatum and C. gloeosporioides. The three Bacillus atrophaeus strains, LB14, HM03, and HM17, produced large quantities of chitinase and protease enzymes, whereas the B. amyloliquefaciens strain LB01 produced protease and cellulase enzymes. Two important antagonistic traits, siderophore production and solubilization of insoluble phosphate, were observed in the three B. atrophaeus strains. Analyses of disease suppression revealed that LB14 was most effective for suppressing the incidence of anthracnose symptoms on pepper fruits. LB14 produced antagonistic compounds and suppressed conidial germination of C. acutatum and C. gloeosporioides. The results from the present study will provide a basis for developing a reliable alternative to fungicides for anthracnose control.

Phyllosticta musarum Infection-Induced Defences Suppress Anthracnose Disease Caused by Colletotrichum musae in Banana Fruits cv ‘Embul’

Directory of Open Access Journals (Sweden)

C. L. Abayasekara

2013-03-01

Full Text Available Anthracnose development by Colletotrichum musae was observed to be significantly less in the fruits of the banana cultivar ‘Embul’ (Mysore, AAB infected with Phyllosticta musarum than in fruits without such infections. Anthracnose disease originates from quiescent C. musae infections in the immature fruit. P. musarum incites minute, scattered spots, referred to as freckles, in the superficial tissues of immature banana peel which do not expand during maturation or ripening. P. musarum does not appear to have a direct suppressive effect on C. musae as conidia of C. musae germinate on both freckled and non-freckled fruit forming quiescent infections. Our investigations have shown that P. musarum infection induced several defence responses in fruit including the accumulation of five phytoalexins, upregulation of chitinase and β-1,3-glucanase, phenylalanine ammonia lyase (PAL activity and cell wall lignification. ¹H and ¹³C NMR spectral data of one purified phytoalexin compared closely with 4′-hydroxyanigorufone. Some of the P. musarum-induced defences that retained during ripening, restrict C. musae development at the ripe stage. This paper examines the potential of P. musarum-induced defences, in the control of anthracnose, the most destructive postharvest disease in banana.

Proteomic analysis of bronchoalveolar lavage fluid proteins from mice infected with Francisella tularensis ssp novicida

Energy Technology Data Exchange (ETDEWEB)

Varnum, Susan M.; Webb-Robertson, Bobbie-Jo M.; Pounds, Joel G.; Moore, Ronald J.; Smith, Richard D.; Frevert, Charles; Skerret, Shawn J.; Wunschel, David S.

2012-07-06

Francisella tularensis causes the zoonosis tularemia in humans and is one of the most virulent bacterial pathogens. We utilized a global proteomic approach to characterize protein changes in bronchoalveolar lavage fluid from mice exposed to one of three organisms, F. tularensis ssp. novicida, an avirulent mutant of F. tularensis ssp. novicida (F.t. novicida-ΔmglA); and Pseudomonas aeruginosa. The composition of BALF proteins was altered following infection, including proteins involved in neutrophil activation, oxidative stress and inflammatory responses. Components of the innate immune response were induced including the acute phase response and the complement system, however the timing of their induction varied. Francisella tularensis ssp. novicida infected mice do not appear to have an effective innate immune response in the first hours of infection, however within 24 hours they show an upregulation of innate immune response proteins. This delayed response is in contrast to P. aeruginosa infected animals which show an early innate immune response. Likewise, F.t. novicida-ΔmglA infection initiates an early innate immune response, however this response is dimished by 24 hours. Finally, this study identifies several candidate biomarkers, including Chitinase 3-like-1 (CHI3L1 or YKL-40) and peroxiredoxin 1, that are associated with F. tularensis ssp. novicida but not P. aeruginosa infection.

Determination of lytic enzyme activities of indigenous Trichoderma isolates from Pakistan

Science.gov (United States)

Asad, Saeed Ahmad; Tabassum, Ayesha; Hameed, Abdul; Hassan, Fayyaz ul; Afzal, Aftab; Khan, Sabaz Ali; Ahmed, Rafiq; Shahzad, Muhammad

2015-01-01

Abstract This study investigated lytic enzyme activities in three indigenous Trichoderma strains namely, Trichoderma asperellum, Trichoderma harzianum and Trichoderma sp. Native Trichoderma strains and a virulent strain of Rhizoctonia solani isolated from infected bean plants were also included in the study. Enzyme activities were determined by measuring sugar reduction by dinitrosalicylic acid (DNS) method using suitable substrates. The antagonists were cultured in minimal salt medium with the following modifications: medium A (1 g of glucose), medium B (0.5 g of glucose + 0.5 g of deactivated R. solani mycelia), medium C (1.0 g of deactivated respective antagonist mycelium) and medium D (1 g of deactivated R. solani mycelia). T asperellum showed presence of higher amounts of chitinases, β-1, 3-glucanases and xylanases in extracellular protein extracts from medium D as compared to medium A. While, the higher activities of glucosidases and endoglucanses were shown in medium D extracts by T. harzianum. β-glucosidase activities were lower compared with other enzymes; however, activities of the extracts of medium D were significantly different. T. asperellum exhibited maximum inhibition (97.7%). On the other hand, Trichoderma sp. did not show any effect on mycelia growth of R. solani on crude extract. PMID:26691463

Comparative Genome Analysis of Enterobacter cloacae

Science.gov (United States)

Liu, Wing-Yee; Wong, Chi-Fat; Chung, Karl Ming-Kar; Jiang, Jing-Wei; Leung, Frederick Chi-Ching

2013-01-01

The Enterobacter cloacae species includes an extremely diverse group of bacteria that are associated with plants, soil and humans. Publication of the complete genome sequence of the plant growth-promoting endophytic E. cloacae subsp. cloacae ENHKU01 provided an opportunity to perform the first comparative genome analysis between strains of this dynamic species. Examination of the pan-genome of E. cloacae showed that the conserved core genome retains the general physiological and survival genes of the species, while genomic factors in plasmids and variable regions determine the virulence of the human pathogenic E. cloacae strain; additionally, the diversity of fimbriae contributes to variation in colonization and host determination of different E. cloacae strains. Comparative genome analysis further illustrated that E. cloacae strains possess multiple mechanisms for antagonistic action against other microorganisms, which involve the production of siderophores and various antimicrobial compounds, such as bacteriocins, chitinases and antibiotic resistance proteins. The presence of Type VI secretion systems is expected to provide further fitness advantages for E. cloacae in microbial competition, thus allowing it to survive in different environments. Competition assays were performed to support our observations in genomic analysis, where E. cloacae subsp. cloacae ENHKU01 demonstrated antagonistic activities against a wide range of plant pathogenic fungal and bacterial species. PMID:24069314

Hydrolysate from a mixture of legume flours with antifungal activity as an ingredient for prolonging the shelf-life of wheat bread.

Science.gov (United States)

Rizzello, Carlo Giuseppe; Verni, Michela; Bordignon, Stefano; Gramaglia, Valerio; Gobbetti, Marco

2017-06-01

Aiming at identifying antifungal compounds from plant matrices to be used as ingredients in the bakery industry, a water/salt-soluble extract (WSE) was produced from a legume enzyme hydrolysate, consisting of a mixture of pea, lentil, and faba bean flours, and assayed towards Penicillium roqueforti DPPMAF1. Agar diffusion assays allowed the selection of the optimal processing conditions for hydrolysis. As shown by hyphal radial growth rate, the inhibition was observed towards several fungi, including Aspergillus parasiticus CBS971.97, Penicillium carneum CBS 112297, Penicillium paneum CBS 101032, Penicillium polonicum 112490. A multi-step purification was carried out to identify the active compounds. The antifungal activity was attributed to native proteins (nsLTP, ubiquitin, lectin alpha-1 chain, wound-induced basic protein, defensin-1, defensin-2) and a mixture of peptides, which were released during hydrolysis. Nine peptides were purified and identified as sequences encrypted in legume vicilins, lectins and chitinases. WSE was used as ingredient for making bread under pilot plant conditions. Chemical, structural and sensory characterization of bread showed the lack of significant changes compared to control. The bread made with the legume hydrolysate had a longer shelf-life than that of the control. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Directory of Open Access Journals (Sweden)

Shutao Zhang

Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

A High Diversity in Chitinolytic and Chitosanolytic Species and Enzymes and Their Oligomeric Products Exist in Soil with a History of Chitin and Chitosan Exposure.

Science.gov (United States)

Nampally, Malathi; Rajulu, M B Govinda; Gillet, Dominique; Suryanarayanan, T S; Moerschbacher, Bruno B

2015-01-01

Chitin is one of the most abundant biomolecules on earth, and its partially de-N-acetylated counterpart, chitosan, is one of the most promising biotechnological resources due to its diversity in structure and function. Recently, chitin and chitosan modifying enzymes (CCMEs) have gained increasing interest as tools to engineer chitosans with specific functions and reliable performance in biotechnological and biomedical applications. In a search for novel CCME, we isolated chitinolytic and chitosanolytic microorganisms from soils with more than ten-years history of chitin and chitosan exposure and screened them for chitinase and chitosanase isoenzymes as well as for their patterns of oligomeric products by incubating their secretomes with chitosan polymers. Of the 60 bacterial strains isolated, only eight were chitinolytic and/or chitosanolytic, while 20 out of 25 fungal isolates were chitinolytic and/or chitosanolytic. The bacterial isolates produced rather similar patterns of chitinolytic and chitosanolytic enzymes, while the fungal isolates produced a much broader range of different isoenzymes. Furthermore, diverse mixtures of oligosaccharides were formed when chitosan polymers were incubated with the secretomes of select fungal species. Our study indicates that soils with a history of chitin and chitosan exposure are a good source of novel CCME for chitosan bioengineering.

Plastic degradation by thermophilic Bacillus sp. BCBT21 isolated from composting agricultural residual in Vietnam

Science.gov (United States)

Dang, Thi Cam Ha; Thang Nguyen, Dang; Thai, Hoang; Chinh Nguyen, Thuy; Thu Hien Tran, Thi; Le, Viet Hung; Huynh Nguyen, Van; Bach Tran, Xuan; Phuong Thao Pham, Thi; Giang Nguyen, Truong; Nguyen, Quang Trung

2018-03-01

Three different kinds of plastic bags HL, VHL, and VN1 with different chemical nature were degraded by a novel thermophilic bacterial strain isolated from composting agricultural residual in Vietnam in shaking liquid medium at 55 °C after 30 d. The new strain was classified in the Bacillus genus by morphological property and sequence of partial 16Sr RNA coding gene and named as Bacillus sp. BCBT21. This strain could produce extracellular hydrolase enzymes including lipase, CMCase, xylanase, chitinase, and protease with different level of activity in the same media. After a 30-d treatment at 55 °C with Bacillus sp. BCBT21, all characteristics including properties and morphology of treated plastic bags had been significantly changed. The weight loss, structure and surface morphology of these bags as well as the change in the average molecular weight of VHL bag were detected. Especially, the average molecular weight of VHL bag was significantly reduced from 205 000 to 116 760. New metabolites from the treated bags indicated biodegradation occurring with the different pathways. This finding suggests that there is high potential to develop an effective integrated method for plastic bags degradation by a combination of extracellular enzymes from bacteria and fungi existing in the composting process.

Selection of the N-acylhomoserine lactone-degrading bacterium Alteromonas stellipolaris PQQ-42 and of its potential for biocontrol in aquaculture

Directory of Open Access Journals (Sweden)

Marta eTorres

2016-05-01

Full Text Available The production of virulence factors by many pathogenic microorganisms depends on the intercellular communication system called quorum sensing (QS, which involves the production and release of signal molecules known as autoinducers. Based on this, new-therapeutic strategies have emerged for the treatment of a variety of infections, such as the enzymatic degradation of signalling molecules, known as quorum quenching (QQ. In this study, we present the screening of QQ activity amongst 450 strains isolated from a bivalve hatchery in Granada (Spain, and the selection of the strain PQQ-42, which degrades a wide range of N-acylhomoserine lactones (AHLs. The selected strain, identified as Alteromonas stellipolaris, degraded the accumulation of AHLs and reduced the production of protease and chitinase and swimming motility of a Vibrio species in co-cultivation experiments in vitro. In the bio-control experiment, strain PQQ-42 significantly reduced the pathogenicity of V. mediterranei VibC-Oc-097 upon the coral Oculina patagonica showing a lower degree of tissue damage (29.25±14.63 % in its presence, compared to when the coral was infected with V. mediterranei VibC-Oc-097 alone (77.53±13.22 %. Our results suggest that this AHL-degrading bacterium may have biotechnological applications in aquaculture.

High Morphologic Plasticity of Microglia/Macrophages Following Experimental Intracerebral Hemorrhage in Rats

Directory of Open Access Journals (Sweden)

Shu-Sheng Yang

2016-07-01

Full Text Available As current efforts have limited effects on the clinical outcome of intracerebral hemorrhage (ICH, the mechanisms including microglia/macrophages that involved inflammation need further investigation. Here, 0.4 units of collagenase VII were injected into the left caudate putamen (CPu to duplicate ICH rat models. In the brains of ICH rats, microglia/macrophages, the nearest cells to the hemorrhagic center, were observed as ameboid and Prussian-blue positive. Furthermore, the ameboid microglia/macrophages were differentiation (CD 68 and interleukin-1β (IL-1β positive, and neither CD206 nor chitinase3-like 3 (Ym1 positive, suggesting their strong abilities of phagocytosis and secretion of IL-1β. According to the distance to the hemorrhagic center, we selected four areas—I, II, III, and IV—to analyze the morphology of microglia/macrophages. The processes decreased successively from region I to region IV. Microglia/macrophages in region IV had no processes. The processes in region I were radially distributed, however, they showed obvious directivity towards the hemorrhagic center in regions II and III. Region III had the largest density of compactly arrayed microglia/macrophages. All these in vivo results present the high morphologic plasticity of microglia/macrophages and their functions in the pathogenesis of ICHs.

The complete sequence of the first Spodoptera frugiperda Betabaculovirus genome: a natural multiple recombinant virus.

Science.gov (United States)

Cuartas, Paola E; Barrera, Gloria P; Belaich, Mariano N; Barreto, Emiliano; Ghiringhelli, Pablo D; Villamizar, Laura F

2015-01-20

Spodoptera frugiperda (Lepidoptera: Noctuidae) is a major pest in maize crops in Colombia, and affects several regions in America. A granulovirus isolated from S. frugiperda (SfGV VG008) has potential as an enhancer of insecticidal activity of previously described nucleopolyhedrovirus from the same insect species (SfMNPV). The SfGV VG008 genome was sequenced and analyzed showing circular double stranded DNA of 140,913 bp encoding 146 putative ORFs that include 37 Baculoviridae core genes, 88 shared with betabaculoviruses, two shared only with betabaculoviruses from Noctuide insects, two shared with alphabaculoviruses, three copies of own genes (paralogs) and the other 14 corresponding to unique genes without representation in the other baculovirus species. Particularly, the genome encodes for important virulence factors such as 4 chitinases and 2 enhancins. The sequence analysis revealed the existence of eight homologous regions (hrs) and also suggests processes of gene acquisition by horizontal transfer including the SfGV VG008 ORFs 046/047 (paralogs), 059, 089 and 099. The bioinformatics evidence indicates that the genome donors of mentioned genes could be alpha- and/or betabaculovirus species. The previous reported ability of SfGV VG008 to naturally co-infect the same host with other virus show a possible mechanism to capture genes and thus improve its fitness.

Evaluating the Biodeterioration Enzymatic Activities of Fungal Contamination Isolated from Some Ancient Yemeni Mummies Preserved in the National Museum

Directory of Open Access Journals (Sweden)

Khalid Mohammed Naji

2014-01-01

Full Text Available Sophisticated mummification using chemical preservation was prevalent in ancient Yemeni civilization as noted in the 4th century B.C. mummies of the National Museum of Yemen, Sana’a, used in this study. Five of these mummies were used to evaluate hydrolytic enzymes produced as a result of fungal contamination. Forty-seven fungal species were isolated, thereby reflecting a high degree of contamination which may have resulted from the poor ventilation and preservation system. Aspergillus was the most common genus isolated (48.9%. Fifteen isolates exhibited ability to produce cellulase (EC; 3.2.1.4, Aspergillus candidus being the highest cellulose-producer. Pectin lyase (PL, EC; 4.2.2.2 and pectin methyl esterase (PME, EC; 3.1.1.11 were produced by Trichoderma hamatum, whereas chitinase (EC; 3.2.1.14 was produced by Aspergillus niger. Protease activity was noted by only Cladosporium herbarum. The higher activities of these fungal hydrolytic enzymes represent the major threats of biodeterioration including deteriorating linen bandages as well as the mummy bodies. Therefore, it is recommended to improve the preservation system of the mummies at the National Museum to minimize the contamination up to the lowest level and protect the mummies from biodeterioration.

Antifungal modes of action of Saccharomyces and other biocontrol yeasts against fungi isolated from sour and grey rots.

Science.gov (United States)

Nally, M C; Pesce, V M; Maturano, Y P; Rodriguez Assaf, L A; Toro, M E; Castellanos de Figueroa, L I; Vazquez, F

2015-07-02

The aim of this study was to determine the putative modes of action of 59 viticultural yeasts (31 Saccharomyces and 28 non-Saccharomyces) that inhibited fungi isolated from sour and grey rot in grapes. Inhibition of fungal mycelial growth by metabolites, enzyme activities (laminarinases, chitinases), antifungal volatiles, competition for nutrients (siderophores, Niche Overlap Index (NOI)), inhibition of fungal spore germination and decreased germinal tube length and induction of resistance were assayed. Biofungicide yeasts were classified into "antifungal patterns", according to their mechanisms of action. Thirty isolates presented at least two of the mechanisms assayed. We propose that inhibition of fungal mycelial growth by metabolites, laminarinases, competition for nutrients, inhibition of fungal spore germination and decreased germinal tube length, and antifungal volatiles by Saccharomyces and non-Saccharomyces viticultural yeasts is used as putative biocontrol mechanisms against phytopathogenic fungi. Twenty-four different antifungal patterns were identified. Siderophore production (N)and a combination of siderophore production and NOI>0.92 (M)were the most frequent antifungal patterns observed in the biofungicide yeasts assayed. Elucidation of these mechanisms could be useful for optimization of an inoculum formulation, resulting in a more consistent control of grey and sour rot with Saccharomyces and non-Saccharomyces biocontrol yeasts. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of antagonistic and plant growth promoting activities of chitinolytic endophytic actinomycetes associated with medicinal plants against Sclerotium rolfsii in chickpea.

Science.gov (United States)

Singh, S P; Gaur, R

2016-08-01

To evaluate the potential of chitinolytic endophytic Actinomycetes isolated from medicinal plants in order to diminish the collar rot infestation induced by Sclerotium rolfsii in chickpea. Sixty-eight chitinolytic endophytic Actinomycetes were recovered from various medicinal plants and evaluated for their chitinase activity. Among these isolates, 12 were screened for their plant growth promoting abilities and antagonistic potential against Sc. rolfsii. Further, these isolates were validated in vivo for their ability to protect chickpea against Sc. rolfsii infestation under greenhouse conditions. The isolates significantly (P plant mortality (42-75%) of chickpea. On the basis of 16S rDNA profiling, the selected antagonistic strains were identified as Streptomyces diastaticus, Streptomyces fradiae, Streptomyces olivochromogenes, Streptomyces collinus, Streptomyces ossamyceticus and Streptomyces griseus. This study is the first report of the isolation of endophytic Actinomycetes from various medicinal plants having antagonistic and plant growth promoting abilities. The isolated species showed potential for controlling collar rot disease on chickpea and could be useful in integrated control against diverse soil borne plant pathogens. Our investigation suggests that endophytic Actinomycetes associated with medicinal plants can be used as bioinoculants for developing safe, efficacious and environment-friendly biocontrol strategies in the near future. © 2016 The Society for Applied Microbiology.

Potential biochemical markers for selection of disease resistance in Vigna radiata

International Nuclear Information System (INIS)

Badere, R.S.; Koche, D.K.; Choudhary, A.D.; Pawar, S.E.

2001-01-01

The Vigna radiata (L.) Wilczek (Green gram), a major pulse crop is prone to damaging diseases caused by Erysiphe polygoni, Cercospora canescens and Rhizoctonia sp. Therefore, the development of multiple resistance is a major breeding objective in green gram. Resistance to powdery mildew has already been developed, however, there are no reports on the development of resistance to Cercospora in green gram. Owing to limitation of conventional screening methods, the improvement for multiple disease resistance is inadequate, in this crop. It needs an efficient and quick selection method, for screening the plant population at an early stage. It is well established that the resistant interaction, in plants, involves accumulation of antibiotic compound phytoalexin (Genestein in Vigna radiata) and induction of enzymes such as β-1,3 gulcanase and Chitinases. These compounds are not only induced by pathogens but also pathogen-derived elicitors. These biochemical compounds can be used as resistance indicative biochemical markers for screening the natural or mutagen induced genetic diversity in populations of Vigna radiata in non-destructive manner. It, however, needs a systematic study of plant defense response. This paper deals with the response of resistant and susceptible cultivars of vigna radiata to Cercospora elicitor and development of non-destructive selection method for disease resistance. (author)

A High Diversity in Chitinolytic and Chitosanolytic Species and Enzymes and Their Oligomeric Products Exist in Soil with a History of Chitin and Chitosan Exposure

Science.gov (United States)

Nampally, Malathi; Rajulu, M. B. Govinda; Gillet, Dominique; Suryanarayanan, T. S.; Moerschbacher, Bruno B.

2015-01-01

Chitin is one of the most abundant biomolecules on earth, and its partially de-N-acetylated counterpart, chitosan, is one of the most promising biotechnological resources due to its diversity in structure and function. Recently, chitin and chitosan modifying enzymes (CCMEs) have gained increasing interest as tools to engineer chitosans with specific functions and reliable performance in biotechnological and biomedical applications. In a search for novel CCME, we isolated chitinolytic and chitosanolytic microorganisms from soils with more than ten-years history of chitin and chitosan exposure and screened them for chitinase and chitosanase isoenzymes as well as for their patterns of oligomeric products by incubating their secretomes with chitosan polymers. Of the 60 bacterial strains isolated, only eight were chitinolytic and/or chitosanolytic, while 20 out of 25 fungal isolates were chitinolytic and/or chitosanolytic. The bacterial isolates produced rather similar patterns of chitinolytic and chitosanolytic enzymes, while the fungal isolates produced a much broader range of different isoenzymes. Furthermore, diverse mixtures of oligosaccharides were formed when chitosan polymers were incubated with the secretomes of select fungal species. Our study indicates that soils with a history of chitin and chitosan exposure are a good source of novel CCME for chitosan bioengineering. PMID:26273652