The Role of Co-chaperones in Synaptic Proteostasis and Neurodegenerative Disease

Directory of Open Access Journals (Sweden)

Erica L. Gorenberg

2017-05-01

Full Text Available Synapses must be preserved throughout an organism's lifespan to allow for normal brain function and behavior. Synapse maintenance is challenging given the long distances between the termini and the cell body, reliance on axonal transport for delivery of newly synthesized presynaptic proteins, and high rates of synaptic vesicle exo- and endocytosis. Hence, synapses rely on efficient proteostasis mechanisms to preserve their structure and function. To this end, the synaptic compartment has specific chaperones to support its functions. Without proper synaptic chaperone activity, local proteostasis imbalances lead to neurotransmission deficits, dismantling of synapses, and neurodegeneration. In this review, we address the roles of four synaptic chaperones in the maintenance of the nerve terminal, as well as their genetic links to neurodegenerative disease. Three of these are Hsp40 co-chaperones (DNAJs: Cysteine String Protein alpha (CSPα; DNAJC5, auxilin (DNAJC6, and Receptor-Mediated Endocytosis 8 (RME-8; DNAJC13. These co-chaperones contain a conserved J domain through which they form a complex with heat shock cognate 70 (Hsc70, enhancing the chaperone's ATPase activity. CSPα is a synaptic vesicle protein known to chaperone the t-SNARE SNAP-25 and the endocytic GTPase dynamin-1, thereby regulating synaptic vesicle exocytosis and endocytosis. Auxilin binds assembled clathrin cages, and through its interactions with Hsc70 leads to the uncoating of clathrin-coated vesicles, a process necessary for the regeneration of synaptic vesicles. RME-8 is a co-chaperone on endosomes and may have a role in clathrin-coated vesicle endocytosis on this organelle. These three co-chaperones maintain client function by preserving folding and assembly to prevent client aggregation, but they do not break down aggregates that have already formed. The fourth synaptic chaperone we will discuss is Heat shock protein 110 (Hsp110, which interacts with Hsc70, DNAJAs, and

Lactic acid induces aberrant amyloid precursor protein processing by promoting its interaction with endoplasmic reticulum chaperone proteins.

Directory of Open Access Journals (Sweden)

Yiwen Xiang

Full Text Available BACKGROUND: Lactic acid, a natural by-product of glycolysis, is produced at excess levels in response to impaired mitochondrial function, high-energy demand, and low oxygen availability. The enzyme involved in the production of β-amyloid peptide (Aβ of Alzheimer's disease, BACE1, functions optimally at lower pH, which led us to investigate a potential role of lactic acid in the processing of amyloid precursor protein (APP. METHODOLOGY/PRINCIPAL FINDINGS: Lactic acid increased levels of Aβ40 and 42, as measured by ELISA, in culture medium of human neuroblastoma cells (SH-SY5Y, whereas it decreased APP metabolites, such as sAPPα. In cell lysates, APP levels were increased and APP was found to interact with ER-chaperones in a perinuclear region, as determined by co-immunoprecipitation and fluorescence microscopy studies. Lactic acid had only a very modest effect on cellular pH, did increase the levels of ER chaperones Grp78 and Grp94 and led to APP aggregate formation reminiscent of aggresomes. CONCLUSIONS/SIGNIFICANCE: These findings suggest that sustained elevations in lactic acid levels could be a risk factor in amyloidogenesis related to Alzheimer's disease through enhanced APP interaction with ER chaperone proteins and aberrant APP processing leading to increased generation of amyloid peptides and APP aggregates.

The RNA splicing factor ASF/SF2 inhibits human topoisomerase I mediated DNA relaxation

DEFF Research Database (Denmark)

Andersen, Félicie Faucon; Tange, Thomas Ø.; Sinnathamby, Thayaline

2002-01-01

Human topoisomerase I interacts with and phosphorylates the SR-family of RNA splicing factors, including ASF/SF2, and has been suggested to play an important role in the regulation of RNA splicing. Here we present evidence to support the theory that the regulation can go the other way around...

Insight into the assembly of chaperones

Energy Technology Data Exchange (ETDEWEB)

May, R P [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); Stegmann, R; Manakova, E; Roessle, M; Hermann, T; Heumann, H [Max-Planck-Institut fuer Biochemie, Martinsried (Germany); Axmann, S; Plueckthun, A [Zurich Univ. (Switzerland); Wiedenmann, A [HMI, Berlin (Germany)

1997-04-01

Chaperones are proteins that help other proteins (substrate proteins) to acquire a `good` conformation. The folding is a dynamic process and involves repetitive binding and release of the chaperone components and of the substrate protein. Small-angle neutron scattering is used to investigate the structural changes that appear to happen during the folding process. (author). 2 refs.

Characterization of protein/ligand interactions by {sup 1}H/{sup 3}H exchange: application to the hAsf{sup 1}/ histone H{sup 3} complex; Caracterisation des interactions proteine / ligand par echange {sup 1}H/{sup 3}H: application au complexe entre la proteine hAsf{sup 1} et l'histone H{sup 3}

Energy Technology Data Exchange (ETDEWEB)

Mousseau, G

2007-05-15

In the first chapter will be exposed the main current methods of identification to high debit of the interactions protein-protein. Then the methods allowing to characterize the surfaces of interaction or to determine the structures of the complexes will be listed by discussing the main advantages and the inconveniences. Our approach of characterization of the zones of interaction protein-protein is a method of 'foot-printing' 1, based on the identification and radicals' quantification formed on the residues of proteins accessible to the water. The second chapter will so discuss the development of this method of radical identification using the atom of tritium as radioactive label. Our approach will finally be validated in the third chapter by applying it to the characterization of amino acids involved in the interaction enter the human protein anti silencing factor 1 (hAsf11-156) and a fragment of the histone H{sup 3}. (N.C.)

Estudo de misturas asf?lticas com res?duo de constru??o e demoli??o oriundo do munic?pio de Manaus-AM.

OpenAIRE

Melo, Diego Meneses de

2010-01-01

A disserta??o ora apresentada tem por objetivo realizar estudo sobre a utiliza??o de res?duos de constru??es e demoli??es (RCD) como agregado gra?do em concreto asf?ltico, buscando solu??o t?cnica e ambiental para a car?ncia hist?rica de agregados p?treos no munic?pio de Manaus-AM. A pesquisa exp?e caracter?sticas peculiares do material alternativo, comparando com o seixo rolado, elemento usual nas misturas asf?lticas utilizadas regionalmente. Realizouse a dosagem de uma mistur...

Chaperoning Roles of Macromolecules Interacting with Proteins in Vivo

Directory of Open Access Journals (Sweden)

Baik L. Seong

2011-03-01

Full Text Available The principles obtained from studies on molecular chaperones have provided explanations for the assisted protein folding in vivo. However, the majority of proteins can fold without the assistance of the known molecular chaperones, and little attention has been paid to the potential chaperoning roles of other macromolecules. During protein biogenesis and folding, newly synthesized polypeptide chains interact with a variety of macromolecules, including ribosomes, RNAs, cytoskeleton, lipid bilayer, proteolytic system, etc. In general, the hydrophobic interactions between molecular chaperones and their substrates have been widely believed to be mainly responsible for the substrate stabilization against aggregation. Emerging evidence now indicates that other features of macromolecules such as their surface charges, probably resulting in electrostatic repulsions, and steric hindrance, could play a key role in the stabilization of their linked proteins against aggregation. Such stabilizing mechanisms are expected to give new insights into our understanding of the chaperoning functions for de novo protein folding. In this review, we will discuss the possible chaperoning roles of these macromolecules in de novo folding, based on their charge and steric features.

The role of Vif oligomerization and RNA chaperone activity in HIV-1 replication.

Science.gov (United States)

Batisse, Julien; Guerrero, Santiago; Bernacchi, Serena; Sleiman, Dona; Gabus, Caroline; Darlix, Jean-Luc; Marquet, Roland; Tisné, Carine; Paillart, Jean-Christophe

2012-11-01

The viral infectivity factor (Vif) is essential for the productive infection and dissemination of HIV-1 in non-permissive cells that involve most natural HIV-1 target cells. Vif counteracts the packaging of two cellular cytidine deaminases named APOBEC3G (A3G) and A3F by diverse mechanisms including the recruitment of an E3 ubiquitin ligase complex and the proteasomal degradation of A3G/A3F, the inhibition of A3G mRNA translation or by a direct competition mechanism. In addition, Vif appears to be an active partner of the late steps of viral replication by participating in virus assembly and Gag processing, thus regulating the final stage of virion formation notably genomic RNA dimerization and by inhibiting the initiation of reverse transcription. Vif is a small pleiotropic protein with multiple domains, and recent studies highlighted the importance of Vif conformation and flexibility in counteracting A3G and in binding RNA. In this review, we will focus on the oligomerization and RNA chaperone properties of Vif and show that the intrinsic disordered nature of some Vif domains could play an important role in virus assembly and replication. Experimental evidence demonstrating the RNA chaperone activity of Vif will be presented. Copyright © 2012 Elsevier B.V. All rights reserved.

Interactive surface in the PapD chaperone cleft is conserved in pilus chaperone superfamily and essential in subunit recognition and assembly.

OpenAIRE

Slonim, L N; Pinkner, J S; Brändén, C I; Hultgren, S J

1992-01-01

The assembly of adhesive pili in Gram-negative bacteria is modulated by specialized periplasmic chaperone systems. PapD is the prototype member of the superfamily of periplasmic pilus chaperones. Previously, the alignment of chaperone sequences superimposed on the three dimensional structure of PapD revealed the presence of invariant, conserved and variable amino acids. Representative residues that protruded into the PapD cleft were targeted for site directed mutagenesis to investigate the pi...

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Directory of Open Access Journals (Sweden)

Tomohisa Mori

Full Text Available The membrane of the endoplasmic reticulum (ER of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Sigma-1 receptor chaperone at the ER-mitochondrion interface mediates the mitochondrion-ER-nucleus signaling for cellular survival.

Science.gov (United States)

Mori, Tomohisa; Hayashi, Teruo; Hayashi, Eri; Su, Tsung-Ping

2013-01-01

The membrane of the endoplasmic reticulum (ER) of a cell forms contacts directly with mitochondria whereby the contact is referred to as the mitochondrion-associated ER membrane or the MAM. Here we found that the MAM regulates cellular survival via an MAM-residing ER chaperone the sigma-1 receptor (Sig-1R) in that the Sig-1R chaperones the ER stress sensor IRE1 to facilitate inter-organelle signaling for survival. IRE1 is found in this study to be enriched at the MAM in CHO cells. We found that IRE1 is stabilized at the MAM by Sig-1Rs when cells are under ER stress. Sig-1Rs stabilize IRE1 and thus allow for conformationally correct IRE1 to dimerize into the long-lasting, activated endonuclease. The IRE1 at the MAM also responds to reactive oxygen species derived from mitochondria. Therefore, the ER-mitochondrion interface serves as an important subcellular entity in the regulation of cellular survival by enhancing the stress-responding signaling between mitochondria, ER, and nucleus.

Chaperones ameliorate beta cell dysfunction associated with human islet amyloid polypeptide overexpression.

Directory of Open Access Journals (Sweden)

Lisa Cadavez

Full Text Available In type 2 diabetes, beta-cell dysfunction is thought to be due to several causes, one being the formation of toxic protein aggregates called islet amyloid, formed by accumulations of misfolded human islet amyloid polypeptide (hIAPP. The process of hIAPP misfolding and aggregation is one of the factors that may activate the unfolded protein response (UPR, perturbing endoplasmic reticulum (ER homeostasis. Molecular chaperones have been described to be important in regulating ER response to ER stress. In the present work, we evaluate the role of chaperones in a stressed cellular model of hIAPP overexpression. A rat pancreatic beta-cell line expressing hIAPP exposed to thapsigargin or treated with high glucose and palmitic acid, both of which are known ER stress inducers, showed an increase in ER stress genes when compared to INS1E cells expressing rat IAPP or INS1E control cells. Treatment with molecular chaperone glucose-regulated protein 78 kDa (GRP78, also known as BiP or protein disulfite isomerase (PDI, and chemical chaperones taurine-conjugated ursodeoxycholic acid (TUDCA or 4-phenylbutyrate (PBA, alleviated ER stress and increased insulin secretion in hIAPP-expressing cells. Our results suggest that the overexpression of hIAPP induces a stronger response of ER stress markers. Moreover, endogenous and chemical chaperones are able to ameliorate induced ER stress and increase insulin secretion, suggesting that improving chaperone capacity can play an important role in improving beta-cell function in type 2 diabetes.

A study for the structural and functional regulation of chaperon protein by radiation

International Nuclear Information System (INIS)

Lee, Seung Sik; Chung, Byung Yeoup; Kim, Jin Hong

2011-01-01

The purpose of the this project provides new application areas for radiation technology for improvement of protein activities using radiation through the structural changes and functional regulations of molecular chaperon. Research scope includes 1) isolation of molecular chaperon proteins related radiation response from Psedomonads and purification of recombinant protein from E. coli., 2) the establishment of effective irradiation dose for the structural changes of chaperon protein, 3) analysis of the structural and functional changes of molecular chaperon by gamma irradiation. Main results are as follow: the chaperon activities of 2-Cys peroxiredxin show the maximum (about 3 times) at 15-30 kGy of gamma irradiation, but they were reduced greater than 30 kGy of gamma rays: the peroxidase activities show a tendency to decrease with increasing gamma irradiation: the structural change of peroxiredoxin (PP1084 and PA3529) by gamma irradiation (the formation of low molecular weight complexes or fragmentation of peroxiredoxin by gamma irradiation, the increase of beta-sheet and random coil by gamma irradiation and the decrease of alpha-helix and turn by gamma irradiation, and increased chaperon activity is related with increased hydrophobicity)

Progranulin acts as a shared chaperone and regulates multiple lysosomal enzymes

Directory of Open Access Journals (Sweden)

Jinlong Jian

2017-09-01

Full Text Available Multifunctional factor progranulin (PGRN plays an important role in lysosomes, and its mutations and insufficiency are associated with lysosomal storage diseases, including neuronal ceroid lipofuscinosis and Gaucher disease (GD. The first breakthrough in understanding the molecular mechanisms of PGRN as regulator of lysosomal storage diseases came unexpectedly while investigating the role of PGRN in inflammation. Challenged PGRN null mice displayed typical features of GD. In addition, GRN gene variants were identified in GD patients and the serum levels of PGRN were significantly lower in GD patients. PGRN directly binds to and functions as a chaperone of the lysosomal enzyme β-glucocerebrosidase (GCaase, whose mutations cause GD. In addition, its C-terminus containing granulin E domain, termed Pcgin (PGRN C-terminus for GCase Interaction, is required for the association between PGRN and GCase. The concept that PGRN acts as a chaperone of lysosomal enzymes was further supported and extended by a recent article showing that PGRN acts as a chaperone molecule of lysosomal enzyme cathepsin D (CSTD, and the association between PGRN and CSTD is also mediated by PGRN's C-terminal granulin E domain. Collectively, these reports suggest that PGRN may act as a shared chaperone and regulates multiple lysosomal enzymes.

Estudio experimental de microaglomerado asfáltico antiderrapante modificado con NFU

OpenAIRE

Botasso, Gerardo; Segura, Adrián

2013-01-01

Dadas las actuales mayores velocidades de circulación en vías urbanas y rurales, tipologías de vehículos y aumento de accidentes por excesos de velocidad, son necesarios nuevos diseños de mezclas asfálticas que permitan mayor adherencia neumático calzada y mejor evacuación del agua de la calzada para así disminuir las distancias de frenado. Para tal fin se ha considerado utilizar micromezclas en caliente en donde, a efectos de garantizar una adecuada macro y microtextura, se otorgan discontin...

Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

Science.gov (United States)

Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

2016-05-01

The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

FKBP immunophilins and Alzheimer's disease: A chaperoned affair

Indian Academy of Sciences (India)

2011-07-08

Jul 8, 2011 ... FKBP immunophilins and Alzheimer's disease: A chaperoned affair. Weihuan Cao Mary ... Keywords. Alzheimer's disease; amyloid precursor protein; beta amyloid; FKBP; FK506; immunophilins; tau ... 43 | Issue 1. March 2018.

Coupling mechanisms between nucleosome assembly and the cellular response to DNA damage

International Nuclear Information System (INIS)

Lautrette, Aurelie

2006-01-01

Cells are continuously exposed to genotoxic stresses that induce a variety of DNA lesions. To protect their genome, cells have specific pathways that orchestrate the detection, signaling and repair of DNA damages. This work is dedicated to the characterization of such pathways that couple the DNA damage response to the assembly of chromatin, a complex that protects and regulates DNA accessibility. We have focused our study on two multifunctional proteins: Rad53, a central checkpoint kinase in the cellular response to DNA damage and Asf1, a histone chaperone involved in chromatin assembly. We have characterized in vitro the binding mode of Asf1 with Rad53 and Asfl with histones. This study is associated with the functional analysis of the role of these interactions in vivo in yeast cells. (author) [fr

Endoplasmic reticulum proteins SDF2 and SDF2L1 act as components of the BiP chaperone cycle to prevent protein aggregation.

Science.gov (United States)

Fujimori, Tsutomu; Suno, Ryoji; Iemura, Shun-Ichiro; Natsume, Tohru; Wada, Ikuo; Hosokawa, Nobuko

2017-08-01

The folding of newly synthesized proteins in the endoplasmic reticulum (ER) is assisted by ER-resident chaperone proteins. BiP (immunoglobulin heavy-chain-binding protein), a member of the HSP70 family, plays a central role in protein quality control. The chaperone function of BiP is regulated by its intrinsic ATPase activity, which is stimulated by ER-resident proteins of the HSP40/DnaJ family, including ERdj3. Here, we report that two closely related proteins, SDF2 and SDF2L1, regulate the BiP chaperone cycle. Both are ER-resident, but SDF2 is constitutively expressed, whereas SDF2L1 expression is induced by ER stress. Both luminal proteins formed a stable complex with ERdj3 and potently inhibited the aggregation of different types of misfolded ER cargo. These proteins associated with non-native proteins, thus promoting the BiP-substrate interaction cycle. A dominant-negative ERdj3 mutant that inhibits the interaction between ERdj3 and BiP prevented the dissociation of misfolded cargo from the ERdj3-SDF2L1 complex. Our findings indicate that SDF2 and SDF2L1 associate with ERdj3 and act as components in the BiP chaperone cycle to prevent the aggregation of misfolded proteins, partly explaining the broad folding capabilities of the ER under various physiological conditions. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Chaperone-like properties of tobacco plastid thioredoxins f and m

Science.gov (United States)

Sanz-Barrio, Ruth; Fernández-San Millán, Alicia; Carballeda, Jon; Corral-Martínez, Patricia; Seguí-Simarro, José M.; Farran, Inmaculada

2012-01-01

Thioredoxins (Trxs) are ubiquitous disulphide reductases that play important roles in the redox regulation of many cellular processes. However, some redox-independent functions, such as chaperone activity, have also been attributed to Trxs in recent years. The focus of our study is on the putative chaperone function of the well-described plastid Trxs f and m. To that end, the cDNA of both Trxs, designated as NtTrxf and NtTrxm, was isolated from Nicotiana tabacum plants. It was found that bacterially expressed tobacco Trx f and Trx m, in addition to their disulphide reductase activity, possessed chaperone-like properties. In vitro, Trx f and Trx m could both facilitate the reactivation of the cysteine-free form of chemically denatured glucose-6 phosphate dehydrogenase (foldase chaperone activity) and prevent heat-induced malate dehydrogenase aggregation (holdase chaperone activity). Our results led us to infer that the disulphide reductase and foldase chaperone functions prevail when the proteins occur as monomers and the well-conserved non-active cysteine present in Trx f is critical for both functions. By contrast, the holdase chaperone activity of both Trxs depended on their oligomeric status: the proteins were functional only when they were associated with high molecular mass protein complexes. Because the oligomeric status of both Trxs was induced by salt and temperature, our data suggest that plastid Trxs could operate as molecular holdase chaperones upon oxidative stress, acting as a type of small stress protein. PMID:21948853

Pharmacological chaperoning: a primer on mechanism and pharmacology.

Science.gov (United States)

Leidenheimer, Nancy J; Ryder, Katelyn G

2014-05-01

Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

The FKBP51 Glucocorticoid Receptor Co-Chaperone: Regulation, Function, and Implications in Health and Disease.

Science.gov (United States)

Fries, Gabriel R; Gassen, Nils C; Rein, Theo

2017-12-05

Among the chaperones and co-chaperones regulating the glucocorticoid receptor (GR), FK506 binding protein (FKBP) 51 is the most intensely investigated across different disciplines. This review provides an update on the role of the different co-chaperones of Hsp70 and Hsp90 in the regulation of GR function. The development leading to the focus on FKBP51 is outlined. Further, a survey of the vast literature on the mechanism and function of FKBP51 is provided. This includes its structure and biochemical function, its regulation on different levels-transcription, post-transcription, and post-translation-and its function in signaling pathways. The evidence portraying FKBP51 as a scaffolding protein organizing protein complexes rather than a chaperone contributing to the folding of individual proteins is collated. Finally, FKBP51's involvement in physiology and disease is outlined, and the promising efforts in developing drugs targeting FKBP51 are discussed.

Mitochondrial Chaperones in the Brain: Safeguarding Brain Health and Metabolism?

Directory of Open Access Journals (Sweden)

José Pedro Castro

2018-04-01

Full Text Available The brain orchestrates organ function and regulates whole body metabolism by the concerted action of neurons and glia cells in the central nervous system. To do so, the brain has tremendously high energy consumption and relies mainly on glucose utilization and mitochondrial function in order to exert its function. As a consequence of high rate metabolism, mitochondria in the brain accumulate errors over time, such as mitochondrial DNA (mtDNA mutations, reactive oxygen species, and misfolded and aggregated proteins. Thus, mitochondria need to employ specific mechanisms to avoid or ameliorate the rise of damaged proteins that contribute to aberrant mitochondrial function and oxidative stress. To maintain mitochondria homeostasis (mitostasis, cells evolved molecular chaperones that shuttle, refold, or in coordination with proteolytic systems, help to maintain a low steady-state level of misfolded/aggregated proteins. Their importance is exemplified by the occurrence of various brain diseases which exhibit reduced action of chaperones. Chaperone loss (expression and/or function has been observed during aging, metabolic diseases such as type 2 diabetes and in neurodegenerative diseases such as Alzheimer’s (AD, Parkinson’s (PD or even Huntington’s (HD diseases, where the accumulation of damage proteins is evidenced. Within this perspective, we propose that proper brain function is maintained by the joint action of mitochondrial chaperones to ensure and maintain mitostasis contributing to brain health, and that upon failure, alter brain function which can cause metabolic diseases.

Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone

Energy Technology Data Exchange (ETDEWEB)

Barta, Michael L.; Zhang, Lingling; Picking, Wendy L.; Geisbrecht, Brian V. (UMKC); (OKLU)

2010-10-05

Type III secretion systems are a common virulence mechanism in many Gram-negative bacterial pathogens. These systems use a nanomachine resembling a molecular needle and syringe to provide an energized conduit for the translocation of effector proteins from the bacterial cytoplasm to the host cell cytoplasm for the benefit of the pathogen. Prior to translocation specialized chaperones maintain proper effector protein conformation. The class II chaperone, Invasion plasmid gene (Ipg) C, stabilizes two pore forming translocator proteins. IpgC exists as a functional dimer to facilitate the mutually exclusive binding of both translocators. In this study, we present the 3.3 {angstrom} crystal structure of an amino-terminally truncated form (residues 10-155, denoted IpgC10-155) of the class II chaperone IpgC from Shigella flexneri. Our structure demonstrates an alternative quaternary arrangement to that previously described for a carboxy-terminally truncated variant of IpgC (IpgC{sup 1-151}). Specifically, we observe a rotationally-symmetric 'head-to-head' dimerization interface that is far more similar to that previously described for SycD from Yersinia enterocolitica than to IpgC1-151. The IpgC structure presented here displays major differences in the amino terminal region, where extended coil-like structures are seen, as opposed to the short, ordered alpha helices and asymmetric dimerization interface seen within IpgC{sup 1-151}. Despite these differences, however, both modes of dimerization support chaperone activity, as judged by a copurification assay with a recombinant form of the translocator protein, IpaB. Conclusions: From primary to quaternary structure, these results presented here suggest that a symmetric dimerization interface is conserved across bacterial class II chaperones. In light of previous data which have described the structure and function of asymmetric dimerization, our results raise the possibility that class II chaperones may

An overview on molecular chaperones enhancing solubility of expressed recombinant proteins with correct folding.

Science.gov (United States)

Mamipour, Mina; Yousefi, Mohammadreza; Hasanzadeh, Mohammad

2017-09-01

The majority of research topics declared that most of the recombinant proteins have been expressed by Escherichia coli in basic investigations. But the majority of high expressed proteins formed as inactive recombinant proteins that are called inclusion body. To overcome this problem, several methods have been used including suitable promoter, environmental factors, ladder tag to secretion of proteins into the periplasm, gene protein optimization, chemical chaperones and molecular chaperones sets. Co-expression of the interest protein with molecular chaperones is one of the common methods The chaperones are a group of proteins, which are involved in making correct folding of recombinant proteins. Chaperones are divided two groups including; cytoplasmic and periplasmic chaperones. Moreover, periplasmic chaperones and proteases can be manipulated to increase the yields of secreted proteins. In this article, we attempted to review cytoplasmic chaperones such as Hsp families and periplasmic chaperones including; generic chaperones, specialized chaperones, PPIases, and proteins involved in disulfide bond formation. Copyright © 2017 Elsevier B.V. All rights reserved.

Current trends in chaperone use by plastic and reconstructive surgeons.

Science.gov (United States)

Choudry, Umar; Barta, Ruth J; Kim, Nicholas

2013-06-01

There is a paucity of literature regarding the use of chaperones by surgeons when examining patients. Use of a chaperone not only makes the patient comfortable but also potentially protects the surgeon from perceived misconduct. This is especially true for plastic surgeons who examine sensitive areas commonly. The purpose of this study was to determine the current trends in chaperone use by plastic surgeons when examining patients. A 23-question online survey was sent to all members of the American Society of Plastic Surgeons. Data collected online were analyzed using Student t test and Pearson χ test. A P use by plastic surgeons during all examinations of patients was 30%. This rate increased up to 60% while examining sensitive areas. Male surgeons reported a higher frequency of chaperone use than female surgeons (P use compared to reconstructive surgeons (P = 0.001). Similarly, surgeons who had been in practice for more than 20 years reported a higher rate of chaperone use compared to surgeons in practice for less than 20 years (P = 0.032). Sixty-one (7.6%; 56 male and 5 female) surgeons reported being accused of inappropriate behavior by patients, of whom 49 (80%) did not have a chaperone present. There was no significant difference among male and female surgeons in rates of being accused of inappropriate behavior (7.9% vs 4.2%, P = 0.19). There was a higher rate of chaperone use by male plastic surgeons, surgeons with more than 20 years experience, and cosmetic surgeons. Despite the difference in chaperone use between the sexes, both had similar rates of being accused of inappropriate behavior during examinations by patients, and although these incidents were quite low, most had no chaperone present during those examinations.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2012-02-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

The use of a chaperone in obstetrical and gynaecological practice.

LENUS (Irish Health Repository)

Afaneh, I

2010-05-01

The aim of this study was to assess the use of a chaperone in obstetrical and gynaecological practice in Ireland and to explore patients\\' opinions. Two questionnaires were designed; one for patients and the other one was sent to 145 gynaecologists in Ireland. One hundred and fifty two women took part in this survey of whom 74 were gynaecological and 78 were obstetric patients. Ninety five (65%) patients felt no need for a chaperone during a vaginal examination (VE) by a male doctor. On the other hand 34 (23%) participating women would request a chaperone if being examined by a female doctor. Among clinicians 116 (80%) responded by returning the questionnaire. Overall 60 (52%) always used a chaperone in public practice, in contrast to 24 (27%) in private practice. The study demonstrated that most patients do not wish to have a chaperone during a VE but a small proportion would still request one regardless of the examiner\\'s gender. Patients should be offered the choice of having a chaperone and their opinion should be respected and documented.

Antiferromagnetism in the organic conductor bis-tetramethyltetraselenafulvalene hexafluoroarsenate [(TMTSF)2AsF6]: Static magnetic susceptibility

DEFF Research Database (Denmark)

Mortensen, Kell; Tomkiewicz, Yaffa; Bechgaard, Klaus

1982-01-01

The anisotropy in the static magnetic susceptibility of bis-tetramethyltetraselenafulvalene hexafluoroarsenate [(TMTSF)2AsF6] has been investigated above and below the metal-to-insulator transition for a range of fields between 0.5 and 30 kG. The results are consistent with the expectations of a ...

Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β.

Science.gov (United States)

Roundhill, Elizabeth; Turnbull, Doug; Burchill, Susan

2016-05-01

Overexpression of plasma membrane multidrug resistance-associated protein 1 (MRP-1) in Ewing's sarcoma (ES) predicts poor outcome. MRP-1 is also expressed in mitochondria, and we have examined the submitochondrial localization of MRP-1 and investigated the mechanism of MRP-1 transport and role of this organelle in the response to doxorubicin. The mitochondrial localization of MRP-1 was examined in ES cell lines by differential centrifugation and membrane solubilization by digitonin. Whether MRP-1 is chaperoned by heat shock proteins (HSPs) was investigated by immunoprecipitation, immunofluorescence microscopy, and HSP knockout using small hairpin RNA and inhibitors (apoptozole, 17-AAG, and NVPAUY). The effect of disrupting mitochondrial MRP-1-dependent efflux activity on the cytotoxic effect of doxorubicin was investigated by counting viable cell number. Mitochondrial MRP-1 is glycosylated and localized to the outer mitochondrial membrane, where it is coexpressed with HSP90. MRP-1 binds to both HSP90 and HSP70, although only inhibition of HSP90β decreases expression of MRP-1 in the mitochondria. Disruption of mitochondrial MRP-1-dependent efflux significantly increases the cytotoxic effect of doxorubicin (combination index, MRP-1 is expressed in the outer mitochondrial membrane and is a client protein of HSP90β, where it may play a role in the doxorubicin-induced resistance of ES.-Roundhill, E., Turnbull, D., Burchill, S. Localization of MRP-1 to the outer mitochondrial membrane by the chaperone protein HSP90β. © FASEB.

Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

Science.gov (United States)

Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

2012-03-01

Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

Engineered disulfide bonds restore chaperone-like function of DJ-1 mutants linked to familial Parkinson's disease.

Science.gov (United States)

Logan, Todd; Clark, Lindsay; Ray, Soumya S

2010-07-13

Loss-of-function mutations such as L166P, A104T, and M26I in the DJ-1 gene (PARK7) have been linked to autosomal-recessive early onset Parkinson's disease (PD). Cellular and structural studies of the familial mutants suggest that these mutations may destabilize the dimeric structure. To look for common dynamical signatures among the DJ-1 mutants, short MD simulations of up to 1000 ps were conducted to identify the weakest region of the protein (residues 38-70). In an attempt to stabilize the protein, we mutated residue Val 51 to cysteine (V51C) to make a symmetry-related disulfide bridge with the preexisting Cys 53 on the opposite subunit. We found that the introduction of this disulfide linkage stabilized the mutants A104T and M26I against thermal denaturation, improved their ability to scavenge reactive oxygen species (ROS), and restored a chaperone-like function of blocking alpha-synuclein aggregation. The L166P mutant was far too unstable to be rescued by introduction of the V51C mutation. The results presented here point to the possible development of pharmacological chaperones, which may eventually lead to PD therapeutics.

Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

Science.gov (United States)

Sporn, Zachary A; Hines, Justin K

2015-01-01

Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

Applying chaperones to protein-misfolding disorders: molecular chaperones against α-synuclein in Parkinson's disease.

Science.gov (United States)

Chaari, Ali; Hoarau-Véchot, Jessica; Ladjimi, Moncef

2013-09-01

Parkinson's disease (PD) is a neurodegenerative disorder characterized by the accumulation of a protein called α-synuclein (α-syn) into inclusions known as lewy bodies (LB) within neurons. This accumulation is also due to insufficient formation and activity of dopamine produced in certain neurons within the substantia nigra. Lewy bodies are the pathological hallmark of the idiopathic disorder and the cascade that allows α-synuclein to misfold, aggregate and form these inclusions has been the subject of intensive research. Targeting these early steps of oligomerization is one of the main therapeutic approaches in order to develop neurodegenerative-modifying agents. Because the folding and refolding of alpha synuclein is the key point of this cascade, we are interested in this review to summarize the role of some molecular chaperones proteins such as Hsp70, Hsp90 and small heat shock proteins (sHsp) and Hsp 104. Hsp70 and its co-chaperone, Hsp70 and small heat shock proteins can prevent neurodegeneration by preventing α-syn misfolding, oligomerization and aggregation in vitro and in Parkinson disease animal models. Hsp104 is able to resolve disordered protein aggregates and cross beta amyloid conformers. Together, these chaperones have a complementary effect and can be a target for therapeutic intervention in PD. Published by Elsevier B.V.

The Malarial Exported PFA0660w Is an Hsp40 Co-Chaperone of PfHsp70-x.

Directory of Open Access Journals (Sweden)

Michael O Daniyan

Full Text Available Plasmodium falciparum, the human pathogen responsible for the most dangerous malaria infection, survives and develops in mature erythrocytes through the export of proteins needed for remodelling of the host cell. Molecular chaperones of the heat shock protein (Hsp family are prominent members of the exportome, including a number of Hsp40s and a Hsp70. PFA0660w, a type II Hsp40, has been shown to be exported and possibly form a complex with PfHsp70-x in the infected erythrocyte cytosol. However, the chaperone properties of PFA0660w and its interaction with human and parasite Hsp70s are yet to be investigated. Recombinant PFA0660w was found to exist as a monomer in solution, and was able to significantly stimulate the ATPase activity of PfHsp70-x but not that of a second plasmodial Hsp70 (PfHsp70-1 or a human Hsp70 (HSPA1A, indicating a potential specific functional partnership with PfHsp70-x. Protein binding studies in the presence and absence of ATP suggested that the interaction of PFA0660w with PfHsp70-x most likely represented a co-chaperone/chaperone interaction. Also, PFA0660w alone produced a concentration-dependent suppression of rhodanese aggregation, demonstrating its chaperone properties. Overall, we have provided the first biochemical evidence for the possible role of PFA0660w as a chaperone and as co-chaperone of PfHsp70-x. We propose that these chaperones boost the chaperone power of the infected erythrocyte, enabling successful protein trafficking and folding, and thereby making a fundamental contribution to the pathology of malaria.

Chaperones and the Proteasome System: Regulating the Construction and Demolition of Striated Muscle

Directory of Open Access Journals (Sweden)

Casey Carlisle

2017-12-01

Full Text Available Protein folding factors (chaperones are required for many diverse cellular functions. In striated muscle, chaperones are required for contractile protein function, as well as the larger scale assembly of the basic unit of muscle, the sarcomere. The sarcomere is complex and composed of hundreds of proteins and the number of proteins and processes recognized to be regulated by chaperones has increased dramatically over the past decade. Research in the past ten years has begun to discover and characterize the chaperones involved in the assembly of the sarcomere at a rapid rate. Because of the dynamic nature of muscle, wear and tear damage is inevitable. Several systems, including chaperones and the ubiquitin proteasome system (UPS, have evolved to regulate protein turnover. Much of our knowledge of muscle development focuses on the formation of the sarcomere but recent work has begun to elucidate the requirement and role of chaperones and the UPS in sarcomere maintenance and disease. This review will cover the roles of chaperones in sarcomere assembly, the importance of chaperone homeostasis and the cooperation of chaperones and the UPS in sarcomere integrity and disease.

1H, 15N and 13C resonance assignments of the J-domain of co-chaperone Sis1 from Saccharomyces cerevisiae.

Science.gov (United States)

Pinheiro, Glaucia M S; Amorim, Gisele C; Iqbal, Anwar; Ramos, C H I; Almeida, Fabio C L

2018-04-30

Protein folding in the cell is usually aided by molecular chaperones, from which the Hsp70 (Hsp = heat shock protein) family has many important roles, such as aiding nascent folding and participating in translocation. Hsp70 has ATPase activity which is stimulated by binding to the J-domain present in co-chaperones from the Hsp40 family. Hsp40s have many functions, as for instance the binding to partially folded proteins to be delivered to Hsp70. However, the presence of the J-domain characterizes Hsp40s or, by this reason, as J-proteins. The J-domain alone can stimulate Hsp70 ATPase activity. Apparently, it also maintains the same conformation as in the whole protein although structural information on full J-proteins is still missing. This work reports the 1 H, 15 N and 13 C resonance assignments of the J-domain of a Hsp40 from Saccharomyces cerevisiae, named Sis1. Secondary structure and order parameter prediction from chemical shifts are also reported. Altogether, the data show that Sis1 J-domain is highly structured and predominantly formed by α-helices, results that are in very good agreement with those previously reported for the crystallographic structure.

Investigation of certain physical–chemical features of oil recovery by an optimized alkali–surfactant–foam (ASF) system

NARCIS (Netherlands)

Hosseini Nasab, S.M.; Zitha, P.L.J.

2017-01-01

The objective of this study is to discover a synergistic effect between foam stability in bulk and micro-emulsion phase behaviour to design a high-performance chemical system for an optimized alkaline–surfactant–foam (ASF) flooding for enhanced oil recovery (EOR). The focus is on the interaction

Polímeros como modificadores asfálticos

Directory of Open Access Journals (Sweden)

Letícia SocaI da Silva

2009-12-01

Full Text Available

Neste trabalho foram preparadas diferentes misturas de ligante asfáltico modificado com polímeros. Foram utilizadas quatro amostras de polímeros, sendo duas de SBS, uma de SEBS e uma de Polietileno Modificado, as quais foram caracterizadas quanto a sua estrutura e propriedades térmicas através de técnicas de Ressonância Magnética Nuclear (RMN, Cromatografia por Permeação a Gel (GPC, Análise Termogravimétrica (TGA e Calorimetria Diferencial de Varredura (DSC. O ligante modificado foi avaliado quanto a sua viscosidade, retorno elástico, comportamento reológico e estabilidade à estocagem. Foram correlacionadas a estrutura química e as transições térmicas dos polímeros com as características do ligante modificado. Os polímeros do tipo SBS foram os melhores modificadores de asfalto, quando comparado com os demais polímeros avaliados.

Chaperone use during intimate examinations in primary care: postal survey of family physicians

Directory of Open Access Journals (Sweden)

Upshur Ross EG

2005-12-01

Full Text Available Abstract Background Physicians have long been advised to have a third party present during certain parts of a physical examination; however, little is known about the frequency of chaperone use for those specific intimate examinations regularly performed in primary care. We aimed to determine the frequency of chaperone use among family physicians across a variety of intimate physical examinations for both male and female patients, and also to identify the factors associated with chaperone use. Methods Questionnaires were mailed to a randomly selected sample of 500 Ontario members of the College of Family Physicians of Canada. Participants were asked about their use of chaperones when performing a variety of intimate examinations, namely female pelvic, breast, and rectal exams and male genital and rectal exams. Results 276 of 500 were returned (56%, of which 257 were useable. Chaperones were more commonly used with female patients than with males (t = 9.09 [df = 249], p Conclusion Clinical practice concerning the use of chaperones during intimate exams continues to be discordant with the recommendations of medical associations and medico-legal societies. Chaperones are used by only a minority of Ontario family physicians. Chaperone use is higher for examinations of female patients than of male patients and is highest for female pelvic exams. The availability of a nurse in the clinic to act as a chaperone is associated with more frequent use of chaperones.

The fragile X mental retardation protein has nucleic acid chaperone properties.

Science.gov (United States)

Gabus, Caroline; Mazroui, Rachid; Tremblay, Sandra; Khandjian, Edouard W; Darlix, Jean-Luc

2004-01-01

The fragile X syndrome is the most common cause of inherited mental retardation resulting from the absence of the fragile X mental retardation protein (FMRP). FMRP contains two K-homology (KH) domains and one RGG box that are landmarks characteristic of RNA-binding proteins. In agreement with this, FMRP associates with messenger ribonucleoparticles (mRNPs) within actively translating ribosomes, and is thought to regulate translation of target mRNAs, including its own transcript. To investigate whether FMRP might chaperone nucleic acid folding and hybridization, we analysed the annealing and strand exchange activities of DNA oligonucleotides and the enhancement of ribozyme-directed RNA substrate cleavage by FMRP and deleted variants relative to canonical nucleic acid chaperones, such as the cellular YB-1/p50 protein and the retroviral nucleocapsid protein HIV-1 NCp7. FMRP was found to possess all the properties of a potent nucleic acid chaperone, requiring the KH motifs and RGG box for optimal activity. These findings suggest that FMRP may regulate translation by acting on RNA-RNA interactions and thus on the structural status of mRNAs.

Multiscale modeling of a conditionally disordered pH-sensing chaperone.

Science.gov (United States)

Ahlstrom, Logan S; Law, Sean M; Dickson, Alex; Brooks, Charles L

2015-04-24

The pH-sensing chaperone HdeA promotes the survival of enteropathogenic bacteria during transit through the harshly acidic environment of the mammalian stomach. At low pH, HdeA transitions from an inactive, folded, dimer to chaperone-active, disordered, monomers to protect against the acid-induced aggregation of periplasmic proteins. Toward achieving a detailed mechanistic understanding of the pH response of HdeA, we develop a multiscale modeling approach to capture its pH-dependent thermodynamics. Our approach combines pK(a) (logarithmic acid dissociation constant) calculations from all-atom constant pH molecular dynamics simulations with coarse-grained modeling and yields new, atomic-level, insights into HdeA chaperone function that can be directly tested by experiment. "pH triggers" that significantly destabilize the dimer are each located near the N-terminus of a helix, suggesting that their neutralization at low pH destabilizes the helix macrodipole as a mechanism of monomer disordering. Moreover, we observe a non-monotonic change in the pH-dependent stability of HdeA, with maximal stability of the dimer near pH5. This affect is attributed to the protonation Glu37, which exhibits an anomalously high pK(a) value and is located within the hydrophobic dimer interface. Finally, the pH-dependent binding pathway of HdeA comprises a partially unfolded, dimeric intermediate that becomes increasingly stable relative to the native dimer at lower pH values and displays key structural features for chaperone-substrate interaction. We anticipate that the insights from our model will help inform ongoing NMR and biochemical investigations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.

Science.gov (United States)

Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc

2011-10-01

Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.

The Chlamydia type III secretion system C-ring engages a chaperone-effector protein complex.

Directory of Open Access Journals (Sweden)

Kris E Spaeth

2009-09-01

Full Text Available In Gram-negative bacterial pathogens, specialized chaperones bind to secreted effector proteins and maintain them in a partially unfolded form competent for translocation by type III secretion systems/injectisomes. How diverse sets of effector-chaperone complexes are recognized by injectisomes is unclear. Here we describe a new mechanism of effector-chaperone recognition by the Chlamydia injectisome, a unique and ancestral line of these evolutionarily conserved secretion systems. By yeast two-hybrid analysis we identified networks of Chlamydia-specific proteins that interacted with the basal structure of the injectisome, including two hubs of protein-protein interactions that linked known secreted effector proteins to CdsQ, the putative cytoplasmic C-ring component of the secretion apparatus. One of these protein-interaction hubs is defined by Ct260/Mcsc (Multiple cargo secretion chaperone. Mcsc binds to and stabilizes at least two secreted hydrophobic proteins, Cap1 and Ct618, that localize to the membrane of the pathogenic vacuole ("inclusion". The resulting complexes bind to CdsQ, suggesting that in Chlamydia, the C-ring of the injectisome mediates the recognition of a subset of inclusion membrane proteins in complex with their chaperone. The selective recognition of inclusion membrane proteins by chaperones may provide a mechanism to co-ordinate the translocation of subsets of inclusion membrane proteins at different stages in infection.

Polypeptide binding properties of the chaperone calreticulin

DEFF Research Database (Denmark)

Jørgensen, C S; Heegaard, N H; Holm, A

2000-01-01

Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains to be elu......Calreticulin is a highly conserved eukaryotic ubiquitious protein located mainly in the endoplasmic reticulum. Two major characteristics of calreticulin are its chaperone activity and its lectin properties, but its precise function in intracellular protein and peptide processing remains...

Thermodynamic stability of complexes of BF3, PF5 and AsF5 with chlorine fluorides, oxyfluorides, and related compounds

International Nuclear Information System (INIS)

Trowbridge, L.D.

1996-07-01

The recent discovery of solid, water sensitive, arsenic-containing deposits in auxiliary process piping in the PGDP led to a search for explanations that could account for such accumulated material. A plausible explanation for the deposits is the formation of complexes of AsF 5 with one or more gases that may have been present as a result of cascade equipment cleanup activities. A literature search was performed. The target of the search was literature that would provide information on the dissociation pressure of complexes of AsF 5 or its hydrolysis products with any gases that may be (at least intermittently) present in the cascade location where the deposits were found. While the precise information sought (namely reliable, accurate dissociation pressures of such complexes at cascade temperatures) was not found in the detail desired. other information on these or similar complexes was obtained which permits prediction of the conditions under which the complexes might form, dissociate, or migrate, and how they might behave in the presence of atmospheric moisture. Information was gathered on potential AsF 5 complexes with ClF, ClF 3 , ClF 5 , ClF 3 O, ClO 2 F, and ClO 3 F. Information was also collected on many other related complexes as it was encountered, particularly for series of complexes which could assist in predicting chemical trends. Thermodynamic analysis and property estimation methods have been used to generate provisional estimates of the dissociation pressures of the two complexes ClF 3 *AsF 5 and ClO 2 F*AsF 5 . In addition, several hydrolysis species have been identified, and stability properties of the most relevant such complex (H 3 O*AsF 6 ) have similarly been estimated. While the predicted dissociation pressures are somewhat uncertain. they do lead to a tentative picture of the formation and behavior of such complexes in a cascade cleanup environment

The Salmonella type III effector SspH2 specifically exploits the NLR co-chaperone activity of SGT1 to subvert immunity.

Directory of Open Access Journals (Sweden)

Amit P Bhavsar

Full Text Available To further its pathogenesis, S. Typhimurium delivers effector proteins into host cells, including the novel E3 ubiquitin ligase (NEL effector SspH2. Using model systems in a cross-kingdom approach we gained further insight into the molecular function of this effector. Here, we show that SspH2 modulates innate immunity in both mammalian and plant cells. In mammalian cell culture, SspH2 significantly enhanced Nod1-mediated IL-8 secretion when transiently expressed or bacterially delivered. In addition, SspH2 also enhanced an Rx-dependent hypersensitive response in planta. In both of these nucleotide-binding leucine rich repeat receptor (NLR model systems, SspH2-mediated phenotypes required its catalytic E3 ubiquitin ligase activity and interaction with the conserved host protein SGT1. SGT1 has an essential cell cycle function and an additional function as an NLR co-chaperone in animal and plant cells. Interaction between SspH2 and SGT1 was restricted to SGT1 proteins that have NLR co-chaperone function and accordingly, SspH2 did not affect SGT1 cell cycle functions. Mechanistic studies revealed that SspH2 interacted with, and ubiquitinated Nod1 and could induce Nod1 activity in an agonist-independent manner if catalytically active. Interestingly, SspH2 in vitro ubiquitination activity and protein stability were enhanced by SGT1. Overall, this work adds to our understanding of the sophisticated mechanisms used by bacterial effectors to co-opt host pathways by demonstrating that SspH2 can subvert immune responses by selectively exploiting the functions of a conserved host co-chaperone.

Concepción de marketing internacional para la importación de membranas asfálticas de origen argentino para edificaciones en el Estado Plurinacional de Bolivia

OpenAIRE

Fuentes Orellana, Mayra A.

2015-01-01

La tesis tiene como objetivo determinar cuales son los lineamientos de marketing internacional para la importación de membranas asfálticas desde Argentina hasta Bolivia. Objetivo General: Determinar los lineamientos idóneos en un marco genérico, para la importación de membranas asfálticas bajo un análisis de las herramientas del marketing internacional. Objetivos Específicos: -Identificar la estrategia de marketing internacional adecuado para planificar...

Angular dependent torque measurements on CaFe0.88Co0.12AsF

Science.gov (United States)

Xiao, H.; Gao, B.; Ma, Y. H.; Li, X. J.; Mu, G.; Hu, T.

2016-08-01

Out-of-plane angular dependent torque measurements were performed on CaFe0.88Co0.12AsF (Ca1 1 1 1) single crystals. In the normal state, the torque data shows \\sin 2θ angular dependence and H 2 magnetic field dependence, as a result of paramagnetism. In the mixed state, the torque signal is a combination of the vortex torque and paramagnetic torque, and the former allows the determination of the anisotropy parameter γ. At T   =  11.5 K, γ (11.5 K ≃ 0.5 T c)  =  19.1, which is similar to the result of SmFeAsO0.8F0.2, γ ≃ 23 at T≃ 0.4{{T}\\text{c}} . So the 11 1 1 is more anisotropic compared to 11 and 122 families of iron-based superconductors. This may suggest that the electronic coupling between layers in 1 1 1 1 is less effective than in 11 and 122 families.

RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology

Directory of Open Access Journals (Sweden)

Sandeep Raut

2017-07-01

Full Text Available Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C-Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila. Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development.

Hsp100/ClpB Chaperone Function and Mechanism

Energy Technology Data Exchange (ETDEWEB)

Vierling, Elizabeth [Univ. of Massachusetts, Amherst, MA (United States). Dept. of Biochemistry and Molecular Biology

2015-01-27

The supported research investigated the mechanism of action of a unique class of molecular chaperones in higher plants, the Hsp100/ClpB proteins, with the ultimate goal of defining how these chaperones influence plant growth, development, stress tolerance and productivity. Molecular chaperones are essential effectors of cellular “protein quality control”, which comprises processes that ensure the proper folding, localization, activation and turnover of proteins. Hsp100/ClpB proteins are required for temperature acclimation in plants, optimal seed yield, and proper chloroplast development. The model plant Arabidopsis thaliana and genetic and molecular approaches were used to investigate two of the three members of the Hsp100/ClpB proteins in plants, cytosolic AtHsp101 and chloroplast-localized AtClpB-p. Investigating the chaperone activity of the Hsp100/ClpB proteins addresses DOE goals in that this activity impacts how “plants generate and assemble components” as well as “allowing for their self repair”. Additionally, Hsp100/ClpB protein function in plants is directly required for optimal “utilization of biological energy” and is involved in “mechanisms that control the architecture of energy transduction systems”.

Divergent tissue and sex effects of rapamycin on the proteasome-chaperone network of old mice

Directory of Open Access Journals (Sweden)

Karl Andrew Rodriguez

2014-11-01

Full Text Available Rapamycin, an allosteric inhibitor of the mTOR kinase, increases longevity in mice in a sex-specific manner. In contrast to the widely accepted theory that a loss of proteasome activity is detrimental to both life- and healthspan, biochemical studies in vitro reveal that rapamycin inhibits 20S proteasome peptidase activity. We tested if this unexpected finding is also evident after chronic rapamycin treatment in vivo by measuring peptidase activities for both the 26S and 20S proteasome in liver, fat, and brain tissues of old, male and female mice fed encapsulated chow containing 2.24mg/kg (14 ppm rapamycin for 6 months. Further we assessed if rapamycin altered expression of the chaperone proteins known to interact with the proteasome-mediated degradation system (PMDS, heat shock factor 1 (HSF1, and the levels of key mTOR pathway proteins. Rapamycin had little effect on liver proteasome activity in either gender, but increased proteasome activity in female brain lysates and lowered its activity in female fat tissue. Rapamycin-induced changes in molecular chaperone levels were also more substantial in tissues from female animals. Furthermore, mTOR pathway proteins showed more significant changes in female tissues compared to those from males. These data show collectively that there are divergent tissue and sex effects of rapamycin on the proteasome-chaperone network and that these may be linked to the disparate effects of rapamycin on males and females. Further our findings suggest that rapamycin induces indirect regulation of the PMDS/heat-shock response through its modulation of the mTOR pathway rather than via direct interactions between rapamycin and the proteasome.

Interplay between chaperones and protein disorder promotes the evolution of protein networks.

Directory of Open Access Journals (Sweden)

Sebastian Pechmann

2014-06-01

Full Text Available Evolution is driven by mutations, which lead to new protein functions but come at a cost to protein stability. Non-conservative substitutions are of interest in this regard because they may most profoundly affect both function and stability. Accordingly, organisms must balance the benefit of accepting advantageous substitutions with the possible cost of deleterious effects on protein folding and stability. We here examine factors that systematically promote non-conservative mutations at the proteome level. Intrinsically disordered regions in proteins play pivotal roles in protein interactions, but many questions regarding their evolution remain unanswered. Similarly, whether and how molecular chaperones, which have been shown to buffer destabilizing mutations in individual proteins, generally provide robustness during proteome evolution remains unclear. To this end, we introduce an evolutionary parameter λ that directly estimates the rate of non-conservative substitutions. Our analysis of λ in Escherichia coli, Saccharomyces cerevisiae, and Homo sapiens sequences reveals how co- and post-translationally acting chaperones differentially promote non-conservative substitutions in their substrates, likely through buffering of their destabilizing effects. We further find that λ serves well to quantify the evolution of intrinsically disordered proteins even though the unstructured, thus generally variable regions in proteins are often flanked by very conserved sequences. Crucially, we show that both intrinsically disordered proteins and highly re-wired proteins in protein interaction networks, which have evolved new interactions and functions, exhibit a higher λ at the expense of enhanced chaperone assistance. Our findings thus highlight an intricate interplay of molecular chaperones and protein disorder in the evolvability of protein networks. Our results illuminate the role of chaperones in enabling protein evolution, and underline the

Magnetism and Pressure-Induced Superconductivity of Checkerboard-Type Charge-Ordered Molecular Conductor β-(meso-DMBEDT-TTF2X (X = PF6 and AsF6

Directory of Open Access Journals (Sweden)

Yutaka Nishio

2012-11-01

Full Text Available The metallic state of the molecular conductor β-(meso-DMBEDT-TTF2X (DMBEDT-TTF = 2-(5,6-dihydro-1,3-dithiolo[4,5-b][1,4]dithiin-2-ylidene-5,6-dihydro-5,6-dimethyl-1,3-dithiolo[4,5-b][1,4]dithiin, X = PF6, AsF6 is transformed into the checkerboard-type charge-ordered state at around 75–80 K with accompanying metal-insulator (MI transition on the anisotropic triangular lattice. With lowering temperatures, the magnetic susceptibility decreases gradually and reveals a sudden drop at the MI transition. By applying pressure, the charge-ordered state is suppressed and superconductivity appears in β-(meso-DMBEDT-TTF2AsF6 as well as in the reported β-(meso-DMBEDT-TTF2PF6. The charge-ordered spin-gapped state and the pressure-induced superconducting state are discussed through the paired-electron crystal (PEC model, where the spin-bonded electron pairs stay and become mobile in the crystal, namely the valence-bond solid (VBS and the resonant valence bonded (RVB state in the quarter-filled band structure.

Structural Bioinformatics and Protein Docking Analysis of the Molecular Chaperone-Kinase Interactions: Towards Allosteric Inhibition of Protein Kinases by Targeting the Hsp90-Cdc37 Chaperone Machinery

Directory of Open Access Journals (Sweden)

Gennady Verkhivker

2013-11-01

Full Text Available A fundamental role of the Hsp90-Cdc37 chaperone system in mediating maturation of protein kinase clients and supporting kinase functional activity is essential for the integrity and viability of signaling pathways involved in cell cycle control and organism development. Despite significant advances in understanding structure and function of molecular chaperones, the molecular mechanisms and guiding principles of kinase recruitment to the chaperone system are lacking quantitative characterization. Structural and thermodynamic characterization of Hsp90-Cdc37 binding with protein kinase clients by modern experimental techniques is highly challenging, owing to a transient nature of chaperone-mediated interactions. In this work, we used experimentally-guided protein docking to probe the allosteric nature of the Hsp90-Cdc37 binding with the cyclin-dependent kinase 4 (Cdk4 kinase clients. The results of docking simulations suggest that the kinase recognition and recruitment to the chaperone system may be primarily determined by Cdc37 targeting of the N-terminal kinase lobe. The interactions of Hsp90 with the C-terminal kinase lobe may provide additional “molecular brakes” that can lock (or unlock kinase from the system during client loading (release stages. The results of this study support a central role of the Cdc37 chaperone in recognition and recruitment of the kinase clients. Structural analysis may have useful implications in developing strategies for allosteric inhibition of protein kinases by targeting the Hsp90-Cdc37 chaperone machinery.

Deletion of the Mitochondrial Chaperone TRAP-1 Uncovers Global Reprogramming of Metabolic Networks

Directory of Open Access Journals (Sweden)

Sofia Lisanti

2014-08-01

Full Text Available Reprogramming of metabolic pathways contributes to human disease, especially cancer, but the regulators of this process are unknown. Here, we have generated a mouse knockout for the mitochondrial chaperone TRAP-1, a regulator of bioenergetics in tumors. TRAP-1−/− mice are viable and showed reduced incidence of age-associated pathologies, including obesity, inflammatory tissue degeneration, dysplasia, and spontaneous tumor formation. This was accompanied by global upregulation of oxidative phosphorylation and glycolysis transcriptomes, causing deregulated mitochondrial respiration, oxidative stress, impaired cell proliferation, and a switch to glycolytic metabolism in vivo. These data identify TRAP-1 as a central regulator of mitochondrial bioenergetics, and this pathway could contribute to metabolic rewiring in tumors.

The heat-shock protein/chaperone network and multiple stress resistance.

Science.gov (United States)

Jacob, Pierre; Hirt, Heribert; Bendahmane, Abdelhafid

2017-04-01

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multistress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat-shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone 'client proteins', many are primary metabolism enzymes and signal transduction components with essential roles for the proper functioning of a cell. HSPs/chaperones are controlled by the action of diverse heat-shock factors, which are recruited under stress conditions. In this review, we give an overview of the regulation of the HSP/chaperone network with a focus on Arabidopsis thaliana. We illustrate the role of HSPs/chaperones in regulating diverse signalling pathways and discuss several basic principles that should be considered for engineering multiple stress resistance in crops through the HSP/chaperone network. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Chaperones and intimate physical examinations: what do male and female patients want?

Science.gov (United States)

Fan, V C; Choy, H T; Kwok, G Yj; Lam, H G; Lim, Q Y; Man, Y Y; Tang, C K; Wong, C C; Yu, Y F; Leung, G Kk

2017-02-01

Many studies of patients' perception of a medical chaperone have focused on female patients; that of male patients are less well studied. Moreover, previous studies were largely based on patient populations in English-speaking countries. Therefore, this study was conducted to investigate the perception and attitude of male and female Chinese patients to the presence of a chaperone during an intimate physical examination. A cross-sectional guided questionnaire survey was conducted on a convenient sample of 150 patients at a public teaching hospital in Hong Kong. Over 90% of the participants considered the presence of a chaperone appropriate during intimate physical examination, and 84% felt that doctors, irrespective of gender, should always request the presence of a chaperone. The most commonly cited reasons included the availability of an objective account should any legal issue arise, protection against sexual harassment, and to provide psychological support. This contrasted with the experience of those who had previously undergone an intimate physical examination of whom only 72.6% of women and 35.7% of men had reportedly been chaperoned. Among female participants, 75.0% preferred to be chaperoned during an intimate physical examination by a male doctor, and 28.6% would still prefer to be chaperoned when being examined by a female doctor. Among male participants, over 50% indicated no specific preference but a substantial minority reported a preference for chaperoned examination (21.2% for male doctor and 25.8% for female doctor). Patients in Hong Kong have a high degree of acceptance and expectations about the role of a medical chaperone. Both female and male patients prefer such practice regardless of physician gender. Doctors are strongly encouraged to discuss the issue openly with their patients before they conduct any intimate physical examination.

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae.

Science.gov (United States)

Ivanyi-Nagy, Roland; Lavergne, Jean-Pierre; Gabus, Caroline; Ficheux, Damien; Darlix, Jean-Luc

2008-02-01

RNA chaperone proteins are essential partners of RNA in living organisms and viruses. They are thought to assist in the correct folding and structural rearrangements of RNA molecules by resolving misfolded RNA species in an ATP-independent manner. RNA chaperoning is probably an entropy-driven process, mediated by the coupled binding and folding of intrinsically disordered protein regions and the kinetically trapped RNA. Previously, we have shown that the core protein of hepatitis C virus (HCV) is a potent RNA chaperone that can drive profound structural modifications of HCV RNA in vitro. We now examined the RNA chaperone activity and the disordered nature of core proteins from different Flaviviridae genera, namely that of HCV, GBV-B (GB virus B), WNV (West Nile virus) and BVDV (bovine viral diarrhoea virus). Despite low-sequence similarities, all four proteins demonstrated general nucleic acid annealing and RNA chaperone activities. Furthermore, heat resistance of core proteins, as well as far-UV circular dichroism spectroscopy suggested that a well-defined 3D protein structure is not necessary for core-induced RNA structural rearrangements. These data provide evidence that RNA chaperoning-possibly mediated by intrinsically disordered protein segments-is conserved in Flaviviridae core proteins. Thus, besides nucleocapsid formation, core proteins may function in RNA structural rearrangements taking place during virus replication.

Progress and potential of non-inhibitory small molecule chaperones for the treatment of Gaucher disease and its implications for Parkinson disease.

Science.gov (United States)

Jung, Olive; Patnaik, Samarjit; Marugan, Juan; Sidransky, Ellen; Westbroek, Wendy

2016-05-01

Gaucher disease, caused by pathological mutations GBA1, encodes the lysosome-resident enzyme glucocerebrosidase, which cleaves glucosylceramide into glucose and ceramide. In Gaucher disease, glucocerebrosidase deficiency leads to lysosomal accumulation of substrate, primarily in cells of the reticulo-endothelial system. Gaucher disease has broad clinical heterogeneity, and mutations in GBA1 are a risk factor for the development of different synucleinopathies. Insights into the cell biology and biochemistry of glucocerebrosidase have led to new therapeutic approaches for Gaucher disease including small chemical chaperones. Such chaperones facilitate proper enzyme folding and translocation to lysosomes, thereby preventing premature breakdown of the enzyme in the proteasome. This review discusses recent progress in developing chemical chaperones as a therapy for Gaucher disease, with implications for the treatment of synucleinopathies. It focuses on the development of non-inhibitory glucocerebrosidase chaperones and their therapeutic advantages over inhibitory chaperones, as well as the challenges involved in identifying and validating chemical chaperones.

Comportamiento mecánico y dinámico de una mezcla asfáltica con adición de fibras

Directory of Open Access Journals (Sweden)

Oscar Javier Reyes Ortiz

2005-01-01

Full Text Available El artículo refiere el análisis experimental en el laboratorio, del efecto de la adición de fibras de polipropileno por vía seca (reemplazo de material granular por fibra sobre las propiedades mecánicas y dinámicas de una mezcla. Inicialmente se caracteriza el material granular y asfalto CA60/70, se realiza el diseño de la mezcla asfáltica de granulometría 0/10 (IDU RSV 2002 y asfalto de acuerdo con la metodología Marshall; se evalúa el efecto de fibras sobre las propiedades mecánicas mediante la evaluación de la estabilidad y fluencia, y dinámicamente por su valor de deformación permanente y modulo dinámico. Los resultados muestran un efecto positivo de las fibras en la modificación de la mezcla asfáltica. El modulo dinámico aumenta en un 45% promedio en un porcentaje de adición de 0.60%; la deformación permanente disminuye en 27.6% para una adición de fibras de 0.60% y 48.8% para la adición de fibras de 0.75%, respectivamente. Este comportamiento refleja otra alternativa eficaz para mejorar la mezcla asfáltica, aumentando la resistencia a la disgregación por efecto abrasivo del tráfico y retardando el inicio y propagación del agrietamiento por ahuellamiento

Main: AS1CAMV [PLACE

Lifescience Database Archive (English)

Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

The ESASSI-08 cruise in the South Scotia Ridge region: Water masses, currents, and the ASF

Science.gov (United States)

Palmer, M.; Gomis, D.; Flexas, M. M.; Jordà, G.; Orsi, A. H.

2009-04-01

The ESASSI-08 oceanographic cruise carried out in January 2008 was the major milestone of ESASSI, the Spanish component of SASSI (a core project of the International Polar Year devoted to study the shelf-slope exchanges in different locations of Antarctica). The specific objectives of ESASSI, the sampling strategy and the overall distribution of the main variables across the 11 sections covered by the cruise are presented in a poster. Here we focus on three specific issues: i) the observation of strong tidal currents over some of the sampled slopes; ii) the path of the Antarctic Slope Front (ASF) over the SSR; and iii) the outflow of dense, ventilated water from the Weddell Sea into the South Scotia Sea. The main results are: i) Strong tidal currents with a significant diurnal component were observed over the southern slope of the SSR. Three tidal models are compared with the observations and used to de-tide ADCP currents. ii) The signature of the ASF is clearly detected on the southern slopes of the SSR (on the Weddell Sea flank). Over the northern slopes (the Scotia Sea flank), however, only weak signatures of frontal structures are observed; an in-depth biochemical analysis will be required to link the structures observed over the two flanks of the SSR. What seems clear is that the ASF does not extend further than Elephant Island, since southwestward of that island the shelf and the slope are fully occupied by Circumpolar Deep Water (CDW) from the Antarctic Circumpolar Current. iii) The shallower component of Weddell Sea Deep Water (Upper WSDW) flows over the SSR and pours into the Scotia Sea except to the east of Elephant Island, where the channels are less than 1500 m deep. The densest component of WSDW (Lower WSDW) is observed at both flanks of the SSR, but again a more detailed analysis of biochemical data will be required to prove a direct flux of this water mass across the SSR. Weddell Sea Bottom Water (WSBW) is not observed in any of the sampled sections.

Structure of the human histone chaperone FACT Spt16 N-terminal domain

Energy Technology Data Exchange (ETDEWEB)

Marcianò, G.; Huang, D. T., E-mail: d.huang@beatson.gla.ac.uk [Cancer Research UK Beatson Institute, Garscube Estate, Switchback Road, Glasgow G61 1BD, Scotland (United Kingdom)

2016-01-22

The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of human Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding.

Structure of the human histone chaperone FACT Spt16 N-terminal domain

International Nuclear Information System (INIS)

Marcianò, G.; Huang, D. T.

2016-01-01

The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of human Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding

Study of receptor-chaperone interactions using the optical technique of spectroscopic ellipsometry.

Science.gov (United States)

Kriechbaumer, Verena; Tsargorodskaya, Anna; Mustafa, Mohd K; Vinogradova, Tatiana; Lacey, Joanne; Smith, David P; Abell, Benjamin M; Nabok, Alexei

2011-07-20

This work describes a detailed quantitative interaction study between the novel plastidial chaperone receptor OEP61 and isoforms of the chaperone types Hsp70 and Hsp90 using the optical method of total internal reflection ellipsometry (TIRE). The receptor OEP61 was electrostatically immobilized on a gold surface via an intermediate layer of polycations. The TIRE measurements allowed the evaluation of thickness changes in the adsorbed molecular layers as a result of chaperone binding to receptor proteins. Hsp70 chaperone isoforms but not Hsp90 were shown to be capable of binding OEP61. Dynamic TIRE measurements were carried out to evaluate the affinity constants of the above reactions and resulted in clear discrimination between specific and nonspecific binding of chaperones as well as differences in binding properties between the highly similar Hsp70 isoforms. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Gamma-irradiation effects to posttranslational modification and chaperon function of bovine α-crystalline

International Nuclear Information System (INIS)

Hiroki, K; Matsumoto, S.; Awakura, M.; Fujii, N.

2001-01-01

The formation of D-asparate (D-Asp) in αA-crystallin of the aged human eye and the cataract crystalline lens has been reported. Crystalline lens keeps the transparency by forming α-crystallin which consists of a high order association of αA-and αB-crystallin. Bovine α-crystallin for investigating a chaperone function which protects the crystalline lens from getting to opaque or disordered agglutination with heat or light, is irradiated by gamma-ray (Co-60) at 0, 1, 2, 3, and 4 kGy, respectively. The irradiated bovine α-crystallin are analyzed with electrophoresis, gel permeation chromatograph, and UV absorption spectrometer for checking on the agglutination and the isomerization of macromolecules. Oxidation of methionine residues (Met-1) and isomerization of asparagine residues (Asp-151) in the αA-crystallin are ascertained in molecular levels with reversed phase liquid chromatography. The Met-1 oxidation and the Asp-151 isomerization depend on gamma-irradiation doses. It is thought that OH radical and H radical in water generated by the irradiation lead to the oxidation and the isomerization. Stereoinversion in the α-crystallin following to such a chemical change are considered to lead to the agglutination of polymer and the reduction of chaperon function. (M. Suetake)

Comparison of intra-organellar chaperone capacity for dealing with stress-induced protein unfolding.

Science.gov (United States)

Hageman, Jurre; Vos, Michel J; van Waarde, Maria A W H; Kampinga, Harm H

2007-11-23

Molecular chaperones are essential for cells to prevent that partially unfolded proteins form non-functional, toxic aggregates. This requirement is increased when cells experience protein unfolding stresses and such could affect all compartments in the eukaryotic cell. Whether all organelles are equipped with comparable chaperone capacities is largely unknown, mainly due to the lack of suitable reporters that allow such a comparison. Here we describe the development of fluorescent luciferase reporters that are sorted to various cellular locations (nucleus, cytoplasm, endoplasmic reticulum, and peroxisomes) and that differ minimally in their intrinsic thermal stability properties. When heating living cells, the rate of inactivation was most rapid for the nuclear-targeted luciferase, indicating that the nucleus is the most sensitive organelle toward heat-induced denaturing stress. Post-heat re-activation, however, occurred at equal kinetics irrespective of luciferase localization. Also, induction of thermotolerance by a priming heat treatment, that coordinately up-regulates all heat-inducible chaperones, resulted in a transient heat resistance of the luciferase in all organelles in a comparable manner. Overexpression of the main heat-inducible Hsp70 family member, HspA1A, protected only the cytosolic and nuclear, but not the other luciferases. Together, our data suggest that in each compartment investigated, including the peroxisome in which so far no chaperones could be detected, chaperone machines are present and can be induced with activities similar to those present in the cytosolic/nuclear compartment.

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Ray, Sougata Sinha; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31–43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25–43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min-1. Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18. PMID:26098662

Role of Subunit Exchange and Electrostatic Interactions on the Chaperone Activity of Mycobacterium leprae HSP18.

Science.gov (United States)

Nandi, Sandip Kumar; Panda, Alok Kumar; Chakraborty, Ayon; Sinha Ray, Sougata; Biswas, Ashis

2015-01-01

Mycobacterium leprae HSP18, a major immunodominant antigen of M. leprae pathogen, is a small heat shock protein. Previously, we reported that HSP18 is a molecular chaperone that prevents aggregation of different chemically and thermally stressed client proteins and assists refolding of denatured enzyme at normal temperature. We also demonstrated that it can efficiently prevent the thermal killing of E. coli at higher temperature. However, molecular mechanism behind the chaperone function of HSP18 is still unclear. Therefore, we studied the structure and chaperone function of HSP18 at normal temperature (25°C) as well as at higher temperatures (31-43°C). Our study revealed that the chaperone function of HSP18 is enhanced significantly with increasing temperature. Far- and near-UV CD experiments suggested that its secondary and tertiary structure remain intact in this temperature range (25-43°C). Besides, temperature has no effect on the static oligomeric size of this protein. Subunit exchange study demonstrated that subunits of HSP18 exchange at 25°C with a rate constant of 0.018 min(-1). Both rate of subunit exchange and chaperone activity of HSP18 is found to increase with rise in temperature. However, the surface hydrophobicity of HSP18 decreases markedly upon heating and has no correlation with its chaperone function in this temperature range. Furthermore, we observed that HSP18 exhibits diminished chaperone function in the presence of NaCl at 25°C. At elevated temperatures, weakening of interactions between HSP18 and stressed client proteins in the presence of NaCl results in greater reduction of its chaperone function. The oligomeric size, rate of subunit exchange and structural stability of HSP18 were also found to decrease when electrostatic interactions were weakened. These results clearly indicated that subunit exchange and electrostatic interactions play a major role in the chaperone function of HSP18.

Crystallization of the FaeE chaperone of Escherichia coli F4 fimbriae

International Nuclear Information System (INIS)

Van Molle, Inge; Buts, Lieven; Coppens, Fanny; Qiang, Liu; Wyns, Lode; Loris, Remy; Bouckaert, Julie; De Greve, Henri

2005-01-01

The periplasmic chaperone FaeE of E. coli F4 fimbriae crystallizes in three crystal forms. F4 (formerly K88) fimbriae from enterotoxigenic Escherichia coli are assembled via the FaeE/FaeD chaperone/usher pathway. The chaperone FaeE crystallizes in three crystal forms, all belonging to space group C2. Crystals of form 1 diffract to 2.3 Å and have unit-cell parameters a = 195.7, b = 78.5, c = 184.6 Å, β = 102.2°. X-ray data for crystal form 2 were collected to 2.7 Å using an SeMet variant of FaeE. The crystals have unit-cell parameters a = 136.4, b = 75.7, c = 69.4 Å, β = 92.8°. Crystals of form 3 were formed in a solution containing the FaeE–FaeG complex and diffract to 2.8 Å. Unit-cell parameters are a = 109.7, b = 78.6, c = 87.8 Å, β = 96.4°

Crystallization of the FaeE chaperone of Escherichia coli F4 fimbriae

Energy Technology Data Exchange (ETDEWEB)

Van Molle, Inge, E-mail: ivmolle@vub.ac.be; Buts, Lieven; Coppens, Fanny; Qiang, Liu; Wyns, Lode; Loris, Remy; Bouckaert, Julie; De Greve, Henri [Laboratorium voor Ultrastructuur, Vlaams Interuniversitair Instituut voor Biotechnologie, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussel (Belgium)

2005-04-01

The periplasmic chaperone FaeE of E. coli F4 fimbriae crystallizes in three crystal forms. F4 (formerly K88) fimbriae from enterotoxigenic Escherichia coli are assembled via the FaeE/FaeD chaperone/usher pathway. The chaperone FaeE crystallizes in three crystal forms, all belonging to space group C2. Crystals of form 1 diffract to 2.3 Å and have unit-cell parameters a = 195.7, b = 78.5, c = 184.6 Å, β = 102.2°. X-ray data for crystal form 2 were collected to 2.7 Å using an SeMet variant of FaeE. The crystals have unit-cell parameters a = 136.4, b = 75.7, c = 69.4 Å, β = 92.8°. Crystals of form 3 were formed in a solution containing the FaeE–FaeG complex and diffract to 2.8 Å. Unit-cell parameters are a = 109.7, b = 78.6, c = 87.8 Å, β = 96.4°.

Cloning and molecular characterization of a copper chaperone gene ...

African Journals Online (AJOL)

The cDNA encoding a copper chaperone, designated as HbCCH1, was isolated from Hevea brasiliensis. HbCC1 was 589 bp long containing a 261 bp open reading frame encoding a putative protein of 86 amino acids, flanked by a 103 bp 5'UTR and a 225 bp 3'UTR. The predicted molecular mass of HbCCH1 was 9.2 kDa, ...

A primate specific extra domain in the molecular chaperone Hsp90.

Directory of Open Access Journals (Sweden)

Vishwadeepak Tripathi

Full Text Available Hsp90 (heat shock protein 90 is an essential molecular chaperone that mediates folding and quality control of client proteins. Many of them such as protein kinases, steroid receptors and transcription factors are involved in cellular signaling processes. Hsp90 undergoes an ATP hydrolysis dependent conformational cycle to assist folding of the client protein. The canonical Hsp90 shows a typical composition of three distinct domains and interacts with individual cochaperone partners such as Hop, Cdc37 and Aha1 (activator of Hsp90 ATPase that regulate the reaction cycle of the molecular chaperone. A bioinformatic survey identified an additional domain of 122 amino acids in front of the canonical Hsp90 sequence. This extra domain (E domain is specific to the Catarrhini or drooping nose monkeys, a subdivision of the higher primates that includes man, the great apes and the old world monkeys but is absent from all other species. Our biochemical analysis reveals that Hsp103 associates with cochaperone proteins such as Hop, Cdc37 and Aha1 similar to Hsp90. However, the extra domain reduces the ATP hydrolysis rate to about half when compared to Hsp90 thereby acting as a negative regulator of the molecular chaperonés intrinsic ATPase activity.

Investigating the Chaperone Properties of a Novel Heat Shock Protein, Hsp70.c, from Trypanosoma brucei

Directory of Open Access Journals (Sweden)

Adélle Burger

2014-01-01

Full Text Available The neglected tropical disease, African Trypanosomiasis, is fatal and has a crippling impact on economic development. Heat shock protein 70 (Hsp70 is an important molecular chaperone that is expressed in response to stress and Hsp40 acts as its co-chaperone. These proteins play a wide range of roles in the cell and they are required to assist the parasite as it moves from a cold blooded insect vector to a warm blooded mammalian host. A novel cytosolic Hsp70, from Trypanosoma brucei, TbHsp70.c, contains an acidic substrate binding domain and lacks the C-terminal EEVD motif. The ability of a cytosolic Hsp40 from Trypanosoma brucei J protein 2, Tbj2, to function as a co-chaperone of TbHsp70.c was investigated. The main objective was to functionally characterize TbHsp70.c to further expand our knowledge of parasite biology. TbHsp70.c and Tbj2 were heterologously expressed and purified and both proteins displayed the ability to suppress aggregation of thermolabile MDH and chemically denatured rhodanese. ATPase assays revealed a 2.8-fold stimulation of the ATPase activity of TbHsp70.c by Tbj2. TbHsp70.c and Tbj2 both demonstrated chaperone activity and Tbj2 functions as a co-chaperone of TbHsp70.c. In vivo heat stress experiments indicated upregulation of the expression levels of TbHsp70.c.

A pH Switch Regulates the Inverse Relationship between Membranolytic and Chaperone-like Activities of HSP-1/2, a Major Protein of Horse Seminal Plasma.

Science.gov (United States)

Kumar, C Sudheer; Swamy, Musti J

2016-07-05

HSP-1/2, a major protein of horse seminal plasma binds to choline phospholipids present on the sperm plasma membrane and perturbs its structure by intercalating into the hydrophobic core, which results in an efflux of choline phospholipids and cholesterol, an important event in sperm capacitation. HSP-1/2 also exhibits chaperone-like activity (CLA) in vitro and protects target proteins against various kinds of stress. In the present study we show that HSP-1/2 exhibits destabilizing activity toward model supported and cell membranes. The membranolytic activity of HSP-1/2 is found to be pH dependent, with lytic activity being high at mildly acidic pH (6.0-6.5) and low at mildly basic pH (8.0-8.5). Interestingly, the CLA is also found to be pH dependent, with high activity at mildly basic pH and low activity at mildly acidic pH. Taken together the present studies demonstrate that the membranolytic and chaperone-like activities of HSP-1/2 have an inverse relationship and are regulated via a pH switch, which is reversible. The higher CLA observed at mildly basic pH could be correlated to an increase in surface hydrophobicity of the protein. To the best of our knowledge, this is the first study reporting regulation of two different activities of a chaperone protein by a pH switch.

Hsp90 molecular chaperone: structure, functions and participation in cardio-vascular pathologies

Directory of Open Access Journals (Sweden)

Kroupskaya I. V.

2009-10-01

Full Text Available The review is devoted to the analysis of structural and functional properties of molecular chaperon Hsp90. Hsp90 is a representative of highly widespread family of heat shock proteins. The protein is found in eubacteria and all branches of eukarya, but it is apparently absent in archaea. It is one of key regulators of numerous signalling pathways, cell growth and development, apoptosis, induction of autoimmunity, and progression of heart failure. The full functional activity of Hsp90 shows up in a complex with other molecular chaperones and co-chaperones. Molecular interactions between chaperones, different signalling proteins and protein-partners are highly crucial for the normal functioning of signalling pathways and their destruction causes an alteration in the cell physiology up to its death.

An unexpected role for the yeast nucleotide exchange factor Sil1 as a reductant acting on the molecular chaperone BiP

Science.gov (United States)

Siegenthaler, Kevin D; Pareja, Kristeen A; Wang, Jie; Sevier, Carolyn S

2017-01-01

Unfavorable redox conditions in the endoplasmic reticulum (ER) can decrease the capacity for protein secretion, altering vital cell functions. While systems to manage reductive stress are well-established, how cells cope with an overly oxidizing ER remains largely undefined. In previous work (Wang et al., 2014), we demonstrated that the chaperone BiP is a sensor of overly oxidizing ER conditions. We showed that modification of a conserved BiP cysteine during stress beneficially alters BiP chaperone activity to cope with suboptimal folding conditions. How this cysteine is reduced to reestablish 'normal' BiP activity post-oxidative stress has remained unknown. Here we demonstrate that BiP's nucleotide exchange factor – Sil1 – can reverse BiP cysteine oxidation. This previously unexpected reductant capacity for yeast Sil1 has potential implications for the human ataxia Marinesco-Sjögren syndrome, where it is interesting to speculate that a disruption in ER redox-signaling (due to genetic defects in SIL1) may influence disease pathology. DOI: http://dx.doi.org/10.7554/eLife.24141.001 PMID:28257000

Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase.

Science.gov (United States)

Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph; Marquardt, Iris; Donsante, Anthony; Yi, Ling; Hicks, Julia D; Steinbach, Peter J; Wilson, Callum; Elpeleg, Orly; Møller, Lisbeth Birk; Christodoulou, John; Kaler, Stephen G; Gärtner, Jutta

2012-08-01

Copper (Cu) is a trace metal that readily gains and donates electrons, a property that renders it desirable as an enzyme cofactor but dangerous as a source of free radicals. To regulate cellular Cu metabolism, an elaborate system of chaperones and transporters has evolved, although no human Cu chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the Cu chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution of a highly conserved arginine residue at position 163, with tryptophan in domain II of CCS, which interacts directly with superoxide dismutase 1 (SOD1). Biochemical analyses of the patient's fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result, this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal Cu homeostasis. CCS-Arg163Trp represents the primary example of a human mutation in a gene coding for a Cu chaperone. © 2012 Wiley Periodicals, Inc.

Análisis de un asfalto modificado con icopor y su incidencia en una mezcla asfáltica densa en caliente

Directory of Open Access Journals (Sweden)

Ana Sofía Figueroa Infante

2007-09-01

Full Text Available En esta investigación se presentan los resultados obtenidos al elaborar una mezcla asfáltica MDC-2 con asfalto modificado con Icopor (poliestireno, resultado de la trituración de vasos desechables, con el ánimo de mejorar las propiedades mecánicas de las mezclas tipo rodadura y garantizar la durabilidad de las mismas bajo las solicitaciones impuestas en el período de diseño. Para el diseño se realizó la caracterización de los materiales pétreos, pertenecientes a una de las canteras de mayor utilización en la Sabana de Bogotá, del asfalto producido en Barrancabermeja, Santander, y del poliestireno obtenido de los desechos no biodegradables. El método em-pleado para la obtención de los porcentajes óptimos de asfalto-agregados-icopor, fue el Marshall. Se realizaron los siguientes ensayos: el estudio del asfalto teniendo en cuenta el envejecimiento, el comportamiento dinámico de la mezcla a partir de los ensayos de fatiga trapezoidal para 20°C y 30°C y para deformaciones de 90x10-6, 150x10-6 y 220x10-6m, ahuellamiento para una carga de 13 toneladas, similar a la del eje más pesado de un bus de Transmilenio, módulo dinámico para 15°C, 20°C y 30°C y para las frecuencias de 2.5, 5 y 10Hz. Los resultados obtenidos se contrastaron con los de una mezcla asfáltica convencional. Como conclusiones de esta investigación se destacan: la disminución en más de un 50% de la deformación plástica ocurrida por el paso de vehículos de 13 ton, de acuerdo con el modelo utilizado, el aumento de la estabilidad de la mezcla asfáltica conservando un menor peso y la posibilidad de inclusión de estos materiales de desecho que impactan el am-biente pero contribuyen con la resistencia de un material como el concreto asfáltico, entre otros.

ATP-dependent molecular chaperones in plastids--More complex than expected.

Science.gov (United States)

Trösch, Raphael; Mühlhaus, Timo; Schroda, Michael; Willmund, Felix

2015-09-01

Plastids are a class of essential plant cell organelles comprising photosynthetic chloroplasts of green tissues, starch-storing amyloplasts of roots and tubers or the colorful pigment-storing chromoplasts of petals and fruits. They express a few genes encoded on their organellar genome, called plastome, but import most of their proteins from the cytosol. The import into plastids, the folding of freshly-translated or imported proteins, the degradation or renaturation of denatured and entangled proteins, and the quality-control of newly folded proteins all require the action of molecular chaperones. Members of all four major families of ATP-dependent molecular chaperones (chaperonin/Cpn60, Hsp70, Hsp90 and Hsp100 families) have been identified in plastids from unicellular algae to higher plants. This review aims not only at giving an overview of the most current insights into the general and conserved functions of these plastid chaperones, but also into their specific plastid functions. Given that chloroplasts harbor an extreme environment that cycles between reduced and oxidized states, that has to deal with reactive oxygen species and is highly reactive to environmental and developmental signals, it can be presumed that plastid chaperones have evolved a plethora of specific functions some of which are just about to be discovered. Here, the most urgent questions that remain unsolved are discussed, and guidance for future research on plastid chaperones is given. This article is part of a Special Issue entitled: Chloroplast Biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

The Hsc/Hsp70 co-chaperone network controls antigen aggregation and presentation during maturation of professional antigen presenting cells.

Directory of Open Access Journals (Sweden)

Nadja Kettern

Full Text Available The maturation of mouse macrophages and dendritic cells involves the transient deposition of ubiquitylated proteins in the form of dendritic cell aggresome-like induced structures (DALIS. Transient DALIS formation was used here as a paradigm to study how mammalian cells influence the formation and disassembly of protein aggregates through alterations of their proteostasis machinery. Co-chaperones that modulate the interplay of Hsc70 and Hsp70 with the ubiquitin-proteasome system (UPS and the autophagosome-lysosome pathway emerged as key regulators of this process. The chaperone-associated ubiquitin ligase CHIP and the ubiquitin-domain protein BAG-1 are essential for DALIS formation in mouse macrophages and bone-marrow derived dendritic cells (BMDCs. CHIP also cooperates with BAG-3 and the autophagic ubiquitin adaptor p62 in the clearance of DALIS through chaperone-assisted selective autophagy (CASA. On the other hand, the co-chaperone HspBP1 inhibits the activity of CHIP and thereby attenuates antigen sequestration. Through a modulation of DALIS formation CHIP, BAG-1 and HspBP1 alter MHC class I mediated antigen presentation in mouse BMDCs. Our data show that the Hsc/Hsp70 co-chaperone network controls transient protein aggregation during maturation of professional antigen presenting cells and in this way regulates the immune response. Similar mechanisms may modulate the formation of aggresomes and aggresome-like induced structures (ALIS in other mammalian cell types.

Dual inhibition of chaperoning process by taxifolin: molecular dynamics simulation study.

Science.gov (United States)

Verma, Sharad; Singh, Amit; Mishra, Abha

2012-07-01

Hsp90 (heat shock protein 90), a molecular chaperone, stabilizes more than 200 mutated and over expressed oncogenic proteins in cancer development. Cdc37 (cell division cycle protein 37), a co-chaperone of Hsp90, has been found to facilitate the maturation of protein kinases by acting as an adaptor and load these kinases onto the Hsp90 complex. Taxifolin (a natural phytochemical) was found to bind at ATP-binding site of Hsp90 and stabilized the inactive "open" or "lid-up" conformation as evidenced by molecular dynamic simulation. Furthermore, taxifolin was found to bind to interface of Hsp90 and Cdc37 complex and disrupt the interaction of residues of both proteins which were essential for the formation of active super-chaperone complex. Thus, taxifolin was found to act as an inhibitor of chaperoning process and may play a potential role in the cancer chemotherapeutics. Copyright © 2012 Elsevier Inc. All rights reserved.

New organic superconductors beta-(BDA-TTP)2X [BDA-TTP + 2,5-bis(1,3-dithian-2ylidene)-1,3,4,6-tetrathiapentalene; X(-) = SbF6(-), AsF6(-), and PF6(-)].

Science.gov (United States)

Yamada, J; Watanabe, M; Akutsu, H; Nakatsuji, S; Nishikawa, H; Ikemoto, I; Kikuchi, K

2001-05-09

The synthesis, electrochemical properties, and molecular structure of a new pi-electron donor, 2,5-bis(1,3-dithian-2-ylidene)-1,3,4,6-tetrathiapentalene (BDA-TTP), is described. In contrast to the hitherto-known tetrachalcogenafulvalene pi-donors providing organic superconductors, this donor contains only the bis-fused 1,3-dithiole-2-ylidene unit as a pi-electron system, yet produces a series of ambient-pressure superconductors beta-(BDA-TTP)2X [X = SbF6 (magnetic T(c) = 6.9 K, resistive T(c) = 7.5 K), AsF6 (magnetic T(c) = 5.9 K, resistive T(c) = 5.8 K), and PF6 (magnetic T(c) = 5.9 K)], which are isostructural. The values of the intermolecular overlap integrals calculated on the donor layers of these superconductors suggest a two-dimensional (2D) electronic structure with loose donor packing. Tight-binding band calculations also indicate that these superconductors have the 2D band dispersion relations and closed Fermi surfaces.

Roles of silkworm endoplasmic reticulum chaperones in the secretion of recombinant proteins expressed by baculovirus system.

Science.gov (United States)

Imai, Saki; Kusakabe, Takahiro; Xu, Jian; Li, Zhiqing; Shirai, Shintaro; Mon, Hiroaki; Morokuma, Daisuke; Lee, Jae Man

2015-11-01

Baculovirus expression vector system (BEVS) is widely used for production of recombinant eukaryotic proteins in insect larvae or cultured cells. BEVS has advantages over bacterial expression system in producing post-translationally modified secreted proteins. However, for some unknown reason, it is very difficult for insects to secrete sufficiently for certain proteins of interest. To understand the reasons why insect cells fail to secrete some kinds of recombinant proteins, we here employed three mammalian proteins as targets, EPO, HGF, and Wnt3A, with different secretion levels in BEVS and investigated their mRNA transcriptions from the viral genome, subcellular localizations, and interactions with silkworm ER chaperones. Moreover, we observed that no significantly influence on the secretion amounts of all three proteins when depleting or overexpressing most endogenous ER chaperone genes in cultured silkworm cells. However, among all detected ER chaperones, the depletion of BiP severely decreased the recombinant protein secretion in BEVS, indicating the possible central role of Bip in silkworm secretion pathway.

The SigmaR1 chaperone drives breast and colorectal cancer cell migration by tuning SK3-dependent Ca2+ homeostasis.

Science.gov (United States)

Gueguinou, M; Crottès, D; Chantôme, A; Rapetti-Mauss, R; Potier-Cartereau, M; Clarysse, L; Girault, A; Fourbon, Y; Jézéquel, P; Guérin-Charbonnel, C; Fromont, G; Martin, P; Pellissier, B; Schiappa, R; Chamorey, E; Mignen, O; Uguen, A; Borgese, F; Vandier, C; Soriani, O

2017-06-22

The remodeling of calcium homeostasis contributes to the cancer hallmarks and the molecular mechanisms involved in calcium channel regulation in tumors remain to be characterized. Here, we report that SigmaR1, a stress-activated chaperone, is required to increase calcium influx by triggering the coupling between SK3, a Ca 2+ -activated K + channel (KCNN3) and the voltage-independent calcium channel Orai1. We show that SigmaR1 physically binds SK3 in BC cells. Inhibition of SigmaR1 activity, either by molecular silencing or by the use of sigma ligand (igmesine), decreased SK3 current and Ca 2+ entry in breast cancer (BC) and colorectal cancer (CRC) cells. Interestingly, SigmaR1 inhibition diminished SK3 and/or Orai1 levels in lipid nanodomains isolated from BC cells. Analyses of tissue microarray from CRC patients showed higher SigmaR1 expression levels in cancer samples and a correlation with tumor grade. Moreover, the exploration of a cohort of 4937 BC patients indicated that high expression of SigmaR1 and Orai1 channels was significantly correlated to a lower overall survival. As the SK3/Orai1 tandem drives invasive process in CRC and bone metastasis progression in BC, our results may inaugurate innovative therapeutic approaches targeting SigmaR1 to control the remodeling of Ca 2+ homeostasis in epithelial cancers.

Effects of air transportation cause physiological and biochemical changes indicative of stress leading to regulation of chaperone expression levels and corticosterone concentration.

Science.gov (United States)

Shim, SunBo; Lee, SeHyun; Kim, ChuelKyu; Kim, ByoungGuk; Jee, SeungWan; Lee, SuHae; Sin, JiSoon; Bae, ChangJoon; Woo, Jong-Min; Cho, JungSik; Lee, EonPil; Choi, HaeWook; Kim, HongSung; Lee, JaeHo; Jung, YoungJin; Cho, ByungWook; Chae, KabRyong; Hwang, DaeYoun

2009-01-01

Laboratory animals generally experience numerous unfamiliar environmental and psychological influences such as noises, temperatures, handling, shaking, and smells during the process of air transportation. To investigate whether stress induced by air transportation affects stress-related factors in animals, the levels of hormone and chaperone protein were measured in several tissues of F344 rats transported for 13 h and not transported. Herein, we conclude that the levels of corticosterone, HSP70, and GRP78 were significantly increased in the transported group compare to not transported group, but they were rapidly restored to the not transported group level after a recovery period of one week. However, the magnitude of induction and restoration levels of these factors varied depending on the tissue type. Thus, these results suggest that air transportation should be considered for the improvement of laboratory animal health and to reduce the incidence of laboratory animal stress.

Review: The HSP90 molecular chaperone-an enigmatic ATPase.

Science.gov (United States)

Pearl, Laurence H

2016-08-01

The HSP90 molecular chaperone is involved in the activation and cellular stabilization of a range of 'client' proteins, of which oncogenic protein kinases and nuclear steroid hormone receptors are of particular biomedical significance. Work over the last two decades has revealed a conformational cycle critical to the biological function of HSP90, coupled to an inherent ATPase activity that is regulated and manipulated by many of the co-chaperones proteins with which it collaborates. Pharmacological inhibition of HSP90 ATPase activity results in degradation of client proteins in vivo, and is a promising target for development of new cancer therapeutics. Despite this, the actual function that HSP90s conformationally-coupled ATPase activity provides in its biological role as a molecular chaperone remains obscure. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 594-607, 2016. © 2016 The Authors. Biopolymers Published by Wiley Periodicals, Inc.

Peptide binding specificity of the chaperone calreticulin

DEFF Research Database (Denmark)

Sandhu, N.; Duus, K.; Jorgensen, C.S.

2007-01-01

Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length and composit......Calreticulin is a molecular chaperone with specificity for polypeptides and N-linked monoglucosylated glycans. In order to determine the specificity of polypeptide binding, the interaction of calreticulin with polypeptides was investigated using synthetic peptides of different length...... than 5 amino acids showed binding and a clear correlation with hydrophobicity was demonstrated for oligomers of different hydrophobic amino acids. Insertion of hydrophilic amino acids in a hydrophobic sequence diminished or abolished binding. In conclusion our results show that calreticulin has...

Spinal Muscular Atrophy: From Defective Chaperoning of snRNP Assembly to Neuromuscular Dysfunction

Directory of Open Access Journals (Sweden)

Maia Lanfranco

2017-06-01

Full Text Available Spinal Muscular Atrophy (SMA is a neuromuscular disorder that results from decreased levels of the survival motor neuron (SMN protein. SMN is part of a multiprotein complex that also includes Gemins 2–8 and Unrip. The SMN-Gemins complex cooperates with the protein arginine methyltransferase 5 (PRMT5 complex, whose constituents include WD45, PRMT5 and pICln. Both complexes function as molecular chaperones, interacting with and assisting in the assembly of an Sm protein core onto small nuclear RNAs (snRNAs to generate small nuclear ribonucleoproteins (snRNPs, which are the operating components of the spliceosome. Molecular and structural studies have refined our knowledge of the key events taking place within the crowded environment of cells and the numerous precautions undertaken to ensure the faithful assembly of snRNPs. Nonetheless, it remains unclear whether a loss of chaperoning in snRNP assembly, considered as a “housekeeping” activity, is responsible for the selective neuromuscular phenotype in SMA. This review thus shines light on in vivo studies that point toward disturbances in snRNP assembly and the consequential transcriptome abnormalities as the primary drivers of the progressive neuromuscular degeneration underpinning the disease. Disruption of U1 snRNP or snRNP assembly factors other than SMN induces phenotypes that mirror aspects of SMN deficiency, and splicing defects, described in numerous SMA models, can lead to a DNA damage and stress response that compromises the survival of the motor system. Restoring the correct chaperoning of snRNP assembly is therefore predicted to enhance the benefit of SMA therapeutic modalities based on augmenting SMN expression.

Human Hsp70 molecular chaperone binds two calcium ions within the ATPase domain.

Science.gov (United States)

Sriram, M; Osipiuk, J; Freeman, B; Morimoto, R; Joachimiak, A

1997-03-15

The 70 kDa heat shock proteins (Hsp70) are a family of molecular chaperones, which promote protein folding and participate in many cellular functions. The Hsp70 chaperones are composed of two major domains. The N-terminal ATPase domain binds to and hydrolyzes ATP, whereas the C-terminal domain is required for polypeptide binding. Cooperation of both domains is needed for protein folding. The crystal structure of bovine Hsc70 ATPase domain (bATPase) has been determined and, more recently, the crystal structure of the peptide-binding domain of a related chaperone, DnaK, in complex with peptide substrate has been obtained. The molecular chaperone activity and conformational switch are functionally linked with ATP hydrolysis. A high-resolution structure of the ATPase domain is required to provide an understanding of the mechanism of ATP hydrolysis and how it affects communication between C- and N-terminal domains. The crystal structure of the human Hsp70 ATPase domain (hATPase) has been determined and refined at 1. 84 A, using synchrotron radiation at 120K. Two calcium sites were identified: the first calcium binds within the catalytic pocket, bridging ADP and inorganic phosphate, and the second calcium is tightly coordinated on the protein surface by Glu231, Asp232 and the carbonyl of His227. Overall, the structure of hATPase is similar to bATPase. Differences between them are found in the loops, the sites of amino acid substitution and the calcium-binding sites. Human Hsp70 chaperone is phosphorylated in vitro in the presence of divalent ions, calcium being the most effective. The structural similarity of hATPase and bATPase and the sequence similarity within the Hsp70 chaperone family suggest a universal mechanism of ATP hydrolysis among all Hsp70 molecular chaperones. Two calcium ions have been found in the hATPase structure. One corresponds to the magnesium site in bATPase and appears to be important for ATP hydrolysis and in vitro phosphorylation. Local changes

Broadening the functionality of a J-protein/Hsp70 molecular chaperone system.

Science.gov (United States)

Schilke, Brenda A; Ciesielski, Szymon J; Ziegelhoffer, Thomas; Kamiya, Erina; Tonelli, Marco; Lee, Woonghee; Cornilescu, Gabriel; Hines, Justin K; Markley, John L; Craig, Elizabeth A

2017-10-01

By binding to a multitude of polypeptide substrates, Hsp70-based molecular chaperone systems perform a range of cellular functions. All J-protein co-chaperones play the essential role, via action of their J-domains, of stimulating the ATPase activity of Hsp70, thereby stabilizing its interaction with substrate. In addition, J-proteins drive the functional diversity of Hsp70 chaperone systems through action of regions outside their J-domains. Targeting to specific locations within a cellular compartment and binding of specific substrates for delivery to Hsp70 have been identified as modes of J-protein specialization. To better understand J-protein specialization, we concentrated on Saccharomyces cerevisiae SIS1, which encodes an essential J-protein of the cytosol/nucleus. We selected suppressors that allowed cells lacking SIS1 to form colonies. Substitutions changing single residues in Ydj1, a J-protein, which, like Sis1, partners with Hsp70 Ssa1, were isolated. These gain-of-function substitutions were located at the end of the J-domain, suggesting that suppression was connected to interaction with its partner Hsp70, rather than substrate binding or subcellular localization. Reasoning that, if YDJ1 suppressors affect Ssa1 function, substitutions in Hsp70 itself might also be able to overcome the cellular requirement for Sis1, we carried out a selection for SSA1 suppressor mutations. Suppressing substitutions were isolated that altered sites in Ssa1 affecting the cycle of substrate interaction. Together, our results point to a third, additional means by which J-proteins can drive Hsp70's ability to function in a wide range of cellular processes-modulating the Hsp70-substrate interaction cycle.

Transcription elongation factor GreA has functional chaperone activity.

Science.gov (United States)

Li, Kun; Jiang, Tianyi; Yu, Bo; Wang, Limin; Gao, Chao; Ma, Cuiqing; Xu, Ping; Ma, Yanhe

2012-01-01

Bacterial GreA is an indispensable factor in the RNA polymerase elongation complex. It plays multiple roles in transcriptional elongation, and may be implicated in resistance to various stresses. In this study, we show that Escherichia coli GreA inhibits aggregation of several substrate proteins under heat shock condition. GreA can also effectively promote the refolding of denatured proteins. These facts reveal that GreA has chaperone activity. Distinct from many molecular chaperones, GreA does not form stable complexes with unfolded substrates. GreA overexpression confers the host cells with enhanced resistance to heat shock and oxidative stress. Moreover, GreA expression in the greA/greB double mutant could suppress the temperature-sensitive phenotype, and dramatically alleviate the in vivo protein aggregation. The results suggest that bacterial GreA may act as chaperone in vivo. These results suggest that GreA, in addition to its function as a transcription factor, is involved in protection of cellular proteins against aggregation.

Virus-Induced Chaperone-Enriched (VICE domains function as nuclear protein quality control centers during HSV-1 infection.

Directory of Open Access Journals (Sweden)

Christine M Livingston

2009-10-01

Full Text Available Virus-Induced Chaperone-Enriched (VICE domains form adjacent to nuclear viral replication compartments (RC during the early stages of HSV-1 infection. Between 2 and 3 hours post infection at a MOI of 10, host protein quality control machinery such as molecular chaperones (e.g. Hsc70, the 20S proteasome and ubiquitin are reorganized from a diffuse nuclear distribution pattern to sequestration in VICE domains. The observation that VICE domains contain putative misfolded proteins suggests that they may be similar to nuclear inclusion bodies that form under conditions in which the protein quality control machinery is overwhelmed by the presence of misfolded proteins. The detection of Hsc70 in VICE domains, but not in nuclear inclusion bodies, indicates that Hsc70 is specifically reorganized by HSV-1 infection. We hypothesize that HSV-1 infection induces the formation of nuclear protein quality control centers to remodel or degrade aberrant nuclear proteins that would otherwise interfere with productive infection. Detection of proteolytic activity in VICE domains suggests that substrates may be degraded by the 20S proteasome in VICE domains. FRAP analysis reveals that GFP-Hsc70 is dynamically associated with VICE domains, suggesting a role for Hsc70 in scanning the infected nucleus for misfolded proteins. During 42 degrees C heat shock, Hsc70 is redistributed from VICE domains into RC perhaps to remodel viral replication and regulatory proteins that have become insoluble in these compartments. The experiments presented in this paper suggest that VICE domains are nuclear protein quality control centers that are modified by HSV-1 to promote productive infection.

Decoding Structural Properties of a Partially Unfolded Protein Substrate: En Route to Chaperone Binding.

Science.gov (United States)

Nagpal, Suhani; Tiwari, Satyam; Mapa, Koyeli; Thukral, Lipi

2015-01-01

Many proteins comprising of complex topologies require molecular chaperones to achieve their unique three-dimensional folded structure. The E.coli chaperone, GroEL binds with a large number of unfolded and partially folded proteins, to facilitate proper folding and prevent misfolding and aggregation. Although the major structural components of GroEL are well defined, scaffolds of the non-native substrates that determine chaperone-mediated folding have been difficult to recognize. Here we performed all-atomistic and replica-exchange molecular dynamics simulations to dissect non-native ensemble of an obligate GroEL folder, DapA. Thermodynamics analyses of unfolding simulations revealed populated intermediates with distinct structural characteristics. We found that surface exposed hydrophobic patches are significantly increased, primarily contributed from native and non-native β-sheet elements. We validate the structural properties of these conformers using experimental data, including circular dichroism (CD), 1-anilinonaphthalene-8-sulfonic acid (ANS) binding measurements and previously reported hydrogen-deutrium exchange coupled to mass spectrometry (HDX-MS). Further, we constructed network graphs to elucidate long-range intra-protein connectivity of native and intermediate topologies, demonstrating regions that serve as central "hubs". Overall, our results implicate that genomic variations (or mutations) in the distinct regions of protein structures might disrupt these topological signatures disabling chaperone-mediated folding, leading to formation of aggregates.

Overexpression of the essential Sis1 chaperone reduces TDP-43 effects on toxicity and proteolysis

Science.gov (United States)

Park, Sei-Kyoung; Hong, Joo Y.; Arslan, Fatih; Tietsort, Alex; Tank, Elizabeth M. H.; Li, Xingli

2017-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43 overexpression dramatically alters cell shape and reduces ubiquitin dependent proteolysis of a reporter construct. Furthermore, we show that an excess of the Hsp40 chaperone, Sis1, reduced TDP-43’s effect on toxicity, cell shape and proteolysis. The strength of these effects was influenced by the presence of the endogenous yeast prion, [PIN+]. Although overexpression of Sis1 altered the TDP-43 aggregation pattern, we did not detect physical association of Sis1 with TDP-43, suggesting the possibility of indirect effects on TDP-43 aggregation. Furthermore, overexpression of the mammalian Sis1 homologue, DNAJB1, relieves TDP-43 mediated toxicity in primary rodent cortical neurons, suggesting that Sis1 and its homologues may have neuroprotective effects in ALS. PMID:28531192

Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus.

Science.gov (United States)

Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei

2011-07-01

ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.

Borracha de pneus como modificador de cimentos asfálticos para uso em obras de pavimentação

Directory of Open Access Journals (Sweden)

Sandra Oda

2001-05-01

Full Text Available Este trabalho apresenta estudo sobre a incorporação de borracha de pneus em ligantes asfálticos utilizados em obras de pavimentação. Trata-se de uma alternativa para solucionar um grave problema ambiental, pois no Brasil, anualmente, são descartados mais de 30 milhões de pneus, dos quais a maior parte é disposta em locais inadequados, servindo para a procriação de vetores de doenças e representando risco de contaminação do meio-ambiente. Os efeitos dos principais fatores que condicionam o comportamento do ligante asfalto-borracha (teor e granulometria da borracha, temperatura de mistura, tempo de reação são avaliados através de ensaios tradicionais de caracterização de ligantes asfálticos e ensaios do Método Superpave, diretamente relacionadas ao desempenho dos pavimentos no campo. Os resultados da análise estatística evidenciam o efeito preponderante do teor de borracha e, principalmente, que o ligante asfalto-borracha pode aumentar a resistência ao acúmulo de deformação permanente e ao aparecimento de trincas por fadiga do revestimento

Proteotoxicity is not the reason for the dependence of cancer cells on the major chaperone Hsp70.

Science.gov (United States)

Colvin, Teresa A; Gabai, Vladimir L; Sherman, Michael Y

2014-01-01

Several years ago a hypothesis was proposed that the survival of cancer cells depend on elevated expression of molecular chaperones because these cells are prone to proteotoxic stress. A critical prediction of this hypothesis is that depletion of chaperones in cancer cells should lead to proteotoxicity. Here, using the major chaperone Hsp70 as example, we demonstrate that its depletion does not trigger proteotoxic stress, thus refuting the model. Accordingly, other functions of chaperones, e.g., their role in cell signaling, might define the requirements for chaperones in cancer cells, which is critical for rational targeting Hsp70 in cancer treatment.

Low-power millimeter wave radiations do not alter stress-sensitive gene expression of chaperone proteins.

Science.gov (United States)

Zhadobov, M; Sauleau, R; Le Coq, L; Debure, L; Thouroude, D; Michel, D; Le Dréan, Y

2007-04-01

This article reports experimental results on the influence of low-power millimeter wave (MMW) radiation at 60 GHz on a set of stress-sensitive gene expression of molecular chaperones, namely clusterin (CLU) and HSP70, in a human brain cell line. Selection of the exposure frequency is determined by its near-future applications for the new broadband civil wireless communication systems including wireless local area networks (WLAN) for domestic and professional uses. Frequencies around 60 GHz are strongly attenuated in the earth's atmosphere and such radiations represent a new environmental factor. An exposure system operating in V-band (50-75 GHz) was developed for cell exposure. U-251 MG glial cell line was sham-exposed or exposed to MMW radiation for different durations (1-33 h) and two different power densities (5.4 microW/cm(2) or 0.54 mW/cm(2)). As gene expression is a multiple-step process, we analyzed chaperone proteins induction at different levels. First, using luciferase reporter gene, we investigated potential effect of MMWs on the activation of transcription factors (TFs) and gene promoter activity. Next, using RT-PCR and Western blot assays, we verified whether MMW exposure could alter RNA accumulation, translation, or protein stability. Experimental data demonstrated the absence of significant modifications in gene transcription, mRNA, and protein amount for the considered stress-sensitive genes for the exposure durations and power densities investigated. The main results of this study suggest that low-power 60 GHz radiation does not modify stress-sensitive gene expression of chaperone proteins. (c) 2006 Wiley-Liss, Inc.

Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination.

Science.gov (United States)

Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S

2010-04-01

In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

Coffee enhances the expression of chaperones and antioxidant proteins in rats with nonalcoholic fatty liver disease.

Science.gov (United States)

Salomone, Federico; Li Volti, Giovanni; Vitaglione, Paola; Morisco, Filomena; Fogliano, Vincenzo; Zappalà, Agata; Palmigiano, Angelo; Garozzo, Domenico; Caporaso, Nicola; D'Argenio, Giuseppe; Galvano, Fabio

2014-06-01

Coffee consumption is inversely related to the degree of liver injury in patients with nonalcoholic fatty liver disease (NAFLD). Molecular mediators contributing to coffee's beneficial effects in NAFLD remain to be elucidated. In this study, we administrated decaffeinated espresso coffee or vehicle to rats fed an high-fat diet (HFD) for 12 weeks and examined the effects of coffee on liver injury by using two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) proteomic analysis combined with mass spectrometry. Rats fed an HFD and water developed panacinar steatosis, lobular inflammation, and mild fibrosis, whereas rats fed an HFD and coffee exhibited only mild steatosis. Coffee consumption increased liver expression of the endoplasmic reticulum chaperones glucose-related protein 78 and protein disulfide-isomerase A3; similarly, coffee drinking enhanced the expression of the mitochondrial chaperones heat stress protein 70 and DJ-1. Furthermore, in agreement with reduced hepatic levels of 8-isoprostanes and 8-hydroxy-2'-deoxyguanosine, proteomic analysis showed that coffee consumption induces the expression of master regulators of redox status (i.e., peroxiredoxin 1, glutathione S-transferase α2, and D-dopachrome tautomerase). Last, proteomics revealed an association of coffee intake with decreased expression of electron transfer flavoprotein subunit α, a component of the mitochondrial respiratory chain, involved in de novo lipogenesis. In this study, we were able to identify by proteomic analysis the stress proteins mediating the antioxidant effects of coffee; moreover, we establish for the first time the contribution of specific coffee-induced endoplasmic reticulum and mitochondrial chaperones ensuring correct protein folding and degradation in the liver. Copyright © 2014 Mosby, Inc. All rights reserved.

Multiscale Modeling of a Conditionally Disordered pH-Sensing Chaperone

OpenAIRE

Ahlstrom, Logan S.; Law, Sean M.; Dickson, Alex; Brooks, Charles L.

2015-01-01

The pH-sensing chaperone HdeA promotes the survival of enteropathogenic bacteria during transit through the harshly acidic environment of the mammalian stomach. At low pH, HdeA transitions from an inactive, folded, dimer to chaperone-active, disordered, monomers to protect against the acid-induced aggregation of periplasmic proteins. Toward achieving a detailed mechanistic understanding of the pH response of HdeA, we develop a multiscale modeling approach to capture its pH-dependent thermodyn...

Decoding Structural Properties of a Partially Unfolded Protein Substrate: En Route to Chaperone Binding

Science.gov (United States)

Nagpal, Suhani; Tiwari, Satyam; Mapa, Koyeli; Thukral, Lipi

2015-01-01

Many proteins comprising of complex topologies require molecular chaperones to achieve their unique three-dimensional folded structure. The E.coli chaperone, GroEL binds with a large number of unfolded and partially folded proteins, to facilitate proper folding and prevent misfolding and aggregation. Although the major structural components of GroEL are well defined, scaffolds of the non-native substrates that determine chaperone-mediated folding have been difficult to recognize. Here we performed all-atomistic and replica-exchange molecular dynamics simulations to dissect non-native ensemble of an obligate GroEL folder, DapA. Thermodynamics analyses of unfolding simulations revealed populated intermediates with distinct structural characteristics. We found that surface exposed hydrophobic patches are significantly increased, primarily contributed from native and non-native β-sheet elements. We validate the structural properties of these conformers using experimental data, including circular dichroism (CD), 1-anilinonaphthalene-8-sulfonic acid (ANS) binding measurements and previously reported hydrogen-deutrium exchange coupled to mass spectrometry (HDX-MS). Further, we constructed network graphs to elucidate long-range intra-protein connectivity of native and intermediate topologies, demonstrating regions that serve as central “hubs”. Overall, our results implicate that genomic variations (or mutations) in the distinct regions of protein structures might disrupt these topological signatures disabling chaperone-mediated folding, leading to formation of aggregates. PMID:26394388

Loss-of-function mutations in co-chaperone BAG3 destabilize small HSPs and cause cardiomyopathy.

Science.gov (United States)

Fang, Xi; Bogomolovas, Julius; Wu, Tongbin; Zhang, Wei; Liu, Canzhao; Veevers, Jennifer; Stroud, Matthew J; Zhang, Zhiyuan; Ma, Xiaolong; Mu, Yongxin; Lao, Dieu-Hung; Dalton, Nancy D; Gu, Yusu; Wang, Celine; Wang, Michael; Liang, Yan; Lange, Stephan; Ouyang, Kunfu; Peterson, Kirk L; Evans, Sylvia M; Chen, Ju

2017-08-01

Defective protein quality control (PQC) systems are implicated in multiple diseases. Molecular chaperones and co-chaperones play a central role in functioning PQC. Constant mechanical and metabolic stress in cardiomyocytes places great demand on the PQC system. Mutation and downregulation of the co-chaperone protein BCL-2-associated athanogene 3 (BAG3) are associated with cardiac myopathy and heart failure, and a BAG3 E455K mutation leads to dilated cardiomyopathy (DCM). However, the role of BAG3 in the heart and the mechanisms by which the E455K mutation leads to DCM remain obscure. Here, we found that cardiac-specific Bag3-KO and E455K-knockin mice developed DCM. Comparable phenotypes in the 2 mutants demonstrated that the E455K mutation resulted in loss of function. Further experiments revealed that the E455K mutation disrupted the interaction between BAG3 and HSP70. In both mutants, decreased levels of small heat shock proteins (sHSPs) were observed, and a subset of proteins required for cardiomyocyte function was enriched in the insoluble fraction. Together, these observations suggest that interaction between BAG3 and HSP70 is essential for BAG3 to stabilize sHSPs and maintain cardiomyocyte protein homeostasis. Our results provide insight into heart failure caused by defects in BAG3 pathways and suggest that increasing BAG3 protein levels may be of therapeutic benefit in heart failure.

Molecular mechanisms used by chaperones to reduce the toxicity of aberrant protein oligomers

NARCIS (Netherlands)

Mannini, Benedetta; Cascella, Roberta; Zampagni, Mariagioia; Van Waarde-Verhagen, Maria; Meehan, Sarah; Roodveldt, Cintia; Campioni, Silvia; Boninsegna, Matilde; Penco, Amanda; Relini, Annalisa; Kampinga, Harm H.; Dobson, Christopher M.; Wilson, Mark R.; Cecchi, Cristina; Chiti, Fabrizio

2012-01-01

Chaperones are the primary regulators of the proteostasis network and are known to facilitate protein folding, inhibit protein aggregation, and promote disaggregation and clearance of misfolded aggregates inside cells. We have tested the effects of five chaperones on the toxicity of misfolded

Factibilidad de mezclas asfálticas de alto módulo con agregados del área de influencia de Tunja

Directory of Open Access Journals (Sweden)

Carlos Hernando Higuera Sandoval

2013-12-01

Full Text Available Se presentan los resultados del análisis de factibilidad de mezclas asfálticas de alto módulo (MAM con agregados pétreos provenientes de dos canteras del área de influencia de Tunja y asfalto modificado con polímeros tipo V. Las metodologías de diseño empleadas para determinar la fórmula de trabajo fueron Marshall y Ramcodes; el módulo dinámico de las respectivas mezclas se determinó por medio del ensayo de tracción indirecta en el equipo Nottingham Asphalt Tester – NAT–. Los resultados mostraron que las mezclas diseñadas tienen altos valores de flujo, lo que indica que se deforman fácilmente, y presentan valores de estabilidad superiores a las mezclas asfálticas convencionales; en cuanto al módulo dinámico, ninguna mezcla supera los 10.000 MPa a 20 ºC que exigen las especificaciones del INVIAS y del IDU; sin embargo, tomando como referencia la temperatura media anual ponderada de Tunja (13 ºC, una de las mezclas alcanza 11.000 MPa.

Transduced human copper chaperone for Cu,Zn-SOD (PEP-1-CCS) protects against neuronal cell death.

Science.gov (United States)

Choi, Soo Hyun; Kim, Dae Won; Kim, So Young; An, Jae Jin; Lee, Sun Hwa; Choi, Hee Soon; Sohn, Eun Jung; Hwang, Seok-Il; Won, Moo Ho; Kang, Tae-Cheon; Kwon, Hyung Joo; Kang, Jung Hoon; Cho, Sung-Woo; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

2005-12-31

Reactive oxygen species (ROS) contribute to the development of various human diseases. Cu,Zn-superoxide dismutase (SOD) is one of the major means by which cells counteract the deleterious effects of ROS. SOD activity is dependent upon bound copper ions supplied by its partner metallochaperone protein, copper chaperone for SOD (CCS). In the present study, we investigated the protective effects of PEP-1-CCS against neuronal cell death and ischemic insults. When PEP-1-CCS was added to the culture medium of neuronal cells, it rapidly entered the cells and protected them against paraquat-induced cell death. Moreover, transduced PEP-1-CCS markedly increased endogenous SOD activity in the cells. Immunohistochemical analysis revealed that it prevented neuronal cell death in the hippocampus in response to transient forebrain ischemia. These results suggest that CCS is essential to activate SOD, and that transduction of PEP-1-CCS provides a potential strategy for therapeutic delivery in various human diseases including stroke related to SOD or ROS.

Structural and Functional Consequences of Chaperone Site Deletion in αA-Crystallin

Science.gov (United States)

Santhoshkumar, Puttur; Karmakar, Srabani; Sharma, Krishna K.

2016-01-01

The chaperone-like activity of αA-crystallin has an important role in maintaining lens transparency. Previously we identified residues 70–88 as a chaperone site in αA-crystallin. In this study, we deleted the chaperone site residues to generate αAΔ70–76 and αAΔ70–88 mutants and investigated if there are additional substrate-binding sites in αA-crystallin. Both mutant proteins when expressed in E. coli formed inclusion bodies, and on solubilizing and refolding, they exhibited similar structural properties, with a 2- to 3-fold increase in molar mass compared to the molar mass of wild-type protein. The deletion mutants were less stable than the wild-type αA-crystallin. Functionally αAΔ70–88 was completely inactive as a chaperone, while αAΔ70–76 demonstrated a 40–50% reduction in anti-aggregation activity against alcohol dehydrogenase (ADH). Deletion of residues 70–88 abolished the ADH binding sites in αA-crystallin at physiological temperature. At 45 °C, cryptic ADH binding site(s) became exposed, which contributed subtly to the chaperone-like activity of αAΔ70–88. Both of the deletion mutants were completely inactive in suppressing aggregation of βL-crystallin at 53 °C. The mutants completely lost the anti-apoptotic property that αA-crystallin exhibits while they protected ARPE-19 (a human retinal pigment epithelial cell line) and primary human lens epithelial (HLE) cells from oxidative stress. Our studies demonstrate that residues 70–88 in αA-crystallin act as a primary substrate binding site and account for the bulk of the total chaperone activity. The β3 and β4 strands in αA-crystallin comprising 70–88 residues play an important role in maintenance of the structure and in preventing aggregation of denaturing proteins. PMID:27524665

The Yersinia enterocolitica type three secretion chaperone SycO is integrated into the Yop regulatory network and binds to the Yop secretion protein YscM1

Directory of Open Access Journals (Sweden)

Heesemann Jürgen

2007-07-01

Full Text Available Abstract Background Pathogenic yersiniae (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica share a virulence plasmid encoding a type three secretion system (T3SS. This T3SS comprises more than 40 constituents. Among these are the transport substrates called Yops (Yersinia outer proteins, the specific Yop chaperones (Sycs, and the Ysc (Yop secretion proteins which form the transport machinery. The effectors YopO and YopP are encoded on an operon together with SycO, the chaperone of YopO. The characterization of SycO is the focus of this study. Results We have established the large-scale production of recombinant SycO in its outright form. We confirm that Y. enterocolitica SycO forms homodimers which is typical for Syc chaperones. SycO overproduction in Y. enterocolitica decreases secretion of Yops into the culture supernatant suggesting a regulatory role of SycO in type III secretion. We demonstrate that in vitro SycO interacts with YscM1, a negative regulator of Yop expression in Y. enterocolitica. However, the SycO overproduction phenotype was not mediated by YscM1, YscM2, YopO or YopP as revealed by analysis of isogenic deletion mutants. Conclusion We present evidence that SycO is integrated into the regulatory network of the Yersinia T3SS. Our picture of the Yersinia T3SS interactome is supplemented by identification of the SycO/YscM1 interaction. Further, our results suggest that at least one additional interaction partner of SycO has to be identified.

Identification of the Vibrio parahaemolyticus type III secretion system 2-associated chaperone VocC for the T3SS2-specific effector VopC.

Science.gov (United States)

Akeda, Yukihiro; Kodama, Toshio; Saito, Kazunobu; Iida, Tetsuya; Oishi, Kazunori; Honda, Takeshi

2011-11-01

The enteropathogen Vibrio parahaemolyticus possesses two sets of type III secretion systems, T3SS1 and T3SS2. Effector proteins secreted by these T3SSs are delivered into host cells, leading to cell death or diarrhea. However, it is not known how specific effectors are secreted through a specific T3SS when both T3SSs are expressed within bacteria. One molecule thought to determine secretion specificity is a T3SS-associated chaperone; however, no T3SS2-specific chaperone has been identified. Therefore, we screened T3SS2 chaperone candidates by a pull-down assay using T3SS2 effectors fused with glutathione-S-transferase. A secretion assay revealed that the newly identified cognate chaperone VocC for the T3SS2-specific effector VopC was required for the efficient secretion of the substrate through T3SS2. Further experiments determined the chaperone-binding domain and the amino-terminal secretion signal of the cognate effector. These findings, in addition to the previously identified T3SS1-specific chaperone, VecA, provide a strategy to clarify the specificity of effector secretion through T3SSs of V. parahaemolyticus. 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Molecular Chaperones of Leishmania: Central Players in Many Stress-Related and -Unrelated Physiological Processes

Directory of Open Access Journals (Sweden)

Jose M. Requena

2015-01-01

Full Text Available Molecular chaperones are key components in the maintenance of cellular homeostasis and survival, not only during stress but also under optimal growth conditions. Folding of nascent polypeptides is supported by molecular chaperones, which avoid the formation of aggregates by preventing nonspecific interactions and aid, when necessary, the translocation of proteins to their correct intracellular localization. Furthermore, when proteins are damaged, molecular chaperones may also facilitate their refolding or, in the case of irreparable proteins, their removal by the protein degradation machinery of the cell. During their digenetic lifestyle, Leishmania parasites encounter and adapt to harsh environmental conditions, such as nutrient deficiency, hypoxia, oxidative stress, changing pH, and shifts in temperature; all these factors are potential triggers of cellular stress. We summarize here our current knowledge on the main types of molecular chaperones in Leishmania and their functions. Among them, heat shock proteins play important roles in adaptation and survival of this parasite against temperature changes associated with its passage from the poikilothermic insect vector to the warm-blooded vertebrate host. The study of structural features and the function of chaperones in Leishmania biology is providing opportunities (and challenges for drug discovery and improving of current treatments against leishmaniasis.

Molecular Chaperones of Leishmania: Central Players in Many Stress-Related and -Unrelated Physiological Processes

Science.gov (United States)

Requena, Jose M.; Montalvo, Ana M.; Fraga, Jorge

2015-01-01

Molecular chaperones are key components in the maintenance of cellular homeostasis and survival, not only during stress but also under optimal growth conditions. Folding of nascent polypeptides is supported by molecular chaperones, which avoid the formation of aggregates by preventing nonspecific interactions and aid, when necessary, the translocation of proteins to their correct intracellular localization. Furthermore, when proteins are damaged, molecular chaperones may also facilitate their refolding or, in the case of irreparable proteins, their removal by the protein degradation machinery of the cell. During their digenetic lifestyle, Leishmania parasites encounter and adapt to harsh environmental conditions, such as nutrient deficiency, hypoxia, oxidative stress, changing pH, and shifts in temperature; all these factors are potential triggers of cellular stress. We summarize here our current knowledge on the main types of molecular chaperones in Leishmania and their functions. Among them, heat shock proteins play important roles in adaptation and survival of this parasite against temperature changes associated with its passage from the poikilothermic insect vector to the warm-blooded vertebrate host. The study of structural features and the function of chaperones in Leishmania biology is providing opportunities (and challenges) for drug discovery and improving of current treatments against leishmaniasis. PMID:26167482

DAXX envelops a histone H3.3-H4 dimer for H3.3-specific recognition

Energy Technology Data Exchange (ETDEWEB)

Elsässer, Simon J; Huang, Hongda; Lewis, Peter W; Chin, Jason W; Allis, C David; Patel, Dinshaw J [MSKCC; (Rockefeller); (MRC)

2013-01-24

Histone chaperones represent a structurally and functionally diverse family of histone-binding proteins that prevent promiscuous interactions of histones before their assembly into chromatin. DAXX is a metazoan histone chaperone specific to the evolutionarily conserved histone variant H3.3. Here we report the crystal structures of the DAXX histone-binding domain with a histone H3.3–H4 dimer, including mutants within DAXX and H3.3, together with in vitro and in vivo functional studies that elucidate the principles underlying H3.3 recognition specificity. Occupying 40% of the histone surface-accessible area, DAXX wraps around the H3.3–H4 dimer, with complex formation accompanied by structural transitions in the H3.3–H4 histone fold. DAXX uses an extended α-helical conformation to compete with major inter-histone, DNA and ASF1 interaction sites. Our structural studies identify recognition elements that read out H3.3-specific residues, and functional studies address the contributions of Gly90 in H3.3 and Glu225 in DAXX to chaperone-mediated H3.3 variant recognition specificity.

A novel protease activity assay using a protease-responsive chaperone protein

International Nuclear Information System (INIS)

Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto

2009-01-01

Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

A novel protease activity assay using a protease-responsive chaperone protein

Energy Technology Data Exchange (ETDEWEB)

Sao, Kentaro [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Murata, Masaharu, E-mail: m-murata@dem.med.kyushu-u.ac.jp [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Fujisaki, Yuri; Umezaki, Kaori [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan); Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki [Graduate School of Systems Life Sciences, Kyushu University, 744 Motooka Nishi-ku, Fukuoka 819-0395 (Japan); Department of Applied Chemistry, Faculty of Engineering, Kyushu University, Nishi-ku Fukuoka 819-0395 (Japan); Center for Future Chemistry, Kyushu University, 744 Motooka, Nishi-ku, Fukuoka 819-0395 (Japan); Hashizume, Makoto [Department of Advanced Medical Initiatives, Faculty of Medical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku Fukuoka 812-8582 (Japan)

2009-06-05

Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

A Common Structural Motif in the Binding of Virulence Factors to Bacterial Secretion Chaperones

International Nuclear Information System (INIS)

Lilic, M.; Vujanac, M.; Stebbins, C.

2006-01-01

Salmonella invasion protein A (SipA) is translocated into host cells by a type III secretion system (T3SS) and comprises two regions: one domain binds its cognate type III secretion chaperone, InvB, in the bacterium to facilitate translocation, while a second domain functions in the host cell, contributing to bacterial uptake by polymerizing actin. We present here the crystal structures of the SipA chaperone binding domain (CBD) alone and in complex with InvB. The SipA CBD is found to consist of a nonglobular polypeptide as well as a large globular domain, both of which are necessary for binding to InvB. We also identify a structural motif that may direct virulence factors to their cognate chaperones in a diverse range of pathogenic bacteria. Disruption of this structural motif leads to a destabilization of several chaperone-substrate complexes from different species, as well as an impairment of secretion in Salmonella

Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

Science.gov (United States)

Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

2015-01-01

The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

The Role of Sigma-1 Receptor, an Intracellular Chaperone in Neurodegenerative Diseases.

Science.gov (United States)

Penke, Botond; Fulop, Livia; Szucs, Maria; Frecska, Ede

2018-01-01

Widespread protein aggregation occurs in the living system under stress or during aging, owing to disturbance of endoplasmic reticulum (ER) proteostasis. Many neurodegenerative diseases may have a common mechanism: the failure of protein homeostasis. Perturbation of ER results in unfolded protein response (UPR). Prolonged chronical UPR may activate apoptotic pathways and cause cell death. Research articles on Sigma-1 receptor were reviewed. ER is associated to mitochondria by the mitochondria-associated ER-membrane, MAM. The sigma-1 receptor (Sig-1R), a well-known ER-chaperone localizes in the MAM. It serves for Ca2+-signaling between the ER and mitochondria, involved in ion channel activities and especially important during neuronal differentiation. Sig-1R acts as central modulator in inter-organelle signaling. Sig-1R helps cell survival by attenuating ER-stress. According to sequence based predictions Sig-1R is a 223 amino acid protein with two transmembrane (2TM) domains. The X-ray structure of the Sig-1R [1] showed a membrane-bound trimeric assembly with one transmembrane (1TM) region. Despite the in vitro determined assembly, the results of in vivo studies are rather consistent with the 2TM structure. The receptor has unique and versatile pharmacological profile. Dimethyl tryptamine (DMT) and neuroactive steroids are endogenous ligands that activate Sig-1R. The receptor has a plethora of interacting client proteins. Sig-1R exists in oligomeric structures (dimer-trimer-octamer-multimer) and this fact may explain interaction with diverse proteins. Sig-1R agonists have been used in the treatment of different neurodegenerative diseases, e.g. Alzheimer's and Parkinson's diseases (AD and PD) and amyotrophic lateral sclerosis. Utilization of Sig-1R agents early in AD and similar other diseases has remained an overlooked therapeutic opportunity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The heat shock protein-90 co-chaperone, Cyclophilin 40, promotes ALK-positive, anaplastic large cell lymphoma viability and its expression is regulated by the NPM-ALK oncoprotein

International Nuclear Information System (INIS)

Pearson, Joel D; Mohammed, Zubair; Bacani, Julinor T C; Lai, Raymond; Ingham, Robert J

2012-01-01

Anaplastic lymphoma kinase-positive, anaplastic large cell lymphoma (ALK+ ALCL) is a T cell lymphoma defined by the presence of chromosomal translocations involving the ALK tyrosine kinase gene. These translocations generate fusion proteins (e.g. NPM-ALK) with constitutive tyrosine kinase activity, which activate numerous signalling pathways important for ALK+ ALCL pathogenesis. The molecular chaperone heat shock protein-90 (Hsp90) plays a critical role in allowing NPM-ALK and other signalling proteins to function in this lymphoma. Co-chaperone proteins are important for helping Hsp90 fold proteins and for directing Hsp90 to specific clients; however the importance of co-chaperone proteins in ALK+ ALCL has not been investigated. Our preliminary findings suggested that expression of the immunophilin co-chaperone, Cyclophilin 40 (Cyp40), is up-regulated in ALK+ ALCL by JunB, a transcription factor activated by NPM-ALK signalling. In this study we examined the regulation of the immunophilin family of co-chaperones by NPM-ALK and JunB, and investigated whether the immunophilin co-chaperones promote the viability of ALK+ ALCL cell lines. NPM-ALK and JunB were knocked-down in ALK+ ALCL cell lines with siRNA, and the effect on the expression of the three immunophilin co-chaperones: Cyp40, FK506-binding protein (FKBP) 51, and FKBP52 examined. Furthermore, the effect of knock-down of the immunophilin co-chaperones, either individually or in combination, on the viability of ALK+ ALCL cell lines and NPM-ALK levels and activity was also examined. We found that NPM-ALK promoted the transcription of Cyp40 and FKBP52, but only Cyp40 transcription was promoted by JunB. We also observed reduced viability of ALK+ ALCL cell lines treated with Cyp40 siRNA, but not with siRNAs directed against FKBP52 or FKBP51. Finally, we demonstrate that the decrease in the viability of ALK+ ALCL cell lines treated with Cyp40 siRNA does not appear to be due to a decrease in NPM-ALK levels or the

Pharmacological chaperone reshapes the energy landscape for folding and aggregation of the prion protein

Science.gov (United States)

Gupta, Amar Nath; Neupane, Krishna; Rezajooei, Negar; Cortez, Leonardo M.; Sim, Valerie L.; Woodside, Michael T.

2016-06-01

The development of small-molecule pharmacological chaperones as therapeutics for protein misfolding diseases has proven challenging, partly because their mechanism of action remains unclear. Here we study Fe-TMPyP, a tetrapyrrole that binds to the prion protein PrP and inhibits misfolding, examining its effects on PrP folding at the single-molecule level with force spectroscopy. Single PrP molecules are unfolded with and without Fe-TMPyP present using optical tweezers. Ligand binding to the native structure increases the unfolding force significantly and alters the transition state for unfolding, making it more brittle and raising the barrier height. Fe-TMPyP also binds the unfolded state, delaying native refolding. Furthermore, Fe-TMPyP binding blocks the formation of a stable misfolded dimer by interfering with intermolecular interactions, acting in a similar manner to some molecular chaperones. The ligand thus promotes native folding by stabilizing the native state while also suppressing interactions driving aggregation.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

OpenAIRE

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...

Cytosolic iron chaperones: Proteins delivering iron cofactors in the cytosol of mammalian cells.

Science.gov (United States)

Philpott, Caroline C; Ryu, Moon-Suhn; Frey, Avery; Patel, Sarju

2017-08-04

Eukaryotic cells contain hundreds of metalloproteins that are supported by intracellular systems coordinating the uptake and distribution of metal cofactors. Iron cofactors include heme, iron-sulfur clusters, and simple iron ions. Poly(rC)-binding proteins are multifunctional adaptors that serve as iron ion chaperones in the cytosolic/nuclear compartment, binding iron at import and delivering it to enzymes, for storage (ferritin) and export (ferroportin). Ferritin iron is mobilized by autophagy through the cargo receptor, nuclear co-activator 4. The monothiol glutaredoxin Glrx3 and BolA2 function as a [2Fe-2S] chaperone complex. These proteins form a core system of cytosolic iron cofactor chaperones in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Obtenção do módulo dinâmico de misturas asfálticas com agregados sintéticos de argila calcinada, utilizando o ensaio de compressão diametral

Directory of Open Access Journals (Sweden)

Fábio Roberto Garcia Nunes

2009-11-01

Full Text Available

No Brasil, o módulo dinâmico de misturas asfálticas ainda é pouco utilizado, sobretudo por ser, em regra, obtido por intermédio do estado de compressão ou da tração axial, a necessitar, em razão disso, de corpos de prova com aproximadamente 200 mm de altura, a partir de um compactador giratório. Tal imperativo dificulta os estudos realizados com amostras retiradas diretamente do pavimento. Neste trabalho, determinou-se o citado parâmetro por meio do ensaio de compressão diametral em corpos de prova compactados (Marshall de misturas asfálticas, nas dimensões 101,5 × 63,50 mm. Figuraram como agregados graúdos os agregados sintéticos de argila calcinada (ASAC. Os resultados se mostraram equivalentes entre as misturas asfálticas com ASAC e segundo o ensaio de compressão diametral com aqueles obtidos pelo trabalho de KING (2004, quando utilizado o ensaio de compressão axial.

Modulation of chaperone-like and membranolytic activities of major ...

Indian Academy of Sciences (India)

C Sudheer Kumar

2017-06-20

Jun 20, 2017 ... Keywords. Capacitation; membranolytic activity; molecular chaperone; oxidative stress ... also shown to extract phospholipids from the membrane resulting ..... Gulcin I 2006 Antioxidant and antiradical activities of L-carnitine.

Probing molecular mechanisms of the Hsp90 chaperone: biophysical modeling identifies key regulators of functional dynamics.

Directory of Open Access Journals (Sweden)

Anshuman Dixit

Full Text Available Deciphering functional mechanisms of the Hsp90 chaperone machinery is an important objective in cancer biology aiming to facilitate discovery of targeted anti-cancer therapies. Despite significant advances in understanding structure and function of molecular chaperones, organizing molecular principles that control the relationship between conformational diversity and functional mechanisms of the Hsp90 activity lack a sufficient quantitative characterization. We combined molecular dynamics simulations, principal component analysis, the energy landscape model and structure-functional analysis of Hsp90 regulatory interactions to systematically investigate functional dynamics of the molecular chaperone. This approach has identified a network of conserved regions common to the Hsp90 chaperones that could play a universal role in coordinating functional dynamics, principal collective motions and allosteric signaling of Hsp90. We have found that these functional motifs may be utilized by the molecular chaperone machinery to act collectively as central regulators of Hsp90 dynamics and activity, including the inter-domain communications, control of ATP hydrolysis, and protein client binding. These findings have provided support to a long-standing assertion that allosteric regulation and catalysis may have emerged via common evolutionary routes. The interaction networks regulating functional motions of Hsp90 may be determined by the inherent structural architecture of the molecular chaperone. At the same time, the thermodynamics-based "conformational selection" of functional states is likely to be activated based on the nature of the binding partner. This mechanistic model of Hsp90 dynamics and function is consistent with the notion that allosteric networks orchestrating cooperative protein motions can be formed by evolutionary conserved and sparsely connected residue clusters. Hence, allosteric signaling through a small network of distantly connected

Roles of spin fluctuation and frustration in the superconductivity of β-(BDA-TTP)2X (X=SbF6,AsF6) under uniaxial compression

Science.gov (United States)

Ito, Hiroshi; Ishihara, Tetsuo; Tanaka, Hisaaki; Kuroda, Shin-Ichi; Suzuki, Takeo; Onari, Seiichiro; Tanaka, Yukio; Yamada, Jun-Ichi; Kikuchi, Koichi

2008-11-01

β -type BDA-TTP [ BDA-TTP=2,5 -bis(1,3-dithian-2-ylidene)-1,3,4,6-tetrathiapentalene] salts possess high transition temperatures TC reaching 7 K among organic superconductors. TC of β-(BDA-TTP)2X (X=SbF6,AsF6) is studied by resistive measurements under uniaxial compression. TC once increases and takes a maximum under compression parallel to the donor stack while it decreases under compression perpendicular to the donor stack. These results are in agreement with the half-filled Hubbard model on the triangular lattice in which the compression controls the spin fluctuation and frustration in the weak pressure region.

Development of GMP-1 a molecular chaperone network modulator protecting mitochondrial function and its assessment in fly and mice models of Alzheimer's disease.

Science.gov (United States)

Pavlov, Pavel F; Hutter-Paier, Birgit; Havas, Daniel; Windisch, Manfred; Winblad, Bengt

2018-04-27

Mitochondrial dysfunction is an early feature of Alzheimer's disease (AD) and may play an important role in the pathogenesis of disease. It has been shown that amyloid beta peptide (Aβ) and amyloid precursor protein (APP) interact with mitochondria contributing to the mitochondrial dysfunction in AD. Prevention of abnormal protein targeting to mitochondria can protect normal mitochondrial function, increase neuronal survival and at the end, ameliorate symptoms of AD and other neurodegenerative disorders. First steps of mitochondrial protein import are coordinated by molecular chaperones Hsp70 and Hsp90 that bind to the newly synthesized mitochondria-destined proteins and deliver them to the protein import receptors on the surface of organelle. Here, we have described the development of a novel compound named GMP-1 that disrupts interactions between Hsp70/Hsp90 molecular chaperones and protein import receptor Tom70. GMP-1 treatment of SH-SY5Y cells results in decrease in mitochondria-associated APP and protects SH-SY5Y cells from toxic effect of Aβ 1-42 exposure. Experiments in drosophila and mice models of AD demonstrated neuroprotective effect of GMP-1 treatment, improvement in memory and behaviour tests as well as restoration of mitochondrial function. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

The Clp Chaperones and Proteases of the Human Malaria Parasite Plasmodium falciparum

Energy Technology Data Exchange (ETDEWEB)

Bakkouri, Majida El; Pow, Andre; Mulichak, Anne; Cheung, Kevin L.Y.; Artz, Jennifer D.; Amani, Mehrnaz; Fell, Stuart; de Koning-Ward, Tania F.; Goodman, C. Dean; McFadden, Geoffrey I.; Ortega, Joaquin; Hui, Raymond; Houry, Walid A. (McMaster U.); (Melbourne); (Toronto); (Deakin); (HWMRI)

2015-02-09

The Clp chaperones and proteases play an important role in protein homeostasis in the cell. They are highly conserved across prokaryotes and found also in the mitochondria of eukaryotes and the chloroplasts of plants. They function mainly in the disaggregation, unfolding and degradation of native as well as misfolded proteins. Here, we provide a comprehensive analysis of the Clp chaperones and proteases in the human malaria parasite Plasmodium falciparum. The parasite contains four Clp ATPases, which we term PfClpB1, PfClpB2, PfClpC and PfClpM. One PfClpP, the proteolytic subunit, and one PfClpR, which is an inactive version of the protease, were also identified. Expression of all Clp chaperones and proteases was confirmed in blood-stage parasites. The proteins were localized to the apicoplast, a non-photosynthetic organelle that accommodates several important metabolic pathways in P. falciparum, with the exception of PfClpB2 (also known as Hsp101), which was found in the parasitophorous vacuole. Both PfClpP and PfClpR form mostly homoheptameric rings as observed by size-exclusion chromatography, analytical ultracentrifugation and electron microscopy. The X-ray structure of PfClpP showed the protein as a compacted tetradecamer similar to that observed for Streptococcus pneumoniae and Mycobacterium tuberculosis ClpPs. Our data suggest the presence of a ClpCRP complex in the apicoplast of P. falciparum.

Structure of Spa15, a type III secretion chaperone from Shigella flexneri with broad specificity

NARCIS (Netherlands)

Eerde, André van; Hamiaux, Cyril; Pérez, Javier; Parsot, Claude; Dijkstra, Bauke W.

2004-01-01

Type III secretion (TTS) systems are used by many Gram-negative pathogens to inject virulence proteins into the cells of their hosts. Several of these virulence effectors require TTS chaperones that maintain them in a secretion-competent state. Whereas most chaperones bind only one effector, Spa15

Streptococcus mutans copper chaperone, CopZ, is critical for biofilm formation and competitiveness.

Science.gov (United States)

Garcia, S S; Du, Q; Wu, H

2016-12-01

The oral cavity is a dynamic environment characterized by hundreds of bacterial species, saliva, and an influx of nutrients and metal ions such as copper. Although there is a physiologic level of copper in the saliva, the oral cavity is often challenged with an influx of copper ions. At high concentrations copper is toxic and must therefore be strictly regulated by pathogens for them to persist and cause disease. The cariogenic pathogen Streptococcus mutans manages excess copper using the copYAZ operon that encodes a negative DNA-binding repressor (CopY), the P1-ATPase copper exporter (CopA), and the copper chaperone (CopZ). These hypothetical roles of the copYAZ operon in regulation and copper transport to receptors led us to investigate their contribution to S. mutans virulence. Mutants defective in the copper chaperone CopZ, but not CopY or CopA, were impaired in biofilm formation and competitiveness against commensal streptococci. Characterization of the CopZ mutant biofilm revealed a decreased secretion of glucosyltransferases and reduced expression of mutacin genes. These data suggest that the function of copZ on biofilm and competitiveness is independent of copper resistance and CopZ is a global regulator for biofilm and other virulence factors. Further characterization of CopZ may lead to the identification of new biofilm pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Presence of chaperones during pelvic examinations in southeast ...

African Journals Online (AJOL)

2012-12-12

Dec 12, 2012 ... preferred male physicians and 88 (38.3%) had no gender preference. ... is recommended as a standard practice by many medical ... Department of Obstetrics and Gynecology, University of Nigeria ... and eliminates postconsultation bias. .... chaperones gave prevention of sexual harassment as a reason.

Influencia de la temperatura y nivel de energía de compactación en las propiedades dinámicas de una mezcla asfáltica

Directory of Open Access Journals (Sweden)

Óscar Javier Reyes Ortiz

2006-01-01

Full Text Available La temperatura de las mezclas asfálticas varía significativamente desde su producción en la planta hasta la conformación de la estructura de pavimento, especialmente en el proceso de compactación. Estas diferencias de temperatura de la mezcla de un punto a otro, generan segregación, microfisuras, superficies onduladas, desgarramientos y especialmente cambios en las propiedades mecánicas y dinámicas de la mezcla.En este estudio de laboratorio se determinó el efecto en el módulo dinámico, densidad, estabilidad y flujo de una mezcla asfáltica con granulometría 0/10 y asfalto con penetración 60/70, al variar la temperatura de compactación. Se establece que al compactar muestras entre 100 y 150 ºC existe descenso del orden de 30% en el módulo dinámico, 5% en la densidad y 50% en la estabilidad.

Preliminary X-ray diffraction analysis of CfaA, a molecular chaperone essential for the assembly of CFA/I fimbriae of human enterotoxigenic Escherichia coli.

Science.gov (United States)

Bao, Rui; Esser, Lothar; Poole, Steven; McVeigh, Annette; Chen, Yu Xing; Savarino, Stephen J; Xia, Di

2014-02-01

Understanding of pilus bioassembly in Gram-negative bacteria stems mainly from studies of P pili and type 1 fimbriae of uropathogenic Escherichia coli, which are mediated by the classic chaperone-usher pathway (CUP). However, CFA/I fimbriae, a class 5 fimbria and intestinal colonization factor for enterotoxigenic E. coli (ETEC), are proposed to assemble via the alternate chaperone pathway (ACP). Both CUP and ACP fimbrial bioassembly pathways require the function of a periplasmic chaperone, but their corresponding proteins share very low similarity in primary sequence. Here, the crystallization of the CFA/I periplasmic chaperone CfaA by the hanging-drop vapor-diffusion method is reported. X-ray diffraction data sets were collected from a native CfaA crystal to 2 Å resolution and to 1.8 and 2.8 Å resolution, respectively, from a lead and a platinum derivative. These crystals displayed the symmetry of space group C2, with unit-cell parameters a = 103.6, b = 28.68, c = 90.60 Å, β = 119.7°. Initial phases were derived from multiple isomorphous replacement with anomalous scattering experiments using the data from the platinum and lead derivatives. This resulted in an interpretable electron-density map showing one CfaA molecule in an asymmetric unit. Sequence assignments were aided by anomalous signals from the heavy-atom derivatives. Refinement of the atomic model of CfaA is ongoing, which is expected to further understanding of the essential aspects and allowable variations in tertiary structure of the greater family of chaperones involved in chaperone-usher mediated bioassembly.

Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

Science.gov (United States)

Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

2011-02-01

The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

BtcA, A class IA type III chaperone, interacts with the BteA N-terminal domain through a globular/non-globular mechanism.

Directory of Open Access Journals (Sweden)

Chen Guttman

Full Text Available Bordetella pertussis, the etiological agent of "whooping cough" disease, utilizes the type III secretion system (T3SS to deliver a 69 kDa cytotoxic effector protein, BteA, directly into the host cells. As with other T3SS effectors, prior to its secretion BteA binds BtcA, a 13.9 kDa protein predicted to act as a T3SS class IA chaperone. While this interaction had been characterized for such effector-chaperone pairs in other pathogens, it has yet to be fully investigated in Bordetella. Here we provide the first biochemical proof that BtcA is indeed a class IA chaperone, responsible for the binding of BteA's N-terminal domain. We bring forth extensive evidence that BtcA binds its substrate effector through a dual-interface binding mechanism comprising of non-globular and bi-globular interactions at a moderate micromolar level binding affinity. We demonstrate that the non-globular interactions involve the first 31 N-terminal residues of BteA287 and their removal leads to destabilization of the effector-chaperone complex and lower binding affinities to BtcA. These findings represent an important first step towards a molecular understanding of BteA secretion and cell entry.

Endoplasmic reticulum chaperone glucose regulated protein 170-Pokemon complexes elicit a robust antitumor immune response in vivo.

Science.gov (United States)

Yuan, Bangqing; Xian, Ronghua; Wu, Xianqu; Jing, Junjie; Chen, Kangning; Liu, Guojun; Zhou, Zhenhua

2012-07-01

Previous evidence suggested that the stress protein grp170 can function as a highly efficient molecular chaperone, binding to large protein substrates and acting as a potent vaccine against specific tumors when purified from the same tumor. In addition, Pokemon can be found in almost all malignant tumor cells and is regarded to be a promising candidate for the treatment of tumors. However, the potential of the grp170-Pokemon chaperone complex has not been well described. In the present study, the natural chaperone complex between grp170 and the Pokemon was formed by heat shock, and its immunogenicity was detected by ELISPOT and (51)Cr-release assays in vitro and by tumor bearing models in vivo. Our results demonstrated that the grp170-Pokemon chaperone complex could elicit T cell responses as determined by ELISPOT and (51)Cr-release assays. In addition, immunized C57BL/6 mice were challenged with subcutaneous (s.c.) injection of Lewis cancer cells to induce primary tumors. Treatment of mice with the grp170-Pokemon chaperone complex also significantly inhibited tumor growth and prolonged the life span of tumor-bearing mice. Our results indicated that the grp170-Pokemon chaperone complex might represent a powerful approach to tumor immunotherapy and have significant potential for clinical application. Copyright © 2012 Elsevier GmbH. All rights reserved.

Drug Development in Conformational Diseases: A Novel Family of Chemical Chaperones that Bind and Stabilise Several Polymorphic Amyloid Structures.

Directory of Open Access Journals (Sweden)

Marquiza Sablón-Carrazana

Full Text Available The increasing prevalence of conformational diseases, including Alzheimer's disease, type 2 Diabetes Mellitus and Cancer, poses a global challenge at many different levels. It has devastating effects on the sufferers as well as a tremendous economic impact on families and the health system. In this work, we apply a cross-functional approach that combines ideas, concepts and technologies from several disciplines in order to study, in silico and in vitro, the role of a novel chemical chaperones family (NCHCHF in processes of protein aggregation in conformational diseases. Given that Serum Albumin (SA is the most abundant protein in the blood of mammals, and Bovine Serum Albumin (BSA is an off-the-shelf protein available in most labs around the world, we compared the ligandability of BSA:NCHCHF with the interaction sites in the Human Islet Amyloid Polypeptide (hIAPP:NCHCHF, and in the amyloid pharmacophore fragments (Aβ17-42 and Aβ16-21:NCHCHF. We posit that the merging of this interaction sites is a meta-structure of pharmacophore which allows the development of chaperones that can prevent protein aggregation at various states from: stabilizing the native state to destabilizing oligomeric state and protofilament. Furthermore to stabilize fibrillar structures, thus decreasing the amount of toxic oligomers in solution, as is the case with the NCHCHF. The paper demonstrates how a set of NCHCHF can be used for studying and potentially treating the various physiopathological stages of a conformational disease. For instance, when dealing with an acute phase of cytotoxicity, what is needed is the recruitment of cytotoxic oligomers, thus chaperone F, which accelerates fiber formation, would be very useful; whereas in a chronic stage it is better to have chaperones A, B, C, and D, which stabilize the native and fibril structures halting self-catalysis and the creation of cytotoxic oligomers as a consequence of fiber formation. Furthermore, all the

Kinetics and thermodynamics of the thermal inactivation and chaperone assisted folding of zebrafish dihydrofolate reductase.

Science.gov (United States)

Thapliyal, Charu; Jain, Neha; Rashid, Naira; Chaudhuri Chattopadhyay, Pratima

2018-01-01

The maintenance of thermal stability is a major issue in protein engineering as many proteins tend to form inactive aggregates at higher temperatures. Zebrafish DHFR, an essential protein for the survival of cells, shows irreversible thermal unfolding transition. The protein exhibits complete unfolding and loss of activity at 50 °C as monitored by UV-Visible, fluorescence and far UV-CD spectroscopy. The heat induced inactivation of zDHFR follows first-order kinetics and Arrhenius law. The variation in the value of inactivation rate constant, k with increasing temperatures depicts faster inactivation at elevated temperatures. We have attempted to study the chaperoning ability of a shorter variant of GroEL (minichaperone) and compared it with that of conventional GroEL-GroES chaperone system. Both the chaperone system prevented the aggregation and assisted in refolding of zDHFR. The rate of thermal inactivation was significantly retarded in the presence of chaperones which indicate that it enhances the thermal stability of the enzyme. As minichaperone is less complex, and does not require high energy co-factors like ATP, for its function as compared to conventional GroEL-GroES system, it can act as a very good in vitro as well as in vivo chaperone model for monitoring assisted protein folding phenomenon. Copyright © 2017 Elsevier Inc. All rights reserved.

Fluorinated Chaperone-β-Cyclodextrin Formulations for β-Glucocerebrosidase Activity Enhancement in Neuronopathic Gaucher Disease.

Science.gov (United States)

García-Moreno, M Isabel; de la Mata, Mario; Sánchez-Fernández, Elena M; Benito, Juan M; Díaz-Quintana, Antonio; Fustero, Santos; Nanba, Eiji; Higaki, Katsumi; Sánchez-Alcázar, José A; García Fernández, José M; Ortiz Mellet, Carmen

2017-03-09

Amphiphilic glycomimetics encompassing a rigid, undistortable nortropane skeleton based on 1,6-anhydro-l-idonojirimycin and a polyfluorinated antenna, when formulated as the corresponding inclusion complexes with β-cyclodextrin (βCD), have been shown to behave as pharmacological chaperones (PCs) that efficiently rescue lysosomal β-glucocerebrosidase mutants associated with the neuronopathic variants of Gaucher disease (GD), including the highly refractory L444P/L444P and L444P/P415R single nucleotide polymorphs, in patient fibroblasts. The body of work here presented includes the design criteria for the PC prototype, the synthesis of a series of candidates, the characterization of the PC:βCD complexes, the determination of the selectivity profiles toward a panel of commercial and human lysosomal glycosidases, the evaluation of the chaperoning activity in type 1 (non-neuronopathic), type 2 (acute neuronopathic), and type 3 (adult neuronopathic) GD fibroblasts, the confirmation of the rescuing mechanism by immunolabeling, and the analysis of the PC:GCase binding mode by docking experiments.

Different contributions of HtrA protease and chaperone activities to Campylobacter jejuni stress tolerance and physiology

DEFF Research Database (Denmark)

Bæk, Kristoffer Torbjørn; Vegge, Christina Skovgaard; Skórko-Glonek, Joanna

2011-01-01

activity is sufficient for growth at high temperature or oxidative stress, whereas the HtrA protease activity is only essential at conditions close to the growth limit for C. jejuni. However, the protease activity was required to prevent induction of the cytoplasmic heat-shock response even at optimal......The microaerophilic bacterium Campylobacter jejuni is the most common cause of bacterial food-borne infections in the developed world. Tolerance to environmental stress relies on proteases and chaperones in the cell envelope such as HtrA and SurA. HtrA displays both chaperone and protease activity......, but little is known about how each of these activities contributes to stress tolerance in bacteria. In vitro experiments showed temperature dependent protease and chaperone activities of C. jejuni HtrA. A C. jejuni mutant lacking only the protease activity of HtrA was used to show that the HtrA chaperone...

Modulation of chromatin structure by the FACT histone chaperone complex regulates HIV-1 integration.

Science.gov (United States)

Matysiak, Julien; Lesbats, Paul; Mauro, Eric; Lapaillerie, Delphine; Dupuy, Jean-William; Lopez, Angelica P; Benleulmi, Mohamed Salah; Calmels, Christina; Andreola, Marie-Line; Ruff, Marc; Llano, Manuel; Delelis, Olivier; Lavigne, Marc; Parissi, Vincent

2017-07-28

Insertion of retroviral genome DNA occurs in the chromatin of the host cell. This step is modulated by chromatin structure as nucleosomes compaction was shown to prevent HIV-1 integration and chromatin remodeling has been reported to affect integration efficiency. LEDGF/p75-mediated targeting of the integration complex toward RNA polymerase II (polII) transcribed regions ensures optimal access to dynamic regions that are suitable for integration. Consequently, we have investigated the involvement of polII-associated factors in the regulation of HIV-1 integration. Using a pull down approach coupled with mass spectrometry, we have selected the FACT (FAcilitates Chromatin Transcription) complex as a new potential cofactor of HIV-1 integration. FACT is a histone chaperone complex associated with the polII transcription machinery and recently shown to bind LEDGF/p75. We report here that a tripartite complex can be formed between HIV-1 integrase, LEDGF/p75 and FACT in vitro and in cells. Biochemical analyzes show that FACT-dependent nucleosome disassembly promotes HIV-1 integration into chromatinized templates, and generates highly favored nucleosomal structures in vitro. This effect was found to be amplified by LEDGF/p75. Promotion of this FACT-mediated chromatin remodeling in cells both increases chromatin accessibility and stimulates HIV-1 infectivity and integration. Altogether, our data indicate that FACT regulates HIV-1 integration by inducing local nucleosomes dissociation that modulates the functional association between the incoming intasome and the targeted nucleosome.

Treatment of Fabry's Disease with the Pharmacologic Chaperone Migalastat

DEFF Research Database (Denmark)

Germain, Dominique P; Hughes, Derralynn A; Nicholls, Kathleen

2016-01-01

BACKGROUND: Fabry's disease, an X-linked disorder of lysosomal α-galactosidase deficiency, leads to substrate accumulation in multiple organs. Migalastat, an oral pharmacologic chaperone, stabilizes specific mutant forms of α-galactosidase, increasing enzyme trafficking to lysosomes. METHODS: The...

Activation of CuZn superoxide dismutases from Caenorhabditis elegans does not require the copper chaperone CCS.

Science.gov (United States)

Jensen, Laran T; Culotta, Valeria Cizewski

2005-12-16

Reactive oxygen species are produced as the direct result of aerobic metabolism and can cause damage to DNA, proteins, and lipids. A principal defense against reactive oxygen species involves the superoxide dismutases (SOD) that act to detoxify superoxide anions. Activation of CuZn-SODs in eukaryotic cells occurs post-translationally and is generally dependent on the copper chaperone for SOD1 (CCS), which inserts the catalytic copper cofactor and catalyzes the oxidation of a conserved disulfide bond that is essential for activity. In contrast to other eukaryotes, the nematode Caenorhabditis elegans does not contain an obvious CCS homologue, and we have found that the C. elegans intracellular CuZn-SODs (wSOD-1 and wSOD-5) are not dependent on CCS for activation when expressed in Saccharomyces cerevisiae. CCS-independent activation of CuZn-SODs is not unique to C. elegans; however, this is the first organism identified that appears to exclusively use this alternative pathway. As was found for mammalian SOD1, wSOD-1 exhibits a requirement for reduced glutathione in CCS-independent activation. Unexpectedly, wSOD-1 was inactive even in the presence of CCS when glutathione was depleted. Our investigation of the cysteine residues that form the disulfide bond in wSOD-1 suggests that the ability of wSODs to readily form this disulfide bond may be the key to obtaining high levels of activation through the CCS-independent pathway. Overall, these studies demonstrate that the CuZn-SODs of C. elegans have uniquely evolved to acquire copper without the copper chaperone and this may reflect the lifestyle of this organism.

Molecular and biochemical characterization of a unique mutation in CCS, the human copper chaperone to superoxide dismutase

DEFF Research Database (Denmark)

Huppke, Peter; Brendel, Cornelia; Korenke, Georg Christoph

2012-01-01

chaperone mutations have been described to date. We describe a child from a consanguineous family who inherited homozygous mutations in the SLC33A1, encoding an acetyl CoA transporter, and in CCS, encoding the Cu chaperone for superoxide dismutase. The CCS mutation, p.Arg163Trp, predicts substitution...... of a highly conserved arginine residue at position 163, with tryptophan in domain II of CCS, which interacts directly with superoxide dismutase 1 (SOD1). Biochemical analyses of the patient's fibroblasts, mammalian cell transfections, immunoprecipitation assays, and Lys7Δ (CCS homolog) yeast complementation...... support the pathogenicity of the mutation. Expression of CCS was reduced and binding of CCS to SOD1 impaired. As a result, this mutation causes reduced SOD1 activity and may impair other mechanisms important for normal Cu homeostasis. CCS-Arg163Trp represents the primary example of a human mutation...

Rescue of a pathogenic mutant human glucagon receptor by pharmacological chaperones.

Science.gov (United States)

Yu, Run; Chen, Chun-Rong; Liu, Xiaohong; Kodra, János T

2012-10-01

We have previously demonstrated that a homozygous inactivating P86S mutation of the glucagon receptor (GCGR) causes a novel human disease of hyperglucagonemia, pancreatic α-cell hyperplasia, and pancreatic neuroendocrine tumors (Mahvash disease). The mechanisms for the decreased activity of the P86S mutant (P86S) are abnormal receptor localization to the endoplasmic reticulum (ER) and defective interaction with glucagon. To search for targeted therapies for Mahvash disease, we examined whether P86S can be trafficked to the plasma membrane by pharmacological chaperones and whether novel glucagon analogs restore effective receptor interaction. We used enhanced green fluorescent protein-tagged P86S stably expressed in HEK 293 cells to allow fluorescence imaging and western blotting and molecular modeling to design novel glucagon analogs in which alanine 19 was replaced with serine or asparagine. Incubation at 27 °C largely restored normal plasma membrane localization and normal processing of P86S but osmotic chaperones had no effects. The ER stressors thapsigargin and curcumin partially rescued P86S. The lipophilic GCGR antagonist L-168,049 also partially rescued P86S, so did Cpd 13 and 15 to a smaller degree. The rescued P86S led to more glucagon-stimulated cAMP production and was internalized by glucagon. Compared with the native glucagon, the novel glucagon analogs failed to stimulate more cAMP production by P86S. We conclude that the mutant GCGR is partially rescued by several pharmacological chaperones and our data provide proof-of-principle evidence that Mahvash disease can be potentially treated with pharmacological chaperones. The novel glucagon analogs, however, failed to interact with P86S more effectively.

Efficacy of Alkali-treated Sugarcane Fiber for Improving Physicochemical and Textural Properties of Meat Emulsions with Different Fat Levels

Science.gov (United States)

Kim, Hyun-Wook; Setyabrata, Derico; Lee, Yong-Jae; Brad Kim, Yuan H.

2018-01-01

Abstract The objective of this study was to evaluate the efficacy of alkaline-treated sugarcane bagasse fiber on physicochemical and textural properties of meat emulsion with different fat levels. Crude sugarcane bagasse fiber (CSF) was treated with calcium hydroxide (Ca(OH2)) to obtain alkaline-treated sugarcane bagasse fiber (ASF). The two types of sugarcane bagasse fiber (CSF and ASF) were incorporated at 2% levels in pork meat emulsions prepared with 5%, 10% and 20% fat levels. Alkaline-treatment markedly increased acid detergent fiber content (p=0.002), but significantly decreased protein, fat, ash and other carbohydrate contents. ASF exhibited significantly higher water-binding capacity, but lower oil-binding and emulsifying capacities than CSF. Meat emulsions formulated with 10% fat and 2% sugarcane bagasse fiber had equivalent cooking loss and textural properties to control meat emulsion (20% fat without sugarcane bagasse fiber). The two types of sugarcane bagasse fiber had similar impacts on proximate composition, cooking yield and texture of meat emulsion at the same fat level, respectively (p>0.05). Our results confirm that sugarcane bagasse fiber could be a functional food ingredient for improving physicochemical and textural properties of meat emulsion, at 2% addition level. Further, the altered functional properties of alkaline-treated sugarcane bagasse fiber had no impacts on physicochemical and textural properties of meat emulsions, regardless of fat level at 5%, 10% and 20%. PMID:29805281

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

Science.gov (United States)

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265

Heat shock protein 90 (Hsp90) chaperone complex. A molecular target for enhancement of thermosensitivity and radiosensitivity

International Nuclear Information System (INIS)

Akimoto, Tetsuo; Nonaka, Tetsuo; Kitamoto, Yoshizumi; Sakurai, Hideyuki

2002-01-01

Heat shock protein 90 (Hsp90) is a highly conserved heat shock protein in animal and plants, and exists abundantly in the cytoplasm in unstressed condition, accounting for 1-2% in cytoplasmic proteins. Main difference of Hsp90 from other Hsps are its substrate that Hsp90 binds to. These substrates include various signal transduction proteins, kinase, steroid receptors and transcription factors, therefore, Hsp90 plays a key role in maintaining cellular signal transduction networks. Many chaperoned proteins (client proteins) of Hsp90 are associated with cellular proliferation or malignant transformation, thus Hsp90 chaperone complex has been focused as targets for cancer therapy. Among the client proteins, there are several molecules that have been defined as targets or factors for determination or enhancement of radiosensitivity or thermosensitivity. Thus, it is easily speculated that Hsp90 chaperone complex inhibitors that disrupt association of Hsp90 and client protein in combination with radiation or/and heat has potential effect on enhancement of radiosensitivity or thermosensitivity. In this paper, possible mechanisms in enhancing radiosensitivity or thermosensitivity according to the client proteins will be summarized. (author)

Hsp40s specify functions of Hsp104 and Hsp90 protein chaperone machines.

Directory of Open Access Journals (Sweden)

Michael Reidy

2014-10-01

Full Text Available Hsp100 family chaperones of microorganisms and plants cooperate with the Hsp70/Hsp40/NEF system to resolubilize and reactivate stress-denatured proteins. In yeast this machinery also promotes propagation of prions by fragmenting prion polymers. We previously showed the bacterial Hsp100 machinery cooperates with the yeast Hsp40 Ydj1 to support yeast thermotolerance and with the yeast Hsp40 Sis1 to propagate [PSI+] prions. Here we find these Hsp40s similarly directed specific activities of the yeast Hsp104-based machinery. By assessing the ability of Ydj1-Sis1 hybrid proteins to complement Ydj1 and Sis1 functions we show their C-terminal substrate-binding domains determined distinctions in these and other cellular functions of Ydj1 and Sis1. We find propagation of [URE3] prions was acutely sensitive to alterations in Sis1 activity, while that of [PIN+] prions was less sensitive than [URE3], but more sensitive than [PSI+]. These findings support the ideas that overexpressing Ydj1 cures [URE3] by competing with Sis1 for interaction with the Hsp104-based disaggregation machine, and that different prions rely differently on activity of this machinery, which can explain the various ways they respond to alterations in chaperone function.

The heat shock protein/chaperone network and multiple stress resistance

KAUST Repository

Jacob, Pierre; Hirt, Heribert; Bendahmane, Abdelhafid

2016-01-01

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multi-stress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone

The heat shock protein/chaperone network and multiple stress resistance

KAUST Repository

Jacob, Pierre

2016-11-15

Crop yield has been greatly enhanced during the last century. However, most elite cultivars are adapted to temperate climates and are not well suited to more stressful conditions. In the context of climate change, stress resistance is a major concern. To overcome these difficulties, scientists may help breeders by providing genetic markers associated with stress resistance. However, multi-stress resistance cannot be obtained from the simple addition of single stress resistance traits. In the field, stresses are unpredictable and several may occur at once. Consequently, the use of single stress resistance traits is often inadequate. Although it has been historically linked with the heat stress response, the heat shock protein (HSP)/chaperone network is a major component of multiple stress responses. Among the HSP/chaperone

Disaggregases, molecular chaperones that resolubilize protein aggregates

Directory of Open Access Journals (Sweden)

David Z. Mokry

2015-08-01

Full Text Available The process of folding is a seminal event in the life of a protein, as it is essential for proper protein function and therefore cell physiology. Inappropriate folding, or misfolding, can not only lead to loss of function, but also to the formation of protein aggregates, an insoluble association of polypeptides that harm cell physiology, either by themselves or in the process of formation. Several biological processes have evolved to prevent and eliminate the existence of non-functional and amyloidogenic aggregates, as they are associated with several human pathologies. Molecular chaperones and heat shock proteins are specialized in controlling the quality of the proteins in the cell, specifically by aiding proper folding, and dissolution and clearance of already formed protein aggregates. The latter is a function of disaggregases, mainly represented by the ClpB/Hsp104 subfamily of molecular chaperones, that are ubiquitous in all organisms but, surprisingly, have no orthologs in the cytosol of metazoan cells. This review aims to describe the characteristics of disaggregases and to discuss the function of yeast Hsp104, a disaggregase that is also involved in prion propagation and inheritance.

Activation of sigma-1 receptor chaperone in the treatment of neuropsychiatric diseases and its clinical implication

Directory of Open Access Journals (Sweden)

Kenji Hashimoto

2015-01-01

Full Text Available Endoplasmic reticulum (ER protein sigma-1 receptor represents unique chaperone activity in the central nervous system, and it exerts a potent influence on a number of neurotransmitter systems. Several lines of evidence suggest that activation of sigma-1 receptor plays a role in the pathophysiology of neuropsychiatric diseases, as well as in the mechanisms of some therapeutic drugs and neurosteroids. Preclinical studies showed that some selective serotonin reuptake inhibitors (SSRIs; fluvoxamine, fluoxetine, excitalopram, donepezil, and ifenprodil act as sigma-1 receptor agonists. Furthermore, sigma-1 receptor agonists could improve the N-methyl-D-aspartate (NMDA antagonist phencyclidine (PCP-induced cognitive deficits in mice. A study using positron emission tomography have demonstrated that an oral administration of fluvoxamine or donepezil could bind to sigma-1 receptor in the healthy human brain, suggesting that sigma-1 receptor might be involved in the therapeutic mechanisms of these drugs. Moreover, case reports suggest that sigma-1 receptor agonists, including fluvoxamine, and ifenprodil, may be effective in the treatment of cognitive impairment in schizophrenia, delirium in elderly people, and flashbacks in post-traumatic stress disorder. In this review article, the author would like to discuss the clinical implication of sigma-1 receptor agonists, including endogenous neurosteroids, in the neuropsychiatric diseases.

Interplay between Molecular Chaperones and the Ubiquitin-Proteasome System in Targeting of Misfolded Proteins for Degradation

DEFF Research Database (Denmark)

Poulsen, Esben Guldahl

interacting with purified 26S proteasomes, and the subsequent characterization of two novel proteasome interacting proteins. The third study was aimed at analyzing the chaperone-assisted pathway leading to degradation of misfolded kinetochore proteins in S. pombe. In this study chaperones, E2s, E3s and DUBs...

Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity.

Science.gov (United States)

Park, Chang-Jin; Seo, Young-Su

2015-12-01

As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs) functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs) or resistance (R) proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER) HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.

Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity

Directory of Open Access Journals (Sweden)

Chang-Jin Park

2015-12-01

Full Text Available As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs or resistance (R proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.

Hsp90 chaperone inhibitor 17-AAG attenuates Aβ-induced synaptic toxicity and memory impairment.

Science.gov (United States)

Chen, Yaomin; Wang, Bin; Liu, Dan; Li, Jing Jing; Xue, Yueqiang; Sakata, Kazuko; Zhu, Ling-qiang; Heldt, Scott A; Xu, Huaxi; Liao, Francesca-Fang

2014-02-12

The excessive accumulation of soluble amyloid peptides (Aβ) plays a crucial role in the pathogenesis of Alzheimer's disease (AD), particularly in synaptic dysfunction. The role of the two major chaperone proteins, Hsp70 and Hsp90, in clearing misfolded protein aggregates has been established. Despite their abundant presence in synapses, the role of these chaperones in synapses remains elusive. Here, we report that Hsp90 inhibition by 17-AAG elicited not only a heat shock-like response but also upregulated presynaptic and postsynaptic proteins, such as synapsin I, synaptophysin, and PSD95 in neurons. 17-AAG treatment enhanced high-frequency stimulation-evoked LTP and protected neurons from synaptic damage induced by soluble Aβ. In AD transgenic mice, the daily administration of 17-AAG over 7 d resulted in a marked increase in PSD95 expression in hippocampi. 17-AAG treatments in wild-type C57BL/6 mice challenged by soluble Aβ significantly improved contextual fear memory. Further, we demonstrate that 17-AAG activated synaptic protein expression via transcriptional mechanisms through the heat shock transcription factor HSF1. Together, our findings identify a novel function of Hsp90 inhibition in regulating synaptic plasticity, in addition to the known neuroprotective effects of the chaperones against Aβ and tau toxicity, thus further supporting the potential of Hsp90 inhibitors in treating neurodegenerative diseases.

Molecular transformers in the cell: lessons learned from the DegP protease-chaperone.

Science.gov (United States)

Sawa, Justyna; Heuck, Alexander; Ehrmann, Michael; Clausen, Tim

2010-04-01

Structure-function analysis of DegP revealed a novel mechanism for protease and chaperone regulation. Binding of unfolded proteins induces the oligomer reassembly from the resting hexamer (DegP6) into the functional protease-chaperone DegP12/24. The newly formed cage exhibits the characteristics of a proteolytic folding chamber, shredding those proteins that are severely misfolded while stabilizing and protecting proteins present in their native state. Isolation of native DegP complexes with folded outer membrane proteins (OMPs) highlights the importance of DegP in OMP biogenesis. The encapsulated OMP beta-barrel is significantly stabilized in the hydrophobic chamber of DegP12/24 and thus DegP seems to employ a reciprocal mechanism to those chaperones assisting the folding of water soluble proteins via polar interactions. In addition, we discuss in this review similarities to other complex proteolytic machines that, like DegP, are under control of a substrate-induced or stress-induced oligomer conversion.

Choline Kinase Alpha as an Androgen Receptor Chaperone and Prostate Cancer Therapeutic Target

Science.gov (United States)

Asim, Mohammad; Massie, Charles E.; Orafidiya, Folake; Pértega-Gomes, Nelma; Warren, Anne Y.; Esmaeili, Mohsen; Selth, Luke A.; Zecchini, Heather I.; Luko, Katarina; Qureshi, Arham; Baridi, Ajoeb; Menon, Suraj; Madhu, Basetti; Escriu, Carlos; Lyons, Scott; Vowler, Sarah L.; Zecchini, Vincent R.; Shaw, Greg; Hessenkemper, Wiebke; Russell, Roslin; Mohammed, Hisham; Stefanos, Niki; Lynch, Andy G.; Grigorenko, Elena; D’Santos, Clive; Taylor, Chris; Lamb, Alastair; Sriranjan, Rouchelle; Yang, Jiali; Stark, Rory; Dehm, Scott M.; Rennie, Paul S.; Carroll, Jason S.; Griffiths, John R.; Tavaré, Simon; Mills, Ian G.; McEwan, Iain J.; Baniahmad, Aria; Tilley, Wayne D.; Neal, David E.

2016-01-01

Background: The androgen receptor (AR) is a major drug target in prostate cancer (PCa). We profiled the AR-regulated kinome to identify clinically relevant and druggable effectors of AR signaling. Methods: Using genome-wide approaches, we interrogated all AR regulated kinases. Among these, choline kinase alpha (CHKA) expression was evaluated in benign (n = 195), prostatic intraepithelial neoplasia (PIN) (n = 153) and prostate cancer (PCa) lesions (n = 359). We interrogated how CHKA regulates AR signaling using biochemical assays and investigated androgen regulation of CHKA expression in men with PCa, both untreated (n = 20) and treated with an androgen biosynthesis inhibitor degarelix (n = 27). We studied the effect of CHKA inhibition on the PCa transcriptome using RNA sequencing and tested the effect of CHKA inhibition on cell growth, clonogenic survival and invasion. Tumor xenografts (n = 6 per group) were generated in mice using genetically engineered prostate cancer cells with inducible CHKA knockdown. Data were analyzed with χ2 tests, Cox regression analysis, and Kaplan-Meier methods. All statistical tests were two-sided. Results: CHKA expression was shown to be androgen regulated in cell lines, xenografts, and human tissue (log fold change from 6.75 to 6.59, P = .002) and was positively associated with tumor stage. CHKA binds directly to the ligand-binding domain (LBD) of AR, enhancing its stability. As such, CHKA is the first kinase identified as an AR chaperone. Inhibition of CHKA repressed the AR transcriptional program including pathways enriched for regulation of protein folding, decreased AR protein levels, and inhibited the growth of PCa cell lines, human PCa explants, and tumor xenografts. Conclusions: CHKA can act as an AR chaperone, providing, to our knowledge, the first evidence for kinases as molecular chaperones, making CHKA both a marker of tumor progression and a potential therapeutic target for PCa. PMID:26657335

In vitro reconstitution of chaperone-mediated human RISC assembly.

Science.gov (United States)

Naruse, Ken; Matsuura-Suzuki, Eriko; Watanabe, Mariko; Iwasaki, Shintaro; Tomari, Yukihide

2018-01-01

To silence target mRNAs, small RNAs and Argonaute (Ago) proteins need to be assembled into RNA-induced silencing complexes (RISCs). Although the assembly of Drosophila melanogaster RISC was recently reconstituted by Ago2, the Dicer-2/R2D2 heterodimer, and five chaperone proteins, the absence of a reconstitution system for mammalian RISC assembly has posed analytical challenges. Here we describe reconstitution of human RISC assembly using Ago2 and five recombinant chaperone proteins: Hsp90β, Hsc70, Hop, Dnaja2, and p23. Our data show that ATP hydrolysis by both Hsp90β and Hsc70 is required for RISC assembly of small RNA duplexes but not for that of single-stranded RNAs. The reconstitution system lays the groundwork for further studies of small RNA-mediated gene silencing in mammals. © 2018 Naruse et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Unfolded Protein Response-regulated Drosophila Fic (dFic) Protein Reversibly AMPylates BiP Chaperone during Endoplasmic Reticulum Homeostasis*

Science.gov (United States)

Ham, Hyeilin; Woolery, Andrew R.; Tracy, Charles; Stenesen, Drew; Krämer, Helmut; Orth, Kim

2014-01-01

Drosophila Fic (dFic) mediates AMPylation, a covalent attachment of adenosine monophosphate (AMP) from ATP to hydroxyl side chains of protein substrates. Here, we identified the endoplasmic reticulum (ER) chaperone BiP as a substrate for dFic and mapped the modification site to Thr-366 within the ATPase domain. The level of AMPylated BiP in Drosophila S2 cells is high during homeostasis, whereas the level of AMPylated BiP decreases upon the accumulation of misfolded proteins in the ER. Both dFic and BiP are transcriptionally activated upon ER stress, supporting the role of dFic in the unfolded protein response pathway. The inactive conformation of BiP is the preferred substrate for dFic, thus endorsing a model whereby AMPylation regulates the function of BiP as a chaperone, allowing acute activation of BiP by deAMPylation during an ER stress response. These findings not only present the first substrate of eukaryotic AMPylator but also provide a target for regulating the unfolded protein response, an emerging avenue for cancer therapy. PMID:25395623

Possible Function of Molecular Chaperones in Diseases Caused by Propagating Amyloid Aggregates

Directory of Open Access Journals (Sweden)

Vladimir F. Lazarev

2017-05-01

Full Text Available The vast majority of neurodegenerative pathologies stem from the formation of toxic oligomers and aggregates composed of wrongly folded proteins. These protein complexes can be released from pathogenic cells and enthralled by other cells, causing the formation of new aggregates in a prion-like manner. By this mechanism, migrating complexes can transmit a disorder to distant regions of the brain and promote gradually transmitting degenerative processes. Molecular chaperones can counteract the toxicity of misfolded proteins. In this review, we discuss recent data on the possible cytoprotective functions of chaperones in horizontally transmitting neurological disorders.

Investigation of original multivalent iminosugars as pharmacological chaperones for the treatment of Gaucher disease.

Science.gov (United States)

Laigre, Eugénie; Hazelard, Damien; Casas, Josefina; Serra-Vinardell, Jenny; Michelakakis, Helen; Mavridou, Irene; Aerts, Johannes M F G; Delgado, Antonio; Compain, Philippe

2016-06-24

Multivalent iminosugars conjugated with a morpholine moiety and/or designed as prodrugs have been prepared and evaluated as new classes of pharmacological chaperones for the treatment of Gaucher disease. This study further confirms the interest of the prodrug concept and shows that the addition of a lysosome-targeting morpholine unit into iminosugar cluster structures has no significant impact on the chaperone activity on Gaucher cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

The identification and characterization of nucleic acid chaperone activity of human enterovirus 71 nonstructural protein 3AB.

Science.gov (United States)

Tang, Fenfen; Xia, Hongjie; Wang, Peipei; Yang, Jie; Zhao, Tianyong; Zhang, Qi; Hu, Yuanyang; Zhou, Xi

2014-09-01

Human enterovirus 71 (EV71) belongs to the genus Enterovirus in the family Picornaviridae and has been recognized as one of the most important pathogens that cause emerging infectious disease. Despite of the importance of EV71, the nonstructural protein 3AB from this virus is little understood for its function during EV71 replication. Here we expressed EV71 3AB protein as recombinant protein in a eukaryotic expression system and uncovered that this protein possesses a nucleic acid helix-destabilizing and strand annealing acceleration activity in a dose-dependent manner, indicating that EV71 3AB is a nucleic acid chaperone protein. Moreover, we characterized the RNA chaperone activity of EV71 3AB, and revealed that divalent metal ions, such as Mg(2+) and Zn(2+), were able to inhibit the RNA helix-destabilizing activity of 3AB to different extents. Moreover, we determined that 3B plus the last 7 amino acids at the C-terminal of 3A (termed 3B+7) possess the RNA chaperone activity, and five amino acids, i.e. Lys-80, Phe-82, Phe-85, Tyr-89, and Arg-103, are critical and probably the active sites of 3AB for its RNA chaperone activity. This report reveals that EV71 3AB displays an RNA chaperone activity, adds a new member to the growing list of virus-encoded RNA chaperones, and provides novel knowledge about the virology of EV71. Copyright © 2014 Elsevier Inc. All rights reserved.

Metal chaperones: a holistic approach to the treatment of AD

Directory of Open Access Journals (Sweden)

Paul Anthony Adlard

2012-03-01

Full Text Available As the burden of proof for the role of metal ion dysregulation in the pathogenesis of multiple CNS disorders grows, it has become important to more precisely identify and differentiate the biological effects of various pharmacological modulators of metal ion homeostasis. This is particularly evident in disorders such as Alzheimer’s disease, where the use of metal chaperones (that transport metals, as opposed to chelators (which exclude metals from biological interactions, may prove to be the first truly disease modifying approach for this condition. The purpose of this mini-review is to highlight the emerging notion that metal chaperones, such as PBT2 (Prana Biotechnology, modulate a variety of critical pathways affecting key aspects of the AD cascade to provide a more holistic approach to the treatment of this disease.

Molecular chaperones in targeting misfolded proteins for ubiquitin-dependent degradation

DEFF Research Database (Denmark)

Kriegenburg, Franziska; Ellgaard, Lars; Hartmann-Petersen, Rasmus

2012-01-01

The accumulation of misfolded proteins presents a considerable threat to the health of individual cells and has been linked to severe diseases, including neurodegenerative disorders. Considering that, in nature, cells often are exposed to stress conditions that may lead to aberrant protein...... conformational changes, it becomes clear that they must have an efficient quality control apparatus to refold or destroy misfolded proteins. In general, cells rely on molecular chaperones to seize and refold misfolded proteins. If the native state is unattainable, misfolded proteins are targeted for degradation...... via the ubiquitin-proteasome system. The specificity of this proteolysis is generally provided by E3 ubiquitin-protein ligases, hundreds of which are encoded in the human genome. However, rather than binding the misfolded proteins directly, most E3s depend on molecular chaperones to recognize...

Preparation of chromatographically pure specimens, crystallization, and X-ray diffraction study of the periplasmatic chaperone protein Caf1M from Y. Pestis

International Nuclear Information System (INIS)

Mikhailov, A.M.; Vainshtein, B.K.; Chernovskaya, T.V.; Vasil'ev, A.M.; Rudenko, E.G.; Abramov, V.M.; Zav'yalov, V.P.; Kornev, A.N.; Kornilov, V.V.; Karlyshev, A.V.; MacIntyre, Sh.

1999-01-01

The for growing conditions perfect single crystals of the protein Caf1M have been established. The unit-cell parameters of the crystals are (a=112.6 A, b=78.1 A, c=65.3 A, sp. gr. P2 1 2 1 2 1 ), molecular weight is 28 kDa), which is a representative of molecular periplasmatic chaperones, were found. This investigation is the first necessary stage of determination the three-dimensional structure of this biomacromolecule at atomic resolution. Taking into account that the primary amino acid sequences of the protein Caf1M and of the structurally studied protein PapD and also their secondary structures are homologous, the phase problem can be solved by the molecular replacement method

Cytosolic chaperones mediate quality control of higher-order septin assembly in budding yeast.

Science.gov (United States)

Johnson, Courtney R; Weems, Andrew D; Brewer, Jennifer M; Thorner, Jeremy; McMurray, Michael A

2015-04-01

Septin hetero-oligomers polymerize into cytoskeletal filaments with essential functions in many eukaryotic cell types. Mutations within the oligomerization interface that encompasses the GTP-binding pocket of a septin (its "G interface") cause thermoinstability of yeast septin hetero-oligomer assembly, and human disease. When coexpressed with its wild-type counterpart, a G interface mutant is excluded from septin filaments, even at moderate temperatures. We show that this quality control mechanism is specific to G interface mutants, operates during de novo septin hetero-oligomer assembly, and requires specific cytosolic chaperones. Chaperone overexpression lowers the temperature permissive for proliferation of cells expressing a G interface mutant as the sole source of a given septin. Mutations that perturb the septin G interface retard release from these chaperones, imposing a kinetic delay on the availability of nascent septin molecules for higher-order assembly. Un-expectedly, the disaggregase Hsp104 contributes to this delay in a manner that does not require its "unfoldase" activity, indicating a latent "holdase" activity toward mutant septins. These findings provide new roles for chaperone-mediated kinetic partitioning of non-native proteins and may help explain the etiology of septin-linked human diseases. © 2015 Johnson et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Role of the HSPA9/HSC20 chaperone pair in promoting directional human iron-sulfur cluster exchange involving monothiol glutaredoxin 5.

Science.gov (United States)

Olive, Joshua A; Cowan, J A

2018-07-01

Iron‑sulfur clusters are essential cofactors found across all domains of life. Their assembly and transfer are accomplished by highly conserved protein complexes and partners. In eukaryotes a [2Fe-2S] cluster is first assembled in the mitochondria on the iron‑sulfur cluster scaffold protein ISCU in tandem with iron, sulfide, and electron donors. Current models suggest that a chaperone pair interacts with a cluster-bound ISCU to facilitate cluster transfer to a monothiol glutaredoxin. In humans this protein is glutaredoxin 5 (GLRX5) and the cluster can then be exchanged with a variety of target apo proteins. By use of circular dichroism spectroscopy, the kinetics of cluster exchange reactivity has been evaluated for human GLRX5 with a variety of cluster donor and acceptor partners, and the role of chaperones determined for several of these. In contrast to the prokaryotic model, where heat-shock type chaperone proteins HscA and HscB are required for successful and efficient transfer of a [2Fe-2S] cluster from the ISCU scaffold to a monothiol glutaredoxin. However, in the human system the chaperone homologs, HSPA9 and HSC20, are not necessary for human ISCU to promote cluster transfer to GLRX5, and appear to promote the reverse transfer. Cluster exchange with the human iron‑sulfur cluster carrier protein NFU1 and ferredoxins (FDX's), and the role of chaperones, has also been evaluated, demonstrating in certain cases control over the directionality of cluster transfer. In contrast to other prokaryotic and eukaryotic organisms, NFU1 is identified as a more likely physiological donor of [2Fe-2S] cluster to human GLRX5 than ISCU. Copyright © 2018 Elsevier Inc. All rights reserved.

Can foreign proteins imported into yeast mitochondria interfere with PIM1p protease and/or chaperone function?

Science.gov (United States)

Saveliev, A S; Kovaleva, I E; Novikova, L A; Isaeva, L V; Luzikov, V N

1999-03-15

When studying the fate of mammalian apocytochrome P450scc (apo-P450scc) imported in small amounts into isolated yeast mitochondria, we found that it undergoes degradation, this process being retarded if recipient mitochondria are preloaded in vivo (to about 0.2% of total organelle protein) with a fusion protein composed of mammalian adrenodoxin reductase and adrenodoxin (AdR-Ad); in parallel we observed aggregation of apo-P450scc. These effects suggest some overload of Pim1p protease and/or mtHsp70 system by AdR-Ad, as both of them are involved in the degradation of apo-P450scc (see Savel'ev et al. J. Biol. Chem. 273, 20596-20602, 1998). However, under the same conditions AdR-Ad was not able to impede the import of proteins into mitochondria and the development of the mitochondrial respiratory machinery in yeast, the processes requiring the mtHsp70 system and Pim1p, respectively. These data imply that chaperones and Pim1p protease prefer their natural targets in mitochondria to imported foreign proteins. Copyright 1999 Academic Press.

Import, maturation, and function of SOD1 and its copper chaperone CCS in the mitochondrial intermembrane space.

Science.gov (United States)

Kawamata, Hibiki; Manfredi, Giovanni

2010-11-01

Cu, Zn, superoxide dismutase (SOD1) is a ubiquitous enzyme localized in multiple cellular compartments, including mitochondria, where it concentrates in the intermembrane space (IMS). Similar to other small IMS proteins, the import and retention of SOD1 in the IMS is linked to its folding and maturation, involving the formation of critical intra- and intermolecular disulfide bonds. Therefore, the cysteine residues of SOD1 play a fundamental role in its IMS localization. IMS import of SOD1 involves its copper chaperone, CCS, whose mitochondrial distribution is regulated by the Mia40/Erv1 disulfide relay system in a redox-dependent manner: CCS promotes SOD1 maturation and retention in the IMS. The function of SOD1 in the IMS is still unknown, but it is plausible that it serves to remove superoxide released from the mitochondrial respiratory chain. Mutations in SOD1 cause familial amyotrophic lateral sclerosis (ALS), whose pathologic features include mitochondrial bioenergetic dysfunction. Mutant SOD1 localization in the IMS is not dictated by oxygen concentration and the Mia40/Erv1 system, but is primarily dependent on aberrant protein folding and aggregation. Mutant SOD1 localization and aggregation in the IMS might cause the mitochondrial abnormalities observed in familial ALS and could play a significant role in disease pathogenesis.

MiR-17-5p impairs trafficking of H-ERG K+ channel protein by targeting multiple er stress-related chaperones during chronic oxidative stress.

Directory of Open Access Journals (Sweden)

Qi Wang

Full Text Available BACKGROUND: To investigate if microRNAs (miRNAs play a role in regulating h-ERG trafficking in the setting of chronic oxidative stress as a common deleterious factor for many cardiac disorders. METHODS: We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H2O2 for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR. Protein levels of chaperones and h-ERG trafficking were measured by Western blot analysis. Luciferase reporter gene assay was used to study miRNA and target interactions. Whole-cell patch-clamp techniques were employed to record h-ERG K(+ current. RESULTS: H-ERG trafficking was impaired by H2O2 after 48 h treatment, accompanied by reciprocal changes of expression between miR-17-5p seed miRNAs and several chaperones (Hsp70, Hsc70, CANX, and Golga2, with the former upregulated and the latter downregulated. We established these chaperones as targets for miR-17-5p. Application miR-17-5p inhibitor rescued H2O2-induced impairment of h-ERG trafficking. Upregulation of endogenous by H2O2 or forced miR-17-5p expression either reduced h-ERG current. Sequestration of AP1 by its decoy molecule eliminated the upregulation of miR-17-5p, and ameliorated impairment of h-ERG trafficking. CONCLUSIONS: Collectively, deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, in the setting of prolonged duration of oxidative stress. These findings revealed the role of miRNAs in h-ERG trafficking, which may contribute to the cardiac electrical disturbances associated with oxidative stress.

MiR-17-5p impairs trafficking of H-ERG K+ channel protein by targeting multiple er stress-related chaperones during chronic oxidative stress.

Science.gov (United States)

Wang, Qi; Hu, Weina; Lei, Mingming; Wang, Yong; Yan, Bing; Liu, Jun; Zhang, Ren; Jin, Yuanzhe

2013-01-01

To investigate if microRNAs (miRNAs) play a role in regulating h-ERG trafficking in the setting of chronic oxidative stress as a common deleterious factor for many cardiac disorders. We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H2O2 for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR. Protein levels of chaperones and h-ERG trafficking were measured by Western blot analysis. Luciferase reporter gene assay was used to study miRNA and target interactions. Whole-cell patch-clamp techniques were employed to record h-ERG K(+) current. H-ERG trafficking was impaired by H2O2 after 48 h treatment, accompanied by reciprocal changes of expression between miR-17-5p seed miRNAs and several chaperones (Hsp70, Hsc70, CANX, and Golga2), with the former upregulated and the latter downregulated. We established these chaperones as targets for miR-17-5p. Application miR-17-5p inhibitor rescued H2O2-induced impairment of h-ERG trafficking. Upregulation of endogenous by H2O2 or forced miR-17-5p expression either reduced h-ERG current. Sequestration of AP1 by its decoy molecule eliminated the upregulation of miR-17-5p, and ameliorated impairment of h-ERG trafficking. Collectively, deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, in the setting of prolonged duration of oxidative stress. These findings revealed the role of miRNAs in h-ERG trafficking, which may contribute to the cardiac electrical disturbances associated with oxidative stress.

The determinants and engagement patterns of chaperones and chauffeurs by Australian doctors in after-hours house-call services

Directory of Open Access Journals (Sweden)

Chris Onyebuchi Ifediora

2017-04-01

Full Text Available Objectives The use of escorts (chauffeurs and chaperones while on duty in after-hours-house-call (AHHC is one key protective option available to doctors in the service, and has been linked to low burnout and increased satisfaction in AHHC. This study aims to explore the patterns of engagement of escorts in Australian AHHC. Method This is a questionnaire-based, electronic survey of all 300 doctors involved in AHHC through the National Home Doctor Service (NHDS, Australia’s largest providers of the service. The survey explored the doctor’s experiences over the 12-month period from October 2013 to September 2014. Results This survey received a total of 168 valid responses, giving a response rate of 56%. Nearly 61% of the doctors involved in AHHC engaged escorts (chauffeurs and chaperones. Of those doctors that engage chauffeurs, three-quarters do so “all or most times”, while only one-quarter engaged chaperones to the same degree of frequency. Hiring escorts is very popular among Brisbane (91.7% and Sydney-based (88.2% practitioners, but is unpopular in the City of Gold Coast (26.1%. There were moderate patronages in Adelaide (52.9% and Melbourne Area (46.4%. Compared to males, females were less likely to drive themselves without escorts (OR 0.20; P < 0.01; CI [0.07–0.57], but more likely to engage chauffeurs (OR 5.87; P = 0.03; CI [1.16–29.77]. Practitioners who were apprehensive were three times more likely to either engage escorts as chauffeurs (OR 3.10; P = 0.04; CI [1.05–9.15] or as an accompanying chaperone if they self-drive (OR 3.03; P = 0.02; CI [1.16–7.89]. Conclusion More needs to be done to increase the engagement of escorts by doctors involved in the Australian AHHC, particularly given their proven benefits in the service. Future studies may be needed to fully explore the real reasons behind the significant associations identified in this study.

PfClpC Is an Essential Clp Chaperone Required for Plastid Integrity and Clp Protease Stability in Plasmodium falciparum

Directory of Open Access Journals (Sweden)

Anat Florentin

2017-11-01

Full Text Available Summary: The deadly malaria parasite Plasmodium falciparum contains a nonphotosynthetic plastid, known as the apicoplast, that functions to produce essential metabolites, and drugs that target the apicoplast are clinically effective. Several prokaryotic caseinolytic protease (Clp genes have been identified in the Plasmodium genome. Using phylogenetic analysis, we focused on the Clp members that may form a regulated proteolytic complex in the apicoplast. We genetically targeted members of this complex and generated conditional mutants of the apicoplast-localized PfClpC chaperone and PfClpP protease. Conditional inhibition of the PfClpC chaperone resulted in growth arrest and apicoplast loss and was rescued by addition of the essential apicoplast-derived metabolite IPP. Using a double-conditional mutant parasite line, we discovered that the chaperone activity is required to stabilize the mature protease, revealing functional interactions. These data demonstrate the essential function of PfClpC in maintaining apicoplast integrity and its role in regulating the proteolytic activity of the Clp complex. : Plasmodium falciparum contains a unique organelle, the apicoplast. Using genetic and phenotypic assays, Florentin et al. characterize the apicoplast Clp chaperone and protease. They find that the chaperone is essential for protease stability and that together they function to maintain organelle integrity and segregation into daughter cells. Keywords: malaria, Plasmodium, apicoplast, IPP, Clp, chaperone, caseinolytic protease

Thermosensitivity of growth is determined by chaperone-mediated proteome reallocation

Science.gov (United States)

Chen, Ke; Gao, Ye; Mih, Nathan; O’Brien, Edward J.; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Maintenance of a properly folded proteome is critical for bacterial survival at notably different growth temperatures. Understanding the molecular basis of thermoadaptation has progressed in two main directions, the sequence and structural basis of protein thermostability and the mechanistic principles of protein quality control assisted by chaperones. Yet we do not fully understand how structural integrity of the entire proteome is maintained under stress and how it affects cellular fitness. To address this challenge, we reconstruct a genome-scale protein-folding network for Escherichia coli and formulate a computational model, FoldME, that provides statistical descriptions of multiscale cellular response consistent with many datasets. FoldME simulations show (i) that the chaperones act as a system when they respond to unfolding stress rather than achieving efficient folding of any single component of the proteome, (ii) how the proteome is globally balanced between chaperones for folding and the complex machinery synthesizing the proteins in response to perturbation, (iii) how this balancing determines growth rate dependence on temperature and is achieved through nonspecific regulation, and (iv) how thermal instability of the individual protein affects the overall functional state of the proteome. Overall, these results expand our view of cellular regulation, from targeted specific control mechanisms to global regulation through a web of nonspecific competing interactions that modulate the optimal reallocation of cellular resources. The methodology developed in this study enables genome-scale integration of environment-dependent protein properties and a proteome-wide study of cellular stress responses. PMID:29073085

Bovine leukemia virus nucleocapsid protein is an efficient nucleic acid chaperone

International Nuclear Information System (INIS)

Qualley, Dominic F.; Sokolove, Victoria L.; Ross, James L.

2015-01-01

Nucleocapsid proteins (NCs) direct the rearrangement of nucleic acids to form the most thermodynamically stable structure, and facilitate many steps throughout the life cycle of retroviruses. NCs bind strongly to nucleic acids (NAs) and promote NA aggregation by virtue of their cationic nature; they also destabilize the NA duplex via highly structured zinc-binding motifs. Thus, they are considered to be NA chaperones. While most retroviral NCs are structurally similar, differences are observed both within and between retroviral genera. In this work, we compare the NA binding and chaperone activity of bovine leukemia virus (BLV) NC to that of two other retroviral NCs: human immunodeficiency virus type 1 (HIV-1) NC, which is structurally similar to BLV NC but from a different retrovirus genus, and human T-cell leukemia virus type 1 (HTLV-1) NC, which possesses several key structural differences from BLV NC but is from the same genus. Our data show that BLV and HIV-1 NCs bind to NAs with stronger affinity in relation to HTLV-1 NC, and that they also accelerate the annealing of complementary stem-loop structures to a greater extent. Analysis of kinetic parameters derived from the annealing data suggests that while all three NCs stimulate annealing by a two-step mechanism as previously reported, the relative contributions of each step to the overall annealing equilibrium are conserved between BLV and HIV-1 NCs but are different for HTLV-1 NC. It is concluded that while BLV and HTLV-1 belong to the same genus of retroviruses, processes that rely on NC may not be directly comparable. - Highlights: • BLV NC binds strongly to DNA and RNA. • BLV NC promotes mini-TAR annealing as well as HIV-1 NC. • Annealing kinetics suggest a low degree of similarity between BLV NC and HTLV-1 NC

Bovine leukemia virus nucleocapsid protein is an efficient nucleic acid chaperone

Energy Technology Data Exchange (ETDEWEB)

Qualley, Dominic F., E-mail: dqualley@berry.edu; Sokolove, Victoria L.; Ross, James L.

2015-03-13

Nucleocapsid proteins (NCs) direct the rearrangement of nucleic acids to form the most thermodynamically stable structure, and facilitate many steps throughout the life cycle of retroviruses. NCs bind strongly to nucleic acids (NAs) and promote NA aggregation by virtue of their cationic nature; they also destabilize the NA duplex via highly structured zinc-binding motifs. Thus, they are considered to be NA chaperones. While most retroviral NCs are structurally similar, differences are observed both within and between retroviral genera. In this work, we compare the NA binding and chaperone activity of bovine leukemia virus (BLV) NC to that of two other retroviral NCs: human immunodeficiency virus type 1 (HIV-1) NC, which is structurally similar to BLV NC but from a different retrovirus genus, and human T-cell leukemia virus type 1 (HTLV-1) NC, which possesses several key structural differences from BLV NC but is from the same genus. Our data show that BLV and HIV-1 NCs bind to NAs with stronger affinity in relation to HTLV-1 NC, and that they also accelerate the annealing of complementary stem-loop structures to a greater extent. Analysis of kinetic parameters derived from the annealing data suggests that while all three NCs stimulate annealing by a two-step mechanism as previously reported, the relative contributions of each step to the overall annealing equilibrium are conserved between BLV and HIV-1 NCs but are different for HTLV-1 NC. It is concluded that while BLV and HTLV-1 belong to the same genus of retroviruses, processes that rely on NC may not be directly comparable. - Highlights: • BLV NC binds strongly to DNA and RNA. • BLV NC promotes mini-TAR annealing as well as HIV-1 NC. • Annealing kinetics suggest a low degree of similarity between BLV NC and HTLV-1 NC.

Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity

Directory of Open Access Journals (Sweden)

Bo Zhang

2017-08-01

Full Text Available Cold shock proteins (Csps enable organisms to acclimate to and survive in cold environments and the bacterial CspA family exerts the cold protection via its RNA chaperone activity. However, most Archaea do not contain orthologs to the bacterial csp. TRAM, a conserved domain among RNA modification proteins ubiquitously distributed in organisms, occurs as an individual protein in most archaeal phyla and has a structural similarity to Csp proteins, yet its biological functions remain unknown. Through physiological and biochemical studies on four TRAM proteins from a cold adaptive archaeon Methanolobus psychrophilus R15, this work demonstrated that TRAM is an archaeal Csp and exhibits RNA chaperone activity. Three TRAM encoding genes (Mpsy_0643, Mpsy_3043, and Mpsy_3066 exhibited remarkable cold-shock induced transcription and were preferentially translated at lower temperature (18°C, while the fourth (Mpsy_2002 was constitutively expressed. They were all able to complement the cspABGE mutant of Escherichia coli BX04 that does not grow in cold temperatures and showed transcriptional antitermination. TRAM3066 (gene product of Mpsy_3066 and TRAM2002 (gene product of Mpsy_2002 displayed sequence-non-specific RNA but not DNA binding activity, and TRAM3066 assisted RNases in degradation of structured RNA, thus validating the RNA chaperone activity of TRAMs. Given the chaperone activity, TRAM is predicted to function beyond a Csp.

Functional Analysis of the Chaperone-Usher Fimbrial Gene Clusters of Salmonella enterica serovar Typhi.

Science.gov (United States)

Dufresne, Karine; Saulnier-Bellemare, Julie; Daigle, France

2018-01-01

The human-specific pathogen Salmonella enterica serovar Typhi causes typhoid, a major public health issue in developing countries. Several aspects of its pathogenesis are still poorly understood. S . Typhi possesses 14 fimbrial gene clusters including 12 chaperone-usher fimbriae ( stg, sth, bcf , fim, saf , sef , sta, stb, stc, std, ste , and tcf ). These fimbriae are weakly expressed in laboratory conditions and only a few are actually characterized. In this study, expression of all S . Typhi chaperone-usher fimbriae and their potential roles in pathogenesis such as interaction with host cells, motility, or biofilm formation were assessed. All S . Typhi fimbriae were better expressed in minimal broth. Each system was overexpressed and only the fimbrial gene clusters without pseudogenes demonstrated a putative major subunits of about 17 kDa on SDS-PAGE. Six of these (Fim, Saf, Sta, Stb, Std, and Tcf) also show extracellular structure by electron microscopy. The impact of fimbrial deletion in a wild-type strain or addition of each individual fimbrial system to an S . Typhi afimbrial strain were tested for interactions with host cells, biofilm formation and motility. Several fimbriae modified bacterial interactions with human cells (THP-1 and INT-407) and biofilm formation. However, only Fim fimbriae had a deleterious effect on motility when overexpressed. Overall, chaperone-usher fimbriae seem to be an important part of the balance between the different steps (motility, adhesion, host invasion and persistence) of S . Typhi pathogenesis.

Simulação do comportamento mecânico de misturas asfálticas usando um modelo computacional multi-escala

Directory of Open Access Journals (Sweden)

Flávio Vasconcelos de Souza

2009-10-01

Full Text Available As misturas asfálticas, por serem materiais heterogêneos, possuem comportamento global dependente do comportamento dos constituintes individuais, de suas frações volumétricas e das interações físico-químicas entre os constituintes, dentre outros fatores. Deste modo, para que se possa compreender melhor o comportamento desses materiais, é necessário o uso de metodologias capazes de considerar as características e fenômenos ocorrentes nas escalas menores. Uma metodologia que vem sendo bastante estudada e aplicada na comunidade científica internacional são os chamados modelos multi-escala. O objetivo do presente trabalho é descrever um modelo computacional multi-escala e aplicá-lo à simulação de ensaios comumente usados em misturas asfálticas, quais sejam, os ensaios de compressão diametral e de fadiga por flexão em viga. Para o caso de compressão diametral, os resultados numéricos se mostraram em concordância com os resultados observados experimentalmente. Para o caso de carregamento cíclico, não foi feita uma comparação com experimentos, mas os resultados numéricos mostram a capacidade do modelo em simular qualitativamente os fenômenos de trincamento por fadiga e acúmulo de deformações permanentes.

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

Science.gov (United States)

Nelson, Gregory M; Huffman, Holly; Smith, David F

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

Effects of nucleic acid local structure and magnesium ions on minus-strand transfer mediated by the nucleic acid chaperone activity of HIV-1 nucleocapsid protein

OpenAIRE

Wu, Tiyun; Heilman-Miller, Susan L.; Levin, Judith G.

2007-01-01

HIV-1 nucleocapsid protein (NC) is a nucleic acid chaperone, which is required for highly specific and efficient reverse transcription. Here, we demonstrate that local structure of acceptor RNA at a potential nucleation site, rather than overall thermodynamic stability, is a critical determinant for the minus-strand transfer step (annealing of acceptor RNA to (−) strong-stop DNA followed by reverse transcriptase (RT)-catalyzed DNA extension). In our system, destabilization of a stem-loop stru...

A S52P mutation in the 'α-crystallin domain' of Mycobacterium leprae HSP18 reduces its oligomeric size and chaperone function.

Science.gov (United States)

Nandi, Sandip K; Rehna, Elengikal A A; Panda, Alok K; Shiburaj, Sugathan; Dharmalingam, Kuppamuthu; Biswas, Ashis

2013-12-01

Mycobacterium leprae HSP18 is a small heat shock protein (sHSP). It is a major immunodominant antigen of M. leprae pathogen. Previously, we have reported the existence of two M. leprae HSP18 variants in various leprotic patients. One of the variants has serine at position 52, whereas the other one has proline at the same position. We have also reported that HSP18 having proline at position 52 (HSP18P(52)) is a nonameric protein and exhibits chaperone function. However, the structural and functional characterization of wild-type HSP18 having serine at position 52 (HSP18S(52)) is yet to be explored. Furthermore, the implications of the S52P mutation on the structure and chaperone function of HSP18 are not well understood. Therefore, we cloned and purified these two HSP18 variants. We found that HSP18S(52) is also a molecular chaperone and an oligomeric protein. Intrinsic tryptophan fluorescence and far-UV CD measurements revealed that the S52P mutation altered the tertiary and secondary structure of HSP18. This point mutation also reduced the oligomeric assembly and decreased the surface hydrophobicity of HSP18, as revealed by HPLC and 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid binding studies, respectively. Mutant protein was less stable against thermal and chemical denaturation and was more susceptible towards tryptic cleavage than wild-type HSP18. HSP18P(52) had lower chaperone function and was less effective in protecting thermal killing of Escherichia coli than HSP18S(52). Taken together, our data suggest that serine 52 is important for the larger oligomerization and chaperone function of HSP18. Because both variants differ in stability and function, they may have different roles in the survival of M. leprae in infected hosts. © 2013 FEBS.

FEMALE MICE ARE RESISTANT TO Fabp1 GENE ABLATION-INDUCED ALTERATIONS IN BRAIN ENDOCANNABINOID LEVELS

Science.gov (United States)

Martin, Gregory G.; Chung, Sarah; Landrock, Danilo; Landrock, Kerstin K.; Dangott, Lawrence J.; Peng, Xiaoxue; Kaczocha, Martin; Murphy, Eric J.; Kier, Ann B.; Schroeder, Friedhelm

2017-01-01

Although liver fatty acid binding protein (FABP1, L-FABP) is not detectable in brain, Fabp1 gene ablation (LKO) markedly increases endocannabinoids (EC) in brains of male mice. Since the brain EC system of females differs significantly from that of males, it was important to determine if LKO differently impacted the brain EC system. LKO did not alter brain levels of arachidonic acid (ARA)-containing ECs, i.e arachidonoylethanolamide (AEA) and 2-arachidonoylglycerol (2-AG), but decreased non-ARA-containing N-acylethanolamides (OEA, PEA) and 2-oleoylglycerol (2-OG) that potentiate the actions of AEA and 2-AG. These changes in brain potentiating EC levels were not associated with: i) a net decrease in levels of brain membrane proteins associated with fatty acid uptake and EC synthesis; ii) a net increase in brain protein levels of cytosolic EC chaperones and enzymes in EC degradation; or iii) increased brain protein levels of EC receptors (CB1, TRVP1). Instead, the reduced or opposite responsiveness of female brain EC levels to loss of FABP1 (LKO) correlated with intrinsically lower FABP1 level in livers of WT females than males. These data show that female mouse brain endocannabinoid levels were unchanged (AEA, 2-AG) or decreased (OEA, PEA, 2-OG) by complete loss of FABP1 (LKO). PMID:27450559

A BAG3 chaperone complex maintains cardiomyocyte function during proteotoxic stress.

Science.gov (United States)

Judge, Luke M; Perez-Bermejo, Juan A; Truong, Annie; Ribeiro, Alexandre Js; Yoo, Jennie C; Jensen, Christina L; Mandegar, Mohammad A; Huebsch, Nathaniel; Kaake, Robyn M; So, Po-Lin; Srivastava, Deepak; Pruitt, Beth L; Krogan, Nevan J; Conklin, Bruce R

2017-07-20

Molecular chaperones regulate quality control in the human proteome, pathways that have been implicated in many diseases, including heart failure. Mutations in the BAG3 gene, which encodes a co-chaperone protein, have been associated with heart failure due to both inherited and sporadic dilated cardiomyopathy. Familial BAG3 mutations are autosomal dominant and frequently cause truncation of the coding sequence, suggesting a heterozygous loss-of-function mechanism. However, heterozygous knockout of the murine BAG3 gene did not cause a detectable phenotype. To model BAG3 cardiomyopathy in a human system, we generated an isogenic series of human induced pluripotent stem cells (iPSCs) with loss-of-function mutations in BAG3. Heterozygous BAG3 mutations reduced protein expression, disrupted myofibril structure, and compromised contractile function in iPSC-derived cardiomyocytes (iPS-CMs). BAG3-deficient iPS-CMs were particularly sensitive to further myofibril disruption and contractile dysfunction upon exposure to proteasome inhibitors known to cause cardiotoxicity. We performed affinity tagging of the endogenous BAG3 protein and mass spectrometry proteomics to further define the cardioprotective chaperone complex that BAG3 coordinates in the human heart. Our results establish a model for evaluating protein quality control pathways in human cardiomyocytes and their potential as therapeutic targets and susceptibility factors for cardiac drug toxicity.

Structural basis for inhibition of the histone chaperone activity of SET/TAF-Iβ by cytochrome c.

Science.gov (United States)

González-Arzola, Katiuska; Díaz-Moreno, Irene; Cano-González, Ana; Díaz-Quintana, Antonio; Velázquez-Campoy, Adrián; Moreno-Beltrán, Blas; López-Rivas, Abelardo; De la Rosa, Miguel A

2015-08-11

Chromatin is pivotal for regulation of the DNA damage process insofar as it influences access to DNA and serves as a DNA repair docking site. Recent works identify histone chaperones as key regulators of damaged chromatin's transcriptional activity. However, understanding how chaperones are modulated during DNA damage response is still challenging. This study reveals that the histone chaperone SET/TAF-Iβ interacts with cytochrome c following DNA damage. Specifically, cytochrome c is shown to be translocated into cell nuclei upon induction of DNA damage, but not upon stimulation of the death receptor or stress-induced pathways. Cytochrome c was found to competitively hinder binding of SET/TAF-Iβ to core histones, thereby locking its histone-binding domains and inhibiting its nucleosome assembly activity. In addition, we have used NMR spectroscopy, calorimetry, mutagenesis, and molecular docking to provide an insight into the structural features of the formation of the complex between cytochrome c and SET/TAF-Iβ. Overall, these findings establish a framework for understanding the molecular basis of cytochrome c-mediated blocking of SET/TAF-Iβ, which subsequently may facilitate the development of new drugs to silence the oncogenic effect of SET/TAF-Iβ's histone chaperone activity.

Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System

Science.gov (United States)

Verghese, Jacob; Abrams, Jennifer; Wang, Yanyu

2012-01-01

Summary: The eukaryotic heat shock response is an ancient and highly conserved transcriptional program that results in the immediate synthesis of a battery of cytoprotective genes in the presence of thermal and other environmental stresses. Many of these genes encode molecular chaperones, powerful protein remodelers with the capacity to shield, fold, or unfold substrates in a context-dependent manner. The budding yeast Saccharomyces cerevisiae continues to be an invaluable model for driving the discovery of regulatory features of this fundamental stress response. In addition, budding yeast has been an outstanding model system to elucidate the cell biology of protein chaperones and their organization into functional networks. In this review, we evaluate our understanding of the multifaceted response to heat shock. In addition, the chaperone complement of the cytosol is compared to those of mitochondria and the endoplasmic reticulum, organelles with their own unique protein homeostasis milieus. Finally, we examine recent advances in the understanding of the roles of protein chaperones and the heat shock response in pathogenic fungi, which is being accelerated by the wealth of information gained for budding yeast. PMID:22688810

Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

Science.gov (United States)

Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

2010-07-30

Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

Chaperone-protease networks in mitochondrial protein homeostasis.

Science.gov (United States)

Voos, Wolfgang

2013-02-01

As essential organelles, mitochondria are intimately integrated into the metabolism of a eukaryotic cell. The maintenance of the functional integrity of the mitochondrial proteome, also termed protein homeostasis, is facing many challenges both under normal and pathological conditions. First, since mitochondria are derived from bacterial ancestor cells, the proteins in this endosymbiotic organelle have a mixed origin. Only a few proteins are encoded on the mitochondrial genome, most genes for mitochondrial proteins reside in the nuclear genome of the host cell. This distribution requires a complex biogenesis of mitochondrial proteins, which are mostly synthesized in the cytosol and need to be imported into the organelle. Mitochondrial protein biogenesis usually therefore comprises complex folding and assembly processes to reach an enzymatically active state. In addition, specific protein quality control (PQC) processes avoid an accumulation of damaged or surplus polypeptides. Mitochondrial protein homeostasis is based on endogenous enzymatic components comprising a diverse set of chaperones and proteases that form an interconnected functional network. This review describes the different types of mitochondrial proteins with chaperone functions and covers the current knowledge of their roles in protein biogenesis, folding, proteolytic removal and prevention of aggregation, the principal reactions of protein homeostasis. This article is part of a Special Issue entitled: Protein Import and Quality Control in Mitochondria and Plastids. Copyright © 2012 Elsevier B.V. All rights reserved.

Production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing 10S-dioxygenase from Nostoc punctiforme PCC 73102 with the aid of a chaperone.

Science.gov (United States)

Kim, Min-Ji; Seo, Min-Ju; Shin, Kyung-Chul; Oh, Deok-Kun

2017-01-01

To increase the production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing Nostoc punctiforme 10S-dioxygenase with the aid of a chaperone. The optimal conditions for 10S-hydroxy-8(E)-octadecenoic acid production by recombinant cells co-expressing chaperone plasmid were pH 9, 35 °C, 15 % (v/v) dimethyl sulfoxide, 40 g cells l -1 , and 10 g oleic acid l -1 . Under these conditions, recombinant cells co-expressing chaperone plasmid produced 7.2 g 10S-hydroxy-8(E)-octadecenoic acid l -1 within 30 min, with a conversion yield of 72 % (w/w) and a volumetric productivity of 14.4 g l -1 h -1 . The activity of recombinant cells expressing 10S-dioxygenase was increased by 200 % with the aid of a chaperone, demonstrating the first biotechnological production of 10S-hydroxy-8(E)-octadecenoic acid using recombinant cells expressing 10S-dioxygenase.

DmsD, a Tat system specific chaperone, interacts with other general chaperones and proteins involved in the molybdenum cofactor biosynthesis

OpenAIRE

Li, Haiming; Chang, Limei; Howell, Jenika M.; Turner, Raymond J.

2010-01-01

Many bacterial oxidoreductases depend on the Tat translocase for correct cell localization. Substrates for the Tat translocase possess twin-arginine leaders. System specific chaperones or redox enzyme maturation proteins (REMPs) are a group of proteins implicated in oxidoreductase maturation. DmsD is a REMP discovered in Escherichia coli, which interacts with the twin-arginine leader sequence of DmsA, the catalytic subunit of DMSO reductase. In this study, we identified several potential inte...

Regulation of human Nfu activity in Fe-S cluster delivery-characterization of the interaction between Nfu and the HSPA9/Hsc20 chaperone complex.

Science.gov (United States)

Wachnowsky, Christine; Liu, Yushi; Yoon, Taejin; Cowan, J A

2018-01-01

Iron-sulfur cluster biogenesis is a complex, but highly regulated process that involves de novo cluster formation from iron and sulfide ions on a scaffold protein, and subsequent delivery to final targets via a series of Fe-S cluster-binding carrier proteins. The process of cluster release from the scaffold/carrier for transfer to the target proteins may be mediated by a dedicated Fe-S cluster chaperone system. In human cells, the chaperones include heat shock protein HSPA9 and the J-type chaperone Hsc20. While the role of chaperones has been somewhat clarified in yeast and bacterial systems, many questions remain over their functional roles in cluster delivery and interactions with a variety of human Fe-S cluster proteins. One such protein, Nfu, has recently been recognized as a potential interaction partner of the chaperone complex. Herein, we examined the ability of human Nfu to function as a carrier by interacting with the human chaperone complex. Human Nfu is shown to bind to both chaperone proteins with binding affinities similar to those observed for IscU binding to the homologous HSPA9 and Hsc20, while Nfu can also stimulate the ATPase activity of HSPA9. Additionally, the chaperone complex was able to promote Nfu function by enhancing the second-order rate constants for Fe-S cluster transfer to target proteins and providing directionality in cluster transfer from Nfu by eliminating promiscuous transfer reactions. Together, these data support a hypothesis in which Nfu can serve as an alternative carrier protein for chaperone-mediated cluster release and delivery in Fe-S cluster biogenesis and trafficking. © 2017 Federation of European Biochemical Societies.

Comparação da análise da frente de onda e da sensibilidade ao contraste em olhos pseudofácicos com implante de lentes intra-oculares esférica e asférica Wavefront analysis and contrast sensitivity comparison between spheric and aspheric intraocular lenses

Directory of Open Access Journals (Sweden)

Wilson Takashi Hida

2008-06-01

Full Text Available OBJETIVO: Comparar a análise da frente de onda e a sensibilidade de contraste pós-operatórias em pacientes submetidos à facoemulsificação com implante de lentes intra-oculares esféricas num olho e asféricas no olho contralateral. MÉTODOS: Este estudo prospectivo comparativo, randomizado, duplo-cego, incluiu 32 olhos de 16 pacientes. Uma avaliação oftalmológica completa foi realizada durante as visitas antes e depois da cirurgia (no primeiro, terceiro, sétimo, e nonagésimo dias pós-cirúrgicos, que incluiu acuidade visual, teste de sensibilidade ao contraste, aberrometria. Todos exames (menos aberrometr=ia foram feitos monocularmente com pupilas não dilatadas. Os pacientes foram submetidos a facectomia ultra-sônica convencional com implante de uma lente asférica SN60WF num olho e esférica SN60ATno outro. RESULTADOS: A acuidade visual média com a melhor correção foi -0,146 LogMAR no grupo da lente intra-ocular esférica, e -0.165 logMAR no grupo da lente intra-ocular asférica sob condições fotópicas, -0,003 LogMAR sob condições mesópicas. A sensibilidade ao contraste foi semelhante em ambos os grupos tanto em condições fotópicas e mesópicas. Em relação às aberrações ópticas ocorreu uma diferença significativa nas aberrações totais (1,09 ± 0,56 no grupo asférico e 1,52 ± 1,19 no grupo esférico e no componente esférico das aberrações de alta ordem(0,422 ± 0,202 no grupo asférico e 0,124 ± 0,087 no grupo esférico. CONCLUSÃO: As duas lentes intra-oculares promoveram uma excelente visão em situações de alto contraste, e os olhos implantados com a lente asférica tiveram menos aberrações totais e esféricas que aqueles implantados com a lente esférica.PURPOSE: Compare the wavefront and contrast sensitivity of bilateral pseudophakic patients with aspheric in one eye and spheric intraocular lenses in the other. METHODS: This prospective, comparative, randomized study, double masked, included 32

Site-selective probing of cTAR destabilization highlights the necessary plasticity of the HIV-1 nucleocapsid protein to chaperone the first strand transfer

Science.gov (United States)

Godet, Julien; Kenfack, Cyril; Przybilla, Frédéric; Richert, Ludovic; Duportail, Guy; Mély, Yves

2013-01-01

The HIV-1 nucleocapsid protein (NCp7) is a nucleic acid chaperone required during reverse transcription. During the first strand transfer, NCp7 is thought to destabilize cTAR, the (−)DNA copy of the TAR RNA hairpin, and subsequently direct the TAR/cTAR annealing through the zipping of their destabilized stem ends. To further characterize the destabilizing activity of NCp7, we locally probe the structure and dynamics of cTAR by steady-state and time resolved fluorescence spectroscopy. NC(11–55), a truncated NCp7 version corresponding to its zinc-finger domain, was found to bind all over the sequence and to preferentially destabilize the penultimate double-stranded segment in the lower part of the cTAR stem. This destabilization is achieved through zinc-finger–dependent binding of NC to the G10 and G50 residues. Sequence comparison further revealed that C•A mismatches close to the two G residues were critical for fine tuning the stability of the lower part of the cTAR stem and conferring to G10 and G50 the appropriate mobility and accessibility for specific recognition by NC. Our data also highlight the necessary plasticity of NCp7 to adapt to the sequence and structure variability of cTAR to chaperone its annealing with TAR through a specific pathway. PMID:23511968

Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone

Science.gov (United States)

Xia, Hongjie; Wang, Peipei; Wang, Guang-Chuan; Yang, Jie; Sun, Xianlin; Wu, Wenzhe; Qiu, Yang; Shu, Ting; Zhao, Xiaolu; Yin, Lei; Qin, Cheng-Feng; Hu, Yuanyang; Zhou, Xi

2015-01-01

RNA helicases and chaperones are the two major classes of RNA remodeling proteins, which function to remodel RNA structures and/or RNA-protein interactions, and are required for all aspects of RNA metabolism. Although some virus-encoded RNA helicases/chaperones have been predicted or identified, their RNA remodeling activities in vitro and functions in the viral life cycle remain largely elusive. Enteroviruses are a large group of positive-stranded RNA viruses in the Picornaviridae family, which includes numerous important human pathogens. Herein, we report that the nonstructural protein 2CATPase of enterovirus 71 (EV71), which is the major causative pathogen of hand-foot-and-mouth disease and has been regarded as the most important neurotropic enterovirus after poliovirus eradication, functions not only as an RNA helicase that 3′-to-5′ unwinds RNA helices in an adenosine triphosphate (ATP)-dependent manner, but also as an RNA chaperone that destabilizes helices bidirectionally and facilitates strand annealing and complex RNA structure formation independently of ATP. We also determined that the helicase activity is based on the EV71 2CATPase middle domain, whereas the C-terminus is indispensable for its RNA chaperoning activity. By promoting RNA template recycling, 2CATPase facilitated EV71 RNA synthesis in vitro; when 2CATPase helicase activity was impaired, EV71 RNA replication and virion production were mostly abolished in cells, indicating that 2CATPase-mediated RNA remodeling plays a critical role in the enteroviral life cycle. Furthermore, the RNA helicase and chaperoning activities of 2CATPase are also conserved in coxsackie A virus 16 (CAV16), another important enterovirus. Altogether, our findings are the first to demonstrate the RNA helicase and chaperoning activities associated with enterovirus 2CATPase, and our study provides both in vitro and cellular evidence for their potential roles during viral RNA replication. These findings increase our

Estudo de misturas asfálticas com ligante modificado pelo polímero EVA para pavimentos urbanos de Manaus - AM Study of asphalt mixtures containing a binder modified with EVA polymer for use in urban pavements in Manaus

Directory of Open Access Journals (Sweden)

Daniela M. G. D'Antona

2011-01-01

Full Text Available A presente pesquisa buscou soluções com materiais alternativos visando à construção de pavimentos urbanos para Manaus (AM com maior vida útil e condizente com as suas condições de serviço, em particular, o seu desempenho mecânico frente às temperaturas regionais. Estudou-se o ligante regional, CAP 50/70, misturado com 4% do polímero EVA, e como partícipe em compósitos asfálticos. A incorporação do mencionado polímero teve como objetivo melhorar suas propriedades reológicas e, por conseguinte, o comportamento mecânico desse compósito - concreto asfáltico, empregado como revestimento nas vias urbanas da Capital do Estado do Amazonas. Os ligantes (virgem e modificado foram caracterizados conforme a especificação da ANP e a metodologia Superpave. As misturas asfálticas foram avaliadas pelo ensaio de fluência por compressão axial, com carregamento dinâmico à temperatura de 40 ºC. O material asfáltico modificado com EVA (AMP EVA demonstrou melhores propriedades reológicas ou equivalentes ao asfalto convencional (REMAN, ao longo de todos os ensaios de caracterização. As misturas alternativas compostas com o CAP modificado (SEVA obtiveram desempenho mecânico superior ao de misturas com cimento asfáltico habitualmente comercializado na região (SMAN.In this research we investigated alternative materials to build urban pavements in Manaus, seeking for pavements with longer lifetime for usage and suitable mechanical properties to withstand the local temperatures. The asphaltic mixtures contained a regional binder, namely CAP 50/70, mixed with 4% of EVA polymer. The incorporation of the latter polymer was aimed at improving the rheological properties of asphaltic concrete used in roads in the Amazonas' capital. The asphalt binders (original and modified were characterized in accordance with the ANP (National Petroleum Agency specification and the Superpave methodology. The asphalt mixtures had their mechanical properties

Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.

Science.gov (United States)

Liu, Shing-Hwa; Yang, Ching-Chin; Chan, Ding-Cheng; Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

2016-04-19

Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis.

ATPase Domain and Interdomain Linker Play a Key Role in Aggregation of Mitochondrial Hsp70 Chaperone Ssc1*

Science.gov (United States)

Blamowska, Marta; Sichting, Martin; Mapa, Koyeli; Mokranjac, Dejana; Neupert, Walter; Hell, Kai

2010-01-01

The co-chaperone Hep1 is required to prevent the aggregation of mitochondrial Hsp70 proteins. We have analyzed the interaction of Hep1 with mitochondrial Hsp70 (Ssc1) and the determinants in Ssc1 that make it prone to aggregation. The ATPase and peptide binding domain (PBD) of Hsp70 proteins are connected by a linker segment that mediates interdomain communication between the domains. We show here that the minimal Hep1 binding entity of Ssc1 consists of the ATPase domain and the interdomain linker. In the absence of Hep1, the ATPase domain with the interdomain linker had the tendency to aggregate, in contrast to the ATPase domain with the mutated linker segment or without linker, and in contrast to the PBD. The closest homolog of Ssc1, bacterial DnaK, and a Ssc1 chimera, in which a segment of the ATPase domain of Ssc1 was replaced by the corresponding segment from DnaK, did not aggregate in Δhep1 mitochondria. The propensity to aggregate appears to be a specific property of the mitochondrial Hsp70 proteins. The ATPase domain in combination with the interdomain linker is crucial for aggregation of Ssc1. In conclusion, our results suggest that interdomain communication makes Ssc1 prone to aggregation. Hep1 counteracts aggregation by binding to this aggregation-prone conformer. PMID:20007714

ATPase domain and interdomain linker play a key role in aggregation of mitochondrial Hsp70 chaperone Ssc1.

Science.gov (United States)

Blamowska, Marta; Sichting, Martin; Mapa, Koyeli; Mokranjac, Dejana; Neupert, Walter; Hell, Kai

2010-02-12

The co-chaperone Hep1 is required to prevent the aggregation of mitochondrial Hsp70 proteins. We have analyzed the interaction of Hep1 with mitochondrial Hsp70 (Ssc1) and the determinants in Ssc1 that make it prone to aggregation. The ATPase and peptide binding domain (PBD) of Hsp70 proteins are connected by a linker segment that mediates interdomain communication between the domains. We show here that the minimal Hep1 binding entity of Ssc1 consists of the ATPase domain and the interdomain linker. In the absence of Hep1, the ATPase domain with the interdomain linker had the tendency to aggregate, in contrast to the ATPase domain with the mutated linker segment or without linker, and in contrast to the PBD. The closest homolog of Ssc1, bacterial DnaK, and a Ssc1 chimera, in which a segment of the ATPase domain of Ssc1 was replaced by the corresponding segment from DnaK, did not aggregate in Delta hep1 mitochondria. The propensity to aggregate appears to be a specific property of the mitochondrial Hsp70 proteins. The ATPase domain in combination with the interdomain linker is crucial for aggregation of Ssc1. In conclusion, our results suggest that interdomain communication makes Ssc1 prone to aggregation. Hep1 counteracts aggregation by binding to this aggregation-prone conformer.

Blocking the chaperone kinome pathway: Mechanistic insights into a novel dual inhibition approach for supra-additive suppression of malignant tumors

Energy Technology Data Exchange (ETDEWEB)

Grover, Abhinav [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Shandilya, Ashutosh [Supercomputing Facility for Bioinformatics and Computational Biology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Agrawal, Vibhuti; Pratik, Piyush; Bhasme, Divya; Bisaria, Virendra S. [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India); Sundar, Durai, E-mail: sundar@dbeb.iitd.ac.in [Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology (IIT) Delhi, Hauz Khas, New Delhi 110016 (India)

2011-01-07

Research highlights: {yields} Withaferin A and 17-DMAG synergistically inhibit the Hsp90-Cdc37 chaperone pair. {yields} Binding of WA to Cdc37 cleft suppresses its kinase binding activity. {yields} 17-DMAG binding to the association complex results in H-bonds with 60% clustering. {yields} The ligands' bound complex was found structurally and thermodynamically stable. -- Abstract: The chaperone Hsp90 is involved in regulating the stability and activation state of more than 200 'client' proteins and takes part in the cancer diseased states. The major clientele-protein kinases depend on Hsp90 for their proper folding and functioning. Cdc37, a kinase targeting co-chaperone of Hsp90, mediates the interactions between Hsp90 and protein kinases. Targeting of Cdc37 has the prospect of delivering predominantly kinase-selective molecular responses as compared to the current pharmacologic Hsp90 inhibitors. The present work reports a bio-computational study carried out with the aim of exploring the dual inhibition of Hsp90/Cdc37 chaperone/co-chaperone association complex by the naturally occurring drug candidates withaferin A and 17-DMAG along with their possible modes of action. Our molecular docking studies reveal that withaferin A in combination with 17-DMAG can act as potent chaperone system inhibitors. The structural and thermodynamic stability of the ligands' bound complex was also observed from molecular dynamics simulations in water. Our results suggest a novel tumor suppressive action mechanism of herbal ligands which can be looked forward for further clinical investigations for possible anticancer drug formulations.

The molecular chaperone function of α-crystallin is impaired by UV photolysis

International Nuclear Information System (INIS)

Borkman, R.F.; McLaughlin, J.

1995-01-01

Buffer solutions of the lens protein γ-crystallin and the enzymes aldolase and liver alcohol dehydrogenase became turbid and formed solid precipitate upon exposure to an elevated temperature of 63 o C or to UV radiation at 308 nm. When α-crystallin was added to the protein solutions in stoichiometric amounts, heat or UV irradiation did not cause turbidity, or turbidity developed much less rapidly than in the absence of α-crystallin. Hence, normal α-crystallin functioned as a ''molecular chaperone,'' providing protection against both UV and heat-induced protein aggregation. When α-crystallin was preirradiated with UV at 308 nm, its ability to function as a chaperone vis-a-vis both UV and heat-induced aggregation was significantly impaired, but only at relatively high UV doss. (author)

The Arabidopsis histone chaperone FACT is required for stress-induced expression of anthocyanin biosynthetic genes.

Science.gov (United States)

Pfab, Alexander; Breindl, Matthias; Grasser, Klaus D

2018-03-01

The histone chaperone FACT is involved in the expression of genes encoding anthocyanin biosynthetic enzymes also upon induction by moderate high-light and therefore contributes to the stress-induced plant pigmentation. The histone chaperone FACT consists of the SSRP1 and SPT16 proteins and associates with transcribing RNAPII (RNAPII) along the transcribed region of genes. FACT can promote transcriptional elongation by destabilising nucleosomes in the path of RNA polymerase II, thereby facilitating efficient transcription of chromatin templates. Transcript profiling of Arabidopsis plants depleted in SSRP1 or SPT16 demonstrates that only a small subset of genes is differentially expressed relative to wild type. The majority of these genes is either up- or down-regulated in both the ssrp1 and spt16 plants. Among the down-regulated genes, those encoding enzymes of the biosynthetic pathway of the plant secondary metabolites termed anthocyanins (but not regulators of the pathway) are overrepresented. Upon exposure to moderate high-light stress several of these genes are up-regulated to a lesser extent in ssrp1/spt16 compared to wild type plants, and accordingly the mutant plants accumulate lower amounts of anthocyanin pigments. Moreover, the expression of SSRP1 and SPT16 is induced under these conditions. Therefore, our findings indicate that FACT is a novel factor required for the accumulation of anthocyanins in response to light-induction.

Computational modeling of allosteric regulation in the hsp90 chaperones: a statistical ensemble analysis of protein structure networks and allosteric communications.

Directory of Open Access Journals (Sweden)

Kristin Blacklock

2014-06-01

Full Text Available A fundamental role of the Hsp90 chaperone in regulating functional activity of diverse protein clients is essential for the integrity of signaling networks. In this work we have combined biophysical simulations of the Hsp90 crystal structures with the protein structure network analysis to characterize the statistical ensemble of allosteric interaction networks and communication pathways in the Hsp90 chaperones. We have found that principal structurally stable communities could be preserved during dynamic changes in the conformational ensemble. The dominant contribution of the inter-domain rigidity to the interaction networks has emerged as a common factor responsible for the thermodynamic stability of the active chaperone form during the ATPase cycle. Structural stability analysis using force constant profiling of the inter-residue fluctuation distances has identified a network of conserved structurally rigid residues that could serve as global mediating sites of allosteric communication. Mapping of the conformational landscape with the network centrality parameters has demonstrated that stable communities and mediating residues may act concertedly with the shifts in the conformational equilibrium and could describe the majority of functionally significant chaperone residues. The network analysis has revealed a relationship between structural stability, global centrality and functional significance of hotspot residues involved in chaperone regulation. We have found that allosteric interactions in the Hsp90 chaperone may be mediated by modules of structurally stable residues that display high betweenness in the global interaction network. The results of this study have suggested that allosteric interactions in the Hsp90 chaperone may operate via a mechanism that combines rapid and efficient communication by a single optimal pathway of structurally rigid residues and more robust signal transmission using an ensemble of suboptimal multiple

Heterologous gln/asn-rich proteins impede the propagation of yeast prions by altering chaperone availability.

Directory of Open Access Journals (Sweden)

Zi Yang

Full Text Available Prions are self-propagating conformations of proteins that can cause heritable phenotypic traits. Most yeast prions contain glutamine (Q/asparagine (N-rich domains that facilitate the accumulation of the protein into amyloid-like aggregates. Efficient transmission of these infectious aggregates to daughter cells requires that chaperones, including Hsp104 and Sis1, continually sever the aggregates into smaller "seeds." We previously identified 11 proteins with Q/N-rich domains that, when overproduced, facilitate the de novo aggregation of the Sup35 protein into the [PSI(+] prion state. Here, we show that overexpression of many of the same 11 Q/N-rich proteins can also destabilize pre-existing [PSI(+] or [URE3] prions. We explore in detail the events leading to the loss (curing of [PSI(+] by the overexpression of one of these proteins, the Q/N-rich domain of Pin4, which causes Sup35 aggregates to increase in size and decrease in transmissibility to daughter cells. We show that the Pin4 Q/N-rich domain sequesters Hsp104 and Sis1 chaperones away from the diffuse cytoplasmic pool. Thus, a mechanism by which heterologous Q/N-rich proteins impair prion propagation appears to be the loss of cytoplasmic Hsp104 and Sis1 available to sever [PSI(+].

Evaluación de las propiedades mecánicas de una mezcla de concreto hidráulico para pavimento rígido con la inclusión de hormigón asfáltico recuperado tipo “rap”

Directory of Open Access Journals (Sweden)

David Alberto Santos Montero

2017-07-01

Full Text Available La construcción de pavimentos rígidos y flexibles genera desarrollo social e impacto económico/ambiental en su concepción, desarrollo y operación posterior. Su construcción requiere de materiales a bajo costo, alta disponibilidad y total  aprovechamiento, así como de propiedades que garanticen el cumplimiento mínimo de durabilidad y costos racionales de mantenimiento. Conviene  obtener y usar materiales de considerada abundancia y que para su procesamiento requieran de una tecnología limpia y tradicional, a fin de que el impacto ambiental sea el más bajo posible. Los agregados reciclables corresponden a estos materiales, y dentro de ellos está el RAP, del inglés Reclaimed Asphalt Pavement (Pavimento Asfáltico Recuperado [1], cuyo término es dado a los materiales extraídos o procesados que contienen una presencia contraída de betún asfáltico y que, ahondado en la fatiga estructural de un pavimento flexible, por efectos de envejecimiento,  se obtiene por medio de una de las técnicas más conocidas de recuperación: El fresado. Gran parte de los países del mundo ha utilizado el RAP en la re-manufactura de mezclas asfálticas. Con ello se disminuye su retiro a sitios de disposición final y se minimiza el consumo de agregados pétreos vírgenes, lo que produce beneficios ambientales a corto plazo, así como otros que sobresalen por el aprovechamiento de su calidad de mezclado y condición estructural residual. Todo ello ha generado una nueva alternativa de estudio en la manufactura de mezclas hidráulicas para la construcción de pavimentos rígidos.

DNAJB6 is a peptide-binding chaperone which can suppress amyloid fibrillation of polyglutamine peptides at substoichiometric molar ratios

NARCIS (Netherlands)

Mansson, Cecilia; Kakkar, Vaishali; Monsellier, Elodie; Sourigues, Yannick; Harmark, Johan; Kampinga, Harm H.; Melki, Ronald; Emanuelsson, Cecilia

Expanded polyglutamine (polyQ) stretches lead to protein aggregation and severe neurodegenerative diseases. A highly efficient suppressor of polyQ aggregation was identified, the DNAJB6, when molecular chaperones from the HSPH, HSPA, and DNAJ families were screened for huntingtin exon 1 aggregation

Arabidopsis COLD SHOCK DOMAIN PROTEIN2 is a RNA chaperone that is regulated by cold and developmental signals

International Nuclear Information System (INIS)

Sasaki, Kentaro; Kim, Myung-Hee; Imai, Ryozo

2007-01-01

Bacterial cold shock proteins (CSPs) are RNA chaperones that unwind RNA secondary structures. Arabidopsis COLD SHOCK DOMAIN PROTEIN2 (AtCSP2) contains a domain that is shared with bacterial CSPs. Here we showed that AtCSP2 binds to RNA and unwinds nucleic acid duplex. Heterologous expression of AtCSP2 complemented cold sensitivity of an Escherichia coli csp quadruple mutant, indicating that AtCSP2 function as a RNA chaperone in E. coli. AtCSP2 mRNA and protein levels increased during cold acclimation, but the protein accumulation was most prominent after 10 days of cold treatment. AtCSP2 promoter::GUS transgenic plants revealed that AtCSP2 is expressed only in root and shoot apical regions during vegetative growth but is expressed in reproductive organs such as pollens, ovules and embryos. These data indicated that AtCSP2 is involved in developmental processes as well as cold adaptation. Localization of AtCSP2::GFP in nucleolus and cytoplasm suggested different nuclear and cytosolic RNA targets

A passive physical model for DnaK chaperoning

Science.gov (United States)

Uhl, Lionel; Dumont, Audrey; Dukan, Sam

2018-03-01

Almost all living organisms use protein chaperones with a view to preventing proteins from misfolding or aggregation either spontaneously or during cellular stress. This work uses a reaction-diffusion stochastic model to describe the dynamic localization of the Hsp70 chaperone DnaK in Escherichia coli cells during transient proteotoxic collapse characterized by the accumulation of insoluble proteins. In the model, misfolded (‘abnormal’) proteins are produced during alcoholic stress and have the propensity to aggregate with a polymerization-like kinetics. When aggregates diffuse more slowly they grow larger. According to Michaelis-Menten-type kinetics, DnaK has the propensity to bind with misfolded proteins or aggregates in order to catalyse refolding. To match experimental fluorescence microscopy data showing clusters of DnaK-GFP localized in multiple foci, the model includes spatial zones with local reduced diffusion rates to generate spontaneous assemblies of DnaK called ‘foci’. Numerical simulations of our model succeed in reproducing the kinetics of DnaK localization experimentally observed. DnaK starts from foci, moves to large aggregates during acute stress, resolves those aggregates during recovery and finally returns to its initial punctate localization pattern. Finally, we compare real biological events with hypothetical repartitions of the protein aggregates or DnaK. We then notice that DnaK action is more efficient on protein aggregates than on protein homogeneously distributed.

The co-chaperones Fkbp4/5 control Argonaute2 expression and facilitate RISC assembly.

Science.gov (United States)

Martinez, Natalia J; Chang, Hao-Ming; Borrajo, Jacob de Riba; Gregory, Richard I

2013-11-01

Argonaute2 (Ago2) protein and associated microRNAs (miRNAs) or small interfering RNAs (siRNAs) form the RNA-induced silencing complex (RISC) for target messenger RNA cleavage and post-transcriptional gene silencing. Although Ago2 is essential for RISC activity, the mechanism of RISC assembly is not well understood, and factors controlling Ago2 protein expression are largely unknown. A role for the Hsc70/Hsp90 chaperone complex in loading small RNA duplexes into the RISC has been demonstrated in cell extracts, and unloaded Ago2 is unstable and degraded by the lysosome in mammalian cells. Here we identify the co-chaperones Fkbp4 and Fkbp5 as Ago2-associated proteins in mouse embryonic stem cells. Pharmacological inhibition of this interaction using FK506 or siRNA-mediated Fkbp4/5 depletion leads to decreased Ago2 protein levels. We find FK506 treatment inhibits, whereas Fkbp4/5 overexpression promotes, miRNA-mediated stabilization of Ago2 expression. Simultaneous treatment with a lysosome inhibitor revealed the accumulation of unloaded Ago2 complexes in FK506-treated cells. We find that, consistent with unloaded miRNAs being unstable, FK506 treatment also affects miRNA abundance, particularly nascent miRNAs. Our results support a role for Fkbp4/5 in RISC assembly.

Effect of aspherical and yellow tinted intraocular lens on blue-on-yellow perimetry Efeito das lentes intraoculares asféricas e com pigmentação amarela na campimetria azul-amarelo

Directory of Open Access Journals (Sweden)

Rodrigo França de Espíndola

2012-10-01

Full Text Available PURPOSE: To investigate the possible effect of aspherical or yellow tinted intraocular lens (IOL on contrast sensitivity and blue-on-yellow perimetry. METHODS: This prospective randomized bilateral double-masked clinical study included 52 patients with visually significant bilateral cataracts divided in two groups; 25 patients (50 eyes received aspherical intraocular lens in one eye and spherical intraocular lens in the fellow eye; and 27 patients (54 eyes received ultraviolet and blue light filter (yellow tinted IOL implantation in one eye and acrylic ultraviolet filter IOL in the fellow eye. The primary outcome measures were contrast sensitivity and blue-on-yellow perimetry values (mean deviation [MD] and pattern standard deviation [PSD] investigated two years after surgery. The results were compared intra-individually. RESULTS: There was a statistically significant between-group (aspherical and spherical intraocular lens difference in contrast sensitivity under photopic conditions at 12 cycles per degree and under mesopic conditions at all spatial frequencies. There were no between-group significant differences (yellow tinted and clear intraocular lens under photopic or mesopic conditions. There was no statistically significant difference between all intraocular lens in MD or PSD. CONCLUSION: Contrast sensitivity was better under mesopic conditions with aspherical intraocular lens. Blue-on-yellow perimetry did not appear to be affected by aspherical or yellow tinted intraocular lens. Further studies with a larger sample should be carried out to confirm or not that hypotheses.OBJETIVO: Investigar a possibilidade de efeitos na sensibilidade ao contraste e nos resultados da campimetria azul-amarelo com implante de uma lente intraocular (LIO asférica ou de pigmentação amarela. MÉTODOS: Trata-se de um estudo prospectivo, randomizado, duplo-mascarado, envolvendo 52 pacientes portadores de catarata senil bilateral, divididos em dois grupos; 25

Autoregulation of Co-Chaperone BAG3 Gene Transcription

OpenAIRE

Gentilella, Antonio; Khalili, Kamel

2009-01-01

The Bcl-2-associated athanogene, BAG, protein family through their BAG domain associates with the heat shock protein 70 (HSP-70) and modulates its chaperone activity. One member of this family, BAG3, appears to play an important role in protein homeostasis, as its expression promotes cell survival by preventing polyubiquitination of Hsp-70 client proteins. Expression of BAG3 is enhanced by a variety of stress-inducing agents. Here we describe a role for BAG3 to modulate transcription of its o...

One out of four: HspL but no other small heat shock protein of Agrobacterium tumefaciens acts as efficient virulence-promoting VirB8 chaperone.

Directory of Open Access Journals (Sweden)

Yun-Long Tsai

Full Text Available Alpha-crystallin-type small heat shock proteins (sHsps are ubiquitously distributed in most eukaryotes and prokaryotes. Four sHsp genes named hspL, hspC, hspAT1, and hspAT2 were identified in Agrobacterium tumefaciens, a plant pathogenic bacterium capable of unique interkingdom DNA transfer via type IV secretion system (T4SS. HspL is highly expressed in virulence-induced growth condition and functions as a VirB8 chaperone to promote T4SS-mediated DNA transfer. Here, we used genetic and biochemical approaches to investigate the involvement of the other three sHsps in T4SS and discovered the molecular basis underlying the dominant function of HspL in promoting T4SS function. While single deletion of hspL but no other sHsp gene reduced T4SS-mediated DNA transfer and tumorigenesis efficiency, additional deletion of other sHsp genes in the hspL deletion background caused synergistic effects in the virulence phenotypes. This is correlated with the high induction of hspL and only modest increase of hspC, hspAT1, and hspAT2 at their mRNA and protein abundance in virulence-induced growth condition. Interestingly, overexpression of any single sHsp gene alone in the quadruple mutant caused increased T4SS-mediated DNA transfer and tumorigenesis. Thermal aggregation protecting assays in vitro indicated that all four sHsps exhibit chaperone activity for the model substrate citrate synthase but only HspL functions as efficient chaperone for VirB8. The higher VirB8 chaperone activity of HspL was also demonstrated in vivo, in which lower amounts of HspL than other sHsps were sufficient in maintaining VirB8 homeostasis in A. tumefaciens. Domain swapping between HspL and HspAT2 indicated that N-terminal, central alpha-crystallin, and C-terminal domains of HspL all contribute to HspL function as an efficient VirB8 chaperone. Taken together, we suggest that the dominant role of HspL in promoting T4SS function is based on its higher expression in virulence

Hypolipidemic effect of avocado (Persea americana Mill) seed in a hypercholesterolemic mouse model.

Science.gov (United States)

Pahua-Ramos, María Elena; Ortiz-Moreno, Alicia; Chamorro-Cevallos, Germán; Hernández-Navarro, María Dolores; Garduño-Siciliano, Leticia; Necoechea-Mondragón, Hugo; Hernández-Ortega, Marcela

2012-03-01

Avocado seed contains elevated levels of phenolic compounds and exhibits antioxidant properties. We investigated the effect of Avocado Seed Flour (ASF) on the lipid levels in mice on a hyperlipidemic diet. The concentration of phenols was determined by high-performance liquid chromatography, antioxidant activity was evaluated using the Trolox equivalent antioxidant capacity method, and dietary fiber was measured using the Association of Official Analytical Chemists (AOAC) method. The LD50 of ASF was determined using Lorke's method and hypolipidemic activity was evaluated in a hypercholesterolemic model in mice. Protocatechuic acid was the main phenolic compound found in ASF, followed by kaempferide and vanillic acid. The total phenolic content in the methanolic extract of ASF was 292.00 ± 9.81 mg gallic acid equivalents/g seed dry weight and the antioxidant activity resulted in 173.3 μmol Trolox equivalents/g DW. In addition, a high content of dietary fiber was found (34.8%). The oral LD50 for ASF was 1767 mg/kg body weight, and treatment with ASF significantly reduced the levels of total cholesterol, LDL-C, and prediction of the atherogenic index. Therefore, the antioxidant activity of phenolic compounds and dietary fiber in ASF may be responsible for the hypocholesterolemic activity of ASF in a hyperlipidemic model of mice.

Interactome Screening Identifies the ER Luminal Chaperone Hsp47 as a Regulator of the Unfolded Protein Response Transducer IRE1α.

Science.gov (United States)

Sepulveda, Denisse; Rojas-Rivera, Diego; Rodríguez, Diego A; Groenendyk, Jody; Köhler, Andres; Lebeaupin, Cynthia; Ito, Shinya; Urra, Hery; Carreras-Sureda, Amado; Hazari, Younis; Vasseur-Cognet, Mireille; Ali, Maruf M U; Chevet, Eric; Campos, Gisela; Godoy, Patricio; Vaisar, Tomas; Bailly-Maitre, Béatrice; Nagata, Kazuhiro; Michalak, Marek; Sierralta, Jimena; Hetz, Claudio

2018-01-18

Maintenance of endoplasmic reticulum (ER) proteostasis is controlled by a dynamic signaling network known as the unfolded protein response (UPR). IRE1α is a major UPR transducer, determining cell fate under ER stress. We used an interactome screening to unveil several regulators of the UPR, highlighting the ER chaperone Hsp47 as the major hit. Cellular and biochemical analysis indicated that Hsp47 instigates IRE1α signaling through a physical interaction. Hsp47 directly binds to the ER luminal domain of IRE1α with high affinity, displacing the negative regulator BiP from the complex to facilitate IRE1α oligomerization. The regulation of IRE1α signaling by Hsp47 is evolutionarily conserved as validated using fly and mouse models of ER stress. Hsp47 deficiency sensitized cells and animals to experimental ER stress, revealing the significance of Hsp47 to global proteostasis maintenance. We conclude that Hsp47 adjusts IRE1α signaling by fine-tuning the threshold to engage an adaptive UPR. Copyright © 2018 Elsevier Inc. All rights reserved.

Oral pharmacological chaperone migalastat compared with enzyme replacement therapy in Fabry disease

DEFF Research Database (Denmark)

Hughes, Derralynn A.; Nicholls, Kathleen; Shankar, Suma P.

2017-01-01

Background Fabry disease is an X-linked lysosomal storage disorder caused by GLA mutations, resulting in α-galactosidase (α-Gal) deficiency and accumulation of lysosomal substrates. Migalastat, an oral pharmacological chaperone being developed as an alternative to intravenous enzyme replacement t...

SLUDGE TREATMENT PROJECT PHASE 1 SLUDGE STORAGE OPTIONS. ASSESSMENT OF T PLANT VERSUS ALTERNATE STORAGE FACILITY

International Nuclear Information System (INIS)

Rutherford, W.W.; Geuther, W.J.; Strankman, M.R.; Conrad, E.A.; Rhoadarmer, D.D.; Black, D.M.; Pottmeyer, J.A.

2009-01-01

dependent on the confidence that DOE has in the long term mission for T Plant, is proposed: (1) If the confidence level in a durable, extended T Plant mission independent of sludge storage is high, then the Sludge Treatment Project (STP) would continue to implement the path forward previously described in the Alternatives Report (HNF-39744). Risks to the sludge project can be minimized through the establishment of an Interface Control Document (ICD) defining agreed upon responsibilities for both the STP and T Plant Operations regarding the transfer and storage of sludge and ensuring that the T Plant upgrade and operational schedule is well integrated with the sludge storage activities. (2) If the confidence level in a durable, extended T Plant mission independent of sludge storage is uncertain, then the ASF conceptual design should be pursued on a parallel path with preparation of T Plant for sludge storage until those uncertainties are resolved. (3) Finally, if the confidence level in a durable, extended T Plant mission independent of sludge storage is low, then the ASF design should be selected to provide independence from the T Plant mission risk

SLUDGE TREATMENT PROJECT PHASE 1 SLUDGE STORAGE OPTIONS ASSESSMENT OF T PLANT VERSUS ALTERNATE STORAGE FACILITY

Energy Technology Data Exchange (ETDEWEB)

RUTHERFORD WW; GEUTHER WJ; STRANKMAN MR; CONRAD EA; RHOADARMER DD; BLACK DM; POTTMEYER JA

2009-04-29

dependent on the confidence that DOE has in the long term mission for T Plant, is proposed: (1) If the confidence level in a durable, extended T Plant mission independent of sludge storage is high, then the Sludge Treatment Project (STP) would continue to implement the path forward previously described in the Alternatives Report (HNF-39744). Risks to the sludge project can be minimized through the establishment of an Interface Control Document (ICD) defining agreed upon responsibilities for both the STP and T Plant Operations regarding the transfer and storage of sludge and ensuring that the T Plant upgrade and operational schedule is well integrated with the sludge storage activities. (2) If the confidence level in a durable, extended T Plant mission independent of sludge storage is uncertain, then the ASF conceptual design should be pursued on a parallel path with preparation of T Plant for sludge storage until those uncertainties are resolved. (3) Finally, if the confidence level in a durable, extended T Plant mission independent of sludge storage is low, then the ASF design should be selected to provide independence from the T Plant mission risk.

Loss of function mutation in LARP7, chaperone of 7SK ncRNA, causes a syndrome of facial dysmorphism, intellectual disability, and primordial dwarfism.

Science.gov (United States)

Alazami, Anas M; Al-Owain, Mohammad; Alzahrani, Fatema; Shuaib, Taghreed; Al-Shamrani, Hussain; Al-Falki, Yahya H; Al-Qahtani, Saleh M; Alsheddi, Tarfa; Colak, Dilek; Alkuraya, Fowzan S

2012-10-01

Primordial dwarfism (PD) is a clinically and genetically heterogeneous condition. Various molecular mechanisms are known to underlie the disease including impaired mitotic mechanics, abnormal IGF2 expression, perturbed DNA damage response, defective spliceosomal machinery, and abnormal replication licensing. Here, we describe a syndromic form of PD associated with severe intellectual disability and distinct facial features in a large multiplex Saudi family. Analysis reveals a novel underlying mechanism for PD involving depletion of 7SK, an abundant cellular noncoding RNA (ncRNA), due to mutation of its chaperone LARP7. We show that 7SK levels are tightly linked to LARP7 expression across cell lines, and that this chaperone is ubiquitously expressed in the mouse embryo. The 7SK is known to influence the expression of a wide array of genes through its inhibitory effect on the positive transcription elongation factor b (P-TEFb) as well as its competing role in HMGA1-mediated transcriptional regulation. This study documents a critical role played by ncRNA in human development and adds to the growing list of molecular mechanisms that, when perturbed, converge on the PD phenotype. © 2012 Wiley Periodicals, Inc.

The Escherichia coli thioredoxin homolog YbbN/Trxsc is a chaperone and a weak protein oxidoreductase.

Science.gov (United States)

Caldas, Thérèse; Malki, Abderrahim; Kern, Renée; Abdallah, Jad; Richarme, Gilbert

2006-05-12

Escherichia coli contains two thioredoxins, Trx1 and Trx2, and a thioredoxin-like protein, YbbN, which presents a strong homology in its N-terminal part with thioredoxin 1 and 2. YbbN, however, does not possess the canonical Cys-x-x-Cys active site of thioredoxins, but instead a Ser-x-x-Cys site. In addition to Cys-38, located in the SxxC site, it contains a second cysteine, Cys-63, close to Cys-38 in the 3D model. Cys-38 and Cys-63 undergo an oxidoreduction process, suggesting that YbbN functions with two redox cysteines. Accordingly, YbbN catalyzes the oxidation of reduced RNase and the isomerization of scrambled RNase. Moreover, upon oxidation, its oligomeric state changes from dimers to tetramers and higher oligomers. YbbN also possesses chaperone properties, promoting protein folding after urea denaturation and forming complexes with unfolded proteins. This is the first biochemical characterization of a member of the YbbN class of bacterial thioredoxin-like proteins, and in vivo experiments will allow to determine the importance of its redox and chaperone properties in the cellular physiology.

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

Energy Technology Data Exchange (ETDEWEB)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk [Imperial College London, South Kensington, London SW7 2AZ (United Kingdom)

2015-05-20

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological and abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

International Nuclear Information System (INIS)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J.

2015-01-01

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological and abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3 1 21 or P3 2 21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be

Functional diversification of hsp40: distinct j-protein functional requirements for two prions allow for chaperone-dependent prion selection.

Science.gov (United States)

Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K

2014-07-01

Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have

Conformational Activation of Argonaute by Distinct yet Coordinated Actions of the Hsp70 and Hsp90 Chaperone Systems.

Science.gov (United States)

Tsuboyama, Kotaro; Tadakuma, Hisashi; Tomari, Yukihide

2018-05-17

Loading of small RNAs into Argonaute, the core protein in RNA silencing, requires the Hsp70/Hsp90 chaperone machinery. This machinery also activates many other clients, including steroid hormone receptors and kinases, but how their structures change during chaperone-dependent activation remains unclear. Here, we utilized single-molecule Förster resonance energy transfer (smFRET) to probe the conformational changes of Drosophila Ago2 mediated by the chaperone machinery. We found that empty Ago2 exists in various closed conformations. The Hsp70 system (Hsp40 and Hsp70) and the Hsp90 system (Hop, Hsp90, and p23) together render Ago2 into an open, active form. The Hsp70 system, but not the Hsp90 system alone, is sufficient for Ago2 to partially populate the open form. Instead, the Hsp90 system is required to extend the dwell time of Ago2 in the open state, which must be transiently primed by the Hsp70 system. Our data uncover distinct and coordinated actions of the chaperone machinery, where the Hsp70 system expands the structural ensembles of Ago2 and the Hsp90 system captures and stabilizes the active form. Copyright © 2018 Elsevier Inc. All rights reserved.

Association of HSP70 and its co-chaperones with Alzheimer's disease

NARCIS (Netherlands)

L. Broer (Linda); M.A. Ikram (Arfan); M. Schuur (Maaike); A.L. DeStefano (Anita); J.C. Bis (Joshua); F. Liu (Fan); F. Rivadeneira Ramirez (Fernando); A.G. Uitterlinden (André); A. Beiser (Alexa); W.T. Longstreth Jr; A. Hofman (Albert); Y.S. Aulchenko (Yurii); S. Seshadri (Sudha); A.L. Fitzpatrick (Annette); B.A. Oostra (Ben); M.M.B. Breteler (Monique); P. Tikka-Kleemola (Päivi)

2011-01-01

textabstractThe heat shock protein (HSP) 70 family has been implicated in the pathology of Alzheimer's disease (AD). In this study, we examined common genetic variations in the 80 genes encoding HSP70 and its co-chaperones. We conducted a study in a series of 462 patients and 5238 unaffected

Chaperones CCS, ATOX and COXIV responses to copper supplementation in healthy adults.

Science.gov (United States)

Araya, Magdalena; Andrews, Monica; Pizarro, Fernando; Arredondo, Miguel

2012-04-01

Assessment of proteins in blood and other tissues has failed to identify markers of early copper effects on health. Studies in animal models show that chaperone of SOD (CCS) respond to changes of copper status. Evidence about other copper chaperones (COXIV, ATOX) is not clear. The aim of this study was to assess by means of an in vitro challenge the mRNA relative abundance of ccs, sod1, coxIV, mtIIa and atox in peripheral mononuclear cells (PMNCs) obtained from healthy individuals, acutely and chronically supplemented with small-to-moderate amounts of copper. Healthy participants received 8 mg Cu/d (supplemented group, SG) or placebo, (placebo group, PG) for 2 months. Biochemical indicators were assessed at basal (T0) and after 2 (T2) and 60 days (T60). At these times PMNCs were obtained, challenged with 1, 5 or 20 μM Cu-histidine for 20 h and the mRNA relative abundance of the selected genes assessed by real time PCR. The results showed that at T0, intracellular copper was not different between experimental and control groups. This increased at T2 and T60 when the copper in the media increased (two-way ANOVA, P CCS mRNA transcripts showed no significant changes (two-way ANOVA) at T2 and T60. In SG, CCS changed by treatment, time and interaction (two-way ANOVA, all P CCS but not SOD, ATOX or COXIV responded consistently to controlled changes of copper availability in an in vitro copper challenge.

Locking the Elbow: Improved Antibody Fab Fragments as Chaperones for Structure Determination.

Science.gov (United States)

Bailey, Lucas J; Sheehy, Kimberly M; Dominik, Pawel K; Liang, Wenguang G; Rui, Huan; Clark, Michael; Jaskolowski, Mateusz; Kim, Yejoon; Deneka, Dawid; Tang, Wei-Jen; Kossiakoff, Anthony A

2018-02-02

Antibody Fab fragments have been exploited with significant success to facilitate the structure determination of challenging macromolecules as crystallization chaperones and as molecular fiducial marks for single particle cryo-electron microscopy approaches. However, the inherent flexibility of the "elbow" regions, which link the constant and variable domains of the Fab, can introduce disorder and thus diminish their effectiveness. We have developed a phage display engineering strategy to generate synthetic Fab variants that significantly reduces elbow flexibility, while maintaining their high affinity and stability. This strategy was validated using previously recalcitrant Fab-antigen complexes where introduction of an engineered elbow region enhanced crystallization and diffraction resolution. Furthermore, incorporation of the mutations appears to be generally portable to other synthetic antibodies and may serve as a universal strategy to enhance the success rates of Fabs as structure determination chaperones. Copyright © 2017 Elsevier Ltd. All rights reserved.

Regulatory coiled-coil domains promote head-to-head assemblies of AAA+ chaperones essential for tunable activity control.

Science.gov (United States)

Carroni, Marta; Franke, Kamila B; Maurer, Michael; Jäger, Jasmin; Hantke, Ingo; Gloge, Felix; Linder, Daniela; Gremer, Sebastian; Turgay, Kürşad; Bukau, Bernd; Mogk, Axel

2017-11-22

Ring-forming AAA+ chaperones exert ATP-fueled substrate unfolding by threading through a central pore. This activity is potentially harmful requiring mechanisms for tight repression and substrate-specific activation. The AAA+ chaperone ClpC with the peptidase ClpP forms a bacterial protease essential to virulence and stress resistance. The adaptor MecA activates ClpC by targeting substrates and stimulating ClpC ATPase activity. We show how ClpC is repressed in its ground state by determining ClpC cryo-EM structures with and without MecA. ClpC forms large two-helical assemblies that associate via head-to-head contacts between coiled-coil middle domains (MDs). MecA converts this resting state to an active planar ring structure by binding to MD interaction sites. Loss of ClpC repression in MD mutants causes constitutive activation and severe cellular toxicity. These findings unravel an unexpected regulatory concept executed by coiled-coil MDs to tightly control AAA+ chaperone activity.

A Cartographic Tool for Managing African Swine Fever in Eurasia: Mapping Wild Boar Distribution Based on the Quality of Available Habitats.

Science.gov (United States)

Bosch, J; Iglesias, I; Muñoz, M J; de la Torre, A

2017-12-01

The current African swine fever (ASF) epidemic in Eurasia represents a risk for the swine industry with devastating socio-economic and political consequences. Wild boar appears to be a key factor in maintaining the disease in endemic areas (mainly the Russian Federation) and spreading the disease across borders, including within the European Union. To help predict and interpret the dynamics of ASF infection, we developed a standardized distribution map based on global land cover vegetation (GLOBCOVER) that quantifies the quality of available habitats (QAH) for wild boar across Eurasia as an indirect index for quantifying numbers of wild boar. QAHs were estimated using a seven-level scale based on expert opinion and found to correlate closely with georeferenced presence of wild boar (n = 22 362): the highest wild boar densities (74.47%) were found in areas at the two highest QAH levels, while the lowest densities (5.66%) were found in areas at the lowest QAH levels. Mapping notifications from 2007 to 2016 onto the QAH map showed that in endemic areas, 60% of ASF notifications occurred in domestic pigs, mostly in agricultural landscapes (QAHs 1.75 and 1) containing low-biosecurity domestic pig farms. In the EU, in contrast, 95% of ASF notifications occurred in wild boar, within natural landscapes (QAH 2). These results suggest that the QAH map can be a useful epi-tool for defining risk scenarios and identifying potential travel corridors for ASF. This tool will help inform resource allocation decisions and improve prevention, control and surveillance of ASF and potentially of other diseases affecting swine and wild boar in Eurasia. © 2016 Blackwell Verlag GmbH.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.

Science.gov (United States)

Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A

2012-10-30

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.

Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain.

Science.gov (United States)

Dabbaghizadeh, Afrooz; Finet, Stéphanie; Morrow, Genevieve; Moutaoufik, Mohamed Taha; Tanguay, Robert M

2017-07-01

The structure and chaperone function of DmHsp22WT, a small Hsp of Drosophila melanogaster localized within mitochondria were examined. Mutations of conserved arginine mutants within the alpha-crystallin domain (ACD) domain (R105G, R109G, and R110G) were introduced, and their effects on oligomerization and chaperone function were assessed. Arginine to glycine mutations do not induce significant changes in tryptophan fluorescence, and the mutated proteins form oligomers that are of equal or smaller size than the wild-type protein. They all form oligomer with one single peak as determined by size exclusion chromatography. While all mutants demonstrate the same efficiency as the DmHsp22WT in a DTT-induced insulin aggregation assay, all are more efficient chaperones to prevent aggregation of malate dehydrogenase. Arginine mutants of DmHsp22 are efficient chaperones to retard aggregation of CS and Luc. In summary, this study shows that mutations of arginine to glycine in DmHsp22 ACD induce a number of structural changes, some of which differ from those described in mammalian sHsps. Interestingly, only the R110G-DmHsp22 mutant, and not the expected R109G equivalent to human R140-HspB1, R116-HspB4, and R120-HspB5, showed different structural properties compared with the DmHsp22WT.

Reduced levels of SCD1 accentuate palmitate-induced stress in insulin-producing β-cells

Directory of Open Access Journals (Sweden)

Hovsepyan Meri

2010-09-01

Full Text Available Abstract Background Stearoyl-CoA desaturase 1 (SCD1 is an ER resident enzyme introducing a double-bond in saturated fatty acids. Global knockout of SCD1 in mouse increases fatty acid oxidation and insulin sensitivity which makes the animal resistant to diet-induced obesity. Inhibition of SCD1 has therefore been proposed as a potential therapy of the metabolic syndrome. Much of the work has focused on insulin target tissue and very little is known about how reduced levels of SCD1 would affect the insulin-producing β-cell, however. The aim of the present study was therefore to investigate how reduced levels of SCD1 affect the β-cell. Results Insulin-secreting MIN6 cells with reduced levels of SCD1 were established by siRNA mediated knockdown. When fatty acid oxidation was measured, no difference between cells with reduced levels of SCD1 and mock-transfected cells were found. Also, reducing levels of SCD1 did not affect insulin secretion in response to glucose. To investigate how SCD1 knockdown affected cellular mechanisms, differentially regulated proteins were identified by a proteomic approach. Cells with reduced levels of SCD1 had higher levels of ER chaperones and components of the proteasome. The higher amounts did not protect the β-cell from palmitate-induced ER stress and apoptosis. Instead, rise in levels of p-eIF2α and CHOP after palmitate exposure was 2-fold higher in cells with reduced levels of SCD1 compared to mock-transfected cells. Accordingly, apoptosis rose to higher levels after exposure to palmitate in cells with reduced levels of SCD1 compared to mock-transfected cells. Conclusions In conclusion, reduced levels of SCD1 augment palmitate-induced ER stress and apoptosis in the β-cell, which is an important caveat when considering targeting this enzyme as a treatment of the metabolic syndrome.

Fab Chaperone-Assisted RNA Crystallography (Fab CARC).

Science.gov (United States)

Sherman, Eileen; Archer, Jennifer; Ye, Jing-Dong

2016-01-01

Recent discovery of structured RNAs such as ribozymes and riboswitches shows that there is still much to learn about the structure and function of RNAs. Knowledge learned can be employed in both biochemical research and clinical applications. X-ray crystallography gives unparalleled atomic-level structural detail from which functional inferences can be deduced. However, the difficulty in obtaining high-quality crystals and their phasing information make it a very challenging task. RNA crystallography is particularly arduous due to several factors such as RNA's paucity of surface chemical diversity, lability, repetitive anionic backbone, and flexibility, all of which are counterproductive to crystal packing. Here we describe Fab chaperone assisted RNA crystallography (CARC), a systematic technique to increase RNA crystallography success by facilitating crystal packing as well as expediting phase determination through molecular replacement of conserved Fab domains. Major steps described in this chapter include selection of a synthetic Fab library displayed on M13 phage against a structured RNA crystallization target, ELISA for initial choice of binding Fabs, Fab expression followed by protein A affinity then cation exchange chromatography purification, final choice of Fab by binding specificity and affinity as determined by a dot blot assay, and lastly gel filtration purification of a large quantity of chosen Fabs for crystallization.

The determinants and engagement patterns of chaperones and chauffeurs by Australian doctors in after-hours house-call services.

Science.gov (United States)

Ifediora, Chris Onyebuchi

2017-01-01

The use of escorts (chauffeurs and chaperones) while on duty in after-hours-house-call (AHHC) is one key protective option available to doctors in the service, and has been linked to low burnout and increased satisfaction in AHHC. This study aims to explore the patterns of engagement of escorts in Australian AHHC. This is a questionnaire-based, electronic survey of all 300 doctors involved in AHHC through the National Home Doctor Service (NHDS), Australia's largest providers of the service. The survey explored the doctor's experiences over the 12-month period from October 2013 to September 2014. This survey received a total of 168 valid responses, giving a response rate of 56%. Nearly 61% of the doctors involved in AHHC engaged escorts (chauffeurs and chaperones). Of those doctors that engage chauffeurs, three-quarters do so "all or most times", while only one-quarter engaged chaperones to the same degree of frequency. Hiring escorts is very popular among Brisbane (91.7%) and Sydney-based (88.2%) practitioners, but is unpopular in the City of Gold Coast (26.1%). There were moderate patronages in Adelaide (52.9%) and Melbourne Area (46.4%). Compared to males, females were less likely to drive themselves without escorts (OR 0.20; P  doctors involved in the Australian AHHC, particularly given their proven benefits in the service. Future studies may be needed to fully explore the real reasons behind the significant associations identified in this study.

Comparison of intra-organellar chaperone capacity for dealing with stress-induced protein unfolding

NARCIS (Netherlands)

Hageman, Jurre; Vos, Michel J.; van Waarde, Maria A. W. H.; Kampinga, Harm H.

2007-01-01

Molecular chaperones are essential for cells to prevent that partially unfolded proteins form non-functional, toxic aggregates. This requirement is increased when cells experience protein unfolding stresses and such could affect all compartments in the eukaryotic cell. Whether all organelles are

The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1.

Science.gov (United States)

Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L

2001-06-01

Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.

Chaperone-Mediated Regulation of Choline Acetyltransferase Protein Stability and Activity by HSC/HSP70, HSP90, and p97/VCP

Directory of Open Access Journals (Sweden)

Trevor M. Morey

2017-12-01

Full Text Available Choline acetyltransferase (ChAT synthesizes the neurotransmitter acetylcholine in cholinergic neurons, and mutations of this enzyme are linked to the neuromuscular disorder congenital myasthenic syndrome (CMS. One CMS-related mutation, V18M, reduces ChAT enzyme activity and cellular protein levels, and is located within a highly-conserved N-terminal proline-rich motif at residues 14PKLPVPP20. We showed previously that disruption of this proline-rich motif by either proline-to-alanine mutation (P17A/P19A or mutation of residue Val18 (V18M enhances ubiquitination and degradation of these mutant ChAT proteins expressed in cholinergic SN56 cells by an unknown mechanism. In this study, using proximity-dependent biotin identification (BioID, co-immunoprecipitation and in situ proximity-ligation assay (PLA, we identified the heat shock proteins (HSPs HSC/HSP70 and HSP90 as novel ChAT protein-interactors. These molecular chaperones are well-known for promoting the folding and stabilization of cellular proteins. Thus, we found that inhibition of HSPs by treatment of cells with either the HSC/HSP70 inhibitors 2-phenylethynesulfonamide (PES or VER-155008, or the HSP90 inhibitor 17-AAG reduced cellular ChAT activity and solubility, and enhanced the ubiquitination and proteasome-dependent loss of ChAT protein. Importantly, the effects of HSP inhibition were greater for mutant ChAT proteins (P17A/P19A-ChAT and CMS-related V18M- and A513T-ChAT compared to wild-type ChAT. HSPs can promote ubiquitination and degradation of terminally misfolded proteins through cooperative interaction with the E3 ubiquitin ligase CHIP/Stub1, and while we show that ChAT interacts with CHIP in situ, siRNA-mediated knock-down of CHIP had no effect on either wild-type or mutant ChAT protein levels. However, inhibition of the endoplasmic reticulum (ER- and HSP-associated co-chaperone p97/VCP prevented degradation of ubiquitinated ChAT. Together, these results identify novel mechanisms

Allogeneic effector/memory Th-1 cells impair FoxP3+ regulatory T lymphocytes and synergize with chaperone-rich cell lysate vaccine to treat leukemia.

Science.gov (United States)

Janikashvili, Nona; LaCasse, Collin J; Larmonier, Claire; Trad, Malika; Herrell, Amanda; Bustamante, Sara; Bonnotte, Bernard; Har-Noy, Michael; Larmonier, Nicolas; Katsanis, Emmanuel

2011-02-03

Therapeutic strategies combining the induction of effective antitumor immunity with the inhibition of the mechanisms of tumor-induced immunosuppression represent a key objective in cancer immunotherapy. Herein we demonstrate that effector/memory CD4(+) T helper-1 (Th-1) lymphocytes, in addition to polarizing type-1 antitumor immune responses, impair tumor-induced CD4(+)CD25(+)FoxP3(+) regulatory T lymphocyte (Treg) immunosuppressive function in vitro and in vivo. Th-1 cells also inhibit the generation of FoxP3(+) Tregs from naive CD4(+)CD25(-)FoxP3(-) T cells by an interferon-γ-dependent mechanism. In addition, in an aggressive mouse leukemia model (12B1), Th-1 lymphocytes act synergistically with a chaperone-rich cell lysate (CRCL) vaccine, leading to improved survival and long-lasting protection against leukemia. The combination of CRCL as a source of tumor-specific antigens and Th-1 lymphocytes as an adjuvant has the potential to stimulate efficient specific antitumor immunity while restraining Treg-induced suppression.

Revestimientos asfálticos sobre bases continuas

Directory of Open Access Journals (Sweden)

Eberle, Karl

1963-10-01

Full Text Available In the course of a meeting connected with research on road pavements, held at Konstance, in Germany, Dr. Eberle submitted for discussion and study two new methods for the construction of modern pavements. In general outline, the first of these methods consists in placing a layer of gravel, of about 18 cms depth, on top of the foundation base, after suitably treating the latter to protect it against frost. An asphaltic layer of much smaller depth is then placed on the gravel layer, which constitutes a flexible base. The asphaltic layer is the actual traffic pavement. The second method is similar to the first as regards the grading, box and foundation. The only difference is that cement mortar is applied to the gravel base, into the hollow spaces of which the mortar is made to penetrate. In both methods the top pavement is consolidated mechanically by means of suitable auxiliary equipment. The choice of one or other of the previous two methods depends on the results obtained from a general study of the location and quality of the available crushed stone, and on the facility to transport these materials to the prepared graded subbases. The author claims that the rational use of these methods gives good results, both technically and economically.Con motivo de celebrarse una reunión encargada de la investigación I sobre firmes para carreteras, verificada en Konstanz, Alemania, el autor expuso para su estudio y consideración dos nuevos métodos constructivos para afirmados modernos. El primero de estos métodos consiste, a grandes rasgos, en colocar una capa, de grava, de unos 18 cm de espesor, sobre la superficie de la base de cimiento, convenientemente tratada, para protegerla contra las heladas. Sobre esta capa, que constituye un firme flexible, se coloca otra asfáltica de mucho menor espesor, que sirve de rodadura. El segundo método es similar al anterior en lo que se refiere a la explanación, caja y cimiento; la única diferencia estriba en

Bag1 Co-chaperone Promotes TRC8 E3 Ligase-dependent Degradation of Misfolded Human Ether a Go-Go-related Gene (hERG) Potassium Channels.

Science.gov (United States)

Hantouche, Christine; Williamson, Brittany; Valinsky, William C; Solomon, Joshua; Shrier, Alvin; Young, Jason C

2017-02-10

Cardiac long QT syndrome type 2 is caused by mutations in the human ether a go-go-related gene (hERG) potassium channel, many of which cause misfolding and degradation at the endoplasmic reticulum instead of normal trafficking to the cell surface. The Hsc70/Hsp70 chaperones assist the folding of the hERG cytosolic domains. Here, we demonstrate that the Hsp70 nucleotide exchange factor Bag1 promotes hERG degradation by the ubiquitin-proteasome system at the endoplasmic reticulum to regulate hERG levels and channel activity. Dissociation of hERG complexes containing Hsp70 and the E3 ubiquitin ligase CHIP requires the interaction of Bag1 with Hsp70, but this does not involve the Bag1 ubiquitin-like domain. The interaction with Bag1 then shifts hERG degradation to the membrane-anchored E3 ligase TRC8 and its E2-conjugating enzyme Ube2g2, as determined by siRNA screening. TRC8 interacts through the transmembrane region with hERG and decreases hERG functional expression. TRC8 also mediates degradation of the misfolded hERG-G601S disease mutant, but pharmacological stabilization of the mutant structure prevents degradation. Our results identify TRC8 as a previously unknown Hsp70-independent quality control E3 ligase for hERG. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Chaperones, but not oxidized proteins, are ubiquitinated after oxidative stress

DEFF Research Database (Denmark)

Kästle, Marc; Reeg, Sandra; Rogowska-Wrzesinska, Adelina

2012-01-01

of these proteins by MALDI tandem mass spectrometry (MALDI MS/MS). As a result we obtained 24 different proteins which can be categorized into the following groups: chaperones, energy metabolism, cytoskeleton/intermediate filaments, and protein translation/ribosome biogenesis. The special set of identified......, ubiquitinated proteins confirm the thesis that ubiquitination upon oxidative stress is no random process to degrade the mass of oxidized proteins, but concerns a special group of functional proteins....

TRPV1 channels and the progesterone receptor Sig-1R interact to regulate pain.

Science.gov (United States)

Ortíz-Rentería, Miguel; Juárez-Contreras, Rebeca; González-Ramírez, Ricardo; Islas, León D; Sierra-Ramírez, Félix; Llorente, Itzel; Simon, Sidney A; Hiriart, Marcia; Rosenbaum, Tamara; Morales-Lázaro, Sara L

2018-02-13

The Transient Receptor Potential Vanilloid 1 (TRPV1) ion channel is expressed in nociceptors where, when activated by chemical or thermal stimuli, it functions as an important transducer of painful and itch-related stimuli. Although the interaction of TRPV1 with proteins that regulate its function has been previously explored, their modulation by chaperones has not been elucidated, as is the case for other mammalian TRP channels. Here we show that TRPV1 physically interacts with the Sigma 1 Receptor (Sig-1R), a chaperone that binds progesterone, an antagonist of Sig-1R and an important neurosteroid associated to the modulation of pain. Antagonism of Sig-1R by progesterone results in the down-regulation of TRPV1 expression in the plasma membrane of sensory neurons and, consequently, a decrease in capsaicin-induced nociceptive responses. This is observed both in males treated with a synthetic antagonist of Sig-1R and in pregnant females where progesterone levels are elevated. This constitutes a previously undescribed mechanism by which TRPV1-dependent nociception and pain can be regulated.

Galectin-1-asialofetuin interaction is inhibited by peptides containing the tyr-xxx-tyr motif acting on the glycoprotein.

Science.gov (United States)

Wéber, Edit; Hetényi, Anasztázia; Váczi, Balázs; Szolnoki, Eva; Fajka-Boja, Roberta; Tubak, Vilmos; Monostori, Eva; Martinek, Tamás A

2010-01-25

Galectin-1 (Gal-1), a ubiquitous beta-galactoside-binding protein expressed by various normal and pathological tissues, has been implicated in cancer and autoimmune/inflammatory diseases in consequence of its regulatory role in adhesion, cell viability, proliferation, and angiogenesis. The functions of Gal-1 depend on its affinity for beta-galactoside-containing glycoconjugates; accordingly, the inhibition of sugar binding blocks its functions, hence promising potential therapeutic tools. The Tyr-Xxx-Tyr peptide motifs have been reported to be glycomimetic sequences, mainly on the basis of their inhibitory effect on the Gal-1-asialofetuin (ASF) interaction. However, the results regarding the efficacy of the Tyr-Xxx-Tyr motif as a glycomimetic inhibitor are still controversial. The present STD and trNOE NMR experiments reveal that the Tyr-Xxx-Tyr peptides studied do not bind to Gal-1, whereas their binding to ASF is clearly detected. (15)N,(1)H HSQC titrations with (15)N-labeled Gal-1 confirm the absence of any peptide-Gal-1 interaction. These data indicate that the Tyr-Xxx-Tyr peptides tested in this work are not glycomimetics as they interact with ASF via an unrevealed molecular linkage.

Determinants for simultaneous binding of copper and platinum to human chaperone Atox1: hitchhiking not hijacking.

Directory of Open Access Journals (Sweden)

Maria E Palm-Espling

Full Text Available Cisplatin (CisPt is an anticancer agent that has been used for decades to treat a variety of cancers. CisPt treatment causes many side effects due to interactions with proteins that detoxify the drug before reaching the DNA. One key player in CisPt resistance is the cellular copper-transport system involving the uptake protein Ctr1, the cytoplasmic chaperone Atox1 and the secretory path ATP7A/B proteins. CisPt has been shown to bind to ATP7B, resulting in vesicle sequestering of the drug. In addition, we and others showed that the apo-form of Atox1 could interact with CisPt in vitro and in vivo. Since the function of Atox1 is to transport copper (Cu ions, it is important to assess how CisPt binding depends on Cu-loading of Atox1. Surprisingly, we recently found that CisPt interacted with Cu-loaded Atox1 in vitro at a position near the Cu site such that unique spectroscopic features appeared. Here, we identify the binding site for CisPt in the Cu-loaded form of Atox1 using strategic variants and a combination of spectroscopic and chromatographic methods. We directly prove that both metals can bind simultaneously and that the unique spectroscopic signals originate from an Atox1 monomer species. Both Cys in the Cu-site (Cys12, Cys15 are needed to form the di-metal complex, but not Cys41. Removing Met10 in the conserved metal-binding motif makes the loop more floppy and, despite metal binding, there are no metal-metal electronic transitions. In silico geometry minimizations provide an energetically favorable model of a tentative ternary Cu-Pt-Atox1 complex. Finally, we demonstrate that Atox1 can deliver CisPt to the fourth metal binding domain 4 of ATP7B (WD4, indicative of a possible drug detoxification mechanism.

Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?

Science.gov (United States)

Nakanishi, Kotaro

2016-09-01

RNA silencing is a eukaryote-specific phenomenon in which microRNAs and small interfering RNAs degrade messenger RNAs containing a complementary sequence. To this end, these small RNAs need to be loaded onto an Argonaute protein (AGO protein) to form the effector complex referred to as RNA-induced silencing complex (RISC). RISC assembly undergoes multiple and sequential steps with the aid of Hsc70/Hsp90 chaperone machinery. The molecular mechanisms for this assembly process remain unclear, despite their significance for the development of gene silencing techniques and RNA interference-based therapeutics. This review dissects the currently available structures of AGO proteins and proposes models and hypotheses for RISC assembly, covering the conformation of unloaded AGO proteins, the chaperone-assisted duplex loading, and the slicer-dependent and slicer-independent duplex separation. The differences in the properties of RISC between prokaryotes and eukaryotes will also be clarified. WIREs RNA 2016, 7:637-660. doi: 10.1002/wrna.1356 For further resources related to this article, please visit the WIREs website. © 2016 The Authors. WIREs RNA published by Wiley Periodicals, Inc.

Synthetic cation-selective nanotube: permeant cations chaperoned by anions.

Science.gov (United States)

Hilder, Tamsyn A; Gordon, Dan; Chung, Shin-Ho

2011-01-28

The ability to design ion-selective, synthetic nanotubes which mimic biological ion channels may have significant implications for the future treatment of bacteria, diseases, and as ultrasensitive biosensors. We present the design of a synthetic nanotube made from carbon atoms that selectively allows monovalent cations to move across and rejects all anions. The cation-selective nanotube mimics some of the salient properties of biological ion channels. Before practical nanodevices are successfully fabricated it is vital that proof-of-concept computational studies are performed. With this in mind we use molecular and stochastic dynamics simulations to characterize the dynamics of ion permeation across a single-walled (10, 10), 36 Å long, carbon nanotube terminated with carboxylic acid with an effective radius of 5.08 Å. Although cations encounter a high energy barrier of 7 kT, its height is drastically reduced by a chloride ion in the nanotube. The presence of a chloride ion near the pore entrance thus enables a cation to enter the pore and, once in the pore, it is chaperoned by the resident counterion across the narrow pore. The moment the chaperoned cation transits the pore, the counterion moves back to the entrance to ferry another ion. The synthetic nanotube has a high sodium conductance of 124 pS and shows linear current-voltage and current-concentration profiles. The cation-anion selectivity ratio ranges from 8 to 25, depending on the ionic concentrations in the reservoirs.

BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

International Nuclear Information System (INIS)

Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

2010-01-01

Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

Mapping the ER Interactome: The P Domains of Calnexin and Calreticulin as Plurivalent Adapters for Foldases and Chaperones.

Science.gov (United States)

Kozlov, Guennadi; Muñoz-Escobar, Juliana; Castro, Karla; Gehring, Kalle

2017-09-05

The lectin chaperones calreticulin (CRT) and calnexin (CNX) contribute to the folding of glycoproteins in the ER by recruiting foldases such as the protein disulfide isomerase ERp57 and the peptidyl prolyl cis-trans isomerase CypB. Recently, CRT was shown to interact with the chaperone ERp29. Here, we show that ERp29 directly binds to the P domain of CNX. Crystal structures of the D domain of ERp29 in complex with the P domains from CRT and calmegin, a tissue-specific CNX homolog, reveal a commonality in the mechanism of binding whereby the tip of the P domain functions as a plurivalent adapter to bind a variety of folding factors. We show that mutation of a single residue, D348 in CNX, abrogates binding to ERp29 as well as ERp57 and CypB. The structural diversity of the accessory factors suggests that these chaperones became specialized for glycoprotein folding through convergent evolution of their P-domain binding sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chemical chaperones reduce ER stress and adipose tissue inflammation in high fat diet-induced mouse model of obesity.

Science.gov (United States)

Chen, Yaqin; Wu, Zhihong; Zhao, Shuiping; Xiang, Rong

2016-06-08

Obesity, which is characteristic by chronic inflammation, is defined as abnormal or excessive fat accumulation in adipose tissues. Endoplasmic reticulum (ER) stress is increased in adipose tissue of obese state and is known to be strongly associated with chronic inflammation. The aim of this study was to investigate the effect of ER stress on adipokine secretion in obese mice and explore the potential mechanisms. In this study, we found high-fat diet induced-obesity contributed to strengthened ER stress and triggered chronic inflammation in adipose tissue. Chemical chaperones, 4-PBA and TUDCA, modified metabolic disorders and decreased the levels of inflammatory cytokines in obese mice fed a high-fat diet. The alleviation of ER stress is in accordance with the decrease of free cholesterol in adipose tissue. Furthermore chemical chaperones suppress NF-κB activity in adipose tissue of obese mice in vivo. In vitro studies showed IKK/NF-κB may be involved in the signal transduction of adipokine secretion dysfunction induced by ER stress. The present study revealed the possibility that inhibition of ER stress may be a novel drug target for metabolic abnormalities associated with obesity. Further studies are now needed to characterize the initial incentive of sustained ER stress in obese.

Strong anisotropy effect in an iron-based superconductor CaFe0.882Co0.118AsF

Science.gov (United States)

Ma, Yonghui; Ji, Qiucheng; Hu, Kangkang; Gao, Bo; Li, Wei; Mu, Gang; Xie, Xiaoming

2017-07-01

The anisotropy of iron-based superconductors is much smaller than that of the cuprates and that predicted by theoretical calculations. A credible understanding for this experimental fact is still lacking up to now. Here we experimentally study the magnetic-field-angle dependence of electronic resistivity in the superconducting phase of an iron-based superconductor CaFe{}0.882Co{}0.118AsF, and find the strongest anisotropy effect of the upper critical field among the iron-based superconductors based on the framework of Ginzburg-Landau theory. The evidence of the energy band structure and charge density distribution from electronic structure calculations demonstrates that the observed strong anisotropic effect mainly comes from the strong ionic bonding in between the ions of Ca2+ and F-, which weakens the interlayer coupling between the layers of FeAs and CaF. This finding provides a significant insight into the nature of the experimentally-observed strong anisotropic effect of electronic resistivity, and also paves the way for designing exotic two-dimensional artificial unconventional superconductors in the future.

The DNLZ/HEP zinc-binding subdomain is critical for regulation of the mitochondrial chaperone HSPA9.

Science.gov (United States)

Vu, Michael T; Zhai, Peng; Lee, Juhye; Guerra, Cecilia; Liu, Shirley; Gustin, Michael C; Silberg, Jonathan J

2012-02-01

Human mitochondrial DNLZ/HEP regulates the catalytic activity and solubility of the mitochondrial hsp70 chaperone HSPA9. Here, we investigate the role that the DNLZ zinc-binding and C-terminal subdomains play in regulating HSPA9. We show that truncations lacking portions of the zinc-binding subdomain (ZBS) do not affect the solubility of HSPA9 or its ATPase domain, whereas those containing the ZBS and at least 10 residues following this subdomain enhance chaperone solubility. Binding measurements further show that DNLZ requires its ZBS to form a stable complex with the HSPA9 ATPase domain, and ATP hydrolysis measurements reveal that the ZBS is critical for full stimulation of HSPA9 catalytic activity. We also examined if DNLZ is active in vivo. We found that DNLZ partially complements the growth of Δzim17 Saccharomyces cerevisiae, and we discovered that a Zim17 truncation lacking a majority of the C-terminal subdomain strongly complements growth like full-length Zim17. These findings provide direct evidence that human DNLZ is a functional ortholog of Zim17. In addition, they implicate the pair of antiparallel β-strands that coordinate zinc in Zim17/DNLZ-type proteins as critical for binding and regulating hsp70 chaperones. Copyright © 2011 The Protein Society.

A Chaperone Function of NO CATALASE ACTIVITY1 Is Required to Maintain Catalase Activity and for Multiple Stress Responses in Arabidopsis

Science.gov (United States)

Li, Jing; Liu, Juntao; Wang, Guoqiang; Cha, Joon-Yung; Li, Guannan; Chen, She; Li, Zhen; Guo, Jinghua; Zhang, Caiguo; Yang, Yongqing; Kim, Woe-Yeon; Yun, Dae-Jin; Schumaker, Karen S.; Chen, Zhongzhou; Guo, Yan

2015-01-01

Catalases are key regulators of reactive oxygen species homeostasis in plant cells. However, the regulation of catalase activity is not well understood. In this study, we isolated an Arabidopsis thaliana mutant, no catalase activity1-3 (nca1-3) that is hypersensitive to many abiotic stress treatments. The mutated gene was identified by map-based cloning as NCA1, which encodes a protein containing an N-terminal RING-finger domain and a C-terminal tetratricopeptide repeat-like helical domain. NCA1 interacts with and increases catalase activity maximally in a 240-kD complex in planta. In vitro, NCA1 interacts with CATALASE2 (CAT2) in a 1:1 molar ratio, and the NCA1 C terminus is essential for this interaction. CAT2 activity increased 10-fold in the presence of NCA1, and zinc ion binding of the NCA1 N terminus is required for this increase. NCA1 has chaperone protein activity that may maintain the folding of catalase in a functional state. NCA1 is a cytosol-located protein. Expression of NCA1 in the mitochondrion of the nca1-3 mutant does not rescue the abiotic stress phenotypes of the mutant, while expression in the cytosol or peroxisome does. Our results suggest that NCA1 is essential for catalase activity. PMID:25700484

Contribution of market value chain to the control of African swine fever in Zambia.

Science.gov (United States)

Siamupa, C; Saasa, N; Phiri, A M

2018-01-01

African swine fever (ASF) is a worldwide disease of pigs endemic in most sub-Saharan African countries. Zambia has been experiencing outbreaks of ASF for many years because the disease is endemic in the eastern part of the country, with incursion into the central part of Lusaka Province. The latest outbreaks of ASF in Lusaka occurred in 2013 with substantial pig mortalities, loss in trade, and cost of control measures and compensation of affected farmers. The aims of the study were to identify market value chain-related factors that were associated with ASF outbreaks and assess why these outbreaks are becoming frequent despite control measures being put in place. Using a mixed-method design, participants involved in the value chain were purposively sampled. Some pig farmers were included using a respondent-driven technique. Farmers came from Lusaka, Chilanga, Kafue, and Chongwe districts. Other participants included district veterinary officers, veterinary assistants, police officers, and veterinary staff manning veterinary checkpoints, abattoir and processing plant managers, meat inspectors, market chairpersons, and traders. Semi-structured questionnaires, in-depth interviews, and direct observations were used to collect data to come up with narrations, tables, and flow charts. In assessing the contribution of the value chain in ASF, aspects of ASF screening, market availability and procedures, knowledge on ASF transmission, occurrence of ASF outbreak, and regulation of pig movement were investigated. Despite government ASF control measures being applied, the following were noted: (1) low awareness levels of ASF transmission among pig farmers and traders; (2) only 50% of farmers had their animals screened for ASF before sale; (3) all the markets did not have the pork inspected; (4) laxity in enforcing livestock movement control because of inadequate police and veterinary staff manning checkpoints; (5) lack of enforcement of meat inspection and food safety

The chaperone BAG6 captures dislocated glycoproteins in the cytosol.

Directory of Open Access Journals (Sweden)

Jasper H L Claessen

Full Text Available Secretory and membrane (glycoproteins are subject to quality control in the endoplasmic reticulum (ER to ensure that only functional proteins reach their destination. Proteins deemed terminally misfolded and hence functionally defective may be dislocated to the cytosol, where the proteasome degrades them. What we know about this process stems mostly from overexpression of tagged misfolded proteins, or from situations where viruses have hijacked the quality control machinery to their advantage. We know of only very few endogenous substrates of ER quality control, most of which are degraded as part of a signaling pathway, such as Insig-1, but such examples do not necessarily represent terminally misfolded proteins. Here we show that endogenous dislocation clients are captured specifically in association with the cytosolic chaperone BAG6, or retrieved en masse via their glycan handle.

The exported chaperone Hsp70-x supports virulence functions for Plasmodium falciparum blood stage parasites

Science.gov (United States)

Charnaud, Sarah C.; Dixon, Matthew W. A.; Nie, Catherine Q.; Chappell, Lia; Sanders, Paul R.; Nebl, Thomas; Hanssen, Eric; Berriman, Matthew; Chan, Jo-Anne; Blanch, Adam J.; Beeson, James G.; Rayner, Julian C.; Przyborski, Jude M.; Tilley, Leann; Crabb, Brendan S.

2017-01-01

Malaria is caused by five different Plasmodium spp. in humans each of which modifies the host erythrocyte to survive and replicate. The two main causes of malaria, P. falciparum and P. vivax, differ in their ability to cause severe disease, mainly due to differences in the cytoadhesion of infected erythrocytes (IE) in the microvasculature. Cytoadhesion of P. falciparum in the brain leads to a large number of deaths each year and is a consequence of exported parasite proteins, some of which modify the erythrocyte cytoskeleton while others such as PfEMP1 project onto the erythrocyte surface where they bind to endothelial cells. Here we investigate the effects of knocking out an exported Hsp70-type chaperone termed Hsp70-x that is present in P. falciparum but not P. vivax. Although the growth of Δhsp70-x parasites was unaffected, the export of PfEMP1 cytoadherence proteins was delayed and Δhsp70-x IE had reduced adhesion. The Δhsp70-x IE were also more rigid than wild-type controls indicating changes in the way the parasites modified their host erythrocyte. To investigate the cause of this, transcriptional and translational changes in exported and chaperone proteins were monitored and some changes were observed. We propose that PfHsp70-x is not essential for survival in vitro, but may be required for the efficient export and functioning of some P. falciparum exported proteins. PMID:28732045

The exported chaperone Hsp70-x supports virulence functions for Plasmodium falciparum blood stage parasites.

Directory of Open Access Journals (Sweden)

Sarah C Charnaud

Full Text Available Malaria is caused by five different Plasmodium spp. in humans each of which modifies the host erythrocyte to survive and replicate. The two main causes of malaria, P. falciparum and P. vivax, differ in their ability to cause severe disease, mainly due to differences in the cytoadhesion of infected erythrocytes (IE in the microvasculature. Cytoadhesion of P. falciparum in the brain leads to a large number of deaths each year and is a consequence of exported parasite proteins, some of which modify the erythrocyte cytoskeleton while others such as PfEMP1 project onto the erythrocyte surface where they bind to endothelial cells. Here we investigate the effects of knocking out an exported Hsp70-type chaperone termed Hsp70-x that is present in P. falciparum but not P. vivax. Although the growth of Δhsp70-x parasites was unaffected, the export of PfEMP1 cytoadherence proteins was delayed and Δhsp70-x IE had reduced adhesion. The Δhsp70-x IE were also more rigid than wild-type controls indicating changes in the way the parasites modified their host erythrocyte. To investigate the cause of this, transcriptional and translational changes in exported and chaperone proteins were monitored and some changes were observed. We propose that PfHsp70-x is not essential for survival in vitro, but may be required for the efficient export and functioning of some P. falciparum exported proteins.

Off-pathway assembly of fimbria subunits is prevented by chaperone CfaA of CFA/I fimbriae from enterotoxigenic E. coli.

Science.gov (United States)

Bao, Rui; Liu, Yang; Savarino, Stephen J; Xia, Di

2016-12-01

The assembly of the class 5 colonization factor antigen I (CFA/I) fimbriae of enterotoxigenic E. coli was proposed to proceed via the alternate chaperone-usher pathway. Here, we show that in the absence of the chaperone CfaA, CfaB, the major pilin subunit of CFA/I fimbriae, is able to spontaneously refold and polymerize into cyclic trimers. CfaA kinetically traps CfaB to form a metastable complex that can be stabilized by mutations. Crystal structure of the stabilized complex reveals distinctive interactions provided by CfaA to trap CfaB in an assembly competent state through donor-strand complementation (DSC) and cleft-mediated anchorage. Mutagenesis indicated that DSC controls the stability of the chaperone-subunit complex and the cleft-mediated anchorage of the subunit C-terminus additionally assist in subunit refolding. Surprisingly, over-stabilization of the chaperone-subunit complex led to delayed fimbria assembly, whereas destabilizing the complex resulted in no fimbriation. Thus, CfaA acts predominantly as a kinetic trap by stabilizing subunit to avoid its off-pathway self-polymerization that results in energetically favorable trimers and could serve as a driving force for CFA/I pilus assembly, representing an energetic landscape unique to class 5 fimbria assembly. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Molecular Microbiology published by John Wiley & Sons Ltd.

Development of an aspheric 22-diopter 50-mm diameter magnifier Desenvolvimento de uma lupa asférica de 22 dioptrias de 50 mm de diâmetro

Directory of Open Access Journals (Sweden)

José Américo Bonatti

2008-04-01

Full Text Available PURPOSE: To develop in an interdisciplinary approach between ophthalmology and design areas an ergonomic +22-diopter 50-mm aspheric hand magnifier for low vision. METHODS: An aluminum cylinder was cut, processed using a lathe and carved to produce a ring that accommodated a 50-mm aspheric lens, with an external depression not to slide from the holder's fingers. A cylindrical steel bar was cut, processed using a lathe and carved in order to form an externally turned ring to be screwed into the internal thread of the aluminum ring, to maintain the lens in a steady position. Both rings were submitted to electrostatic painting with a dull black electrostatic Epoxi ink, except the lower border of the external ring, to indicate the correct side of the magnifier to face the material to be read. RESULTS: A 22-diopter 50-mm diameter aspheric lens magnifier with a black ring to be hold at its external circular depression was obtained in order to safely search the adequate reading focus with an inferior aluminum colored ring to face the object to be read and allow a less distorted reading. This is the first Brazilian high-magnification great-diameter magnifier for low vision that permits basically the focusing on an entire word, not only syllables, in order to allow a faster and more comfortable reading. CONCLUSIONS: By an interdisciplinary approach a 22-diopter 50-mm aspheric lens magnifier was developed with image and ergonomic characteristics such as to permit comfortable and adequate reading performance in cases of low vision.OBJETIVO: Desenvolver de modo interdisciplinar entre as áreas de oftalmologia e design uma lupa de mão ergonômica de +22 dioptrias de 50 mm de diâmetro asférica para baixa visão. MÉTODOS: Um cilindro de alumínio foi cortado, torneado e teve feita internamente uma rosca a fim de produzir um anel para acomodar uma lente asférica de 50 mm de diâmetro com uma depressão externa para não escorregar dos dedos do portador. Uma

Hydroimidazolone modification of the conserved Arg12 in small heat shock proteins: studies on the structure and chaperone function using mutant mimics.

Directory of Open Access Journals (Sweden)

Ram H Nagaraj

Full Text Available Methylglyoxal (MGO is an α-dicarbonyl compound present ubiquitously in the human body. MGO reacts with arginine residues in proteins and forms adducts such as hydroimidazolone and argpyrimidine in vivo. Previously, we showed that MGO-mediated modification of αA-crystallin increased its chaperone function. We identified MGO-modified arginine residues in αA-crystallin and found that replacing such arginine residues with alanine residues mimicked the effects of MGO on the chaperone function. Arginine 12 (R12 is a conserved amino acid residue in Hsp27 as well as αA- and αB-crystallin. When treated with MGO at or near physiological concentrations (2-10 µM, R12 was modified to hydroimidazolone in all three small heat shock proteins. In this study, we determined the effect of arginine substitution with alanine at position 12 (R12A to mimic MGO modification on the structure and chaperone function of these proteins. Among the three proteins, the R12A mutation improved the chaperone function of only αA-crystallin. This enhancement in the chaperone function was accompanied by subtle changes in the tertiary structure, which increased the thermodynamic stability of αA-crystallin. This mutation induced the exposure of additional client protein binding sites on αA-crystallin. Altogether, our data suggest that MGO-modification of the conserved R12 in αA-crystallin to hydroimidazolone may play an important role in reducing protein aggregation in the lens during aging and cataract formation.

Structural and Biochemical Characterization of SrcA, a Multi-cargo Type III Secretion Chaperone in Salmonella Required for Pathogenic Association with a Host

Energy Technology Data Exchange (ETDEWEB)

Cooper, C.; Zhang, K; Andres, S; Fnag, Y; Kaniuk, N; Hannemann, M; Brumell, J; Foster, L; Junop, M; Coombes, B

2010-01-01

Many Gram-negative bacteria colonize and exploit host niches using a protein apparatus called a type III secretion system (T3SS) that translocates bacterial effector proteins into host cells where their functions are essential for pathogenesis. A suite of T3SS-associated chaperone proteins bind cargo in the bacterial cytosol, establishing protein interaction networks needed for effector translocation into host cells. In Salmonella enterica serovar Typhimurium, a T3SS encoded in a large genomic island (SPI-2) is required for intracellular infection, but the chaperone complement required for effector translocation by this system is not known. Using a reverse genetics approach, we identified a multi-cargo secretion chaperone that is functionally integrated with the SPI-2-encoded T3SS and required for systemic infection in mice. Crystallographic analysis of SrcA at a resolution of 2.5 {angstrom} revealed a dimer similar to the CesT chaperone from enteropathogenic E. coli but lacking a 17-amino acid extension at the carboxyl terminus. Further biochemical and quantitative proteomics data revealed three protein interactions with SrcA, including two effector cargos (SseL and PipB2) and the type III-associated ATPase, SsaN, that increases the efficiency of effector translocation. Using competitive infections in mice we show that SrcA increases bacterial fitness during host infection, highlighting the in vivo importance of effector chaperones for the SPI-2 T3SS.

Structural and biochemical characterization of SrcA, a multi-cargo type III secretion chaperone in Salmonella required for pathogenic association with a host.

Directory of Open Access Journals (Sweden)

Colin A Cooper

2010-02-01

Full Text Available Many Gram-negative bacteria colonize and exploit host niches using a protein apparatus called a type III secretion system (T3SS that translocates bacterial effector proteins into host cells where their functions are essential for pathogenesis. A suite of T3SS-associated chaperone proteins bind cargo in the bacterial cytosol, establishing protein interaction networks needed for effector translocation into host cells. In Salmonella enterica serovar Typhimurium, a T3SS encoded in a large genomic island (SPI-2 is required for intracellular infection, but the chaperone complement required for effector translocation by this system is not known. Using a reverse genetics approach, we identified a multi-cargo secretion chaperone that is functionally integrated with the SPI-2-encoded T3SS and required for systemic infection in mice. Crystallographic analysis of SrcA at a resolution of 2.5 A revealed a dimer similar to the CesT chaperone from enteropathogenic E. coli but lacking a 17-amino acid extension at the carboxyl terminus. Further biochemical and quantitative proteomics data revealed three protein interactions with SrcA, including two effector cargos (SseL and PipB2 and the type III-associated ATPase, SsaN, that increases the efficiency of effector translocation. Using competitive infections in mice we show that SrcA increases bacterial fitness during host infection, highlighting the in vivo importance of effector chaperones for the SPI-2 T3SS.

Evidence of hemolysis in pigs infected with highly virulent African swine fever virus

Directory of Open Access Journals (Sweden)

Zaven Karalyan

2016-12-01

Full Text Available Aim: The research was conducted to understand more profoundly the pathogenetic aspects of the acute form of the African swine fever (ASF. Materials and Methods: A total of 10 pigs were inoculated with ASF virus (ASFV (genotype II in the study of the red blood cells (RBCs, blood and urine biochemistry in the dynamics of disease. Results: The major hematological differences observed in ASFV infected pigs were that the mean corpuscular volume, mean corpuscular hemoglobin, and hematocrits were significantly decreased compared to controls, and the levels of erythropoietin were significantly increased. Also were detected the trends of decrease in RBC count at terminal stages of ASF. Analysis of blood biochemistry revealed that during ASF development, besides bilirubinemia significantly elevated levels of lactate dehydrogenase, and aspartate aminotransferase were detected. Analysis of urine biochemistry revealed the presence of bilirubinuria, proteinuria during ASF development. Proteinuria, especially at late stages of the disease reflects a severe kidney damage possible glomerulonefritis. Conclusion: The results of this study indicate the characteristics of developing hemolytic anemia observed in acute ASF (genotype II.

Chaperone roles for TMAO and HSP70 during hyposmotic stress in the spiny dogfish shark (Squalus acanthias).

Science.gov (United States)

MacLellan, Robyn J; Tunnah, Louise; Barnett, David; Wright, Patricia A; MacCormack, Tyson; Currie, Suzanne

2015-10-01

Salinity decreases are experienced by many marine elasmobranchs. To understand how these fishes cope with hyposmotic stress on a cellular level, we used the spiny dogfish shark (Squalus acanthias) as a model to test whether a reciprocal relationship exists between the cell's two primary protein protection mechanisms, the chemical (e.g., trimethylamine oxide, TMAO) and molecular (e.g., heat shock protein 70, HSP70) chaperone systems. This relationship is interesting given that many elasmobranchs are expected to gain water and lose osmolytes, chemical chaperones, and ions as they osmoconform to new, lowered salinity. Dogfish were cannulated for repeated blood sampling and exposed to 70% seawater (SW) for 48 h. These hyposmotic conditions had no effect on red blood cell (RBC) and white muscle TMAO concentrations, and did not result in HSP70 induction or signs of protein damage (i.e., increased ubiquitin), suggesting that TMAO levels were sufficiently protective in these tissues. However, in the gill, we observed a significant decrease in TMAO concentration and a significant induction of HSP70 as well as signs of protein damage. In the face of this cellular stress response, gill Na(+)/K(+)-ATPase (NKA) activity significantly increased during hyposmotic conditions, as expected. We suggest that this functional preservation in the gill is partly the result of HSP70 induction with lowered salinity. We conclude a reciprocal relationship between TMAO and HSP70 in the gills of dogfish as a result of in vivo hyposmotic stress. When osmotically induced protein damage surpasses the protective capacity of remaining TMAO, HSP70 is induced to preserve tissue and organismal function.

Species-specific activation of Cu/Zn SOD by its CCS copper chaperone in the pathogenic yeast Candida albicans.

Science.gov (United States)

Gleason, Julie E; Li, Cissy X; Odeh, Hana M; Culotta, Valeria C

2014-06-01

Candida albicans is a pathogenic yeast of important public health relevance. Virulence of C. albicans requires a copper and zinc containing superoxide dismutase (SOD1), but the biology of C. albicans SOD1 is poorly understood. To this end, C. albicans SOD1 activation was examined in baker's yeast (Saccharomyces cerevisiae), a eukaryotic expression system that has proven fruitful for the study of SOD1 enzymes from invertebrates, plants, and mammals. In spite of the 80% similarity between S. cerevisiae and C. albicans SOD1 molecules, C. albicans SOD1 is not active in S. cerevisiae. The SOD1 appears incapable of productive interactions with the copper chaperone for SOD1 (CCS1) of S. cerevisiae. C. albicans SOD1 contains a proline at position 144 predicted to dictate dependence on CCS1. By mutation of this proline, C. albicans SOD1 gained activity in S. cerevisiae, and this activity was independent of CCS1. We identified a putative CCS1 gene in C. albicans and created heterozygous and homozygous gene deletions at this locus. Loss of CCS1 resulted in loss of SOD1 activity, consistent with its role as a copper chaperone. C. albicans CCS1 also restored activity to C. albicans SOD1 expressed in S. cerevisiae. C. albicans CCS1 is well adapted for activating its partner SOD1 from C. albicans, but not SOD1 from S. cerevisiae. In spite of the high degree of homology between the SOD1 and CCS1 molecules in these two fungal species, there exists a species-specific barrier in CCS-SOD interactions which may reflect the vastly different lifestyles of the pathogenic versus the noninfectious yeast.

Repression of Proteases and Hsp90 Chaperone Expression Induced by an Antiretroviral in Virulent Environmental Strains of Cryptococcus neoformans.

Science.gov (United States)

Serafin, Cleber Fernando; Paris, Ana Paula; Paula, Claudete Rodrigues; Simão, Rita Cássia Garcia; Gandra, Rinaldo Ferreira

2017-04-01

This study evaluated the effect of the antiretroviral ritonavir on protease secretion in different strains of Cryptococcus neoformans isolated from the environment and investigated the expression of heat shock protein (Hsp90), classically described virulence factors in other yeast in the presence of the same antiretroviral. The presence of the enzyme was detected by the formation of a degradation of the halo around the colonies. The results were classified as follows: level 1 (without proteases), level 2 (positive for proteases), and level 3 (strongly positive for proteases). Total protein extract isolated from the cell walls of the 12 strains incubated in the absence and presence of ritonavir (0.3125 mg mL -1 ) were resolved by SDS-PAGE and analyzed by Western blot assays using an antiserum against Hsp90 from Blastocladiella emersonii. All strains tested showed inhibition of proteinase activity in the presence of ritonavir at 0.3125 to 1.25 mg mL -1 . High levels of Hsp90 were observed in the absence of ritonavir (0.3125 mg mL -1 ), except for the non-virulent control cells. In contrast, in the presence of the antiretroviral, a drastic reduction in the expression of the chaperone was observed. The data suggest that ritonavir, in addition to containing viral replication, could inhibit the expression of virulence factors in opportunistic yeast, as proteases and Hsp90. According to our current knowledge, this is the first time that the inhibition of Hsp90 by an antiretroviral was reported for environmental isolates of C. neoformans.

Targeting HSP90 and monoclonal protein trafficking modulates the unfolded protein response, chaperone regulation and apoptosis in myeloma cells

International Nuclear Information System (INIS)

Born, E J; Hartman, S V; Holstein, S A

2013-01-01

Multiple myeloma is characterized by the production of substantial quantities of monoclonal protein. We have previously demonstrated that select inhibitors of the isoprenoid biosynthetic pathway (IBP) induce apoptosis of myeloma cells via inhibition of Rab geranylgeranylation, leading to disruption of monoclonal protein trafficking and induction of the unfolded protein response (UPR) pathway. Heat-shock protein 90 (HSP90) inhibitors disrupt protein folding and are currently under clinical investigation in myeloma. The effects of combining IBP and HSP90 inhibitors on cell death, monoclonal protein trafficking, the UPR and chaperone regulation were investigated in monoclonal protein-producing cells. An enhanced induction of cell death was observed following treatment with IBP and HSP90 inhibitors, which occurred through both ER stress and non-ER stress pathways. The HSP90 inhibitor 17-AAG abrogated the effects of the IBP inhibitors on intracellular monoclonal protein levels and localization as well as induction of the UPR in myeloma cells. Disparate effects on chaperone expression were observed in myeloma vs amyloid light chain cells. Here we demonstrate that the novel strategy of targeting MP trafficking in concert with HSP90 enhances myeloma cell death via a complex modulation of ER stress, UPR, and cell death pathways

Distinct Prion Domain Sequences Ensure Efficient Amyloid Propagation by Promoting Chaperone Binding or Processing In Vivo.

Directory of Open Access Journals (Sweden)

Christine R Langlois

2016-11-01

Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.

Promiscuous histone mis-assembly is actively prevented by chaperones | Center for Cancer Research

Science.gov (United States)

About the Cover Chaperone HJURP drives the proper loading of protein CENP-A to the centromere of a chromosome. The effect of HJURP on CENP-A's structural dynamics are observed and explained using dual-resolution in silico simulations, while in vivo experiments demonstrate how CENP-A mutations influence its specific localization in human cells. Abstract

The Role of System-Specific Molecular Chaperones in the Maturation of Molybdoenzymes in Bacteria

Directory of Open Access Journals (Sweden)

Meina Neumann

2011-01-01

Full Text Available Biogenesis of prokaryotic molybdoenzymes is a complex process with the final step representing the insertion of a matured molybdenum cofactor (Moco into a folded apoenzyme. Usually, specific chaperones of the XdhC family are required for the maturation of molybdoenzymes of the xanthine oxidase family in bacteria. Enzymes of the xanthine oxidase family are characterized to contain an equatorial sulfur ligand at the molybdenum center of Moco. This sulfur ligand is inserted into Moco while bound to the XdhC-like protein and before its insertion into the target enzyme. In addition, enzymes of the xanthine oxidase family bind either the molybdopterin (Mo-MPT form of Moco or the modified molybdopterin cytosine dinucleotide cofactor (MCD. In both cases, only the matured cofactor is inserted by a proofreading process of XdhC. The roles of these specific XdhC-like chaperones during the biogenesis of enzymes of the xanthine oxidase family in bacteria are described.

The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro.

Science.gov (United States)

Cristofari, Gaël; Ivanyi-Nagy, Roland; Gabus, Caroline; Boulant, Steeve; Lavergne, Jean-Pierre; Penin, François; Darlix, Jean-Luc

2004-01-01

The hepatitis C virus (HCV) is an important human pathogen causing chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HCV is an enveloped virus with a positive-sense, single-stranded RNA genome encoding a single polyprotein that is processed to generate viral proteins. Several hundred molecules of the structural Core protein are thought to coat the genome in the viral particle, as do nucleocapsid (NC) protein molecules in Retroviruses, another class of enveloped viruses containing a positive-sense RNA genome. Retroviral NC proteins also possess nucleic acid chaperone properties that play critical roles in the structural remodelling of the genome during retrovirus replication. This analogy between HCV Core and retroviral NC proteins prompted us to investigate the putative nucleic acid chaperoning properties of the HCV Core protein. Here we report that Core protein chaperones the annealing of complementary DNA and RNA sequences and the formation of the most stable duplex by strand exchange. These results show that the HCV Core is a nucleic acid chaperone similar to retroviral NC proteins. We also find that the Core protein directs dimerization of HCV (+) RNA 3' untranslated region which is promoted by a conserved palindromic sequence possibly involved at several stages of virus replication.

Cell Surface Trafficking of TLR1 Is Differentially Regulated by the Chaperones PRAT4A and PRAT4B*

Science.gov (United States)

Hart, Bryan E.; Tapping, Richard I.

2012-01-01

The subcellular localization of Toll-like receptors (TLRs) is critical to their ability to function as innate immune sensors of microbial infection. We previously reported that an I602S polymorphism of human TLR1 is associated with aberrant trafficking of the receptor to the cell surface, loss of responses to TLR1 agonists, and differential susceptibility to diseases caused by pathogenic mycobacteria. Through an extensive analysis of receptor deletion and point mutants we have discovered that position 602 resides within a short 6 amino acid cytoplasmic region that is required for TLR1 surface expression. This short trafficking motif, in conjunction with the adjacent transmembrane domain, is sufficient to direct TLR1 to the cell surface. A serine at position 602 interrupts this trafficking motif and prevents cell surface expression of TLR1. Additionally, we have found that ER-resident TLR chaperones, PRAT4A and PRAT4B, act as positive and negative regulators of TLR1 surface trafficking, respectively. Importantly, either over-expression of PRAT4A or knock-down of PRAT4B rescues cell surface expression of the TLR1 602S variant. We also report that IFN-γ treatment of primary human monocytes derived from homozygous 602S individuals rescues TLR1 cell surface trafficking and cellular responses to soluble agonists. This event appears to be mediated by PRAT4A whose expression is strongly induced in human monocytes by IFN-γ. Collectively, these results provide a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression. PMID:22447933

Modelagem da formação e propagação de trincas em misturas asfálticas

Directory of Open Access Journals (Sweden)

Jorge Barbosa Soares

2009-12-01

Full Text Available

O trincamento da camada asfáltica em pavimentos é apontado como o principal defeito das rodovias brasileiras. Estudos experimentais e numéricos sobre este fenômeno vêm sendo realizados considerando o material como homogêneo. Este artigo apresenta uma abordagem numérica baseada na Teoria da Mecânica da Fratura na qual considera-se a heterogeneidade do material, sendo o ligante e os agregados tratados separadamente. As simulações realizadas são verificadas e calibradas através de ensaios laboratoriais simples e convencionais. O estudo trata da formação e propagação de trincas sob carregamentos monotônicos e aponta para uma nova forma de simulação do fenômeno de fadiga de misturas. É ainda discutida a utilização de uma abordagem multi-escala, na qual o dano observado na forma da propagação de trincas na escala local pode ser considerado numa escala global compatível com o pavimento real.

Chaperone-usher fimbriae in a diverse selection of Gallibacterium genomes

DEFF Research Database (Denmark)

Kudirkiene, Egle; Bager, Ragnhild Jørgensen; Johnson, Timothy J.

2014-01-01

Background Fimbriae are bacterial cell surface organelles involved in the pathogenesis of many bacterial species, including Gallibacterium anatis, in which a F17-like fimbriae of the chaperone-usher (CU) family was recently shown to be an important virulence factor and vaccine candidate. To reveal...... that their expression may require other in vitro or in vivo conditions. Conclusions This is the first approach establishing a systematic fimbria classification system within Gallibacterium spp., which indicates a species-wide distribution of γ4 CU fimbriae among a diverse collection of Gallibacterium isolates...

Binding Affects the Tertiary and Quaternary Structures of the Shigella Translocator Protein IpaB and its Chaperone IpgC†

Science.gov (United States)

Adam, Philip R.; Patil, Mrinalini K.; Dickenson, Nicholas E.; Choudhari, Shyamal; Barta, Michael; Geisbrecht, Brian V.; Picking, Wendy L.; Picking, William D.

2012-01-01

Shigella flexneri uses its type III secretion system (T3SS) to promote invasion of human intestinal epithelial cells as the first step in causing shigellosis, a life threatening form of dysentery. The Shigella type III secretion apparatus (T3SA) consists of a basal body that spans the bacterial envelope and an exposed needle that injects effector proteins into target cells. The nascent Shigella T3SA needle is topped with a pentamer of the needle tip protein invasion plasmid antigen D (IpaD). Bile salts trigger recruitment of the first hydrophobic translocator protein, IpaB, to the tip complex where it senses contact with a host membrane. In the bacterial cytoplasm, IpaB exists in a complex with its chaperone IpgC. Several structures of IpgC have been solved and we recently reported the 2.1-Å crystal structure of the N-terminal domain (IpaB74.224) of IpaB. Like IpgC, the IpaB N-terminal domain exists as a homodimer in solution. We now report that when the two are mixed, these homodimers dissociate and form heterodimers having a nanomolar dissociation constant. This is consistent with the equivalent complexes co-purified after being co-expressed in E. coli. Fluorescence data presented here also indicate that the N-terminal domain of IpaB possesses two regions that appear to contribute additively to chaperone binding. It is also likely that the IpaB N terminus adopts an alternative conformation as a result of chaperone binding. The importance of these findings within the functional context of these proteins is discussed. PMID:22497344

The chaperone role of the pyridoxal 5'-phosphate and its implications for rare diseases involving B6-dependent enzymes.

Science.gov (United States)

Cellini, Barbara; Montioli, Riccardo; Oppici, Elisa; Astegno, Alessandra; Voltattorni, Carla Borri

2014-02-01

The biologically active form of the B6 vitamers is pyridoxal 5'-phosphate (PLP), which plays a coenzymatic role in several distinct enzymatic activities ranging from the synthesis, interconversion and degradation of amino acids to the replenishment of one-carbon units, synthesis and degradation of biogenic amines, synthesis of tetrapyrrolic compounds and metabolism of amino-sugars. In the catalytic process of PLP-dependent enzymes, the substrate amino acid forms a Schiff base with PLP and the electrophilicity of the PLP pyridine ring plays important roles in the subsequent catalytic steps. While the essential role of PLP in the acquisition of biological activity of many proteins is long recognized, the finding that some PLP-enzymes require the coenzyme for refolding in vitro points to an additional role of PLP as a chaperone in the folding process. Mutations in the genes encoding PLP-enzymes are causative of several rare inherited diseases. Patients affected by some of these diseases (AADC deficiency, cystathionuria, homocystinuria, gyrate atrophy, primary hyperoxaluria type 1, xanthurenic aciduria, X-linked sideroblastic anaemia) can benefit, although at different degrees, from the administration of pyridoxine, a PLP precursor. The effect of the coenzyme is not limited to mutations that affect the enzyme-coenzyme interaction, but also to those that cause folding defects, reinforcing the idea that PLP could play a chaperone role and improve the folding efficiency of misfolded variants. In this review, recent biochemical and cell biology studies highlighting the chaperoning activity of the coenzyme on folding-defective variants of PLP-enzymes associated with rare diseases are presented and discussed. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

A Human Neural Crest Stem Cell-Derived Dopaminergic Neuronal Model Recapitulates Biochemical Abnormalities in GBA1 Mutation Carriers

Directory of Open Access Journals (Sweden)

Shi-Yu Yang

2017-03-01

Full Text Available Numerically the most important risk factor for the development of Parkinson's disease (PD is the presence of mutations in the glucocerebrosidase GBA1 gene. In vitro and in vivo studies show that GBA1 mutations reduce glucocerebrosidase (GCase activity and are associated with increased α-synuclein levels, reflecting similar changes seen in idiopathic PD brain. We have developed a neural crest stem cell-derived dopaminergic neuronal model that recapitulates biochemical abnormalities in GBA1 mutation-associated PD. Cells showed reduced GCase protein and activity, impaired macroautophagy, and increased α-synuclein levels. Advantages of this approach include easy access to stem cells, no requirement to reprogram, and retention of the intact host genome. Treatment with a GCase chaperone increased GCase protein levels and activity, rescued the autophagic defects, and decreased α-synuclein levels. These results provide the basis for further investigation of GCase chaperones or similar drugs to slow the progression of PD.

Effect of Hypergravity on the Level of Heat Shock Proteins 70 and 90 in Pea Seedlings

Science.gov (United States)

Kozeko, Liudmyla; Kordyum, Elizabeth

2009-01-01

Exposure to hypergravity induces significant changes in gene expression of plants which are indicative of stress conditions. A substantial part of the general stress response is up-regulation of heat shock proteins (Hsp) which function as molecular chaperones. The objective of this research was to test the possible changes in the Hsp70 and Hsp90 level in response to short-term hypergravity exposure. In this study 5-day-old etiolated pea seedlings were exposed to centrifuge-induced hypergravity (3-14 g) for 15 min and 1 h and a part of the seedlings was sampled at 1.5 and 24 h after the exposures. Western blot analysis showed time-dependent changes in Hsp70 and Hsp90 levels: an increase under hypergravity and a tendency towards recovery of the normal content during re-adaptation. The quantity and time of their expression was correlated with the g-force level. These data suggest that short-term hypergravity acts as a stress which could increase the risk of protein denaturation and aggregation. Molecular chaperons induced during the stress may have an essential role in counteracting this risk.

Sylvie Chaperon, Les origines de la sexologie (1850-1900)

OpenAIRE

Anne-Claire Rebreyend

2008-01-01

Le mot sexologie apparaît seulement au début des années 1910 en France. Mais dès la seconde moitié du XIXe siècle s’affirme un nouveau savoir médical sur la sexualité, une protosexologie dont Sylvie Chaperon retrace l’histoire par le biais de sources médicales et policières, de romans érotiques, de mémoires. « Premier panorama synthétique » (p. 11) d’une histoire de la sexologie encore lacunaire en France, Les origines de la sexologie pointe la lente émergence d’une nouvelle discipline sur la...

Sylvie Chaperon, Les origines de la sexologie (1850-1900

Directory of Open Access Journals (Sweden)

Anne-Claire Rebreyend

2008-07-01

Full Text Available Le mot sexologie apparaît seulement au début des années 1910 en France. Mais dès la seconde moitié du XIXe siècle s’affirme un nouveau savoir médical sur la sexualité, une protosexologie dont Sylvie Chaperon retrace l’histoire par le biais de sources médicales et policières, de romans érotiques, de mémoires. « Premier panorama synthétique » (p. 11 d’une histoire de la sexologie encore lacunaire en France, Les origines de la sexologie pointe la lente émergence d’une nouvelle discipline sur la...

Exploitation of alfalfa seed (Medicago sativa L.) flour into gluten-free rice cookies: Nutritional, antioxidant and quality characteristics.

Science.gov (United States)

Giuberti, Gianluca; Rocchetti, Gabriele; Sigolo, Samantha; Fortunati, Paola; Lucini, Luigi; Gallo, Antonio

2018-01-15

In an effort to increase the nutritional value of common gluten-free (GF) cereal-based foods, GF cookies using alfalfa seed flour (ASF), at different substitution levels to common rice flour (0% as control, 15%, 30% and 45% w/w), were produced. Crude protein, total dietary fibre, total polyunsaturated, total n-3 and n-6 fatty acid contents increased linearly (p<0.05) by raising the substitution levels of rice with ASF. The hardness, the total phenolic content, the in vitro antioxidant capacity and the resistant starch increased linearly (p<0.05), whereas the starch hydrolysis index decreased linearly (p<0.05) by raising the substitution levels of rice flour with ASF. Despite the fact that ASF-substituted GF cookies had inferior sensory attributes compared to the control, the score given by the panellists remained at fairly good levels for all tested parameters, showing acceptability of the substituted GF cookies. Copyright © 2017 Elsevier Ltd. All rights reserved.

The metal chaperone Atox1 regulates the activity of the human copper transporter ATP7B by modulating domain dynamics.

Science.gov (United States)

Yu, Corey H; Yang, Nan; Bothe, Jameson; Tonelli, Marco; Nokhrin, Sergiy; Dolgova, Natalia V; Braiterman, Lelita; Lutsenko, Svetlana; Dmitriev, Oleg Y

2017-11-03

The human transporter ATP7B delivers copper to the biosynthetic pathways and maintains copper homeostasis in the liver. Mutations in ATP7B cause the potentially fatal hepatoneurological disorder Wilson disease. The activity and intracellular localization of ATP7B are regulated by copper, but the molecular mechanism of this regulation is largely unknown. We show that the copper chaperone Atox1, which delivers copper to ATP7B, and the group of the first three metal-binding domains (MBD1-3) are central to the activity regulation of ATP7B. Atox1-Cu binding to ATP7B changes domain dynamics and interactions within the MBD1-3 group and activates ATP hydrolysis. To understand the mechanism linking Atox1-MBD interactions and enzyme activity, we have determined the MBD1-3 conformational space using small angle X-ray scattering and identified changes in MBD dynamics caused by apo -Atox1 and Atox1-Cu by solution NMR. The results show that copper transfer from Atox1 decreases domain interactions within the MBD1-3 group and increases the mobility of the individual domains. The N-terminal segment of MBD1-3 was found to interact with the nucleotide-binding domain of ATP7B, thus physically coupling the domains involved in copper binding and those involved in ATP hydrolysis. Taken together, the data suggest a regulatory mechanism in which Atox1-mediated copper transfer activates ATP7B by releasing inhibitory constraints through increased freedom of MBD1-3 motions. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Chloroplast SRP43 acts as a chaperone for glutamyl-tRNA reductase, the rate-limiting enzyme in tetrapyrrole biosynthesis.

Science.gov (United States)

Wang, Peng; Liang, Fu-Cheng; Wittmann, Daniel; Siegel, Alex; Shan, Shu-Ou; Grimm, Bernhard

2018-04-10

Assembly of light-harvesting complexes requires synchronization of chlorophyll (Chl) biosynthesis with biogenesis of light-harvesting Chl a/b-binding proteins (LHCPs). The chloroplast signal recognition particle (cpSRP) pathway is responsible for transport of nucleus-encoded LHCPs in the stroma of the plastid and their integration into the thylakoid membranes. Correct folding and assembly of LHCPs require the incorporation of Chls, whose biosynthesis must therefore be precisely coordinated with membrane insertion of LHCPs. How the spatiotemporal coordination between the cpSRP machinery and Chl biosynthesis is achieved is poorly understood. In this work, we demonstrate a direct interaction between cpSRP43, the chaperone that mediates LHCP targeting and insertion, and glutamyl-tRNA reductase (GluTR), a rate-limiting enzyme in tetrapyrrole biosynthesis. Concurrent deficiency for cpSRP43 and the GluTR-binding protein (GBP) additively reduces GluTR levels, indicating that cpSRP43 and GBP act nonredundantly to stabilize GluTR. The substrate-binding domain of cpSRP43 binds to the N-terminal region of GluTR, which harbors aggregation-prone motifs, and the chaperone activity of cpSRP43 efficiently prevents aggregation of these regions. Our work thus reveals a function of cpSRP43 in Chl biosynthesis and suggests a striking mechanism for posttranslational coordination of LHCP insertion with Chl biosynthesis.

TLK1 and Rad9 Cooperate in XRT-Refractory CaP

Science.gov (United States)

2011-04-01

left with few options for establishing the role of such phosphorylation in higher organisms, in cell lines and even more importantly in transgenic ...Asf1 [12]. In this assay, Bluescript plasmid isolated from bacteria was first relaxed with wheat -germ Topoisomerase 1 (Figure 1 panel B, lane 5 and

Periplasmic expression of soluble single chain T cell receptors is rescued by the chaperone FkpA

Directory of Open Access Journals (Sweden)

Bogen Bjarne

2010-02-01

Full Text Available Abstract Background Efficient expression systems exist for antibody (Ab molecules, which allow for characterization of large numbers of individual Ab variants. In contrast, such expression systems have been lacking for soluble T cell receptors (TCRs. Attempts to generate bacterial systems have generally resulted in low yields and material which is prone to aggregation and proteolysis. Here we present an optimized periplasmic bacterial expression system for soluble single chain (sc TCRs. Results The effect of 1 over-expression of the periplasmic chaperon FkpA, 2 culture conditions and 3 molecular design was investigated. Elevated levels of FkpA allowed periplasmic soluble scTCR expression, presumably by preventing premature aggregation and inclusion body formation. Periplasmic expression enables disulphide bond formation, which is a prerequisite for the scTCR to reach its correct fold. It also enables quick and easy recovery of correctly folded protein without the need for time-consuming downstream processing. Expression without IPTG induction further improved the periplasmic expression yield, while addition of sucrose to the growth medium showed little effect. Shaker flask yield of mg levels of active purified material was obtained. The Vαβ domain orientation was far superior to the Vβα domain orientation regarding monomeric yield of functionally folded molecules. Conclusion The general expression regime presented here allows for rapid production of soluble scTCRs and is applicable for 1 high yield recovery sufficient for biophysical characterization and 2 high throughput screening of such molecules following molecular engineering.

Sodium 4-phenylbutyrate acts as a chemical chaperone on misfolded myocilin to rescue cells from endoplasmic reticulum stress and apoptosis.

Science.gov (United States)

Yam, Gary Hin-Fai; Gaplovska-Kysela, Katarina; Zuber, Christian; Roth, Jürgen

2007-04-01

To evaluate the effect of chemical chaperones on the trafficking of secretion-incompetent primary open-angle glaucoma-associated mutant myocilin and the possibility to rescue cells coexpressing mutant and wild-type myocilin from endoplasmic reticulum (ER) stress and apoptosis. CHO-K1, HEK293 and human trabecular meshwork cells were transfected to express wild-type or mutant (C245Y, G364V, P370L, Y437H) myocilin-green fluorescent protein fusion protein and were treated or not with various chemical chaperones (glycerol, dimethylsulfoxide, or sodium 4-phenylbutyrate) for different time periods. The secretion, Triton X-100 solubility, and intracellular distribution of wild-type and mutant myocilin were analyzed by immunoprecipitation, Western blotting, and confocal double immunofluorescence. The effect of sodium 4-phenylbutyrate on ER stress proteins and apoptosis was examined in cells coexpressing mutant and wild-type myocilin. Treatment with sodium 4-phenylbutyrate, but not with glycerol or dimethylsulfoxide, reduced the amount of detergent-insoluble myocilin aggregates, diminished myocilin interaction with calreticulin, and restored the secretion of mutant myocilin. Heteromeric complexes formed by mutant and wild-type myocilin induced the ER stress-associated phosphorylated form of ER-localized eukaryotic initiation factor (eIF)-2alpha kinase and the active form of caspase 3, which resulted in an increased rate of apoptosis. Sodium 4-phenylbutyrate treatment of cells coexpressing mutant and wild-type myocilin relieved ER stress and significantly reduced the rate of apoptosis. These findings indicate that sodium 4-phenylbutyrate protects cells from the deleterious effects of ER-retained aggregated mutant myocilin. These data point to the possibility of a chemical chaperone treatment for myocilin-caused primary open-angle glaucoma.

Enhanced Transport Capabilities via Nanotechnologies: Impacting Bioefficacy, Controlled Release Strategies, and Novel Chaperones

Directory of Open Access Journals (Sweden)

Thomai Panagiotou

2011-01-01

side affects and providing improved therapeutic interventions. Innovative nanotechnology applications, such as simultaneous targeting, imaging and delivery to tumors, are now possible through use of novel chaperones. Other examples include nanoparticles attachment to T-cells, release from novel hydrogel implants, and functionalized encapsulants. Difficult tasks such as drug delivery to the brain via the blood brain barrier and/or the cerebrospinal fluid are now easier to accomplish.

Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

Science.gov (United States)

Liang, Jingjing; Sagum, Cari A; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Han, Ziying; Harty, Ronald N

2017-01-01

Ebola (EBOV) and Marburg (MARV) viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3), a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs), as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA). Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

Directory of Open Access Journals (Sweden)

Jingjing Liang

2017-01-01

Full Text Available Ebola (EBOV and Marburg (MARV viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3, a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs, as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA. Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

HDAC6 inhibition enhances 17-AAG--mediated abrogation of hsp90 chaperone function in human leukemia cells.

Science.gov (United States)

Rao, Rekha; Fiskus, Warren; Yang, Yonghua; Lee, Pearl; Joshi, Rajeshree; Fernandez, Pravina; Mandawat, Aditya; Atadja, Peter; Bradner, James E; Bhalla, Kapil

2008-09-01

Histone deacetylase 6 (HDAC6) is a heat shock protein 90 (hsp90) deacetylase. Treatment with pan-HDAC inhibitors or depletion of HDAC6 by siRNA induces hyperacetylation and inhibits ATP binding and chaperone function of hsp90. Treatment with 17-allylamino-demothoxy geldanamycin (17-AAG) also inhibits ATP binding and chaperone function of hsp90, resulting in polyubiquitylation and proteasomal degradation of hsp90 client proteins. In this study, we determined the effect of hsp90 hyperacetylation on the anti-hsp90 and antileukemia activity of 17-AAG. Hyperacetylation of hsp90 increased its binding to 17-AAG, as well as enhanced 17-AAG-mediated attenuation of ATP and the cochaperone p23 binding to hsp90. Notably, treatment with 17-AAG alone also reduced HDAC6 binding to hsp90 and induced hyperacetylation of hsp90. This promoted the proteasomal degradation of HDAC6. Cotreatment with 17-AAG and siRNA to HDAC6 induced more inhibition of hsp90 chaperone function and depletion of BCR-ABL and c-Raf than treatment with either agent alone. In addition, cotreatment with 17-AAG and tubacin augmented the loss of survival of K562 cells and viability of primary acute myeloid leukemia (AML) and chronic myeloid leukemia (CML) samples. These findings demonstrate that HDAC6 is an hsp90 client protein and hyperacetylation of hsp90 augments the anti-hsp90 and antileukemia effects of 17-AAG.

Mouse zygote-specific proteasome assembly chaperone important for maternal-to-zygotic transition

Directory of Open Access Journals (Sweden)

Seung-Wook Shin

2012-11-01

During the maternal-to-zygotic transition (MZT, maternal proteins in oocytes are degraded by the ubiquitin–proteasome system (UPS, and new proteins are synthesized from the zygotic genome. However, the specific mechanisms underlying the UPS at the MZT are not well understood. We identified a molecule named zygote-specific proteasome assembly chaperone (ZPAC that is specifically expressed in mouse gonads, and expression of ZPAC was transiently increased at the mouse MZT. ZPAC formed a complex with Ump1 and associated with precursor forms of 20S proteasomes. Transcription of ZPAC genes was also under the control of an autoregulatory feedback mechanism for the compensation of reduced proteasome activity similar to Ump1 and 20S proteasome subunit gene expression. Knockdown of ZPAC in early embryos caused a significant reduction of proteasome activity and decrease in Ump1 and mature proteasomes, leading to accumulation of proteins that need to be degraded at the MZT and early developmental arrest. Therefore, a unique proteasome assembly pathway mediated by ZPAC is important for progression of the mouse MZT.

Proteomic Data From Human Cell Cultures Refine Mechanisms of Chaperone-Mediated Protein homeostasis

OpenAIRE

Finka, Andrija; Goloubinoff, Andrija Finka and Pierre

2013-01-01

In the crowded environment of human cells, folding of nascent polypeptides and refolding of stress-unfolded proteins is error prone. Accumulation of cytotoxic misfolded and aggregated species may cause cell death, tissue loss, degenerative conformational diseases, and aging. Nevertheless, young cells effectively express a network of molecular chaperones and folding enzymes, termed here “the chaperome,” which can prevent formation of potentially harmful misfolded protein conformers and use the...

Estimating Velocities of Glaciers Using Sentinel-1 SAR Imagery

Science.gov (United States)

Gens, R.; Arnoult, K., Jr.; Friedl, P.; Vijay, S.; Braun, M.; Meyer, F. J.; Gracheva, V.; Hogenson, K.

2017-12-01

In an international collaborative effort, software has been developed to estimate the velocities of glaciers by using Sentinel-1 Synthetic Aperture Radar (SAR) imagery. The technique, initially designed by the University of Erlangen-Nuremberg (FAU), has been previously used to quantify spatial and temporal variabilities in the velocities of surging glaciers in the Pakistan Karakoram. The software estimates surface velocities by first co-registering image pairs to sub-pixel precision and then by estimating local offsets based on cross-correlation. The Alaska Satellite Facility (ASF) at the University of Alaska Fairbanks (UAF) has modified the software to make it more robust and also capable of migration into the Amazon Cloud. Additionally, ASF has implemented a prototype that offers the glacier tracking processing flow as a subscription service as part of its Hybrid Pluggable Processing Pipeline (HyP3). Since the software is co-located with ASF's cloud-based Sentinel-1 archive, processing of large data volumes is now more efficient and cost effective. Velocity maps are estimated for Single Look Complex (SLC) SAR image pairs and a digital elevation model (DEM) of the local topography. A time series of these velocity maps then allows the long-term monitoring of these glaciers. Due to the all-weather capabilities and the dense coverage of Sentinel-1 data, the results are complementary to optically generated ones. Together with the products from the Global Land Ice Velocity Extraction project (GoLIVE) derived from Landsat 8 data, glacier speeds can be monitored more comprehensively. Examples from Sentinel-1 SAR-derived results are presented along with optical results for the same glaciers.

Efficient charge carriers induced by extra outer-shell electrons in iron-pnictides: a comparison between Ni- and Co-doped CaFeAsF

International Nuclear Information System (INIS)

Zhang Min; Yu Yi; Tan Shun; Zhang Yuheng; Zhang Changjin; Zhang Lei; Qu Zhe; Ling Langsheng; Xi, Chuanying

2010-01-01

A comprehensive study of the difference between CaFe 1-x Ni x AsF and CaFe 1-x Co x AsF systems has been carried out by measuring the efficient charge carrier concentration, the valence states and the superconducting phase diagram. It is found that at the same doping level, Ni doping introduces nearly twice the number of charge carriers as Co doping. However, x-ray absorption near-edge spectroscopy measurements reveal that the valence state of Fe in both systems is close to 2, indicating that there is no valence mismatch. We suggest that the charge carriers in CaFe 1-x M x AsF (M=transition metal elements) are not induced by valence mismatch but come from the difference in the number of outer-shell electrons. We also suggest that with Ni and Co doping, the systems change from a multi-band material in the underdoped regions to a single-band state in the overdoped regions.

Influencia de las condiciones ambientales de la ciudad de Bogotá sobre el comportamiento mecánicos de una mezcla asfáltica Influence of the Bogotá environmental conditions on the mechanical behavior of an asphalt mixture

Directory of Open Access Journals (Sweden)

Hugo Alexander Rondón Quintana

2009-08-01

Full Text Available El artículo presenta el cambio que experimenta el módulo resiliente, la deformación permanente y la resistencia última bajo carga monotónica de una mezcla asfáltica densa en caliente cuando es expuesta al ambiente de la ciudad de Bogotá D.C. (Colombia. Las mezclas fueron elaboradas y evaluadas empleando dos cementos asfálticos (CA y un CA modificado (CAM con polímero tipo etil vinil acetato: CA 80-100, CA 60-70 y CAM 20-40 respectivamente. Con el fin de observar su evolución en el tiempo, a la fecha los parámetros mecánicos de las mezclas han sido medidos cada tres meses aproximadamente durante 20 meses para el caso de las mezclas fabricadas con los CA 80-100 y CA 60-70, y 10 meses para aquellas que emplearon el CAM 20-40. De los resultados se concluye que el comportamiento que experimentan las mezclas depende del tipo de CA utilizado. Adicionalmente, la tendencia de las mezclas con los tres tipos de CA es experimentar un aumento en los valores de rigidez con el tiempo de exposición al ambiente debido principalmente a procesos de endurecimiento por envejecimiento de los ligantes asfálticos.The paper presents the evolution of the resilient modulus, permanent deformation and strength under monotonic loading of a dense hot mixture due to long term exposure to the environment in the city of Bogota D.C. (Colombia. The mixtures were made using two asphalt cements (AC and modified asphalt cement (MAC with ethil-vinil-acetate: AC 80-100, AC 60-70 and MAC 20-40 respectively. The mechanical properties have been evaluated every three months over a period of 20 months for the AC 80-100 and AC 60-70, and 10 months for MAC 20-40. The results show differences depending on the type of cement. All mixtures increase the modulus with time due to aging of the asphalt cement.

Comparación del LASIK convencional y el LASIK asférico en el tratamiento de la ametropía Comparison of conventional LASIK and aspheric LASIK in the treatment of ametropia

Directory of Open Access Journals (Sweden)

Yanaisa Riverón Ruiz

2012-12-01

Full Text Available Objetivo: comparar los resultados del LASIK con patrón de ablación convencional y el asférico en la corrección de ametropías y evaluar la sensibilidad al contraste en ambos procedimientos. Métodos: se realizó un estudio comparativo y prospectivo en 64 pacientes de la consulta externa del Servicio de Cirugía Refractiva del Instituto Cubano de Oftalmología "Ramón Pando Ferrer". Estos fueron distribuidos aleatoriamente en dos grupos iguales para ambas técnicas. Las variables estudiadas fueron agudeza visual sin corrección y mejor corregida, aberración y sensibilidad al contraste en condiciones fotópicas. Resultados: la agudeza visual sin corrección mejoró ocho líneas en la cartilla de Snellen, sin diferencias entre ambos procedimientos. La aberración esférica presentó un valor medio inferior en el tratamiento asférico (0,30. Se encontró una disminución de la sensibilidad al contraste después del tratamiento convencional. Conclusiones: ambas técnicas quirúrgicas mantienen una buena agudeza visual con corrección y sin esta, después de la cirugía en ambientes fotópicos. La calidad visual del tratamiento asférico es superior, al inducir menor aberración esférica y mejor sensibilidad al contraste después de cirugía.Objective: to compare the results obtained with the LASIK using both conventional and aspheric patterns to correct ametropies and to evaluate the contrast sensitivity after these two procedures. Methods: a comparative and prospective study was conducted in 64 patients who attended the refractive surgery outpatient service of “Ramon Pando Ferrer” Cuban Institute of Ophthalmology. They were randomly distributed in two groups for both procedures. Several variables were studied such as: uncorrected visual acuity, best corrected visual acuity, aberration and contrast sensitivity at photopic conditions. Results: uncorrected visual acuity improved 8 lines in the Snellen’s chart, without significant

Comportamiento mecánico y funcional de mezclas asfálticas reductoras de ruido tipo SMA 8 LA (Stone Mastic Asphalt Low-Noise) y LOA 5 D (Noise-reducing asphalt)

OpenAIRE

Chamorro Ramos, Alberto

2011-01-01

El presente estudio tiene por objeto el estudio del comportamiento mecánico y funcional de las mezclas asfálticas SMA 8LA y LOA5D, originarias de Alemania, destinadas a ofrecer una reducción sonora en la interacción neumático-pavimento, al tener una alta absorción acústica, garantizando la seguridad y confort que se debe prestar a los usuarios de las vías, así como una mayor durabilidad que la las mezclas porosas. En España no están normalizadas y son un tipo de mezclas muy modern...

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Directory of Open Access Journals (Sweden)

Jyoti K. Jha

2017-04-01

Full Text Available Replication of Vibrio cholerae chromosome 2 (Chr2 depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in rctB that reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding.

The OsO(3)F(+) and mu-F(OsO(3)F)(2)(+) cations: their syntheses and study by Raman and (19)F NMR spectroscopy and electron structure calculations and X-ray crystal structures of [OsO(3)F][PnF(6)] (Pn = As, Sb), [OsO(3)F][HF](2)[AsF(6)], [OsO(3)F][HF][SbF(6)], and [OsO(3)F][Sb(3)F(16)].

Science.gov (United States)

Gerken, Michael; Dixon, David A; Schrobilgen, Gary J

2002-01-28

The fluoride ion donor properties of OsO(3)F(2) have been investigated. The salts [OsO(3)F][AsF(6)], [OsO(3)F][HF](2)[AsF(6)], mu-F(OsO(3)F)(2)[AsF(6)], [OsO(3)F][HF](2)[SbF(6)], and [OsO(3)F][HF][SbF(6)] have been prepared by reaction of OsO(3)F(2) with AsF(5) and SbF(5) in HF solvent and have been characterized in the solid state by Raman spectroscopy. The single-crystal X-ray diffraction studies of [OsO(3)F][AsF(6)] (P2(1)/n, a = 7.0001(11) A, c = 8.8629(13) A, beta = 92.270(7) degrees, Z = 4, and R(1) = 0.0401 at -126 degrees C), [OsO(3)F][SbF(6)] (P2(1)/c, a = 5.4772(14) A, b = 10.115(3) A, c = 12.234(3) A, beta = 99.321(5) degrees, Z = 4, and R(1) = 0.0325 at -173 degrees C), [OsO(3)F][HF](2)[AsF(6)] (P2(1)/n, a = 5.1491(9) A, b = 8.129(2) A, c = 19.636(7) A, beta = 95.099(7) degrees, Z = 4, and R(1) = 0.0348 at -117 degrees C), and [OsO(3)F][HF][SbF(6)] (Pc, a = 5.244(4) A, b = 9.646(6) A, c = 15.269(10) A, beta = 97.154(13) degrees, Z = 4, and R(1) = 0.0558 at -133 degrees C) have shown that the OsO(3)F(+) cations exhibit strong contacts to the anions and HF solvent molecules giving rise to cyclic, dimeric structures in which the osmium atoms have coordination numbers of 6. The reaction of OsO(3)F(2) with neat SbF(5) yielded [OsO(3)F][Sb(3)F(16)], which has been characterized by (19)F NMR spectroscopy in SbF(5) and SO(2)ClF solvents and by Raman spectroscopy and single-crystal X-ray diffraction in the solid state (P4(1)m, a = 10.076(6) A, c = 7.585(8) A, Z = 2, and R(1) = 0.0858 at -113 degrees C). The weak fluoride ion basicity of the Sb(3)F(16)(-) anion resulted in an OsO(3)F(+) cation (C(3)(v) point symmetry) that is well isolated from the anion and in which the osmium is four-coordinate. The geometrical parameters and vibrational frequencies of OsO(3)F(+), ReO(3)F, mu-F(OsO(3)F)(2)(+), (FO(3)Os--FPnF(5))(2), and (FO(3)Os--(HF)(2)--FPnF(5))(2) (Pn = As, Sb) have been calculated using density functional theory methods.

A Cloud-Based System for Automatic Hazard Monitoring from Sentinel-1 SAR Data

Science.gov (United States)

Meyer, F. J.; Arko, S. A.; Hogenson, K.; McAlpin, D. B.; Whitley, M. A.

2017-12-01

Despite the all-weather capabilities of Synthetic Aperture Radar (SAR), and its high performance in change detection, the application of SAR for operational hazard monitoring was limited in the past. This has largely been due to high data costs, slow product delivery, and limited temporal sampling associated with legacy SAR systems. Only since the launch of ESA's Sentinel-1 sensors have routinely acquired and free-of-charge SAR data become available, allowing—for the first time—for a meaningful contribution of SAR to disaster monitoring. In this paper, we present recent technical advances of the Sentinel-1-based SAR processing system SARVIEWS, which was originally built to generate hazard products for volcano monitoring centers. We outline the main functionalities of SARVIEWS including its automatic database interface to Sentinel-1 holdings of the Alaska Satellite Facility (ASF), and its set of automatic processing techniques. Subsequently, we present recent system improvements that were added to SARVIEWS and allowed for a vast expansion of its hazard services; specifically: (1) In early 2017, the SARVIEWS system was migrated into the Amazon Cloud, providing access to cloud capabilities such as elastic scaling of compute resources and cloud-based storage; (2) we co-located SARVIEWS with ASF's cloud-based Sentinel-1 archive, enabling the efficient and cost effective processing of large data volumes; (3) we integrated SARVIEWS with ASF's HyP3 system (http://hyp3.asf.alaska.edu/), providing functionality such as subscription creation via API or map interface as well as automatic email notification; (4) we automated the production chains for seismic and volcanic hazards by integrating SARVIEWS with the USGS earthquake notification service (ENS) and the USGS eruption alert system. Email notifications from both services are parsed and subscriptions are automatically created when certain event criteria are met; (5) finally, SARVIEWS-generated hazard products are now

Is the Inclusion of Animal Source Foods in Fortified Blended Foods Justified?

Directory of Open Access Journals (Sweden)

Kristen E. Noriega

2014-09-01

Full Text Available Fortified blended foods (FBF are used for the prevention and treatment of moderate acute malnutrition (MAM in nutritionally vulnerable individuals, particularly children. A recent review of FBF recommended the addition of animal source food (ASF in the form of whey protein concentrate (WPC, especially to corn-soy blends. The justification for this recommendation includes the potential of ASF to increase length, weight, muscle mass accretion and recovery from wasting, as well as to improve protein quality and provide essential growth factors. Evidence was collected from the following four different types of studies: (1 epidemiological; (2 ASF versus no intervention or a low-calorie control; (3 ASF versus an isocaloric non-ASF; and (4 ASF versus an isocaloric, isonitrogenous non-ASF. Epidemiological studies consistently associated improved growth outcomes with ASF consumption; however, little evidence from isocaloric and isocaloric, isonitrogenous interventions was found to support the inclusion of meat or milk in FBF. Evidence suggests that whey may benefit muscle mass accretion, but not linear growth. Overall, little evidence supports the costly addition of WPC to FBFs. Further, randomized isocaloric, isonitrogenous ASF interventions with nutritionally vulnerable children are needed.

Hsp70 cochaperones HspBP1 and BAG-1M differentially regulate steroid hormone receptor function.

Directory of Open Access Journals (Sweden)

Regina T Knapp

Full Text Available Hsp70 binding protein 1 (HspBP1 and Bcl2-associated athanogene 1 (BAG-1, the functional orthologous nucleotide exchange factors of the heat shock protein 70 kilodalton (Hsc70/Hsp70 chaperones, catalyze the release of ADP from Hsp70 while inducing different conformational changes of the ATPase domain of Hsp70. An appropriate exchange rate of ADP/ATP is crucial for chaperone-dependent protein folding processes. Among Hsp70 client proteins are steroid receptors such as the glucocorticoid receptor (GR, the mineralocorticoid receptor (MR, and the androgen receptor (AR. BAG-1 diversely affects steroid receptor activity, while to date the influence of HspBP1 on steroid receptor function is mostly unknown. Here, we compared the influence of HspBP1 and BAG-1M on Hsp70-mediated steroid receptor folding complexes and steroid receptor activity. Coimmunoprecipitation studies indicated preferential binding of Hsp40 and the steroid receptors to BAG-1M as compared to HspBP1. Furthermore, Hsp70 binding to the ligand-binding domain of GR was reduced in the presence of HspBP1 but not in the presence of BAG-1M as shown by pull-down assays. Reporter gene experiments revealed an inhibitory effect on GR, MR, and AR at a wide range of HspBP1 protein levels and at hormone concentrations at or approaching saturation. BAG-1M exhibited a transition from stimulatory effects at low BAG-1M levels to inhibitory effects at higher BAG-1M levels. Overall, BAG-1M and HspBP1 had differential impacts on the dynamic composition of steroid receptor folding complexes and on receptor function with important implications for steroid receptor physiology.

Transcriptome-Based Analysis in Lactobacillus plantarum WCFS1 Reveals New Insights into Resveratrol Effects at System Level.

Science.gov (United States)

Reverón, Inés; Plaza-Vinuesa, Laura; Franch, Mónica; de Las Rivas, Blanca; Muñoz, Rosario; López de Felipe, Félix

2018-05-01

This study was undertaken to expand our insights into the mechanisms involved in the tolerance to resveratrol (RSV) that operate at system-level in gut microorganisms and advance knowledge on new RSV-responsive gene circuits. Whole genome transcriptional profiling was used to characterize the molecular response of Lactobacillus plantarum WCFS1 to RSV. DNA repair mechanisms were induced by RSV and responses were triggered to decrease the load of copper, a metal required for RSV-mediated DNA cleavage, and H 2 S, a genotoxic gas. To counter the effects of RSV, L. plantarum strongly up- or downregulated efflux systems and ABC transporters pointing to transport control of RSV across the membrane as a key mechanism for RSV tolerance. L. plantarum also downregulated tRNAs, induced chaperones, and reprogrammed its transcriptome to tightly control ammonia levels. RSV induced a probiotic effector gene and a likely deoxycholate transporter, two functions that improve the host health status. Our data identify novel protective mechanisms involved in RSV tolerance operating at system level in a gut microbe. These insights could influence the way RSV is used for a better management of gut microbial ecosystems to obtain associated health benefits. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Indole and synthetic derivative activate chaperone expression to reduce polyQ aggregation in SCA17 neuronal cell and slice culture models

Directory of Open Access Journals (Sweden)

Kung PJ

2014-10-01

Full Text Available Pin-Jui Kung,1,* Yu-Chen Tao,1,* Ho-Chiang Hsu,1 Wan-Ling Chen,1 Te-Hsien Lin,1 Donala Janreddy,2 Ching-Fa Yao,2 Kuo-Hsuan Chang,3 Jung-Yaw Lin,1 Ming-Tsan Su,1 Chung-Hsin Wu,1 Guey-Jen Lee-Chen,1 Hsiu-Mei Hsieh-Li1 1Department of Life Science, 2Department of Chemistry, National Taiwan Normal University, Taipei, Taiwan; 3Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan *These authors contributed equally to this work Abstract: In spinocerebellar ataxia type 17 (SCA17, the expansion of a translated CAG repeat in the TATA box binding protein (TBP gene results in a long polyglutamine (polyQ tract in the TBP protein, leading to intracellular accumulation of aggregated TBP and cell death. The molecular chaperones act in preventing protein aggregation to ameliorate downstream harmful events. In this study, we used Tet-On SH-SY5Y cells with inducible SCA17 TBP/Q79-green fluorescent protein (GFP expression to test indole and synthetic derivative NC001-8 for neuroprotection. We found that indole and NC001-8 up-regulated chaperone expression to reduce polyQ aggregation in neuronal differentiated TBP/Q79 cells. The effects on promoting neurite outgrowth and on reduction of aggregation on Purkinje cells were also confirmed with cerebellar primary and slice cultures of SCA17 transgenic mice. Our results demonstrate how indole and derivative NC001-8 reduce polyQ aggregation to support their therapeutic potentials in SCA17 treatment. Keywords: spinocerebellar ataxia type 17, TATA box binding protein, polyQ aggregation, indole and derivative, therapeutics

Generation of sea ice geophysical flux estimates utilizing a multisensor data processor in preparation for the RADARSAT and EOS eras

International Nuclear Information System (INIS)

Holt, B.; Kwok, R.; Carsey, F.; Curlander, J.

1991-01-01

A geophysical processor for deriving sea ice type and ice motion information from sequential SAR image data has been designed and is in implementation phase for use with ERS-1 SAR data at the Alaska SAR Facility (ASF). This SAR ice data processor, called the ASF Geophysical Processing System, or ASF-GPS, will be in place for launch in May 1991. Descriptions of the salient aspects of ASF-GPS and its current status are presented. The next step in the evolution of processors for geophysical descriptions of sea ice is now in design phase; it involves the utilization of data from other sensors and sources and the generation of higher-level products. The augmented data are environmental, e.g., weather agency analyses, satellite-derived surface temperatures and drifting buoy data. These data serve to (1) improve the performance of the basic data product generation, the ice type and motion data sets, by increasing accuracy and shortening processing time, and (2) extend the level of the data products by computation of key geophysical fluxes. Geophysical quantities required from the sea ice processor include the surface heat, momentum, brine and freshwater fluxes, radiation balance, snow cover, melt pond cover and thermodynamic state. The estimation of two of these fluxes, brine and freshwater, is discussed, and the requirements for suitable environmental data are also presented. Finally, the system design of the ASF-GPS and the follow-on processor, designed initially to utilize SAR data from RADARSAT with weather and other inputs, e.g., AVHRR, and, after upgrade, from the suite of EOS instruments, will be presented. As now envisioned this system will have layered architecture with major branches in data management, user interface and science data analysis and will serve as a prototype design for a wide range of applications

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

Energy Technology Data Exchange (ETDEWEB)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo; Miller Jenkins, Lisa M.; Wlodawer, Alexander; Chattoraj, Dhruba; Dunny, Gary M.

2017-04-18

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that

SigE Is a Chaperone for the Salmonella enterica Serovar Typhimurium Invasion Protein SigD

OpenAIRE

Darwin, K. Heran; Robinson, Lloyd S.; Miller, Virginia L.

2001-01-01

SigD is translocated into eucaryotic cells by a type III secretion system. In this work, evidence that the putative chaperone SigE directly interacts with SigD is presented. A bacterial two-hybrid system demonstrated that SigE can interact with itself and SigD. In addition, SigD was specifically copurified with SigE-His6 on a nickel column.

Antarctic krill 454 pyrosequencing reveals chaperone and stress transcriptome.

Directory of Open Access Journals (Sweden)

Melody S Clark

Full Text Available BACKGROUND: The Antarctic krill Euphausia superba is a keystone species in the Antarctic food chain. Not only is it a significant grazer of phytoplankton, but it is also a major food item for charismatic megafauna such as whales and seals and an important Southern Ocean fisheries crop. Ecological data suggest that this species is being affected by climate change and this will have considerable consequences for the balance of the Southern Ocean ecosystem. Hence, understanding how this organism functions is a priority area and will provide fundamental data for life history studies, energy budget calculations and food web models. METHODOLOGY/PRINCIPAL FINDINGS: The assembly of the 454 transcriptome of E. superba resulted in 22,177 contigs with an average size of 492bp (ranging between 137 and 8515bp. In depth analysis of the data revealed an extensive catalogue of the cellular chaperone systems and the major antioxidant proteins. Full length sequences were characterised for the chaperones HSP70, HSP90 and the super-oxide dismutase antioxidants, with the discovery of potentially novel duplications of these genes. The sequence data contained 41,470 microsatellites and 17,776 Single Nucleotide Polymorphisms (SNPs/INDELS, providing a resource for population and also gene function studies. CONCLUSIONS: This paper details the first 454 generated data for a pelagic Antarctic species or any pelagic crustacean globally. The classical "stress proteins", such as HSP70, HSP90, ferritin and GST were all highly expressed. These genes were shown to be over expressed in the transcriptomes of Antarctic notothenioid fish and hypothesized as adaptations to living in the cold, with the associated problems of decreased protein folding efficiency and increased vulnerability to damage by reactive oxygen species. Hence, these data will provide a major resource for future physiological work on krill, but in particular a suite of "stress" genes for studies understanding

MiR-17-5p Impairs Trafficking of H-ERG K+ Channel Protein by Targeting Multiple ER Stress-Related Chaperones during Chronic Oxidative Stress

OpenAIRE

Wang, Qi; Hu, Weina; Lei, Mingming; Wang, Yong; Yan, Bing; Liu, Jun; Zhang, Ren; Jin, Yuanzhe

2013-01-01

BACKGROUND: To investigate if microRNAs (miRNAs) play a role in regulating h-ERG trafficking in the setting of chronic oxidative stress as a common deleterious factor for many cardiac disorders. METHODS: We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H2O2 for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR. Protein levels of chaperones and h-ERG trafficking were measured by Western blot analysis. Lucifer...

Chaperone-mediated autophagy and neurodegeneration: connections, mechanisms, and therapeutic implications.

Science.gov (United States)

Liu, Xiaolei; Huang, Sihua; Wang, Xingqin; Tang, Beisha; Li, Wenming; Mao, Zixu

2015-08-01

Lysosomes degrade dysfunctional intracellular components via three pathways: macroautophagy, microautophagy, and chaperone-mediated autophagy (CMA). Unlike the other two, CMA degrades cytosolic proteins with a recognized KFERQ-like motif in lysosomes and is important for cellular homeostasis. CMA activity declines with age and is altered in neurodegenerative diseases. Its impairment leads to the accumulation of aggregated proteins, some of which may be directly tied to the pathogenic processes of neurodegenerative diseases. Its induction may accelerate the clearance of pathogenic proteins and promote cell survival, representing a potential therapeutic approach for the treatment of neurodegenerative diseases. In this review, we summarize the current findings on how CMA is involved in neurodegenerative diseases, especially in Parkinson's disease.

Proteomic data from human cell cultures refine mechanisms of chaperone-mediated protein homeostasis.

Science.gov (United States)

Finka, Andrija; Goloubinoff, Pierre

2013-09-01

In the crowded environment of human cells, folding of nascent polypeptides and refolding of stress-unfolded proteins is error prone. Accumulation of cytotoxic misfolded and aggregated species may cause cell death, tissue loss, degenerative conformational diseases, and aging. Nevertheless, young cells effectively express a network of molecular chaperones and folding enzymes, termed here "the chaperome," which can prevent formation of potentially harmful misfolded protein conformers and use the energy of adenosine triphosphate (ATP) to rehabilitate already formed toxic aggregates into native functional proteins. In an attempt to extend knowledge of chaperome mechanisms in cellular proteostasis, we performed a meta-analysis of human chaperome using high-throughput proteomic data from 11 immortalized human cell lines. Chaperome polypeptides were about 10% of total protein mass of human cells, half of which were Hsp90s and Hsp70s. Knowledge of cellular concentrations and ratios among chaperome polypeptides provided a novel basis to understand mechanisms by which the Hsp60, Hsp70, Hsp90, and small heat shock proteins (HSPs), in collaboration with cochaperones and folding enzymes, assist de novo protein folding, import polypeptides into organelles, unfold stress-destabilized toxic conformers, and control the conformal activity of native proteins in the crowded environment of the cell. Proteomic data also provided means to distinguish between stable components of chaperone core machineries and dynamic regulatory cochaperones.

In vivo functional expression of a screened P. aeruginosa chaperone-dependent lipase in E. coli

Directory of Open Access Journals (Sweden)

Wu Xiangping

2012-09-01

Full Text Available Abstract Background Microbial lipases particularly Pseudomonas lipases are widely used for biotechnological applications. It is a meaningful work to design experiments to obtain high-level active lipase. There is a limiting factor for functional overexpression of the Pseudomonas lipase that a chaperone is necessary for effective folding. As previously reported, several methods had been used to resolve the problem. In this work, the lipase (LipA and its chaperone (LipB from a screened strain named AB which belongs to Pseudomonas aeruginosa were overexpressed in E. coli with two dual expression plasmid systems to enhance the production of the active lipase LipA without in vitro refolding process. Results In this work, we screened a lipase-produced strain named AB through the screening procedure, which was identified as P. aeruginosa on the basis of 16S rDNA. Genomic DNA obtained from the strain was used to isolate the gene lipA (936 bp and lipase specific foldase gene lipB (1023 bp. One single expression plasmid system E. coli BL21/pET28a-lipAB and two dual expression plasmid systems E. coli BL21/pETDuet-lipA-lipB and E. coli BL21/pACYCDuet-lipA-lipB were successfully constructed. The lipase activities of the three expression systems were compared to choose the optimal expression method. Under the same cultured condition, the activities of the lipases expressed by E. coli BL21/pET28a-lipAB and E. coli BL21/pETDuet-lipA-lipB were 1300 U/L and 3200 U/L, respectively, while the activity of the lipase expressed by E. coli BL21/pACYCDuet-lipA-lipB was up to 8500 U/L. The lipase LipA had an optimal temperature of 30°C and an optimal pH of 9 with a strong pH tolerance. The active LipA could catalyze the reaction between fatty alcohols and fatty acids to generate fatty acid alkyl esters, which meant that LipA was able to catalyze esterification reaction. The most suitable fatty acid and alcohol substrates for esterification were octylic acid and hexanol

A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

Science.gov (United States)

Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

2015-09-01

Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

Science.gov (United States)

Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

2009-01-01

Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

Effect of leucine-to-methionine substitutions on the diffraction quality of histone chaperone SET/TAF-Iβ/INHAT crystals

International Nuclear Information System (INIS)

Senda, Miki; Muto, Shinsuke; Horikoshi, Masami; Senda, Toshiya

2008-01-01

The combination of leucine-to-methionine substitutions and optimization of cryoconditions improved the resolution of histone chaperone SET/TAF-Iβ/INHAT crystals from around 5.5 to 2.3 Å without changing the crystallization conditions, allowing successful structure determination of SET/TAF-Iβ/INHAT by the multiwavelength anomalous diffraction method. One of the most frequent problems in crystallization is poor quality of the crystals. In order to overcome this obstacle several methods have been utilized, including amino-acid substitutions of the target protein. Here, an example is presented of crystal-quality improvement by leucine-to-methionine substitutions. A variant protein with three amino-acid substitutions enabled improvement of the crystal quality of the histone chaperone SET/TAF-Iβ/INHAT when combined with optimization of the cryoconditions. This procedure improved the resolution of the SET/TAF-Iβ/INHAT crystals from around 5.5 to 2.3 Å without changing the crystallization conditions

Targeting Hsp90-Cdc37: A Promising Therapeutic Strategy by Inhibiting Hsp90 Chaperone Function.

Science.gov (United States)

Wang, Lei; Li, Li; Gu, Kai; Xu, Xiao-Li; Sun, Yuan; You, Qi-Dong

2017-01-01

The Hsp90 chaperone protein regulates the folding, maturation and stability of a wide variety of oncoproteins. In recent years, many Hsp90 inhibitors have entered into the clinical trials while all of them target ATPase showing similar binding capacity and kinds of side-effects so that none have reached to the market. During the regulation progress, numerous protein- protein interactions (PPI) such as Hsp90 and client proteins or cochaperones are involved. With the Hsp90-cochaperones PPI networks being more and more clear, many cancerous proteins have been reported to be tightly correlated to Hsp90-cochaperones PPI. Among them, Hsp90-Cdc37 PPI has been widely reported to associate with numerous protein kinases, making it a novel target for the treatment of cancers. In this paper, we briefly review the strategies and modulators targeting Hsp90-Cdc37 complex including direct and indirect regulation mechanism. Through these discussions we expect to present inspirations for new insights into an alternative way to inhibit Hsp90 chaperone function. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Switch I-dependent allosteric signaling in a G-protein chaperone-B12 enzyme complex.

Science.gov (United States)

Campanello, Gregory C; Lofgren, Michael; Yokom, Adam L; Southworth, Daniel R; Banerjee, Ruma

2017-10-27

G-proteins regulate various processes ranging from DNA replication and protein synthesis to cytoskeletal dynamics and cofactor assimilation and serve as models for uncovering strategies deployed for allosteric signal transduction. MeaB is a multifunctional G-protein chaperone, which gates loading of the active 5'-deoxyadenosylcobalamin cofactor onto methylmalonyl-CoA mutase (MCM) and precludes loading of inactive cofactor forms. MeaB also safeguards MCM, which uses radical chemistry, against inactivation and rescues MCM inactivated during catalytic turnover by using the GTP-binding energy to offload inactive cofactor. The conserved switch I and II signaling motifs used by G-proteins are predicted to mediate allosteric regulation in response to nucleotide binding and hydrolysis in MeaB. Herein, we targeted conserved residues in the MeaB switch I motif to interrogate the function of this loop. Unexpectedly, the switch I mutations had only modest effects on GTP binding and on GTPase activity and did not perturb stability of the MCM-MeaB complex. However, these mutations disrupted multiple MeaB chaperone functions, including cofactor editing, loading, and offloading. Hence, although residues in the switch I motif are not essential for catalysis, they are important for allosteric regulation. Furthermore, single-particle EM analysis revealed, for the first time, the overall architecture of the MCM-MeaB complex, which exhibits a 2:1 stoichiometry. These EM studies also demonstrate that the complex exhibits considerable conformational flexibility. In conclusion, the switch I element does not significantly stabilize the MCM-MeaB complex or influence the affinity of MeaB for GTP but is required for transducing signals between MeaB and MCM. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The crystal structure of the human co-chaperone P58(IPK.

Directory of Open Access Journals (Sweden)

Maria Svärd

Full Text Available P58(IPK is one of the endoplasmic reticulum- (ER- localised DnaJ (ERdj proteins which interact with the chaperone BiP, the mammalian ER ortholog of Hsp70, and are thought to contribute to the specificity and regulation of its diverse functions. P58(IPK, expression of which is upregulated in response to ER stress, has been suggested to act as a co-chaperone, binding un- or misfolded proteins and delivering them to BiP. In order to give further insights into the functions of P58(IPK, and the regulation of BiP by ERdj proteins, we have determined the crystal structure of human P58(IPK to 3.0 Å resolution using a combination of molecular replacement and single wavelength anomalous diffraction. The structure shows the human P58(IPK monomer to have a very elongated overall shape. In addition to the conserved J domain, P58(IPK contains nine N-terminal tetratricopeptide repeat motifs, divided into three subdomains of three motifs each. The J domain is attached to the C-terminal end via a flexible linker, and the structure shows the conserved Hsp70-binding histidine-proline-aspartate (HPD motif to be situated on the very edge of the elongated protein, 100 Å from the putative binding site for unfolded protein substrates. The residues that comprise the surface surrounding the HPD motif are highly conserved in P58(IPK from other organisms but more varied between the human ERdj proteins, supporting the view that their regulation of different BiP functions is facilitated by differences in BiP-binding.

The molecular chaperone α-crystallin inhibits UV-induced protein aggregation

International Nuclear Information System (INIS)

Borkman, R.F.; Knight, Grady; Obi, Bettie

1996-01-01

Solutions of γ-crystallin, and various enzymes, at neutral pH and 24-26 o C, became turbid upon exposure to UV radiation at 295 or 308 nm. SDS-PAGE analysis revealed interchain cross-linking and aggregate formation compared to dark control solutions as reported previously. When α-crystallin was added to the protein solutions in stoichiometric amounts. UV irradiation resulted in significantly less turbidity than in the absence of α-crystallin. For example, addition of 0.5 mg of α-crystallin to 0.5 mg of γ-crystallin in 1.0 ml solution yielded only 25% of the turbidity seen in the absence of α-crystallin. Addition of 2.0 mg of α-crystallin resulted in 20% of the turbidity. Given the molecular weights of α- and γ-crystallin (about 800 kDa and 20 kDa, respectively), A γ/α 1:1 weight ratio corresponds to a 40:1 molar ratio, and a γ-/α 1:4 weight ratio corresponds to a 10:1 molar ratio. Hence, the molar ratio of α-crystallin needed to effectively protect γ-crystallin from photochemical opacification was γ/α = n:1, where n was in the range 10-40. In terms of subunits, this ratio is γ/α = 1:m, where m = 1-4. Thus, each γ-crystallin molecule needs 1-4 α subunits for protection. Similar stoichiometries were observed for protection of the other proteins studied. The protection stems in part from screening of UV radiation by α-crystallin but more importantly from a chaperone effect analogous to that seen in thermal aggregation experiments. (author)

Desempenho visual após implante de uma lente intraocular asférica multifocal difrativa Visual performance after implantation of an aspheric multifocal diffractive intraocular lens

Directory of Open Access Journals (Sweden)

Leonardo Akaishi

2010-08-01

Full Text Available OBJETIVO: Avaliar a acuidade visual a distancia, intermediária e perto após o implante de uma lente intraocular (LIO asférica multifocal difrativa AcrySof® ReSTOR® SN6AD1. MÉTODOS: Estudo prospectivo de 50 pacientes com catarata submetidos à facoemulsificação e implante de LIO AcrySof® ReSTOR®. Foram avaliados acuidade visual sem correção (AVSC, acuidade visual com correção (AVCC para longe, acuidade visual para perto corrigida para longe (AVPC e acuidade visual intermediária corrigida para longe (AVIC. Um questionário de satisfação e fenômenos visuais foi administrado ao final do estudo. RESULTADO: Após três meses de cirurgia, a média das acuidades (logMAR era: AVSC, 0,05 ± 0,07; AVCC, 0,00 ± 0,01; AVPC, 0,00 ± 0,0, e AVIC, 0,15 ± 0,05. A AVCC e AVPC era de 20/25 ou melhor em todos os pacientes, sendo a AVIC J3 ou melhor em 83% dos pacientes. Pacientes relataram excelente desempenho visual nas questões relacionadas a atividades para distância, intermediário, e perto com pouca ou nenhuma dificuldade. Nenhum paciente relatou halos ou 'glare' severos, sendo os mesmos caracterizados entre nenhum a moderado. CONCLUSÃO: A LIO asférica AcrySof® ReSTOR® SN6AD1 mostrou excelentes resultados na visão para longe, perto e intermediário, além de apresentar uma baixa incidência de fenômenos visuais.PURPOSE: To evaluate distance, intermediate, and near vision after aspheric multifocal diffractive AcrySof® ReSTOR® SN6AD1 intraocular lens (IOL implantation. METHODS: Prospective study of 50 patients with cataract that had phacoemulsification and AcrySof® ReSTOR® IOL implantation. Uncorrected distance vision acuity (UDVA, corrected distance visual acuity (CDVA, distance-corrected near visual acuity (DCNVA, and distance-corrected intermediate visual acuity (DCIVA were measured postoperatively. A patient-satisfaction and visual phenomena questionnaire was administered at the end of the study. RESULTS: Three months

Breaking BAG: The Co-Chaperone BAG3 in Health and Disease.

Science.gov (United States)

Behl, Christian

2016-08-01

Human BAG (Bcl-2-associated athanogene) proteins form a family of antiapoptotic proteins that currently consists of six members (BAG1-6) all sharing the BAG protein domain from which the name arises. Via this domain, BAG proteins bind to the heat shock protein 70 (Hsp70), thereby acting as a co-chaperone regulating the activity of Hsp70. In addition to their antiapoptotic activity, all human BAG proteins have distinct functions in health and disease, and BAG3 in particular is the focus of many investigations. BAG3 has a modular protein domain composition offering the possibility for manifold interactions with other proteins. Various BAG3 functions are implicated in disorders including cancer, myopathies, and neurodegeneration. The discovery of its role in selective autophagy and the description of BAG3-mediated selective macroautophagy as an adaptive mechanism to maintain cellular homeostasis, under stress as well as during aging, make BAG3 a highly interesting target for future pharmacological interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Two for the Price of One: A Neuroprotective Chaperone Kit within NAD Synthase Protein NMNAT2.

Directory of Open Access Journals (Sweden)

Angela Lavado-Roldán

2016-07-01

Full Text Available One of the most fascinating properties of the brain is the ability to function smoothly across decades of a lifespan. Neurons are nondividing mature cells specialized in fast electrical and chemical communication at synapses. Often, neurons and synapses operate at high levels of activity through sophisticated arborizations of long axons and dendrites that nevertheless stay healthy throughout years. On the other hand, aging and activity-dependent stress strike onto the protein machineries turning proteins unfolded and prone to form pathological aggregates associated with neurodegeneration. How do neurons protect from those insults and remain healthy for their whole life? Ali and colleagues now present a molecular mechanism by which the enzyme nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2 acts not only as a NAD synthase involved in axonal maintenance but as a molecular chaperone helping neurons to overcome protein unfolding and protein aggregation.

A cytosolic copper storage protein provides a second level of copper tolerance in Streptomyces lividans.

Science.gov (United States)

Straw, Megan L; Chaplin, Amanda K; Hough, Michael A; Paps, Jordi; Bavro, Vassiliy N; Wilson, Michael T; Vijgenboom, Erik; Worrall, Jonathan A R

2018-01-24

Streptomyces lividans has a distinct dependence on the bioavailability of copper for its morphological development. A cytosolic copper resistance system is operative in S. lividans that serves to preclude deleterious copper levels. This system comprises of several CopZ-like copper chaperones and P 1 -type ATPases, predominantly under the transcriptional control of a metalloregulator from the copper sensitive operon repressor (CsoR) family. In the present study, we discover a new layer of cytosolic copper resistance in S. lividans that involves a protein belonging to the newly discovered family of copper storage proteins, which we have named Ccsp (cytosolic copper storage protein). From an evolutionary perspective, we find Ccsp homologues to be widespread in Bacteria and extend through into Archaea and Eukaryota. Under copper stress Ccsp is upregulated and consists of a homotetramer assembly capable of binding up to 80 cuprous ions (20 per protomer). X-ray crystallography reveals 18 cysteines, 3 histidines and 1 aspartate are involved in cuprous ion coordination. Loading of cuprous ions to Ccsp is a cooperative process with a Hill coefficient of 1.9 and a CopZ-like copper chaperone can transfer copper to Ccsp. A Δccsp mutant strain indicates that Ccsp is not required under initial copper stress in S. lividans, but as the CsoR/CopZ/ATPase efflux system becomes saturated, Ccsp facilitates a second level of copper tolerance.

Plantation forestry under global warming: hybrid poplars with improved thermotolerance provide new insights on the in vivo function of small heat shock protein chaperones.

Science.gov (United States)

Merino, Irene; Contreras, Angela; Jing, Zhong-Ping; Gallardo, Fernando; Cánovas, Francisco M; Gómez, Luis

2014-02-01

Climate-driven heat stress is a key factor affecting forest plantation yields. While its effects are expected to worsen during this century, breeding more tolerant genotypes has proven elusive. We report here a substantial and durable increase in the thermotolerance of hybrid poplar (Populus tremula×Populus alba) through overexpression of a major small heat shock protein (sHSP) with convenient features. Experimental evidence was obtained linking protective effects in the transgenic events with the unique chaperone activity of sHSPs. In addition, significant positive correlations were observed between phenotype strength and heterologous sHSP accumulation. The remarkable baseline levels of transgene product (up to 1.8% of total leaf protein) have not been reported in analogous studies with herbaceous species. As judged by protein analyses, such an accumulation is not matched either by endogenous sHSPs in both heat-stressed poplar plants and field-grown adult trees. Quantitative real time-polymerase chain reaction analyses supported these observations and allowed us to identify the poplar members most responsive to heat stress. Interestingly, sHSP overaccumulation was not associated with pleiotropic effects that might decrease yields. The poplar lines developed here also outperformed controls under in vitro and ex vitro culture conditions (callus biomass, shoot production, and ex vitro survival), even in the absence of thermal stress. These results reinforce the feasibility of improving valuable genotypes for plantation forestry, a field where in vitro recalcitrance, long breeding cycles, and other practical factors constrain conventional genetic approaches. They also provide new insights into the biological functions of the least understood family of heat shock protein chaperones.

Decarbonylated cyclophilin A Cpr1 protein protects Saccharomyces cerevisiae KNU5377Y when exposed to stress induced by menadione.

Science.gov (United States)

Kim, Il-Sup; Jin, Ingnyol; Yoon, Ho-Sung

2011-01-01

Cyclophilins are conserved cis-trans peptidyl-prolyl isomerase that are implicated in protein folding and function as molecular chaperones. The accumulation of Cpr1 protein to menadione in Saccharomyces cerevisiae KNU5377Y suggests a possibility that this protein may participate in the mechanism of stress tolerance. Stress response of S. cerevisiae KNU5377Y cpr1Δ mutant strain was investigated in the presence of menadione (MD). The growth ability of the strain was confirmed in an oxidant-supplemented medium, and a relationship was established between diminishing levels of cell rescue enzymes and MD sensitivity. The results demonstrate the significant effect of CPR1 disruption in the cellular growth rate, cell viability and morphology, and redox state in the presence of MD and suggest the possible role of Cpr1p in acquiring sensitivity to MD and its physiological role in cellular stress tolerance. The in vivo importance of Cpr1p for antioxidant-mediated reactive oxygen species (ROS) neutralization and chaperone-mediated protein folding was confirmed by analyzing the expression changes of a variety of cell rescue proteins in a CPR1-disrupted strain. The cpr1Δ to the exogenous MD showed reduced expression level of antioxidant enzymes, molecular chaperones, and metabolic enzymes such as nicotinamide adenine dinucleotide phosphate (NADPH)- or adenosine triphosphate (ATP)-generating systems. More importantly, it was shown that cpr1Δ mutant caused imbalance in the cellular redox homeostasis and increased ROS levels in the cytosol as well as mitochondria and elevated iron concentrations. As a result of excess ROS production, the cpr1Δ mutant provoked an increase in oxidative damage and a reduction in antioxidant activity and free radical scavenger ability. However, there was no difference in the stress responses between the wild-type and the cpr1Δ mutant strains derived from S. cerevisiae BY4741 as a control strain under the same stress. Unlike BY4741, KNU5377Y Cpr1

Infrared spectrum of arsenic pentafluoride

International Nuclear Information System (INIS)

Blanchard, S.

1967-01-01

After a literature review about arsenic fluorides, we give several methods of obtaining very pure AsF 5 in order to ascertain the right spectrum of this compound. Our spectra fit well with Akers's observations, and we note that AsF 5 structure can be explained in terms of C 3v molecular symmetry, with the As-F bond stretching lying at 786 cm -1 and 811 cm -1 . (author) [fr

The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.

Science.gov (United States)

Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio

2017-03-23

Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.

Biochemical characterization of the prolyl 3-hydroxylase 1.cartilage-associated protein.cyclophilin B complex.

Science.gov (United States)